DOCSLIB.ORG

Genetic Alteration of the DCX Gene in Japanese Patients with Subcortical Laminar Heterotopia Or Isolated Lissencephaly Sequence

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Alteration of the DCX Gene in Japanese Patients with Subcortical Laminar Heterotopia Or Isolated Lissencephaly Sequence J Hum Genet (2000) 45:167–170 © Jpn Soc Hum Genet and Springer-Verlag 2000167 ORIGINAL ARTICLE Michiko Sakamoto · Jiro Ono · Shintaro Okada Yusuke Nakamura · Hiroki Kurahashi Genetic alteration of the DCX gene in Japanese patients with subcortical laminar heterotopia or isolated lissencephaly sequence Received: October 25, 1999 / Accepted: January 21, 2000 Abstract We examined mutations of the doublecortin seizures. Lissencephaly, on the other hand, produces pro- (DCX) gene, which is responsible for X-linked subcortical found mental retardation, seizures, and other neurological laminar heterotopia (SCLH) and lissencephaly, in eight abnormalities. One gene responsible for lissencephaly was unrelated Japanese patients, four with SCLH and four with identified on chromosome 17p13 (Lo Nigro et al. 1997) and isolated lissencephaly sequence (ILS). Polymerase chain is called LIS1 (Reiner et al. 1993). Only 38% of patients reaction (PCR) disclosed a deletion of part of the DCX with isolated lissencephaly sequence (ILS) have visible gene in one male ILS patient. Single-strand conformational cytogenetic or submicroscopic deletions of the LIS1 gene polymorphism analysis and subsequent sequence analysis (Dobyns et al. 1993), and only 10 of 25 ILS patients who had were carried out in the remaining seven patients. One male shown no gross deletions had mutations in the LIS1 gene ILS patient had a nonsense mutation in exon V, which (Pilz et al. 1998). These findings may also reflect mutations would result in premature termination of the gene product. in other genes responsible for ILS. SCLH and lissencephaly One female SCLH patient had a missense mutation in exon can be inherited alone or together in a single pedigree IV. Our results indicate that in the Japanese, as has been (Pinard et al. 1994). Among sporadic patients with SCLH, seen elsewhere, abnormality of the DCX gene is the com- the sex ratio skewed toward females (Dobyns et al. 1996), mon cause of SCLH and ILS. suggesting the involvement of X-linked mutations. Linkage and physical mapping localized the responsible gene to Key words DCX gene · Subcortical laminar heterotopia · Xq21.3-q24 (Ross et al. 1997). Recently, the DCX gene was Isolated lissencephaly sequence isolated by two groups and shown to be responsible for SCLH and X-linked lissencephaly (des Portes et al. 1998a; Gleeson et al. 1998). They identified mutations in the DCX Introduction gene in 10 of 11 patients (des Portes et al. 1998b). LIS1 and DCX mutations cause about 76% of ILS, but each of them Subcortical laminar heterotopia (SCLH) and lissencephaly is responsible for different patterns of malformation (Pilz et al. 1998). An extended study disclosed that the mouse Dcx are brain malformations caused by abnormal neuronal mi- 21 gration. SCLH consists of symmetrical and circumferential gene encoded a putative Ca -dependent signaling protein bands of gray matter located just beneath the cortex and (Sossey-Alaouni et al. 1998). separated from it by a thin band of white matter. The phe- In this study, we report that we have determined the notype of affected females varies from nearly normal intel- intron-exon boundary sequences of the DCX gene and ex- ligence to severe mental retardation, but most patients have amined the DCX gene for alterations in eight Japanese patients, four with SCLH and four with ILS. The data pre- sented here further support the conclusion that abnormali- M. Sakamoto · Y. Nakamura · H. Kurahashi Division of Clinical Genetics, Department of Medical Genetics, B9, ties of the DCX gene are responsible for SCLH and ILS. Biomedical Research Center, Osaka University Medical School, Osaka, Japan M. Sakamoto (*) · J. Ono · S. Okada Division of Pediatrics, D5, Osaka University Medical School, 2-2 Patients and methods Yamadaoka, Suita, Osaka 565-0871, Japan Tel. 81-6-879-3938; Fax 81-6-879-3939 e-mail: [email protected] Patients Y. Nakamura Laboratory of Molecular Medicine, Human Genome Center, DNA samples from eight Japanese patients known to have Institute of Medical Science, University of Tokyo, Tokyo, Japan type 1 lissencephaly or SCLH were analyzed after the ob- 168 Table 1. Clinical diagnosis and sex distribution BioProducts, Rockland, ME, USA) for 5min, bands were Case no. Clinical diagnosis Sex visualized and analyzed by means of an FMBIO II Multi- View fluorescent image analyzer (Takara, Tokyo, Japan). 1 ILS M Direct sequencing of PCR products from genomic DNA 2 ILS M 3 ILS M was performed on both strands by the dideoxy chain- 4 ILS F termination method (ABI PRISM DNA sequencing kit; 5 SCLH M Applied Biosystems). Reactions were analyzed with the 6 SCLH M ABI 373S autosequencer according to the manufacturer’s 7 SCLH F 8 SCLH F protocol (Applied Biosystems). ILS, Isolated lissencephaly sequence; SCLH, subcortical laminar het- erotopia; M, male; F, female Fluorescence in situ hybridization (FISH) A human genomic DNA cosmid library was constructed by taining of informed consent, in accordance with established a method described previously (Tokino et al. 1991). Screen- standards. Experienced neurologists diagnosed four of the ing was performed with α-32P-dCTP labeled DCX cDNA as patients with ILS and the other four with SCLH by their a probe. phenotype and brain magnetic resonance imaging (MRI). Metaphase chromosomes of the patients were obtained The clinical characterization of case 6 has been described from lymphoblastoid cell cultures. Dual-color FISH was elsewhere (Ono et al. 1997). None of the patients has a carried out on the slides as previously described (Inazawa family history of mental retardation or seizure disorders. et al. 1994). The test probes were labeled with digoxigenin- They were previously surveyed for genetic alteration in the 11-dUTP by nick-translation; a biotin-labeled chromosome LIS1 gene located at 17p13.3, and none was found to have X alpha-satellite probe served as the control (Oncor a mutation in the LIS1 gene (Sakamoto et al. 1998). Gaithersburg, MD, USA). The test probe and the control Samples were also obtained from the parents of case 7 and were detected simultaneously with avidin-fluorescein the parents of case 8. The clinical diagnosis and the sex of isothiocyanate (FITC) and antidigoxigenin-rhodamine the subjects are shown in Table 1. None of the patients had (Boehringer-Mannheim, Berlin, Germany), after which any obvious cytogenetic abnormalities. the chromosomes were counterstained with 4,6-diamino-2- phenylindole (DAPI) (Sigma, St. Louis, MO, USA) in an anti-fade solution. Signals were examined on a Nikon Genomic sequencing Optiphoto fluorescent microscope equipped with a charge- coupled device (CCD) camera (Nikon, Tokyo, Japan) and YACs 749f7 and 737h4 (CEPH Mega YAC library), which superimposed by means of Mac-Probe Version 2.5 software included the entire genomic region of the DCX gene, were (Perceptive Scientific Instruments League city, TX, USA). used for determining the intron sequences. Polymerase chain reaction (PCR) experiments were performed with a Gene Amp PCR system 2400 (Perkin-Elmer Cetus, Norwalk, CT, USA). To isolate genomic fragments corre- Results sponding to both splice acceptor and donor sites of all ex- ons, inverse PCR was employed (Triglia et al. 1988). YAC In order to survey the patients with lissencephaly or SCLH DNA was completely digested with MspI, TaqI, RsaI, AluI, for subtle genetic alterations in the DCX gene, we deter- or Sau3AI, and self-ligated in a diluted condition. PCR was mined the genomic sequences surrounding the exon-intron performed with oppositely directed primers located in DCX boundaries at both donor and acceptor sites of the gene. We cDNA and with the self-ligated DNA as template. designed PCR primers for exon amplification so as to yield Direct sequencing of the inverse PCR products was per- products including exon-intron junctions and comprising formed using the dideoxy chain-termination method (ABI appropriate sizes for SSCP (Table 2). Inverse PCR, using PRISM DNA sequencing kit; Applied Biosystems, Foster the YAC as a template, successfully yielded the required City, CA, USA). Reactions were analyzed with an ABI PCR products including the junction sequences. 373S autosequencer according to the manufacturer’s proto- We performed SSCP analysis on the four SCLH and four col (Applied Biosystems). ILS patients. In one male ILS patient (case 3), no PCR products were obtained between exons IV and VII in the Mutation analysis DCX gene (Fig. 1). Southern analysis, using PCR products of these exons as probes, showed no corresponding bands in We performed single-strand conformational polymorphism this patient (data not shown). These results suggested that (SSCP) analyses according to standard methods; in brief, this patient had a deletion in this region of the DCX gene. each sample was electrophoresed at 250V across a precast Three patients showed aberrant electrophoretic patterns 5% polyacrylamide Tris-borate electrophoresis buffer when exons IV and V were screened. Direct sequencing of (TBE) gel in a room maintained at 4° Celsius. After the gels the PCR products from the genomic DNA of these patients were stained in a 13 solution of SYBR Green II (FMC revealed that one male ILS patient (case 2) had a nonsense 169 Table 2. Oligonucleotide primers used for exon amplification Sense primers Antisense primers Product size (bp) E1s AGACTGCTTCCTAAGCTGGAGA E1a GGGAGTAAGAGATAGAGAGGGA 254 E2s AGCAGCAGATTGCAGATCTGGA E2a1 CAAGGCGTCAAAGCTGCGAAAA 388 E2s2 TTGTGTACGCTGTGTCCTCTGA E2a2 TAACCAATGATGCCACCTCCCA 214 E3s1 GTTCTACTCCAGTGTCAGTGTG
Load more

Recommended publications
  • Genotype-Phenotype Correlations in RP1-Associated Retinal Dystrophies: a Multi-Center Cohort Study in JAPAN
    Journal of Clinical Medicine Article Genotype-Phenotype Correlations in RP1-Associated Retinal Dystrophies: A Multi-Center Cohort Study in JAPAN Kei Mizobuchi 1,* , Takaaki Hayashi 1,2 , Noriko Oishi 3, Daiki Kubota 3, Shuhei Kameya 3, Koichiro Higasa 4, Takuma Futami 5, Hiroyuki Kondo 5 , Katsuhiro Hosono 6, Kentaro Kurata 6, Yoshihiro Hotta 6 , Kazutoshi Yoshitake 7, Takeshi Iwata 7 , Tomokazu Matsuura 8 and Tadashi Nakano 1 1 Department of Ophthalmology, The Jikei University School of Medicine, 3-19-18, Nishi-shimbashi, Minato-ku, Tokyo 105-8471, Japan; [email protected] (T.H.); [email protected] (T.N.) 2 Department of Ophthalmology, Katsushika Medical Center, The Jikei University School of Medicine, 6-41-2 Aoto, Katsushika-ku, Tokyo 125-8506, Japan 3 Department of Ophthalmology, Nippon Medical School Chiba Hokusoh Hospital, 1715 Kamagari, Inzai, Chiba 270-1694, Japan; [email protected] (N.O.); [email protected] (D.K.); [email protected] (S.K.) 4 Department of Genome Analysis, Institute of Biomedical Science, Kansai Medical University, 2-5-1 Shinmachi, Hirakata, Osaka 573-1010, Japan; [email protected] 5 Department of Ophthalmology, University of Occupational and Environmental Health, 1-1, Iseigaoka, Yahatanishi-ku Kitakyushu-shi, Fu-kuoka 807-8555, Japan; [email protected] (T.F.); [email protected] (H.K.) 6 Department of Ophthalmology, Hamamatsu University School of Medicine, 1-20-1, Handayama, Higashi-ku, Shizuoka, Hamamatsu 431-3192, Japan; [email protected] (K.H.); [email protected] (K.K.); [email protected] (Y.H.) 7 Citation: Mizobuchi, K.; Hayashi, T.; National Institute of Sensory Organs, National Hospital Organization Tokyo Medical Center, Oishi, N.; Kubota, D.; Kameya, S.; 2-5-1 Higashigaoka, Meguro-ku, Tokyo 152-8902, Japan; [email protected] (K.Y.); [email protected] (T.I.) Higasa, K.; Futami, T.; Kondo, H.; 8 Department of Laboratory Medicine, The Jikei University School of Medicine, 3-19-18, Nishi-shimbashi, Hosono, K.; Kurata, K.; et al.
    [Show full text]
  • Mechanisms and Disturbances of Neuronal Migration the Developing Nervous System: a Series of Review Articles
    0031-3998/00/4806-0725 PEDIATRIC RESEARCH Vol. 48, No. 6, 2000 Copyright © 2000 International Pediatric Research Foundation, Inc. Printed in U.S.A. The Developing Nervous System: A Series of Review Articles The following article is the first in an important series of review articles which discuss the developmental biology of the nervous system and its relation to diseases and disorders that are found in new born infants and children. This review, by Pierre Gressens, describes neuronal migration in the developing brain and abnormalities in humans resulting from aberrations in neuronal migration. Alvin Zipursky Editor-in-Chief Mechanisms and Disturbances of Neuronal Migration PIERRE GRESSENS Service de Neurologie Pédiatrique and INSERM E 9935, Hôpital Robert-Debré, F-75019 Paris, France ABSTRACT Neuronal migration appears as a complex ontogenic step of migration of neurons destined to the neocortex. New insights occurring early during embryonic and fetal development. Control gained from the analysis of animal models as well as from the of neuronal migration involves different cell populations includ- study of human diseases will be included. (Pediatr Res 48: ing Cajal-Retzius neurons, subplate neurons, neuronal precursors 725–730, 2000) or radial glia. The integrity of multiple molecular mechanisms, such as cell cycle control, cell-cell adhesion, interaction with extracellular matrix protein, neurotransmitter release, growth Abbreviations: factor availability, platelet-activating factor degradation or trans- BDNF, brain-derived neurotrophic factor duction pathways seems to be critical for normal neuronal mi- EGF, epidermal growth factor gration. The complexity and the multiplicity of these mecha- NMDA, N-methyl-D-aspartate nisms probably explain the clinical, radiologic and genetic NT, neurotrophin heterogeneity of human disorders of neuronal migration.
    [Show full text]
  • Doublecortin (Dcx) Family Proteins Regulate Filamentous Actin Structure in Developing Neurons
    The Journal of Neuroscience, January 9, 2013 • 33(2):709–721 • 709 Cellular/Molecular Doublecortin (Dcx) Family Proteins Regulate Filamentous Actin Structure in Developing Neurons Xiaoqin Fu,1 Kristy J. Brown,2 Chan Choo Yap,3 Bettina Winckler,3 Jyoti K. Jaiswal,2 and Judy S. Liu1 1Center for Neuroscience Research and 2Center for Genetic Medicine Research, Children’s National Medical Center, Washington, DC 20010, and 3Department of Neuroscience, University of Virginia Medical School, Charlottesville, Virginia 22908 Doublecortin (Dcx) is the causative gene for X-linked lissencephaly, which encodes a microtubule-binding protein. Axon tracts are abnormal in both affected individuals and in animal models. To determine the reason for the axon tract defect, we performed a semi- quantitative proteomic analysis of the corpus callosum in mice mutant for Dcx. In axons from mice mutant for Dcx, widespread differ- ences are found in actin-associated proteins as compared with wild-type axons. Decreases in actin-binding proteins ␣-actinin-1 and ␣-actinin-4 and actin-related protein 2/3 complex subunit 3 (Arp3), are correlated with dysregulation in the distribution of filamentous actin (F-actin) in the mutant neurons with increased F-actin around the cell body and decreased F-actin in the neurites and growth cones. The actin distribution defect can be rescued by full-length Dcx and further enhanced by Dcx S297A, the unphosphorylatable mutant, but not with the truncation mutant of Dcx missing the C-terminal S/P-rich domain. Thus, the C-terminal region of Dcx dynamically regulates formation of F-actin features in developing neurons, likely through interaction with spinophilin, but not through ␣-actinin-4 or Arp3.
    [Show full text]
  • The Retinitis Pigmentosa 1 Protein Is a Photoreceptor Microtubule-Associated Protein
    The Journal of Neuroscience, July 21, 2004 • 24(29):6427–6436 • 6427 Neurobiology of Disease The Retinitis Pigmentosa 1 Protein Is a Photoreceptor Microtubule-Associated Protein Qin Liu,1 Jian Zuo,2 and Eric A. Pierce1 1F. M. Kirby Center for Molecular Ophthalmology, Scheie Eye Institute, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104, and 2Department of Developmental Neurobiology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105 The outer segments of rod and cone photoreceptor cells are highly specialized sensory cilia made up of hundreds of membrane discs stacked into an orderly array along the photoreceptor axoneme. It is not known how the alignment of the outer segment discs is controlled, although it has been suggested that the axoneme may play a role in this process. Mutations in the retinitis pigmentosa 1 (RP1) gene are a common cause of retinitis pigmentosa (RP). Disruption of the Rp1 gene in mice causes misorientation of outer segment discs, suggesting a role for RP1 in outer segment organization. Here, we show that the RP1 protein is part of the photoreceptor axoneme. Amino acids 28–228 of RP1, which share limited homology with the microtubule-binding domains of the neuronal microtubule-associated protein (MAP) doublecortin, mediate the interaction between RP1 and microtubules, indicating that the putative doublecortin (DCX) domains in RP1 are functional. The N-terminal portion of RP1 stimulates the formation of microtubules in vitro and stabilizes cytoplas- mic microtubules in heterologous cells. Evaluation of photoreceptor axonemes from mice with targeted disruptions of the Rp1 gene shows that Rp1 proteins that contain the DCX domains also help control axoneme length and stability in vivo.
    [Show full text]
  • Doublecortin Is Required in Mice for Lamination of the Hippocampus but Not the Neocortex
    The Journal of Neuroscience, September 1, 2002, 22(17):7548–7557 Doublecortin Is Required in Mice for Lamination of the Hippocampus But Not the Neocortex Joseph C. Corbo,1,2 Thomas A. Deuel,1 Jeffrey M. Long,3 Patricia LaPorte,3 Elena Tsai,1 Anthony Wynshaw-Boris,3 and Christopher A. Walsh1 1Department of Neurology, Beth Israel Deaconess Medical Center, and Programs in Neuroscience and Biological and Biomedical Sciences, Harvard Medical School, Boston, Massachusetts 02115, 2Department of Pathology, Brigham and Women’s Hospital, Boston, Massachusetts 02115, and 3Departments of Pediatrics and Medicine, University of California, San Diego School of Medicine, San Diego, California 92093 Doublecortin (DCX) is a microtubule-associated protein that is cal lamination that is largely indistinguishable from wild type required for normal neocortical and hippocampal development and show normal patterns of neocortical neurogenesis and in humans. Mutations in the X-linked human DCX gene cause neuronal migration. In contrast, the hippocampus of both het- gross neocortical disorganization (lissencephaly or “smooth erozygous females and hemizygous males shows disrupted brain”) in hemizygous males, whereas heterozygous females lamination that is most severe in the CA3 region. Behavioral show a mosaic phenotype with a normal cortex as well as a tests show defects in context and cued conditioned fear tests, second band of misplaced (heterotopic) neurons beneath the suggesting that deficits in hippocampal learning accompany cortex (“double cortex syndrome”). We created a mouse carry- the abnormal cytoarchitecture. ing a targeted mutation in the Dcx gene. Hemizygous male Dcx mice show severe postnatal lethality; the few that survive to Key words: doublecortin; knock-out; mouse; cerebral cortex; adulthood are variably fertile.
    [Show full text]
  • Apoer2/VLDL Receptor and Dab1 in the Rostral Migratory Stream Function in Postnatal Neuronal Migration Independently of Reelin
    ApoER2/VLDL receptor and Dab1 in the rostral migratory stream function in postnatal neuronal migration independently of Reelin Nuno Andrade*, Vukoslav Komnenovic†, Sophia M. Blake*, Yves Jossin‡, Brian Howell§, Andre Goffinet‡, Wolfgang J. Schneider*, and Johannes Nimpf*¶ *Max F. Perutz Laboratories, University Departments at the Vienna Biocenter, Department of Medical Biochemistry, Medical University of Vienna, A-1030 Vienna, Austria; †Institute of Molecular Biotechnology, Austrian Academy of Sciences, 1030 Vienna, Austria; ‡Developmental Neurobiology Unit, University of Leuven Medical School, 3000 Leuven, Belgium; and §Neurogenetics Branch, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 Edited by Thomas C. Su¨dhof, The University of Texas Southwestern Medical Center, Dallas, TX, and approved March 30, 2007 (received for review December 21, 2006) Postnatal migration of interneuron precursors from the subventricu- In the cerebrum, Reelin is crucial for correct positioning of lar zone to the olfactory bulb occurs in chains that form the substrate radially migrating neuroblasts via its binding to ApoER2 and for the rostral migratory stream. Reelin is suggested to induce de- very-low-density lipoprotein receptor (VLDLR) (18, 19), which tachment of neuroblasts from the chains when they arrive at the triggers tyrosine phosphorylation of the adaptor Dab1 by re- olfactory bulb. Here we show that ApoER2 and possibly very-low- ceptor clustering (20). Binding of Reelin to the receptors and density lipoprotein receptor (VLDLR) and their intracellular adapter subsequent phosphorylation of Dab1 are consecutive steps of a protein Dab1 are involved in chain formation most likely independent linear pathway, because disruption of any of the corresponding of Reelin.
    [Show full text]
  • Widely Used Genetic Technique May Lead to Spurious Results
    Spectrum | Autism Research News https://www.spectrumnews.org NEWS Widely used genetic technique may lead to spurious results BY JESSICA WRIGHT 7 AUGUST 2014 Target practice: An RNA fragment designed to block the doublecortin gene misdirects neurons (right two panels) from their correct destinations (left) even in cells that lack the gene (far right). A popular method that neuroscientists use to simulate the effects of a mutation may alter the brain and produce misleading results, cautions a study published 18 June in Neuron1. The technique involves using a fragment of RNA, called a short hairpin RNA (shRNA), to interfere with protein production. It simulates the effects of a harmful mutation without having to change the genetic code, and is widely used because of its relative simplicity. For years, studies have hinted that the method may have ‘off-target’ effects — meaning that a given shRNA may block more than just its intended target. For example, a 2003 study found that an shRNA designed for the doublecortin gene prevents neurons from migrating to their correct locations in the mouse brain2. Deleting the gene in mice does not show this effect, suggesting that it is an unintended consequence3. In 2006, another study showed that a supposedly benign shRNA can weaken the connections between neurons4. “We had this controversy that existed for many years,” says Joseph Gleeson, professor of neurosciences at the University of California, San Diego, and lead researcher on the new study. “The neurobiology field continued to use shRNAs because they’re so easy to use, but there was this dark cloud hanging over the field that it might not be completely reliable.” 1 / 3 Spectrum | Autism Research News https://www.spectrumnews.org The new study confirms those fears.
    [Show full text]
  • Dissertation
    DISSERTATION Titel der Dissertation Characterization of Thrombospondin-1 as novel ligand for the Reelin pathway receptors ApoER2 and VLDLR in the postnatal mouse brain angestrebter akademischer Grad Doktor/in der Naturwissenschaften (Dr. rer.nat.) Verfasserin / Verfasser: Sophia Maria Blake Matrikel-Nummer: 0021434 Dissertationsgebiet (lt. Stu- A 091490 Molekulare Biologie dienblatt): Betreuerin / Betreuer: Univ.-Prof. Dr. Johannes Nimpf Wien, am 06. Dezember 2008 Formular Nr.: A.04 Contents 1 Contents 1 Abstract .................................................................................... 3 2 Zusammenfassung .................................................................. 5 3 Introduction .............................................................................. 7 3.1 Neocortical development ..................................................................7 3.1.1 The Neocortex............................................................................. 7 3.1.2 Neuronal migration in the developing neocortex .................... 8 3.1.3 Cortical layering........................................................................ 10 3.1.4 Mouse strains with defects in cortical architecture............... 11 3.1.4.1 reeler................................................................................... 11 3.1.4.2 dab1-/- (scrambler, yotari) .................................................. 11 3.1.4.3 vldlr-/-/apoER2-/- .................................................................. 12 3.2 The Reelin signaling cascade........................................................
    [Show full text]
  • Pseudo-Repeats in Doublecortin Make Distinct Mechanistic Contributions to Microtubule Regulation
    bioRxiv preprint doi: https://doi.org/10.1101/808899; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Pseudo-repeats in doublecortin make distinct mechanistic contributions to microtubule regulation Szymon W. Manka* and Carolyn A. Moores* Institute of Structural and Molecular Biology, Department of Biological Sciences, Birkbeck, University of London, WC1E 7HX, London, UK *Corresponding authors: [email protected] or [email protected] Abstract Doublecortin (DCX) is a neuronal microtubule-associated protein (MAP) indispensable for brain development. Its flexibly linked DC domains – NDC and CDC – mediate microtubule (MT) nucleation and stabilisation, but it is unclear how. Using high-resolution time-resolved cryo-EM, we mapped NDC and CDC interactions with tubulin at different MT polymerisation stages and studied their functional effects on MT dynamics using TIRF microscopy. Although coupled, each DC repeat appears to have a distinct role in MT nucleation and stabilisation by DCX: CDC is a conformationally plastic tubulin binding module that appears to facilitate MT nucleation by binding tubulin oligomers and stabilising tubulin-tubulin contacts in the nascent MT lattice, while NDC appears to be favoured along the mature lattice, providing enhanced and durable MT stabilisation. Our near-atomic resolution structures of MT-bound DC domains also explain in unprecedented detail the DCX mutation-related brain defects observed in the clinic. This modular composition of DCX reflects a common design principle among MAPs where pseudo- repeats of tubulin/MT binding elements chaperone or stabilise distinct conformational transitions to regulate distinct stages of MT dynamic instability.
    [Show full text]
  • In Vivo Conversion of Astrocytes to Neurons in the Injured Adult Spinal Cord
    ARTICLE Received 2 Jan 2014 | Accepted 29 Jan 2014 | Published 25 Feb 2014 DOI: 10.1038/ncomms4338 In vivo conversion of astrocytes to neurons in the injured adult spinal cord Zhida Su1,2, Wenze Niu1, Meng-Lu Liu1, Yuhua Zou1 & Chun-Li Zhang1 Spinal cord injury (SCI) leads to irreversible neuronal loss and glial scar formation, which ultimately result in persistent neurological dysfunction. Cellular regeneration could be an ideal approach to replenish the lost cells and repair the damage. However, the adult spinal cord has limited ability to produce new neurons. Here we show that resident astrocytes can be converted to doublecortin (DCX)-positive neuroblasts by a single transcription factor, SOX2, in the injured adult spinal cord. Importantly, these induced neuroblasts can mature into synapse-forming neurons in vivo. Neuronal maturation is further promoted by treatment with a histone deacetylase inhibitor, valproic acid (VPA). The results of this study indicate that in situ reprogramming of endogenous astrocytes to neurons might be a potential strategy for cellular regeneration after SCI. 1 Department of Molecular Biology, University of Texas Southwestern Medical Center, 6000 Harry Hines Blvd, Dallas, Texas 75390-9148, USA. 2 Institute of Neuroscience and Key Laboratory of Molecular Neurobiology of Ministry of Education, Neuroscience Research Center of Changzheng Hospital, Second Military Medical University, 800 Xiangyin Rd, Shanghai 200433, China. Correspondence and requests for materials should be addressed to C.-L.Z. (email: [email protected]).
    [Show full text]
  • The X-Linked Intellectual Disability Gene Product and E3 Ubiquitin Ligase KLHL15 Degrades Doublecortin Proteins to Constrain Neuronal Dendritogenesis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.02.324285; this version posted October 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. KLHL15 degrades doublecortin proteins The X-linked intellectual disability gene product and E3 ubiquitin ligase KLHL15 degrades doublecortin proteins to constrain neuronal dendritogenesis Jianing Song1,2, Ronald A. Merrill1,2, Andrew Y. Usachev1, and Stefan Strack1* From the 1Department of Neuroscience and Pharmacology and the Iowa Neuroscience Institute, University of Iowa, Iowa City, Iowa 52242 2 These authors contributed equally to the work. *To whom correspondence should be addressed: Stefan Strack: Dept. of Neuroscience and Pharmacology, The University of Iowa, Iowa City, IA 52242; [email protected]; Tel. (319) 384-4439; Fax. (319) 335-8930 Running Title: KLHL15 degrades doublecortin proteins Keywords: Kelch-like 15, KLHL15, E3 ubiquitin ligase, protein phosphatase 2A, signal transduction, doublecortin, doublecortin-like kinases, microtubule-associated protein, ubiquitination, proteasomal degradation, protein turnover, neurite outgrowth, dendritic complexity, pulse-chase, HaloTag ______________________________________________________________________________ ABSTRACT doublecortin (DCX), also an X-linked disease gene, and doublecortin-like kinases 1 and 2 Proper brain development and function (DCLK1/2) as bona fide KLHL15 interactors requires finely controlled mechanisms
    [Show full text]
  • 82310507.Pdf
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Neuron, Vol. 23, 247±256, June, 1999, Copyright 1999 by Cell Press Doublecortin Is a Developmentally Regulated, Microtubule-Associated Protein Expressed in Migrating and Differentiating Neurons ² Fiona Francis,*k Annette Koulakoff, in the deeper layers, while later born neurons cross Dominique Boucher,² Philippe Chafey,* through these layers to successively reach regions Bruce Schaar,³ Marie-Claude Vinet,* closer to the cerebral surface (reviewed by McConnell, GaeÈ lle Friocourt,* Nathalie McDonnell,* 1995; Caviness et al., 1997). In this way, a six-layered Orly Reiner,§ Axel Kahn,* Susan K. McConnell,³ neocortex develops. Migrating neurons mainly travel in Yoheved Berwald-Netter,² Philippe Denoulet,² association with radially extending glial fibres (Rakic, and Jamel Chelly* 1971; Luskin et al., 1988); however, tangential and chain *U129 de l'INSERM migration have also been observed in some brain re- Institut Cochin de Ge ne tique Mole culaire gions (Luskin, 1993; Tan and Breen, 1993; O'Rourke et 24, rue du Faubourg Saint Jacques al., 1995; Lois et al., 1996). Many questions still remain 75014 Paris concerning the corticogenesis process: the signals that ² Laboratoire de Biochimie Cellulaire determine the timing of cells leaving the proliferative CNRS UPR 9065 pool, which ultimately affects their laminar fate (Frantz ColleÁ ge de France and McConnell, 1996), the mechanism and direction of 11, Place M. Berthelot cell locomotion, and the recognition of the final desti- 75005 Paris nation. France Lissencephaly is a cortical malformation disorder as- ³ Department of Biological Sciences sociated with severe mental retardation and epilepsy Stanford University (Harding, 1996), which exists as an X-linked disease (X-LIS) Stanford, California 94305 caused by mutations in the doublecortin gene (des § Department of Molecular Genetics Portes et al., 1998a; Gleeson et al., 1998).
    [Show full text]