DOCSLIB.ORG

CDCA7 Promotes Lung Adenocarcinoma Proliferation Via Regulating the Cell Cycle T

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
CDCA7 Promotes Lung Adenocarcinoma Proliferation Via Regulating the Cell Cycle T Pathology - Research and Practice 215 (2019) 152559 Contents lists available at ScienceDirect Pathology - Research and Practice journal homepage: www.elsevier.com/locate/prp Original article CDCA7 promotes lung adenocarcinoma proliferation via regulating the cell cycle T Hongying Wanga,1, Liang Yeb,1, Ze Xingc, Hanqing Lid, Tangfeng Lva, Hongbing Liua, ⁎ Fang Zhanga, Yong Songa, a Department of Respiratory Medicine, Jinling Hospital, Southern Medical University. Nanjing 210002, Jiangsu Provence, China b Department of Respiratory Medicine, Nanjing First Hospital, Nanjing Medicine University, Nanjing, Jiangsu Provence, China c Department of Oncology Medicine, Inner Mongolia Medicine University Affiliated Hospital, Hohhot, Inner Mongolia Autonomous Region, China d Department of Hematology, Jinling Hospital, Southern Medical University. Nanjing 210002, Jiangsu Provence, China ARTICLE INFO ABSTRACT Keywords: CDCA7 is overexpressed in several malignant cancers and is predicted by bioinformatics to be a candidate CDCA7 oncogene in lung adenocarcinoma (LUAD). However, the clinical and biological function of CDCA7 in LUAD has Lung cancer never been investigated. In this study, we used quantitative real-time RT-PCR and immunohistochemistry to Cell cycle determine the expression level and clinical significance of CDCA7. As a result, CDCA7 was significantly over- myc expressed in LUAD compared to adjacent normal tissues. Furthermore, overexpression of CDCA7 was positively Apoptosis associated with more advanced clinical features. Silencing CDCA7 inhibited cell proliferation in LUAD through G1 phase arrest and induction of apoptosis. In conclusion, CDCA7 can be used as a potential therapeutic target for new biomarkers and LUAD. 1. Introduction mediator of lymphomagenesis and overexpression of CDCA7 predicted poor prognosis in triple negative breast cancer [9,10]. Lung cancer is the most common type of malignant cancer as well as CDCA7 is a recently identified target of myc-dependent transcrip- the leading cause of cancer death [1]. The incidence of lung cancer has tional regulation and is a proto-oncogene that regulates the expression been continuously increasing during recent decades. Non-small cell of hundreds of genes involved in cell cycle progression, adhesion, me- lung cancer (NSCLC), which comprises 85% of lung cancer, is the main tabolism, and apoptosis. In recent years, several authors, [5,6] have pathological type and includes two different subtypes, lung adeno- reported high expression of CDCA7 gene in various human malig- carcinoma (LUAD) and lung squamous cancer. Although most LUAD nancies, suggesting that CDCA7 is closely related to various malignant patients have received standard therapies to date, < 15% of LUAD tumors. However, the role of CDCA7 in lung adenocarcinoma has not patients survive after 5 years [2,3]. Thus, further investigation on the been studied. Therefore, in-depth study may provide a new target for mechanisms and molecular function of oncogenes is urgently needed to the treatment of LUAD. help identify new therapeutic targets. The CDCA7 gene (Cell division cycle-associated protein 7), also 2. Methods and materials known as JPO1, is located on chromosome 2q31 and encodes a nuclear protein consisting of 371 amino acids [4] in 1997, Dang et al. dis- 2.1. Date sources and bioinformatics covered a new differentially expressed gene, JPO1, in fibroblasts transfected with the Myc gene, using representational difference ana- TCGA (The cancer genome atlas) was jointly launched by the lysis [5]. The JPO1 gene is periodically expressed in the cell cycle and National Cancer Institute (NCI) and the National Human Genome reaches the highest level between G1 and S and was officially renamed Research Institute (NHGRI) in 2006. Clinical data, genomic variation, CDCA7 by the Human Genome Nomenclature Committee [6]. Previous mRNA expression, miRNA expression, methylation, etc. of various studies on CDCA7 genes have focused on the interaction between human cancers (including tumors including subtypes) are important CDCA7 and Myc [4,7,8]. In 2018, CDCA7 was reported to be a critical data sources for cancer researchers. ⁎ Corresponding author. E-mail address: [email protected] (Y. Song). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.prp.2019.152559 Received 2 April 2019; Received in revised form 4 July 2019; Accepted 22 July 2019 0344-0338/ H. Wang, et al. Pathology - Research and Practice 215 (2019) 152559 The Cancer Genome Atlas (TCGA) data set naming Table 1 TCGA_LUAD_exp_HiSeqV2-2015-02-24 was downloaded from the Primer sequences. website of the UCSC Cancer Browser (https://genomecancer.ucsc.edu/ Gene Sense Anti-sense ), which contained the data of 511 LUAD patients including 57 paired tissues [11–13]. All standardized mRNA expression values were ob- CDCA7 GGGTGGCGATGAAGTTTCCA GGGGATGTCTTCCACGGAAC tained from the genomic Matrix file. The age, sex, survival, TNM stage, CCND1 CCCGCACGATTTCATTGAAC AGGGCGGATTGGAAATGAAC fi CCNE1 CGGTATATGGCGACACAAGA AGGGGACTTAAACGCCACTT and other clinical data were obtained from the clinical_data le. Dif- CCNE2 CAGGTTTGGAGTGGGACAGT CTCCATTGCACACTGGTGAC ferences in CDCA7 expression between LUAD and normal tissues were P21 GCAGACCAGCATGACAGATTT GGATTAGGGCTTCCTCTTGGA studied using an unpaired Student's t-test. A list of 179 genes with the P27 TGGAGAAGCACTGCAGAGAC GCGTGTCCTCAGAGTTAGCC highest expression correlation with CDCA7 (Pearson’s r value ≥ 0.5;) β-ACTIN GAAATCGTGCGTGACATTAA AAGGAAGGCTGGAAGAGTG was submitted to DAVID Bioinformatics Resources 6.7 (http://david. abcc.ncifcrf.gov/) for KEGG enrichment analysis [14,15]. The probe System as follows: initial denaturation step at 95 °C for 10 min, followed 224428_s_at(CDCA7) was used for overall survival analysis on by 40 cycles at 92 °C for 15 s and 60 °C for 1 min. Primers of CDCA7 and kmplot.com (http://kmplot.com/analysis/index.php?p=service& other associated genes are shown in Table 1 and the housekeeping gene cancer=lung) and we used Median as the cutoff to obtain results. ACTIN was used as a control. Changes in gene expression were calcu- −ΔΔ lated using the 2 CT method. 2.2. Cell lines, cell culture and siRNA transfection The human LUAD cell lines A549, H1299, PC9, SPC-A-1 and the 2.5. Protein extraction and western blotting normal human bronchial epithelial cell line HBE were purchased from Shanghai Life Sciences Research Institute (Shanghai, China). The cells Cells were harvested and treated on ice with RIPA lysis buffer were cultured in RPMI 1640 Medium (KeyGene, Nanjing China) sup- (KeyGene, Nanjing, China). Protein concentration was measured using plemented with 10% fetal bovine serum (FBS) and penicillin/strepto- the BCA Protein Assay Kit (KeyGene). Equal amounts of each protein mycin (KeyGene, Nanjing, China). All the cells were incubated at 37 °C were separated by SDS-PAGE and transferred to polyvinylidene fluoride with 5% CO2. H1299 and PC9 cells were seeded in 6-well plates 24 h membranes. The membranes were blocked in 2% bovine serum albumin fl – before transfection. When con uency reached 60% 70%, cells were in the Tris-buffered saline with Tween 20 (TBS-T) for 1 h, then in- fi transfected with siRNA targeting a speci c gene or a negative control cubated with antibody overnight (4 °C) against CDCA7 (HPA005565- (RealGene, Nanjing, China) using Lipofectamine RNAimax reagent 100UL 1:500; Sigma-Aldrich, St. Louis, MO, USA), cyclin D1 (2978, (Invitrogen, Carlsbad, CA, USA). Nonsense RNAi was used as a negative 1:1000; Cell Signaling Technology, Danvers, MA, USA), cyclin E1 ffi control for CDCA7 siRNA. Transfection e ciency was assessed by (ab7959, 1:200; Abcam, Cambridge, MA, USA), cyclin E2 (11935-1-ap, quantitative real-time RT-PCR and western blotting. Two separate 1:500; Protein Technologies, Manchester, UK), p21 (SC-397, 1:500; siRNAs were designed, and the sequences were as follows: siRNA-1 of Santa Cruz Biotechnology, Santa Cruz, CA, USA) p27 (SC-528, 1:200; ′ ′ ′ CDCA7: sense 5 - GCCAGATGTCACTAACGAACT-3 , antisense 5 - AGT Santa Cruz Biotechnology), or GAPDH (D16H11, 1:1000; Cell Signaling ′ ′− TCGTTAGTGACATCTGGC-3 ; siRNA-2 for CDCA7: sense 5 CCTCTG Technology). After washing three times with TBS-T 3, the membranes ′ ′ ATGACAGTTGTGACA-3 , anti-sense 5 - TGTCACAACTGTCATCAG were incubated with goat anti-rabbit horseradish peroxidase (HRP)- ′ AGG-3 . And the following nonsense siRNA was used as a control: sense conjugated secondary antibody (1:10,000; Abcam) or goat anti-mouse ′ ′ ′ 5 -UUCUCCGAACGUGUCACGUTT-3 , antisense 5 -ACGUGACACGUUC HRP-conjugated secondary antibody (1:10,000; Abcam) for 2 h at room ′ GGAGAATT -3 . temperature until the blots were detected by enhanced chemilumines- cence (Thermo Fisher Scientific) All experiments were repeated at least 2.3. Tissue collection and immunohistochemistry three times independently. We collected primary NSCLC and adjacent normal tissues from a series of 53 patients who underwent NSCLC surgery in the Department 2.6. Cell proliferation assay of Jinling Hospital Affiliated to Southern Medical University between 2016 and 2018. No patients received radiotherapy or chemotherapy After 24 h of transfection, the cells were seeded in 96-well plates at before surgical resection. The histopathological classification of the 4×104 cells per well at a concentration of 100 μL. Then, 20 μL of CCK- tissues was performed by two pathologists in a double-blind manner. 8 reagent was added to each well, and the cells were cultured at 37 °C All tumor and adjacent normal specimens were
Load more

Recommended publications
  • The Myc Target Gene JPO1/CDCA7 Is Frequently Overexpressed in Human Tumors and Has Limited Transforming Activity in Vivo
    Research Article The Myc Target Gene JPO1/CDCA7 Is Frequently Overexpressed in Human Tumors and Has Limited Transforming Activity In vivo Rebecca C. Osthus,1,2 Baktiar Karim,5 Julia E. Prescott,1 B. Douglas Smith,6 Michael McDevitt,2,6 David L. Huso,5 and Chi V. Dang1,2,3,4,6 1Program in Human Genetics and Molecular Biology, 2Division of Hematology, 3Departments of Medicine, Cell Biology, 4Pathology, and 5Comparative Medicine, 6The Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland Abstract metabolism, ribosome biogenesis as well as other cellular processes, how deregulated MYC expression contributes to MYC is frequently overexpressed in human cancers, but the downstream events contributing to tumorigenesis remain tumorigenesis through targets genes remains poorly understood. incompletely understood. MYC encodes an oncogenic tran- In particular, the contributions of large numbers of target genes scription factor, of which target genes presumably contribute with unknown functions to Myc-mediated tumorigenesis remain to cellular transformation. Although Myc regulates about 15% undelineated. Here, we sought to determine the expression pattern of genes and combinations of target genes are likely required of JPO1/CDCA7, which encodes a nuclear protein with unknown for tumorigenesis, we studied in depth the expression of the function, in human cancers and its transforming activity in Myc target gene, JPO1/CDCA7, in human cancers and its ability transgenic mice. to provoke tumorigenesis in transgenic mice. JPO1/CDCA7 is We identified JPO1 as a novel transcript that is differentially regulated in Myc-transformed fibroblasts in a representational frequently overexpressed in human cancers, and in particular, difference analysis screen (13).
    [Show full text]
  • Supplementary Data
    SUPPLEMENTARY DATA A cyclin D1-dependent transcriptional program predicts clinical outcome in mantle cell lymphoma Santiago Demajo et al. 1 SUPPLEMENTARY DATA INDEX Supplementary Methods p. 3 Supplementary References p. 8 Supplementary Tables (S1 to S5) p. 9 Supplementary Figures (S1 to S15) p. 17 2 SUPPLEMENTARY METHODS Western blot, immunoprecipitation, and qRT-PCR Western blot (WB) analysis was performed as previously described (1), using cyclin D1 (Santa Cruz Biotechnology, sc-753, RRID:AB_2070433) and tubulin (Sigma-Aldrich, T5168, RRID:AB_477579) antibodies. Co-immunoprecipitation assays were performed as described before (2), using cyclin D1 antibody (Santa Cruz Biotechnology, sc-8396, RRID:AB_627344) or control IgG (Santa Cruz Biotechnology, sc-2025, RRID:AB_737182) followed by protein G- magnetic beads (Invitrogen) incubation and elution with Glycine 100mM pH=2.5. Co-IP experiments were performed within five weeks after cell thawing. Cyclin D1 (Santa Cruz Biotechnology, sc-753), E2F4 (Bethyl, A302-134A, RRID:AB_1720353), FOXM1 (Santa Cruz Biotechnology, sc-502, RRID:AB_631523), and CBP (Santa Cruz Biotechnology, sc-7300, RRID:AB_626817) antibodies were used for WB detection. In figure 1A and supplementary figure S2A, the same blot was probed with cyclin D1 and tubulin antibodies by cutting the membrane. In figure 2H, cyclin D1 and CBP blots correspond to the same membrane while E2F4 and FOXM1 blots correspond to an independent membrane. Image acquisition was performed with ImageQuant LAS 4000 mini (GE Healthcare). Image processing and quantification were performed with Multi Gauge software (Fujifilm). For qRT-PCR analysis, cDNA was generated from 1 µg RNA with qScript cDNA Synthesis kit (Quantabio). qRT–PCR reaction was performed using SYBR green (Roche).
    [Show full text]
  • This Thesis Has Been Submitted in Fulfilment of the Requirements for a Postgraduate Degree (E.G
    This thesis has been submitted in fulfilment of the requirements for a postgraduate degree (e.g. PhD, MPhil, DClinPsychol) at the University of Edinburgh. Please note the following terms and conditions of use: This work is protected by copyright and other intellectual property rights, which are retained by the thesis author, unless otherwise stated. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author. The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author. When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given. Investigation into the role of LSH ATPase in chromatin remodelling Alina Gukova Doctor of Philosophy – University of Edinburgh – 2020 ABSTRACT Chromatin remodelling is a crucial nuclear process affecting replication, transcription and repair. Global reduction of DNA methylation is observed in Immunodeficiency-Centromeric Instability-Facial Anomaly (ICF) syndrome. Several proteins were found to be mutated in patients diagnosed with ICF, among them are LSH and CDCA7. LSH is a chromatin remodeller bearing homology to the members of Sf2 remodelling family. A point mutation in its ATPase lobe was identified in ICF. CDCA7 is a zinc finger protein that was recently found to be crucial for nucleosome remodelling activity of LSH. Several point mutations in its zinc finger domain were described in ICF patients. In vitro and in vivo studies have shown that LSH-/- phenotype demonstrates reduction of global DNA methylation, implying that chromatin remodelling LSH functions may be required for the efficient methyltransferase activity, linking this finding to ICF phenotype.
    [Show full text]
  • A Set of Regulatory Genes Co-Expressed in Embryonic Human Brain Is Implicated in Disrupted Speech Development
    Molecular Psychiatry https://doi.org/10.1038/s41380-018-0020-x ARTICLE A set of regulatory genes co-expressed in embryonic human brain is implicated in disrupted speech development 1 1 1 2 3 Else Eising ● Amaia Carrion-Castillo ● Arianna Vino ● Edythe A. Strand ● Kathy J. Jakielski ● 4,5 6 7 8 9 Thomas S. Scerri ● Michael S. Hildebrand ● Richard Webster ● Alan Ma ● Bernard Mazoyer ● 1,10 4,5 6,11 6,12 13 Clyde Francks ● Melanie Bahlo ● Ingrid E. Scheffer ● Angela T. Morgan ● Lawrence D. Shriberg ● Simon E. Fisher 1,10 Received: 22 September 2017 / Revised: 3 December 2017 / Accepted: 2 January 2018 © The Author(s) 2018. This article is published with open access Abstract Genetic investigations of people with impaired development of spoken language provide windows into key aspects of human biology. Over 15 years after FOXP2 was identified, most speech and language impairments remain unexplained at the molecular level. We sequenced whole genomes of nineteen unrelated individuals diagnosed with childhood apraxia of speech, a rare disorder enriched for causative mutations of large effect. Where DNA was available from unaffected parents, CHD3 SETD1A WDR5 fi 1234567890();,: we discovered de novo mutations, implicating genes, including , and . In other probands, we identi ed novel loss-of-function variants affecting KAT6A, SETBP1, ZFHX4, TNRC6B and MKL2, regulatory genes with links to neurodevelopment. Several of the new candidates interact with each other or with known speech-related genes. Moreover, they show significant clustering within a single co-expression module of genes highly expressed during early human brain development. This study highlights gene regulatory pathways in the developing brain that may contribute to acquisition of proficient speech.
    [Show full text]
  • Structural Basis of Specific DNA Binding by the Transcription Factor
    8388–8398 Nucleic Acids Research, 2019, Vol. 47, No. 16 Published online 21 June 2019 doi: 10.1093/nar/gkz557 Structural basis of specific DNA binding by the transcription factor ZBTB24 Ren Ren1,†, Swanand Hardikar1,†, John R. Horton1, Yue Lu1, Yang Zeng1,2,AnupK.Singh1, Kevin Lin1, Luis Della Coletta1, Jianjun Shen1,2, Celine Shuet Lin Kong3, Hideharu Hashimoto4, Xing Zhang1, Taiping Chen1,2,* and Xiaodong Cheng 1,2,* 1Department of Epigenetics and Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, 2 Houston, TX 77030, USA, Program in Genetics and Epigenetics, The University of Texas MD Anderson Cancer Downloaded from https://academic.oup.com/nar/article/47/16/8388/5521786 by guest on 23 September 2021 Center UTHealth Graduate School of Biomedical Sciences, Houston, TX 77030, USA, 3Program in Cancer Biology, The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences, Houston, TX 77030, USA and 4Department of Biochemistry, Emory University School of Medicine, Atlanta, GA 30322, USA Received October 13, 2018; Revised June 07, 2019; Editorial Decision June 11, 2019; Accepted June 13, 2019 ABSTRACT INTRODUCTION ZBTB24, encoding a protein of the ZBTB family ZBTB (zinc-finger- and BTB domain-containing) proteins, of transcriptional regulators, is one of four known characterized by the presence of an N-terminal BTB genes––the other three being DNMT3B, CDCA7 and (broad-complex, tram-track, and bric-a-brac)` domain [also HELLS––that are mutated in immunodeficiency, cen- known as POZ (poxvirus and zinc finger) domain] and a tromeric instability and facial anomalies (ICF) syn- C-terminal domain with tandem C2H2 Kr¨uppel-type zinc fingers (ZFs), are a large family of evolutionarily con- drome, a genetic disorder characterized by DNA hy- served transcriptional regulators (1).
    [Show full text]
  • Transcriptome Analysis of Sézary Syndrome and Lymphocytic- Variant Hypereosinophilic Syndrome T Cells Reveals Common and Divergent Genes
    www.oncotarget.com Oncotarget, 2019, Vol. 10, (No. 49), pp: 5052-5069 Research Paper Transcriptome analysis of Sézary syndrome and lymphocytic- variant hypereosinophilic syndrome T cells reveals common and divergent genes Andrea M. Moerman-Herzog1, Daniel A. Acheampong1,2, Amanda G. Brooks1, Suzan M. Blair1, Ping-Ching Hsu3 and Henry K. Wong1 1Department of Dermatology, University of Arkansas for Medical Sciences, Little Rock, Arkansas, USA 2Joint Graduate Program in Bioinformatics, University of Arkansas at Little Rock and University of Arkansas for Medical Sciences, Little Rock, Arkansas, USA 3Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, Arkansas, USA Correspondence to: Henry K. Wong, email: [email protected] Keywords: Sézary syndrome; lymphocytic-variant hypereosinophilic syndrome; biomarkers; microarrays; progression Received: May 24, 2019 Accepted: July 15, 2019 Published: August 20, 2019 Copyright: Moerman-Herzog et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Sézary syndrome (SS) is an aggressive cutaneous T cell lymphoma with pruritic skin inflammation and immune dysfunction, driven by neoplastic, clonal memory T cells in both peripheral blood and skin. To gain insight into abnormal gene expression promoting T cell dysfunction, lymphoproliferation and transformation in SS, we first compared functional transcriptomic profiles of both resting and activated CD4+CD45RO+ T cells from SS patients and normal donors to identified differential expressed genes. Next, a meta-analysis was performed to compare our SS data to public microarray data from a novel benign disease control, lymphocytic-variant hypereosinophilic syndrome (L-HES).
    [Show full text]
  • Mechanisms of Aryl Hydrocarbon Receptor-Mediated Regulation of Gene Expression and the Cell Cycle
    UNIVERSITY OF CINCINNATI Date:___________________ I, _________________________________________________________, hereby submit this work as part of the requirements for the degree of: in: It is entitled: This work and its defense approved by: Chair: _______________________________ _______________________________ _______________________________ _______________________________ _______________________________ Mechanisms of Aryl Hydrocarbon Receptor-Mediated Regulation of Gene Expression and the Cell Cycle A dissertation submitted to the Division of Research and Advanced Studies of the University of Cincinnati In partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (Ph.D.) In the Department of Environmental Health of the College of Medicine November 28, 2006 by Jennifer L. Marlowe B.S., Miami University, 1999 Committee Chair: Alvaro Puga, Ph.D. Professor Department of Environmental Health University of Cincinnati Committee: Dr. Timothy Dalton Dr. Mary Beth Genter Dr. Erik Knudsen Dr. Ying Xia The focus of this dissertation is the discovery of novel mechanisms and pathways of gene regulation by the aryl hydrocarbon receptor (AHR), primarily regarding the role of this protein in modulating cell cycle progression. The AHR is a member of the PAS (Per-Arnt-Sim) superfamily of receptors, which mediate responses to environmental stresses such as hypoxia and circadian rhythm, and control basic physiologic processes like vascular development, learning, and neurogenesis. The AHR protein was discovered by virtue of its high affinity interaction with the persistent environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), and is now known as the primary mediator of the toxic effects of this and hundreds of other HAH and PAH ligands. The mechanisms by which the AHR acts to mediate toxicity of these compounds include the activity of the AHR as a potent transcriptional activator.
    [Show full text]
  • The MER41 Family of Hervs Is Uniquely Involved in the Immune-Mediated Regulation of Cognition/Behavior-Related Genes
    bioRxiv preprint doi: https://doi.org/10.1101/434209; this version posted October 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The MER41 family of HERVs is uniquely involved in the immune-mediated regulation of cognition/behavior-related genes: pathophysiological implications for autism spectrum disorders Serge Nataf*1, 2, 3, Juan Uriagereka4 and Antonio Benitez-Burraco 5 1CarMeN Laboratory, INSERM U1060, INRA U1397, INSA de Lyon, Lyon-Sud Faculty of Medicine, University of Lyon, Pierre-Bénite, France. 2 University of Lyon 1, Lyon, France. 3Banque de Tissus et de Cellules des Hospices Civils de Lyon, Hôpital Edouard Herriot, Lyon, France. 4Department of Linguistics and School of Languages, Literatures & Cultures, University of Maryland, College Park, USA. 5Department of Spanish, Linguistics, and Theory of Literature (Linguistics). Faculty of Philology. University of Seville, Seville, Spain * Corresponding author: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/434209; this version posted October 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT Interferon-gamma (IFNa prototypical T lymphocyte-derived pro-inflammatory cytokine, was recently shown to shape social behavior and neuronal connectivity in rodents. STAT1 (Signal Transducer And Activator Of Transcription 1) is a transcription factor (TF) crucially involved in the IFN pathway.
    [Show full text]
  • Microarray Gene Expression Analysis in Ovine Ductus Arteriosus During Fetal Development and Birth Transition
    nature publishing group Articles Basic Science Investigation Microarray gene expression analysis in ovine ductus arteriosus during fetal development and birth transition Ravi Goyal1, Dipali Goyal1, Lawrence D. Longo1 and Ronald I. Clyman2 BACKGROUND: Patent ductus arteriosus (PDA) in the new- (PDA) persists after birth, the blood shunts from the high- born is the most common congenital heart anomaly and is pressure aorta to the low-pressure pulmonary artery (left to significantly more common in preterm infants. Contemporary right shunt). This can lead to pulmonary hyperemia and edema pharmacological treatment is effective in only 70–80% of the and decreases renal, mesenteric, and cerebral perfusion result- cases. Moreover, indomethacin or ibuprofen, which are used ing in pulmonary engorgement with an increase in pulmonary to close a PDA may be accompanied by serious side effects in vascular resistance and congestive cardiac failure. In those premature infants. To explore the novel molecular pathways, cases in which the pulmonary vascular resistance exceeds which may be involved in the maturation and closure of the the systemic vascular resistance, the blood shunts from right ductus arteriosus (DA), we used fetal and neonatal sheep to test to left. The main therapeutic option for a PDA is to treat the the hypothesis that maturational development of DA is associ- neonate with indomethacin or ibuprofen to inhibit the enzyme ated with significant alterations in specific mRNA expression. cyclooxygenase and thus inhibit prostaglandin synthesis. This METHODS: We conducted oligonucleotide microarray exper- is successful in about 70–80% of infants. Its use, however, may iments on the isolated mRNA from DA and ascending aorta lead to undesirable side effects such as gastrointestinal bleed- from three study groups (premature fetus—97 ± 0 d, near-term ing, perforation, and/or necrotizing enterocolitis.
    [Show full text]
  • Downregulation of SNRPG Induces Cell Cycle Arrest and Sensitizes Human Glioblastoma Cells to Temozolomide by Targeting Myc Through a P53-Dependent Signaling Pathway
    Cancer Biol Med 2020. doi: 10.20892/j.issn.2095-3941.2019.0164 ORIGINAL ARTICLE Downregulation of SNRPG induces cell cycle arrest and sensitizes human glioblastoma cells to temozolomide by targeting Myc through a p53-dependent signaling pathway Yulong Lan1,2*, Jiacheng Lou2*, Jiliang Hu1, Zhikuan Yu1, Wen Lyu1, Bo Zhang1,2 1Department of Neurosurgery, Shenzhen People’s Hospital, Second Clinical Medical College of Jinan University, The First Affiliated Hospital of Southern University of Science and Technology, Shenzhen 518020, China;2 Department of Neurosurgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116023, China ABSTRACT Objective: Temozolomide (TMZ) is commonly used for glioblastoma multiforme (GBM) chemotherapy. However, drug resistance limits its therapeutic effect in GBM treatment. RNA-binding proteins (RBPs) have vital roles in posttranscriptional events. While disturbance of RBP-RNA network activity is potentially associated with cancer development, the precise mechanisms are not fully known. The SNRPG gene, encoding small nuclear ribonucleoprotein polypeptide G, was recently found to be related to cancer incidence, but its exact function has yet to be elucidated. Methods: SNRPG knockdown was achieved via short hairpin RNAs. Gene expression profiling and Western blot analyses were used to identify potential glioma cell growth signaling pathways affected by SNRPG. Xenograft tumors were examined to determine the carcinogenic effects of SNRPG on glioma tissues. Results: The SNRPG-mediated inhibitory effect on glioma cells might be due to the targeted prevention of Myc and p53. In addition, the effects of SNRPG loss on p53 levels and cell cycle progression were found to be Myc-dependent. Furthermore, SNRPG was increased in TMZ-resistant GBM cells, and downregulation of SNRPG potentially sensitized resistant cells to TMZ, suggesting that SNRPG deficiency decreases the chemoresistance of GBM cells to TMZ via the p53 signaling pathway.
    [Show full text]
  • Genome-Wide Identification of Genes Regulating DNA Methylation Using Genetic Anchors for Causal Inference
    bioRxiv preprint doi: https://doi.org/10.1101/823807; this version posted October 30, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genome-wide identification of genes regulating DNA methylation using genetic anchors for causal inference Paul J. Hop1,2, René Luijk1, Lucia Daxinger3, Maarten van Iterson1, Koen F. Dekkers1, Rick Jansen4, BIOS Consortium5, Joyce B.J. van Meurs6, Peter A.C. ’t Hoen 7, M. Arfan Ikram8, Marleen M.J. van Greevenbroek9,10, Dorret I. Boomsma11, P. Eline Slagboom1, Jan H. Veldink2, Erik W. van Zwet12, Bastiaan T. Heijmans1* 1 Molecular Epidemiology, Department of Biomedical Data Sciences, Leiden University Medical Center, Leiden, 2333 ZC, The Netherlands 2 Department of Neurology, UMC Utrecht Brain Center, University Medical Centre Utrecht, Utrecht University, Utrecht 3584 CG, Netherlands 3 Department of Human Genetics, Leiden University Medical Center, Leiden, 2333 ZC, The Netherlands 4 Department of Psychiatry, Amsterdam UMC, Vrije Universiteit Amsterdam, Amsterdam Neuroscience, Amsterdam, 1081 HV, The Netherlands 5 Biobank-based Integrated Omics Study Consortium. For a complete list of authors, see the acknowledgements. 6 Department of Internal Medicine, Erasmus Medical Centre, Rotterdam, The Netherlands. 7 Centre for Molecular and Biomolecular Informatics, Radboud Institute for Molecular Life Sciences, Radboud University
    [Show full text]
  • Transcriptomic and Open Chromatin Atlas of High-Resolution Anatomical Regions in the Rhesus Macaque Brain
    ARTICLE https://doi.org/10.1038/s41467-020-14368-z OPEN Transcriptomic and open chromatin atlas of high-resolution anatomical regions in the rhesus macaque brain Senlin Yin1,7, Keying Lu1,7, Tao Tan2,3,4,7, Jie Tang 1,7, Jingkuan Wei3, Xu Liu5, Xinlei Hu1, Haisu Wan5, Wei Huang6, Yong Fan4*, Dan Xie 1* & Yang Yu 2* 1234567890():,; The rhesus macaque is a prime model animal in neuroscience. A comprehensive tran- scriptomic and open chromatin atlas of the rhesus macaque brain is key to a deeper understanding of the brain. Here we characterize the transcriptome of 416 brain samples from 52 regions of 8 rhesus macaque brains. We identify gene modules associated with specific brain regions like the cerebral cortex, pituitary, and thalamus. In addition, we discover 9703 novel intergenic transcripts, including 1701 coding transcripts and 2845 lncRNAs. Most of the novel transcripts are only expressed in specific brain regions or cortical regions of specific individuals. We further survey the open chromatin regions in the hippocampal CA1 and several cerebral cortical regions of the rhesus macaque brain using ATAC-seq, revealing CA1- and cortex-specific open chromatin regions. Our results add to the growing body of knowledge regarding the baseline transcriptomic and open chromatin profiles in the brain of the rhesus macaque. 1 Frontier Science Center for Disease Molecular Network, State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, 610041 Chengdu, China. 2 Department of Obstetrics and Gynecology, Peking University Third Hospital, 100191 Beijing, China. 3 Yunnan Key Laboratory of Primate Biomedical Research, Institute of Primate Translational Medicine, Kunming University of Science and Technology, 650500 Kunming, Yunnan, China.
    [Show full text]