Pathology - Research and Practice 215 (2019) 152559 Contents lists available at ScienceDirect Pathology - Research and Practice journal homepage: www.elsevier.com/locate/prp Original article CDCA7 promotes lung adenocarcinoma proliferation via regulating the cell cycle T Hongying Wanga,1, Liang Yeb,1, Ze Xingc, Hanqing Lid, Tangfeng Lva, Hongbing Liua, ⁎ Fang Zhanga, Yong Songa, a Department of Respiratory Medicine, Jinling Hospital, Southern Medical University. Nanjing 210002, Jiangsu Provence, China b Department of Respiratory Medicine, Nanjing First Hospital, Nanjing Medicine University, Nanjing, Jiangsu Provence, China c Department of Oncology Medicine, Inner Mongolia Medicine University Affiliated Hospital, Hohhot, Inner Mongolia Autonomous Region, China d Department of Hematology, Jinling Hospital, Southern Medical University. Nanjing 210002, Jiangsu Provence, China ARTICLE INFO ABSTRACT Keywords: CDCA7 is overexpressed in several malignant cancers and is predicted by bioinformatics to be a candidate CDCA7 oncogene in lung adenocarcinoma (LUAD). However, the clinical and biological function of CDCA7 in LUAD has Lung cancer never been investigated. In this study, we used quantitative real-time RT-PCR and immunohistochemistry to Cell cycle determine the expression level and clinical significance of CDCA7. As a result, CDCA7 was significantly over- myc expressed in LUAD compared to adjacent normal tissues. Furthermore, overexpression of CDCA7 was positively Apoptosis associated with more advanced clinical features. Silencing CDCA7 inhibited cell proliferation in LUAD through G1 phase arrest and induction of apoptosis. In conclusion, CDCA7 can be used as a potential therapeutic target for new biomarkers and LUAD. 1. Introduction mediator of lymphomagenesis and overexpression of CDCA7 predicted poor prognosis in triple negative breast cancer [9,10]. Lung cancer is the most common type of malignant cancer as well as CDCA7 is a recently identified target of myc-dependent transcrip- the leading cause of cancer death [1]. The incidence of lung cancer has tional regulation and is a proto-oncogene that regulates the expression been continuously increasing during recent decades. Non-small cell of hundreds of genes involved in cell cycle progression, adhesion, me- lung cancer (NSCLC), which comprises 85% of lung cancer, is the main tabolism, and apoptosis. In recent years, several authors, [5,6] have pathological type and includes two different subtypes, lung adeno- reported high expression of CDCA7 gene in various human malig- carcinoma (LUAD) and lung squamous cancer. Although most LUAD nancies, suggesting that CDCA7 is closely related to various malignant patients have received standard therapies to date, < 15% of LUAD tumors. However, the role of CDCA7 in lung adenocarcinoma has not patients survive after 5 years [2,3]. Thus, further investigation on the been studied. Therefore, in-depth study may provide a new target for mechanisms and molecular function of oncogenes is urgently needed to the treatment of LUAD. help identify new therapeutic targets. The CDCA7 gene (Cell division cycle-associated protein 7), also 2. Methods and materials known as JPO1, is located on chromosome 2q31 and encodes a nuclear protein consisting of 371 amino acids [4] in 1997, Dang et al. dis- 2.1. Date sources and bioinformatics covered a new differentially expressed gene, JPO1, in fibroblasts transfected with the Myc gene, using representational difference ana- TCGA (The cancer genome atlas) was jointly launched by the lysis [5]. The JPO1 gene is periodically expressed in the cell cycle and National Cancer Institute (NCI) and the National Human Genome reaches the highest level between G1 and S and was officially renamed Research Institute (NHGRI) in 2006. Clinical data, genomic variation, CDCA7 by the Human Genome Nomenclature Committee [6]. Previous mRNA expression, miRNA expression, methylation, etc. of various studies on CDCA7 genes have focused on the interaction between human cancers (including tumors including subtypes) are important CDCA7 and Myc [4,7,8]. In 2018, CDCA7 was reported to be a critical data sources for cancer researchers. ⁎ Corresponding author. E-mail address: [email protected] (Y. Song). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.prp.2019.152559 Received 2 April 2019; Received in revised form 4 July 2019; Accepted 22 July 2019 0344-0338/ H. Wang, et al. Pathology - Research and Practice 215 (2019) 152559 The Cancer Genome Atlas (TCGA) data set naming Table 1 TCGA_LUAD_exp_HiSeqV2-2015-02-24 was downloaded from the Primer sequences. website of the UCSC Cancer Browser (https://genomecancer.ucsc.edu/ Gene Sense Anti-sense ), which contained the data of 511 LUAD patients including 57 paired tissues [11–13]. All standardized mRNA expression values were ob- CDCA7 GGGTGGCGATGAAGTTTCCA GGGGATGTCTTCCACGGAAC tained from the genomic Matrix file. The age, sex, survival, TNM stage, CCND1 CCCGCACGATTTCATTGAAC AGGGCGGATTGGAAATGAAC fi CCNE1 CGGTATATGGCGACACAAGA AGGGGACTTAAACGCCACTT and other clinical data were obtained from the clinical_data le. Dif- CCNE2 CAGGTTTGGAGTGGGACAGT CTCCATTGCACACTGGTGAC ferences in CDCA7 expression between LUAD and normal tissues were P21 GCAGACCAGCATGACAGATTT GGATTAGGGCTTCCTCTTGGA studied using an unpaired Student's t-test. A list of 179 genes with the P27 TGGAGAAGCACTGCAGAGAC GCGTGTCCTCAGAGTTAGCC highest expression correlation with CDCA7 (Pearson’s r value ≥ 0.5;) β-ACTIN GAAATCGTGCGTGACATTAA AAGGAAGGCTGGAAGAGTG was submitted to DAVID Bioinformatics Resources 6.7 (http://david. abcc.ncifcrf.gov/) for KEGG enrichment analysis [14,15]. The probe System as follows: initial denaturation step at 95 °C for 10 min, followed 224428_s_at(CDCA7) was used for overall survival analysis on by 40 cycles at 92 °C for 15 s and 60 °C for 1 min. Primers of CDCA7 and kmplot.com (http://kmplot.com/analysis/index.php?p=service& other associated genes are shown in Table 1 and the housekeeping gene cancer=lung) and we used Median as the cutoff to obtain results. ACTIN was used as a control. Changes in gene expression were calcu- −ΔΔ lated using the 2 CT method. 2.2. Cell lines, cell culture and siRNA transfection The human LUAD cell lines A549, H1299, PC9, SPC-A-1 and the 2.5. Protein extraction and western blotting normal human bronchial epithelial cell line HBE were purchased from Shanghai Life Sciences Research Institute (Shanghai, China). The cells Cells were harvested and treated on ice with RIPA lysis buffer were cultured in RPMI 1640 Medium (KeyGene, Nanjing China) sup- (KeyGene, Nanjing, China). Protein concentration was measured using plemented with 10% fetal bovine serum (FBS) and penicillin/strepto- the BCA Protein Assay Kit (KeyGene). Equal amounts of each protein mycin (KeyGene, Nanjing, China). All the cells were incubated at 37 °C were separated by SDS-PAGE and transferred to polyvinylidene fluoride with 5% CO2. H1299 and PC9 cells were seeded in 6-well plates 24 h membranes. The membranes were blocked in 2% bovine serum albumin fl – before transfection. When con uency reached 60% 70%, cells were in the Tris-buffered saline with Tween 20 (TBS-T) for 1 h, then in- fi transfected with siRNA targeting a speci c gene or a negative control cubated with antibody overnight (4 °C) against CDCA7 (HPA005565- (RealGene, Nanjing, China) using Lipofectamine RNAimax reagent 100UL 1:500; Sigma-Aldrich, St. Louis, MO, USA), cyclin D1 (2978, (Invitrogen, Carlsbad, CA, USA). Nonsense RNAi was used as a negative 1:1000; Cell Signaling Technology, Danvers, MA, USA), cyclin E1 ffi control for CDCA7 siRNA. Transfection e ciency was assessed by (ab7959, 1:200; Abcam, Cambridge, MA, USA), cyclin E2 (11935-1-ap, quantitative real-time RT-PCR and western blotting. Two separate 1:500; Protein Technologies, Manchester, UK), p21 (SC-397, 1:500; siRNAs were designed, and the sequences were as follows: siRNA-1 of Santa Cruz Biotechnology, Santa Cruz, CA, USA) p27 (SC-528, 1:200; ′ ′ ′ CDCA7: sense 5 - GCCAGATGTCACTAACGAACT-3 , antisense 5 - AGT Santa Cruz Biotechnology), or GAPDH (D16H11, 1:1000; Cell Signaling ′ ′− TCGTTAGTGACATCTGGC-3 ; siRNA-2 for CDCA7: sense 5 CCTCTG Technology). After washing three times with TBS-T 3, the membranes ′ ′ ATGACAGTTGTGACA-3 , anti-sense 5 - TGTCACAACTGTCATCAG were incubated with goat anti-rabbit horseradish peroxidase (HRP)- ′ AGG-3 . And the following nonsense siRNA was used as a control: sense conjugated secondary antibody (1:10,000; Abcam) or goat anti-mouse ′ ′ ′ 5 -UUCUCCGAACGUGUCACGUTT-3 , antisense 5 -ACGUGACACGUUC HRP-conjugated secondary antibody (1:10,000; Abcam) for 2 h at room ′ GGAGAATT -3 . temperature until the blots were detected by enhanced chemilumines- cence (Thermo Fisher Scientific) All experiments were repeated at least 2.3. Tissue collection and immunohistochemistry three times independently. We collected primary NSCLC and adjacent normal tissues from a series of 53 patients who underwent NSCLC surgery in the Department 2.6. Cell proliferation assay of Jinling Hospital Affiliated to Southern Medical University between 2016 and 2018. No patients received radiotherapy or chemotherapy After 24 h of transfection, the cells were seeded in 96-well plates at before surgical resection. The histopathological classification of the 4×104 cells per well at a concentration of 100 μL. Then, 20 μL of CCK- tissues was performed by two pathologists in a double-blind manner. 8 reagent was added to each well, and the cells were cultured at 37 °C All tumor and adjacent normal specimens were