Airway Mucin Dynamics in Infection and Inflammation

Total Page:16

File Type:pdf, Size:1020Kb

Airway Mucin Dynamics in Infection and Inflammation AIRWAY MUCIN DYNAMICS IN INFECTION AND INFLAMMATION Bethany Batson A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor in Philosophy in the Department of Pathology and Laboratory Medicine in the School of Medicine. Chapel Hill 2019 Approved by: Claire Doerschuk Mehmet Kesimer Jonathon Homeister Marianne Muhlebach Wanda O’Neal © 2019 Bethany Batson ALL RIGHTS RESERVED ii ABSTRACT Bethany Batson: Airway Mucin Dynamics in Infection and Inflammation (Under the direction of Mehmet Kesimer) Mucus plays a critical role in the innate immunity of the airways acting as the body’s first line of defense against pathogens. Mucus is a complex gel and much is still unknown regarding its constituents and how these cooperatively imbue mucus with its physiological and rheological properties. One such component, mucin, a large polymeric glycoprotein, is responsible for many of the rheological properties of mucus and its concentration has been linked to the development of several airway diseases. The importance of a properly functioning and mobile mucus layer is most evident when it becomes defective, a defining feature of the cystic fibrosis (CF) and asthmatic airway disease, which can have devastating consequences. A better understanding of why mucus becomes static and occludes airways or becomes a nidus for infection would not only clarify the pathogenesis of these diseases, but would inform future therapeutic advances. Using in vitro models and in vivo sputum samples, the following body of work aims to elucidate and characterize how the various mucus components including mucin, mucin interacting proteins, and regulatory exosomal miRNAs change in CF and asthmatic lung environments with the hypothesis that these qualitative and quantitative changes are key drivers in the development of pathologic mucus. We will show that the ratio of the two main gel- iii forming mucins is unique to specific airway diseases as are the proteins with which theses mucin interact. A specific focus will be placed on IgGFc-binding protein (FCGBP), a mucin interacting protein predicted to stabilize the colonic mucus layer, which we show is differentially secreted in CF and asthma lung environments. Several exosomal miRNA were identified that target mucin and its glycosylation machinery which also show disease specificity in regards to their expression. These findings broaden our understanding of how mucins are altered and contribute to the function of mucus in health and disease. iv ACKNOWLEDGMENTS Countless individuals have played a role in the creation, revision, and completion of this body of work. My committee members, Dr. Claire Doerschuk, Dr. Marianne Muhlebach, Dr. Wanda O’Neal, Dr. Jonathon Homeister, and Dr. Mehmet Kesimer provided the encouragement and input that facilitated the completion of my work and graduate studies. I would like to dedicate this work to my mentor, Mehmet Kesimer, who nurtured my enthusiasm for research and gave me the opportunity to become an independent investigator. This work would not have been possible without his blessing and guidance. Not only did you push me scientifically, but your continued support while I struggled with a difficult pregnancy and a newborn made finishing my PhD a reality. I have spent the past five years in the Kesimer lab, which have been filled with riveting scientific (and non-scientific) conversation, laughter, and collaboration, and exciting science. Each member of the lab has enhanced my graduate experience with their specific area of technical expertise but also in other less scientific ways. From Giorgia Radicioni, I have learned about Italy and scuba diving; from Boris Reidel, everything German and Star Wars; from Jerome Carpenter, anything sports, PowerPoint animations, and what it means to be “optihensive”, with Stephanie Livengood, I have shared my love for cats and dogs; and from Sabri Abdelwahab, I have learned about selfless generosity and developed v a heightened appreciation for Baklava. I could never forget, the former lab manager and one of my best friends, Amina Ford, who taught me how to laugh through difficult times and that regardless of your title and position, with hard work you can achieve great things. I not only view these individuals as my labmates, but my friends and North Carolina family. This work was truly a collaborative effort that involved numerous labs and core facilities within the CF center, and those both on and off UNCs’ campus. Within the Marsico Lung Institute and CF center I would like to acknowledge the following labs and cores: The CF Center Tissue Procurement and Cell Culture Core, The Molecular Biology Core, The Histology Core, The Michael Hooker Microscopy Core, and really the entire 7th floor of Marsico Hall. Outside of the CF center, I would like to recognize Dr. Brenda Temple from The UNC Center for Structural Biology, the High Throughput Genomic Sequencing Facility, Dr. Flavia Teles and Lynn Martin, and The UNC Animal Histopathology Core. Outside of UNC, I would like to acknowledge the fruitful collaboration with Dr. Tiemeyer and Tadahiro Kumagai from University of Georgia’s Complex Carbohydrate Research Center. Lastly I would like to thank my family. My husband, Kellen Batson, has provided unending encouragement, unconditional love and support, which started with his willingness to move from the West Coast to North Carolina and continues even now as he encourages me to pursue my dream of becoming a medical doctor. Life became a little bit more complicated when we decided to have Finley, but I wouldn’t choose to be married, parents, and best friends with anyone else! Finley Marie Batson, even though you are unaware of what I have been up to these last vi couple years, you have brought an incredible amount of joy, laughter, and smiles into my life. I work hard for you, my little cupcake, and hopefully one day you will be as proud of me as I already am of you. vii TABLE OF CONTENTS LIST OF FIGURES .................................................................................................. xiv LIST OF TABLES ..................................................................................................... xix LIST OF ABBREVIATIONS ..................................................................................... xxi INTRODUCTION: MUCUS & MUCIN ........................................................................ 1 CHAPTER 1. PART A: COMPREHENSIVE CHARACTERIZATION OF MUCINS WITHIN THE CF AIRWAY USING IN-VITRO MODELS ................. 7 Introduction: Cystic Fibrosis ................................................................................... 7 Methods ............................................................................................................... 11 Cell Culture ....................................................................................................... 11 CF cell culture models ...................................................................................... 11 Mucin Isolation and Static Light Scattering ....................................................... 12 Isolation and Analysis of Stored Gel Forming Mucins ....................................... 13 Whole Mount Immunohistochemistry (IHC) ...................................................... 13 Agarose Gel Electrophoresis ............................................................................ 14 Mass Spectrometry ........................................................................................... 15 Proteomic Semi-tryptic peptide analysis ........................................................... 17 Rate Zonal Centrifugation ................................................................................. 17 Exosome Isolation ............................................................................................ 18 MUC5B and MUC5AC Standard In-Vitro Experimental Design ........................ 18 Results: ................................................................................................................ 20 viii CF Cell Culture Models: Immunohistochemistry and MUC5B and MUC5AC concentration quantitation ......................................................... 20 SMM: MUC5AC and MUC5B concentration quantitation .................................. 21 CF cell culture models: Macromolecular characterization of secreted and intracellular gel forming mucins .......................................................... 21 Ps.a. cell culture model: MUC5B Semi-tryptic peptide analysis ........................ 23 CF cell culture models: Conformation analysis of the secreted gel forming mucins .......................................................................................... 24 SMM cell culture model: Proteomic pathway analysis of secreted proteins ...... 24 Ps.a. cell culture model: Proteomic pathway analysis of secreted proteins ...... 25 Proteomic comparison of secretions from SMM and Ps.a. CF cell culture models ........................................................................................... 26 CF Cell culture models: Proteomic analysis of mucin interacting proteins in secretions ................................................................................ 26 Ps.a. CF cell culture model: Pathway analysis of differentially expressed exosomal miRNA ...................................................................................... 27 Ps.a. CF cell culture model: In silico MUC5B activity prediction
Recommended publications
  • Anti-Inflammatory Effects of V-3 Polyunsaturated Fatty Acids And
    ORIGINAL ARTICLE Anti-inflammatory Effects of v-3 Polyunsaturated Fatty Acids and Soluble Epoxide Hydrolase Inhibitors in Angiotensin-II–Dependent Hypertension Arzu Ulu, MSc,* Todd R. Harris, PhD,* Christophe Morisseau, PhD,* Christina Miyabe, BS,* Hiromi Inoue, DVM,† Gertrud Schuster, PhD,‡ Hua Dong, PhD,* Ana-Maria Iosif, PhD,§ Jun-Yan Liu, PhD,* Robert H. Weiss, MD,†¶ Nipavan Chiamvimonvat, MD,k¶ John D. Imig, PhD,** and Bruce D. Hammock, PhD* renal markers of inflammation (ie, prostaglandins and MCP-1), Abstract: The mechanisms underlying the anti-inflammatory and downregulated an epithelial sodium channel, and upregulated angioten- antihypertensive effects of long-chain v-3 polyunsaturated fatty acids sin-converting enzyme-2 message and significantly modulated cyclo- (v-3 PUFAs) are still unclear. The epoxides of an v-6 fatty acid, oxygenase and lipoxygenase metabolic pathways. Overall, our findings arachidonic acid epoxyeicosatrienoic acids also exhibit antihyperten- suggest that epoxides of the v-3 PUFAs contribute to lowering systolic sive and anti-inflammatory effects. Thus, we hypothesized that the blood pressure and attenuating inflammation in part by reduced pros- major v-3 PUFAs, including eicosapentaenoic acid (EPA) and doco- taglandinsandMCP-1andbyupregulation of angiotensin-converting sahexaenoic acid (DHA), may lower the blood pressure and attenuate enzyme-2 in angiotensin-II–dependent hypertension. renal markers of inflammation through their epoxide metabolites. v Here, we supplemented mice with an v-3 rich diet for 3 weeks in Key Words: -3 polyunsaturated fatty acids, EPA, DHA, soluble – a murine model of angiotensin-II–dependent hypertension. Also, epoxide hydrolase inhibitors, angiotensin-II dependent hypertension because EPA and DHA epoxides are metabolized by soluble epoxide (J Cardiovasc PharmacolÔ 2013;62:285–297) hydrolase (sEH), we tested the combination of an sEH inhibitor and the v-3 rich diet.
    [Show full text]
  • Bioinformatics Approach for Pattern of Myelin-Specific Proteins And
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Qazvin University of Medical Sciences Repository Biotech Health Sci. 2016 November; 3(4):e38278. doi: 10.17795/bhs-38278. Published online 2016 August 16. Research Article Bioinformatics Approach for Pattern of Myelin-Specific Proteins and Related Human Disorders Samiie Pouragahi,1,2,3 Mohammad Hossein Sanati,4 Mehdi Sadeghi,2 and Marjan Nassiri-Asl3,* 1Department of Molecular Medicine, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 2Department of Bioinformatics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran 3Department of Pharmacology, Cellular and Molecular Research Center, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 4Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran *Corresponding author: Marjan Nassiri-Asl, School of Medicine, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-2833336001, Fax: +98-2833324971, E-mail: [email protected] Received 2016 April 06; Revised 2016 May 30; Accepted 2016 June 22. Abstract Background: Recent neuroinformatic studies, on the structure-function interaction of proteins, causative agents basis of human disease have implied that dysfunction or defect of different protein classes could be associated with several related diseases. Objectives: The aim of this study was the use of bioinformatics approaches for understanding the structure, function and relation- ship of myelin protein 2 (PMP2), a myelin-basic protein in the basis of neuronal disorders. Methods: A collection of databases for exploiting classification information systematically, including, protein structure, protein family and classification of human disease, based on a new approach was used.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Dysregulated Hepatic Methionine
    Virginia Commonwealth University VCU Scholars Compass Internal Medicine Publications Dept. of Internal Medicine 2015 Dysregulated Hepatic Methionine Metabolism Drives Homocysteine Elevation in Diet-Induced Nonalcoholic Fatty Liver Disease Tommy Pacana Virginia Commonwealth University, [email protected] Sophie Cazanave Virginia Commonwealth University Aurora Verdianelli Virginia Commonwealth University See next page for additional authors Follow this and additional works at: http://scholarscompass.vcu.edu/intmed_pubs Part of the Medicine and Health Sciences Commons Copyright: © 2015 Pacana et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited Downloaded from http://scholarscompass.vcu.edu/intmed_pubs/98 This Article is brought to you for free and open access by the Dept. of Internal Medicine at VCU Scholars Compass. It has been accepted for inclusion in Internal Medicine Publications by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Authors Tommy Pacana, Sophie Cazanave, Aurora Verdianelli, Viashali Patel, Hae-Ki Min, Faridoddin Mirshahi, Eoin Quinlavin, and Arun J. Sanyal This article is available at VCU Scholars Compass: http://scholarscompass.vcu.edu/intmed_pubs/98 RESEARCH ARTICLE Dysregulated Hepatic Methionine Metabolism Drives Homocysteine Elevation in Diet-Induced Nonalcoholic Fatty
    [Show full text]
  • Oral Absorption of Peptides and Nanoparticles Across the Human Intestine: Opportunities, Limitations and Studies in Human Tissues☆
    Advanced Drug Delivery Reviews 106 (2016) 256–276 Contents lists available at ScienceDirect Advanced Drug Delivery Reviews journal homepage: www.elsevier.com/locate/addr Oral absorption of peptides and nanoparticles across the human intestine: Opportunities, limitations and studies in human tissues☆ P. Lundquist, P. Artursson ⁎ Department of Pharmacy, Uppsala University, Box 580, SE-752 37 Uppsala, Sweden article info abstract Article history: In this contribution, we review the molecular and physiological barriers to oral delivery of peptides and nanopar- Received 2 May 2016 ticles. We discuss the opportunities and predictivity of various in vitro systems with special emphasis on human Received in revised form 2 July 2016 intestine in Ussing chambers. First, the molecular constraints to peptide absorption are discussed. Then the phys- Accepted 8 July 2016 iological barriers to peptide delivery are examined. These include the gastric and intestinal environment, the Available online 3 August 2016 mucus barrier, tight junctions between epithelial cells, the enterocytes of the intestinal epithelium, and the Keywords: subepithelial tissue. Recent data from human proteome studies are used to provide information about the protein fi Oral drug delivery expression pro les of the different physiological barriers to peptide and nanoparticle absorption. Strategies that Peptide drugs have been employed to increase peptide absorption across each of the barriers are discussed. Special consider- Nanoparticles ation is given to attempts at utilizing endogenous transcytotic pathways. To reliably translate in vitro data on Ussing chamber peptide or nanoparticle permeability to the in vivo situation in a human subject, the in vitro experimental system Peptide permeability needs to realistically capture the central aspects of the mentioned barriers.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Single Amino Acid Repeats in the Proteome World: Structural, Functional, and Evolutionary Insights
    RESEARCH ARTICLE Single Amino Acid Repeats in the Proteome World: Structural, Functional, and Evolutionary Insights Amitha Sampath Kumar, Divya Tej Sowpati, Rakesh K. Mishra* Centre for Cellular and Molecular Biology, Council of Scientific and Industrial Research, Uppal Road, Hyderabad, 500007, India * [email protected] a11111 Abstract Microsatellites or simple sequence repeats (SSR) are abundant, highly diverse stretches of short DNA repeats present in all genomes. Tandem mono/tri/hexanucleotide repeats in the coding regions contribute to single amino acids repeats (SAARs) in the proteome. While SSRs in the coding region always result in amino acid repeats, a majority of SAARs arise due to a combination of various codons representing the same amino acid and not as a con- OPEN ACCESS sequence of SSR events. Certain amino acids are abundant in repeat regions indicating a Citation: Kumar AS, Sowpati DT, Mishra RK (2016) Single Amino Acid Repeats in the Proteome positive selection pressure behind the accumulation of SAARs. By analysing 22 proteomes World: Structural, Functional, and Evolutionary including the human proteome, we explored the functional and structural relationship of Insights. PLoS ONE 11(11): e0166854. amino acid repeats in an evolutionary context. Only ~15% of repeats are present in any doi:10.1371/journal.pone.0166854 known functional domain, while ~74% of repeats are present in the disordered regions, sug- Editor: Eugene A. Permyakov, Russian Academy of gesting that SAARs add to the functionality of proteins by providing flexibility, stability and Medical Sciences, RUSSIAN FEDERATION act as linker elements between domains. Comparison of SAAR containing proteins across Received: August 28, 2016 species reveals that while shorter repeats are conserved among orthologs, proteins with Accepted: November 5, 2016 longer repeats, >15 amino acids, are unique to the respective organism.
    [Show full text]
  • Tnfa-Induced Mucin 4 Expression Elicits Trastuzumab Resistance in HER2-Positive Breast Cancer María F
    Published OnlineFirst October 3, 2016; DOI: 10.1158/1078-0432.CCR-16-0970 Cancer Therapy: Clinical Clinical Cancer Research TNFa-Induced Mucin 4 Expression Elicits Trastuzumab Resistance in HER2-Positive Breast Cancer María F. Mercogliano1, Mara De Martino1, Leandro Venturutti1, Martín A. Rivas2, Cecilia J. Proietti1, Gloria Inurrigarro3, Isabel Frahm3, Daniel H. Allemand4, Ernesto Gil Deza5, Sandra Ares5, Felipe G. Gercovich5, Pablo Guzman 6, Juan C. Roa6,7, Patricia V. Elizalde1, and Roxana Schillaci1 Abstract Purpose: Although trastuzumab administration improved the Results: TNFa overexpression turned trastuzumab-sensitive outcome of HER2-positive breast cancer patients, resistance cells and tumors into resistant ones. Histopathologic findings events hamper its clinical benefits. We demonstrated that TNFa revealed mucin foci in TNFa-producing tumors. TNFa induced stimulation in vitro induces trastuzumab resistance in HER2- upregulation of MUC4 that reduced trastuzumab binding to its positive breast cancer cell lines. Here, we explored the mechanism epitope and impaired ADCC. Silencing MUC4 enhanced trastu- of TNFa-induced trastuzumab resistance and the therapeutic zumab binding, increased ADCC, and overcame trastuzumab and strategies to overcome it. trastuzumab-emtansine antiproliferative effects in TNFa-overex- Experimental Design: Trastuzumab-sensitive breast cancer pressing cells. Accordingly, administration of TNFa-blocking cells, genetically engineered to stably overexpress TNFa,and antibodies downregulated MUC4 and sensitized de novo trastu- de novo trastuzumab-resistant tumors, were used to evaluate zumab-resistant breast cancer cells and tumors to trastuzumab. In trastuzumab response and TNFa-blocking antibodies effective- HER2-positive breast cancer samples, MUC4 expression was ness respectively. Immunohistochemistry and antibody-depen- found to be an independent predictor of poor disease-free survival dent cell cytotoxicity (ADCC), together with siRNA strategy, (P ¼ 0.008).
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Mechanistic Implications for the Chorismatase Fkbo Based on the Crystal Structure
    Mechanistic Implications for the Chorismatase FkbO Based on the Crystal Structure Puneet Juneja 1,†, Florian Hubrich 2,†, Kay Diederichs 1, Wolfram Welte 1 and Jennifer N. Andexer 2 1 - Department of Biology, University of Konstanz, D-78457 Konstanz, Germany 2 - Institute of Pharmaceutical Sciences, Albert-Ludwigs-University Freiburg, Albertstr 25, D-79104 Freiburg, Germany Correspondence to Jennifer N. Andexer: [email protected] http://dx.doi.org/10.1016/j.jmb.2013.09.006 Edited by M. Guss Abstract Chorismate-converting enzymes are involved in many biosynthetic pathways leading to natural products and can often be used as tools for the synthesis of chemical building blocks. Chorismatases such as FkbO from Streptomyces species catalyse the hydrolysis of chorismate yielding (dihydro)benzoic acid derivatives. In contrast to many other chorismate-converting enzymes, the structure and catalytic mechanism of a chorismatase had not been previously elucidated. Here we present the crystal structure of the chorismatase FkbO in complex with a competitive inhibitor at 1.08 Å resolution. FkbO is a monomer in solution and exhibits pseudo-3-fold symmetry; the structure of the individual domains indicates a possible connection to the trimeric RidA/YjgF family and related enzymes. The co-crystallised inhibitor led to the identification of FkbO's active site in the cleft between the central and the C-terminal domains. A mechanism for FkbO is proposed based on both interactions between the inhibitor and the surrounding amino acids and an FkbO structure with chorismate modelled in the active site. We suggest that the methylene group of the chorismate enol ether takes up a proton from an active-site glutamic acid residue, thereby initiating chorismate hydrolysis.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Review Article Cystathionine -Synthase in Physiology and Cancer
    Hindawi BioMed Research International Volume 2018, Article ID 3205125, 11 pages https://doi.org/10.1155/2018/3205125 Review Article Cystathionine �-Synthase in Physiology and Cancer Haoran Zhu,1,2 Shaun Blake,1,2 Keefe T. Chan,1 Richard B. Pearson ,1,2,3,4 and Jian Kang 1 1 Division of Research, Peter MacCallum Cancer Centre, 305 Grattan Street, Melbourne, Victoria 3000, Australia 2Sir Peter MacCallum Department of Oncology, Australia 3Department of Biochemistry and Molecular Biology, University of Melbourne, Parkville, Victoria 3052, Australia 4Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3168, Australia Correspondence should be addressed to Richard B. Pearson; [email protected] Received 23 March 2018; Accepted 29 May 2018; Published 28 June 2018 Academic Editor: Maria L. Tornesello Copyright © 2018 Haoran Zhu et al. Tis is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Cystathionine �-synthase (CBS) regulates homocysteine metabolism and contributes to hydrogen sulfde (H2S) biosynthesis through which it plays multifunctional roles in the regulation of cellular energetics, redox status, DNA methylation, and protein modifcation. Inactivating mutations in CBS contribute to the pathogenesis of the autosomal recessive disease CBS-defcient homocystinuria. Recent studies demonstrating that CBS promotes colon and ovarian cancer growth in preclinical models highlight a newly identifed oncogenic role for CBS. On the contrary, tumor-suppressive efects of CBS have been reported in other cancer types, suggesting context-dependent roles of CBS in tumor growth and progression. Here, we review the physiological functions of CBS, summarize the complexities regarding CBS research in oncology, and discuss the potential of CBS and its key metabolites, including homocysteine and H2S, as potential biomarkers for cancer diagnosis or therapeutic targets for cancer treatment.
    [Show full text]