Estrogen Receptor Β Is a Novel Target in Acute Myeloid Leukemia

Author Manuscript Published OnlineFirst on August 23, 2017; DOI: 10.1158/1535-7163.MCT-17-0292 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Estrogen receptor β is a novel target in acute myeloid leukemia

Sarah-Grace Rota1,2, Alessia Roma1,2, Iulia Dude2; Christina Ma2; Robert Stevens3, Janet MacEachern3, Joanna Graczyk3, Shaundrei Mabriel G. Espiritu4, Praveen N. Rao2, Mark D. Minden5, Elena Kreinin2, David A. Hess6, Andrew C. Doxey4, and Paul A. Spagnuolo1,2*

1 Department of Food Science, University of Guelph, 50 Stone Rd. Guelph Ontario, Canada. N1G2W1

2 School of Pharmacy, University of Waterloo, 10A Victoria Street, Kitchener Ontario, Canada. N2G 1C5

3Grand River Cancer Centre. 835 King St W, Kitchener, Ontario, Canada. N2G 1G3.

4Department of Biology, University of Waterloo, 200 University Ave. W. Waterloo, Ontario, Canada. N2L 3G1

5Princess Margaret Cancer Center, Ontario Cancer Institute, 610 University Ave, Toronto ON, M5G 2M9, Canada;

6University of Western Ontario, Robarts Research Institute, 100 Perth Drive, London, ON N6A 5K8

* Correspondence: Paul A. Spagnuolo, Ph.D. Associate Professor Department of Food Science, University of Guelph Guelph, Ontario, N1G 2W1 Phone: (519) 824-4120 x53732

Key points: 1) ERβ expression predicted sensitivity to diosmetin in primary AML patient samples and cell lines; 2) In vivo studies demonstrated that ERβ targeting imparts selective anti- AML and anti-LSC activity

Funding: This work was supported by grants to PAS by the Stem Cell Network, Leukemia and Lymphoma Society of Canada, University of Waterloo, Ontario Research Fund and the Canadian Foundation of Innovation, to Rao PPN by the Natural Sciences and Engineering Research Council of Canada (NSERC) and the Early Researcher Award and to ACD by NSERC.

Running Title: ERβ in AML

Downloaded from mct.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 23, 2017; DOI: 10.1158/1535-7163.MCT-17-0292 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Abstract

Acute myeloid leukemia (AML) is a devastating disease characterized by poor patient outcome and suboptimal chemotherapeutics. Here, a high throughput screen identified diosmetin, a citrus flavonoid, with anti-AML activity. Diosmetin imparted selective toxicity against leukemia and leukemia stem cells in vitro and in vivo with no effect on normal hematopoietic

stem cells. Mechanistically, we demonstrated that diosmetin targets estrogen receptor (ER) β.

ERβ expression conferred cell sensitivity, as patient-derived AML cells with high levels of ERβ were sensitive whereas cells with low ERβ were insensitive to diosmetin. Knockdown of ERβ

confirmed resistance whereas overexpression enhanced sensitivity to diosmetin; which was

demonstrated to be mediated by ROS signaling. In summary, these studies highlight targeting of

ERβ with diosmetin as a potential novel therapeutic strategy for the treatment of AML.

Introduction

Acute myeloid leukemia (AML) is an aggressive hematological malignancy with poor patient outcome characterized clinically by an accumulation of immature myeloid cells in the bone marrow(1). Current induction therapy fails to achieve long-term remission and the five

year-survival rates for adult patients (i.e., >60 years old) is less than 10%(2). New therapeutics to

improve AML patient outcomes are clearly needed.

To identify novel and selective anti-AML drugs, we created a unique library of food-

derived bioactive compounds and screened this library against TEX leukemia cells, an AML and

surrogate leukemia stem cell (LSC) line(3) used successfully in high throughput screens(4-6).

Through this approach, we identified diosmetin as a novel drug with anti-AML activity.

Mechanistically, we show that diosmetin binds to estrogen receptor (ER)  and demonstrate that

ERβ is functionally important to diosmetin’s activity.

Methods

Cell Culture

Cell lines from the ATCC were cultured in 5% CO2 at 37°C. They were obtained in 2012 and no authentication was performed thereafter. Additional details can be found in supplementary materials. U2OS human osteosarcoma cells with epitope (FLAG)-tagged ERβ under the doxycycline promoter (hereafter denoted U2OS-ERβ) were grown in RPMI and were generated by Monroe et al (2003)(7). Primary human AML samples were provided by Drs. Mark

Minden (Princess Margaret Cancer Center), Joanna Graczyk, Janet MacEachern, and Robert

Stevens (Grand River Cancer Centre) and were cultured in IMDM, supplemented with 20% FCS

and antibiotics. These cells were isolated from the peripheral blood of consenting AML patients

who had at least 80% malignant cells among the mononuclear cells. Normal hematopoietic stem

cells (HSCs) were purchased from Stem Cell Technologies (Vancouver, BC) or provided by Dr.

David Hess (Western University). The collection and use of human tissue for this study was approved by institutional ethics review boards (University Health Network, Toronto, ON,

Canada, Western University, and University of Waterloo, Waterloo, Ontario).

Cell growth and viability

Cell growth and viability was measured using the 3-(4,5-dimethylthiazol-2-yl)-5-(3-

carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt (MTS) reduction assay

(Promega, Madison, WI) or Annexin V and propidium iodide (ANN/PI) staining (Biovision,

Mountainview, CA), according to the manufacturer’s protocol and as previously described(6, 8).

Colony formation assays (CFAs) were performed, as previously described(9) and as outlined in

the supplementary methods.

Chemical screen and ROS measurements

Food-derived bioactive molecules were obtained from Chengdu Biopurify

Phytochemicals Ltd. (n=288, Sichuan, China) and screened as outlined in the supplementary

methods. ROS measurements were conducted as detailed in supplementary methods(10).

Target prediction using structural bioinformatics and molecular docking

Starting with diosmetin, we searched the Protein Data Bank (PDB) for protein structures

capable of binding diosmetin-like ligands. We identified an initial set of 9 structures co-bound

with four diosmetin-like ligands: biochanin A (QSO), genistein (GEN), kaempherol (KMP), and

luteolin (LU2). This set was expanded to include proteins with similar binding site compositions

using the PoSSuM (Pocket Similarity Search using Multi-Sketches) tool with default

parameters(11, 12). This search yielded a final set of 92 proteins with predicted diosmetin-

binding potential. The Database for Annotation, Visualization and Integrated Discovery

(DAVID) tool(13) was then used to summarize and identify overrepresented functions common

to this group of potential target proteins.

The molecular docking experiments were conducted using the computational software

Discovery Studio (DS), Structure-Based-Design program from BIOVIA/Accelrys Inc. (San

Diego, USA), as previously described(14, 15). Briefly, diosmetin was built using the small

molecules module in DS. The crystal structures of ERα (pdb id: 1X7R) and ERβ (pdb id: 1X7J)

with genistein bound was obtained from PDB. The protein was prepared using the

macromolecules module in DS. Ligand binding site was defined by selecting a 12 Å radius

sphere using genistein crystal structure after which it was deleted. Then molecular docking was

performed using the receptor-ligand interactions module in DS. The CDOCKER alogorithm was

used to find the most appropriate binding modes of diosmetin using CHARMm force field. The

docked poses obtained were ranked based on the CDOCKER energies and CDOCKER

interactions energies in kcal/mol.

mRNA and protein detection

Quantitative PCR (qPCR) was performed as previously described(9) in triplicate using an

ABI 7900 Sequence Detection System (Applied Biosystems) with 5ng of RNA equivalent

cDNA, SYBR Green PCR Master mix (Applied Biosystems, Foster City, CA, USA), and 300nM

of ER-specific primers (forward ERβ: 5’-TGCTCAATTCCAGTATGTACC-3’, reverse ERβ: 5’-

ATGAGGTGAGTGTTTGAGAG-3’, forward ERα: 5’-CATTATGGAGTCTGGTCCTG-3’, reverse ERα: 5’-TTCGTATCCCACCTTTCATC-3’). Relative mRNA expression was determined using the ΔΔCT method as previously described18, and efficiency was calculated using LinRegPCR analysis software.20,21Western blotting was performed as previously described(6) and as outlined in the supplementary methods.

Estrogen receptor reporter assay

A Human Estrogen Receptors Reporter Assay Panel (Indigo Biosciences, State College,

PA) was performed according to manufacturer’s protocol. Briefly, to investigate agonist activity, reporter HeLa cells were seeded in white 96-well plates and immediately dosed with increasing concentrations of diosmetin. To investigate antagonist activity, reporter cells were plated as above but17--estradiol (E2), a known ERα and ERβ agonist, was added at the constant

submaximal (EC75) concentrations. Following a 24-hour incubation period, a luciferase detection reagent was added to the wells and light emission was quantified using a luminometer.

RNAi knockdown of ERβ

Lentiviral infections were performed as described(9). Briefly, OCI-AML2 cells (5 x 106)

were re-suspended and incubated overnight at 37oC in media (6.5mL) containing protamine

sulfate (5 μg/mL) and 1mL of virus cocktail (which contains a puromycin antibiotic resistance

gene and the short hairpin RNA (shRNA) sequence). Next, the virus was removed by

centrifugation and the cells were washed and resuspended in fresh media containing puromycin

(1μg/mL). Following puromycin selection, live cells were plated for viability assays. The shRNA

coding sequences (Sigma Chemical) were: ERβ (TRCN0000003328) shRNA clone 16 5’-

CCGGGATGCTTTGGTTTGGGTGATTCTCGAGAATCACCCAAACCAAAGCATCTTTTT-

3’, (TRCN0000003327) ERβ shRNA clone 17 5’-

CCGGCCTTAATTCTCCTTCCTCCTACTCGAGTAGGAGGAAGGAGAATTAAGGTTTTT-

3’; and a TRC scramble control.

In vivo models

NOD/SCID gamma mice (NSG; Jackson Laboratory, Bar Harbor, ME or University of

Western Ontario) were used for xenograft and engraftment assays as previously described(5, 6,

16) and detailed in the supplementary methods section. For engraftment experiments, human

myeloid cells (hCD45+/CD33+) were detected in femoral bone marrow by flow cytometry

following a 6-week engraftment period. All animal studies were carried out according to the

regulations of the Canadian Council on Animal Care and with the approval of the University of

Waterloo, Animal Care Committee.

Statistical Analysis

Unless otherwise stated, in vitro results are presented as mean ± SD whereas in vivo

results are presented as mean ± SEM. Data were analyzed with GraphPad Prism 4.0 (GraphPad

Software, USA) using one-way ANOVA with Tukey’s post hoc analysis for between group

comparisons or standard student’s t-tests where appropriate and Mann-Whitney t-tests for animal

experiments. p<0.05 was accepted as being statistically significant.

Results

A screen for novel anti-AML compounds identifies diosmetin

To identify novel anti-AML compounds, we screened our unique in-house library against

TEX cells using the MTS assay. Compound screens against TEX cells have identified novel

anti-AML targets(4-6) and drugs that have been evaluated in human clinical trials(17). In our

screen, the flavonoid diosmetin was one of 2 compounds that imparted the greatest reduction in

TEX cell viability (Fig 1A and supplementary Fig 1A; arrow indicates diosmetin; insert: chemical structure). Diosmetin’s ability to reduce growth and proliferation was also shown in a

panel of AML cell lines using the MTS assay following a 96h incubation period (Fig 1B; EC50

values: 3-15µM). We next assessed diosmetin’s effects on functionally defined subsets of primitive human AML and normal hematopoietic cell populations. Treatment of TEX cells with

diosmetin at sublethal doses reduced their ability to engraft in the marrow of immune-deficient mice (Figure 1C; U11=1; p<0.01). Adding diosmetin into the culture medium had no effect on the clonogenic growth of normal hematopoietic cells (Fig. 1D; n=3) but reduced clonogenic growth in a subset of AML patient cells (Fig 1E, n=8, t11=6.5; p<0.001; Fig 1F n=4; supplementary table

1-2 for patient characteristics). Taken together, diosmetin selectively targets primitive leukemia

cells.

Estrogen receptors are the predicted molecular target

In primary and validation screens, 5 of the 12 most potent compounds were structurally

similar (Fig 2A). So to investigate the cellular target, a unique structural bioinformatics

approach was used (Fig 2A) to mine existing protein structural data for known interactions

involving these compounds. We first screened the protein data bank (PDB) for crystallographic

or NMR-derived protein structures co-bound with diosmetin and these structurally similar

compounds. This resulted in an initial set of nine structures, which were subsequently used as

templates to find additional proteins of similar ligand binding site composition using the Pocket

Similarity Search using Multi-Sketches (PoSSuM) tool. This analysis yielded a final list of 92

predicted diosmetin-binding proteins, 52 of which were human. To summarize this list of

potential targets, the DAVID tool was used, which reports statistically overrepresented

functional or protein family categories in gene lists. The analysis predicted nuclear hormone

receptors, specifically estrogen-receptors, as a dominant class of diosmetin-binding proteins (Fig

2B).

Molecular docking was next utilized to explore binding interactions of diosmetin in the

ligand binding domain of human ERα and ERβ receptors(14). The Structure-Based-Design

program predicted diosmetin to bind with greater affinity and stability to ERβ than ERα (ERα and ERβ stability: -22.73kcal/mol vs. -24.03kcal/mol, respectively; affinity: -37.94kcal/mol vs. -

39.05 kcal/mol, respectively; Fig 2C). As a final bioinformatics approach, we interrogated

publically available AML databases(18, 19) to determine whether there is a population of AML

patients who may respond to an ERβ-specific small molecule. Interestingly, within these

databases we identified a sub-population of AML patient cells that overexpress ERβ while

underexpressing ERα, further suggesting a potential clinical utility for targeting ERβ

(Supplementary Figs 2-3).

Diosmetin is an ERβ agonist

To determine if ERβ is diosmetin’s molecular target, we first performed ER agonist and

antagonist luciferase reporter assays. In the agonist assay, ER reporter cells were treated with

diosmetin and luminescence increased in a dose-dependent manner for ERβ (Fig 3A; F5,12=162;

p<0.0001) and ERα (Fig 3B; F5,12=245.9; p<0.0001). Given the similarity of the ERα and ERβ

ligand binding domain, dual receptor binding was not surprising. Nonetheless, diosmetin clearly

demonstrated preferential binding toward ERβ (Fig 3C; F5,30=53.75; p<0.0001). In the

antagonist assay, reporter cells were co-incubated with the ERα and ERβ ligand, 17-estradiol

(E2), and diosmetin for 24 hours. E2-induced luminescence was not affected demonstrating that

diosmetin does not act as an ERα or β antagonist (Fig 3D&E). ER agonist activity at 24h had no

effect on the viability of these luciferase promoter cells (Supplementary Fig 4).

Patient-derived AML cell sensitivity is linked to ERβ expression

Since diosmetin preferentially bound to ERβ, we next determined whether ERβ

expression predicted the differential response (i.e., diosmetin sensitive or insensitive) observed in

the clonogenic growth assays (Fig 1D-E). Interestingly, ERβ levels were elevated in diosmetin-

sensitive primary cells (Fig 4A). In contrast, primary cells (normal and patient-derived) that were insensitive to diosmetin had no-to-low ERβ but elevated ERα mRNA levels (Fig 4B) suggesting

that ERβ/ERα ratios confer patient-derived AML cell sensitivity to diosmetin. In addition, AML

cell lines sensitive to diosmetin (Fig 1B) express ERβ protein, as measured by immunoblotting

(Supplementary Figure 5).

ERβ is functionally important to diosmetin’s activity

To further define the role of ERβ in diosmetin-induced cell death, we utilized doxycycline inducible flag-tagged ERβ U2OS cells (U2OS-ERβ cells)(7). Treatment with

100ng/mL doxycycline for 24h increased ERβ 4-fold compared to vehicle control treated cells

(Fig 5A). In the absence of doxycycline (i.e., no ERβ) these cells were insensitive to diosmetin

(Fig 5B); however, when treated with 100ng/mL doxycycline (i.e., increased ERβ expression),

diosmetin imparted toxicity (Fig 5B; F1,8=24.44; p<0.01). Since diosmetin is a flavonoid and

flavonoids generate reactive oxygen species (ROS)(20-22), we confirmed that diosmetin’s

activity is characterized by increases in intracellular ROS, as measured by DCF-DA and flow

cytometry (Supplementary Fig 6). Consistent with this observation, ROS increased in cells

treated with doxycycline and diosmetin but not with diosmetin alone (Fig 5C; t4=5.254; p<0.01).

To further confirm its functional importance, we generated ERβ knockdown OCI-AML2 cells using two independent shRNA vectors (denoted 16 and 17); knockdown was confirmed by immunoblotting (Fig 5D). ERβ knockdown cells are resistant to diosmetin-induced death compared to scramble controls (Fig 5E; F4,18=8.604, p<0.001). Moreover, consistent with our

observation that ERβ activation is characterized by increased ROS, diosmetin increased ROS in a dose-dependent manner in transduced controls but had little effect in the resistant knockdown

cells (Fig 5F; F4,18=5.152; p<0.01). Together, this data demonstrates that ERβ is functionally

important to diosmetin’s activity.

ERβ targeting imparts anti-AML activity in vivo

Given the cytotoxicity of diosmetin in AML cells, we performed additional experiments

in vivo in a functionally defined subset of primitive human AML and normal hematopoietic cell

populations. First, normal HSCs were injected into the tail vein of NSG mice and after 1 week,

intraperitoneal injections of diosmetin (50mg /kg/every other day) were administered for 6

weeks. Treatment with the ERβ agonist had no effect on the presence of normal human myeloid

cells (hCD45+/CD33+) in mouse bone marrow compared to vehicle control, as measured by flow

cytometry (Fig 6A).

Primary engraftment was next assessed where patient-derived AML cells were injected

into the tail vein of NSG mice and, after 1 week, intraperitoneal injections of diosmetin

(50mg/kg/every other day) or vehicle control were administered for 6 weeks. Human myeloid

cells were then measured in mouse bone marrow. Treatment with diosmetin significantly

reduced LSC primary engraftment compared to vehicle control treated mice (Fig 6B; U=21;

p<0.05). In secondary transplant assays, an equal number of viable leukemia cells from control

or diosmetin-treated mice were injected into the tail vein of NSG mice (n=5/group) and, after 6-

weeks, engraftment was assessed in mouse bone marrow. Human cells isolated from mice treated

with the diosmetin had significantly reduced LSC secondary engraftment compared to vehicle

control treated mice (Fig 6C; U=2; p<0.05). Analysis of complete blood counts, bilirubin,

serological markers (i.e., alkaline phosphatase or creatine kinase, which are markers of kidney

function or liver function, respectively) and mouse body weights showed no difference between

control and diosmetin treatment groups (Fig 6 C-H). Together, this demonstrates the selective

activity of the ERβ agonist diosmetin against primitive leukemia cells.

Discussion

A high throughput screen identified diosmetin as a novel anti-AML compound and

validation studies determined that this flavonoid was capable of inducing selective toxicity in

leukemia and leukemia stem cells with no effect on normal cells in vitro and in vivo. We

subsequently demonstrated that selective AML toxicity was related to ERβ targeting highlighting

this estrogen receptor subtype as a novel anti-AML target.

ER isoforms, ERα and ERβ, are encoded by genes at different chromosomal locations

and perform different cellular roles(23). While ERα activation results in cell proliferation; ERβ

targeting results in cell senescence or death(24, 25). ERβ activation induced death in prostate(25), colon(26), and breast(26, 27) cancer tissue and loss of ERβ in mice results in

prostate hyperplasia and myeloproliferative disease (e.g., increased myeloid cell numbers in bone

marrow, blood, spleen and lymph nodes) resembling chronic lymphocytic leukemia (CLL) (28,

29). In this study, ERβ targeting with diosmetin induced selective toxicity that was dependent on

AML cell ERβ expression. Patient-derived AML cells with elevated ERβ mRNA were diosmetin

sensitive whereas insensitive cells had low-to-non-detectable ERβ levels. Moreover, ERβ

knockdown conferred resistance whereas overexpression, using doxycycline-inducible cells,

resulted in enhanced cell death following ERβ targeting with diosmetin. Indeed, ERβ ligand

activation or transfection of ER negative cell lines with ERβ results in reduced proliferation,

induction of apoptosis and/or inhibition of tumor formation in prostate(30), colon(31),

lymphoma(32, 33), and breast(26, 27) cancer models. Thus, ERβ targeting exerts anti-

proliferative effects and is demonstrated here, for the first time, as a novel anti-AML/LSC target.

High ratios of ERβ/ERα conferred AML cell sensitivity. Interrogation of publically available AML patient genetic databases identified an AML patient subpopulation with this phenotype confirming the potential prognostic significance of ERβ and clinical utility of ERβ drug targeting. Similarly, elevated ERβ levels were observed in CLL patients compared to normal samples(34). Low ERβ/ERα ratios were observed in breast tumors compared to matched

normal adjacent tissue(35) and the presence of ERβ (ratio 1.0-1.5) resulted in favorable patient

response to chemotherapy(36). Down regulation and degradation of ERβ by Pescadillo (PES1)

resulted in lower ERβ/ERα ratios and breast cancer progression in mice; elevated ERα and PES1

coupled with downregulated ERβ was also found in breast cancer patients(37). Moreover, ER

hypermethylation in AML is a common clinical characteristic associated with improved patient

outcome. In one study ERα was specifically tested; however, no differentiation was made

between ERα and ERβ in the other two studies(38, 39),(40). ERβ methylation (i.e., decreased

ERβ activity) is observed in colon or breast tumors(41, 42). It is important to note; however, that

while receptor expression is critical, other factors influence the cellular response to ER

interactions with estrogen hormones or selective estrogen receptor modulators (SERMS; e.g.,

tamoxifen, raloxifene)(43). Indeed, tamoxifen is an ER antagonist in breast, but a weak ER

agonist in bone tissue whereas raloxifene is a strong agonist in bone but a weak agonist in breast

tissue(44). While future studies are needed to further define the role of ERs in myeloid cells and

leukemia pathogenesis, our study points to the direct anti-tumorigenic and prognostic potential of

ERβ in AML.

Although a wide spectrum of ERβ agonists are under clinical development (AUS-131,

fosfestrol, KB-9520, sulfestrol)(42, 45) none are FDA approved or have been tested clinically in

AML. Diosmetin is widely available and when provided orally as diosmin at 10mg/kg, (the

aglycone prodrug form), diosmetin reached a Cmax of 126mM within 2h with a half-life of 26-

48h(46). In addition, administration of 500mg of daflon, a common product used for chronic

venous insufficiency that contains 450mg of diosmin, results in 0.17-1.32mM diosmetin plasma

concentrations(47, 48) with minimal reported toxicities(49, 50). Our study provides a clear

rationale for preclinical testing and/or potential clinical evaluation of ER-based therapies for

AML, specifically focusing on potent ERβ agonists such as diosmetin. Similar to our anti-AML

in vivo observations, treatment with ERβ agonists has shown anti-tumor effects in

lymphoma(33), prostate(30) and breast(51, 52) cancer models. Tamoxifen also enhanced

cytarabine’s anti-tumor activity in AML xenografts(53). However, tamoxifen decreased bone

marrow cell numbers and increased myeloid progenitor apoptosis in healthy mice(53), which

was convincingly shown to be ERα mediated (i.e., effects not shown in ERβ-/- mice). This

emphasizes the need for caution when applying SERM therapies, as these agents exert tissue-

and context-dependent activities and both ERα and ERβ are found on hematopoietic

progenitors(54, 55),(56). Hence, clinical evaluation, specifically within the hematopoietic

compartment, of potent and selective ERβ agonists is required to translate these observations into

patient benefits. Nonetheless, our work demonstrates a potential clinical benefit of ERβ agonists

in AML therapy, particularly in a sub-population of patients who present with favorably high

ERβ/ERα ratios.

In conclusion, ERβ expression conferred AML cell sensitivity to the ERβ agonist,

diosmetin, highlighting diosmetin as a novel drug and ERβ as a potential novel anti-AML target.

Acknowledgements: We are grateful to Drs. John E. Dick and David G. Monroe for their generous gift of TEX cells and doxycycline-inducible ERβ cells, respectively; Rose Hurren, Jean

Flanagan, Martin Ryan and Nancy Gibson for assisting with the engraftment assays; and the practitioners at the Cancer Centres of Grand River and Princess Margaret for their assistance in procuring primary patient samples. This work was supported by grants to PAS by the Stem Cell

Network, Leukemia and Lymphoma Society of Canada, University of Waterloo, Ontario

Research Fund and the Canadian Foundation of Innovation, to Rao PPN by the Natural Sciences and Engineering Research Council of Canada (NSERC) and the Early Researcher Award and to

ACD by NSERC.

References

1. Shipley JL, Butera JN. Acute myelogenous leukemia. Experimental hematology. 2009;37(6):649-58. Epub 2009/05/26. 2. Lowenberg B, Downing JR, Burnett A. Acute myeloid leukemia. The New England journal of medicine. 1999;341(14):1051-62. Epub 1999/09/30. 3. Warner JK, Wang JC, Takenaka K, Doulatov S, McKenzie JL, Harrington L, et al. Direct evidence for cooperating genetic events in the leukemic transformation of normal human hematopoietic cells. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, UK. 2005;19(10):1794-805. Epub 2005/08/12. 4. McDermott SP, Eppert K, Notta F, Isaac M, Datti A, Al-Awar R, et al. A small molecule screening strategy with validation on human leukemia stem cells uncovers the therapeutic efficacy of kinetin riboside. Blood. 2012;119(5):1200-7. Epub 2011/12/14. 5. Skrtic M, Sriskanthadevan S, Jhas B, Gebbia M, Wang X, Wang Z, et al. Inhibition of mitochondrial translation as a therapeutic strategy for human acute myeloid leukemia. Cancer cell. 2011;20(5):674-88. Epub 2011/11/19. 6. Lee EA, Angka L, Rota SG, Hanlon T, Mitchell A, Hurren R, et al. Targeting Mitochondria with Avocatin B Induces Selective Leukemia Cell Death. Cancer research. 2015;75(12):2478-88. Epub 2015/06/17. 7. Monroe DG, Getz BJ, Johnsen SA, Riggs BL, Khosla S, Spelsberg TC. Estrogen receptor isoform-specific regulation of endogenous gene expression in human osteoblastic cell lines expressing either ERalpha or ERbeta. Journal of cellular biochemistry. 2003;90(2):315-26. Epub 2003/09/25. 8. Tcheng M, Samudio I, Lee EA, Minden MD, Spagnuolo PA. The mitochondria target drug avocatin B synergizes with induction chemotherapeutics to induce leukemia cell death. Leukemia & lymphoma. 2017;58(4):986-8. Epub 2016/08/26. 9. Spagnuolo PA, Hurren R, Gronda M, Maclean N, Datti A, Basheer A, et al. Inhibition of intracellular dipeptidyl peptidases 8 and 9 enhances parthenolide's anti-leukemic activity. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, UK. 2013. Epub 2013/01/16.

10. Angka L, Lee EA, Rota SG, Hanlon T, Sukhai M, Minden M, et al. Glucopsychosine increases cytosolic calcium to induce calpain-mediated apoptosis of acute myeloid leukemia cells. Cancer letters. 2014. Epub 2014/03/19. 11. Ito J, Tabei Y, Shimizu K, Tsuda K, Tomii K. PoSSuM: a database of similar protein- ligand binding and putative pockets. Nucleic acids research. 2012;40(Database issue):D541-8. Epub 2011/12/03. 12. Ito J, Ikeda K, Yamada K, Mizuguchi K, Tomii K. PoSSuM v.2.0: data update and a new function for investigating ligand analogs and target proteins of small-molecule drugs. Nucleic acids research. 2015;43(Database issue):D392-8. Epub 2014/11/19. 13. Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature protocols. 2009;4(1):44-57. Epub 2009/01/10. 14. Manas ES, Xu ZB, Unwalla RJ, Somers WS. Understanding the selectivity of genistein for human estrogen receptor-beta using X-ray crystallography and computational methods. Structure. 2004;12(12):2197-207. Epub 2004/12/04. 15. Rao PP, Mohamed T, Teckwani K, Tin G. Curcumin Binding to Beta Amyloid: A Computational Study. Chemical biology & drug design. 2015;86(4):813-20. Epub 2015/03/18. 16. Sachlos E, Risueno RM, Laronde S, Shapovalova Z, Lee JH, Russell J, et al. Identification of drugs including a dopamine receptor antagonist that selectively target cancer stem cells. Cell. 2012;149(6):1284-97. Epub 2012/05/29. 17. Reed GA, Schiller GJ, Kambhampati S, Tallman MS, Douer D, Minden MD, et al. A Phase 1 study of intravenous infusions of tigecycline in patients with acute myeloid leukemia. Cancer medicine. 2016. Epub 2016/10/14. 18. Valk PJ, Verhaak RG, Beijen MA, Erpelinck CA, Barjesteh van Waalwijk van Doorn- Khosrovani S, Boer JM, et al. Prognostically useful gene-expression profiles in acute myeloid leukemia. The New England journal of medicine. 2004;350(16):1617-28. Epub 2004/04/16. 19. Haferlach T, Kohlmann A, Wieczorek L, Basso G, Kronnie GT, Bene MC, et al. Clinical utility of microarray-based gene expression profiling in the diagnosis and subclassification of leukemia: report from the International Microarray Innovations in Leukemia Study Group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010;28(15):2529-37. Epub 2010/04/22. 20. Wang IK, Lin-Shiau SY, Lin JK. Induction of apoptosis by apigenin and related flavonoids through cytochrome c release and activation of caspase-9 and caspase-3 in leukaemia HL-60 cells. European journal of cancer. 1999;35(10):1517-25. Epub 2000/02/16. 21. Bishayee K, Ghosh S, Mukherjee A, Sadhukhan R, Mondal J, Khuda-Bukhsh AR. Quercetin induces cytochrome-c release and ROS accumulation to promote apoptosis and arrest the cell cycle in G2/M, in cervical carcinoma: signal cascade and drug-DNA interaction. Cell proliferation. 2013;46(2):153-63. Epub 2013/03/21. 22. Andueza A, Garcia-Garzon A, Ruiz de Galarreta M, Ansorena E, Iraburu MJ, Lopez- Zabalza MJ, et al. Oxidation pathways underlying the pro-oxidant effects of apigenin. Free radical biology & medicine. 2015;87:169-80. Epub 2015/06/30. 23. Liang J, Xie Q, Li P, Zhong X, Chen Y. Mitochondrial estrogen receptor beta inhibits cell apoptosis via interaction with Bad in a ligand-independent manner. Molecular and cellular biochemistry. 2015;401(1-2):71-86. Epub 2014/12/20.

24. Heldring N, Pike A, Andersson S, Matthews J, Cheng G, Hartman J, et al. Estrogen receptors: how do they signal and what are their targets. Physiological reviews. 2007;87(3):905- 31. Epub 2007/07/07. 25. McPherson SJ, Hussain S, Balanathan P, Hedwards SL, Niranjan B, Grant M, et al. Estrogen receptor-beta activated apoptosis in benign hyperplasia and cancer of the prostate is androgen independent and TNFalpha mediated. Proceedings of the National Academy of Sciences of the United States of America. 2010;107(7):3123-8. Epub 2010/02/06. 26. Hartman J, Lindberg K, Morani A, Inzunza J, Strom A, Gustafsson JA. Estrogen receptor beta inhibits angiogenesis and growth of T47D breast cancer xenografts. Cancer research. 2006;66(23):11207-13. Epub 2006/12/06. 27. Strom A, Hartman J, Foster JS, Kietz S, Wimalasena J, Gustafsson JA. Estrogen receptor beta inhibits 17beta-estradiol-stimulated proliferation of the breast cancer cell line T47D. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(6):1566-71. Epub 2004/01/28. 28. Shim GJ, Wang L, Andersson S, Nagy N, Kis LL, Zhang Q, et al. Disruption of the estrogen receptor beta gene in mice causes myeloproliferative disease resembling chronic myeloid leukemia with lymphoid blast crisis. Proceedings of the National Academy of Sciences of the United States of America. 2003;100(11):6694-9. Epub 2003/05/13. 29. Imamov O, Morani A, Shim GJ, Omoto Y, Thulin-Andersson C, Warner M, et al. Estrogen receptor beta regulates epithelial cellular differentiation in the mouse ventral prostate. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(25):9375-80. Epub 2004/06/10. 30. Cheng J, Lee EJ, Madison LD, Lazennec G. Expression of estrogen receptor beta in prostate carcinoma cells inhibits invasion and proliferation and triggers apoptosis. FEBS letters. 2004;566(1-3):169-72. Epub 2004/05/19. 31. Hartman J, Edvardsson K, Lindberg K, Zhao C, Williams C, Strom A, et al. Tumor repressive functions of estrogen receptor beta in SW480 colon cancer cells. Cancer research. 2009;69(15):6100-6. Epub 2009/07/16. 32. Yakimchuk K, Hasni MS, Guan J, Chao MP, Sander B, Okret S. Inhibition of lymphoma vascularization and dissemination by estrogen receptor beta agonists. Blood. 2014;123(13):2054- 61. Epub 2014/01/29. 33. Yakimchuk K, Iravani M, Hasni MS, Rhonnstad P, Nilsson S, Jondal M, et al. Effect of ligand-activated estrogen receptor beta on lymphoma growth in vitro and in vivo. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, UK. 2011;25(7):1103-10. Epub 2011/04/20. 34. Yakimchuk K, Norin S, Kimby E, Hagglund H, Warner M, Gustafsson JA. Up-regulated estrogen receptor beta2 in chronic lymphocytic leukemia. Leukemia & lymphoma. 2012;53(1):139-44. Epub 2011/07/20. 35. Leygue E, Dotzlaw H, Watson PH, Murphy LC. Altered estrogen receptor alpha and beta messenger RNA expression during human breast tumorigenesis. Cancer research. 1998;58(15):3197-201. Epub 1998/08/12. 36. Madeira M, Mattar A, Logullo AF, Soares FA, Gebrim LH. Estrogen receptor alpha/beta ratio and estrogen receptor beta as predictors of endocrine therapy responsiveness-a randomized neoadjuvant trial comparison between anastrozole and tamoxifen for the treatment of postmenopausal breast cancer. BMC cancer. 2013;13:425. Epub 2013/09/21.

37. Cheng L, Li J, Han Y, Lin J, Niu C, Zhou Z, et al. PES1 promotes breast cancer by differentially regulating ERalpha and ERbeta. The Journal of clinical investigation. 2012;122(8):2857-70. Epub 2012/07/24. 38. Toyota M, Kopecky KJ, Toyota MO, Jair KW, Willman CL, Issa JP. Methylation profiling in acute myeloid leukemia. Blood. 2001;97(9):2823-9. Epub 2001/04/21. 39. Niijima T, Matsumura Y, Katayama Y, Morinaga O, Ike N. [A study on tumor of the bladder: clinical and prognostic studies on 426 cases (author's transl)]. Nihon Hinyokika Gakkai zasshi The japanese journal of urology. 1976;67(12):1057-63. Epub 1976/12/01. 40. Issa JP, Zehnbauer BA, Civin CI, Collector MI, Sharkis SJ, Davidson NE, et al. The estrogen receptor CpG island is methylated in most hematopoietic neoplasms. Cancer research. 1996;56(5):973-77. Epub 1996/03/01. 41. Zhao C, Lam EW, Sunters A, Enmark E, De Bella MT, Coombes RC, et al. Expression of estrogen receptor beta isoforms in normal breast epithelial cells and breast cancer: regulation by methylation. Oncogene. 2003;22(48):7600-6. Epub 2003/10/25. 42. Rody A, Holtrich U, Solbach C, Kourtis K, von Minckwitz G, Engels K, et al. Methylation of estrogen receptor beta promoter correlates with loss of ER-beta expression in mammary carcinoma and is an early indication marker in premalignant lesions. Endocrine- related cancer. 2005;12(4):903-16. Epub 2005/12/03. 43. Deroo BJ, Korach KS. Estrogen receptors and human disease. The Journal of clinical investigation. 2006;116(3):561-70. Epub 2006/03/03. 44. Riggs BL, Hartmann LC. Selective estrogen-receptor modulators -- mechanisms of action and application to clinical practice. The New England journal of medicine. 2003;348(7):618-29. Epub 2003/02/14. 45. NIH. 2015; Available from: https://clinicaltrials.gov/ct2/home. 46. Cova D, De Angelis L, Giavarini F, Palladini G, Perego R. Pharmacokinetics and metabolism of oral diosmin in healthy volunteers. International journal of clinical pharmacology, therapy, and toxicology. 1992;30(1):29-33. Epub 1992/01/01. 47. Campanero MA, Escolar M, Perez G, Garcia-Quetglas E, Sadaba B, Azanza JR. Simultaneous determination of diosmin and diosmetin in human plasma by ion trap liquid chromatography-atmospheric pressure chemical ionization tandem mass spectrometry: Application to a clinical pharmacokinetic study. Journal of pharmaceutical and biomedical analysis. 2010;51(4):875-81. Epub 2009/10/06. 48. Spanakis M, Kasmas S, Niopas I. Simultaneous determination of the flavonoid aglycones diosmetin and hesperetin in human plasma and urine by a validated GC/MS method: in vivo metabolic reduction of diosmetin to hesperetin. Biomedical chromatography : BMC. 2009;23(2):124-31. Epub 2008/10/14. 49. Thanapongsathorn W, Vajrabukka T. Clinical trial of oral diosmin (Daflon) in the treatment of hemorrhoids. Diseases of the colon and rectum. 1992;35(11):1085-8. Epub 1992/11/01. 50. Pecking AP, Fevrier B, Wargon C, Pillion G. Efficacy of Daflon 500 mg in the treatment of lymphedema (secondary to conventional therapy of breast cancer). Angiology. 1997;48(1):93- 8. Epub 1997/01/01. 51. Lazennec G, Bresson D, Lucas A, Chauveau C, Vignon F. ER beta inhibits proliferation and invasion of breast cancer cells. Endocrinology. 2001;142(9):4120-30. Epub 2001/08/23. 52. Treeck O, Pfeiler G, Horn F, Federhofer B, Houlihan H, Vollmer A, et al. Novel estrogen receptor beta transcript variants identified in human breast cancer cells affect cell growth and

apoptosis of COS-1 cells. Molecular and cellular endocrinology. 2007;264(1-2):50-60. Epub 2006/11/11. 53. Sanchez-Aguilera A, Arranz L, Martin-Perez D, Garcia-Garcia A, Stavropoulou V, Kubovcakova L, et al. Estrogen signaling selectively induces apoptosis of hematopoietic progenitors and myeloid neoplasms without harming steady-state hematopoiesis. Cell stem cell. 2014;15(6):791-804. Epub 2014/12/07. 54. Thurmond TS, Murante FG, Staples JE, Silverstone AE, Korach KS, Gasiewicz TA. Role of estrogen receptor alpha in hematopoietic stem cell development and B lymphocyte maturation in the male mouse. Endocrinology. 2000;141(7):2309-18. Epub 2000/06/30. 55. Igarashi H, Kouro T, Yokota T, Comp PC, Kincade PW. Age and stage dependency of estrogen receptor expression by lymphocyte precursors. Proceedings of the National Academy of Sciences of the United States of America. 2001;98(26):15131-6. Epub 2001/12/26. 56. Nakada D, Oguro H, Levi BP, Ryan N, Kitano A, Saitoh Y, et al. Oestrogen increases haematopoietic stem-cell self-renewal in females and during pregnancy. Nature. 2014;505(7484):555-8. Epub 2014/01/24.

Figure Legends

Figure 1. Diosmetin is identified as a novel anti-AML agent. (A) A screen of an in-house

library identified diosmetin (arrow) as the most potent at reducing TEX cell viability, an AML

and surrogate LSC cell line (Insert: diosmetin structure). Viability was assessed using the MTS

assay. (B) Diosmetin’s ability to reduce growth and proliferation was tested in a panel of AML

cell lines after 96h using the MTS assay. Data presented as an average of 3 independent

experiments. (C) TEX cells were treated with suboptimal doses of diosmetin (i.e., 10µM for 24 hours) or a vehicle control and then live cells were injected via tail vein into NSG mice

(n=7/group). After 6 weeks, human AML cells (hCD45+/CD33+) in mouse bone marrow were

detected by flow cytometry. Data presented as % human cells in individual mouse bone marrow

relative to control. (D-E) Normal hematopoietic cells (n=3) or patient-derived AML cells

(D:n=8; E: n=4) were cultured with diosmetin for 7-14 days and clonogenic growth was

assessed by enumerating colonies as described in the methods section. Data are presented as %

clonogenic growth compared to control ± SEM, similar to previously described(5).

**p<0.01,*** p<0.001.

Figure 2. Estrogen receptor β is diosmetin’s predicted molecular target. (A) A flow chart

outlining the structural bioinformatics approach for prediction and analysis of diosmetin-binding

proteins from the PDB. (B) Initial list of human target proteins identified in the PDB as co-bound

with diosmetin-like compounds. (C) Molecular docking experiments using the receptor-ligand interactions module (Discovery Studio software) were performed to explore the binding interactions between diosmetin and human ERα and ERβ receptors.

Figure 3. Diosmetin is an ER agonist and ERβ is functionally important to its activity. ERβ

agonist activity was tested by adding increasing concentrations of diosmetin to HeLa cells

containing (A) ERβ or (B) ERα under the control of a luciferase reporter. (C) Comparison of

luminescence at individual diosmetin concentrations highlights diosmetin’s preferentially ERβ

binding. (D-E) Diosmetin was tested as an ERβ antagonist by adding increasing concentrations

of diosmetin in the presence of estradiol (E2) to HeLa cells containing ERα or ERβ under the

control of a luciferase reporter. Data are presented as relative luciferase intensity (RLU)

compared to vehicle control treated cells. Data presented as an average of 3 independent

experiments. *p<0.05; **p<0.01,*** p<0.001.

Figure 4. Estrogen receptorβ expression confers patient-derived AML cell sensitivity to

diosmetin. ERα and ERβ gene expression were measured by qPCR data in primary AML

samples sensitive (A; n=5) and insensitive (B; n=6) to diosmetin. Data presented as relative

mRNA expression normalized to GAPDH. (Normal hematopoietic cells denoted as N; primary insensitive AML samples denoted as IN).

Figure 5: Estrogen receptorβ is diosmetin’s molecular target. (A) U2OS-ERβ human osteosarcoma cells, with ERβ under a doxycycline inducible promoter, were incubated in the presence or absence of doxycycline (100ng/mL) for 72 hours. Expression of ERβ was measured in the presence of increasing doxycycline concentrations (100-500ng/mL) using Western blotting. Experiments were performed three times and representative blots are shown. (B)

Viability of U2OS-ERβ cells were measured in the presence or absence of diosmetin with or without doxycycline (100ng/mL) for 72 hours using the ANN/PI assay. Data presented as an average of 3 independent experiments and as percent viable (ANN-/PI-) relative to zero controls

(C) ROS was measured in U2OS-ERβ cells treated with diosmetin (24h at 10µM) or a vehicle control in the presence of doxycycline (100ng/mL), using DCF-DA staining as outlined in the methods section. (D) ERβ (gene: ESR2) gene silencing was achieved by lentiviral mediated transduction and confirmed by immunoblotting. Densitometry calculated as outlined in the methods section. (E) Viability of ERβ knockdown cells was tested with increasing concentrations of diosmetin by the ANN/PI assay. Data presented as an average of 3 independent experiments. (F) ROS was measured in knockdown cells using DCF-DA staining, as outlined in the methods section. Data presented as an average of 3 independent experiments. *p<0.05;

**p<0.01,*** p<0.001.

Figure 6. Diosmetin targets leukemia stem cells in vivo. (A) Normal CD34+ cells from cord blood were injected via tail vein into NSG mice (n=5/group). After one week, mice were treated

intraperitoneally with 50mg/kg/every other day with diosmetin. After 6 weeks, normal human myeloid cells (hCD45+/CD33+) in mouse bone marrow were detected by flow cytometry. (B)

Patient-derived AML cells were injected via tail vein into NSG mice (n=10/group). After one week, mice were treated intraperitoneally with 50mg/kg/every other day with diosmetin. After 6 weeks, human AML cells (hCD45+/CD33+) in mouse bone marrow were detected by flow cytometry. (C) Secondary engraftments were performed, as detailed in the methods section, where equal numbers of viable human leukemia cells that were collected from mice injected with patient-derived AML cells treated with a control or diosmetin were injected into the tail vein of

NSG mice (n=5/group). After 6 weeks, human AML cells (hCD45+/CD33+) in mouse bone marrow were detected by flow cytometry. For all experiments, data were normalized to vehicle treated controls and presented as percent engraftment. (D-I) Compared to control treated animals, diosmetin treated mice had no changes in body weights, white blood cells, red blood cells, bilirubin levels or serum levels of (B; middle) alkaline phosphatase (marker or kidney function) or creatine kinase (marker of liver damage). *p<0.05.

A B C

D E

Downloaded from mct.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Figure 1 Author Manuscript Published OnlineFirst on August 23, 2017; DOI: 10.1158/1535-7163.MCT-17-0292 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Downloaded from mct.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Figure 2 Author Manuscript Published OnlineFirst on August 23, 2017; DOI: 10.1158/1535-7163.MCT-17-0292 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

A B C

*** *** ***

*** *** *** *** *** *** ***

D E

Downloaded from mct.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Figure 3 Author Manuscript Published OnlineFirst on August 23, 2017; DOI: 10.1158/1535-7163.MCT-17-0292 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

A B

Downloaded from mct.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Figure 4 Author Manuscript Published OnlineFirst on August 23, 2017; DOI: 10.1158/1535-7163.MCT-17-0292 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

A B C ***

D E F

** ** ** ** ** **

Downloaded from mct.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Figure 5 Author Manuscript Published OnlineFirst on August 23, 2017; DOI: 10.1158/1535-7163.MCT-17-0292 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

A B C

D E F

G H I

Downloaded from mct.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Figure 6 Author Manuscript Published OnlineFirst on August 23, 2017; DOI: 10.1158/1535-7163.MCT-17-0292 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Estrogen receptor β is a novel target in acute myeloid leukemia

Sarah-Grace Rota, Alessia Roma, Iulia Dude, et al.

Mol Cancer Ther Published OnlineFirst August 23, 2017.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-17-0292

Supplementary Access the most recent supplemental material at: Material http://mct.aacrjournals.org/content/suppl/2017/08/23/1535-7163.MCT-17-0292.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/early/2017/08/23/1535-7163.MCT-17-0292. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.