Product Data Sheet
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Prenatal Diagnosis of Sex Chromosome Mosaicism with Two Marker Chromosomes in Three Cell Lines and a Review of the Literature
MOLECULAR MEDICINE REPORTS 19: 1791-1796, 2019 Prenatal diagnosis of sex chromosome mosaicism with two marker chromosomes in three cell lines and a review of the literature JIANLI ZHENG1, XIAOYU YANG2, HAIYAN LU1, YONGJUAN GUAN1, FANGFANG YANG1, MENGJUN XU1, MIN LI1, XIUQING JI3, YAN WANG3, PING HU3 and YUN ZHOU1 1Department of Prenatal Diagnosis, Laboratory of Clinical Genetics, Maternity and Child Health Care Hospital, Yancheng, Jiangsu 224001; 2Department of Clinical Reproductive Medicine, State Key Laboratory of Reproductive Medicine, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029; 3Department of Prenatal Diagnosis, State Key Laboratory of Reproductive Medicine, Obstetrics and Gynecology Hospital Affiliated to Nanjing Medical University, Nanjing, Jiangsu 210004, P.R. China Received March 31, 2018; Accepted November 21, 2018 DOI: 10.3892/mmr.2018.9798 Abstract. The present study described the diagnosis of a fetus identifying the karyotype, identifying the origin of the marker with sex chromosome mosaicism in three cell lines and two chromosome and preparing effective genetic counseling. marker chromosomes. A 24-year-old woman underwent amniocentesis at 21 weeks and 4 days of gestation due to Introduction noninvasive prenatal testing identifying that the fetus had sex chromosome abnormalities. Amniotic cell culture revealed a Abnormalities involving sex chromosomes account for karyotype of 45,X[13]/46,X,+mar1[6]/46,X,+mar2[9], and approximately 0.5% of live births. Individuals with mosaic prenatal ultrasound was unremarkable. The woman underwent structural aberrations of the X and Y chromosomes exhibit repeat amniocentesis at 23 weeks and 4 days of gestation for complicated and variable phenotypes. The phenotypes of molecular detection. -
The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid
The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid Leukemia Cells Supported Only by Exogenous Cytokines Is Associated with a Patient Subset with Adverse Outcome Annette K. Brenner, Elise Aasebø, Maria Hernandez-Valladares, Frode Selheim, Frode Berven, Ida-Sofie Grønningsæter, Sushma Bartaula-Brevik and Øystein Bruserud Supplementary Material S2 of S31 Table S1. Detailed information about the 68 AML patients included in the study. # of blasts Viability Proliferation Cytokine Viable cells Change in ID Gender Age Etiology FAB Cytogenetics Mutations CD34 Colonies (109/L) (%) 48 h (cpm) secretion (106) 5 weeks phenotype 1 M 42 de novo 241 M2 normal Flt3 pos 31.0 3848 low 0.24 7 yes 2 M 82 MF 12.4 M2 t(9;22) wt pos 81.6 74,686 low 1.43 969 yes 3 F 49 CML/relapse 149 M2 complex n.d. pos 26.2 3472 low 0.08 n.d. no 4 M 33 de novo 62.0 M2 normal wt pos 67.5 6206 low 0.08 6.5 no 5 M 71 relapse 91.0 M4 normal NPM1 pos 63.5 21,331 low 0.17 n.d. yes 6 M 83 de novo 109 M1 n.d. wt pos 19.1 8764 low 1.65 693 no 7 F 77 MDS 26.4 M1 normal wt pos 89.4 53,799 high 3.43 2746 no 8 M 46 de novo 26.9 M1 normal NPM1 n.d. n.d. 3472 low 1.56 n.d. no 9 M 68 MF 50.8 M4 normal D835 pos 69.4 1640 low 0.08 n.d. -
Genetics of Azoospermia
International Journal of Molecular Sciences Review Genetics of Azoospermia Francesca Cioppi , Viktoria Rosta and Csilla Krausz * Department of Biochemical, Experimental and Clinical Sciences “Mario Serio”, University of Florence, 50139 Florence, Italy; francesca.cioppi@unifi.it (F.C.); viktoria.rosta@unifi.it (V.R.) * Correspondence: csilla.krausz@unifi.it Abstract: Azoospermia affects 1% of men, and it can be due to: (i) hypothalamic-pituitary dysfunction, (ii) primary quantitative spermatogenic disturbances, (iii) urogenital duct obstruction. Known genetic factors contribute to all these categories, and genetic testing is part of the routine diagnostic workup of azoospermic men. The diagnostic yield of genetic tests in azoospermia is different in the different etiological categories, with the highest in Congenital Bilateral Absence of Vas Deferens (90%) and the lowest in Non-Obstructive Azoospermia (NOA) due to primary testicular failure (~30%). Whole- Exome Sequencing allowed the discovery of an increasing number of monogenic defects of NOA with a current list of 38 candidate genes. These genes are of potential clinical relevance for future gene panel-based screening. We classified these genes according to the associated-testicular histology underlying the NOA phenotype. The validation and the discovery of novel NOA genes will radically improve patient management. Interestingly, approximately 37% of candidate genes are shared in human male and female gonadal failure, implying that genetic counselling should be extended also to female family members of NOA patients. Keywords: azoospermia; infertility; genetics; exome; NGS; NOA; Klinefelter syndrome; Y chromosome microdeletions; CBAVD; congenital hypogonadotropic hypogonadism Citation: Cioppi, F.; Rosta, V.; Krausz, C. Genetics of Azoospermia. 1. Introduction Int. J. Mol. Sci. -
Product Description SALSA MLPA Probemix P360-B2 Y-Chromosome
MRC-Holland ® Product Description version B2-01; Issued 20 March 2019 MLPA Product Description SALSA ® MLPA ® Probemix P360-B2 Y-Chromosome Microdeletions To be used with the MLPA General Protocol. Version B2. As compared to version B1, one probe length has been adjusted . For complete product history see page 14. Catalogue numbers: • P360-025R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 25 reactions. • P360-050R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 50 reactions. • P360-100R: SALSA MLPA Probemix P360 Y-Chromosome Microdeletions, 100 reactions. To be used in combination with a SALSA MLPA reagent kit, available for various number of reactions. MLPA reagent kits are either provided with FAM or Cy5.0 dye-labelled PCR primer, suitable for Applied Biosystems and Beckman capillary sequencers, respectively (see www.mlpa.com ). This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix is intended to quantify genes or chromosomal regions in which the occurrence of copy number changes is not yet well-established and the relationship between genotype and phenotype is not yet clear. Interpretation of results can be complicated. MRC-Holland recommends thoroughly screening any available literature. Certificate of Analysis: Information regarding storage conditions, quality tests, and a sample electropherogram from the current sales lot is available at www.mlpa.com . Precautions and warnings: For professional use only. Always consult the most recent product description AND the MLPA General Protocol before use: www.mlpa.com . It is the responsibility of the user to be aware of the latest scientific knowledge of the application before drawing any conclusions from findings generated with this product. -
The Role of Microtubule-Associated Protein 1S (MAP1S) in Regulating Autophagy
University of Manchester The role of microtubule-associated protein 1S (MAP1S) in regulating autophagy in the heart A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health 2019 Yulia Suciati Kohar School of Medical Sciences Division of Cardiovascular Sciences TABLE OF CONTENTS List of Figures ............................................................................................................... 6 List of Tables ............................................................................................................... 10 Abbreviations ............................................................................................................. 12 Abstract ...................................................................................................................... 16 Declaration ................................................................................................................. 18 Copyright statement .................................................................................................. 19 Acknowledgments ...................................................................................................... 20 1. INTRODUCTION .................................................................................................. 22 1.1. The Global Burden of Cardiovascular Disease ........................................... 22 1.2. Coronary artery disease and myocardial infarction................................... 24 1.3. -
Molecular Pathogenesis of a Malformation Syndrome Associated with a Pericentric Chromosome 2 Inversion
UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE BIOLOGIA ANIMAL Molecular pathogenesis of a malformation syndrome associated with a pericentric chromosome 2 inversion Manuela Pinto Cardoso Mestrado em Biologia Humana e do Ambiente Dissertação orientada por: Doutor Dezsö David Doutora Deodália Dias 2017 ACKNOWLEDGEMENTS I would like to say “thank you!” to all the people that contributed in some way to this thesis. First and foremost, I would like to express my deepest gratitude to my supervisor, Dr. Dezsö David, for giving me the opportunity to work in his research group and for everything he taught me. Without his mentorship I would have never learned so much. I am grateful for Prof. Deodália Dias’s encouragement and support in all these years that I have been under her wings. I would like to extent my thanks to everyone at the National Health Institute Dr. Ricardo Jorge, for their continuous help in all stages of this thesis. To the team at Harvard Medical School, thank you for the technical assistance, and in special Dr. Cynthia Morton and Dr. Michael Talkowski. I am also grateful to Dr. Rui Gonçalves and Dr. João Freixo, who accompanied this case study and shared their medical knowledge. Of course, I am grateful for the family members for their involvement in this study. To my lab mates, a shout-out to them all! I really hold them dear for their help and the many laughs we shared every day. Thank you Mariana for being there literally since day one and for playing the role of a more mature counterpart. -
Male Infertility G.R
Guidelines on Male Infertility G.R. Dohle, A. Jungwirth, G. Colpi, A. Giwercman, T. Diemer, T.B. Hargreave © European Association of Urology 2008 TABLE OF CONTENTS PAGE 1. INTRODUCTION 6 1.1 Definition 1.2 Epidemiology and aetiology 6 1.3 Prognostic factors 6 1.4 Recommendations 7 1.5 References 7 2. INVESTIGATIONS 7 2.1 Semen analysis 7 2.1.1 Frequency of semen analysis 7 2.2 Recommendations 8 2.3 References 8 3. PRIMARY SPERMATOGENIC FAILURE 8 3.1 Definition 8 3.2 Aetiology 8 3.3 History and physical examination 8 3.4 Investigations 9 3.4.1 Semen analysis 9 3.4.2 Hormonal determinations 9 3.4.3 Testicular biopsy 9 3.5 Treatment 9 3.6 Conclusions 10 3.7 Recommendations 10 3.8 References 10 4. GENETIC DISORDERS IN INFERTILITY 14 4.1 Introduction 14 4.2 Chromosomal abnormalities 14 4.2.1 Sperm chromosomal abnormalities 14 4.2.2 Sex chromosome abnormalities (Klinefelter’s syndrome and variants [mosaicism] 14 4.2.3 Autosomal abnormalities 14 4.2.4 Translocations 15 4.3 Genetic defects 15 4.3.1 X-linked genetic disorders and male fertility 15 4.3.2 Kallmann’s syndrome 15 4.3.3 Androgen insensitivity: Reifenstein’s syndrome 15 4.3.4 Other X-disorders 15 4.3.5 X-linked disorders not associated with male infertility 15 4.4. Y genes and male infertility 15 4.4.1 Introduction 15 4.4.2 Clinical implications of Y microdeletions 16 4.4.2.1 Testing for Y microdeletions 16 4.4.2.2 Recommendations 16 4.4.3 Autosomal defects with severe phenotypic abnormalities as well as infertility 16 4.5 Cystic fibrosis mutations and male infertility 17 4.6 Unilateral or bilateral absence/abnormality of the vas and renal anomalies 17 4.7 Other single gene disorders 18 4.8 Unknown genetic disorders 18 4.9 Genetic and DNA abnormalities in sperm 18 4.10 Genetic counselling and ICSI 18 4.11 Conclusions 19 4.12 Recommendations 19 4.13 References 19 2 UPDATE MARCH 2007 5. -
MAP1S Antibody Rabbit Polyclonal Antibody Catalog # ALS16470
10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 MAP1S Antibody Rabbit Polyclonal Antibody Catalog # ALS16470 Specification MAP1S Antibody - Product Information Application IHC Primary Accession Q66K74 Reactivity Human Host Rabbit Clonality Polyclonal Calculated MW 112kDa KDa MAP1S Antibody - Additional Information Gene ID 55201 Human Kidney: Formalin-Fixed, Paraffin-Embedded (FFPE) Other Names Microtubule-associated protein 1S, MAP-1S, BPY2-interacting protein 1, Microtubule-associated protein 8, Variable charge Y chromosome 2-interacting protein 1, VCY2-interacting protein 1, VCY2IP-1, MAP1S heavy chain, MAP1S light chain, MAP1S, BPY2IP1, C19orf5, MAP8, VCY2IP1 Target/Specificity Human MAP1S Reconstitution & Storage Human Testis: Formalin-Fixed, Aliquot and store at -20°C or -80°C. Avoid Paraffin-Embedded (FFPE) freeze-thaw cycles. Precautions MAP1S Antibody - Background MAP1S Antibody is for research use only and not for use in diagnostic or therapeutic Microtubule-associated protein that mediates procedures. aggregation of mitochondria resulting in cell death and genomic destruction (MAGD). Plays a role in anchoring the microtubule organizing MAP1S Antibody - Protein Information center to the centrosomes. Binds to DNA. Plays a role in apoptosis. Involved in the formation of microtubule bundles (By similarity). Name MAP1S Synonyms BPY2IP1, C19orf5, MAP8, MAP1S Antibody - References VCY2IP1 Wong E.Y.,et al.Biol. Reprod. Function 70:775-784(2004). Microtubule-associated protein that Ding J.,et al.Biochem. Biophys. Res. Commun. mediates aggregation of mitochondria 339:172-179(2006). resulting in cell death and genomic Ota T.,et al.Nat. Genet. 36:40-45(2004). Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 destruction (MAGD). -
Genetic Dissection of the AZF Regions of the Human Y Chromosome: Thriller Or Filler for Male (In)Fertility?
Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2010, Article ID 936569, 18 pages doi:10.1155/2010/936569 Review Article Genetic Dissection of the AZF Regions of the Human Y Chromosome: Thriller or Filler for Male (In)fertility? Paulo Navarro-Costa,1, 2, 3 Carlos E. Plancha,2 and Joao˜ Gonc¸alves1 1 Departamento de Gen´etica, Instituto Nacional de Saude´ Dr. Ricardo Jorge, 1649-016 Lisboa, Portugal 2 Faculdade de Medicina de Lisboa, Instituto de Histologia e Biologia do Desenvolvimento, 1649-028 Lisboa, Portugal 3 Faculdade de Medicina de Lisboa, Instituto de Medicina Molecular, 1649-028 Lisboa, Portugal Correspondence should be addressed to Paulo Navarro-Costa, [email protected] Received 17 December 2009; Accepted 23 April 2010 Academic Editor: Brynn Levy Copyright © 2010 Paulo Navarro-Costa et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The azoospermia factor (AZF) regions consist of three genetic domains in the long arm of the human Y chromosome referred to as AZFa, AZFb and AZFc. These are of importance for male fertility since they are home to genes required for spermatogenesis. In this paper a comprehensive analysis of AZF structure and gene content will be undertaken. Particular care will be given to the molecular mechanisms underlying the spermatogenic impairment phenotypes associated to AZF deletions. Analysis of the 14 different AZF genes or gene families argues for the existence of functional asymmetries between the determinants; while some are prominent players in spermatogenesis, others seem to modulate more subtly the program. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name basic charge, Y-linked, 2C Gene Symbol BPY2C Organism Human Gene Summary This gene is located in the nonrecombining portion of the Y chromosome and expressed specifically in testis. The encoded protein interacts with ubiquitin protein ligase E3A and may be involved in male germ cell development and male infertility. Three nearly identical copies of this gene exist on chromosome Y; two copies are part of a palindromic region. This record represents the more telomeric copy within the palindrome. Gene Aliases BPY2, VCY2, VCY2C RefSeq Accession No. NC_000024.9, NG_004755.2, NT_011903.12 UniGene ID Not Available Ensembl Gene ID ENSG00000185894 Entrez Gene ID 442868 Assay Information Unique Assay ID qHsaCIP0039936 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000564093, ENST00000397843, ENST00000532993, ENST00000356641, ENST00000371933, ENST00000252512, ENST00000433566, ENST00000434536, ENST00000589596, ENST00000506447, ENST00000511820, ENST00000430049, ENST00000325971, ENST00000602732, ENST00000331070, ENST00000382585, ENST00000602770, ENST00000382392, ENST00000382287, ENST00000602680, ENST00000434067, ENST00000409568, ENST00000328828, ENST00000376454, ENST00000376451, ENST00000266037, ENST00000550890, ENST00000590278 Amplicon Context Sequence AGCGTCATCATTAGGCTTTTTATCTGGTCTCAGGTAAATGGAACAATATCACCTG GGTGTTGAGCCAATTATACAGTGTAGTATTATTTGAAGGCTGGGCATAGTCAGAA GTGTCAGCTTTATGCTGGTCCAGTGATACAATATAATCTTGGTGATGTGACAGCC -
And Y-Linked Ampliconic Genes in Human Populations
HIGHLIGHTED ARTICLE | INVESTIGATION Dynamic Copy Number Evolution of X- and Y-Linked Ampliconic Genes in Human Populations Elise A. Lucotte,1 Laurits Skov, Jacob Malte Jensen, Moisès Coll Macià, Kasper Munch, and Mikkel H. Schierup Bioinformatic Research Center, Aarhus University, 8000, Denmark ORCID ID: 0000-0001-8442-2654 (E.A.L.) ABSTRACT Ampliconic genes are multicopy, with the majority found on sex chromosomes and enriched for testis-expressed genes. While ampliconic genes have been associated with the emergence of hybrid incompatibilities, we know little about their copy number distribution and their turnover in human populations. Here, we explore the evolution of human X- and Y-linked ampliconic genes by investigating copy number variation (CNV) and coding variation between populations using the Simons Genome Diversity Project. We develop a method to assess CNVs using the read depth on modified X and Y chromosome targets containing only one repetition of each ampliconic gene. Our results reveal extensive standing variation in copy number both within and between human populations for several ampliconic genes. For the Y chromosome, we can infer multiple independent amplifications and losses of these gene copies even within closely related Y haplogroups, that diversified , 50,000 years ago. Moreover, X- and Y-linked ampliconic genes seem to have a faster amplification dynamic than autosomal multicopy genes. Looking at expression data from another study, we also find that X- and Y-linked ampliconic genes with extensive CNV are significantly more expressed than genes with no CNV during meiotic sex chromosome inactivation (for both X and Y) and postmeiotic sex chromosome repression (for the Y chromosome only). -
Evolution of Y Chromosome Ampliconic Genes in Great Apes
The Pennsylvania State University The Graduate School EVOLUTION OF Y CHROMOSOME AMPLICONIC GENES IN GREAT APES A Dissertation in Bioinformatics and Genomics by Rahulsimham Vegesna © 2020 Rahulsimham Vegesna Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2020 The dissertation of Rahulsimham Vegesna was reviewed and approved by the following: Paul Medvedev Associate Professor of Computer Science & Engineering Associate Professor of Biochemistry & Molecular Biology Dissertation Co-Adviser Co-Chair of Committee Kateryna D. Makova Pentz Professor of Biology Dissertation Co-Adviser Co-Chair of Committee Michael DeGiorgio Associate Professor of Biology and Statistics Wansheng Liu Professor of Animal Genomics George H. Perry Chair, Intercollege Graduate Degree Program in Bioinformatics and Genomics Associate Professor of Anthropology and Biology ii ABSTRACT In addition to the sex-determining gene SRY and several other single-copy genes, the human Y chromosome harbors nine multi-copy gene families which are expressed exclusively in testis. In humans, these gene families are important for spermatogenesis and their loss is observed in patients suffering from infertility. However, only five of the nine ampliconic gene families are found across great apes, while others are missing or pseudogenized in some species. My research goal is to understand the evolution of the Y ampliconic gene families in humans and in non-human great ape species. The specific objectives I addressed in this dissertation are 1. To test whether Y ampliconic gene expression levels depend on their copy number and whether there is a gene dosage compensation to counteract the ampliconic gene copy number variation observed in humans.