Molecular Phylogeny of Obligate Fish Parasites of the Family Cymothoidae

Home , Aega (genus), Cymothoida, Epactionotus, Glossanodon, Labracoglossa, Neoscombrops

Mar Biol (2017) 164:105 DOI 10.1007/s00227-017-3138-5

ORIGINAL PAPER

Molecular phylogeny of obligate fsh parasites of the family Cymothoidae (Isopoda, Crustacea): evolution of the attachment mode to host fsh and the habitat shift from saline water to freshwater

Hiroki Hata1 · Atsushi Sogabe2 · Shinya Tada1 · Ryohei Nishimoto3 · Reina Nakano3 · Nobuhiko Kohya3 · Hirohiko Takeshima4 · Ryota Kawanishi5

Received: 20 December 2016 / Accepted: 31 March 2017 © Springer-Verlag Berlin Heidelberg 2017

Abstract In host–parasite coevolution, parasite innova- an abdominal burrower clade, and cymothoid clades that tions including the acquisition of new habitats and novel are closer to the base of Cymothoidae than those initially traits can trigger evolutionary breakthroughs and enhance analysed. We found that the basal clade of Cymothoidae parasite diversifcation via accumulation of new hosts. All was Elthusa sacciger, which is parasitic in the opercular species of the family Cymothoidae are obligate fsh para- cavity of synaphobranchid eels. This result suggests that sites, attaching to exterior body surfaces of fsh, the buccal cymothoids may have originated in deep seas, subsequently or opercular cavities, or burrowing into abdominal muscle expanded to shallow seas, and then to brackish and/or tissue. In the present study, we constructed a molecular freshwater, by shifting host species. Invasion of freshwater phylogeny of 27 cymothoid species that parasitise 38 fsh habitats has occurred at least twice; freshwater abdominal species, combined with 2 prior cymothoid datasets, based muscle burrowers living on armoured catfsh constitute a on the sequences of mitochondrial 16S rRNA and COI clade allied to E. sacciger. The ancestral host attachment genes. We explored the evolution of the host attachment site, based on our dataset, was the opercular cavity, fol- mode, and the habitat shift from saline water to freshwa- lowed (sequentially) by buccal colonisation and attachment ter. Our evolutionary trees include two freshwater clades, to the external body.

Responsible Editor: T. Reusch. Introduction Reviewed by C. Boyko and an undisclosed expert. During host–parasite coevolution, parasite innovation Electronic supplementary material The online version of this (acquisition of new traits and colonisation of new habitats) article (doi:10.1007/s00227-017-3138-5) contains supplementary can enhance parasite diversifcation via accumulation of material, which is available to authorized users. new host species (Zietara and Lumme 2002; Ricklefs et al. * Hiroki Hata 2014). The family Cymothoidae is a diverse group of Isop- [email protected]‑u.ac.jp oda containing 366 species of 42 genera to the best of our knowledge (Table S1), all of which are obligate parasites 1 Graduate School of Science and Engineering, Ehime University, 2‑5 Bunkyo, Matsuyama, Ehime 790‑8577, Japan on fsh, feeding on blood, mucus, and/or tissue (Adlard and Lester 1995; Horton and Okamura 2003; Bruce and 2 Department of Biology, Faculty of Agriculture and Life Science, Hirosaki University, 1‑1 Bunkyo, Hirosaki, Aomori Schotte 2008). Cymothoids have been identifed in marine 036‑8560, Japan actinopterygian fsh (notably Perciformes, Clupeiformes, 3 Department of Biology, Faculty of Science, Ehime Beloniformes, and Tetraodontiformes) and certain elasmo- University, 2‑5 Bunkyo, Matsuyama, Ehime 790‑8577, Japan branchs (Brusca 1981; Smit et al. 2014). Cymothoids have 4 Research Institute for Humanity and Nature, 457‑4 expanded their distribution to include freshwater fsh, being Motoyama, Kamigamo, Kita‑ku, Kyoto 603‑8047, Japan currently parasitic on freshwater actinopterygians including 5 Faculty of Environmental Earth Science, Hokkaido Characiformes, Siluriformes, and Cypriniformes. 310 spe- University, N10W5 Kita‑ku, Sapporo 060‑0810, Japan cies (85%) of 32 genera (76%) are marine, 33 species (9%)

1 3 105 Page 2 of 15 Mar Biol (2017) 164:105 of 9 genera (21%) are fresh water inhabitants. At least 27 gene sequences differ by a maximum of 5 of the 317 bases species in nine genera (including Riggia, Braga, Asotana, among four species in three genera (Ceratothoa italica and Paracymothoa) inhabit Amazonia in South America. [EF455804–6], C. collaris [EF455807], Nerocila bivit- Several species of the genus Ichthyoxenos live in freshwa- tata [EF455810], and Anilocra physodes [EF455808–9]). ter habitats of eastern and south-eastern Asia, and central Such extreme similarity differs from the fndings of another Africa (Brusca 1981; Tsai and Dai 1999). study (Jones et al. 2008), which also sequenced 16S rRNA Cymothoids parasitise the exterior bodies of fsh gene, and we found that the sequences in question were (including the fns), or the buccal or opercular cavities, or those of some members of the genus Ceratothoa. It may burrow into abdominal muscular tissue to create capsules be that Ketmaier et al. (2008) included these inappropriate (with small openings) in the abdominal cavity (Brusca sequences in their analyses. 1981; Bruce 1990; Smit et al. 2014). Each cymothoid spe- In the present study, we newly collected two freshwater cies exhibits a specifc attachment mode to its host fsh, and cymothoid species; these were a burrowing parasite (Arty- is morphologically specialised in this context (Bruce 1986, stone sp.) from an armoured catfsh (Epactionotus yasi) 1987, 1990). Seven genera (e.g. Anilocra, Nerocila, and living in the Iguazu river, South America, and a buccal Renocila), 16 genera (e.g. Ceratothoa and Cymothoa), 17 parasite (Ichthyoxenos tanganyikae) from a cichlid (Simo- genera (e.g. Elthusa and Ryukyua), four genera (e.g. Ich- chromis diagramma) of Lake Tanganyika. We also col- thyoxenos and Artystone) are known as parasites on fsh lected samples of ten genera of marine cymothoids from body surface, in the buccal cavity, opercular cavity, bur- the buccal and opercular cavities, and the body surfaces, of rowing into abdominal cavity, respectively (Table S1). Host their various host fsh (ranging from anguilliformes to per- specifcity and host range vary among cymothoid species. ciformes) living in various depths (See Table 1). We sought In general, however, cymothoids that attach to external to describe the evolution within the family Cymothoidae. surfaces of fsh exhibit wider host ranges than other spe- In particular, we explored how the organisms acquired cies, sometimes straddling fsh orders. On the other hand, novel host attachment modes, shifted such modes, and cymothoids that burrow into the abdominal muscles of fsh expanded into freshwater habitats. We also sought to are highly species-specifc, being parasitic on only one or resolve taxonomic confusion within the family. We con- several species within a single family (Tsai and Dai 1999; structed phylogenetic trees based on mitochondrial 16S Thatcher 2006; Yamano et al. 2011). Cymothoids that are rRNA and COI sequences; we used the families Aegidae, parasitic in the buccal and opercular cavities exhibit inter- Bopyridae, Cirolanidae, Corallanidae, and Sphaeromatidae mediate width of host range (Bruce 1986; Hadfeld et al. as outgroups. 2015). We used a molecular phylogenetic approach to explore cymothoid evolution in terms of the acquisition of attach- Materials and methods ment modes, shifts in such modes, habitat expansion (par- ticularly to freshwater), and acquisition of new host fsh. Sample collection Brusca (1981) suggested that external surface attachment was an ancestral trait, citing morphological, zoogeographic, We collected 29 cymothoid species from 59 species of host and ecological data. Jones et al. (2008) suggested that buc- fsh, as well as 2 species of Aegidae, 1 species of Coralla- cal- or opercular cavity-dwelling were ancestral in nature, nidae, and 1 species of Sphaeromatidae (Table 1). 27 spe- and that external attachment had evolved on several occa- cies of 12 genera cymothoids were newly collected for sions; mitochondrial 16S rRNA sequence data were used molecular phylogeny. In total, 15 genera of all the 43 genera to support these conclusions. However, molecular methods of Cymothoidae are included in this study. Host fsh were have never been used to analyse cymothoids that burrow identifed by reference to Nakabo (2013). We distinguished under the host epidermis to occupy the abdominal cav- four cymothoid attachment modes (Brusca 1981; Smit et al. ity, and few data are available on freshwater cymothoids. 2014): (1) buccal-dwelling, where both males and females Thus, it remains unclear whether several cymothoids inde- live inside the buccal cavities of host fsh; (2) opercular cav- pendently acquired the ability to live in freshwater, or ity-dwelling, where females attach to a specifc site within whether a single group acquired that competence and has the opercular cavity and their body form is distinctly asym- subsequently diversifed. Although there have been several metrical, refecting the shape of the host operculum; (3) molecular phylogenetic studies on the family Cymothoi- external body-attaching, where the parasites attach to the dae, the reference frameworks are unclear; ambiguous external body surface (including the fns) of the hosts, being sequences were included in previous phylogenies based cryptically coloured in contrast to the pale colour of para- on 16S rRNA and COI sequences (Ketmaier et al. 2008), sites exhibiting other attachment modes; and (4) abdominal- and were stored in GenBank as below. The 16S rRNA burrowing, where parasites become buried under the host

1 3 Mar Biol (2017) 164:105 Page 3 of 15 105

Table 1 The species studied, with their classifcation, attachment modes, host species (and the classifcation thereof), the depth ranges of the host fsh, and DDBJ/EMBL/GenBank accession numbers of the sequences studied

Family Species Attachment Host species Order of host Family of Depth 16S No. COI No. Sampling locality site fsh host fsh (m)

Cymothoi- Anilocra Body Ostorhinchus Perciformes Apogonidae 15–30 EF422800 – Moreton Bay, Qld, dae apogonae surface fasciatus AUS (GB) Anilocra Body Etrumeus Clupeiformes Clupeidae –125 – LC160309 Uwa Sea, Ehime, clupei surface micropus JPN Anilocra Body Sardinella Clupeiformes Clupeidae 5– LC159426 LC159540 Moji, Fukuoka, clupei surface zunasi JPN Anilocra lon- Body Diagramma Perciformes Haemulidae – EF422789,97 – Lizard Is., Qld, gicauda surface labiosum AUS (GB) Anilocra Body Scolopsis Perciformes Nemipteri- 1–25 EF422790,806 – Lizard Is., Qld, nemipteri surface bilineata dae AUS (GB) Anilocra Body Symphodus Perciformes Labridae 1–50 – EF455817 Italy (GB) physodes surface tinca Anilocra Body Chromis Perciformes Pomacentri- 5–25 EF432778 – Heron Is., Qld, pomacentri surface nitida dae AUS (GB) Anilocra Body Prionurus Perciformes Acanthuridae 2–20 LC159427 LC159541 Kushimoto, prionuri surface scalprum Wakayama, JPN Anilocra sp. unknown unknown – – – EF422795 – Lizard Is., Qld, AUS (GB) Anilocra sp. 1 Body Pterocaesio Perciformes Caesionidae –10 LC159428 LC159542 Iou Is., surface marri Kagoshima, JPN Artystone sp. Abdominal Epactionotus Siluriformes Loricariidae – LC159429 LC159543 Iguazu River cavity yasi Ceratothoa Buccal Labracoglossa Perciformes Kyphosidae – LC159430 LC159544 Niijima Is., Tokyo, arimae cavity argentiven- JPN tris Ceratothoa Buccal Dentex gib- Perciformes Sparidae 20– LC159438 LC159551 West Africa collaris cavity bosus 220 Ceratothoa Buccal Lithognathus Perciformes Sparidae 10–20 – EF455816 Tyrrhenian Sea collaris cavity mormyrus (GB) Ceratothoa Buccal Lithognathus Perciformes Sparidae 10–20 – EF455813 Tyrrhenian Sea italica cavity mormyrus (GB) Ceratothoa Buccal Sparus aurata Perciformes Sparidae 1–30 – GQ240266 Adriatic Sea (GB) oestroides cavity Ceratothoa Buccal Dicentrarchus Perciformes Moronidae 10– – GQ240276 Adriatic Sea (GB) oestroides cavity labrax 100 Ceratothoa Buccal Rexea pro- Perciformes Gempylidae 135– LC160305 – Kagoshima Bay, oxyrrhyn- cavity metheoides 540 JPN chaena Ceratothoa Buccal Dentex Perciformes Sparidae 50– LC159432 LC159545,9 Yamaguchi, JPN oxyrrhyn- cavity hypseloso- 200 chaena mus Ceratothoa Buccal Dentex abei Perciformes Sparidae 50– – LC160310 Amami Is., JPN oxyrrhyn- cavity 150 chaena Ceratothoa Buccal Glossanodon Argentini- Argentinidae 70– LC159433 LC159546 East China Sea oxyrrhyn- cavity semifascia- formes 1017 chaena1 tus Ceratothoa Buccal Niphon spi- Perciformes Serranidae 100– LC159434 LC159547 Sagami Bay, JPN oxyrrhyn- cavity nosus 200 chaena Ceratothoa Buccal Doederleinia Perciformes Acropoma- 100– LC159435 LC159548 Ehime, JPN oxyrrhyn- cavity berycoides tidae 600 chaena Ceratothoa Buccal Chloroph- Aulopi- Chloroph- 300– LC159437 LC159550 Kagoshima, JPN oxyrrhyn- cavity thalmus formes thalmidae 350 chaena albatrossis

1 3 105 Page 4 of 15 Mar Biol (2017) 164:105

Table 1 continued

Family Species Attachment Host species Order of host Family of Depth 16S No. COI No. Sampling locality site fsh host fsh (m) Ceratothoa Buccal Sphyraena Perciformes Sphyraeni- 6–300 EF422802 – Cairns, Qld, AUS sp. cavity forsteri dae (GB) Ceratothoa Buccal Trachurus Perciformes Carangidae 50– LC159440 LC159553 Imabari, Ehime, sp. 1 cavity japonicus 275 JPN Ceratothoa Buccal Decapterus Perciformes Carangidae 0–20 – LC160313 Tateyama, Chiba, sp. 1 cavity maruadsi JPN Ceratothoa Buccal Decapterus Perciformes Carangidae 1–320 – LC160314,5 Iburi, Kochi, JPN sp. 1 cavity muroadsi Ceratothoa Buccal Takifugu Tetraodonti- Tetradonti- – LC159439 LC159552 Maizuru, Kyoto, sp. 2 cavity favipterus formes dae JPN Ceratothoa Buccal Carangoides Perciformes Carangidae 64– LC159441 LC159554 Yawatahama, sp. 3 cavity equula 226 Ehime, JPN Ceratothoa Buccal Caranx mela- Perciformes Carangidae 0–190 – LC160316 Iburi, Kochi, JPN sp. 3 cavity mpygus Ceratothoa Buccal Pseudocaranx Perciformes Carangidae 10–25 LC160306 – Nichinan, sp. 3 cavity dentex Miyazaki, JPN Ceratothoa Buccal Scorpaena Scorpaeni- Scorpaenidae 100– LC159443 LC159555 East China Sea sp. 31 cavity neglecta formes 150 Ceratothoa Buccal Evynnis tumi- Perciformes Sparidae 30– – LC160317 Sagami Bay, JPN verrucosa cavity frons 346 Ceratothoa Buccal Evynnis cardi- Perciformes Sparidae 0–100 – LC160318 Yawatahama, verrucosa cavity nalis Ehime, JPN Ceratothoa Buccal Pagrus major Perciformes Sparidae 10– LC159444 LC159556 Iburi, Kochi, JPN verrucosa cavity 200 Ceratothoa Buccal Sebastes Scorpaeni- Scorpaenidae – LC159445 LC159557 Gogo Is., Ehime, verrucosa cavity inermis formes JPN Cterissa Opercular Sargocentron Beryciformes Holocentri- – – LC160319 Okinawa, JPN sakaii cavity rubrum dae Cterissa Opercular Sargocentron Beryciformes Holocentri- 1–20 – LC160320 Ginowan, sakaii cavity praslin dae Okinawa, JPN Cterissa Opercular Sargocentron Beryciformes Holocentri- 16–70 LC159446 LC159558 Kunigami, sakaii cavity ittodai dae Okinawa, JPN Cymothoa Buccal Hime japonica Aulopi- Aulopidae 85– LC159447 LC159559 East China Sea eremita1 cavity formes 510 Cymothoa Buccal Cynoscion Perciformes Sciaenidae 10–26 – KP339866 St. Catherines Is., excisa cavity regalis GA, USA (GB) Cymothoa Buccal Sillago ciliata Perciformes Sillaginidae 20–22 EF422791,801 – Moreton Bay, Qld, indica cavity AUS (GB) Cymothoa Buccal Siganus Perciformes Siganidae 1–20 – LC160321 Yoron Is., pulchrum cavity spinus Kagoshima, JPN Cymothoa Buccal Chilomycterus Tetraodonti- Diodontidae 20– LC160307 – Tosashimizu, pulchrum cavity reticulatus formes 100 Kochi, JPN Cymothoa Buccal Diodon Tetraodonti- Diodontidae 3–20 – LC160322 Nago, Okinawa, pulchrum cavity hystrix formes JPN Cymothoa Buccal Diodon holo- Tetraodonti- Diodontidae 2–35 LC159449 LC159560 Amami Is., JPN pulchrum cavity canthus formes Cymothoa Buccal Calotomus Perciformes Scaridae – LC159450 LC159561 Chiba, JPN pulchrum cavity japonicus Cymothoidae unknown unknown – – – EF422792 – Lizard Is., Qld, gen. sp. AUS (GB) Cymothoidae unknown unknown – – – EF422793 – Lizard Is., Qld, gen. sp. AUS (GB) Cymothoidae unknown unknown – – – EF422794 – Lizard Is., Qld, gen. sp. AUS (GB) Cymothoidae unknown unknown – – – EF422796 – Lizard Is., Qld, gen. sp. AUS (GB)

1 3 Mar Biol (2017) 164:105 Page 5 of 15 105

Table 1 continued

Family Species Attachment Host species Order of host Family of Depth 16S No. COI No. Sampling locality site fsh host fsh (m) Cymothoidae unknown unknown – – – EF422798 – Lizard Is., Qld, gen. sp. AUS (GB) Cymothoidae unknown unknown – – – EF422799 – Lizard Is., Qld, gen. sp. AUS (GB) Cymothoidae unknown unknown – – – EF422804 – Lizard Is., Qld, gen. sp. AUS (GB) Cymothoidae Opercular Chrysiptera Perciformes Pomacentri- 0–12 LC159451 LC159562 Sunabe, Okinawa, gen. sp. cavity brownriggii dae JPN Elthusa mori- Opercular Ereunias gral- Scorpaeni- Ereuniidae 500– LC159457 LC159568 Kumano, Mie, takii cavity lator formes JPN Elthusa sac- Opercular Synaphobran- Anguilli- Synapho- 400– – LC160323 Off the Pacifc ciger2 cavity chus kaupii formes branchidae 2200 coast of Tohoku, JPN Elthusa sac- Opercular Synaphobran- Anguilli- Synapho- 290– LC159452 LC159563 Tokyo Bay, JPN ciger cavity chus affnis formes branchidae 2400 Elthusa Buccal unknown – – – AF260852 AF260843 San Diego, CA, vulgaris cavity EF455812 USA, (GB) AF259546 Elthusa sp. 1 Opercular Ventrifossa Gadiformes Macrouridae 350– LC159453 LC159564 Suruga Bay, JPN cavity garmani 550 Elthusa sp. 1 Opercular Coelorinchus Gadiformes Macrouridae 300– LC159454 LC159565 Suruga Bay, JPN cavity japonicus 1000 Elthusa sp. 2 Opercular Hexagrammos Scorpaeni- Hexagram- 139– LC159455 LC159566 Hokkaido, JPN cavity otakii formes midae 155 Elthusa sp. 23 Opercular Hemitripterus Scorpaeni- Hemitripteri- 0–550 LC159456 LC159567 Pacifc coast of cavity villosus formes dae Tohoku, JPN Glossobius Buccal Cypselurus sp. Beloniformes Exocoetidae – LC159458 LC159569 Nichinan, auritus cavity Miyazaki, JPN Ichthyoxenos Buccal Simochromis Perciformes Cichlidae – LC159459 LC159570 Mpulungu, tanganyikae cavity diagramma Zambia Joryma hilsae unknown unknown – – – JX413102 KC896399 India (GB) Lobothorax Buccal Trichiurus Perciformes Trichiuridae – LC159460 LC159571 Chinen, Okinawa, sp. 1 cavity sp. 2 JPN Mothocya Opercular Tylosurus Beloniformes Belonidae 0–13 LC159461 LC159572 Watarai, Mie, JPN collettei cavity crocodilus Mothocya Opercular Tylosurus sp. Beloniformes Belonidae – EF422803 – Moreton Bay, Qld, renardi cavity AUS (GB) Mothocya Opercular Hyporham- Beloniformes Hemiram- 30– LC159462 LC159573 Ehime, JPN parvostis cavity phus sajori phidae Mothocya Opercular Platybelone Beloniformes Belonidae 0–2 – LC160324 Hachijyo Is., sp. 14 cavity argalus Tokyo, JPN platyura Nerocila Body Sarpa salpa Perciformes Sparidae 5–70 – EF455819 Tyrrhenian Sea bivittata surface (GB) Nerocila Body Lates japoni- Perciformes Latidae – LC159463 LC159574 Kochi, JPN japonica surface cus Nerocila Body Aluterus Tetraodonti- Monacanthi- 1–80 – LC160325 Minamisatsuma, japonica surface monoceros formes dae Kagoshima, JPN Nerocila Body Acanthopa- Perciformes Sparidae –50 – LC160326 Ube, Yamaguchi, japonica surface grus latus JPN Nerocila Body Acan- Perciformes Sparidae 15– LC159464 LC159575 Kanagawa, JPN japonica surface thopagrus schlegelii Nerocila Body Acanthogo- Perciformes Gobiidae 1–14 – LC160327,8 Yamaguchi, JPN japonica surface bius favi- manus

1 3 105 Page 6 of 15 Mar Biol (2017) 164:105

Table 1 continued

Family Species Attachment Host species Order of host Family of Depth 16S No. COI No. Sampling locality site fsh host fsh (m) Nerocila Body Lepidotrigla Scorpaeni- Triglidae 43– – LC160329,30 Uwa Sea, Ehime, japonica surface hime formes 357 JPN Nerocila Body Mola mola Tetraodonti- Molidae 30–70 – LC160331 Iburi, Kochi, JPN japonica surface formes Nerocila Body Terapon puta Perciformes Terapontidae –30 KJ855322 – India (GB) longispina surface Nerocila Body Otolithes Perciformes Sciaenidae 10–40 KJ855322 – India (GB) longispina surface ruber Nerocila unknown unknown – – – – KC896398 India (GB) longispina Nerocila Body Acanthopa- Perciformes Sparidae – EF422805 – Brisbane, Qld, monodi surface grus aus- AUS (GB) tralis Nerocila Body Scomb- Perciformes Scombridae 0–200 – LC160332 Seto Inland Sea, phaiopleura surface eromorus JPN niphonius Nerocila Body Sardinops Clupeiformes Clupeidae 0–200 LC159465 LC159576 Sagami Bay, JPN phaiopleura surface sagax mela- nostictus Nerocila Body unknown – – – JX413101 – India (GB) poruvae surface Nerocila unknown unknown – – – – KJ855321 India (GB) poruvae Nerocila sp. 1 Body Pennahia Perciformes Sciaenidae 40– LC159466 LC159577 Tokushima, JPN surface argentata 140 Olencira Buccal unknown – – – AF259547 AF255791 Charleston, SC, praegusta- cavity USA (GB) tor Renocila Body Blenniella Perciformes Blenniidae 0–6 EF422788 – Heron Is., Qld, ovata surface chrysospilos AUS (GB) Ryukyua Opercular Amblygaster Clupeiformes Clupeidae 10–75 LC159467 LC159578 Henza Is., globosa cavity sirm Okinawa, JPN Cirolanidae Cirolana Free-living none – – – AF259544 AF255788 South of Lüderitz, rugicauda Namibia (GB) Bopyridae Athelges Body unknown – – – – KT208746 North Sea (GB) paguri surface Bopyroides Branchial unknown – – – – DQ889082 unknown (GB) hippolytes chamber Orthione Branchial Upogebia – – – – KP412462 South Korea (GB) griffenis chamber major Corallanidae Tachaea chin- Body Palaemon – – – LC160308 – Osaka, JPN ensis surface paucidens Aegidae Aega psora Free-living none – – – – FJ581463 St. Lawrence Gulf, Canada (GB) Aegidae gen. Body Hyperoglyphe Perciformes Centrolophi- 150– LC159469 LC159579 Amami Is., JPN sp. surface japonica dae 1537 Aegidae gen. Opercular Fistularia Gaster- Fistulariidae 18–57 LC159470 LC159580 Kimotsuki, sp. cavity petimba osteiformes Kagoshima, JPN Alitropus unknown Channa Perciformes Channidae – – KT445864 India (GB) typus striata Rocinela Free-living none – – – – EF432739 unknown (GB) angustata Syscenus Free-living none – – – – FJ581911 St. Lawrence infelix Gulf, Canada (GB)

1 3 Mar Biol (2017) 164:105 Page 7 of 15 105

Table 1 continued

Family Species Attachment Host species Order of host Family of Depth 16S No. COI No. Sampling locality site fsh host fsh (m) Sphaeroma- Cymodoce sp. Body Neoscombrops Perciformes Acropoma- 60– LC159471 LC159581 Uwa Sea, Ehime, tidae surface pacifcus tidae 500 JPN

The accession numbers of novel sequences are shown in bold GB GenBank 1 Collected by R/V Yoko-Maru in June 2015, 2 collected by R/V Wakataka-Maru in November 2013, 3 collected by R/V Wakataka-Maru in July 2014, 4 the Kanagawa Prefectural Museum of Natural History (KPM-NH 376)

epidermis, forming a capsule with a small opening within on electropherograms were excluded by checking for dou- myomeric tissue to occupy the abdominal cavity. ble peaks and mismatches in overlapping sequences of any given taxon (Mindell et al. 1999); we used Geneious version DNA extraction 7.1.7 software to this end (Kearse et al. 2012).

Samples of dorsal musculature (ca. 2 2 mm3) were excised Sequence analysis × from ethanol-preserved specimens. Total genomic DNA was extracted with Genomic DNA Purifcation Kit (Promega, Forward and reverse sequences were assembled using Wisconsin, USA) following the manufacturer’s protocol. Geneious version 7.1.7. For the 16S rRNA genes, assembled sequences were aligned using MAFFT 7.273 software PCR and sequencing running the Q-INS-i option that aligns sequences by con- sidering RNA secondary structure (Katoh and Standley The 16S rRNA gene region of mitochondrial DNA (mtDNA) 2013). Next, ambiguities were removed by trimAl ver- was amplifed using the forward primer (16Sar) 5′–CGC- sion 1.2 software (Capella-Gutiérrez et al. 2009). For the CTGTTTAACAAAAACAT–3′ and the reverse primer COI genes, the assembled sequences were translated into (16Sbr) 5′–CCGGTCTGAACTCAGATCATGT–3′ (Simon proteins and aligned to identify pseudogenes contain- et al. 1994) via polymerase chain reaction (PCR). Each PCR ing unexpected insertions, deletions, frameshifts, and stop was performed in a 10 μL reaction volume containing 3.35 codons (Mindell et al. 1999). The protein sequences were

μL sterile distilled H20, 5.0 μL Ampdirect Plus (Shimadzu, then reverse-translated prior to phylogenetic analysis using Kyoto, Japan), 0.3 μL each primer (10 μM solutions), 0.05 MEGA 6.06 software (Tamura et al. 2013). μL Taq DNA polymerase (BIOTAQ HS DNA Polymerase, We ran χ2 homogeneity tests to explore the compositional Bioline, London, UK), and 1 μL template. The thermal homogeneity of nucleotides within 16S rRNA genes, and cycle profle was as follows: initial denaturation at 94 °C for those of all codons of COI genes. These tests showed that the 10 min; 30 cycles of 94 °C for 30 s, 48 °C for 1 min, and third codon positions of the COI genes exhibited signifcant 72 °C for 1 min; and a fnal extension at 72 °C for 10 min. heterogeneity in terms of base frequency. Most phylogenetic The COI regions of mtDNA were amplifed using the for- reconstruction algorithms assume homogeneity in nucleotide ward primer LCO1490 (5′–GGTCAACAAATCATAAA- base compositions and can give rise to phylogenetic inac- GATATTGG–3′) and the reverse primer HCO2198 (5′– curacies when this assumption is violated (e.g. Tarrío et al. TAAACTTCAGGGTGACCAAAAAATCA–3′) (Folmer 2001; Hassanin 2006). Therefore, the frst, second, and third et al. 1994) using the volumes described above. The thermal codon positions of the COI genes were separately analysed. cycle profle was as follows: initial denaturation at 94 °C The third codon position was subjected to RY coding. Thus, for 10 min; 35 cycles of 94 °C for 30 s, 40 °C for 1 min, the pyrimidines C and T formed a single character, as did the and 72 °C for 1.5 min; and a fnal extension at 72 °C for purines A and G (Phillips and Penny 2003). 10 min. PCR products were purifed using polyethylene gly- col following a published protocol (Rosenthal et al. 1993) Phylogenetic analysis and subjected to direct cycle sequencing employing BigDye Terminator version 3.1 technology (Applied Biosystems Phylogenetic trees were constructed based on the indi- [ABI], Foster City, CA, USA) using the PCR primers. The vidual 16S rRNA and COI datasets, and their combination. sequencing protocol used was that recommended by ABI. We used both the maximum likelihood (ML) and Bayes- Labelled fragments were sequenced on an ABI 3130 plat- ian inference (BI) methods. Individual substitution mod- form. All pseudogenes (nuclear copies of mtDNA) evident els were used to analyse the 16S rRNA data, and the frst,

1 3 105 Page 8 of 15 Mar Biol (2017) 164:105 second, and third codon positions of COI. We calculated most of our results on the tree constructed using the com- Akaike Information Criteria and selected the best substitu- bined dataset (Figs. 1, S1). tion model using Kakusan 4 software (Tanabe 2011). Fol- Phylogenetic analysis revealed that the basal branches lowing this model selections, we used the GTR G model within the family Cymothoidae were Elthusa sacciger; par- + when applying both the ML and BI methods to the 16S asitic in the opercular cavity of synaphobranchid eels living rRNA data. For COI analysis, we employed the GTR G in the deep sea (between 400 and 3000 m) of the Western + model when evaluating all three codon positions by the Pacifc, and the freshwater abdomen-burrowing Artystone ML method, and the SYM G, GTR G, and F81 G sp., parasitic on an armoured catfsh of the Iguassu River, + + + models to evaluate the frst, second, and third codon posi- South America. The opercular cavity parasite clade, includ- tions, respectively, when applying the BI method. For the ing the genera Elthusa and Cterissa, arose next (Figs. 1, combined dataset, we used the GTR G model to evalu- 2, 3, and S2). These parasites colonise both deep-water + ate all markers by the ML method, and the GTR G, fsh (Ereuniidae, Hemitripteridae, Hexagrammidae, and + SYM G, GTR G, and F81 G models to evaluate the Macrouridae) and shallow water coastal fsh belonging to + + + 16S rRNA data, and the frst, second, and third codon posi- Holocentridae. The mouth-dwelling Ceratothoa and Glos- tions of COI, respectively, when applying the BI method. sobius are next; most of their host fsh species are coastal ML and BI analyses were performed using RAxML ver- in nature. The next clade contains only Ichthyoxenos tan- sion 8 (Stamatakis 2014) and MrBayes version 3.2.6 (Ron- ganyikae, which parasitises the mouth of a Tanganyikan quist et al. 2012) software, respectively. In the BI method, cichlid (Simochromis diagramma); this species seems to two independent Markov-chain Monte Carlo runs, each of form a monophyletic group with the Mothocya species 1,000,000 generations, were performed; the trees were sam- parasitic in the opercular cavities of marine Belonidae and pled every 100 generations. The frst 4000 trees were dis- Hemiramphidae. Subsequently, two clades of parasites liv- carded as burn-in. A majority-rule consensus tree was con- ing in the buccal and opercular cavities arose; one clade structed from the remaining 6000 trees. We confrmed that includes Elthusa vulgaris and the other includes Lobo- all analyses attained the stationary condition well before the thorax and Ryukyua. Finally, Cymothoa (parasitic in the end of the burn-in period. To this end, we plotted the natural mouth) and Anilocra and Nerocila (parasitic on the external logarithms of the likelihoods of all sampled trees against the body surfaces of marine fsh) arose and became diversifed. generation time, and confrmed that average standard devia- The abdominal muscle burrower Artystone sp. para- tion of split frequencies and the potential scale reduction sitises a freshwater loricariid fsh, Epactionotus yasi, and factor for all parameters reached 0.006 and 1.00, respec- forms a highly supported clade with Alitropus typus, a spe- tively. We also confrmed that evaluating effective sample cies of Aegidae that is parasitic in the opercular cavities or size values for all parameters were more than 200. on the body surfaces of fsh that live in brackish or freshwater of southern Asia to eastern Australia (Pillai 1967; Bruce Evolution of the attachment mode 1983; Nair and Nair 1983; Bruce 2009). This was apparent in the phylogenetic tree based on COI sequences (Fig. 3). To explore how attachment modes were acquired by, and shifted within, Cymothoidae, we identifed the ancestral Habitat expansion and shift to a new host fsh mode using the Trace Character History function of Mes- quite 3.04 (Maddison and Maddison 2015) software run- One of the basal taxa of Cymothoidae is Elthusa sac- ning an ML reconstruction algorithm. ciger, which is parasitic on deep-sea Synaphobranchi- dae. Smit et al. (2014) indicated that Cymothoidae may have originated in the Jurassic era (199–145 Ma) Results and discussion because fossils of bopyrid isopods, a family closely related to Cymothoidae (Boyko et al. 2013), have been Phylogeny of the Cymothoidae dated to that time. In addition, the fossil record suggests that cirolanid isopods scavenged a marine fsh, Three phylogenetic trees were constructed based on the Pachyrhizodus marathonensis, of the extinct order Cros- 16S rRNA, COI, and combined datasets. These trees sognathiformes, in the Albian, Early Cretaceous (113– included two freshwater clades, an abdominal burrower, 100 Ma) (Wilson et al. 2011). In terms of marine fsh, and the clade closer to the base of Cymothoidae (which most existing orders that marine cymothoids parasitise were analysed for the frst time). The topologies were were absent in the Jurassic era (Inoue et al. 2015), the nearly consistent among the trees, although the bootstrap exception being the order Anguilliformes. Deep-sea values/Bayesian posterior probabilities were low in both Synaphobranchidae originated in the Triassic era (Inoue the 16S rRNA and COI trees (Figs. 1, 2, 3, S1). We base et al. 2010; Johnson et al. 2012), and it is thus possible

1 3 Mar Biol (2017) 164:105 Page 9 of 15 105 that the isopods parasitic in the opercular cavity of these clade evolved much earlier than did the I. tanganyikae deep-sea eels constitute the origin of Cymothoidae, clade. which later diversifed and expanded their habitat to include shallow seas and freshwater by evolving to live Evolution of the attachment mode to host fsh with newly derived fsh. Intensive collection of deep-sea cymothoids is required to rigorously defne the phyloge- Our results suggest that the ancestor of the family netic position of parasites of synaphobranchid eels and Cymothoidae was most likely an opercular parasite to evaluate the hypothesis we advance above. On the (Fig. 4), although more taxon sampling and molecu- other hand, phylogeny of cymothoids and that of host lar analyses are necessary to resolve the basal part of fshes are not concordant because of dynamic host shift cymothoid phylogeny. Subsequently, at a very early by cymothoids (Fig. 1). Especially, cymothoids living in stage, certain lineages seem to have invaded freshwater the buccal cavity and on external body surfaces of fshes habitats and some acquired the ability to burrow into the have wide ranges of host fsh species (Fig. 1; Table 1) abdominal cavity. All abdominal cavity-burrowing spe- and suggesting frequent host shift in the coevolution cies (the genera Ichthyoxenos, Artystone, and Riggia) between cymothoids and host fshes. are strictly confned to brackish or freshwater, with the In the present study, we analysed two freshwater species, exception of only one species, Ourozeuktes bopyroides, one of which was a fesh-burrowing Artystone sp. parasitic that is marine and parasitic on a leatherjacket (Acantha- on an armoured catfsh, Epactionotus yasi, of the Iguassu luteres spilomelanurus) of one of the most derived fsh River basin, South America; the other was the freshwater orders, Tetraodontiformes (Brusca 1981; Saunders 2012; buccal parasite, Ichthyoxenos tanganyikae, which is para- Trilles and Hipeau-Jacquotte 2012). Further analyses on sitic on a Tanganyikan cichlid, Simochromis diagramma. these species are required to defne the timing and fre- Artystone sp. forms a highly supported clade with Alitro- quency of evolution of abdominal cavity burrowers. pus typus, a species of Aegidae that is parasitic in the oper- Mouth-dwelling capacity evolved only once and then cular cavity or body surface of brackish or freshwater fsh became diversifed. Three clades of mouth parasites have of southern Asia to eastern Australia (Pillai 1967; Bruce reverted to opercular cavity parasitism. The fnal evo- 1983; Nair and Nair 1983; Bruce 2009). This suggests that lutionary step was attachment to the external surface of Alitropus (which contains only A. typus) may belong to fsh. Based on the 16S rRNA data, parasites of the buc- Cymothoidae rather than Aegidae. Alitropus typus has seven cal or opercular cavity may be the ancestors of organisms pairs of prehensile legs and short coxae on pereopods 5–7, exhibiting external attachment today (Jones et al. 2008). and is unique among aegid species (Chilton 1926; Bruce Our 16S rRNA and COI dataset supports this sugges- 1983; note that Rocinela simplex of Chilton [1926] is a jun- tion. Furthermore, we have defned three clades near the ior synonym of A. typus). However, this pereopod morphol- base of the tree, suggesting that parasites of the opercular ogy is common in Cymothoidae (Brusca 1981). Further, this cavity are the most ancient. For the frst time, we used clade diverges near the base of the cymothoid phylogenetic molecular data to reveal the ancient origin of freshwater tree, suggesting that the lineage may have immigrated to abdominal burrowers, and the independent expansion into freshwater in Gondwanaland, and diversifed following the a freshwater habitat by a Tanganyikan mouth-dwelling break-up of that continent. Alitropus typus and Artystone cymothoid. sp. colonise siluriform fsh that also originated in Gondwa- naland (106.1 Ma; Near et al. 2012), partly supporting this Phylogenetic relationships among species hypothesis. of Cymothoidae and fsh parasites of Aegidae In contrast, Ichthyoxenos tanganyikae is closely related to the opercular cavity-parasitic genus Mothocya Taxonomic studies of the family Cymothoidae are chal- that lives in shallow coastal regions, suggesting that this lenging when only morphological data are available; species also arose by invasion of the lacustrine habitat, intra-specific variation is sufficiently great to sometimes perhaps via the Congo River where a close relative, I. overwhelm inter-specific variation (Smit et al. 2014). expansus, has been described from the opercular cavity This is attributable to the morphological convergence of the characiform fsh Eugnathichthys eetveldii (Fryer of cymothoid species that share morphologically similar 1968; Lincoln 1972). Ichthyoxenos tanganyikae is appar- host fish, and divergence among cymothoid populations ently asymmetrical, as are cymothoids that parasitise the that utilise different species of host fish but nonethe- opercular cavity, suggesting that this mouth-parasitic less belong to a single species. In such cases, molecular group originated from a parasite of the opercular cav- markers are important in taxonomic terms, as has also ity (Fig. 4). These two freshwater clades arose indepen- been found for bivalves parasitic on various host species dently from different marine ancestors; the Artystone (Goto et al. 2012). Taxonomy and phylogeny based on

1 3 105 Page 10 of 15 Mar Biol (2017) 164:105

Fig. 1 A maximum likelihood tree of the family Cymothoidae based dontidae, respectively; Nelson et al. 2016) are shown in parentheses on combined data on mitochondrial 16S rRNA and COI genes. The or following silhouettes of the families. Dark- and light-grey fsh numbers adjacent to branches are the maximum likelihood bootstrap inhabit deep (>200 m) and shallow water, respectively; ‘FW’ identi- values followed by the Bayesian posterior probabilities. Values >50 fes freshwater fsh. See Table 1 for details of host fsh species. The and 0.5 (bootstrap values and probabilities, respectively) are shown. photograph of Artystone sp. is reproduced with the kind permission The host fsh families and the numbers of families (informative in of I. Seidel terms of phylogenetic position; 1 to 536 indicate Myxinidae to Dio- both morphology and molecular markers have been con- Elthusa spp. parasitic in the opercular cavity of Ereu- ducted on Cymothoidae (Hadfield 2012; Martin 2015), niidae, Hemitripteridae, Hexagrammidae, Macrouri- and most genera are well established. Our results also dae; and E. vulgaris. In addition, our data suggest that confirmed the monophyly of most genera. However, the Alitropus typus belongs to Cymothoidae, not Aegidae; genus Elthusa is not a monophyletic group, but rather both molecular phylogeny and morphology support this contains at least three distinct clades: Elthusa sacciger; suggestion.

1 3 Mar Biol (2017) 164:105 Page 11 of 15 105

Fig. 2 Maximum likelihood tree of the family Cymothoidae based by the Bayesian posterior probabilities. Values >50 and 0.5 (bootstrap on mitochondrial 16S rRNA sequence data. The numbers adjacent to values and probabilities, respectively) are shown. The host fsh spe- the branches are the maximum likelihood bootstrap values followed cies are shown in parentheses

Conclusions cymothoid isopods may have originated in the deep sea, and then expanded their habitats to include shallow seas We constructed a molecular phylogeny of the family and brackish or freshwater by shifting their host species. Cymothoidae based on mitochondrial 16S rRNA and Invasion of freshwater has occurred (independently) at COI sequences. The phylogenetic tree suggests that least twice. The ancestral attachment mode is most likely

1 3 105 Page 12 of 15 Mar Biol (2017) 164:105

Fig. 3 Maximum likelihood tree of the family Cymothoidae based the Bayesian posterior probabilities. Values >50 and 0.5 (bootstrap on mitochondrial COI sequence data. The numbers adjacent to the values and probabilities, respectively) are shown. The host fsh spe- branches are the maximum likelihood bootstrap values followed by cies are shown in parentheses

1 3 Mar Biol (2017) 164:105 Page 13 of 15 105

Fig. 4 Reconstruction of the Cymothoidae attachment mode using a nodes where only one state was signifcant upon comparison of log- maximum likelihood tree based on combined data on mitochondrial likelihoods. The host fsh species are shown in parentheses. The pho- 16S rRNA and COI sequences. The pie charts indicate the relative tographs of Artystone sp. and Elthusa sacciger are reproduced with likelihoods of the attachment mode for each clade. Asterisks indicate the kind permission of I. Seidel and H. Hirasaka, respectively to be the opercular cavity-dwelling. The ability to live in for providing specimens and/or assisting sample collection. Photos in the buccal cavity and on external body surfaces evolved Figs. 1, 4 courtesy of I. Seidel and H. Hirasaka. We are also grate- ful to members of the Maneno Team (Tanganyika Research Project subsequently. Team) and staffs of Lake Tanganyika Research Unit, Mpulungu, Zam- bia, for their support. Research in Lake Tanganyika was conducted Acknowledgements We sincerely thank J. Akahane, G. Akinaga, under permission from the Zambian Ministry of Agriculture, Food, S. N. Chiba, R. Dohi, A. Fujii, K. Goto, H. Hamaoka, T. Hattori, T. and Fisheries. This study was supported by Showa Seitoku Memorial Hayakawa, N. Hayashida, I. Hirabayashi, H. Hirasaka, S. Isozaki, G. Foundation (Grant No. H26) and the Mikimoto Fund for marine Ecol- Itani, M. Ito, M. Ito, H. Matsuba, Kanagawa Prefectural Museum of ogy (Grant No. H24). Natural History, H. Katahira, E. Katayama, Y. Kimura, K. Koeda, T. Kunishima, H. Mishima, K. Miyamoto, Y. Miyazaki, T. Moritaki, F. Compliance with ethical standards Nakao, N. Nakayama, M. Nishiguchi, M. Ogishi, J. Ohtomi, T. Oka, T. Okada, I. Oura, K. Sakai, T. Sakai, T. Sakumoto, M. Sakurai, T. Sato, T. P. Satoh, Seikai National Fisheries Research Institute, H. Confict of interest All authors declare that they have no confict of Senou, T. Shigeta, S. Sodeyama, R. Shimomura, T. Shinonome, interest. K. Tachihara, R. Tagashira, M. Takami, T. Takaya, F. Tashiro, Toba Aquarium, Tohoku National Fisheries Research Institute, T. Tsukay- Ethical standard All experiments were conducted in accordance with ama, A. Umemoto, M. Utsunomiya, Y. Yagi, A. Yasui, and S. Yoshimi the Ethical Guidelines for Animal Experiments of Ehime University.

1 3 105 Page 14 of 15 Mar Biol (2017) 164:105

References Ceratothoa oestroides (Isopoda: Cymothoidae). J Fish Dis 26:401–406. doi:10.1046/j.1365-2761.2003.00476.x Inoue JG, Miya M, Miller MJ, Sado T, Hanel R, Hatooka K, Aoyama Adlard RD, Lester RJG (1995) The life-cycle and biology of Anilo- J, Minegishi Y, Nishida M, Tsukamoto K (2010) Deep-ocean cra pomacentri (Isopoda, Cymothoidae), an ectoparasitic iso- origin of the freshwater eels. Biol Lett 6:363–366. doi:10.1098/ pod of the coral-reef fsh, Chromis nitida (Perciformes, Poma- rsbl.2009.0989 centridae). Aust J Zool 43:271–281. doi:10.1071/ZO9950271 Inoue J, Sato Y, Sinclair R, Tsukamoto K, Nishida M (2015) Rapid Boyko CB, Moss J, Williams JD, Shields JD (2013) A molecular genome reshaping by multiple-gene loss after whole-genome dupli- phylogeny of Bopyroidea and Cryptoniscoidea (Crustacea: cation in teleost fsh suggested by mathematical modeling. Proc Natl Isopoda). Syst Biodivers 11:495–506. doi:10.1080/14772000. Acad Sci USA 112:14918–14923. doi:10.1073/pnas.1507669112 2013.865679 Johnson GD, Ida H, Sakaue J, Sado T, Asahida T, Miya M (2012) A Bruce NL (1983) Aegidae (Isopoda: Crustacea) from Australia ‘living fossil’ eel (Anguilliformes: Protoanguillidae, fam. nov.) with descriptions of three new species. J Nat Hist 17:757–788. from an undersea cave in Palau. Proc R Soc B 279:934–943. doi:10.1080/00222938300770591 doi:10.1098/rspb.2011.1289 Bruce NL (1986) Revision of the isopod crustacean genus Mothocya Jones CM, Miller TL, Grutter AS, Cribb TH (2008) Natatory- Costa, in Hope, 1851 (Cymothoidae: Flabellifera), parasitic on stage cymothoid isopods: description, molecular identifca- marine fshes. J Nat Hist 20:1089–1189 tion and evolution of attachment. Int J Parasitol 38:477–491. Bruce NL (1987) Australian Pleopodias Richardson, 1910, and Anilo- doi:10.1016/j.ijpara.2007.07.013 cra Leach, 1818 (Isopoda: Cymothoidae), crustacean parasites of Katoh K, Standley DM (2013) MAFFT multiple sequence alignment marine fshes. Rec Aust Mus 39:85–130 software version 7: improvements in performance and usability. Bruce NL (1990) The genera Catoessa, Elthusa, Enispa, Ichthyox- Mol Biol Evol 30:772–780. doi:10.1093/molbev/mst010 enus, Idusa, Livoneca and Norileca n.gen. (Isopoda, Cymothoi- Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, dae), crustacean parasites of marine fshes, with descriptions of Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton eastern Australian species. Rec Aust Mus 42:247–300. doi:10.38 B, Meintjes P, Drummond A (2012) Geneious Basic: an inte- 53/j.0067-1975.42.1990.118 grated and extendable desktop software platform for the organi- Bruce NL (2009) The marine fauna of New Zealand: Isopoda, Aegi- zation and analysis of sequence data. Bioinformatics 28:1647– dae (Crustacea). NIWA Biodivers Mem 122:1–252 1649. doi:10.1093/bioinformatics/bts199 Bruce NL, Schotte M (2008) Cymothoidae. In: Boyko CB, Bruce Ketmaier V, Joyce DA, Horton T, Mariani S (2008) A molecular phy- NL, Merrin KL, Ota Y, Poore GCB, Taiti S, Schotte M, Wil- logenetic framework for the evolution of parasitic strategies in son GDF (eds) World Marine, Freshwater and Terrestrial Iso- cymothoid isopods (Crustacea). J Zool Syst Evol Res 46:19–23. pod Crustaceans database. http://www.marinespecies.org/aphia. doi:10.1111/j.1439-0469.2007.00423.x php?p taxdetails&id 118274. Accessed 13 Dec 2016. (2008 Lincoln R (1972) A new species of Lironeca (Isopoda; Cymothoidae) onwards= ) = parasitic on cichlid fshes in Lake Tanganyika. Bull Br Mus Nat Brusca RC (1981) A monograph on the Isopoda Cymothoidae (Crus- Hist Zool 21:329–337 tacea) of the eastern Pacifc. Zool J Linn Soc 73:117–199 Maddison WP, Maddison DR (2015) Mesquite: a modular system for Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T (2009) trimAl: evolutionary analysis version 3.04. http://mesquiteproject.org. a tool for automated alignment trimming in large-scale phylo- Accessed 13 Dec 2016 genetic analyses. Bioinformatics 25:1972–1973. doi:10.1093/ Martin MB (2015) Taxonomy and phylogeny of the buccal-attaching bioinformatics/btp348 Cymothoidae (Crustacea: Isopoda) of Australia. Dissertation, Chilton C (1926) Zoological results of a tour in the far East. The Tan- University of Tasmania aidacea and Isopoda of Tale Sap. Rec Indian Mus 28:173–185 Mindell D, Sorenson M, Dimcheff D, Hasegawa M, Ast J, Yuri T Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA (1999) Interordinal relationships of birds and other reptiles based primers for amplifcation of mitochondrial cytochrome c oxidase on whole mitochondrial genomes. Syst Biol 48:138–152 subunit I from diverse metazoan invertebrates. Mol Mar Biol Nair GA, Nair NB (1983) Effect of infestation with the iso- Biotechnol 3:294–299 pod, Alitropus typus M. Edwards (Crustacea: Flabellif- Fryer G (1968) A new parasitic isopod of the family Cymothoidae era: Aegidae) on the haematological parameters of the from clupeid fshes of Lake Tanganyika: a further Lake Tang- host fsh, Channa striatus (Bloch). Aquaculture 30:11–19. anyika enigma. J Zool 156:35–43 doi:10.1016/0044-8486(83)90147-3 Goto R, Kawakita A, Ishikawa H, Hamamura Y, Kato M (2012) Nakabo T (2013) Fishes of Japan with pictorial keys to the species. Molecular phylogeny of the bivalve superfamily Galeomma- Tokai University Press, Kanagawa toidea (Heterodonta, Veneroida) reveals dynamic evolution of Near TJ, Eytan RI, Dornburg A, Kuhn KL, Moore JA, Davis MP, symbiotic lifestyle and interphylum host switching. BMC Evol Wainwright PC, Friedman M, Smith WL (2012) Resolution of Biol 12:1–13. doi:10.1186/1471-2148-12-172 ray-fnned fsh phylogeny and timing of diversifcation. Proc Natl Hadfeld KA (2012) The biodiversity and systematics of marine fsh Acad Sci USA 109:13698–13703. doi:10.1073/pnas.1206625109 parasitic isopods of the family Cymothoidae from Southern Nelson JS, Grande TC, Wilson MVH (2016) Fishes of the world. Africa. Dissertation, University of Johanesburg Wiley, Hoboken Hadfeld KA, Bruce NL, Smit NJ (2015) Review of Mothocya Costa Phillips MJ, Penny D (2003) The root of the mammalian tree inferred in Hope 1851 Crustacea Isopoda Cymothoidae from southern from whole mitochondrial genomes. Mol Phylogenet Evol Africa, with the description of a new species. Afr Zool 50:147– 28:171–185. doi:10.1016/S1055-7903(03)00057-5 163. doi:10.1080/15627020.2015.1043943 Pillai NK (1967) Littoral and parasitic isopods from Kerala: families Hassanin A (2006) Phylogeny of Arthropoda inferred from mitochon- Eurydicidae, Corallanidae and Aegidae-2. J Bombay Nat Hist drial sequences: strategies for limiting the misleading effects of Soc 64:267–283 multiple changes in pattern and rates of substitution. Mol Phylo- Ricklefs RE, Outlaw DC, Svensson-Coelho M, Medeiros MCI, Ellis genet Evol 38:100–116. doi:10.1016/j.ympev.2005.09.012 VA, Latta S (2014) Species formation by host shifting in avian Horton T, Okamura B (2003) Post-haemorrhagic anaemia in sea malaria parasites. Proc Natl Acad Sci USA 111:14816–14821. bass, Dicentrarchus labrax (L.), caused by blood feeding of doi:10.1073/pnas.1416356111

1 3 Mar Biol (2017) 164:105 Page 15 of 15 105

Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Tarrío R, Rodríguez-Trelles F, Ayala FJ (2001) Shared nucleotide Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) composition biases among species and their impact on phylo- MrBayes 3.2: effcient Bayesian phylogenetic inference and genetic reconstructions of the Drosophilidae. Mol Biol Evol model choice across a large model space. Syst Biol 61:539–542. 18:1464–1473. doi:10.1093/oxfordjournals.molbev.a003932 doi:10.1093/sysbio/sys029 Thatcher VE (2006) Isopoda. In: Thatcher VE (ed) Amazon fsh para- Rosenthal A, Coutelle O, Craxton M (1993) Large-scale production sites. Pensoft Pub, Sofa, pp 416–453 of DNA sequencing templates by microtitre format PCR. Nucl Trilles J-P, Hipeau-Jacquotte R (2012) Symbiosis and parasitism in Acids Res 21:173–174. doi:10.1093/nar/21.1.173 the Crustacea. In: Forest J, von Vaupel Klein JC (eds) Treatise Saunders B (2012) Discovery of Australia’s fshes: a history of Aus- on zoology—anatomy, taxonomy, biology. The Crustacea. Brill, tralian ichthyology to 1930. CSIRO Publishing Collingwood, Leiden, pp 239–317. doi:10.1163/9789004188259_006 VIC Tsai M-L, Dai C-F (1999) Ichthyoxenus fushanensis, new species Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Floors P (1994) (Isopoda: Cymothoidae), parasite of the fresh-water fsh Vari- Evolution, weighting, and phylogenetic utility of mitochondrial corhinus barbatulus from northern Taiwan. J Crustacean Biol gene sequences and a compilation of conserved polymerase 19:917–923. doi:10.1163/193724099X00600 chain reaction primers. Ann Entomol Soc Am 87:651–701 Wilson GDF, Paterson JR, Kear BP (2011) Fossil isopods asso- Smit NJ, Bruce NL, Hadfeld KA (2014) Global diversity of fsh para- ciated with a fsh skeleton from the Lower Cretaceous of sitic isopod crustaceans of the family Cymothoidae. Int J Para- Queensland, Australia—direct evidence of a scavenging life- sitol Parasit Wildl 3:188–197. doi:10.1016/j.ijppaw.2014.03.004 style in Mesozoic Cymothoida. Palaeontology 54:1053–1068. Stamatakis A (2014) RAxML version 8: a tool for phylogenetic doi:10.1111/j.1475-4983.2011.01095.x analysis and post-analysis of large phylogenies. Bioinformatics Yamano H, Yamauchi T, Hosoya K (2011) A new host record of Ich- 30:1312–1313. doi:10.1093/bioinformatics/btu033 thyoxenus amurensis (Crustacea: Isopoda: Cymothoidae) from Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) the Amur bitterling Rhodeus sericeus (Cypriniformes: Cyprini- MEGA6: molecular evolutionary genetics analysis version 6.0. dae). Limnology 12:103–106. doi:10.1007/s10201-010-0325-1 Mol Biol Evol 30:2725–2729. doi:10.1093/molbev/mst197 Zietara MS, Lumme J (2002) Speciation by host switch and Tanabe AS (2011) Kakusan4 and Aminosan: two programs for adaptive radiation in a fsh parasite genus Gyrodactylus comparing nonpartitioned, proportional and separate mod- (monogenea, gyrodactylidae). Evolution 56:2445–2458. els for combined molecular phylogenetic analyses of mul- doi:10.1111/j.0014-3820.2002.tb00170.x tilocus sequence data. Mol Ecol Resour 11:914–921. doi:10.1111/j.1755-0998.2011.03021.x

1 3