sign in sign up
<<
Home , Alphasatellite, Becurtovirus, Chloroplast DNA, Eragrovirus, Topocuvirus, Turncurtovirus

TRANSLOCATION OF -DERIVED NUCLEIC TO AND MITOCHONDRIA IN

by

Tauqeer Ahmad

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of and Systems Biology University of Toronto

© Copyright by Tauqeer Ahmad 2016

TRANSLOCATION OF VIRUS-DERIVED NUCLEIC ACIDS TO CHLOROPLASTS AND MITOCHONDRIA IN PLANTS

Tauqeer Ahmad Degree of Doctor of Philosophy

Department of Cell and Systems Biology University of Toronto 2016 ABSTRACT In this study, I demonstrated that a non-coding RNA sequence from potato virus X as small as 127 nucleotides (located near the 3´end of 8 kDa and the start of CP as well as the non-coding intergenic region) is capable of translocating not only its own sequence but also a reporter , fluorescent green mRNA into chloroplasts of the transgenic tobacco plants.

This is the first evidence showing that a small viral RNA sequence (designated “RNA tractor”) is capable of translocating RNA sequences to the . The chloroplast translocation efficiency of the PVX RNA tractor was determined to be 120 X lower than that of Eggplant latent , a member of the family that replicates and accumulates in the chloroplast. Furthermore, I investigated two on various Nicotiana species to assess the effects of their ploidy level on infectivity and symptomatology. For this purpose, infectious clones of Ageratum enation virus (AEV), a monopartite (DNA-A with Beta-

DNA particle) and Tomato leaf curl New Delhi virus (ToLCNDV), a bipartite (DNA-A and

DNA-B), begomoviruses were used. All plants inoculated with ToLCNDV were systemically infected and showed characteristic symptoms. However, in the case of AEV, all plants except N. tabacum cv. Xanthi were infected by the virus but remained symptomless. Taken together, these results indicate that there is no clear relationship between infectivity and ploidy levels; furthermore, symptomatology depends on the type of virus and/or species. Another key ii

question to answer was whether or not the of the begomoviruses could be isolated from chloroplasts of the infected tobacco and tomato plants. PCR results confirmed the presence of only DNA-A of the AEV in the chloroplasts. Preliminary studies clearly show that the “RNA tractor” sequence and AEV are incapable of targeting the mitochondria. These findings suggest that members from different viral families may be associated with the same , but that members do not necessarily target the different . Thus, the present study could be important for understanding the evolutionary importance of the interactions of viral genomes with different organelles of plant cells and their consequential pathological effects.

iii

Acknowledgments

Thanks to Almighty Allah, the Omniscient, Omnipotent and Omnipresence who blessed me the aptitude of accomplishing this colossal work. I deem it a profound honor to express the depth of my gratitude to Prof. Mounir G. AbouHaidar, my supervisor, for the continuous support of my Ph.D. study and related research, motivation, and immense knowledge. I feel that his guidance has helped me to mature into an independent researcher with the abilities to cope with any type of research at both the scientific and administrative levels. I am greatly indebted to my other committee members: Prof. Richard Collins and Prof. Maurice Ringuette for their insightful comments, meticulous criticism, encouragement and critical review of my thesis. I would like to thank Dr. Eiji Nambara for being a part of my examining committee. I really appreciate Dr. Andrew White who has devoted his valuable time to review my thesis and took part in my final defense My sincere thanks also go to Dr. Christendat and Dr. Guttman for providing me access to their laboratory facilities. Many thanks are due, to Henry and Audrey for their cooperation with confocal and electron microscopic studies. Bruce and Andrew, I do appreciate your efforts for the programming of growth chamber and greenhouse supplies. Many thanks are immense for the entire CSB staff (especially Ian and Tamar) helping me move well along with the administration matters in all these years. My profound thanks to Dr. Saleem Haider, the man who introduced me to Professor AbouHaidar. Special thanks to Dr. Kathleen Hefferon for proof-reading parts of the thesis and publications. Thanks to Dr. Srividhya Venkataramana for all the help and the opportunity to collaborate in publications. A special note of thanks to all of my colleagues; Alexander, Amanda, Kayvan, Tatyana, Liu, Amjad, Hasan, Reem, Amira, Dang, Lingjie and other fellows. It has been a pleasure working with you all and thanks for offering a helping hand whenever needed. I would like to express my heartfelt gratitude to all my family members. It is through their wholehearted prayers that enabled me to achieve one of my goals. I am also indebted to all those who prayed for my success. I must acknowledge my wife and best friend, Sadaf, without her love, encouragement and editing assistance, I would not have finished this thesis. Love to my kids Ismaeel, Tayyab and Noor for always cheering me up.

iv

Table of Contents

Acknowledgments ...... iv Table of Contents ...... v List of Tables ...... x List of Figures ...... xi List of Abbreviations ...... xiv CHAPTER 1 ...... 1 1 LITERATURE REVIEW ...... 1 1.1 POTEXVIRUSES ...... 1 1.1.1 Replication ...... 1 1.1.2 Intercellular Transport of Potexvirus ...... 4 1.1.3 Intracellular trafficking of viral RNA in potexviruses ...... 5 1.1.4 Interaction between viral and chloroplast ...... 6 1.1.5 Virion and viral RNA within chloroplasts ...... 7 1.1.6 Targeting of nuclear-encoded proteins to organelles ...... 8 1.1.7 mRNA-based to different organelles ...... 9 1.1.8 The accumulation of Avsunviroidae within the chloroplasts ...... 10 1.1.9 Non-coding in ...... 11 1.1.10 in chloroplast ...... 11 1.1.11 RNA transport into mitochondria ...... 14 1.2 GEMINIVIRUSES ...... 15 1.2.1 Genus ...... 17 1.2.2 Begomovirus ...... 20 1.2.3 Long distance movement within plants ...... 21 1.2.4 Translocation of begomoviruses into chloroplast ...... 21 CHAPTER 2 ...... 23 2 STUDIES ON TRANSLOCATION OF RNAS FROM TO ORGANELLES ...... 23 2.1 INTRODUCTION ...... 23 2.2 RESEARCH PLAN ...... 27 2.3 MATERIALS AND METHODS ...... 28 2.3.1 construction and transformation...... 28

v

2.3.2 Heat shock transformation of E.coli ...... 35 2.3.3 Isolation and purification of plasmid DNA from E.coli (mini-prep) ...... 36 2.3.4 Gel electrophoresis...... 37 2.3.5 Agrobacterium transformation ...... 37 2.3.6 Plant transformation ...... 38 2.3.7 Infection of N. tabacum cv. Xanthi with PVX and virus isolation ...... 39 2.3.8 Extraction of viral genomic RNA ...... 41 2.3.9 Chloroplast isolation ...... 42 2.3.10 cDNA synthesis and RT-PCR ...... 43 2.3.11 Real-time RT-PCR ...... 44 2.3.12 SDS-PAGE and western blot analysis ...... 45 2.3.13 Isolation of intact mitochondria and enzymatic treatments ...... 46 2.4 RESULTS ...... 47 2.4.1 Detection of PVX RNA and coat protein in chloroplast...... 47 2.4.2 Reconstruction control experiments ...... 50 2.4.3 Design of constructs to confirm RNA tractor activity in chloroplasts...... 51 2.4.4 Analyses for expression of different constructs in total cellular RNA ...... 52 2.4.5 Translocation of RNA transcripts driven by different constructs into chloroplasts ...... 53 2.4.6 Quantitation of translocated RNA to chloroplasts by real-time RT-PCR...... 54 2.4.7 Comparison of translocation efficiency of PVX RNA tractor (pTR:127) to Eggplant latent viroid sequence (pCELVd-GFP) ...... 57 2.4.8 Translocation of “RNA tractor” sequence to plant mitochondria ...... 58 2.5 DISCUSSION ...... 60 CHAPTER 3 ...... 65 3 STUDIES ON INFECTIVITY AND TRANSLOCATION OF VIRAL FROM CYTOSOL TO ORGANELLES ...... 65 3.1 INTRODUCTION ...... 65 3.2 RESEARCH PLAN ...... 68 3.3 MATERIALS AND METHODS ...... 68 3.3.1 Plant growth conditions ...... 68 3.3.2 Agrobacterium-mediated inoculation ...... 69 3.3.3 Extraction of total nucleic acids from plants and PCR ...... 69 3.3.4 Isolation of intact chloroplast and enzymatic treatments ...... 70 3.3.5 Light microscopy and transmission electron microscopy (TEM) ...... 72 3.3.6 Isolation of intact mitochondria and enzymatic treatments ...... 73 vi

3.3.7 Isolation of virus ...... 74 3.4 RESULTS ...... 75 3.4.1 Infectivity Assays: Inoculation of plants with AEV and ToLCNDV DNA clones ...... 75 3.4.2 Chloroplast DNA Analysis ...... 80 3.4.3 Reconstruction control experiments ...... 80 3.4.4 Microscopic studies ...... 82 3.4.5 Translocation of AEV DNA in mitochondria ...... 83 3.5 DISCUSSION ...... 84 CHAPTER 4 ...... 89 4 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS ...... 89 4.1 GENERAL CONCLUSIONS ...... 89 4.2 FUTURE DIRECTIONS ...... 90 APPENDIX A ...... 93 5 ATTEMPTS FOR RNA TRACTOR SEQUENCE MODIFICATION FOR GFP EXPRESSION IN CHLOROPLASTS ...... 93 5.1 INTRODUCTION ...... 93 5.2 Addition of SD-like sequence (pCrbcLSD-GFP) ...... 94 5.3 Addition of 5´-translation control region of large sub-unit RuBisCO gene ...... 96 5.4 Addition of 5´-UTR of Psb A gene for translation initiation of GFP in chloroplast ...... 100 5.5 Addition of bacterial translation initiation region (TIR) for GFP expression ...... 103 APPENDIX B ...... 107 6 STRATEGY TO FIND OUT THE CAPACITY OF CHIMERIC EGGPLANT LATENT VIROID SEQUENCE AS A 5´-UTR FOR GFP EXPRESSION IN CHLOROPLASTS ...... 107 APPENDIX C ...... 112 7 VIRAL AND CHLOROPLASTIC SIGNALS ESSENTIAL FOR INITIATION AND EFFICIENCY OF TRANSLATION IN AGROBACTERIUM TUMEFACIENS ...... 112 7.1 SUMMARY ...... 112 7.2 INTRODUCTION ...... 113 7.3 MATERIALS AND METHODS ...... 114 7.3.1 Construction of GFP expression : ...... 114

vii

7.3.2 Agrobacterium transformation ...... 116 7.3.3 RNA isolation, reverse and PCR ...... 116 7.3.4 Detection of GFP expression ...... 117 7.4 RESULTS AND DISCUSSION ...... 118 7.4.1 Estimation of equal GFP transcript levels in A. tumefaciens harboring each of the above constructs ...... 119 7.4.2 Major differences in translation initiation requirements between A. tumefaciens and E. coli: High GFP translation levels in A. tumefaciens under the control of phage T7 translational enhancer and RBS ...... 120 7.4.3 Effect of the AT-rich sequence from the (AIMV) upstream of the GFP gene on its translation in A. tumefaciens ...... 123 7.4.4 Analysis of 5´ -UTR sequences derived from some natural chloroplastic genes on translation in A. tumefaciens...... 124 7.4.5 Identification of the minimal translation initiation sequence of the rbcL gene required for high-level expression in A. tumefaciens...... 124 7.4.6 Comparison of the 5´-UTRs of both rbcL and Psb A genes for translation initiation in A. tumefaciens ...... 126 7.4.7 5´-UTR of the chloroplastic atp1 gene supports low GFP translation levels in A. tumefaciens ...... 127 7.5 CONCLUSION ...... 128 APPENDIX D ...... 129 8 ANALYSIS OF THE INTERNAL BINDING SITE (IRBS) OF PVX ...... 129 8.1 BACKGROUND ...... 129 8.2 MATERIALS AND METHODS ...... 130 8.2.1 Construction of GFP expression plasmids ...... 130 8.2.2 Plant transformation for stable ...... 131 8.2.3 Confocal microscopy ...... 132 8.2.4 Western Blot ...... 132 8.3 RESULTS AND DISCUSSION ...... 133 8.3.1 Expression of GFP using stable gene experiments ...... 133 8.3.2 Western blot analysis ...... 136 APPENDIX E ...... 138 9 NOVEL AND UNIVERSAL APPROACH TO SILENCE ALL GEMINIVIRUSES IN PLANTS ...... 138 9.1 SUMMARY ...... 138 9.2 INTRODUCTION ...... 139 viii

9.3 MATERIALS AND METHODS ...... 141 9.3.1 Vector construction ...... 141 9.3.2 Plant transformation ...... 143 9.3.3 Characterization of transgenic lines ...... 143 9.3.4 Agroinoculation ...... 144 9.3.5 Detection of viral genome in infected plants ...... 145 9.4 RESULTS ...... 145 9.4.1 Production of transgenic lines ...... 145 9.4.2 Transgenic plant evaluation against infectious clones of AEV ...... 146 9.4.3 Testing of transgenic plants for resistance against ToLCNDV ...... 148 9.5 CONCLUSION ...... 150 REFERENCES ...... 154

ix

List of Tables

Table 2.1 / primers used in the production of different constructs...... 33 Table 2.2 Primer sequences used for semi-quantitative and real time RT- PCR...... 44 Table 2.3 Relative quantification (expression) of GFP-transcripts derived from transgenic leaves harboring given constructs using comparative real time RT-PCR...... 54 Table 2.4 Relative quantification of chloroplast RNA expression of pTR:127 and pC-ELVd-GFP using real time RT-PCR...... 58 Table 3.1 Primer sequences used for semi-quantitative PCR...... 70 Table 3.2 Summary of the results of the infectivity assays ...... 78 Table 7.1 Sequences of the translation initiation signals in the pC-GFP vector...... 115 Table 8.1 Oligonucleotides/ primers used in the production of different constructs with or without a hairpin structure to investigate the IRBS...... 131

x

List of Figures

Figure 1.1 The organization of the Potexvirus genome...... 2 Figure 1.2 Genome organization of isolates in various geminivirus...... 16 Figure 1.3 Genome organizations of begomoviruses and their associated DNA satellites...... 17 Figure 2.1 Genome of Potato virus X with five open reading frames...... 23 Figure 2.2 A partial physical map of modified pCAMBIA1300 construct designated as pC-GFP with 35S , GFP gene, and T- nos terminator cassette...... 30 Figure 2.3 Schematic representation of constructs (A-E) in pC-GFP plasmid previously studied in our lab...... 31 Figure 2.4 Schematic representation of the constructs used in this study for “RNA tractor” activity...... 32 Figure 2.5 Partial DNA sequence of the pTR:127 construct used in this study as “RNA tractor”...... 32 Figure 2.6 Detection of PVX RNA and coat protein inside the chloroplast using RT-PCR and western blot...... 49 Figure 2.7 RT-PCR analyses of total and chloroplast RNAs expressed...... 53 Figure 2.8 Graphical representation of real-time PCR data to quantify translocated “RNA tractor” sequence using SYBR® Green detection method...... 56 Figure 2.9 Graphical representation of real-time RT-PCR data (using SYBR® Green detection method) showing relative translocation activity of pTR:127 compared to Eggplant latent viroid (pCELVd-GFP)...... 57 Figure 2.10 Mitochondria isolation and RT- PCR- analyses with mitochondria and total RNA from transgenic tobacco plants harboring pTR:127 construct...... 59 Figure 3.1 Photographs of symptomatic and non-symptomatic different Nicotiana species: ...... 76 Figure 3.2 Photographs of symptomatic and non-symptomatic different Nicotiana species: ...... 77 Figure 3.3 PCR-mediated detection of AEV and ToLCNDV DNA extracted from chloroplasts and leaf tissues (total DNA) of infected plants at 35 dpi...... 79 Figure 3.4 Reconstruction experiments to reject the possibility of adsorption of virions or/and DNA during the purification of chloroplasts...... 81 Figure 3.5 Phase contrast and electron microscopic studies of chloroplasts...... 83

xi

Figure 3.6 PCR-mediated detection of AEV DNA extracted from mitochondria and leaf tissues of N. benthamiana infected plants at 35 dpi...... 84 Figure 5.1 Schematic representation of the 3´end portion of tobacco chloroplast 16SrRNA (290)...... 94 Figure 5.2 Details of partial DNA sequences of the pCrbcLSD-GFP construct under the control of 35S promoter and the nopaline synthase terminator (T-nos)...... 95 Figure 5.3 Confocal microscopic observation of cv. Xanthi leaves harboring pCrbcLSD-GFP...... 95 Figure 5.4 Details of partial DNA sequences of the pCvdTCR-GFP and pC127TCR-GFP constructs under the control of the Cauliflower 35S promoter and the nopaline synthase terminator (T-nos)...... 97 Figure 5.5 Confocal microscopic observation of GFP in N. benthamiana leaves after 72 hr of agro-infiltration...... 98 Figure 5.6 Confocal microscopic observation of GFP in agrobacteria cells after 48 hr...... 99 Figure 5.7 Details of partial DNA sequences of the pCELVdpsbA-GFP construct in pC-GFP under the control of the Cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (T-nos)...... 101 Figure 5.8 Confocal microscopic observation for GFP in transgenic tobacco plant leaves and agrobacteria cells harboring pCELVdpsbA- GFP construct...... 101 Figure 5.9 Details of partial DNA sequences of the pET-GFP construct in pET29 under the control of T7 promoter and T7 terminator...... 104 Figure 5.10 Fluorescence micrograph of GFP in E. coli cells transfected with the pET-GFP construct and induced with 0.5 mM IPTG for 16 hr...... 104 Figure 5.11 Details of partial DNA sequences of the pC127pETSD-GFP construct in pC-GFP under the control of the Cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (T-nos)...... 104 Figure 5.12 Confocal microscopic observation of GFP in leaves and agrobacteria cells harboring pC127pETSD-GFP after 72 hr...... 105 Figure 6.1 Details of partial DNA sequence of Eggplant latent viroid for different constructs...... 108 Figure 6.2 The GFP arising from different ELVd-5´-UTR-GFP transcripts...... 109 Figure 7.1 Schematic representation of constructs used in this study...... 118

xii

Figure 7.2 Quantitation of equivalent GFP transcript levels for all the constructs used in this study...... 119 Figure 7.3 Detection of green fluorescence due to GFP expression (and translational efficiency) for each of the constructs (Panels 1-10) after transformation into Agrobacterium and confocal microscopy...... 122 Figure 7.4 Western blots of the enhanced GFP protein (28 kDa) using anti- GFP antiserum and alkaline phosphatase enzyme-linked secondary antibody conjugate...... 123 Figure 7.5 Confocal microscopic observation of GFP in N. tabacum leaves after 72 hr of agro-infiltration with a) pC rbcL58-GFP and b) pC-GFP constructs respectively...... 126 Figure 8.1 Confocal microscopic observation of GFP in transgenic N. tabacum leaves harboring constructs without and with hairpin structure (Panels A-I)...... 135 Figure 8.2 Western blot using anti-GFP antiserum to detect GFP (27 kDa) expression in transgenic N. tabacum cv. Xanthi plants harboring constructs in the presence or absence of a hairpin structure...... 136 Figure 9.1 A partial Schematic diagram of the binary construct pART27- AEVIR used for plant transformation...... 142 Figure 9.2 PCR-verification of transgenic N. benthamiana plants harboring pTR27-AEVIR construct...... 146 Figure 9.3 Semi-quantitative PCR-based testing of wild-type (Wt) and transgenic N. Benthamiana plants harboring pART27AEV-IR construct for their resistance against AEV after three weeks of challenging with infectious clones of AEV DNA-A and DNA- β in A. tumefaciens strain GV3101...... 147 Figure 9.4 Infectivity of infectious clones of ToLCNDV in tobacco plants...... 149 Figure 9.5 Semi-quantitative PCR-based testing of wild-type and transgenic N. Benthamiana plants harboring pART27AEV-IR construct for their resistance against ToLCNDV after three weeks of challenging with infectious clones of ToLCNDV (DNA-A and DNA- B) in A. tumefaciens strain GV3101...... 150 Figure 9.6 Organization of a Geminivirus replication origin...... 151

xiii

List of Abbreviations

A. tumefaciens Agrobacterium tumefaciens AbMV Abutilon mosaic virus AEV Ageratum enation virus AlMV Alfalfa mosaic virus AltMV Alternanthera mosaic virus ASBVd BaMV Bamboo mosaic virus BAP 6-benzylaminopurine BCTIV Beet curly top Iran virus BCTV β Beta β-ME β-mercaptoethanol BGMV Bean golden mosaic virus bp BSA Bovine Serum Albumin CaMV Cauliflower Mosaic Virus 5´cap m7GpppGp °C degree Celsius cc cubic centimeter CChMVd Chrysanthemum chlorotic mottle viroid CIP Calf Intestinal Alkaline Phosphatase cm centimeter CNV Cucumber necrosis tombusvirus CP capsid/coat protein cpDNA Chloroplast deoxyribonucleic Cq quantification cycle C-sens complementary sense CTAB Cetyl trimethylammonium bromide (hexadecyl-trimethyl- ammonium bromide cv cultivar xiv

ddH2O double distilled water DEPC Diethylpyrocarbonate DIC Differential Interference Contrast DNase deoxyribonuclease dNTP deoxynucleotide triphosphate dpi days post-inoculation dsRNA double-stranded ribonucleic acid DTT dithiothreitol E. coli Escherichia coli ECSV Eragrostis curvula streakvirus EDTA ethylenediaminetetraacetic acid EF-G elongation factor G EF-Tu elongation factor thermo unstable eIF4E Eukaryotic translation initiation factor 4E ELVd Eggplant latent viroid ER endoplasmic reticulum EtOH Ethanol FdV Ferredoxin V FIA Freund’s Incomplete Adjuvant g gravitational constant (9.8m/s2) g gram GFP Green Fluorescent Protein Gs guanosin(s) HCl Hydrochloric acid HC-pro helper-component protease HEL Helicase HELD helicase-like domain HEPES N-2-Hydroxyethylpiperazine-N'-2-Ethanesulfonic Acid hr hour IF-1 or 3 Initiation Factors 1 or 3 ihp -containing hair-pin Inac Inactivated xv

IPTG isopropyl-β-D-thiogalactopyranoside IRBS Internal Ribosome Binding Site IRES Internal Ribosome Entry Site kbp kilo base pairs kDa kiloDalton KOH Potassium hydroxide L Liter LB Luria-Bertani (media) LBA LB media with 15 g/L agar µg microgram µL microliter µM micromolar M Molar mA milliamperes MES 2-(N-) ethanesulfonic acid min minutes mM millimolar MP movement protein mRNA messenger ribonucleic acid MS Murashige and Skoog MSV streak virus MT methyltransferase mtDNA mitochondrial deoxyribonucleic acid NAA Naphthalene acetic acid NaCl sodium chloride NaOAc Sodium acetate NbRbCS Nicotiana benthamiana ribulose-1,5-bisphosphate carboxylase/oxygenase small sub-unit ncRNA non-coding ribonucleic acid NEP nuclear encoded polymerase NIG NSP-interacting GTPase Ni-NTA nickel-nitrilotriacetic acid xvi

nm nanometer NPTII neomycin phosphotransferase NSP nuclear shuttle protein nt nucleotide OCS octopine synthase terminator OD optical density ORF ORI origin PAGE polyacrylamide gel electrophoresis PCR polymerase chain reaction PD plasmodesmata Pdk pyruvate dehydrogenase kinase PEG Polyethylene glycol PGK phosphoglycerate kinase Pi post-inoculation PLMVd Peach latent mosaic viroid PMSF phenylmethylsulfonyl fluoride POL Polymerase PTGS Post-transcriptional gene silencing PVP Polyvinylpyrrolidone PVX Potato virus X RaLC radish leaf curl rbcL ribulose-1,5-bisphosphate carboxylase/oxygenase large sub-unit RbCS RuBisCO small subunit RBR retinoblastoma-related protein RBS ribosome binding site RCR rolling circle replication RFU relative fluorescence unit RNase ribonuclease RNP ribonucleoprotein rpm revolutions per minute rRNA ribosomal ribonucleic acid xvii

RT-PCR reverse transcription polymerase chain reaction RT-qPCR reverse transcription quantitative polymerase chain reaction RuBisCO Ribulose1, 5-bisphosphate carboxylase/oxygenase SD Shine/Dalgarno SDS sodium dodecyl sulphate sec second SEL size exclusion limit sgRNA subgenomic RNA siRNA small interfering RNAs TBS Tris-buffered saline 5´-TCR 5´-translation control region

TCTV Turnip curly top virus TE-1 1:10 dilution of 10 mM Tris-HCl (pH 8), and 1mM EDTA TEM Transmission TGBp triple gene block protein Tic of the inner envelope membrane of the chloroplast TIM transporter inner membrane TIR translation initiation region TMV Tobacco mosaic virus T-nos Nopalin synthase terminator Toc translocon of the outer envelope membrane of the chloroplast ToLCNDV Tomato leaf curl New Delhi virus TOM transporter outer membrane ToMV Tomato mosaic tobamovirus TPCTV Tomato pseudo-curly top virus TPs Transit Tris Tris (hydroxymethyl)aminomethane tRNA transfer ribonucleic acid TRoV turnip rosette virus TRV Tobacco rattle virus TYLCV tomato yellow leaf curl virus 3´and 5´-UTR 3´and 5´-untranslated region xviii

V Volt v/v volume/volume VIGS virus-induced gene silencing vRNA viral ribonucleic acid V-sense viral sense w/v weight/volume

xix

CHAPTER 1

1 LITERATURE REVIEW

1.1 POTEXVIRUSES

1.1.1 Replication

Potexviruses belong to the , a new family of plant RNA has been extensively studied. The genomes of the genus Potexvirus contain five open reading frames

(ORFs) encoding an RNA-dependent RNA polymerase (RdRp; replicase), three overlapping proteins, named triple gene block (TGB1-3), and the coat protein (CP) (1, 2) as shown in Figure

1.1.

1

Figure 1.1 The organization of the Potexvirus genome. (A) The RNA-dependent RNA polymerase (RdRp, replicase) gene contains a methyltransferase domain (MT), a helicase domain (HEL), and an RNA polymerase domain (POL). The three genes of the triple gene block (TGB) are partially overlapped. Arrows indicate subgenomic (sg) RNAs for expression of TGBs. (B) The organization of the three TGB genes. TGB1: The first TGB ORF encodes the TGB1 protein and has a helicase- like domain (HELD), which contains seven typical motifs of a general helicase (I, Ia, II, III, IV, V, and VI; dark boxes). TGB2: the TGB2 protein is encoded in the second TGB ORF and has two transmembrane domains (dark boxes). The GDx6GGxYxDG sequence is conserved inTGB2- encoding viruses.TGB3: The TGB3 protein is encoded by the third TGB ORF and contains a (dark box). Among the TGB3-encoding potexviruses, the TGB3 gene has a conserved C(x5) G (x6−9) C sequence (3).

These viral proteins are used either in viral replication or in movement in infected host plants (4-

7). At the early stage of infection, potexviruses, which have a (+) positive stranded RNA genome, release viral RNA (vRNA) from the virion and synthesize the virus-encoded replicase using host translation machinery. Replicase then forms a viral replication complex along with host factors and subsequently synthesizes (i) minus (-) stranded vRNA from (+) vRNA and (ii)

(+) vRNA or (+) subgenomic (sg) RNA from synthesized (-) vRNA. CP and TGB1-3 proteins

2

are derived from (+) sgRNAs and are used for encapsidation and movement of their progeny (+) vRNAs, which were synthesized from (-) vRNA as a template, into nearby uninfected cells through the plasmodesmata (PD). In moving the progeny (+) vRNAs or virions via PD into adjacent cells, most plant viruses use their own movement proteins. In the case of potexviruses, it has been established that viral cell-to-cell movement requires TGB proteins and CP (3, 5, 6, 8-

11). Solovyev, et al. (6) abridged the information about TGB proteins and TGB-mediated plant viruses. The TGB proteins have been divided into two main potex- and hordei-like TGBs groups, based on phylogeny and on differences in the viral movement mechanism (5, 12). The potex-like viruses form filamentous virions containing a monopartite RNA genome and depend on CP for cell-to-cell movement, whereas hordei-like viruses are rod-shaped, consist of multipartite RNA genomes, and do not require the CP for cell-to-cell movement (2, 5, 12, 13). Verchot-Lubicz, et al. (5) summarized and compared the movement strategies employed by TGB proteins in potex- like viruses and hordei-like viruses. Recently, Park, et al. (14) have described the recent findings on the cell-to-cell movement of potexvirus vRNA and/or virions through the PD including the intracellular trafficking and intercellular transport of vRNA. TGB1 protein is translated from sgRNA1, whereas TGB2 and TGB3 proteins are co-translated from sgRNA2 (15). Potexvirus

TGB1 protein is encoded by the first TGB ORF and contains a helicase-like domain (HELD) and this protein is also important for viral movement (16, 17). Potexvirus TGB1 protein also functions as a suppressor of RNA silencing (18, 19). Potexvirus TGB2 protein is an important membrane protein that carries two predicted transmembrane domains that interact with ER membranes and has sequence-independent RNA-binding activity (12, 20-22). TGB3 protein, which is translated by the third TGB ORF, is also an integral protein in ER membranes and is important for cell-to-cell viral movement (23, 24). Studies have shown that localization of TGB2

3

and TGB3 proteins into ER is critical for viral cell-to-cell movement (20, 23). In addition, both

TGB2 and TGB3 proteins may be responsible for gating the PD (25, 26).

1.1.2 Intercellular Transport of Potexvirus

For intercellular movement of viral RNA, most plant viruses need to increase the PD size exclusion limit and exit through the PD. Potexvirus and plant viruses, in general, pass their vRNA through the PD as its RNP movement complex (27) or the virion form (28). Lough, et al.

(29) showed that TGB1 is an integral protein for plasmodesmal gating rather than coat protein which is involved in RNP movement complex. Potexviruses employ a complex cell-to-cell movement strategy with the involvement of the triple gene block (TGB) (27). TGBp1 defined as the potexvirus movement protein, potentiates the intercellular movement of viral RNA in the presence of TGBp2 and TGBp3 (3, 27, 29-33). Studies provide evidence that the fifth ORF of potexvirus protein, the coat protein (CP), is also required for potexvirus cell-to-cell movement

(9, 34, 35). The TGBp1-RNA complex appears to be delivered to PD by means of vesicle trafficking along the ER-microfilament pathway (36, 37). In this model, TGBp2 and TGBp3 are integral membrane proteins that serve to anchor the TGBp1-RNA complex to the vesicle surface

(3, 38-40) and, following cargo delivery to PD, the TGBp2 and TGBp3 are suggested to be recycled through the endocytic pathway (38). In a new model for cell to cell movement of PVX vRNA at the entrances of PD at the late stage of infection, that was proposed by Tilsner, et al.

(41), vRNA processing and movement are highly compartmentalized at PD, i.e., replication occurs at the PD so that vRNA is rapidly passed through PD and to the nearby cells instantly after replication. In contrast to earlier models, the new model indicates that virus replication and movement are not spatially separated within the cell. However, some concerns about interactions between TBG proteins still need to be experimentally confirmed, i.e., how three TGB proteins

4

coordinate to facilitate vRNA transport (41) and whether other factors including host protein(s) are required for these interactions and for vRNA transport.

1.1.3 Intracellular trafficking of viral RNA in potexviruses

After the replication of (+) vRNA, (+) vRNA is changed to the PD-transportable potexvirus vRNA form by TGB1 protein for cell-to-cell movement through the PD. Two models (virion or a ribonucleoprotein (RNP) movement complex containing vRNA, TGB1 protein, and CP) have been suggested for the formation of PD-transportable potexvirus vRNA during the cell-to-cell movement of vRNA through the PD (14). Lough, et al. (42) showed that vRNAs of potexviruses were transported by the formation of RNP movement complex involving vRNA, TGB1 protein, and CP rather than intact virion alone. In contrast, experimental evidence has shown that the PD- transportable potexvirus vRNA form is partially or fully encapsidated by the CP subunit and that the TGB1 protein is associated with the 5′ end of the CP-coated vRNA (5, 43). As the cell-to-cell movement of potexvirus vRNA through the PD requires three TGB proteins and the CP. Studies also indicate that potexvirus TGB1 protein requires viral CP in the RNP movement complex to move together with their vRNA into PD (44, 45). Various host proteins might also be required for the formation of the RNP movement complex, but how host proteins cooperate with the RNP movement complex remains unanswered. It has been demonstrated that both TGB2 and TGB3 proteins are important membrane proteins in the ER or ER-associated vesicles located at actin filaments (12, 46). Considering the role of TGB2 and TGB3 proteins for potexvirus vRNA trafficking to PD, two models have been designed (5, 45). Verchot-Lubicz, et al. (5) summarized the first model with two pathways of potexvirus vRNA trafficking to PD based on the interactions between TGB2 and TGB3 proteins. One pathway suggests that the potexvirus RNP movement complex is transported by TGB2-induced granular vesicles as directed by TGB3 protein (TGB2/3 granular vesicles) to PD. The first pathway, therefore, suggests that the

5

potexvirus RNP movement complex is released from membrane bound bodies by TGB3 protein and that the released RNP movement complex then binds to the TGB2/3 granular vesicles in the

ER tubule and moves to the PD (5). The second pathway for the vRNA trafficking of potexvirus to PD by TGB3 protein is supported by interaction and localization assays between TGB2 and

TGB3 proteins (24, 47). In the second model, the stable association of the virion cargo with the

TGB2- and TGB3-based membrane complex and recruitment of TGB1 protein to the PD has been proposed for cell-to-cell movement of bamboo mosaic virus (48). They also found that the stable TGB2-TGB3-virion complex associates with TGB1 protein for targeting PD and suggested the refined model for potexvirus vRNA trafficking to PD (48).

1.1.4 Interaction between viral and chloroplast proteins

Various specific interactions are known to occur between viral and chloroplast proteins. Qiao, et al. (49) have reported that Potato virus X coat protein (PVXCP) interacts with the precursor of plastocyanin, a protein involved in , and thus is involved in the virus movement and symptom development processes. Tomato mosaic virus coat protein (CP) interacts with a long distance movement-related protein in tobacco, designated IP-L, and localizes at the membranes and it is believed to develop the chlorotic symptoms in infected plants

(50). The role of the chloroplast protein, N receptor-interacting protein 1, in the activation of defense signaling is affected by direct interaction with both the plant N immune receptor and the helicase domain of Tobacco mosaic virus (TMV) (51). In addition, this viral domain may also be associated with the 33K subunit of the oxygen-evolving complex of photosystem II, as a decrease in 33K subunit mRNA was observed after infection of Nicotiana benthamiana with

TMV (52). Similarly, an increase of Plum pox virus titer was observed after downregulation of the psaK gene of in infected plants (53). The HC-Pro of Potato virus Y has been shown to interact with the chloroplast division-related factor, NtMinD in the chloroplasts of

6

infected leaves (54). The HC-Pro protein of Sugarcane mosaic virus likewise interacts with the precursor of Ferredoxin-5 (Ferredoxin V) (FdV) in maize and affect the import of FdV into chloroplasts, which could lead to disruption of chloroplast structure and function (55). Kong, et al. (56) showed that silencing of PsbA, a 23-kDa oxygen-evolving complex protein, expression increased Rice stripe virus (RSV) accumulation and disease symptom severity in infected plants, suggesting an interaction between disease-specific protein (SP) of (RSV) and PsbA.

Additionally, accumulation of SP during RSV infection resulted in perturbation of chloroplast structure and function. Zhao, et al. (57) showed that Tomato mosaic tobamovirus (ToMV) movement protein (MP) interacted with the RuBisCO small subunit (RbCS) of Nicotiana benthamiana and in vivo, as silencing of Nicotiana benthamiana RbCS

(NbRbCS) enabled ToMV to induce necrosis in infected leaves, thus suggesting that NbRbCS plays a key role in tobamovirus movement and plant antiviral defenses.

Alternanthera mosaic virus (AltMV) TGB3 protein was localized near the in mesophyll cells, suggestive of facilitating virus movement between different cell types (58).

Jang, et al. (59) revealed an interaction between AltMV TGB3 and Photosystem II (PSII) oxygen-evolving complex (OEC) protein (PsbO), a nuclear-encoded major component of the chloroplast-localized OEC of PS II, surrounding chloroplast in mesophyll cells, raising the possibility that the interaction induces symptom development. Together, these findings show that the mechanisms for viral movement may differ among potexviruses (60).

1.1.5 Virion and viral RNA within chloroplasts

Previously, it was shown that tobacco mosaic virus (TMV) was accumulated in the chloroplasts of infected plants (61). However, it was later revealed that some of the isolated virions were only one-third the length of the wild-type virus and that not all of the virus-like particles actually contained TMV RNA (62). It was also demonstrated that the TMV coat

7

protein was able to encapsidate some chloroplastic RNAs, and encapsidation was more likely to occur with chloroplastic transcripts than with nuclear transcripts (63). It was then proposed that the TMV coat protein is able to encapsidate chloroplast RNA transcripts inside the chloroplast itself, and this leads to the formation of pseudovirions within the organelle (64).

Thus, it was established that both the TMV coat protein and virus-like rods are present within the chloroplasts of infected plants (65). Recently, Cheng, et al. (66) observed that Bamboo mosaic virus (BaMV) viral RNA with the coordination of chloroplast phosphoglycerate kinase localizes to chloroplasts of infected cells of Nicotiana benthamiana plant, suggesting that host factors play a key role in targeting of viral RNA to the cellular organelles.

1.1.6 Targeting of nuclear-encoded proteins to organelles

Plant cells contain two types of endosymbiotic organelles, chloroplasts, and mitochondria, where as a result of endosymbiotic gene transfer, the majority of their proteins are encoded in the nucleus which post-translationally must be transported into the respective organelle after synthesis in the cytoplasm (67-69). The most common pathway of this transport involves N- terminal targeting signals, also known as transit peptides, which are usually cleaved off after import into the organelle. Such signal peptides are recognized by import receptors on the organellar outer membrane, and precursors are targeted into the organelle through translocase complexes located on the outer and inner membranes of the organelles, such as Toc (translocon of the outer envelope membrane of the chloroplast) and Tic (translocon of the inner envelope membrane of the chloroplast) in the chloroplasts and Tom (transporter outer membrane) and Tim

(transporter inner membrane) in the mitochondria (70). The following translocation into the chloroplast or mitochondrial matrix, the targeting signals are cleaved off by either the stromal processing peptidase or the mitochondrial processing peptidase, respectively. It is known that targeting signals for mitochondria and chloroplasts are distinct from that for the endoplasmic

8

reticulum, with respect to sequence composition and predicted secondary structure. Despite similarities observed between chloroplastic and mitochondrial targeting signals, a given protein is targeted specifically into either mitochondria or chloroplasts (67, 70). However, a number of proteins have been identified that exhibit dual targeting properties, i.e., they are imported into both chloroplast and mitochondria (71, 72). In some cases, such dual targeting results from transit peptides comprising two independent transport signals in tandem. As a result of differential transcription, splicing and/or translation processes, either of the two signals can be exposed at the N-terminus of the precursor protein, where it decides the target organelle. In some cases, however, the dual attribute is due to ambiguous transit peptides, which are able to interact with the protein transport machinery of both endosymbiotic organelles (71, 72). Recently,

Baudisch, et al. (67) have estimated the number of proteins in with dual importing attributes by a combination of extended in silico analyses and protein transport experiments.

1.1.7 mRNA-based protein targeting to different organelles

Previously, it was assumed that proteins are synthesized at random locations in the cytosol and then imported into the different organelles using localization information in the polypeptide sequence (73). Over the past decades, mRNAs and ribosome subunits were observed to target to the ER membrane in the absence of translation and, hence, the signal and nascent chain.

These results raised the possibility that proteins are targeted to the ER by the localization of the mRNAs encoding them (74, 75). Supporting these possibilities, it was shown that most mRNAs encoding mitochondrial proteins were not equally distributed in the cytoplasm but enriched in the vicinity of mitochondria (76-78). Further studies also showed the mRNA localization in the proximity of chloroplast and (79, 80). In addition to targeting the protein, this mRNA-based targeting may also function to (i) keep out the protein from intracellular regions where it would be toxic, (ii) overcome the requirement for other targeting mechanisms, (iii)

9

guarantee expeditious translational responses to changing abiotic or biotic conditions, (iv) allow the regulation of the protein synthesis by cellular and extracellular stimuli that reflect demand for the product, (v) impart economic benefits from not having to localize the many copies of a protein translated from a single mRNA and (vi) substantiate translation sites that are secluded from other regions under stress. Localization is specified by a cis-acting sequence in the mRNA called a localization element or Zipcode (81). Zipcodes range from only a few nucleotides (82) to highly complex and redundant sequences of up to 1 kb (83). These codes are most often located within the 3'-UTR and in most cases sufficient for the localization of a reporter mRNA.

Currently, many of the 3'-UTR features leading to mRNA localization are known (84) and were found by experiments using fluorescence microscopy or cross-linking and immunoprecipitation

(85, 86).

1.1.8 The accumulation of Avsunviroidae viroids within the chloroplasts

Viroids are single-stranded, circular RNA plant that are approximately

247-401 nucleotides in length (87). Viroids are divided into two families, the , and the Avsunviroidae. The four members of the Avsunviroidae family are the Avocado sunblotch viroid (ASBVd), the Peach latent mosaic viroid (PLMVd), the Chrysanthemum chlorotic mottle viroid (CChMVd), and the Eggplant latent viroid (ELVd) (88). Viroids do not code for any proteins and they depend on their host factors for replication (89). It has also been shown that members of the Avsunviroidae family accumulate and replicate within the chloroplasts of infected plants (90, 91) and that these viroids may use the nuclear-encoded polymerase (NEP) of the chloroplast for their replication (92). Therefore, it has been proposed that these viroids enter the chloroplast using some endogenous RNA translocation pathway, however, the mechanism of this RNA import has yet to be described (93). Furthermore, there is very little sequence conservation between the four members of the Avsunviroidae outside of

10

their hammerhead structures, therefore secondary structure might play a more important role in the import of the RNA into the chloroplast (94). In a recent work, it has been shown that

Eggplant latent viroid RNA sequence acting as a 5'-UTR end mediates the specific trafficking and accumulation of a functional foreign mRNA into N. benthamiana chloroplasts (95, 96).

1.1.9 Non-coding RNAs in plastids

As a result of relaxed transcription and translation in plastids, many transcripts may arise from a single promoter from both strands. After their downstream processing, a number of stable RNA species are synthesized including a distinct class of -encoded non- coding (nc) RNA, however, their role still needs to be determined in plastid gene regulation

(97). Surprisingly, strand-specific RNA sequencing has shown a large number of ncRNAs in

Arabidopsis and chloroplasts (98, 99). Most of these transcribed ncRNAs are antisense to the protein-coding genes. Such antisense transcripts bind near the 3’end of the mRNA and stabilize the target transcripts by protecting the 3’ ends from 3’ 5’exoribonulceases (99).

1.1.10 Translation in chloroplast

Chloroplasts are membrane-enclosed organelles that are characteristic of photosynthetic plants and algae (100). Of all the organelles contained within a eukaryotic cell, chloroplasts and mitochondria are unique because they carry some of their own genetic information and are able to synthesize some of their own proteins (101). Chloroplasts contain double-stranded, circular that range in size from 120 to 160 kbp and typically contain four segments: a large region of single copy genes, a small region of single copy genes and 2 copies of inverted repeats (101). These genomes encode various components that are necessary for protein syntheses such as 4 ribosomal RNAs (rRNAs), 30 transfer RNAs

(tRNAs), 21 ribosomal proteins and 4 RNA polymerase subunits. The chloroplast genome also 11

encodes proteins that are involved in photosynthesis such as 28 thylakoid proteins and the ribulose-1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) large subunit (102). Although chloroplasts possess their own genome and protein synthesis machinery, these organelles are unable to exist autonomously outside of the eukaryotic cell. This is likely due to a considerable relocation of genetic information from the chloroplastic genome to the host nucleus (103). This suggests that the maintenance of the chloroplast is likely to require rigid coordination of both transcription and translation in the nucleus as well as in the chloroplast (104). Despite importing numerous peptides, the chloroplast also utilizes prokaryotic protein synthesis machinery to generate many of its own proteins. Although prokaryotic protein synthesis follows the same three steps required for eukaryotic translation (Initiation, Elongation, and

Termination), there are a few major differences. For example, while eukaryotic messenger

RNAs (mRNAs) possess 5’caps (m7GpppGp) and 3’poly-A tails, prokaryotic RNA transcripts are missing both of these structures. Without the 5’cap, a prokaryotic ribosome identifies the translational start site within an mRNA transcript by binding to a Shine-Dalgarno sequence

(typically GGAGG in chloroplasts) upstream of the initiator AUG (101, 105). The prokaryotic and eukaryotic systems also differ in the sizes of their ribosomal subunits, in the number of initiation factors involved in translation, and in the number of cistrons contained within their mRNA transcripts (105).The chloroplast utilizes a prokaryotic system to synthesize proteins encoded in its own genome. Prokaryotic translation can be divided into 3 stages: Initiation,

Elongation, and Termination. Protein synthesis initiates when the 16SrRNA of the 30S small ribosomal subunit base pairs with the Shine-Dalgarno sequence upstream of the initiator AUG in the mRNA transcript. Meanwhile, Initiation Factor 2 (IF-2) binds to a tRNA aminoacylated with formylmethionine (tRNAfMet) and facilitates the base pairing between this tRNA and the start codon of the mRNA (105). Finally, the 50S large ribosomal subunit unites with the

12

previously mentioned components to complete the initiation complex. The formation of this complex is promoted by two additional initiation factors. Initiation Factor 3 (IF-3) binds to the

30S subunit and prevents it from joining the 50S subunit when no mRNA transcript is present and Initiation Factor 1 (IF-1) promotes the dissociation of the 70S ribosome (106). In the second phase of protein synthesis, the peptide chain is elongated through the addition of amino acids. First, a new amino-acyl tRNA molecule bound to an EF-Tu elongation factor enters the ribosome, and if the correct codon-anticodon pairing is made, a molecule of Guanosine

Triphosphate (GTP) within the EF-Tu is hydrolyzed and the elongation factor dissociates from the tRNA (105). The amino-acyl tRNA then moves into the A site of the ribosome and peptidyl transferase catalyzes the formation of a new peptide bond between the amino acids in the A and P sites. Next, another elongation factor, EF-G, enters the ribosome, which triggers the hydrolysis of an attached GTP molecule. This hydrolysis than triggers a drastic change in the conformation of the ribosome that shifts the tRNAs located in the A and P sites to the P and E sites, respectively. The uncharged tRNA that is now located in the E site is expelled from the ribosome and the A site is now free to accept a new amino-acyl tRNA molecule (105). The final stage of protein synthesis is called termination and this occurs when one of the three termination codons enters the A site of the ribosome (105). Since these codons are not recognized by any tRNA molecule, an additional is not added. Rather, these codons are recognized by release factors that cleave the polypeptide from the final tRNA and release the newly synthesized protein. Release Factor 1 (RF-1) recognizes the UAA and UAG codons while Release Factor 2 (RF-2) recognizes the UAA and UGA codons. A third Release Factor

(RF-3) promotes the release of RF-1 and RF-2 as the final step in the translation process (107).

13

1.1.11 RNA transport into mitochondria

Mitochondria of the most eukaryotic cells play an integral role in cellular processes including respiration, oxidative -mediated ATP production, cellular metabolism and apoptosis (108). These organelles carry their own genome which varies depending on species

(e.g. 17 kb in human and 367 kb in ), but normally encode only a limited set of proteins (e.g. 13 in human and 32 in A. thaliana), suggesting that the most of the mitochondrial proteins are encoded in the nucleus and translocated into the mitochondria (109).

In addition to nuclear-encoded proteins, synthesis of mitochondria-encoded proteins is essential for organelle functions which require rRNAs and a complete set of tRNAs. Plant mitochondrial genomes lack several tRNA genes, consequently, nuclear-encoded tRNAs are imported from the cytosol (110). Based on genetic origin, in plant mitochondria, there are three tRNAs: 1. native mitochondrial tRNAs coded for by the mitochondrial genome, 2. chloroplast-like tRNAs, initially coded for by chloroplast DNA and finally inserted into the mitochondrial genome during evolution, and 3. cytosol-like tRNAs, coded for by the nuclear genome, which are required to import from the cytosol into the mitochondria (110). So far it is known that only noncoding

RNAs are translocated into mitochondria. The import of cytosolic 5S rRNA into mitochondria has been demonstrated in mammals, however, its functional importance remains unanswered

(111). Additionally, two other cytosolic RNAs, the RNA component of the nuclease mitochondrial RNA processing and the RNA component of RNase P, are imported in humans but their existence within the mitochondria remains questionable (112, 113). In higher plants, one-third to one-half of the mitochondrial tRNAs are encoded in the nucleus and then imported into mitochondria (114). Of the nuclear-encoded tRNAs imported from the cytosol, tRNAs aminoacylated with Glycine and Valine (tRNAGly and tRNAVal, respectively) have been most thoroughly studied. Salinas, et al. (115) demonstrated that import of tRNAGly into tobacco

14

mitochondria is sequence-dependent. They found that tRNAG1y (UCC) and tRNAGly (CCC) were detected in the cytosol and mitochondria, while tRNAGly (GCC) was only present in the cytosol.

It has been demonstrated that point in the anticodon of tRNAVal abolish both aminoacylation and import and that D- and T-domains are essential for tRNAVal import (114).

Furthermore, It has been found that both the anticodon and the D-domain regions contain essential determinants for tRNAVal(AAC) import into plant mitochondria (114). Mitochondrial tRNA import has been experimentally documented in several including protozoa, the yeast Saccharomyces cerevisiae, higher plants, and marsupials, however, little is known about the mechanism of tRNA translocation across plant mitochondrial membranes. The import of a tagged bean tRNALeu into mitochondria of transgenic potato was the first direct evidence of this phenomenon (116). Later, it was found that in to be imported, a nuclear-encoded tRNA first needs to interact with mitochondrial membrane receptors which require ATP-dependent step

(s) (117). The tRNA would then pass through the transporter outer membrane (TOM) and transporter inner membrane (TIM) complex via a still unknown mechanism.

1.2 GEMINIVIRUSES

The family is comprised of plant DNA viruses that have long been known as model systems for the elucidation of basic cellular components of the plant replication and transport machinery (118-121). This family consists of phytopathogenic viruses with characteristic twinned, quasi-isometric virions encapsidating genomes of circular single-stranded

(ss) DNA. These viruses replicate through an intermediate dsDNA molecule in the nuclei of infected host plant cells and rely on the host DNA replication machinery (122). Geminiviridae is classified into seven genera, six of which (Mastrevirus, Curtovirus, Topocuvirus, Becurtovirus,

Eragrovirus, and ) consist of viruses with monopartite genomes while the seventh one (Begomovirus) comprises of either monopartite or bipartite (Fig.2). Geminiviruses, with the

15

smallest known genome of plant-infecting viruses, replicate independently in the host cells by using bidirectional mode of transcription from some of the overlapping genes for efficient coding of proteins (121).

Figure 1.2 Genome organization of isolates in various geminivirus. lineages (LIR, long intergenic region; SIR, short intergenic region; CR, common region; rep, replication- associated protein (C1or AC1); ren, replication enhancer (C3 or AC3); trap, trans activator protein (C2 or AC2); ss, silencing suppressor; sd, symptom determinant (C4 or AC4); cp, capsid protein V1 or AV1); mp, movement protein V2 or BC1); reg, regulatory gene (V3); nsp, nuclear shuttle protein (BV1) (123).

16

1.2.1 Genus Begomovirus

Viruses of the genus Begomovirus consists of either monopartite (a single DNA) or bipartite

(with two DNA components: DNA-A and DNA-B) genomes (123-127). The DNA-A of bipartite and the single component of monopartite begomoviruses contain five or six Open Reading

Frames (ORFs) while the DNA-B contains two ORFs (BV1 and BC1, in V-sense and C-sense strand, respectively). Both DNA-A and DNA-B are approximately 2.8-3.0 kb in size.

Monopartite begomoviruses are often associated with one or smaller DNA components, about

1.4 kb in size, known as satellite DNAs (Figure 1.3).

Figure 1.3 Genome organizations of begomoviruses and their associated DNA satellites. Lollipop, origin for rolling-circle replication; C2, possible transcriptional activator protein; C4/AC4, possible symptom determinant; CP, coat protein; NSP, nuclear shuttle protein; AV2, anti-defence proteins; V2, movement protein; Rep, Replication initiator protein; TrAP, transcriptional activator protein; REn, Replication enhancer protein; MP, movement proteins; βC1, Betasatellite encoded protein (128).

Two types of satellite DNAs are known: the alpha-satellites and beta-satellites, depending upon the organization of their DNA and their effects on the symptoms produced by the helper 17

begomovirus. Both the alpha- and betasatellites are dependent upon the for replication and, in many cases, mitigate the symptoms produced by it (129). DNA-A and DNA-B components in bipartite begomoviruses differ from each other, except a short sequence of ~200 nucleotides with high sequence identity that is referred to as “common region” (CR). The genomes of monopartite (and DNA-A components of bipartite) begomoviruses are typically

∼2.8 kb in size and have genes in both orientations from a non-coding intergenic region (IR), which contains promoter elements and the origin (ori) of virion-strand DNA replication. The virion strand ori consists of a predicted hairpin structure containing a conserved (between geminiviruses) nonanucleotide (TAATATTAC) sequence in the loop and repeated upstream motifs known as “iterons”. The DNA-A component of begomoviruses consists of either five or six ORFs in both orientations. These proteins are required for multiple functions: viral replication; virus assembly; host gene regulation and silencing suppression; and vector transmission. Despite the genes are named on the basis of their functions, however, their functions can differ within the genus Begomovirus (130, 131). The virion-sense strand of most begomoviruses encodes the following two proteins:

Coat protein (CP; V1): Coat protein is required for encapsidation, insect transmission and movement in plants (128, 132, 133). It is also believed that CP interferes with nicking of DNA thus limiting the viral DNA copy number during rolling circle replication (RCR) (121, 134). It also functions as the nuclear shuttle protein (NSP) for monopartite viruses (135).

Pre-coat protein (Pre-CP; V2): A pathogenicity determinant, which is believed to involve in virus movement in plants (121, 128) and/or acts as a suppressor of RNA silencing (134, 136). It also contributes in the perinuclear distribution of begomoviruses by association with the endoplasmic reticulum (ER) and cytoplasmic strands (137).

The complementary sense strand encodes four proteins:

18

Replication-associated protein (Rep; C1):

The only virus-encoded gene product required for viral DNA replication. Rep is an RCR-initiator protein that recognizes the reiterated motifs (iterons) and nicks within the nonanucleotide sequence to initiate replication (138, 139). It also conducts ATPase and helicase activities and binding of retinoblastoma-related proteins (140).

Transcriptional activator protein (C2; TrAP):

This protein up-regulates the late (virion sense) genes (for bipartite begomoviruses) and also acts as a suppressor of RNA silencing in bipartite (128, 141) as well as monopartite begomoviruses

(142). It also prevails over virus-induced hypersensitive cell death (143, 144).

Replication enhancer protein (REn; C3): It is involved in establishing an environment conducive for optimal virus replication by interacting with host-encoded proteins (145-147).

C4 protein: The role of the C4 protein is unknown but for some viruses it is a pathogenicity determinant and also counteracts PTGS (148-150).

As mentioned earlier, the bipartite begomovirus genome comprises of two components. Both components are required for different functions; DNA-A component is responsible for replication and transcription while DNA-B is required for inter- and intracellular movement of the virus. DNA-A and DNA-B together are required for a successful systemic infection. The

DNA-B component contains two ORFs in opposite orientations encoding.

Nuclear shuttle protein (NSP; BV1): NSP is responsible for transport of viral DNA from the nucleus into the cytoplasm (151-153).

Movement protein (MP; BC1): BC1 coordinates the movement of viral DNA across plasmodesmata boundaries (152) and it is also responsible for viral pathogenic properties (154).

Its function is also mediated by V2 alone or in a complex with C4 (155).

19

1.2.2 Begomovirus infection

As with all other geminiviruses, which require an insect vector to be transmitted to other plants, begomoviruses rely entirely on their arthropod vector the whitefly Bemisia tabaci for their plant- plant transmission. The feeding of a viruliferous whitefly vector, B. tabaci, on the phloem cells of a suitable host plant leads to the beginning of the begomovirus infection cycle. As soon as the feeding starts, viral particles enter into the vascular system of the plant. From the cells in the vascular system, the viral particles are transmitted to the mesophyll cells. Once these viral particles are in the cells they become uncoated and viral DNA enters the nucleus where viral

DNA replication and transcription occur (156). For monopartite begomoviruses CP is responsible for the transfer of viral DNA into the host and later into the cytoplasm.

Bipartite begomoviruses do not need CP for movement and they use NSP to act as a shuttle for virus movement from the nucleus into the cytoplasm (151). In the nucleus, the complementary strand is synthesized following primer synthesis to produce a dsDNA intermediate, which serves as a template for transcription of viral proteins (157). Once the dsDNA is formed, bi-directional transcription starts with the help of promoter sequences located in the IR. The viral transcripts are transported into the cytoplasm for translation (133). The translated proteins enter the nucleus to carry out replication, packaging, and movement of viral DNA. The Rep protein of the begomovirus binds to the ori and starts RCR mode of replication. After accumulation of ssDNA

CP switch RCR and shuttles ssDNA into the cytoplasm (long distance movement of begomovirus DNA will be discussed in detail in the preceding section). The CP starts packaging of the viral DNA to produce virions and the virus is either transported to the next cell through plasmodesmata or taken up by the whitefly to be transmitted to the next plant.

20

1.2.3 Long distance movement within plants

The movement of geminiviruses within host plants has been studied extensively (120, 137, 151,

155, 158-161). These viruses use the DNA replication machinery of their host to amplify their genomes in the nuclei of infected plant cells (162). When the viral DNA reaches an optimum level in the nucleus it is transported out of the plant cell nucleus to undergo systemic spread by crossing plasmodesmata openings in the . Bipartite begomoviruses are dependent upon DNA-B encoded NSP and MP for their movement in host plants (152, 153, 156). The NSP supports viral DNA export from the nucleus into the cytoplasm from where MP transports viral

DNA to neighboring cells via plasmodesmata (36, 163). It has been shown that βC1 of CLCuMB can substitute the movement function of DNA-B to facilitate movement of begomovirus from the nucleus to the cell periphery (159). Monopartite begomoviruses cross cell membranes with the help of interaction between CP and Pre-CP (137). The CP of monopartite begomoviruses localizes to the periphery of the nucleus and nucleolus, thus acting as a nuclear shuttle homologous to NSP of bipartite begomoviruses. Pre-CP localizes around the nucleus and at the cell periphery with the ER. Such a localization pattern is similar to MP of bipartite begomoviruses, probably assigning movement function to these proteins (135, 137). The transport of viral ssDNA from the nucleus towards plasmodesmata is facilitated by a nuclear export signal (NES) on the CP C-terminus and NES on the Pre-CP N-terminus (132, 137).

1.2.4 Translocation of begomoviruses into chloroplast

The DNA of Abutilon mosaic virus (AbMV), a geminivirus that has a circular single-stranded

DNA genome, was isolated from intact chloroplasts (164) representing the only other example of a geminiviral genome in chloroplasts. Chloroplasts were purified from AbMV- infected and uninfected control Abutilon sellovianum var. marmorata plants. The single-stranded AbMV DNA was examined in the plastids of infected plants. The possibility of adsorption of virions or DNA 21

on the external surface of intact chloroplasts was ruled out by treating them with DNase I and protease. Furthermore, the lamellar system of plastids from AbMV-infected plants was degenerated, suggesting that the virus affected the structure of the plastids in AbMV-infected plants. Bhattacharyya, et al. (165) found that chloroplast structure was severely damaged with the coinfection of Tomato leaf curl New Delhi virus DNA-A and the betasatellite which is associated with radish leaf curl disease (RaLC), conversely, the structure of chloroplasts remained undamaged when the host cells were infected with Tomato leaf curl New Delhi virus

DNA-A alone. Furthermore, these findings demonstrate that protein βC1 encoded for by betasatellite is responsible for damaging the structure and is capable of targeting to chloroplasts, suggesting that a DNA virus-encoded protein is responsible for causing structural and functional damage to this vital organelle. With its unique origin as an converted into a subcellular organelle, a chloroplast is speculated to have potential to carry tools necessary for replication and transcription of viruses (166).

22

CHAPTER 2

2 STUDIES ON TRANSLOCATION OF RNAS FROM CYTOSOL TO ORGANELLES

2.1 INTRODUCTION

Potato Virus X (PVX) is the type member of the Potexvirus genus and systemically infects many species of the Solanaceae family (167). This virus is highly applicable as a model system for exploring various aspects of its infection and how these attributes can be exploited in the molecular biology field. This virus is very useful for genetic studies of proteins and RNA components required for infection, isolation, and biochemical characterization of viral proteins and replication complexes (168). It is a rod-shaped, filamentous virus that possesses a single- stranded, ~6435-7560 nucleotide positive-sense RNA genome. This polycistronic RNA genome is capped at the 5´ end (m7GpppGp), polyadenylated at the 3´ end, and contains five open reading frames (ORFs) (169) as depicted in Figure 2.1.

Figure 2.1 Genome of Potato virus X with five open reading frames. TGBp, Triple gene block protein; CP, coat protein; m7G, 7-methylguanylate cap; Poly-A, Polyadenylation. Note: Figure not drawn to scale.

23

The first ORF encodes a 166 kDa RNA replicase (RNA-dependent RNA polymerase). The second, third and fourth ORFs encode a 25 kDa protein, a 12 kDa protein, and an 8 kDa protein respectively. These proteins are known as the “triple gene block” (TGB) and are thought to be involved in the cell-to-cell movement of the virus (170). The fifth ORF encodes a capsid protein

(CP), which has also been implicated in viral intercellular movement (171). Some plant virus proteins, in particular, the capsid protein (CP), are known to accumulate in the chloroplasts of infected plants (172-175). The CP, as well as other viral RNAs, have been reported to translocate into chloroplasts (172, 176).

Many studies have documented the role of transit peptides and viral proteins in targeting a variety of viruses to specific subcellular regions of their hosts (14, 20, 45, 58, 59, 177, 178).

The majority of chloroplast proteins are translated in the cytoplasm as pre-proteins with amino- terminal transit peptides (TPs) that direct transport to the chloroplast via specific interactions with various components of the import machinery (172, 179). Some viruses seem to use the same

TP mechanism to direct their proteins to chloroplasts. The cucumber necrosis Tombusvirus

(CNV) uses the first 38 amino acids of the capsid protein not only to translocate the CP to the chloroplast but also the green fluorescent protein which is in fusion with the 38 amino acid from the CNV CP. This viral protein seems to contain the 14-3-3 chloroplast targeting motif which is typical to most cellular proteins which are targeted to chloroplasts (177). The TGB proteins of

PVX were shown to play an important role in the cell-to-cell movement of PVX RNA during viral infection (170). The 25 kDa protein of TGB is targeted to plasmodesmata (180) and it is also known to modulate plasmodesmata gating by increasing the size exclusion limit (SEL) to allow the 25 kDa protein as well as the viral RNA to move from cell-to-cell (181). TGBp3 (25 kDa protein) also plays an important role as a suppressor protein which could delay the onset of post-transcriptional gene silencing (PTGS) in plant tissues (182). The other two proteins 12 kDa

24

and 8 kDa were also shown to be implicated in cell-to-cell movement of viral RNA (44, 183).

The CP of PVX has also been shown to play a role in viral intercellular movement by forming ribonucleoprotein particles with the viral RNA and the 25 kDa protein; allowing the PVX RNA to move from cell-to-cell and possibly facilitating long distance movement (42, 184-186).

However, there are currently no reports showing any role of the CP and/or TGB proteins in the

RNA transport to organelles.

Of all the organelles contained within a eukaryotic cell, chloroplasts and mitochondria are unique because they carry their own genetic information and are able to synthesize some of their own proteins (187). The interactions between viruses and host components underlie the appropriate subcellular targeting of viral proteins and nucleic acids during the viral infection cycle (188-190). The genome replication of all plus-strand RNA viruses infecting eukaryotic cells is associated with cellular membranes (191). The membranes can be derived from the endoplasmic reticulum (ER), other organelles of the secretory pathway, mitochondria, chloroplasts, or from the endo-lysosomal compartment. The membrane association provides a structural framework for replication: it fixes the RNA replication process to a spatially confined place, increasing the local concentration of necessary components (192). After entry into host cells, viruses usually target a specific organelle for replication. Tobacco etch virus (193),

Cowpea mosaic virus (194), Tomato ringspot virus (195), Potato virus X (196), and Tobacco mosaic virus (197, 198) target the ER membrane; Tomato bushy stunt virus (199) and Melon necrotic spot carmovirus (200) target the and mitochondria, respectively; and

Turnip yellow mosaic virus (201), Turnip mosaic virus (202) and Bamboo mosaic virus (66) associate with the chloroplast membrane. These findings suggest that members from different viral families might be associated with the same organelle, but that members of the same family do not necessarily target the same organelle or organellar membrane (203). Otulak, et al. (204)

25

examined the Tobacco rattle virus (TRV) not only in the membranous and vesicular ER structures but other cell organelles (chloroplast and mitochondria) as well. This finding also indicates that same virus has the ability to target different cellular organelles during its infectious cycle.

Previous research conducted in our laboratory revealed the presence of PVX CP within the chloroplasts of both PVX-infected potato plants and transgenic potato plants containing the 8 kDa and CP sequences. Further, these studies showed that the dicistronic mRNA was found not only to be translocated to chloroplasts, but also the CP was translated by chloroplastic that are sensitive to chloramphenicol treatment. In addition, a Shine/Dalgarno-like (SD) sequence was identified upstream of the CP gene. This SD sequence was probably essential for the translation of CP by chloroplast ribosomes (205). Northern blot analyses were performed to confirm the existence of PVX CP messenger RNA inside the chloroplasts of infected and transgenic plants (205). Furthermore, it was also shown that a small viral sequence from the

PVX RNA is responsible for translocating the PVX RNA to chloroplasts (206). We mapped this viral RNA sequence “RNA tractor” (located near the end of 8 kDa and the start of CP genes including the small non-coding intergenic region) on the PVX genome by a series of and deletion experiments using pC-GFP binary vector, where PVX sequence is driven by the 35S promoter followed by the GFP gene and the T-nos (nopaline synthase terminator). Previous data indicate that the “RNA tractor” is composed solely of RNA sequence and there is no expressed viral protein involved in such translocation. In this respect it may be comparable to the transport and translocation of the RNA of viroids of the Avsunviridae, which do not code for any proteins and they have to rely on cellular proteins (if any) for their transport, entry to chloroplast for replication (likely using chloroplastic DNA-dependent RNA polymerase) and for exit (90).

Gomez and Pallas (95) demonstrated for the first time that an RNA sequence of Eggplant latent

26

viroid (ELVd) can be transported to chloroplast and it is also functional in this organelle. This supports the existence of a novel signaling mechanism between the host cell and these organelles. (95, 207). In an earlier study, it was demonstrated that the mRNA encoding the eukaryotic translation factor 4E enters the chloroplasts. Furthermore, the localization in the chloroplast of a heterologous GFP mRNA fused to the eIF4E RNA was also observed. However, interestingly, the eIF4E RNA was not translated in the chloroplasts (208). mRNA localization might facilitate the import of proteins targeted to specific organelles. This highlights a novel host-modulated regulatory mechanism that would be potentially able to control the gene expression and the accumulation of the nuclear-encoded proteins in chloroplasts

In a recent study, it has been shown that the Bamboo mosaic virus (BaMV) RNA could be transported to chloroplasts by interacting with nuclear-encoded chloroplast proteins (209).

The “RNA tractor” activity described here is the first report of a virus non-coding sequence that is capable of not only the translocation of its own sequence but also that of a foreign RNA sequence (GFP) to chloroplasts. Presumably, any foreign RNA could be targeted to chloroplast by this “RNA tractor” sequence. These findings suggest that the translocation of PVX RNA into chloroplasts is dependent upon a limited region of the PVX RNA transcript. However, from this work, many questions may be asked. Does the PVX RNA translocation depend upon the sequence or is it a secondary structure? Is this RNA tractor activity limited to chloroplasts or mitochondria can also be targeted? To explore these secrets, experiments are designed to answer some of the above questions.

2.2 RESEARCH PLAN

The overall objectives of this study are:

1. Detection of PVX RNA and coat protein in chloroplasts.

27

2. To determine the smallest RNA sequence required for the translocation process observed

with PVX RNA.

3. To determine the efficiency (quantitation) of translocation of “RNA tractor” to chloroplasts.

4. To compare the translocation efficiency of “RNA tractor” (pTR:127) sequence with

Eggplant latent viroid (pCELVd-GFP; used as a positive control) to chloroplasts.

5. Finally to study the translocation of “RNA tractor” sequence to plant mitochondria.

2.3 MATERIALS AND METHODS

2.3.1 Plasmid construction and transformation

The plasmid pCAMBIA1300 (CAMBIA, Canberra, Australia), a compact binary vector (8.9- kbp), is used in this study. A 35S:GFP:T-nos expression cassette (Gen Bank EF546437) of size

1.9-kbp was subcloned into this binary vector by HindIII and EcoRI sites in the multiple cloning sites and designated as pC-GFP (Figure 2.2). To create pCELVd-GFP, a chimeric DNA containing a modified Eggplant latent viroid (ELVd) sequence, (AN - HM136583) (95), pCATvd-GFP (ELVd sequence with AT-rich sequence derived from 5´-UTR of capsid protein of

Alfalfa mosaic virus (AlMV) RNA), pCATvdmut-GFP, SD-like sequence GGAGGATTCG within ELVd was replaced with CCTCCTAAGC, pC127TCR-GFP and pCELVdTCR-GFP constructs containing a translation control region (TCR) (210), comprised of 58 nucleotides of

5'-UTR and 45 nucleotides from N-terminal of ribulose-1,5-bisphosphate carboxylase/oxygenase large sub-unit (rbcL) gene and pCELVdpsbA-GFP construct comprised of ELVd sequence with 85 nucleotides of 5´-UTR of tobacco chloroplast gene psbA (211) were synthesized and cloned in pUC57 plasmid (Bio Basic Inc.). Following digestion of pUC57 by KpnI/ BamHI and NheI or/and XbaI/BglII restrictions enzymes and gel purification (QIAquick

28

Gel Extraction Kit, QIAgen), the fragments were subcloned into a pC-GFP binary plasmid using the respective restriction sites. The pCrbcLSD-GFP was generated by amplified 127 nucleotides using pTR:127 as a template and RBSKpnIF and RBSBglIIR, with an extension of rbcL anti-SD- like sequence (CCCTCCC), primers. The resulting product was cloned into the pC-GFP vector using its KpnI/BamHI sites. To generate pCSD-GFP (construct with PhageT7 trailer sequence,

T7 translational enhance RBS, is available in pET-X-series), first GFP sequence was amplified using GFP specific primers and resulting PCR product was cloned into the pET29 vector using

NdeI/BamHI sites, designated pET-GFP. Subsequently, GFP with an extension corresponding to the T7 translational enhance RBS in pET vector was amplified using F-Pet BglII and R- GFP

BamHI primers with BgIII and BamHI restriction sites respectively (Table 2.1). The obtained product after digestion and purification was introduced into the pre-existing recombinant pTR:127 construct using its BamHI site and named pC127pETSD-GFP. The construct pC8K-

GFP, containing the sequence upstream of the ATG codon of the PVX CP gene including the 8 kDa ORF and 177 nucleotides upstream of this ORF, was generated by amplifying the product using pre-existing recombinant pTR:8k as a template, subsequently the obtained product was inserted into pC-GFP in its KpnI/BamHI sites. The ATG of CP ORF was fused with ATG of

GFP ORF. To generate pChp-GFP and pChp8K-GFP, a sequence expected to form a stable hairpin was introduced in KpnI site (inac) of both pC-GFP and PC8k-GFP constructs. To create pCAT-GFP, AT-rich sequence derived from 5´-UTR of the capsid protein of Alfalfa mosaic virus

RNA was inserted into a pC-GFP construct using its KpnI (inac) and XbaI sites. To generate pCATvd80-GFP construct, ELVd sequence comprised of 80 nucleotides was cloned into a pCAT-GFP construct using its XbaI/BamHI sites. These four constructs were produced by ligating double-stranded oligonucleotides into restriction-enzyme digested plasmid DNA with compatible ends (Table 2.1). Briefly, complementary oligonucleotides synthesized by Eurofins

29

MWG (Huntsville, AL) were mixed in equimolar amounts (50 µM each), boiled and annealed by cooling to room temperature and ligated into already restriction enzyme digested pC-GFP vector using T4 DNA ligase (New England Biolabs, NEB) according to the manufacturer's protocol. All those constructs which were linearized with single restriction enzyme were also treated with Calf Intestinal Alkaline Phosphatase (CIP) (New England

Biolabs, NEB) to prevent religation of linearized plasmid DNA. The product of each ligation reaction was used to transform E.coli DH5-alpha competent cells and Kanamycin (50 µg/mL) resistant bacterial colonies were screened for the presence of the proper recombinant constructs.

Plasmid extraction was done using the QIAprep spin miniprep kit (Qiagen) or mini-prep method described by Sambrook, et al. (212).

Table 2.1 shows a complete list oligonucleotides and DNA sequence used to generate the plasmids in this study.

Figure 2.2 A partial physical map of modified pCAMBIA1300 construct designated as pC-GFP with 35S Promoter, GFP gene, and T-nos terminator cassette. GFP; green fluorescent protein, 35S; Cauliflower mosaic virus 35S promoter, T-nos; nopaline synthetase terminator, Lac p; lac promoter, lac Z α; lacZ gene alpha codes for beta- galactosidase in E.coli, L; left (T- border), R; right (T-border). Note: Figure not drawn to scale.

To determine the smallest RNA sequence required for the translocation process, a series of deletion clones (Figure 2.3 A-E) were generated from the previous dicistronic construct

(sequence between the PVX 8 kDa and CP proteins (174).

30

Figure 2.3 Schematic representation of constructs (A-E) in pC-GFP plasmid previously studied in our lab. To investigate the translocation of PVX RNA into chloroplasts, regions of the PVX sequence were cloned into PC- GFP binary vector to generate transgenic tobacco plants. A) pTR:8K-CP; this construct contains both the 8 kDa and CP genes and was produced to confirm the previously observed translocation of CP mRNA into chloroplasts. B) pTR:8K(insG80)-CP; the pTR:8K-CP clone was digested with EcoRI and filled with a Klenow fragment; which caused the insertion of a G in the 80th nt position of the 8 kDa gene. This produces a frame shift mutation in the resulting protein. C) pTR:8K; In this construct, the CP gene was truncated so that only the first 13 nt remained. PCR inserts were cloned into PC-GFP binary vector using KpnI/XbaI sites. D) pTR:224; this construct consists of 224 nt of the PVX sequence, including 201 nucleotides from the 3´ end of 8 kDa gene, 10 nt of intergenic region and the first13 nucleotides from the CP gene. E) pTR:127; this construct contains 127 nt of the PVX sequence (“RNA tractor”), including 104 nt from the 8 kDa gene, 10 nt of intergenic region and 13 nucleotides from the CP gene. 35S; Cauliflower mosaic virus 35S promoter, 8k; 8 kDa gene, IR; intergenic region, CP; coat protein, GFP; green fluorescent protein, T-nos; nopaline synthetase terminator. Note: Figures not drawn to scale.

In this study two potential constructs pTR:127 and pTR:27 are used to verify the PVX RNA sequence responsible for translocation of not only PVX RNA but also GFP RNA from cytosol to chloroplasts. Two constructs namely pCELVd-GFP containing Eggplant latent viroid (ELVd) (a non-coding viroid) sequence and pC-GFP are included as positive and negative controls respectively (Figure 2.4 A-D).

31

Figure 2.4 Schematic representation of the constructs used in this study for “RNA tractor” activity. To confirm the trafficking of “RNA tractor” into chloroplasts, transgenic tobacco plants were generated using these constructs. A) pC-GFP; this construct, without any PVX sequence, is included as a negative control B) pTR:27; this construct contains only last 5 nt of 8 kDa, 10nt of intergenic region and 12 nt from the CP gene C) pTR:127; this construct comprises 127 nt of the PVX sequence (“RNA tractor”), including 104 nt from the 8 kDa gene, 10 nt of intergenic region and 13 nt from the CP gene. D) pCELVd-GFP; in this construct a chimeric Eggplant latent viroid (ELVd) sequence consisting of 330 nt (Accession Number - HM136583) is used for a positive control. 35S; Cauliflower mosaic virus 35S promoter. 8k; 8 kDa gene. IR; intergenic region. CP; coat protein. GFP; green fluorescent protein. T-nos; nopaline synthetase terminator. Note: Figures not drawn to scale.

pTR:127 35S KpnI 8k (104 nt) …//TATATAAGGAAGTTCATTTCATTTGGAGAGAACACGGGGACggtacccaggcCTGGAGAATCAATCACA GTGTTGGCTTGCAAGTTAGATGCAGAAACCATCAGAGCCATTGCCGATCTCAAGCCACTCTCCGTTGA IR (10 nt) CP (13 nt) XbaI Inac GFP T-nos ACAGTTAAGTTTCCATTGATACTCGAAAGATGTCAGCACCAGgctagaggatccATGGTGAG//……………

Figure 2.5 Partial DNA sequence of the pTR:127 construct used in this study as “RNA tractor”. KpnI and XbaI are restriction enzymes that were used in the cloning of the pTR:127 construct into the pC-GFP binary plasmid. XbaI (Inac) indicates the inactivated XbaI site.

32

Table 2.1 Oligonucleotides/ primers used in the production of different constructs.

Constructs Oligo Name/ Oligo/Primer sequence* (5'-3´) Cloning Remarks sites** pTR:127 S8K-F AATATTGGTACCCAGGCCTGGAGAATCAATCACAGTGTTG KpnI 8K-R ACTACTGCTAGCCTGGTGCTGACATCTTTCGAGTATC NheI pTR:27 27 sense TAGGCCTATTGATACTCGAAAGATGTCAGCACCAT XbaI / 27 antisense TAGATGGTGCTGACATCTTTCGAGTATCAATAGGCCTAGATC KpnI pET-GFP F-GFPNdeI AATTAACATATGGTGAGCAAGGGCG NdeI/ R- GFP BamHI ACGTGGATCCTTTACTTGTACAGCTCGCC BamHI pCrbcLSD- F-RBSKpnI ATGTACGGTACCCAGGCCTGGAGAATCAATCACAGT KpnI/ GFP R-BSBglII AATTATAGATCTCCCTCCCTGGTGCTGACATCTTTCG BglII pC8k-GFP 12K-F ATCGGGTACCCTAGAAATAGTTTACCCC KpnI/ 12K-R CCATGGATCCTCTAGCTGGTGCTGACAT BamHI pcSD-GFP F-Pet BglII. CACTCCAGATCTAATAATTTTGTTTAACTTTAAG BglII/ R- GFPBamHI ACGTGGATCCTTTACTTGTACAGCTCGCC BamH1 pChp-GFP ACGCGCTCCCCCCGGGGGGTCGACCCCCCGGGGGGAAAGCAGTACStem loop sense KpnI pChp8k-GFP Stem loop antisense TGCTTTCCCCCCGGGGGGTCGACCCCCCGGGGGGAGCGCGTGTAC (inac) pCAT-GFP AT sense TTAAATCTAGCTATATAAGGAAGTTCATTTCATTTGGAGAGGGTTTTTATT KpnI TTTAATTTTCTTTCAAATACTTCCAGGATCAGTAC AT anti sense TGATCCTGGAAGTATTTGAAAGAAAATTAAAAATAAAAACCCTCTCCAA ATGAAATGAACTTCCTTATATAGCTAGATTTAAGTAC pCATvd80- 80 ELVd sense CTAGCACTTTAAATTCGGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGT XbaI GFP CCCTTCCCCAAACCCTTACTTTGTAAGTGTGGTTCG (inac)/ 80 ELVd antisense GATCCGAACCACACTTACAAAGTAAGGGTTTGGGGAAGGGACTCTTGGA BamHI GGAACGTTTAAAGGACGAATCCTCCGAATTTAAAGTG pCATvd-GFP Eggplant latent 5´GCTAGCTATATAAGGAAGTTCATTTCATTTGGAGAGGGTTTTTATTTTT NheI/ viroid (ELVd) AATTTTCTTTCAAATACTTCCAGGATCGGTACCTTGGCGAAACCCCATTTC BamHI chimeric sequence GACCTTTCGGTCTCATCAGGGGTGGCACACACCACCCTATGGGGAGAGGT with an At-rich CGTCCTCTATCTCTCCTGGAAGGCCGGAGCAATCCAAAAGAGGTACACCC leader sequence. ACCCATGGGTCGGGACTTTAAATTCGGAGGATTCGTCCTTTAAACGTTCC DNA was TCCAAGAGTCCCTTCCCCAAACCCTTACTTTGTAAGTGTGGTTCGGCGAA synthesized. TGTACCGTTTCGTCCTTTCGGACTCATCAGGGAAAGTACACACTTTCCGA Sequence of only CGGTGGGTTCGTCGACACCTCTCCCCCTCCCAGGTACTATCCCCTTTCCAG plus strand is given. GATTTGTTCCCAGATCTAAAAAGCCTTCCATTTTCTATTTTGATTTGTAGA AAACTAGTGTGCTTGGGAGTCCCTGATGATTAAATAAACCAAGATTTTAC CATGGGATCC pCELVd-GFP Eggplant latent GGTACCTTGGCGAAACCCCATTTCGACCTTTCGGTCTCATCAGGGGTGGC KpnI viroid (ELVd) ACACACCACCCTATGGGGAGAGGTCGTCCTCTATCTCTCCTGGAAGGCCG /BamHI sequence. DNA was GAGCAATCCAAAAGAGGTACACCCACCCATGGGTCGGGACTTTAAATTC synthesized. The GGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAACCCTT sequence of only plus ACTTTGTAAGTGTGGTTCGGCGAATGTACCGTTTCGTCCTTTCGGACTCAT strand is given. CAGGGAAAGTACACACTTTCCGACGGTGGGTTCGTCGACACCTCTCCCCC TCCCAGGTACTATCCCCTTTCCAGGATTTGTTCCCGGATCC

33

Constructs Oligo Name/ Oligo/Primer sequence* (5´-3´) Cloning Remarks sites** pCATvd mut-GFP SD-like 5’GCTAGCTATATAAGGAAGTTCATTTCATTTGGAGAGGGTTTTTATTTT NheI/ (GGAGGATTCG) TAATTTTCTTTCAAATACTTCCAGGATCGGTACCTTGGCGAAACCCCATT BglII sequence is TCGACCTTTCGGTCTCATCAGGGGTGGCACACACCACCCTATGGGGAGA replaced with anti- GGTCGTCCTCTATCTCTCCTGGAAGGCCGGAGCAATCCAAAAGAGGTAC ACCCACCCATGGGTCGGGACTTTAAATTCCCTCCTAAGCTCCTTTAAAC SD-like GTTCCTCCAAGAGTCCCTTCCCCAAACCCTTACTTTGTAAGTGTGGTTCG (CCTCCTAAGC) GCGAATGTACCGTTTCGTCCTTTCGGACTCATCAGGGAAAGTACACACT sequence. TTCCGACGGTGGGTTCGTCGACACCTCTCCCCCTCCCAGGTACTATCCCC TTTCCAGGATTTGTTCCCAGATCT pCELVdpsbA- 5´-UTR of psbA gene 5´GGTACCTTGGCGAAACCCCATTTCGACCTTTCGGTCTCATCAGGGGTG KpnI/ GFP is included for GCACACACCACCCTATGGGGAGAGGTCGTCCTCTATCTCTCCTGGAAGG BamHI translation in CCGGAGCAATCCAAAAGAGGTACACCCACCCATGGGTCGGGACTTTAA chloroplasts. ATTCGGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAA CCCTTACTTTGTAAGTGTGGTTCGGCGAATGTACCGTTTCGTCCTTTCGG ACTCATCAGGGAAAGTACACACTTTCCGACGGTGGGTTCGTCGACACCT CTCCCCCTCCCAGGTACTATCCCCTTTCCAGGATTTGTTCCCAGATCTAA AAAGCCTTCCATTTTCTATTTTGATTTGTAGAAAACTAGTGTGCTTGGGA GTCCCTGATGATTAAATAAACCAAGATTTTACCATGGGATCC pC127TCR-GFP 5´-translation control GGTACCCAGGCCTGGAGAATCAATCACAGTGTTGGCTTGCAAGTTAGAT KpnI/ region of the rbcL GCAGAAACCATCAGAGCCATTGCCGATCTCAAGCCACTCTCCGTTGAAC BglII gene, comprised of AGTTAAGTTTCCATTGATACTCGAAAGATGTCAGCACCAGTCTAGAGTC 14 N-terminal amino GAGTAGACCTTGTTGTTGTGAGAATTCTTAATTCATGAGTTGTAGGGAG acids and 58 of 5´- GGATTTATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAA UTR region, was GCTAGATCT added for translation in the chloroplasts. pCELVdTCR- 5´-translation control GGTACCTTGGCGAAACCCCATTTCGACCTTTCGGTCTCATCAGGGGTGG KpnI/ GFP region of the rbcL CACACACCACCCTATGGGGAGAGGTCGTCCTCTATCTCTCCTGGAAGGC BamHI gene, comprised of CGGAGCAATCCAAAAGAGGTACACCCACCCATGGGTCGGGACTTTAAAT 14 N-terminal amino TCGGAGGATTCGTCCTTTAAACGTTCCTCCAAGAGTCCCTTCCCCAAACC acids and 58 of 5´- CTTACTTTGTAAGTGTGGTTCGGCGAATGTACCGTTTCGTCCTTTCGGAC UTR region, was TCATCAGGGAAAGTACACACTTTCCGACGGTGGGTTCGTCGACACCTCT added for translation CCCCCTCCCAGGTACTATCCCCTTTCCAGGATTTGTTCCCAGATCTGTCG in the chloroplasts. AGTAGACCTTGTTGTTGTGAGAATTCTTAATTCATGAGTTGTAGGGAGG GATTTATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGC TGGATCC * Underlined bold letters indicate restriction endonuclease recognition sequences. ** Restriction endonuclease recognition sequences introduced into the primers to facilitate cloning of fragments into PC-GFP.

All these constructs were transformed into E. coli DH5α cells. The presence and accuracy of

each inserted DNA sequence in the final recombinant constructs were confirmed by DNA

sequencing (The Centre for Applied Genomics, Toronto, Canada) using the GFP-R reverse

primer Table 2.2. Subsequently, these confirmed clones were transformed into Agrobacterium

tumefaciens strain GV3101 as given in section 2.3.5.

34

2.3.2 Heat shock transformation of E.coli

Escherichia coli (strains DH5 alpha or BL21- CodonPlus used for pET vector only) were made competent and transformed using a calcium chloride heat shock method described by Sambrook, et al. (212). A glycerol stock of E. coli, strain DH5 alpha, was used to inoculate 2 mL of LB medium (1% tryptone, 0.5% bacto yeast extract and 1% sodium chloride, pH 7.5 adjusted with 1

M NaOH), and the culture was grown overnight at 37°C on a shaker (225 rpm). Two hundred microliter of the overnight culture was added to 25 mL fresh LB media and set on a 37°C shaker for an additional 2-3 hours (hr) until the optical density at 595 nm (OD595) was 0.4-0.6. The culture was incubated on ice for 10-20 min and then divided into two tubes which were centrifuged at

3,000 g at 4°C for 5 min. The supernatant was decanted and the pellet was resuspended in 5 mL of sterilized ice-cold 50 mM calcium chloride and incubated 20 min on ice. The cells were pelleted under the same conditions for 5 min. The supernatant was discarded and the pellet was resuspended in 670 μL of ice-cold 100 mM calcium chloride. The tubes were chilled on ice for

30 min. Aliquots of 200 µL were used for transformation with 5 μL ligation mixture (500 ng

DNA of each undigested and digested plasmids used as positive and negative controls respectively). After chilled on ice for 30 min, heat-shock was performed on all samples at 42°C for 50 sec followed by chilled on ice for 2 min. Eight hundred microliter of fresh LB medium was added to each sample and tubes shaked (225 rpm) at 37°C for 45 min. The cells were pelleted at 10, 000 g for 1 minute at room temperate and 800 μL of the supernatant was discarded. The pellet was resuspended in the remaining supernatant and evenly plated on LBA plates (LB media, 15 g/L agar) with 50 μL/mL Kanamycin. The agar plates were inverted and incubated at 37°C overnight for growth. Single colonies were selected and grown in 2 mL LB media supplemented with 50 μL/mL Kanamycin in a 37°C shaker and plates were stored at 4°C. 35

Plasmid DNA was extracted from these cultures (see section 2.3.3). Cloning was then confirmed by sequencing the plasmid insert using a GFP reverse primer (Table 2.1).

2.3.3 Isolation and purification of plasmid DNA from E.coli (mini-prep)

E. coli cells (store at -80°C) were used to inoculate 2 mL of LB media (1% tryptone, 0.5% bacto yeast extract and 1% sodium chloride, pH 7.5 adjusted with 1M NaOH) supplemented with the appropriate selection antibiotic (60 μg/mL Ampicillin for pUC 57 plasmid and 50 μg/mL

Kanamycin for constructs in pC-GFP) and the cells were cultured overnight at 37°C on an orbital shaker (225 rpm). The plasmid DNA was extracted using a modified method as described previously by Sambrook, et al. (212). E.coli cells were pelleted at 10, 000 g for 2 min. The supernatant was decanted and pellets were resuspended in 100 μL of Solution I (50 mM glucose,

10 mM EDTA pH 8.0, 25 mM Tris-HCl pH 8.0) stored at 4°C and 5 mg/mL lysozyme stored at -

20°C. After a 10 min incubation period at room temperature, 200 μL of freshly prepared Solution

II (0.2 N sodium hydroxide (NaOH) and 1% sodium dodecyl sulphate (SDS)) was added to each sample to promote lysis of bacterial cells, denaturation of cellular proteins, chromosomal DNA, and degradation of cellular RNA. The solution was thoroughly mixed by gently inverting the tubes and chilled on ice for 20 min followed by adding 150 µL of ice-cold neutralizing Solution

III (3M sodium acetate pH 4.8). After thoroughly mixing, samples were incubated on ice for 45 min and centrifuged at 14,000 g for 5 min at 4°C to separate precipitated proteins, lipids, and chromosomal DNA from plasmid DNA. The supernatant with plasmid DNA of each sample was transferred to a new tube and mixed with 0.6 volumes of isopropanol. After incubation at room temperature for 1 hr, plasmid DNA was pelleted at 14,000 g for 15 min. Plasmid DNA pellets were washed with 70% ethanol to remove salt followed by 95% ethanol. These pellets were air- dried resuspended in 50 μL of TE-1 buffer (1 mM Tris-HCl pH 8.0 and 0.1 mM EDTA pH 8.0)

36

and purified by adding an equal volume of phenol (saturated with 0.1 M Tris-HCl pH 8.0). Each sample was thoroughly mixed by vortexing and centrifuged at 14,000 g for 5 min at room temperature. The top phase was dispensed without disturbing the interface into a new tube. Two volumes of saturated chloroform stored at 4°C were added to each sample. After mixing, samples were centrifuged at 14,000 g for 5 min at room temperature. The chloroform was removed and this step was repeated. The aqueous phase containing DNA was taken into a new tube and sodium acetate was added to a final concentration of 0.1 M along with 2.5 volumes of ice-cold

95-100% ethanol. The samples were thoroughly mixed and stored at -20°C for further downstream applications.

2.3.4 Gel electrophoresis

DNA and RNA samples were analyzed using gel electrophoresis. TBE buffer (0.1 M Tris base,

0.5 M Boric acid, and 2 mM EDTA pH 8.0) was used for both the preparation of the agarose gel

(1-2%) as well as the running buffer. The DNA or RNA was diluted with 5 μL of TE-1 and 3 μL loading dye (0.25% xylene cyanol, 0.25% bromophenol blue, 20% glycerol). After loading the sample, the gel was subjected to electrophoresis at a constant current of 50 mA and voltage of

120 V. Once the bromophenol dye had migrated half-way down the gel, the gel was stained with

1% ethidium bromide and photographed under ultraviolet light (300 nm) with a transilluminator.

2.3.5 Agrobacterium transformation

A freeze-thaw method for transformation of Agrobacterium tumefaciens strain GV3101 was used as reported previously (213) with minor modifications. A single colony of A.tumefaciens was selected and grown in 2 mL LB medium containing 50 µg/mL Gentamycin (BioBasic) at 28°C on a shaker at 225 rpm. Overnight cell culture was diluted with 50 mL fresh LB medium and grown at 28°C until cells reached an optical density (OD595) of 0.4. The cells were harvested by

37

centrifugation at 3,000 g for 10 min and resuspended in 1 mL precooled 20 mM calcium chloride and incubated on ice for 20 min. Aliquots of 100 µL were used directly for transformation with plasmid DNA (500 ng of the respective constructs) and incubated further for 20 min on ice. In the next step, the mixture of cells, calcium chloride, and DNA was momentarily frozen in liquid nitrogen and then incubated at 37°C for 5 min. After dilution in 1 mL LB-medium, the cells were incubated 3 h at 28°C with gentle shaking (150 rpm). Cells were pelleted down by a brief spin and the supernatant was discarded while leaving behind 100 µL of the media. Cells were mixed well with the media, plated on LB plates containing Kanamycin (100 µg /mL) and Gentamycin

(50 µg/mL) and incubated for 2 days at 28°C. Single colonies from the respective plates with the various constructs were recovered from the plates and grown in 2 mL LB media with Kanamycin and Gentamycin overnight at 28°C with gentle shaking. Next day, 200 µL of the culture was transferred to 20 mL of fresh medium supplemented with the same antibiotics and 100 µM acetosyringone and shaked for 5-6 hr at 28°C until cells reached an optical density (OD595) of

0.4-0.6. These cultures were used for plant transformation and also mixed with autoclaved glycerol (1:1 v/v) and stored at -80°C.

2.3.6 Plant transformation

Healthy viable seeds of tobacco (Nicotiana. tabacum cv. Xanthi) were surface-sterilized by rinsing in 10% household bleach with 0.05% tween-20 (as a surfactant) for 10 min and then washed 3-5 times in sterile distilled water. Seeds were blotted dry on sterilized Whatman filter paper and cultured on ½ MS medium (2.2 g/L MS salts, 15g/L sucrose, 8 g/L agar, pH 5.8 adjusted with 1M KOH) in GA-7 magenta vessels (Sigma- Aldrich). Stable Agrobacterium- mediated transformation was performed as described by Horsch, et al. (214) with some minor modifications. Four to five weeks old plants were used for transformation. Explants (leaf discs,

38

2-3 mm) were co-cultivated for 10-20 min with Agrobacterium cultures (prepared as mentioned in section 2.3.5. These Agrobacterium infected explants were then blotted on sterile filter paper and placed with the abaxial surface touching the regeneration MS1 medium (4.4 g/L MS salts,

30g/L sucrose, 2 g/L 2-(N-morpholino) ethanesulfonic acid (MES) , 1 mg/L 6-benzyl- aminopurine (BAP), 0.4 mg/L naphthalene acetic acid (NAA), and 8 g/L agar, pH 5.8) in Petri- dishes. After three days, transformants were selected on the regeneration MS2 medium (4.4 g/L

MS salts, 30 g/L sucrose, 2 g/L MES, 1 mg/L BAP, 0.4 mg/L NAA, 8 g/L agar, 0.4g/L

Carbenicillin and 0.02 g/L Hygromycin, pH 5.8). Following a 4-6 week culture period,

Hygromycin resistant shoots were transferred to a phytohormone-free ½ MS medium containing

0.4 g/L Carbenicillin and 0.02 g/L Hygromycin in magenta vessels. After 4-6 weeks, the transformants were confirmed by PCR of plant chromosomal DNA and expression was verified by RT-PCR of total plant RNA using the primer sets (Table 2.2). Transgenic plants with roots were transferred from Magenta vessels to pots containing Pro-Mix (Premier Tech,

Canada). Plastic pots were enveloped in polyethylene bags to preserve humidity for one week.

The plants were grown at 23-27°C under 16 hr light/8 hr dark condition in an insect-free greenhouse. All the cultures were kept in the growth chamber at 23±1°C under 16 hr photoperiods of 3000 Lux supplied with cool white fluorescent tube lights. All plant growth regulators (filter sterilized) were added after autoclaving the media. All operations of tissue culture and transformation were carried out in laminar airflow sterile cabinet.

2.3.7 Infection of N. tabacum cv. Xanthi with PVX and virus isolation

N. tabacum cv. Xanthi is a good propagation host for PVX. Plants (4 true-leaf-age) were lightly dusted with Carborundum (400 mesh) and inoculated with infected leaf extracts. After 20 min, the infected plants were washed to remove any residual inoculum. The inoculated plants were

39

kept under greenhouse conditions (23-27°C, 16 hr photoperiod). Two-three weeks post- inoculation (pi), the virus was purified according to the method of AbouHaidar, et al. (215).

Infected leaves were homogenized in 0.1 M Tris-borate buffer, pH 7.5, 0.25% β-mercaptoethanol

(βME) (2 mL of buffer for 1 g of leaves). Subsequent steps were performed at 4°C.

Homogenized tissue was squeezed through four layers of cheesecloth with the addition of n- butanol to the plant sap to a final concentration of 6%. The mixture was kept on ice for 45 min with constant stirring. A low-speed centrifugation for 15 min was then performed (15,000 g) and the supernatant was saved. The virus was precipitated from the supernatant by the addition of polyethylene glycol (PEG M, 8,000) to a final concentration of 8% in the presence of 2% sodium chloride (NaCl) and left at 4°C for 30 to 60 min. After centrifugation at 15,000 g for 10 min, the pellets were resuspended in 0.1 M Tris-borate buffer, pH 7.5. The virus solution was then centrifuged three times at 7,500 g for 5 min each. The supernatant was overlaid onto a 4 mL cushion of 30% sucrose in 0.1 M Tris-borate buffer, pH 7.5 (w/v), in Ti 60 ultracentrifuge tubes

(Beckman). The virus was then pelleted at 86,500 g (35,000 rpm, Ti 60 rotor) for 3 hr. Pellets were re-dissolved in Tris-borate buffer, pH 7.5 (w/v), in Ti 60 ultracentrifuge tubes (Beckman).

The virus was then pelleted at 86,500 g (35,000 rpm, Ti 60 rotor) for 3 hr. Pellets were re- dissolved in the same buffer as above overnight at 4°C and centrifuged three times at 7,500 g for

10 min each. For further purification, the virus in the supernatant can be centrifuged in a CsCl density gradient for 17 hr at 86,500 g at 15°C. Virus band can be collected and diluted 4 times with 0.1 M Tris-borate acid buffer, pH 7.5. The virus can be sedimented by centrifugation at

100,000 g for 2 hr re-dissolved in the same buffer. OD readings were taken at 260 and 280 nm to determine the purity of the virus (A260/A280 ratio of 1.2 for PVX). The concentration of the virus

260nm was determined using an extinction coefficient (E 0.1%,1 cm = 3.0 for PVX) (216). The virions

40

were utilized in a reconstruction control experiment to rule out externally adsorbed virions on chloroplasts.

2.3.8 Extraction of viral genomic RNA

Before the isolation of RNA, purified virions were subjected to DNase I treatments according to the manufacturer’s instructions (New England Biolabs, NEB) to remove host DNA left in the virus. The reaction was carried out at 37°C for 30 min and the reaction was terminated by

EDTA. Treated virus solution was then subjected to a high-speed centrifugation at 86,500 g for 2 hr and the virus pellets were dissolved in diethylpyrocarbonate-treated distilled water (DEPC- dH2O). The viral RNA was extracted from purified virions according to the methods of

AbouHaidar, et al. (215). Virions were incubated in 0.1% (w/v) SDS at 37°C for 10 min. The

RNA was extracted with 2 volumes of phenol/chloroform (1:1 v/v) at 40°C with occasional vortexing (phenol was equilibrated with 0.1 M Tris-HCl, pH 4.0 containing 0.2% βME). The aqueous phase was re-extracted with an equal volume of phenol/chloroform and subsequently subjected to two chloroform extractions with 2 volumes of chloroform/isoamyl alcohol (24:1, v/v). The RNA was precipitated by the addition of sodium acetate (NaOAc) to a final concentration of 0.1 M and 2.5 volumes of ice-cold 95% ethanol (EtOH). The mixture was chilled to -70°C for 15-20 min (or -20°C overnight). Viral RNA was centrifuged at 12,000 g for

30 min. RNA pellets were rinsed with 70% EtOH, vacuum-dried for 5 min, and dissolved in a desired volume of DEPC-dH2O. The purity and concentration of the RNA were determined

260nm according to the OD readings at 260 and 280 nm (E 0.1%,1 cm =25 for RNA). The virion RNA was utilized in a reconstruction control for chloroplastic RNA isolation as well as in a positive control RT-PCR analyses.

41

2.3.9 Chloroplast isolation

Chloroplasts were isolated from transgenic, non-transgenic and PVX- infected plants using the modified method (205). Each isolation step was performed at 4°C separately. Twenty grams of leaves were harvested and homogenized with mortar and pestle in 100 mL of cold grinding buffer (50 mM HEPES-KOH, pH 7.3, 330 mM mannitol, 0.1% BSA, 1 mM MgCl2, 1 mM

MnCl2, 2 mM Na2EDTA, 1 mM DTT). Homogenate was filtered through eight layers of cheesecloth and the filtrate was pelleted at 500 g for 2 min to remove the plant debris. After that, the suspension containing chloroplasts was sedimented by centrifugation at 4°C, 2,500 g for 20 min. Subsequently, each pellet containing the chloroplasts was carefully resuspended in 1 mL grinding buffer. These chloroplasts in each sample were counted by haemocytometer and the quantity was equally adjusted ensuring a similar sample size. Each sample was loaded on top of a sucrose step gradient developed with 4 mL of 30%, 3 mL of 45%, and 2 mL of 60% sucrose in grinding buffer and centrifuged at 77,140 g for 55 min. Intact chloroplasts were collected from the interphase between 30% and 45% sucrose, washed twice with washing buffer (50 mM

HEPES-KOH, pH 8.0, and 330 mM mannitol) and resuspended in 1 mL washing buffer. The purified chloroplasts were visualized under a light microscope to confirm their integrity. Each suspension was incubated at 30°C with RNase A (100 µg/mL) for 40 min to ensure that no cytoplasmic RNA associated with the chloroplasts and/or first with proteinase K (4000 µg/mL) in case of PVX-infected plants followed by twice washing and then RNase A (100 µg/mL). After washing, each pellet was gently resuspended in 1 mL of washing buffer and treated with proteinase K (4000 µg/mL) for 40 min to inactivate the RNase A. These chloroplasts were washed twice with 15 mL of washing buffer. After the final washing, the chloroplasts were used for protein isolation or/and lysed for RNA isolation using phenol-chloroform method.

Subsequently, isolated RNAs were treated twice with DNAse1 (New England Biolabs, NEB) to 42

remove any traces of genomic DNA. After phenol/chloroform purification, the RNAs were precipitated by the addition of sodium acetate (NaOAc) to a final concentration of 0.1 M and 2.5 volumes of ice-cold 95% EtOH and stored at -20°C. Next day RNAs were centrifuged at 12,000 g for 30 min and the pellets were rinsed with 70% EtOH, vacuum-dried for 5 min, and dissolved in a desired volume of DEPC-dH2O. RNA concentration and the 260/280 nm absorbance ratios were determined for purity using an ND-1000 Spectrophotometer (NanoDrop Technologies Inc.,

USA). For reconstruction experiments, purified chloroplasts (1 mL) were incubated with 5 µg of purified PVX RNA (extracted from purified virus particles). Half of this sample was used to extract chloroplast RNA without any treatment with RNase A and used as a positive control. The remaining 0.5 mL sample was treated with 100 µg/mL of RNase A for 60 min at room temperature followed by washing. Washed chloroplasts were again resuspended in 0.5 mL washing buffer and treated with 4,000 µg/mL proteinase K for 60 min followed by three washings.

2.3.10 cDNA synthesis and RT-PCR

Samples of DNAse-treated total and chloroplast RNAs were subjected to 200 units of M-MLV reverse transcriptase (New England Biolabs, NEB) with the GFP187-R, 16SrRNA187-R,

Act187-R, and PVXCP-R reverse primers shown in Table 2.2. Two hundred and fifty nanograms of RNA was used as a template for cDNA synthesis with 200 units of M-MLV reverse transcriptase, 400 nM of each primer and 500 of mM dNTPs in each reaction of 20 µL final volume. PCR reaction were carried out on 2 µL cDNA in a final volume of 30 µL, with reagents provided by New England BioLabs (longTaq polymerase), in a PTC-100 thermocycler

(MJResearch). The PCR was performed at 95°C for 5 min, followed by 95°C for 50 sec, 60°C for 50 sec, 72°C for 50 sec for 32 cycles, and 72°C for 5 min. A minus RT control was included

43

in each RT-PCR reaction to check for any possible genomic DNA contamination. All the primers used to amplify the total and chloroplast RNAs are displayed in Table 2.2.

Table 2.2 Primer sequences used for semi-quantitative and real time RT-PCR. Target Forward (F) and reverse (R) primers (5´-3´) Gene RT-PCR sequence Bank product Accession size/bp No GFP GFP187-F ACGTAAACGGCCACAAGTTC JQ733047 187 GFP187-R AAGTCGTGCTGCTTCATGTG

16SrRNA 16SrRNA-F GAAGAACCTTACCAGGGCTTGA Z00044.2 187 16SrRNA-R CAGTCTGTTCAGGGTTCCAAAC

Actin Act187-F AGTCCTCTTCCAGCCATCCA U60495 187 Act187-R AGCCAAAGCCGTGATTTCC

PVX 8K S8K-F AATATTGGTACCCAGGCCTGGAGAATCAATCACAGTGTTG - - 8K-R ACTACTGCTAGCCTGGTGCTGACATCTTTCGAGTATC

PVXCP PVXCP-R AAAATACTATGAAACTGGGGTAG - -

2.3.11 Real-time RT-PCR

Real-time RT-PCRs were performed using a CFX96 Real-Time PCR Detection System (Bio-

Rad) with the use of a Power Sybr Green Master Mix (Applied Biosystems). Reaction mixtures contained 10 µL of 2X SYBR Green I Master Mixture, 400 nM of each primer (GFP187F&R,

16SrRNA187 F&R, and Actin187 F&R) and 2 µL of cDNA as template, in a total volume of 20

µL. The following amplification program was used in all PCR reactions: 95ºC for 3 min, 32 cycles of 10 sec at 95°C and 30 sec at 62°C. The specificity of each amplification reaction was verified by a dissociation curve (melting curve) analysis after the 32 cycles, by heating the amplicon from 65°C to 95°C. No-template controls were included for each primer pair. All treatments are performed in triplicate including a duplicate of minus RT controls. The relative quantification of gene expression was performed using the comparative CT (threshold cycle) method in which the amount of target (GFP), normalized to an endogenous reference (16SrRNA) and relative to a calibrator (pTR:127), is given by the formula 2-∆∆CT (217).

44

2.3.12 SDS-PAGE and western blot analysis

For preparation of total proteins from PVX-infected tobacco plants, 0.2 g of plant tissue or enzymatic treated chloroplast was homogenized in 160 µL of protein extraction TMPDTNU buffer (50 mM Tris, 20 mM MgCl2, 1 mM PMSF, 100 mM DTT, 2% Triton X-100, 0.5% NP-40 and 8 M urea) plus 40 µL of 5x SDS-PAGE loading dye (212). These samples were boiled at 95-

100 °C for 5 min and 40 µL of each sample was loaded onto 12% SDS-PAGE gels along with the appropriated protein molecular weight markers (Thermo Fisher Scientific). Protein concentrations were determined by the Bradford Protein Assay reagent kit (Bio-Rad, Hercules,

CA). Electrophoresis was performed initially at 150 V until the samples entered the separating gel followed by 100 V until dye reached at the bottom of the gel (218). The proteins were then transferred onto nitrocellulose membrane (0.45 nm pore size, Pall Corporation) for 1 hr in transfer buffer using the Bio-Rad protein electrophoresis unit. The membrane containing the transferred proteins was blocked in Tris-buffered saline (TBS buffer: 50 mM Tris and 150 mM sodium chloride) along with 5% skimmed milk for 5 hr. Subsequently, the membrane was incubated at 4°C overnight with mild shaking with (1:1000) Anti-PVX coat protein, raised in

Rabbit, polyclonal antibodies in TBS+3% BSA. The membrane was washed (TBS, 0.3% Tween

20) 4 times and incubated with (1:3000) Goat Anti-Rabbit IgG (H & L) Alkaline Phosphatase

(Bioshop Canada Inc) for 2 hr at room temperature with mild shaking. The membrane was washed 3 times with TBS-T followed by a final washing with TBS. Finally, signals were developed with alkaline phosphatase substrate solution (BCIP / NBT, Bioshop Canada Inc.) according to the manufacturer instructions. The membranes were dried and photographed.

45

2.3.13 Isolation of intact mitochondria and enzymatic treatments

Tobacco (N. tabacum cv. Xanthi) seeds harvested from transgenic plants harboring pTR:127, pCELVd-GFP constructs were screened on ½ MS medium supplemented with 20 μg/mL

Hygromycin in magenta vessels. Three-week-old plants were transferred to pots (1-2 plants per pot) containing Pro-Mix (Premier Tech, Canada), and grown in a greenhouse. These pots were covered with polyethylene bags to preserve humidity for one week. Non-transgenic tobacco seeds were also sown in Pro-Mix and infected with PVX virus as mentioned in Section 2.3.7.

The plants were grown at 23-27°C under 16 hr light/8 hr dark condition in an insect-free greenhouse. After 4-6 weeks mitochondria were isolated from these plants using the modified method as described previously by Block, et al. (219). Fresh leaves (50 g), for each preparation, were cut and homogenized in a mortar in 120 mL of extraction medium (EM) (20 mM HEPES-

Tris pH 7.6, 0.4 M sucrose, 5 mM EDTA pH 8.0, 0.6% PVP (w/v), 0.6 mM cysteine). The extract was filtered through 8 layers of cheesecloth and centrifuged 5 min at 3500 g. The supernatant was centrifuged at 28,000 g for 10 min to pellet organelles. The pellet was resuspended in 120 mL EM without PVP and centrifuged at 28,000 g for 10 min and the pellet resuspended in 2 mL of suspension buffer (SB) (10 mM MOPS-KOH pH 7.2, 0.2 M sucrose) and loaded on a percoll gradient developed with 2 mL of 10%, 3.5 mL of 32% and 3.5 mL of

50% percoll in SB. The gradient was centrifuged at 40,000 g for 1h and the mitochondria collected as a fuzzy yellow band between the 32% and 50% percoll stages. These mitochondria were washed in 2 volumes of SB buffer at 85,600 g for 90 min at 4°C to remove the percoll. The intact mitochondria isolated from PVX-infected leaves were incubated with 1/10 volume of

Proteinase K (20 mg/mL) at RT for 1 hr to ensure that no virions associated with the mitochondria and washed twice with SB buffer and centrifuged at 28,000 g for 10 min. The supernatant was discarded and each pellet was gently resuspended in washing buffer. These 46

proteinase K treated and other mitochondria, isolated from transgenic plants, were treated with

RNase A (100 µg/mL) (New England Biolabs, NEB) for 1 hr at RT to digest the viral RNA or transgene transcripts adsorbed on the surface of mitochondria and washed with SB washing buffer at 28,000 g for 10 min. Each preparation was again treated with proteinase K to inactive

RNase. After twice washing, the mitochondria were lysed with 1/10 volume of mitochondrial lysis buffer (MLB) (10% (w/v) N-lauroylsarcosine sodium salt, 25 mM Tris-HCl pH 7.5, 20 mM

EDTA pH 8.0 and 2% βME) at 65°C for 30 min. After lowering the temperature of the sample to room temperature, one volume of chloroform: isoamyl alcohol (24:1) was added, mixed well and centrifuged at 14,000 × g for 10 min at room temperature. The aqueous phase was with mixed 1 μg/μL glycogen (Thermo scientific) as a carrier for , 0.1 M sodium acetate and 0.6 volume of isopropanol to precipitate the mitochondrial RNA (mtRNA) overnight at -

20ºC. The mtRNA was pelleted by centrifugation at 14000 × g for 10 min, washed with 70%

EtOH and air-dried. Finally, each pellet was dissolved in 50 μl TE buffer (10 mM Tris-HCI pH

8.0 and 1 mM EDTA). RT-PCR reactions were carried out as mentioned above in Section

2.3.10.

2.4 RESULTS

2.4.1 Detection of PVX RNA and coat protein in chloroplast

PVX RNA and coat protein were identified inside the chloroplasts of infected N.tabacum cv.

Xanthi leaf tissues by RT-PCR. To determine the PVX RNA inside the chloroplasts, RNAs were isolated from enzymatic (Proteinase K and RNAase A) treated chloroplasts of PVX-infected plants and reverse transcribed into cDNA using reverse primer specific to coat protein gene followed by PCR amplification using primers specific to 8k gene sequence. These PCR results

47

confirm the existence of PVX RNA inside the chloroplasts of infected leaf tissues as shown in

Figure 2.6 A; Lane 3.

48

Figure 2.6 Detection of PVX RNA and coat protein inside the chloroplast using RT-PCR and western blot. A) RT-PCR analysis. Total and chloroplast RNAs from health and PVX-infected plants were reverse transcribed into cDNAs with CP reverse primer followed by RT-PCR using forward and reverse primers specific to 8 kDa gene sequence. An RT-PCR product of size 156 bp could be seen in both total and chloroplasts RNAs samples isolated from PVX-infected plants (Panel a: Lanes 1 and 3 respectively). However this RT-PCR product was absent in both total and chloroplasts RNAs samples isolated from healthy plants (Panel a: Lanes 2 and 4 respectively) which were used as negative controls. The purity of chloroplast was confirmed using nuclear-encoded Actin gene. The 187 bp Actin product was not detected in chloroplast RNAs (Panel b: Lanes 3 and 4). A DNA size marker (100 bp) in 100bp increments was electrophoresed in Lane L. The resulting PCR products were analyzed on a 2% agarose gel. B) Western blot analysis of a 12.5% acrylamide gel. PVX CP specific antisera reacted with 50 µg protein (25 kDa coat protein) extracted from chloroplasts and leaf tissues of PVX-infected plants (Lanes 2 and 4 respectively). However, this 25 kDa band corresponding to coat protein was absent in both samples purified from chloroplasts and leaf tissues of healthy plants (Lanes 1 and 3 respectively). C) Reconstruction experiments: RT-PCR analyses were performed on total and chloroplast RNAs using primers specific to the PVX 8 kDa gene sequence (Panel a). Total RNA samples isolated from PVX- infected (Lane 1) and healthy plants (Lane 2) were used as positive and negative controls respectively. Chloroplast RNA isolated from healthy chloroplasts (mixed with PVX RNA) without (Lane 3) and with (Lane 4) RNase A treatment respectively. 16SrRNA gene was included as an internal control (Panel b).

49

To determine whether PVX CP is present in the chloroplasts, these organelles were purified and treated with protease K to remove any externally associated cytoplasmic protein, and tested for the presence or absence of PVX gene products. A band, 25 kDa in size, is seen only in protein extracts from total and chloroplast proteins purified from PVX-infected plants (Figure 2.6 B;

Lanes 2 and 4) but not in the samples of total and chloroplast proteins isolated from non- infected plants (Figure 2.6 B; Lanes 1 and 3).

2.4.2 Reconstruction control experiments

Additionally, reconstruction controls were also included to rule out that the RNA found inside the chloroplasts did not originate from RNA adsorbed on the exterior surface of chloroplasts.

Experiments were conducted where chloroplasts from leaf tissues of healthy non-transgenic N. tabacum plants were isolated and further purified by sucrose gradient centrifugation. Purified chloroplast were mixed with PVX RNA and subjected to enzymatic treatments as mentioned in materials and methods section 2.3.9. Chloroplasts from PVX-infected tobacco plants were isolated and treated with proteinase K prior to the RNase A treatment. Another preparation of untreated purified chloroplasts from leaf tissues of healthy non-transgenic plants was also included as a negative control. Chloroplast RNA samples were reverse transcribed after DNase I treatment, followed by subsequent RT-PCR reactions. It is clear from the reconstruction experiments that viral RNA is completely degraded after RNase treatment (Figure 2.6 C; Lane

4). However, a sample without RNase A treatment showed a prominent band of viral RNA corresponding to 8k gene (Figure 2.6 C; Lane 3). These results clearly demonstrate that PVX

RNA found in chloroplasts cannot be due a simple contamination of adsorbed RNA on the surface of chloroplasts.

50

2.4.3 Design of constructs to confirm RNA tractor activity in chloroplasts

Previously Hefferon, et al. (205) demonstrated that potato plants transformed with clones containing the PVX sequences of the CP and 8 kDa proteins resulted in the translocation of PVX

RNA sequences to the chloroplasts. To establish the role, if any, of either the CP and/or 8kDa proteins in the translocation process of viral RNA from the cytosol to chloroplasts and to determine the minimum sequence “RNA tractor” required for RNA translocation to chloroplasts, several constructs were engineered. To establish the minimum PVX sequence (“RNA tractor”) required for the translocation of RNA to chloroplasts, five constructs were produced in a pC-

GFP binary plasmid, where all PVX sequences are driven by the 35S promoter followed by the

GFP gene and the T-nos terminator (Figure 2.3). Successful transformation of tobacco plants was confirmed for every construct by RT-PCR of total RNA and by DNA sequencing and selected for further experiments. Results obtained from RT-PCR analyses with constructs (pTR:

8K-CP, pTR: 8K (insG80)-CP, pTR: 8K and pTR: 224) indicated that PVX sequence corresponding 8 kDa RNA was present within chloroplasts of transgenic plants harboring these constructs, even where both 8 kDa and CP proteins were disabled either independently or in tandem (Figure 2.3). This suggests that neither protein is responsible for translocation of PVX

RNA into chloroplasts. Furthermore, to elucidate the smallest possible region that retains “RNA tractor” activity, two more constructs, pTR:127 and pTR:27 were designed (Figure 2.3). Note that pTR:127 construct was designed in a manner that the AUG for the GFP is not in frame with the AUG of CP (Figure 2.5). Consequently, the GFP protein will not be translated in chloroplasts. In addition, the viroid clone (pCELVd-GFP) containing 330 nucleotides of

Eggplant latent viroid (GenBank Accession number AN - HM136583) as a 5´-UTR followed by the GFP gene and pC-GFP construct which contains solely the GFP gene were included as positive and negative controls respectively (Figure 2.3). 51

2.4.4 Analyses for expression of different constructs in total cellular RNA

Total RNA from leaf tissues of plants transformed with pC-GFP, pTR:27, pTR:127 and pCELVd-GFP constructs were subjected twice to DNaseI treatments, sequentially repeated using deproteinization and re-precipitation steps between the successive DNAseI digestion steps, to ensure that the RNA in the extract was entirely free of genomic DNA. A reverse transcription reaction of each sample was performed and cDNAs were amplified by PCR using GFP187 primers specific to GFP gene sequence. Chloroplast 16SrRNA, and nuclear Actin genes were also utilized as reference controls using 16SrRNA187 (forward and reverse primers) and

Actin187 (forward and reverse primers) respectively. The PCR products obtained demonstrated that all samples for total RNA used expressed the same levels of RNAs (GFP, Actin, and

16SrRNA) as seen in Figure 2.7 Lanes 1, 3, 5 and 7 respectively.

52

Figure 2.7 RT-PCR analyses of total and chloroplast RNAs expressed. RNAs were extracted from leaf tissues (total RNA) and chloroplasts of transgenic N. tabacum cv. Xanthi harboring pTR:127, pTR:27, pC-GFP and pCELVd-GFP constructs. Chloroplast coded 16SrRNA and nuclear-coded Actin transcripts were used as positive and negative controls respectively for chloroplast samples using gene specific primer pairs giving product size 187 bp in each case. The resulting RT-PCR products were analyzed on 2% gel and the expected 187 bp product was detected from A) GFP: Lanes 1,3,5 and 7 in the case of total RNA and only Lanes 2 and 8 in the case of chloroplast RNA, the 187 bp GFP product was detected. B) Actin: Lanes 1, 3, 5 and 6 in the case of total RNAs, the 187 bp Actin product was not detected in chloroplast RNAs Lanes 2, 4, 6 and 8. C) 16SrRNA: Lanes 1 to 8, the 16SrRNA 187 bp product was detected in all samples which ensure the integrity of RNAs.

2.4.5 Translocation of RNA transcripts driven by different constructs into

chloroplasts

RT-PCR experiments were carried out to detect the presence of PVX RNA short sequences within the chloroplasts of transgenic plants. Chloroplast RNAs, from the same transgenic plants used for total RNA extractions, were reverse transcribed into cDNAs and amplified by PCR.

Chloroplast 16SrRNA and nuclear Actin Tob103 genes were utilized as positive and negative controls respectively. Results obtained show that the expected 187 bp fragment of GFP was detected in the only pTR:127 and in the positive control of pCELVd-GFP (Figure 2.7, Lanes 2 and 8). GFP was not detected in pTR:27 and pC-GFP (Figure 2.7, Lanes 4 and 6). 16SrRNA

53

(chloroplast-encoded gene) bands with equal intensity were visible in all lanes while Actin bands with equal intensity were only visible in total RNA samples (Figure 2.7 Lanes 1, 3, 5 and 7).

This indicated that RNAs extracted from chloroplasts were free from any contaminating cytosolic RNAs. pTR:27 failed to be translocated to chloroplasts which indicates that the PVX

RNA tractor activity requires additional PVX sequence beyond the 27 nucleotides. On the other hand the pTR:127 preserved this RNA tractor activity and could also translocate a foreign mRNA (GFP mRNA) (Figure 2.7 Lane 2).

2.4.6 Quantitation of translocated RNA to chloroplasts by real-time RT-PCR

To reinforce the semi-quantitative RT-PCR data obtained, real time RT-PCR experiments were performed. To check for the variability in expression in transgenic plants, comparative real time

RT-PCR experiments were performed with total RNA isolated from leaf tissue harvested from selected lines of transgenic plants harboring pC-GFP, pTR:27, pTR:127 and pCELVd-GFP constructs respectively (Table 2.3).

Table 2.3 Relative quantification (expression) of GFP-transcripts derived from transgenic leaves harboring given constructs using comparative real time RT-PCR. Total RNAs were extracted and normalized to the expression of endogenous reference actin gene. GFP-transcripts driven by pC-GFP were used as a control.

Cta (Mean) 2-ΔΔCt Total ΔCt ΔΔCt GFP Actin GFP fold (Target) (Reference) difference relative to control pC-GFP (Control) 18.99±0.01 23.75±0.07 -4.76±0.07 0.00±0.07 1 (0.94-1.72)b pTR:27 18.95±0.08 24.21±0.00 -5.56±0.08 -0.8±0.08 1.7 (1.641-1.846) pTR:127 18.90±0.01 23.40±0.02 -4.50±0.02 0.26±0.02 0.8 (0.604-1.612) pCELVd-GFP 18.80±0.20 24.15±0.70 -5.35±0.73 -0.59±0.73 2.0 (0.907-2.49) (a): Threshold cycle (Ct: the number of cycles at which the fluorescence exceeds the threshold); mean values of duplicate assays carried out with two different samples. (b): The range given is relative to control (in brackets). ΔCt: Difference between values of reference and target (target is normalized to the reference). ΔΔCt: ΔCt of each sample is further normalized to the control. 2-ΔΔCt: Fold change relative to control.

54

Calculated Ct values in each case were around 18.9 showing almost the same level of expression.

Furthermore, the change (in the fold) was calculated after normalizing with a reference gene

(Actin). Results shown in Table 2.3 indicate values 1.7, 0.8 and 2-fold of messenger RNA for pTR:27, pTR:127 and pCELVd-GFP respectively, suggesting that even a lower expression of pTR:127 could manage to translocate into chloroplasts and rules out external contamination.

To check the sub-cellular (chloroplast) localization of transcripts, RT-q PCR experiments were performed with chloroplast RNAs isolated from transgenic plants expressing different constructs. RNA transcripts driven by pCELVd-GFP were used as a positive control for chloroplast translocation. Amplification plot is shown in Figure 2.8 A validated the translocation of PVX sequence “RNA tractor”. The light green and dark green plots representing Eggplant latent viroid (pCELVd-GFP) and RNA tractor sequence (pTR:127) respectively showed amplification while there is no amplification for the blue and orange curve in case of pTR:27 and pC-GFP samples respectively. PCR amplification efficiency (91.8%) was set by means of standard curve which was set with serial 10-fold dilutions of the template PCR product (GFP

187) with 5 points (red) as shown in Figure 2.8 A. The efficiency of the PCR should be close to

100 (90-110 %) meaning doubling of the amplicon at each cycle with r2 (coefficient of determination) values above 0.98 and the slope -3.32 (with a tenfold serial dilution the Cq or Ct values should be separated by 3.32 cycles).

55

Figure 2.8 Graphical representation of real-time PCR data to quantify translocated “RNA tractor” sequence using SYBR® Green detection method. A) Quantitative PCR amplification is performed on serial 10-fold dilutions with 5 points (red color) of the template (GFP standardized to 187bp) to establish a standard curve. Duplicate lines indicate a repeat of the same sample. Chloroplast RNA samples; pTR:127 (dark green), pCELVd-GFP (light green), pTR:27 (Blue) and pC-GFP (orange) were amplified by RT- qPCR along with standard (GFP 187). B) Standard curve: Cq is calculated from values in A are plotted (Y-axis) against the log of the copy number (x-axis) of the template to establish a standard curve with an efficiency of 91.8% from the slope - 3.536 and r2 value 0.999. C) Melt curve analysis of the amplicons shows a single peak (about 88°C) displaying the negative first derivative of temperature versus relative fluorescence units (-d (RFU)/dT) plotted against temperature. Cq: quantification cycle. RFU: relative fluorescence unit. A standard curve was a duplicate.

As illustrated in the melting curve in Figure 2.8 C, there is a significant single sharp peak with

Tm of 88°C in each amplicon. This single peak rules out the presence of non-specific bands which may arise due to non-specific binding of primers. These RT-qPCR results are similar to those described for the semi-quantitative RT- PCR (Figure 2.7). 56

2.4.7 Comparison of translocation efficiency of PVX RNA tractor (pTR:127)

to Eggplant latent viroid sequence (pCELVd-GFP)

Chloroplast translocation capacity of pTR:127 was compared with that of pCELVd-GFP using chloroplast 16SrRNA gene as an internal control (Figure 2.9 A and B).

Figure 2.9 Graphical representation of real-time RT-PCR data (using SYBR® Green detection method) showing relative translocation activity of pTR:127 compared to Eggplant latent viroid (pCELVd-GFP). A) Relative real time RT-PCR amplification is performed on chloroplast transcripts (GFP) isolated from pTR:127 (dark green) and pCELVd-GFP (light green) in triplicate samples. Chloroplast 16SrRNA from pTR:127 (black) and pCELVd-GFP (purple) were used as internal controls. B) Melt curve analyses of the amplicons (GFP and 16SrRNA) in single peaks, displaying the negative first derivative of temperature versus relative fluorescence units (- d (RFU)/dT) plotted against temperature. RFU, relative fluorescence units.

Steep curves were observed in the amplification profile suggesting that the reference gene

(16SrRNA) was expressed in all samples almost in a similar way (Figure 2.9 A). A single sharp peak is observed in each sample which confirms the presence of a specific PCR product (Figure

2.9 B). The translocational activity of RNA tractor (pTR:127) was compared to that of Eggplant latent viroid (pCELVd-GFP). Results obtained show that relative RNA abundance of viroid is about 120-fold that of pTR:127 (Table 2.4). 57

Table 2.4 Relative quantification of chloroplast RNA expression of pTR:127 and pC-ELVd-GFP using real time RT-PCR. RNAs were extracted from purified chloroplasts and normalized to the expression of endogenous reference 16SrRNA gene. The abundance of GFP-transcripts driven by pCELVd-GFP was compared with that of GFP- transcripts driven by pTR:127 in chloroplasts.

Cta (Mean) 2-ΔΔCt Chloroplast ΔCt ΔΔCt RNA GFP 16SrRNA GFP fold (Target) (Ref.) change pTR:127 (control) 28.82±0.08 8.81±0.27 20.01±0.29 0±0.29 1 (0.817-1.22)b pCELVd-GFP tested 22.34±34 9.24±0.01 13.10±0.38 -6.91±.10 120.25 (112.20-128.89)

(a): Threshold cycle (number of cycles at which the fluorescence exceeds the threshold). Mean values of duplicate assays carried out with two different samples. (b): The range relative to the control is given in brackets.

2.4.8 Translocation of “RNA tractor” sequence to plant mitochondria

To determine the translocation of “RNA tractor” sequence into mitochondria, RT-PCR with mitochondrial RNA isolated and purified from transgenic plants harboring pTR:127 construct were performed using GFP187 primers specific to GFP gene sequence. Results obtained showed that the expected 187 bp fragment of GFP was detected in only total pTR:127, while this GFP gene fragment was absent in mitochondrial sample (Figure 2.10, Panel a; Lanes 1 and 2 respectively).

58

Figure 2.10 Mitochondria isolation and RT- PCR- analyses with mitochondria and total RNA from transgenic tobacco plants harboring pTR:127 construct. A) The mitochondria were collected as a fuzzy yellow band between the 32% and 50% percoll stages after ultracentrifugation and subjected to enzymatic treatments to remove any external contamination. B) Mitochondrial RNA was isolated and subjected to RT-PCR after DnaseI treatment. GFP primers were used to amplify 187 bp product from leaf tissues (total) and mitochondria (Panel a; Lane 1 and 2 respectively). Primers for18SrRNA gene from mitochondrial genome were used to amplify 187 bp product as an internal control to check the integrity of RNA from leaf tissues (total) and mitochondria (Panel b; Lane 1and 2 respectively). A DNA size marker (100 bp) in 100bp increments was electrophoresed in Lane L. The resulting PCR products were analyzed on a 2% agarose gel.

Taken together these preliminary results, it might be concluded that “RNA tractor” sequence of

PVX failed to translocate into mitochondria of pTR:127 transgenic plants.

59

2.5 DISCUSSION

Our previous studies have shown that the CP and CP RNA of PVX accumulate within chloroplasts of plants transformed with the PVX 8 k-CP dicistronic construct (174, 205).

Although these results established the presence of PVX RNA within chloroplasts, very little was known about the mechanism by which this RNA entered the organelle. At first, it was believed that viral proteins (i.e. the CP and/or 8 kDa proteins) were involved in this translocation phenomenon since they have been previously implicated in the intercellular movement of the viral RNA (170). Results described in this study clearly demonstrated that neither protein (8 kDa or CP) alone or together were required for the translocation of RNA into the chloroplast. Indeed, when an out of frame mutation was introduced into the 8 k gene or when a large segment of the 8 k gene was deleted (pTR:127), the RNA was still translocated to the chloroplast. Similar results were obtained when the CP gene was essentially deleted, with the exception of the first 13 nucleotides including the initiation codon. Construct pTR:127 was still capable of translocation of not only its original PVX sequence but also the downstream sequence of GFP, which constitutes a part of the same original tricistronic (8 k, CP and GFP genes respectively) transcript and is under the control of the 35S promoter. Conversely, results obtained with the pTR:27 construct suggested that the translocation capability was abolished when 127 nucleotides sequence was further deleted to only 27 nucleotides. This finding provides a second line of evidence, indicating the required length of the RNA sequence must be more than 27 RNA nucleotides to maintain the RNA tractor activity. A reconstruction control experiment (Figure

2.6 C) was also included to eliminate the possibility that the RNA we detected was attached to the surface of the chloroplast as a result of the isolation procedure and not degraded even treated with RNase A. The results shown in Figure 2.7 validate the purity of our chloroplast

60

preparations and rule out the possibility that cytoplasmic/nuclear RNAs may co-purify with chloroplasts.

To calculate the relative expression level and also to reinforce the semi-quantitative results, we have used the comparative Ct method, also known as 2-∆∆CT, which is a convenient way to analyze the relative changes in gene expression (217, 220, 221). Comparative Ct method assumes that the amplification efficiency of the target gene, i.e. GFP, and endogenous control, i.e. 16SrRNA, must be the same (221). It is noteworthy that RNA expression level in the selected transgenic lines of pTR:27 and PC-GFP is higher in comparison with RNA level in pTR:127 which further supports our findings and rules out external contamination. The chloroplast translocation efficiency of the PVX RNA tractor was determined to be 120 X lower than that of

Eggplant latent viroid. One explanation for this major difference is the fact that unlike PVX, eggplant latent viroid replicates inside chloroplasts. It is possible that PVX RNA targets this organelle to escape from the host immune system.

To provide another line of evidence of the RNA tractor activity for chloroplasts and determine that the GFP sequence is functional in the chloroplast, pTR:127 construct was redesigned considering the translation mechanism of chloroplasts. Various strategies were attempted to make the RNA tractor sequence functional for GFP mRNA as a reporter gene

(Appendix A). Despite the presence of chloroplastic genome sequences, required for the translation, GFP was failed to express in the chloroplasts, however, it was observed that the GFP was functional in the agrobacteria cells (Appendix C). Further research is required to establish the generality of this phenomenon using RNA tractor.

Since the Eggplant latent viroid chimeric sequence was included as a positive control, for translocation into the chloroplasts, on the basis of the previous findings by Gomez and Pallas

(95) who demonstrated that the viroid sequence acting as a 5´-UTR end mediated the trafficking

61

and accumulation of a functional foreign mRNA into the N. benthamiana chloroplasts. However, it is not clear how and why such a chimeric viroid sequence allowed the translation in chloroplasts. Whether the viroid sequence or/and specific structure motifs are required for the translation of GFP in the chloroplasts. To address these questions, mutational analyses were performed with this chimeric sequence (Appendix B). Overall these results suggest that sequence elements and/or secondary or tertiary structural domain together may require the translation of functional mRNA into the chloroplasts. Further experiments are required to solve this mystery.

Previously in our lab Hefferon, et al. (174) demonstrated with transgenic plants that the 8 kDa protein and the CP could be translated from a dicistronic construct corresponding to the C-terminal half of the 12 kDa protein, the complete 8 kDa and CP genes of PVX, indicating that translation of CP could take place either by internal entry of ribosomes (IRBS) or by a termination/reinitiation mechanism. To confirm and reassess the IRBS property of the PVX 8K region using the GFP gene as a reporter (fused with ORF of

CP of PVX) in in vivo, a stable transgene expression system was used. Western blot and confocal studies indicated the expression of a downstream cistron (GFP) only in absence of the hairpin in transgenic tobacco plants harboring the dicistronic construct, suggesting that that the translation of GFP could take place by a termination/reinitiation or leaky scanning rather an internal ribosome binding site (IRBS) mechanism (Appendix D).

Numerous positive-sense RNA viruses were shown to replicate their genomes on a variety of membrane systems including endosomes and lysosomes, nuclear envelopes, endoplasmic reticulum (ER), and organelles (chloroplasts, mitochondria) (see (222) for more citations). A recent study has shown that Bamboo mosaic virus (BaMV) RNA was transported to chloroplast by interacting with nuclear-encoded chloroplast proteins (209). Many viral proteins 62

(in particular RNA-dependent-RNA polymerases) contain hydrophobic regions which interact with the specific cellular membrane system(s) to generate “vesicle-like” systems where the viral replication is shown to take place. Normally such replication is carried out on the surface of organelles and/or membrane system. Other viruses employ the normal cellular strategy to translocate their proteins to chloroplasts. The transmitted Tombusvirus cucumber necrosis virus (CNV) employs the strategy of the to translocate its capsid proteins to the chloroplast. Such a targeting motif was also shown to contain 14-3-3 binding domain typical of cellular protein translocation from cytosol to chloroplasts (177). These findings suggest that viral and/or host proteins could be responsible for the movement of the viral genome and proteins to the outer membrane system. In our case, however, the PVX RNA tractor system seems to involve no viral proteins. In this respect, it may be most comparable to the transport and translocation of the RNA of viroids and in particular, Avsunviroidae. An Eggplant latent viroid - derived sequence (pCELVd-GFP) was used as a 5´-UTR end to mediate the import of GFP- mRNA into chloroplasts (95). Viroids do not code for any proteins and they have to rely on cellular proteins (if any) for their transport, entry into chloroplasts for replication and for the exit.

Some cellular proteins such as PARBP33 and PARBP35 were shown to be involved in replication, self-cleavage (), protection of RNA and possibly escort of this type of viroid to the chloroplast (223). The RNA tractor described here is the first reported for a viral small sequence that is capable of not only translocating its own sequence but also a foreign sequence such as that of GFP into chloroplasts. Presumably, any foreign RNA could be targeted to chloroplast by this RNA tractor. However, the exact mechanism of viroid and “RNA tractor” translocation (and exit) to chloroplasts remains unclear.

Sequence analysis data of pTR:127 with other Potex and Carlaviruses revealed no sequence which implies that our RNA tractor may be unique to PVX. The role of

63

cellular protein (s) involved in such an RNA translocation event is/are not yet established.

However, we can theorize that the RNA translocation to chloroplast may simply involve an RNA structure which is capable of interacting with a chloroplastic membrane protein which acts in an analogous fashion to a receptor binding process to trigger pinocytosis and/or endocytosis, thereby allowing the internalization of the RNA to the chloroplast. RNA folding analysis of “RNA tractor” sequence revealed the formation of a hairpin (finger-like) structure which potentially could be involved in the attachment of the RNA tractor to the chloroplastic membrane followed by its entry into the chloroplast.

Although this study has provided an intriguing rationale for “RNA tractor” localization to the chloroplasts, the functional consequences or mechanism of localization remains to be determined.

Since it has been established that none of the viral proteins are involved for the movement of

PVX “RNA tractor” into chloroplasts, it is, therefore, possible that some host factors are interacting with PVX “RNA tractor” and facilitating its transport into the chloroplasts. Further studies are required to detect any potential host protein(s) interacting with Eggplant latent viroid and PVX “RNA tractor” using biochemical approaches like electrophoretic mobility shift assay

(224, 225) or/ and UV cross-linking RNA/protein complexes (223, 226, 227), followed by mass spectrometry to analyze the sequence of the purified proteins (228). Understanding the molecular mechanisms of this RNA tractor may lead in the future to further comprehension of some of the trafficking mechanisms of RNAs between organelles (chloroplasts and mitochondria) and nucleus. This may also lead to understanding some aspects of gene regulation and development.

64

CHAPTER 3

3 STUDIES ON INFECTIVITY AND TRANSLOCATION OF VIRAL DNAS FROM CYTOSOL TO ORGANELLES

3.1 INTRODUCTION

The family Geminiviridae is comprised of plant DNA viruses that have long been known as model systems for the elucidation of basic cellular components of the plant replication and transport machinery (118, 119, 229, 230). This family consists of phytopathogenic viruses with characteristic twinned, quasi-isometric virions encapsidating genomes of circular single-stranded

(ss) DNA. Geminiviridae is classified into seven genera, six of which (Mastrevirus, Curtovirus,

Topocuvirus, Becurtovirus, Eragrovirus and Turncurtovirus) consist of viruses with monopartite genomes. The seventh genus Begomovirus consists of viruses with either monopartite (a single

DNA) or bipartite (with two DNA components: DNA-A and DNA-B) genomes (123, 125, 126,

231, 232). The DNA-A of bipartite and the single component of monopartite begomoviruses contain five or six Open Reading Frames (ORFs) while the DNA-B contains two ORFs (BV1 and BC1, in viral-sense and complementary sense strand, respectively). Both DNA-A and DNA-

B are approximately 2.8-3.0 kb in size. Monopartite begomoviruses are often associated with one or smaller DNA components, about 1.4 kb in size, known as satellite DNAs. Two types of satellite DNAs are known: the alpha-satellites and beta-satellites, depending upon the organization of their DNA and their effects on the symptoms produced by the helper begomovirus. Both the alpha- and betasatellites are dependent upon the helper virus for replication and, in many cases, mitigate the symptoms produced by it (233). The major symptoms caused by begomoviruses are leaf curling, stunting, and chlorosis. Geminiviruses encode proteins that contribute to pathogenicity. These proteins differ between monopartite and

65

bipartite begomoviruses, as well between viruses within the individual groups (234, 235).

Begomoviruses infect a wide range of economically important dicotyledonous host plants and are transmitted by the whitefly Bemisia tabaci (236, 237). Various aspects of the Family

Geminiviridae have been comprehensively reviewed (238-240).

I used tobacco and tomato plants for pathogenicity assays. Tobacco is a model plant to study basic biological processes (241) and it is also a major crop species used for studying plant disease susceptibility, which it shares with other Solanaceae plants like potato, tomato, and pepper (242). The genus Nicotiana (family Solanaceae) has been the main focus of research which has provided information about the host- relationship in the context of innate immunity and defense signaling. Particularly Nicotiana benthamiana and N.tabacum (both allotetraploid) species have been widely used as experimental hosts of plant studies

(243). N. benthamiana is generally susceptible to the majority of plant viruses. It is the most widely used experimental host in plant virology mainly but not restricted to its ability to express foreign genes, used as a virus-induced gene silencing (VIGS), as a research model for agroinfiltration (243) and also combination of these methods to investigate signal transduction

(244) and protein trafficking (245).

The movement of geminiviruses within host plants has been studied extensively (161,

229, 243, 246-250). Geminiviruses use the DNA replication machinery of their host to amplify their genomes in the nuclei of infected plant cells (251). This viral DNA is transported out of the plant cell nucleus to undergo systemic spread by crossing plasmodesmatal openings in the cell membrane. For monopartite begomoviruses coat protein with the conjunction of pre-coat is required to cross cell membranes (249). In contrast to monopartite begomoviruses, bipartite begomoviruses are dependent upon DNA-B encoded nuclear shuttle protein (NSP) and movement protein (MP) for their movement in host plants (156, 246, 252). It has been revealed

66

that βC1 of beta-satellite can substitute the movement function of DNA-B to facilitate movement of begomovirus from the nucleus to the cell periphery (248). The transport of viral ssDNA from the nucleus towards plasmodesmata is mediated by a nuclear export signal (NES) on the coat protein C-terminus and NES on the Pre-coat protein N-terminus (249, 250). Nuclear shuttle protein interacts with H3, raising the possibility that viral DNA moves as a minichromosome (253). An NSP-interacting GTPase (NIG) associated with the exterior of the nuclear envelope might facilitate NSP transit into the cytosol, probably through the nuclear pore

(254). The NSP-DNA complex then moves to the cell periphery through interaction with MP.

Viral DNA might be transferred to MP through a mechanism involving NIG-catalyzed GTP hydrolysis (255). Alternatively, NIG might facilitate the interaction of MP with an NSP-DNA complex that moves through plasmodesmata, which provides a mechanism for movement of viral DNA into the nucleus of the next cell. The chaperone, the nuclear-encoded and chloroplast- targeted heat shock cognate 70 kDa protein (cpHSC70-1) was shown to interact with the

Abutilon mosaic virus (AbMV, Geminiviridae) movement protein (MP) for trafficking along plastids and stromules into a neighboring cell or from plastids into the nucleus (256). An involvement of plastids and stromules is assumed in the DNA-virus cycle as well, but their functional role needs to be determined (257).

The molecular mechanisms underlying intercellular movement of viruses have been well studied; however studies on sub-cellular, other than the nucleus, localization of genome of these viruses have been less explored. The key research question in this study is whether or not, viral

DNA can be translocated into chloroplasts. The study conducted to answer this question confirms the presence of only AEV DNA-A (monopartite), conversely, ToLCNDV DNA-A was absent in chloroplasts of the viral infected leaves. The DNA of Abutilon mosaic virus was isolated from intact chloroplasts (164) representing the only other example of a geminiviral viral

67

genome in chloroplasts. Considering these findings on the sub-cellular localization, it is conceivable that viruses use fundamentally different transport mechanisms within their hosts. In this study, I also demonstrate the infectivity of monopartite and bipartite begomoviruses to

Solanum lycopersicum and different Nicotiana species to assess the effects of ploidy level on susceptibility to begomoviruses. These findings could be useful to provide us a better understanding of begomovirus pathogenicity and virus-host interactions.

3.2 RESEARCH PLAN

The overall objectives of this study are:

1. To determine the infectivity of monopartite (AEV) and bipartite (ToLCNDV)

begomoviruses in tomato and different Nicotiana species.

2. To study the capacity of these single-stranded DNA viruses (AEV and ToLCNDV) to

translocate their genomic DNA to chloroplasts of different Nicotiana species and tomato

plants.

3. Finally to study the translocation of AEV DNA-A genome to plant mitochondria.

3.3 MATERIALS AND METHODS

3.3.1 Plant growth conditions

Tobacco (Nicotiana alata, N. benthamiana, N. clevelandii, N. glutinosa, N. rustica, N. sylvestris,

N. tabacum cv. Xanthi, N. tabacum cv. Samsun) and tomato (Solanum lycopersicum, variety

Ultra Girl VFN) seeds were sown in Pro-Mix (Premier Tech ,Canada) and transferred to pots (1-

2 plants per pot) containing Pro-Mix when the seedlings were 3 weeks old. The plants were grown at 23-27°C under 16 h light/8 h dark condition in an insect-free greenhouse.

68

3.3.2 Agrobacterium-mediated inoculation

Infectious clones of AEV (DNA-A and DNA-β) and ToLCNDV (DNA-A and DNA-B) were kindly provided by the Molecular Virology Laboratory, Institute of Agricultural Sciences, The

Punjab University. These clones were transformed into competent cells of Agrobacterium tumefaciens strain GV3101. A single colony of each infectious clone of AEV (DNA-A and

DNA-β) and ToLCNDV (DNA-A and DNA-B) in A. tumefaciens was cultured in 2 mL of LB culture containing antibiotics Kanamycin (100 µg/mL) and Gentamycin (30 µg/mL) and grown overnight at 28°C at 225 rpm. A large 30 mL LB media suspension was then inoculated with the overnight culture and grown at 28°C to an optical density (OD595) of ~1.0. The cells were harvested by centrifugation at 1200 g for 10 min and resuspended in Agrobacterium induction medium (10 mM MgCl2, 10 mM MES pH 5.6 and 150 µM acetosyringone) to a final OD595 of

1.0 and incubate at room temperature for 4-6 hr with gentle shaking (80-100 rpm). These cultures were pelleted again by centrifugation at 1200 g for 10 min and resuspended in 10 mM

MES buffer and adjust to OD595~0.5. At the four true leaf stage, plants were inoculated with

AEV (A + β) and ToLCNDV (A+B) using a 1 cc syringe into the abaxial surface of the leaves.

Each experiment was repeated ten times. Plants were also infiltrated with buffer alone used a negative control. Following inoculation, plants were observed daily for the appearance of symptoms. At 30-35 days post-inoculation (dpi) the plants were photographed and leaf samples were harvested to isolate DNA for PCR analysis.

3.3.3 Extraction of total nucleic acids from plants and PCR

Total genomic DNA was extracted from leaf samples using modified CTAB method (258).

About 100 mg plant material were harvested from newly emerged leaves and ground in 800 μl

2×CTAB buffer (100 mM Tris-HCl pH 8.0, 20 mM EDTA, 1.4 M NaCl, 2% (w/v) cetyl

69

trimethylammonium bromide (CTAB), 0.25 % polyvinylpolypyrrolidone (PVP) and 2.5% (v/v)

β-mercaptethanol) using a pestle and mortar and incubated at 65°C for 30 min. After lowering the temperature of the sample to room temperature, a 500 μl of chloroform: isoamyl alcohol

(24:1) was added, mixed well and centrifuged at 10,000 × g for 10 min at room temperature. The upper DNA containing phase was mixed with 0.6 volume isopropanol to precipitate the DNA.

DNA was pelleted by centrifugation at 14,000 × g for 10 min, washed with 70% ethanol and air dried. Finally, each pellet was dissolved in 50 μl TE buffer (10 mM Tris-HCI pH 8.0/1 mM

EDTA). PCR reaction were carried out on one microgram DNA as template, determined by ND-

1000 Spectrophotometer (NanoDrop Technologies Inc., USA), in a final volume of 30 µL with reagents provided by FroggaBio (2X PCR MasterMix) in a PTC-100 thermocycler (MJ

Research). The PCR was performed at 95°C for 5 min, followed by 95°C for 50 sec, 60°C for 50 sec, 72°C for 50 sec for 32 cycles, and 72°C for 5 min. All the primers used are displayed in

Table 3.1.

Table 3.1 Primer sequences used for semi-quantitative PCR. Target sequence Forward (F) and reverse (R) primers (5´-3´) PCR product size (base pairs) F GAAGCGACCAGCAGATATAATC 169 Bego CP R CATCCTGTACATCCTGGGCTT

F GCCCAGGATGTACAGGATGT 283 AEV CP R CACAGGCCTACGATCCCTAA

F GAAGAACCTTACCAGGGCTTGA 187 16SrRNA R CAGTCTGTTCAGGGTTCCAAAC F AGTCCTCTTCCAGCCATCCA 187 Actin (tobacco) R AGCCAAAGCCGTGATTTCC

F GAAATAGCATAAGATGGCAGACG 277 Actin (tomato) R ATACCCACCATCACACCAGTAT

3.3.4 Isolation of intact chloroplast and enzymatic treatments

Chloroplasts were isolated from healthy and infected plants using the modified method (205).

Each isolation step was performed at 4°C separately. Five grams of leaves were harvested and 70

homogenized with mortar and pestle in 50 mL of cold grinding buffer (50 mM HEPES-KOH pH

7.3, 330 mM mannitol, 0.1% BSA, 1 mM MgCl2, 1 mM MnCl2, 2 mM Na2EDTA, and 1 mM

DTT). Homogenate was filtered through eight layers of cheesecloth and the filtrate was pelleted at 500 g for 2 min to remove the plant debris. After that, the suspension containing chloroplasts was sedimented by centrifugation at 2,500 g for 20 min at 4°C. Subsequently, each pellet containing the chloroplasts was carefully resuspended in 1 mL grinding buffer. These chloroplasts in each sample were counted by haemocytometer and the quantity was equally adjusted ensuring a similar sample size. Each sample was loaded on top of a sucrose step gradient developed with 4 mL of 30%, 3 mL of 45%, and 2 mL of 60% sucrose in grinding buffer and centrifuged at 77,140 g for 55 min. Intact chloroplasts were collected from the interphase between 30 and 45 % sucrose, washed twice with washing buffer (50 mM HEPES-

KOH pH 8.0, and 330 mM mannitol) and resuspended in 1 mL washing buffer. The purified chloroplasts were visualized under a light microscope to confirm their integrity. Each suspension was incubated with 1/10 volume of Proteinase K (20 mg/mL) for 1 hr at 32°C to ensure that no virions associated with the chloroplasts and washed twice with washing buffer. The supernatant was discarded and each pellet was gently resuspended in 1 mL of washing buffer and treated with 20 units DNase 1 (New England Biolabs, NEB) for 1 hr at 32 °C to digest the viral DNA adsorbed on the surface of chloroplasts. Theses chloroplasts were washed twice with 15 mL of washing buffer. These chloroplasts were lysed with 1/10 volume of 2×CTAB at 65°C for 30 min.

After lowering the temperature of the sample to room temperature, one volume of chloroform: isoamyl alcohol (24:1) was added, mixed well and centrifuged at 10,000 × g for 10 min at room temperature. The aqueous phase was mixed with 1 μg/μL glycogen (Thermo scientific) as a carrier for nucleic acid, 0.1 M sodium acetate and 0.6 volume of isopropanol to precipitate the chloroplast DNA (cpDNA) overnight at -20ºC. The cpDNA was pelleted by centrifugation at

71

14,000 × g for 10 min, washed with 70% ethanol and air dried. Finally, each pellet was dissolved in 50 μL TE buffer (10 mM Tris-HCI pH 8.0 /1 mM EDTA). PCR reaction were carried out on one microgram cpDNA as mentioned in material and method section 3.3.3.

3.3.5 Light microscopy and transmission electron microscopy (TEM)

The chloroplasts were visualized under a light microscope to confirm their integrity and purity.

A drop of each sample was overlaid on a glass slide and live chloroplast imaging was performed with a 40 × oil objective lens using a differential interference contrast (DIC) feature of a confocal microscope (TCS SP5, Leica Microsystems). For TEM sample preparation, chloroplasts were pelleted by centrifugation, and the pellets were resuspended 3% glutaraldehyde in 0.1M

Sorensen buffer pH 7.35 for 60 min on a shaker at room temperature and stored overnight at 4°C. After 3x buffer washing (each 10 min), samples were post-fixed with 1% osmium tetroxide in phosphate buffer for 60 min at room temperature. After three washing, these samples were dehydrated for 10 min each step in a graded series of increasing concentrations of ethanol (30%, 50%, 70%, 80%, 90%, and 100%) and infiltrated with 3:1, 1:1 and 1:3 mixtures of ethanol: Spurr’s resin (EMS, USA) for 60 min each step. These samples were replaced with

100% Spurr’s resin and left overnight at room temp. Infiltration was continued the next day and finally, samples were embedded in fresh 100% Spurr’s resin and polymerized at 65°C overnight.

Sections of one-micron thickness were cut with a Leica EM UC6 ultramicrotome (Leica

Microsystems Inc.) to visualize the samples under a light microscope. Ultimately ultra-thin sections (100 nanometer) for TEM were picked up on 200 mesh Cu grids (EMS, USA) and stained with 3% Uranyl acetate in 50% methanol for 45min, followed by Reynold’s lead citrate for 10 min, and allowed to dry overnight at RT and examined with the Hitachi H7700

Transmission Electron Microscope.

72

3.3.6 Isolation of intact mitochondria and enzymatic treatments

Mitochondria were isolated from AEV-infected N.benthamiana leaves using the modified method (219). Fresh leaves (50 g) were cut and homogenized in a mortar in 120 mL of extraction medium (EM) (20 mM HEPES-Tris pH 7.6, 0.4 M sucrose, 5 mM EDTA, 0.6% PVP (w/v) and

0.6 mM cysteine). The extract was filtered through 8 layers of cheesecloth and centrifuged 5 min at 3500 g. The supernatant was centrifuged at 28,000 g for 10 min to pellet organelles. The pellet was resuspended in 120 mL EM without PVP and centrifuged at 28,000 g for 10 min and the pellet resuspended in 2 mL of suspension buffer (SB) (10 mM MOPS-KOH pH 7.2 and 0.2 M sucrose) and loaded on a percoll gradient of 10%, 32% and 50% percoll in SB. The gradient was centrifuged at 40,000 g for 1h and the mitochondria collected as a fuzzy yellow band between the 32% and 50% percoll stages. These mitochondria were washed in 2 volume of SB buffer at

85,600 g for 90 min at 4°C to remove the percoll. These intact mitochondria were incubated with

1/10 volume of Proteinase K (20 mg/mL) at RT for 1hr to ensure that no virions associated with the mitochondria and washed twice with SB buffer and centrifuged at 28,000 g for 10 min. The supernatant was discarded and each pellet was gently resuspended in washing buffer and treated with 20 units DNaseI (New England Biolabs, NEB) for 1hr at RT to digest the viral DNA adsorbed on the surface of mitochondria and washed twice with SB washing buffer at 28,000 g for 10 min. After the final washing, the mitochondria were lysed with 1/10 volume of 2×CTAB buffer at 65°C for 30 min. After lowering the temperature of the sample to room temperature, one volume of chloroform: isoamyl alcohol (24:1) was added, mixed well and centrifuged at

14,000 × g for 10 min at room temperature. The aqueous phase was with mixed 1 μg/μL glycogen (Thermo scientific) as a carrier for nucleic acid, 0.1 M sodium acetate and 0.6 volume of isopropanol to precipitate the mitochondrial DNA (mtDNA) overnight at -20ºC. The mtDNA was pelleted by centrifugation at 14,000 × g for 10 min, washed with 70% ethanol and air dried. 73

Finally, each pellet was dissolved in 50 μL TE buffer (10 mM Tris-HCI pH 8.0 /1 mM EDTA).

PCR reaction were carried out on one microgram mtDNA as a template as mentioned in material and method section 3.3.3.

3.3.7 Isolation of virus

N.benthamiana plants, at the four true leaf stage, were inoculated with infectious clones of AEV

(A + β; 1:1) and ToLCNDV (A+B; 1:1) in Agrobacterium tumefaciens strain GV3101 using a 1 cc syringe into the abaxial surface of the leaves as mentioned above. At 2-3 weeks post- inoculation, virions were purified as described previously (259) with the following modifications. Infected leaves were homogenized in virus extraction buffer (EB) (0.1 M trisodium citrate, 0.75% (w/v) sodium sulphite, 5 mM disodium EDTA, 1% (v/v) 2- mercaptoethanol and 0.325% (w/v) L-ascorbic acid pH 7.0, adjusted with NaOH); 2 mL/g of fresh tissue. The homogenate was made 2.5% (v/v) in Triton X-100, stirred for 16 hr at 4°C and then squeezed through four layers of cheesecloth. The filtrate was clarified by centrifuged at

10,000 g for 15 min and the supernatant was collected and centrifuged at 91,862 g in a Beckman

Ti 60 rotor for 3 hr. The virus pellets were covered with resuspension buffer (RB) (0.01 M trisodium citrate, 1 mM disodium EDTA with 0.05% 2-mercaptoethanol, adjust to pH 7 with

NaOH) overnight at 4°C and then resuspended. The suspension was overlaid onto a cushion of

20% (w/v) sucrose in RB buffer and centrifuged for 3 hr at 91,862 g in a Beckman Ti 60 rotor for 3 hr. The virus solution was clarified by centrifugation three times at 15,000 g for 5 min each.

The virus can be further purified by centrifugation for 16 hr at 52,836 g through 10 to 50% (w/v) sucrose gradients in RB buffer. These virions were stored at 4°C in the presence of 0.01 % sodium azide for further downstream applications.

74

3.4 RESULTS

3.4.1 Infectivity Assays: Inoculation of plants with AEV and ToLCNDV DNA

clones

Infectious clones of monopartite AEV (DNA-A and DNA-β) and bipartite ToLCNDV (DNA-A and DNA-B) begomoviruses in Agrobacterium strain of GV3101 were infiltrated into plants to assess their ability to infect systemically. Agro-infiltrated plants were observed periodically for the appearance of symptoms. Plants inoculated with the monopartite begomovirus AEV remained asymptomatic. In contrast, inoculation with the bipartite begomovirus ToLCNDV showed mild to severe characteristic symptoms in all plants at 35 days post-inoculation (Figure

3.1 and 3.2; Table 3.2).

75

Figure 3.1 Photographs of symptomatic and non-symptomatic different Nicotiana species: N. alata (A, F, and K), N. clevelandii (B, G and L), N. rustica (C, H and M), N. sylvestris (D, I and N), and N. tabacum (E, J, and O). Plants were inoculated with infectious clones of ToLCNDV (DNA-A and DNA-B), showed severe to no typical symptoms (Panel 1), AEV (AEV-A and DNA-β), remained symptomless (Panel 2) and buffer only as a control (Panel 3). Photographs were taken at 35 days post-inoculation (dpi).

76

Figure 3.2 Photographs of symptomatic and non-symptomatic different Nicotiana species: N. Benthamiana (A, F, and K), N. glutinosa (B, G, and L), N. tabacum cv. Xanthi (C, H and M), N. tabacum cv. Samsun (D, I and N), and Solanum lycopersicum (E, J, and O). Plants were inoculated with infectious clones of ToLCNDV (DNA-A and DNA-B), showed typical symptoms (Panel 1), AEV (AEV-A and DNA-β), remained symptomless (Panel 2) and buffer only as a control (Panel 3). Photographs were taken at 35 days post-inoculation (dpi).

77

Table 3.2 Summary of the results of the infectivity assays Species Infectivity Plants Infectivity Plants (ploidy level, of PCR of PCR Symptoms ToLCNDV positive AEV positive number) (plants for (plants for infected ToLCNDV infected AEV /inoculated) /inoculated) ToLCNDV AEV Severe symptoms N.benthamiana 10/10 10 10/10 10 leaf curling, thickening of no to very (4x = 38) veins, stunted growth, mild leaf crumple symptoms Severe symptoms N.glutinosa distortion of leaves, (2x=24) 10/10 10 10/10 10 stunted no growth, leaf crumple, symptoms depressions on the upper surface of the leaves Severe symptoms distortion of leaves, no N. clevelandii 10/10 10 10/10 10 stunted growth, leaf symptoms (4x=48) crumple, depressions on the upper surface of the leaves N. sylvestris no (2x=24) 10/10 10 10/10 10 no to very mild symptoms symptoms

N. rustica (4x=48) 10/10 10 10/10 10 no to very mild symptoms no symptoms N. alata (2x=24) 10/10 10 10/10 10 no to very mild symptoms no symptoms N. tabacum mild symptoms cv. Samsun 10/10 10 10/10 10 depressions on the upper no (4x=48) surface symptoms of the leaves Severe symptoms N.tabacum distortion of leaves, no cv. Xanthi 10/10 10 0/10 0 stunted growth, leaf symptoms (4x=48) crumple, depressions on the upper surface of the leaves N.tabacum no to very mild symptoms no cv. unknown 10/10 10 10/10 10 symptoms (4x=48) Solanum Severe symptoms lycopersicum leaf curling, thickening of no (2x=24-26) 10/10 10 10/10 10 veins, stunted growth, symptoms yellow mosaic or mottled pattern, failure of reproductive organs to develop normally

78

Consequently, the virus infectivity was determined by PCR (Figure 3.3). Total genomic DNA was extracted from leaves and subjected to semi-quantitative PCR using consensus Bego CP F and R primers which were designed to amplify a 169 base pair region of coat protein gene of begomoviruses (Table 3.1). The expected size of coat protein gene could be amplified from plants challenged with infectious clones of AEV and ToLCNDV whereas no band was detected with DNA extracted from buffer treated plants (Figure 3.3, Panel C). The exception was N. tabacum cv. Xanthi plant where only ToLCNDV was systemically infected. The DNA-A titer of

AEV was higher in N. benthamiana than other plants and in comparison to DNA-A of

ToLCNDV as well (Figure 3.3 Panel C). To validate the semi-quantitative results of AEV and

ToLCNDV, DNA samples were amplified by PCR using primers pairs for Actin gene used as an internal control (Figure 3.3, Panel D).

Figure 3.3 PCR-mediated detection of AEV and ToLCNDV DNA extracted from chloroplasts and leaf tissues (total DNA) of infected plants at 35 dpi. Bego CP primers specific to the similar coat protein gene sequences of AEV and ToLCNDV were used to amplify 169 product from chloroplasts (Ch) and leaf tissues (Panels A and C respectively). 16SrRNA gene with consensus primers was included as an internal control to check the integrity of DNA isolated from chloroplasts (Panel B). Actin genes (tobacco and tomato, Table 2) were used as a loading control for total DNA (Panel D). A DNA size marker (100 bp) in 100bp increments was electrophoresed in Lane L. The resulting PCR products were analyzed on a 2% agarose gel.

79

Overall, these results indicate that AEV likewise ToLCNDV can manage to replicate and spread from the site of inoculation, however, the ability of AEV to systemically infect plants without causing symptoms is of interest and suggests that the virus is unable to interact with factors involved in inducing symptoms. It is also noteworthy that AEV behaves distinctly in different cultivars of same species of N. tabacum. This virus infects the cv. Samsun but not the cv.Xanthi, both belong to the same tabacum species, as shown in Figure 3.3.

3.4.2 Chloroplast DNA Analysis

To investigate the subcellular localization of DNA of AEV and ToLCNDV, chloroplasts were isolated under isotonic conditions from different tobacco and tomato plants infected with AEV and ToLCNDV infectious clones (Figure 3.2). DNA was isolated from purified chloroplasts and subjected to PCR analysis. Results obtained demonstrated that the expected size fragment of the coat protein (CP) gene could be amplified from DNA of chloroplasts isolated from only AEV infected plants (Figure 3.3 Panel A, Lanes 1, 2, 3 and 4). On the contrary, no specific CP gene bands were detected with DNA of chloroplasts extracted from ToLCNDV (Figure 3.3, Panel A,

Lanes 5, 6, 7 and 8). Chloroplast DNA of N. tabacum cv. Xanthi was used as a negative control in case of AEV CP gene (Figure 3.3 Panel A, Lane 9). The integrity of chloroplast DNA was confirmed with 16SrRNA gene included as an internal control (Figure 3.3 Panel B, Lanes 1-9).

Thus, these results for both ToLCNDV and AEV infectious clones suggest that the viruses themselves exhibit different properties with respect to subcellular localization.

3.4.3 Reconstruction control experiments

Additionally, reconstruction controls were also included to rule out that the AEV DNA-A found inside the chloroplasts did not originate from DNA adsorbed on the exterior surface of chloroplasts. Experiments were conducted where chloroplasts from leaf tissues of healthy N.

80

benthamiana plants were isolated and purified by sucrose gradient centrifugation. These purified chloroplasts were incubated with AEV virions, half of this sample was used to extract chloroplast DNA without proteinase K and DNase I treatment and used as a positive control. The remaining half sample was treated with proteinase K and DNase I followed by proteinase K with in between washings as described in material and method section 3.3.4. Another preparation of untreated purified chloroplasts from leaf tissues of healthy plants was also included as a negative control. Subsequently, DNA from these chloroplasts was isolated and subjected to PCR reactions using Bego CP F and R primer pairs.

Figure 3.4 Reconstruction experiments to reject the possibility of adsorption of virions or/and DNA during the purification of chloroplasts. PCR experiments were performed with (Panel A, Lanes1-4). Lanes: 1, DNA isolated from infected leaves (AEV) used as a positive control with Bego CP primers; 2, DNA isolated from chloroplast of healthy plants where AEV virions were mixed and used as a reconstruction experiment but without proteinase K and DNase I treatment; 3, DNA isolated from chloroplast of healthy plants and used as a reconstruction experiment where AEV virions were mixed and subsequently treated with proteinase K and DNase I treatment to confirm enzymatic activity and to rule out the possibility that virions or DNA adsorbed with chloroplasts; 4, DNA of chloroplast isolated from healthy leaves infiltrated with buffer only, used as a negative control. Panel B: 16SrNA gene was included as an internal control to check the integrity of chloroplast DNA. Panel C: Actin gene was used as a negative control for chloroplast DNA as shown in Lanes 2, 3 and 4 while Lane 1 band was amplified from total DNA isolated from AEV infected leaf tissues to confirm the integrity of Actin primers. The resulting PCR products were analyzed on a 2% agarose gel.

81

It is clear from the reconstruction experiments that sample which lacks enzymatic treatment exhibits a prominent band of viral DNA, however, virions and DNA were completely degraded after enzymatic treatment (Figure 3.4 Panel A, Lane 2 and 3 respectively). These results clearly demonstrate that DNA found in chloroplasts cannot be the result of a simple contamination of adsorbed virions or DNA on the surface of chloroplasts. This study is also consistent with the data as seen most clearly in Figure 3.3. In addition, chloroplast 16SrRNA, and nuclear Actin genes used as positive and negative reference controls respectively further confirmed the ability to cleanly purify chloroplast DNA from any contaminating complete cells. The reliability of primers and experimental conditions were confirmed with total DNA isolated from AEV infected

N. benthamiana plants (Figure 3.4, Panel A, B and C Lane 1). The efficiency of DNase I digestion after proteinase K treatment was controlled with DNA of AEV that was added to some plastid samples (data not shown). Overall, these results demonstrate that solely the DNA from

AEV is capable of being translocated into chloroplasts. Members from the same begomoviruses family do not necessarily target the same organelles.

3.4.4 Microscopic studies

Chloroplast purity and intactness were further confirmed using a phase contrast microscopy.

Purified chloroplasts were visualized under a phase contrast microscopy to confirm their integrity. Ten aliquots of each sample were examined in detail for their purity. Figure 3.5 A shows these isolated chloroplasts are free from intact cells. In addition, electron microscopic examination with purified chloroplasts revealed that these samples were free of other cellular organelles (Figure 3.5 B and C). Furthermore, ultrastructure of chloroplasts from healthy and

AEV infected asymptomatic plants were studied in details. In both samples, chloroplasts contained a dense stroma with , starch grains, and plastoglobuli. However, the

82

chloroplast of infected plants have more plastoglobuli than those of uninfected plants, in addition, chloroplasts of infected plants are also associated with mild damage in thylakoids and grana as shown (Figure 3.5 C).

Figure 3.5 Phase contrast and electron microscopic studies of chloroplasts. (A) Phase contrast photographs of chloroplasts to examine intactness after purification through sucrose gradient centrifugation. (B) Electron micrographs of chloroplasts from healthy (C) and infected plants. Chloroplasts from infected plants are characterized by degenerated thylakoids (circled) and more plastoglobuli (p). Bar =10µM

3.4.5 Translocation of AEV DNA in mitochondria

To determine the translocation of AEV DNA-A into mitochondria, DNA was isolated from mitochondria of infected plant leaves and subjected to PCR using AEV CP F and R primers. The expected size of coat protein gene could be amplified from total DNA sample whereas no band was detected with DNA extracted from mitochondria of the infected plants (Figure 3.6, Panel A;

Lanes 1 and 2 respectively). It might be concluded from these experiments that DNA-A of AEV failed to translocate into mitochondria of AEV infected pants.

83

Figure 3.6 PCR-mediated detection of AEV DNA extracted from mitochondria and leaf tissues of N. benthamiana infected plants at 35 dpi. AEV CP primers specific to the coat protein gene were used to amplify a 283bp product from AEV infected leaf tissues and mitochondria (Panel A; Lane 1 and 2 respectively). Primers for18SrRNA from mitochondrial genome were used to amplify 187 bp product as an internal control to check the integrity of DNA from leaf tissues and mitochondria (Panel B; Lane 1and 2 respectively). A DNA size marker (100 bp) in 100 bp increments was electrophoresed in Lane L. The resulting PCR products were analyzed on a 2% agarose gel.

3.5 DISCUSSION

The results presented here suggest that all the Nicotiana and tomato plants tested are susceptible to ToLCNDV and exhibit rigorous symptoms of infection. All Nicotiana species, with the exception of N. tabacum cv. Xanthi plants were shown to be susceptible to Ageratum enation virus infection, however, all of these plants remained asymptomatic. This contrasts with the results described by others (260, 261), where tobacco and tomato plants infected with AEV

Tomato isolate and AEV isolate ACL exhibited severe leaf curling, vein clearing, vein enation, reduction in leaf lamina, dimples on upper leaf surface, chlorosis, necrosis and stunted growth symptoms. The causes of symptom induction are multiple but always depend on the aggregation of viral nucleic acids or proteins that interfere with the normal function of the plant and/or trigger a symptomatic defense response (262, 263). Previously, it has been revealed that begomovirus and curtovirus Rep proteins bind to retinoblastoma-related protein (RBR), a key regulator of the plant cell cycle, through a unique motif. Mutation of these motifs in Rep A and Rep results in

84

milder symptoms and reduced viral DNA accumulation (264, 265). AEV used in the study is associated with betasatellite (DNA-β). DNA-β bears a βC1 open reading frame on the complementary sense strand, which is conserved among distinct betasatellites in terms of position and size. Mutational analyses and constitutive expression have revealed that βC1 is a strong pathogenicity/symptom determinant (266-268). Guo, et al. (269) exhibited more severe symptoms and also enhanced viral DNA accumulation when Tomato yellow leaf curl Thailand virus was inoculated in association with betasatellites. These findings are not consistent with our observations where all plants remained symptomless when infected with infectious clones of

AEV DNA-A and DNA-β. The DNA-A molecule nucleotide sequence of infectious AEV clone used in this study exhibited the highest levels of nucleotide sequence identity (94.1%) with the

DNA-A of AEV Tomato isolate. This asymptomatic infectivity of AEV is suggestive of the virus’s inability to interact with factors involved in inducing symptoms. In certain cases, these factors are considered to be involved in the miRNA pathway, which is affected by virus pathogenicity determinants (270). In specific geminiviruses, the C4 protein is a pathogenicity determinant and a suppressor of PTGS by binding to siRNAs (271, 272). Different host proteins such as Shaggy-like protein kinases like SK4-1/SKK have been shown to interact with other geminiviral C4 proteins; this interaction is required to trigger disease symptoms (273, 274) and for C4 function to suppress gene silencing (273). These findings suggest that viral and host factors play a key role in symptom development which are probably correlated with the viral sequences and their mimicry to certain cellular mRNAs in plants.

The present study also shows that individual Nicotiana species even with same ploidy levels differ in their susceptibility to begomoviruses. Species of Nicotiana vary from immune (N. tabacum cv. Xanthi) to high susceptibility (N. benthamiana) to AEV. The susceptibility of N. benthamiana (polyploid), N. glutinosa (diploid) and N. tabacum (polyploid) and resistance

85

response of N. tabacum cv. Xanthi (polyploid) to AEV illustrates that there is no clear relationship between infectivity and ploidy levels. Our results are consistent with those described by others (275) who showed that there is no clear relationship between begomovirus susceptibility/resistance and the ploidy level of Nicotiana spp. Gottula, et al. (276) also demonstrated that there is a limited relationship between host ploidy level and virus resistance.

Interestingly, our results showed that the levels of viral DNA were lower in symptomatic plants than those of asymptomatic plants inoculated with ToLCNDV and AEV respectively. Our studies also exhibited a higher level of viral DNA-A in the case of N. benthamiana plants as compared to that of other Nicotiana species and Solanum lycopersicum. Tsuda, et al. (277) showed that the pathogenicity of pepper mild mottle virus is regulated by the RNA silencing suppressor activity of its replication protein, and not by the levels of viral accumulation. The virus titer does not necessarily correlate with the severity of symptoms indicating that disease can be the result of other molecular mechanisms that underlie the onset of disease symptoms and not general distress.

To address the geminivirus infection, an RNA silencing system which targets the conserved region (CR) of many geminiviruses is designed to generate transgenic tobacco plants.

This system generates a 176 base pair double stranded RNA which encompasses most of the CR region of many begomo- and geminiviruses infecting a large number of economically important crops. This construct was tested against two begomoviruses (AEV and ToLCNDV). The preliminary studies show a very strong reduction in virus replication in the transgenic Nicotiana benthamiana plants (Appendix E). Molecular mechanisms involve in the resistance, as well other molecular approaches for the development of plant resistance are also discussed (see details in Appendix E).

86

Another question that we investigated was whether genome of the begomovirus genomes could be isolated from chloroplasts of tobacco and tomato leaves systemically infected with these viruses. Accordingly, we have demonstrated that only DNA-A of AEV is present within chloroplasts. Several lines of evidence are presented to allow us to conclude that Ageratum enation virus DNA-A enters the chloroplast in vivo. A reconstruction control included in the experiment ruled out the possibility that virions or DNA may co-purify with chloroplasts or that they might become attached to the surface of chloroplasts as a result of the isolation procedure.

The encoding Actin, used as a negative control, further confirmed our ability to cleanly purify chloroplast DNA from any contaminating complete cells. Microscopic studies with isolated chloroplasts provide another line of evidence that these chloroplasts are free from other cellular organelles. These results are in accordance with earlier studies on Abutilon mosaic virus (AbMV), a begomovirus, conducted by Groning, et al. (164) who showed that AbMV DNA was present in the plastids of AbMV-infected Abutilon sellovianum plants. Despite several decades of research, the mechanism by which geminiviruses DNA translocates into the chloroplast remains to be determined. It is believed that viral proteins are involved in the intracellular movement of DNA. The transport of viral ssDNA from the nucleus towards the plasmodesmata is facilitated by a nuclear export signal (NES) on the CP C-terminus and NES on the Pre-CP N-terminus (249, 250). A nuclear shuttle protein is involved in the transportation of viral DNA from the nucleus into the cytoplasm (246, 278). Host factors also play a major role in targeting of the genome of the viruses towards different organelles. Krenz, et al. (256) showed that a chloroplastic HSC70 from Arabidopsis interact with Abutilon mosaic virus movement protein; an interaction that seems to be important for viral transport and symptom induction.

Cheng, et al. (209) demonstrated that chloroplast phosphoglycerate kinase is responsible for the targeting of the bamboo mosaic virus to chloroplasts in N. benthamiana plants. Our studies also

87

revealed that DNA of ToLNDV could not be isolated from chloroplasts of infected plants. These findings suggest that members of the same family do not necessarily target the same organelles.

These studies also indicate that same virus AEV is incapable of targeting different cellular organelles (mitochondria) during its infectious cycle. The potential underlying transport mechanism of AEV genome into chloroplasts is not yet known but it can be hypothesized that genomic determinants in combination with host factors may play a major role in the targeting of nucleic acid to different organelles.

88

CHAPTER 4

4 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS

4.1 GENERAL CONCLUSIONS

The subject of the current study involves pioneering research on the discovery of equivalent

RNA activity embedded in PVX genome where a part of viral RNA functions as a tractor to transport the tagged RNA into chloroplasts. This “RNA tractor” activity is dependent upon a limited non-coding region (127 nucleotides) of the PVX RNA transcript, located near the end of the PVX 8 kDa gene and the start of the coat protein (CP) gene as well as the small non-coding intergenic region. Our PVX “RNA tractor” system doesn’t seem to involve any viral proteins, and in this regard, may be comparable to the translocation of the Eggplant latent viroid RNA.

The PVX “RNA tractor” activity described here is the first report of its kind for a virus non- coding sequence that is capable of translocating not only its own sequence (the entire PVX RNA and the PVX CP mRNA) but also that of a foreign RNA sequence (GFP) into chloroplasts.

Another key research question in this study is whether or not a viral DNA can be translocated into chloroplasts. The research conducted with two begomoviruses, Ageratum enation virus (AEV) and Tomato leaf curl New Delhi virus (ToLCNDV), answers this question by confirming the presence of only AEV DNA-A (monopartite) in chloroplasts of viral infected leaves. The DNA of abutilon mosaic virus was isolated from intact chloroplasts (164), representing the only other example of a geminiviral viral genome in chloroplasts. Considering these findings on the sub-cellular localization, it is plausible that viruses use fundamentally different transport mechanisms within their hosts.

Since both chloroplasts and mitochondria share many structural similarities, in particular, a double membrane and prokaryotic ribosomes (279), we postulated that the PVX 89

“RNA tractor” and AEV DNA-A might be able to target the mitochondria. However, I determined that both the PVX “RNA tractor” and AEV DNA do not target the mitochondria.

Although mitochondria and chloroplasts both considered being evolved from prokaryotic ancestors.

4.2 FUTURE DIRECTIONS

Since it has been determined that none of the viral proteins are involved in the movement of

PVX “RNA tractor” into chloroplasts, it is predicted that host factor (s) is/are interacting with the

PVX RNA and facilitating its trafficking into the chloroplasts. Further studies are required in order to detect whether any potential host protein(s) interact with eggplant latent viroid and the

PVX “RNA tractor,” through the use of biochemical approaches such as Electrophoretic

Mobility Shift Assay (224, 225) or/and UV cross-linking RNA/protein complexes (223, 226,

227), followed by mass spectrometry to analyze the sequence of the purified proteins (228). In addition to this, a chloroplast localization signal within the RNA tractor/DNA sequence, analogous to a nuclear localization signal, needs to be identified. Also, the unique structural features (such as receptors) of chloroplast membranes involved in interaction with RNA tractors would need to be further explored. The prime determinants of the tractor activity such as a canonical nucleotide sequence or secondary structure within the tractor need to be addressed. It would also be interesting to investigate whether this translocation phenomenon occurs in related viruses. Understanding the contingent scenarios of this molecular landscape will provide us clues into how the noncoding RNAs and pathogenic DNAs evolved, and should ultimately allow us to characterize them. This may also lead us to understand some aspects of gene regulation, development and help establish evolutionary relationships.

Our studies also revealed that DNA of AEV, but not of ToLNDV, could be isolated from chloroplasts of infected plants. This finding suggests that members of the same family do not

90

necessarily target the same organelles. The potential underlying transport mechanism of the AEV genome into chloroplasts is not yet known but it can be hypothesized that genomic determinants in combination with viral and/or host protein(s) may be playing a major role in the targeting of nucleic acids to chloroplasts. In addition, the relevance of the findings should be tested for additional geminiviruses other than AEV. All plants inoculated with ToLCNDV were systematically infected and showed characteristic symptoms. However, in the case of AEV, all plants tested, with the exception of N. tabacum, were infected by the virus but remained symptomless. The mechanism by which the N. tabacum cv. Xanthi conferred resistance has not been addressed. Detailed studies of both the molecular genetics of these viruses and their hosts’ natural defense systems will result in the development of novel ways to control virus diseases in plants. The knowledge gained from these studies will not only contribute significantly to the elucidation of the geminiviral intra- and intercellular movement processes but will additionally provide a better understanding of virus replication processes as well as insight with respect to strategies designed to reduce the economic damage caused by these viruses.

Lastly, a novel idea has emerged to use plant chloroplasts as bioreactors to target and overexpress nucleic acid and/or protein molecules in chloroplasts through the previously mentioned RNA and DNA tractors. This could act as a viable biotechnological alternative to bacterial and fungal fermentation or mammalian cell culture towards the industrial-scale production of several compounds (280-283). Therefore, the identification of non-coding RNAs and DNAs as untranslated signals capable of mediating the stable expression of foreign proteins in chloroplasts provides an enriched conceptual basis to develop distinctive strategies for production of biologicals, biopharmaceuticals, vaccines or drugs in bioreactors designed using plant chloroplasts. Genetic engineering of proteins with chloroplast permeability would be another approach in this direction.

91

APPENDICES

92

APPENDIX A

5 ATTEMPTS FOR RNA TRACTOR SEQUENCE MODIFICATION FOR GFP EXPRESSION IN CHLOROPLASTS

5.1 INTRODUCTION

We have demonstrated that the pTR:127 has the capacity to translocate the GFP mRNA to chloroplasts. To provide another line of evidence of RNA tractor activity in chloroplasts and determine that the GFP sequence is functional in the chloroplast, pTR:127 construct was redesigned considering the translation mechanism of chloroplasts. Chloroplasts are plant cellular organelles that have their own genome and a prokaryotic-type translation machinery consisting of 70S-type ribosomes, ~30 tRNA species, initiation/elongation factors (e.g. IF-1, EF-Tu, and

EF-G) and aminoacyl-tRNA synthetases which are highly homologous to those in

(284-288). In prokaryotes, translation is believed to be facilitated by mRNA-rRNA interactions between the Shine-Dalgarno (SD) sequence upstream of the translation initiation codon and the anti-Shine-Dalgarno sequence (ASD) at the 3´end of the small (16S) ribosomal RNA.

Chloroplast mRNAs are not capped, instead, over 90% of chloroplast genes in land plants possess an upstream sequence similar to the bacterial SD sequence (typically GGAGG) that is capable of binding to a complementary sequence near the 3´end of the chloroplast 16SrRNA

(289) as shown in Figure 5.1.

93

Figure 5.1 Schematic representation of the 3´end portion of tobacco chloroplast 16SrRNA (290).

Chloroplast ribosome-binding sites were identified on the plastid RuBisCO large subunit (rbcL) mRNAs. The rbcL translation initiation domain is highly conserved which contains a prokaryotic Shine-Dalgarno (SD) like sequence (AGGGAGGGA) located 4 to 12 nucleotides upstream of the initiation AUG codon and found to be essential for translation (291). Knowing about translation system of chloroplasts and PVX RNA tractor sequence (127 nt) which is enough to translocate not only its own PVX RNA sequence but also a reporter gene (GFP mRNA) into the chloroplast, these strategies were attempted to make RNA tractor sequence functional for GFP mRNA as a reporter gene.

5.2 Addition of SD-like sequence (pCrbcLSD-GFP)

To determine the functionality of rbcL SD-like sequence (AGGGAGGGA) and reflecting the importance of RuBisCO (the most abundant protein in leaves, accounting for 30-50% of soluble leaf protein in plants) the SD-like sequence was inserted to the upstream of GFP initiation codon

AUG in pTR:127 construct and named it pCrbcLSD-GFP (Figure 5.2). Note that pTR:127rbcLSD construct was designed in such a way that the AUG for the GFP is not in frame with the AUG of PVX CP, consequently GFP will not be functional in the cytosol.

94

Figure 5.2 Details of partial DNA sequences of the pCrbcLSD-GFP construct under the control of 35S promoter and the nopaline synthase terminator (T-nos). SD-like sequence (AGGGAGGG) is located 6 nucleotides upstream of the initiation AUG codon of GFP for possible translation in the chloroplast.

However, confocal microscopic observations with transgenic plant harboring pCrbcLSD-GFP construct failed to show GFP expression inside the chloroplasts as depicted in Figure 5.3.

Figure 5.3 Confocal microscopic observation of Nicotiana tabacum cv. Xanthi leaves harboring pCrbcLSD- GFP. Autofluorescence of chloroplasts is shown in red. DIC: Differential interference contrast (microscopy).

From this experiment, it could be speculated that the SD sequence alone might not be able to mediate an efficient initiation of translation but needs to be complemented with an enhancer sequence or/and additional levels of regulation for translation in chloroplasts. According to the previous studies, the following sequence elements of the translation initiation region (TIR) contribute to its translation efficiency: (a) the initiation codon, which is most commonly AUG but sometimes GUG and very rarely UUG, AUU or CUG (292-295); (b) the Shine-Dalgarno

(SD) sequence (296, 297); (c) regions upstream of the SD sequence and downstream of the initiation codon, which are often described as enhancers of translation (297-299). Cross-linking studies have shown that the nucleic acid-binding domain of S1 is aligned with a region of the 95

mRNA upstream of the SD, suggesting that S1 may interact with 5´ parts of the TIR (300, 301).

Consistent with this observation, A/U-rich sequences in front of the SD or downstream of the initiator codon enhance protein synthesis (302, 303). Komarova, et al. (302) demonstrated that nine sequences were acting as translational enhancers. They are all A/U-rich and contain very few Gs contents. Disruption of the E. coli gene coding for S1 has been reported to be lethal

(304). A decreased level of S1 protein in the cell leads to a rapid decrease in total protein synthesis (305). Thus, it can be speculated that the SD sequence alone cannot mediate efficient initiation of translation but has to be complemented with an enhancer sequence.

5.3 Addition of 5´-translation control region of large sub-unit RuBisCO gene

To determine whether the additional determinants along with SD sequence are required to translate GFP mRNA in chloroplasts, 5´-translation control region of chloroplastic large sub-unit

RuBisco gene, comprise of 14 N-terminal amino acids and 59 of 5´-UTR region, is designed based on previous studies (210). In higher plant plastids mRNA sequences in the 5´-untranslated region (UTR) were shown to be important for translation. 5´-UTRs and cis-elements required for efficient translation of plastid mRNAs have been characterized by both in vivo and in vitro studies (211, 306, 307). Using in vitro system, Yukawa, et al. (308) found that mRNAs carrying unprocessed or processed rbcL 5´-UTRs were efficiently translated at similar rates by employing a green fluorescent protein (GFP). Transcription of the tobacco rbcL mRNA initiates at 182 nucleotides upstream of the translation initiation codon (309). The may be processed to create an mRNA with a 58 nucleotide 5´-UTR (310, 311). Kuroda and Maliga (210) employed a transgenic approach to demonstrate accumulation of the neomycin phosphotransferase (NPTII) reporter enzyme when translationally fused with 14 N-terminal amino acids encoded in the rbcL. Fifty-nine nucleotides of upstream were used as 5´-UTR region. N-terminal coding region and the 5´-UTR were collectively designated as the 5´-

96

translation control region or 5´-TCR. Considering the importance of 5´-TCR region, two clones pC127TCR-GFP, and pCVdTCR-GFP are designed with the 5´-TCR region (Figure 5.4).

Figure 5.4 Details of partial DNA sequences of the pCvdTCR-GFP and pC127TCR-GFP constructs under the control of the Cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (T-nos).

Eggplant latent viroid chimeric construct pCvdTCR-GFP was included on the base of previous findings by Gomez and Pallas (95) who demonstrated that the viroid sequence acting as a 5´-

UTR end mediated the trafficking and accumulation of a functional foreign mRNA into N. benthamiana chloroplasts. However when the tobacco leaves were agroinfiltrated with pCvdTCR-GFP and pC127TCR-GFP constructs it was observed that GFP is functional in agrobacteria cells but not in chloroplasts (Figure 5.5).

97

Figure 5.5 Confocal microscopic observation of GFP in N. benthamiana leaves after 72 hr of agro- infiltration. GFP is expressed inside the infiltrated leaves due to fluorescent bacterial cells harboring pCvdTCR-GFP (Panel A) and pC127TCR-GFP (Panel B) constructs respectively. The signal for GFP is shown in green, the autofluorescence of the chloroplast is shown in red.

To confirm whether this GFP expression is inside the agrobacteria cells, these bacterial cells are analyzed as well under confocal microscopy. Consequently, a robust expression of GFP is detected in bacterial cells as demonstrated by confocal microscopy as depicted in Figure 5.6.

98

Figure 5.6 Confocal microscopic observation of GFP in agrobacteria cells after 48 hr. GFP is expressed inside the cells harboring pCvdTCR-GFP (Panel A) and pC127TCR-GFP (Panel B) constructs respectively in the presence of 5´TCR of rbcL which is located upstream of the GFP gene in the both constructs.

In this context, it is important to note that the 16SrRNA of both the chloroplasts and the A. tumefaciens share 79% nucleotide sequence homology and both have the sequence CCUCC at their 3´ end that is complementary to the SD-like sequence GGAGG in the translation initiation region. However, this expression in A. tumefaciens was at least 10 times less than what was observed for the pCpETSD-GFP construct containing the highly efficient phage T7 5´-UTR context (Figure 5.10). Previously we have shown (312) that there was no difference in GFP expression between agrobacteria cells harboring constructs containing the entire 5´-TCR of rbcL and only the 58 nucleotide 5´-UTR region, implying that the coding region downstream of the

AUG codon did not affect protein translation initiation in agrobacteria cells unlike that of chloroplasts which require the entire 5´-TCR for successful protein translation (210).

Despite the presence of 5´-TCR in both pCvdTCR-GFP and pC127TCR-GFP constructs,

GFP was failed to express in the chloroplast of the infiltrated plants. One of the possibilities that

RNA tractor sequence is not translocated in the chloroplasts, it can be ruled out by the fact that

99

Eggplant latent viroid (ELVd), a member of the Avsunviroidae family (a class of subviral plant pathogens that infect, replicate and accumulate in chloroplasts), sequence definitely targets to the chloroplast. In the case of pCvdTCR-GFP if the TCR is functional then GFP should be expressed inside the chloroplast. So in this case, it might require some additional levels of regulation for translation or change in secondary structure of RNA due to TCR sequence which inhibits translation. Secondary structure formation near the 5´-end of a eukaryotic mRNA can have negative or positive effects upon translation initiation (313).

5.4 Addition of 5´-UTR of Psb A gene for translation initiation of GFP in

chloroplast

Another attempt was carried out to translate GFP in chloroplast using 5´-UTR of psbA chloroplast gene along with ELVd sequence used as a carrier sequence to the chloroplast. The 5´-

UTR of psbA gene previously has been successfully characterized for translation of reporter genes both in vivo and in vitro studies (211, 308, 314, 315). Three elements within the 5´-UTR of the chloroplast mRNA are reportedly required for translation in psbA gene. Two of them are complementary to the 3´-terminus of chloroplast 16SrRNA (termed RBS1 and RBS2) and the other is an AU-rich sequence (UAAAUAAA) located between RBS1 and RBS2 and is termed the AU box. RBS1 and RBS2 are cooperatively required for efficient translation of psbA mRNA encoding the D1 protein of photosystem II that is synthesized only in light-grown chloroplasts.

To determine translation in the chloroplast, a construct pCELVdpsbA-GFP that contained

ELVd sequence, 85 nucleotides as a 5´-UTR including RBS, AU-rich region and ATG of the psbA gene upstream of the GFP gene was designed (Figure 5.7) and transformed in

Agrobacterium.

100

Figure 5.7 Details of partial DNA sequences of the pCELVdpsbA-GFP construct in pC-GFP under the control of the Cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (T-nos).

Confocal microscopy studies with agro-infiltrated N.tabacum leaves exhibit that there is no expression of GFP in both chloroplasts and agrobacterium (Figure 5.7), suggesting a major difference in the translatability of the GFP protein between the 5´ non-coding sequences of the

Figure 5.8 Confocal microscopic observation for GFP in transgenic tobacco plant leaves and agrobacteria cells harboring pCELVdpsbA-GFP construct. GFP is not expressed both in the chloroplasts of transgenic plants (Panel A) and inside the bacteria cells (Panel B) in the presence 5´-UTR of chloroplastic psbA gene which is located upstream of the GFP gene in the construct.

RuBisCO large subunit gene and that of the psbA gene, even though both are encoded by the chloroplastic genome and are known to be involved in photosynthesis. This led me to conclude that the presence of the SD-like sequence close to the AUG start codon and a specific 5´-UTR

101

sequence are required for translatability in A. tumefaciens. The rbcL gene with the SD-like sequence 10 nucleotides away from the AUG codon satisfies this requirement whereas the psbA gene SD-like sequence is much farther away (40 nucleotides upstream) from the AUG codon and, therefore, does not allow positive GFP expression. GFP expression was not observed inside the chloroplasts, even in the plants harboring pCELVdpsbA-GFP construct it can be assumed that it requires some additional levels of regulation for translation in the chloroplasts. It might need the interaction of 5´and 3´ ends of chloroplast mRNA which is common in cytoplasmic mRNAs. In , interactions between the two termini of cytoplasmic mRNAs stimulate the initiation of translation. The poly (A) binding protein (PABP) bound to the 3´poly (A) tail interacts with initiation factors bound to the 5´-UTR, thus creating a ‘closed loop’ that promotes the recruitment of the 40S ribosomal subunit. It is generally thought that the ‘closed loop’ role is a quality control mechanism to promote translation of full-length mRNAs rather than truncated forms (316). Translatable chloroplast mRNAs do not contain poly (A) tails. Most of them, similarly to prokaryotic mRNAs, contain an AU-rich 3´-UTR with a terminal inverted repeat.

The 3´-UTR inverted repeat has been shown to play a role in the processing and stabilization of the mRNA (317). Examples of modulation of translation initiation by interactions between the two termini of mRNA in prokaryotes (318, 319) raise the possibility that such interactions might also exist in chloroplast mRNAs and influence their expression. Indeed, there are several reports that support a role for the 3´-UTR in translation initiation of several mRNAs. Correct processing of the 3´-UTR was suggested to be required for high levels of translation initiation and polysomal association in Chlamydomonas reinhardtii cells (320). Recent results from tobacco transformants in which the influence of the psbA UTRs on the translation of a reporter gene were studied indicated that including the psbA 3´-UTR resulted in a three to four-fold enhancement of translation (321). Furthermore, through high-affinity binding of regulatory proteins to C.

102

reinhardtii psbA mRNA is primarily via its 5´-UTR, the 3´-UTR was shown to increase the affinity of binding of the 5´-UTR-binding (322). In another study, deletion of the inverted repeat of the 3´ UTR of tobacco petD mRNA led to a reduction in petD expression beyond that expected by the decrease in mRNA accumulation alone, indicating that the 3´-UTR might also contribute to efficient translation (317). Further research is needed to establish the generality of this phenomenon and its importance for translation efficiency.

5.5 Addition of bacterial translation initiation region (TIR) for GFP

expression

Since the translation machinery in the chloroplast generally resembles that of prokaryotes; the chloroplast ribosomes are closely related to the eubacterial 70S-type ribosomes, chloroplast transcripts like prokaryotes are not m7G capped at their 5´end, and lack 3´poly (A) tails.

Furthermore, the anti-Shine-Dalgarno (SD) sequences at the 3´ends of the 16SrRNAs of and chloroplasts share high homology with the E. coli anti-SD sequence (323-

325). I decided to express GFP using in E.coli translation initiation region, comprises the initiator codon, Shine-Dalgarno (SD) sequence and translational enhancer A/U-rich sequences.

To achieve this target, first pET: GFP-construct was generated by cloning the GFP gene into a

Kanamycin-resistant plasmid pET29 vector, containing original SD sequence (AGGAGA) and

A/U-rich region (uuuguuuaacuuuaagaAGGAGAuauacauAUG) under the control of strong bacteriophage T7 promoter (Figure 5.9). For protein production, this recombinant plasmid was transferred to a host containing a chromosomal copy of the gene for T7 RNA polymerase. The addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to a growing culture induces T7 RNA polymerase, which in turn transcribes the target DNA in the plasmid. The SD sequence

(AGGAGA) helps recruit the ribosome to the mRNA (GFP) to initiate protein synthesis by

103

aligning it with the codon. The expression of GFP in E. coli BL21 Codon Plus strain harboring pET-GFP construct is very high as shown in Figure 5.10.

Figure 5.9 Details of partial DNA sequences of the pET-GFP construct in pET29 under the control of T7 promoter and T7 terminator.

Figure 5.10 Fluorescence micrograph of GFP in E. coli cells transfected with the pET-GFP construct and induced with 0.5 mM IPTG for 16 hr.

This clearly indicates that the S/D sequence (AGGAGA) is quite functional in E. coli.

Subsequently, this cassette including A/U rich, SD sequence and GFP was inserted into pTR:127 construct and designated as pC127pETSD-GFP (Figure 5.11).

Figure 5.11 Details of partial DNA sequences of the pC127pETSD-GFP construct in pC-GFP under the control of the Cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (T-nos).

104

Figure 5.12 Confocal microscopic observation of GFP in leaves and agrobacteria cells harboring pC127pETSD- GFP after 72 hr. GFP is expressed inside the infiltrated leaves due to fluorescent agrobacterial cells (Panel A) which is confirmed by observing the agrobacteria cells alone (Panel B). The signals for GFP are shown in green and the autofluorescence of the chloroplast is shown in red.

Agroinfiltration experiments demonstrated that GFP was expressed in agrobacterial cells but not in the chloroplast as shown in Figure 5.12. CaMV 35S promoter was regarded to be plant specific and not active in other organisms such as bacteria, fungi or human cells. This assumption had been proven wrong. It has also been established that the CaMV35S promoter is not only active in plants but also in E.coli, in soil bacteria Agrobacterium rhizogenes (326), yeast (327) and in extracts of human lines (328). According to these results this viral

35S promoter has the ability to initiate gene expression in A. tumefaciens (Figure 5.12).

However from the Figure 5.12, it seems that the additional levels of regulation are required for translation in chloroplasts. The chloroplast S1 protein is a nuclear-encoded protein and is much shorter than the bacterial protein. Different RNA-binding specificities were reported for the chloroplast S1 protein with preference to AU-rich RNA sequences that are common in the 5´-

UTR of chloroplast genes (329-332). Further research is needed to establish the generality of this phenomenon and its importance for translation efficiency. In future experiments are required to

105

generate a construct where, beside the RNA tractor activity, sequences like SD and other chloroplast ribosomal recognition sequences would be tested to allow translation of the GFP reporter gene in the chloroplast.

106

APPENDIX B

6 STRATEGY TO FIND OUT THE CAPACITY OF CHIMERIC EGGPLANT LATENT VIROID SEQUENCE AS A 5´-UTR FOR GFP EXPRESSION IN CHLOROPLASTS

Gomez and Pallas (95) reported that a chimeric DNA containing a modified Eggplant latent viroid cDNA sequence fused as a 5´-UTR of GFP mediates not only the import of GFP mRNA into the chloroplasts but also allows a high expression of GFP in chloroplasts. The specific localization of the functional chimeric transcripts was demonstrated in transient expression assays with N. benthamiana plants using confocal microscopy. This non-coding viroid, a member of the Avsunviroidae family, is naturally transported and replicated in chloroplasts.

When a chimeric sequence of this viroid was placed in front of GFP, it resulted in a high degree of the GFP expression (95). However, it is not clear how and why such a chimeric viroid sequence allowed the translation in chloroplasts. Whether the viroid sequence or/and specific structure motifs are required for translation of GFP in chloroplasts. To address these questions, first the chimeric viroid sequence (AN -HM136583) from the Eggplant latent viroid (ELVd) was synthesized and cloned in a binary vector pC-GFP carrying the GFP cDNA under the control of the Cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (T-nos). The resultant vector pCELVd-GFP contains an ELVd derived cDNA fused as a untranslated region

(UTR) to the 5´end of the GFP cDNA but without AT-rich leader sequence Figure 6.1.

107

Figure 6.1 Details of partial DNA sequence of Eggplant latent viroid for different constructs. A) pCELVd-GFP without an AT-rich leader sequence B) pCATvd-GFP, with an AT-rich leader sequence C) pCATvdAnti-GFP, SD-like (GGAGGATTCG) sequence (red) is replaced with anti-SD-like (CCTCCTAAGC) sequence D) and pCATvd80-GFP (an internal110 nt of the functional chimeric ELVd sequence previously shown to be sufficient for the trafficking of functional GFP-mRNA into chloroplasts (96) is further truncated to 80 nt. All constructs are under the control of the Cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (T-nos).

This construct was transfected into A.tumefaciens. When the functionality of this chimeric transcript in N. benthamiana transgenic plants was analyzed by confocal microscopy, GFP expression was either invisible or very low in the chloroplasts. However when AT- rich leader sequence is inserted to the upstream of viroid sequence (Figure 6.1) the accumulation of GFP in

108

chloroplasts is very high (Figure 6.2, panel B), suggesting that viroid sequence is fully functional for GFP expression only in the presence of AT-rich sequence.

Figure 6.2 The GFP arising from different ELVd-5´-UTR-GFP transcripts. Confocal microscope observation of the N. benthamiana leaves expressing GFP: Panel A) pCELVd-GFP construct without AT-rich region at the upstream of ELVd, GFP is localized in nucleus, cytoplasm and less in chloroplast; Panel B) pCATvd-GFP construct with AT-rich region, GFP is mostly localized in the chloroplasts; Panel C) pCATvdAnti-GFP construct, SD-like (GGAGGATTCG) sequence is replaced with anti-SD-like (CCTCCTAAGC) sequence, GFP is equally localized in the nucleus, cytoplasm, and chloroplasts; Panel D) pCATvd80-GFP construct, ELVd sequence is truncated to 80 nucleotides only, GFP is localized in nucleus and cytoplasm only. These observations were taken from agroinfiltrated leaves after 72 hr. The left Panel (top to bottom) show the GFP fluorescence (green), middle Panel (top to bottom) indicates the autofluorescence (red) of 109

chloroplasts (chlorophyll) and any overlap of GFP and chloroplast fluorescence is indicated in yellow in the merged right Panel (top to bottom).

This AT-rich sequence is derived from the 5´-UTR region of the capsid protein of Alfalfa mosaic virus (AIMV) and is believed one of the most efficiently translated RNAs known (333). This sequence was shown to function as a translational enhancer in vitro (334) and in vivo (335).

Previously it has been also shown that the middle region of the chimeric vd 5´-UTR, comprised of 110 nucleotides, is important for the expression GFP in the chloroplast, however, the functionality of the localization is increased when it is combined with other regions (96). A Shin-

Dalgarno like sequence (GGAGGATTCG) is noticed in this middle region of the chimeric ELVd sequence. It is hypothesized this sequence in combination with secondary or/and tertiary structure of the central region may be playing a role in the translation of GFP in chloroplasts. To find this, the SD-like sequence GGAGGATTCG is replaced with CCTCCTAAGC sequence and a new construct, pCATvdAnti-GFP, is generated. When the functionality of pCATvd-GFP was analyzed by comparing its transient expression with that of the pCATvdAnti-GFP, it was observed in agroinfiltrated N.benthamiana plants that the GFP from the transcripts of pCATvd-

GFP was mostly localized in the chloroplasts (Figure 6.2, Panel B). However, GFP from the transcripts of pCVdAnti-GFP was equally distributed in the nucleus, cytoplasm and the chloroplasts (Figure 6.2, Panel C), indicating that the Shine-Dalgarno-like sequence may be contributing more in the localization of the RNA rather an expression of GFP in chloroplasts or it might have a dual role. In another experiment, the middle region (110 nt) was further truncated to 80 nucleotides, still having an SD-like sequence, and inserted into pCAT-GFP to create pCATvd80-GFP to determine its functionality for GFP expression. When the agroinfiltrated N. benthamiana plants were examined by confocal microscopy, it was observed that the GFP arising from the transcripts of this construct was uniformly distributed in the nucleus and cytoplasm (Figure 6.2, Panel D) but not in the chloroplasts, suggesting this SD-like sequence 110

alone is not enough for translation in chloroplasts which also confirms the requirement of its structure motif. Another possibility is, it might have lost its translocation capacity to ship its

RNA to the chloroplasts which needs to be determined. However, it is not clear how and why such a chimeric viroid sequence allowed the translation in chloroplasts. Whether the viroid sequence or/and specific structure motifs are required for translation of GFP in chloroplasts.

Overall these results suggest that sequence elements and/or secondary or tertiary structural domain together may require the translation of functional mRNA into the chloroplasts. Further experiments are required to solve this mystery.

111

APPENDIX C

7 VIRAL AND CHLOROPLASTIC SIGNALS ESSENTIAL FOR INITIATION AND EFFICIENCY OF TRANSLATION IN AGROBACTERIUM TUMEFACIENS

Results of this study were published (Ahmad T, Venkataraman S, Hefferon K, AbouHaidar MG. 2014.. Biochemical and biophysical research communications 452:14-20).

7.1 SUMMARY

High-level protein expression vectors using CaMV 35S promoter and highly efficient translation initiation signals for Agrobacterium tumefaciens are relatively less explored compared to that of

Escherichia coli. In the current study, we experimentally investigated the capacity of CaMV 35S promoter to direct GFP gene expression in A. tumefaciens in the context of different viral and chloroplastic translation initiation signals. GFP expression and concomitant translational efficiency were monitored by confocal microscopy and western blot analysis. Among all of the constructs, the highest level of translation was observed for the construct containing the phage

T7 translation initiation region followed by that with chloroplastic RuBisCO Large Subunit

(rbcL) 58-nucleotide 5´ leader region including its SD-like (GGGAGGG). Replacing the SD-like

(GGGAGGG) with non-SD-like (TTTATTT) or replacing the remaining 52 nucleotides of rbcL with nonspecific sequence completely abolished translation. In addition, this 58 nucleotide region of rbcL serves as a translational enhancer in plants when located within 5´-UTR of the

GFP mRNA. Other constructs including those containing sequences upstream of the coat proteins of Alfalfa Mosaic Virus, or the GAGG sequence of T4 phage or the chloroplastic atpI and/or PsbA 5´-UTR sequence supported low levels of GFP expression or none at all. From these studies, we propose high expression vectors in A. tumefaciens and /or plants which contain the

CaMV 35S promoter, followed by the translationally strong T7 SD plus RBS translation

112

initiation region or the rbcL 58-nucleotide 5´ leader region upstream of the gene for the protein of interest.

7.2 INTRODUCTION

Initiation of translation in E. coli involves base pairing between a purine-rich Shine-Dalgarno

(SD) domain at the 5´ untranslated region (5´-UTR) of mRNA and the complementary anti-SD sequence at the 3´ end of 16SrRNA (336). There are distinct sequence elements of the translation initiation region known to contribute to its efficiency (337): the initiation codon, the Shine-

Dalgarno (SD) sequence (297, 338) as well as regions upstream of the SD sequence and downstream of the initiation codon, described as enhancers of translation (339). The distance between the SD sequence and the initiation triplet has a marked effect on the efficiency of translation (340). The 6-nucleotide consensus SD AGGAGG core sequence causes the highest level of protein synthesis.

Chloroplasts have their own translation system, which shows strong homologies to that of prokaryotes. This is consistent with the presence of a Shine-Dalgarno (SD) sequence (GGAGG) located within 12 nucleotides of the AUG initiation codon of many plastid genes (341).

Moreover, the sequence near the 3´ end of the plastid 16SrRNA contains a highly conserved polypyrimidine-rich region (CCUCC) complementary to the SD sequence as in bacteria. Over

90% of higher plant chloroplast genes encoding polypeptides possess an upstream sequence similar to the bacterial SD sequence. The spacing of these chloroplast SD-like sequences is less conserved, ranging from -2 to -29 nucleotides (342). Translation of several chloroplast mRNAs is also regulated in response to light as well as to some nuclear-encoded factors. In this regard, it is interesting to study how well chloroplastic translational machinery function in Eubacteria such as E. coli and A. tumefaciens. The transfer of T-DNA from Agrobacterium into the plant genome represents a natural across kingdom barriers and implicates a closer

113

evolutionary relationship between Agrobacterium and plants than between any other Eubacterial organism (such as the E. coli) and plants. The aim of the present study is to investigate the sequence determinants responsible for efficient translation in A. tumefaciens, which on the one hand is highly similar to E. coli in terms of its dependency on the SD sequence for the translation, while on the other hand is also mechanistically similar to chloroplast genes such as the large subunit of the RuBisCO in its dependence on the 5´upstream control region. Also, the essential molecular determinants for the design of an ideal Agrobacterial expression vector are considered.

7.3 MATERIALS AND METHODS

7.3.1 Construction of GFP expression plasmids:

The binary vector pCAMBIA1300 (CAMBIA, Canberra, Australia) was used in this study. To create a pCTCR-GFP construct, the translation control region (TCR) (210), comprised of 58 nucleotides of 5´-UTR and 45 nucleotides from the N-terminal coding region of the rbcL gene were synthesized and cloned in the pUC57 plasmid (Bio Basic Inc.). Following digestion of pUC57 by KpnI/BamHI and XbaI/BglII respectively and gel purification (QIAquick Gel

Extraction Kit, QIAgen), rbcL TCR DNA fragments were subcloned into a pC-GFP binary plasmid using the respective restriction sites. All other vectors of the pC-GFP series were produced by ligating double-stranded oligonucleotides into restriction-enzyme digested plasmid

DNA with compatible ends (Table 7.1).

114

Table 7.1 Sequences of the translation initiation signals in the pC-GFP vector.

Vector Description Oligonucleotid/DNA sequence (5´→3´) Construct with Sense (XbaI overhang) pC T7SD-GFP PhageT7 trailer ctagttaataattttgtttaactttaaGAAGGAGatatacatATGg sequence (T7 Antisense ( BamHI overhang) translational enhance gatccCATatgtatatCTCCTTCttaaagttaaacaaaattattaa RBS) and is available in pET-X- series. Construct with only Sense (XbaI overhang) pC rbc58-GFP 58 nucleotides of 5´- ctagtgtcgagtagaccttgttgttgtgagaattcttaattcatgagttgtaGGGAGGGatttATGg UTR of the rbcL gene. Antisense (BamHI overhang) gatccCATaaatCCCTCCCtacaactcatgaattaagaattctcacaacaacaaggtctactcgaca

PC rbc58AT-GFP Construct with 58 Sense (XbaI overhang) nucleotides of 5´UTR ctagtgtcgagtagaccttgttgttgtgagaattcttaattcatgagttgtaTTTATTTatttATGg of the rbcL gene Antisense (BamHI overhang) where GGGAGGG gatccCATaaatAAATAAAtacaactcatgaattaagaattctcacaacaacaaggtctactcgaca sequence is replaced with TTTATTT. Construct with 33 Sense (XbaI overhang ctagtaattcttaattcatgagttgtaGGGAGGGatttATGg pC rbc33-GFP nucleotides of 5´-UTR Antisense (BamHI overhang) gatccCATaaatCCCTCCCtacaactcatgaattaagaatta of the rbcL gene. Construct with only Sense (KpnI overhang) pC rbcSD-GFP SD sequence of rbcL gtacattgaacagttaagtttccattgatactcgaaagatgtcagcaccaGGGAGGGg gene, the 5´-UTR Antisense (BamHI overhang) sequence is replaced gatccCCCTCCCtggtgctgacatctttcgagtatcaatggaaacttaactgttcaat with non rbcL sequence Construct with 85 Sense (XbaI overhang) pC PsbA-GFP nucleotides of 5´-UTR ctagtaaaaagccttccattttctattttgatttgtagaaaactagtgtgcttGGGAGtcccTGATGATtaaataa of PsbA gene accAAGattttaccATGg Antisense (BamHI overhang) gatccCATggtaaaatCTTggtttatttaATCATCAgggaCTCCcaagcacactagttttctacaaatca aaatagaaaatggaaggcttttta pC ATP58 Construct with 58 Sense (XbaI overhang) nucleotides of 5´-UTR ctagtagatggttgaatcaaaaaattttgtttaaagttcaattttttcaGAGGGCAAGGcaatATGg of ATPI gene. Antisense (BamHI overhang gatccCATattgCCTTGCCCTCtgaaaaaattgaactttaaacaaaattttttgattcaaccatcta pC AT-GFP Construct with 5´- Sense (KpnI overhang) gtacagtttttatttttaattttctttcaaatacttccaggatctctaGAg UTR of the capsid Antisense (BamHI overhang) protein of alfalfa gatcCTCtagagatcctggaagtatttgaaagaaaattaaaaataaaaact mosaic virus RNA. Construct with 58 ctagtgtcgagtagaccttgttgttgtgagaattcttaattcatgagttgtaGGGAGGGatttATGtcaccacaaa pC TCR-GFP nucleotides of 5´-UTR cagagactaaagcaagtgttggattcaaagctg and 45 nucleotides from the N-terminal coding region of the rbcL gene. The required DNA fragment was synthesized. The sequence of only plus strand is given. 115

Italic letters indicate restriction site overhangs. Underlined capitalized bold letters indicate SD-sequences. Upper case bold letters indicate start codons. Sequence of the sense and antisense primers used to generate the various constructs is shown

Briefly, complementary oligonucleotides synthesized by Eurofins MWG Operon (Huntsville,

AL) were mixed in equimolar amounts (50 µM each), boiled and annealed by cooling to room temperature and ligated into already restriction enzyme digested pC-GFP vector using T4 DNA ligase (New England Biolabs) according to the manufacturer's protocol. The product of each ligation reaction was used to transform E. coli DH5-alpha competent cells and Kanamycin

(50µg/mL) resistant bacterial colonies were screened for the presence of the proper recombinant constructs. The presence and accuracy of the inserted gene within the expression cassette in the final recombinant constructs was confirmed by DNA sequencing (The Centre for Applied

Genomics, Toronto, Canada) using the GFP-R reverse primer:5´-

AAGTCGTGCTGCTTCATGTG -3´.

7.3.2 Agrobacterium transformation

A modified freeze-thaw method for transformation of Agrobacterium tumefaciens was used as reported previously (343). After transformation, the cells were resuspended in LB such that all the samples contained a uniform OD595 of 1.0. From this, equal culture amounts were in turn taken to perform the downstream RNA, confocal microscopy, and western blot analyses.

7.3.3 RNA isolation, reverse transcription and PCR

Total RNA was isolated according to a modified method described by AbouHaidar, et al. (344) and subjected twice to DNase I treatments (New England Biolabs, NEB). A reverse transcription reaction of each sample was performed on 1 µg of total RNA with 200 units of M-MLV reverse transcriptase (Promega), 200 ng of GFP/16SrRNA reverse primer and 500 µM dNTPs in a final volume of 20 µl as recommended. Primers GFP 5´-ACGTAAACGGCCACAAGTTC-3´

116

(forward) and GFP 5´-AAGTCGTGCTGCTTCATGTG-3´ (reverse) were used to amplify an

187 bp of GFP gene. Primers 16SrRNA 5´-AACACATGCAAGTCGAACGC-3´ (forward) and

16SrRNA-R 5´-TAGGCCTTTACCCCACCAAC-3´ (reverse) were used to amplify a 187 bp fragment of Agrobacterium 16SrRNA as an internal and comparative control for semi- quantitative PCR.

7.3.4 Detection of GFP expression

7.3.4.1 Confocal microscopy

Following Agro-transformation, cell samples each containing OD595 to 1.0 were spun down and the pellets resuspended in 10 mM MES (4-Morpholineethanesulfonic acid sodium salt) buffer, pH 5.7. A drop of each cell culture was overlaid on a glass slide and live cell imaging was performed on a confocal microscope (TCS SP5, Leica Microsystems) using a 100× oil objective lens. The 488-nm laser was used for GFP imaging. Differential interference contrast (DIC) microscopy was used for comparative studies of all the constructs. Images were analyzed by

Leica Application Suite Advanced Fluorescence (LAS AF) software.

7.3.4.2 SDS-PAGE and Western blotting

Following Agro-transformation, the cell samples, each adjusted OD595 to 1.0, were harvested by centrifugation and protein from each pellet was extracted using in TMPDTNU (50 mM Tris, 20 mM MgCl2, 1 mM PMSF, 100 mM DTT, 2% Triton X-100, 0.5% NP-40 and 8 M urea) buffer

Equivalent protein amounts were loaded as determined by the Bradford Protein Assay reagent kit

(Bio-Rad, Hercules, CA) and Coomassie Brilliant Blue R-250 staining. SDS-PAGE and western blot analyses were according to Sambrook, et al. (212).

117

7.4 RESULTS AND DISCUSSION

GFP expression in ten pCAMBIA constructs (Fig. 1B) containing different translation initiation contexts upstream of the GFP gene was monitored by confocal microscopy and western blot analysis, after transformation of A. tumefaciens (GV3101 strain) with the respective constructs.

Figure 7.1 Schematic representation of constructs used in this study. Arrows indicate the direction of transcription and translation. 35S is the CaMV 35S promoter. T-nos: represents the transcription terminator; the box between the 35S and GFP contains the different translation initiation contexts. GFP box is differently colored to reflect the efficiency of its expression. Dark green box for the T7SD shows the highest expression, followed by that of the rbcL TCR and the rbcL 58 nucleotide 5´-UTR region (light green). Boxes in light green represent marginal GFP expression while unfilled boxes show no GFP expression. Note: Figures not drawn to scale.

All constructs uniformly contained the CaMV 35S promoter and GFP gene followed by the T- nos terminator. This produces the same GFP transcript levels for all the constructs. The only difference between the constructs was in the sequence of the translation context upstream of the

GFP coding sequence, which resulted in the differential GFP expression.

118

7.4.1 Estimation of equal GFP transcript levels in A. tumefaciens harboring

each of the above constructs

Transcription levels of the GFP mRNA for all the constructs were measured by semi-quantitative

RT-PCR experiments using the 16SrRNA expression levels as the internal control (Figure 7.2,

Top Panel).

Figure 7.2 Quantitation of equivalent GFP transcript levels for all the constructs used in this study. Two percentage agarose-TBE gel analysis of RT-PCR products using primers specific for the 16SrRNA of Agrobacterium as well as primers specific for the GFP mRNA (Materials and Methods). Note the relatively higher levels of the cDNA for 16SrRNA (Panel A) compared to that of the GFP mRNA (Panel B); also of note is the equivalent amounts of the cDNA for the 16SrRNA in all the Lanes (Panel A) as well as equivalent amounts of the GFP-specific cDNA in all the Lanes (Panel B), each representing the constructs used in this study. The fractional numbers in Panel C represent the various dilutions of the RT-PCR product for the 16SrRNA. Compare the amounts of cDNA in Panel B with those of Panel C: the amounts of the GFP cDNA is equivalent with that of the 1/6th dilution of the RT-PCR product for the 16SrRNA.

The transcriptional efficiency of the CaMV 35S promoter was also compared to that of the ribosomal RNA (rrn) promoter, as the latter uniformly showed similar high-level stable expression in all the cells harboring the respective constructs. PCR reactions in the above experiment were extended only up to 20 cycles in order to enable quantitation of the RNAs at the log phase before cDNA synthesis reached saturation levels. We observed that the GFP mRNA expression was uniform and the transcript levels corresponded to 1/6 dilution of the 16SrRNA in

119

all the cells harboring the respective constructs (Figure 7.2, compare middle and bottom

Panels).

7.4.2 Major differences in translation initiation requirements between A.

tumefaciens and E. coli: High GFP translation levels in A. tumefaciens

under the control of phage T7 translational enhancer and RBS

Figure 7.1 shows a summary of a series of constructs with different ribosomal initiation contests.

Construct pC T7 SD-GFP which contained the phage T7 translational enhancer along with the

Shine-Dalgarno sequence (GAAGGAG) and the ribosome binding site (derived from the 5´ non- coding region of the Novagen expression vector, pET29) upstream of the GFP coding sequence, yielded very high levels of GFP protein (Figure 7.3, Panel 2) as observed by strong green signals upon confocal microscopy and by western blot analysis of the expressed protein at ca.27 kDa (Figure 7.4, Lane 1, pCT7SD-GFP). Surprisingly, this construct gave very poor expression in E. coli (data not shown) indicating major differences in the translational machinery between these two microorganisms.

120

121

Figure 7.3 Detection of green fluorescence due to GFP expression (and translational efficiency) for each of the constructs (Panels 1-10) after transformation into Agrobacterium and confocal microscopy. The first image of each Panel represents an image with GFP filter; the middle image that of the DIC filter; and the last image is an overlap of the GFP over the DIC picture.

On the other hand, a construct containing solely the phage T4 SD sequence GAGG between the

CaMV 35S promoter and the ATG of the GFP gene did not express GFP in A. tumefaciens showing that the T4 SD sequence alone was not sufficient for translation initiation in this

122

organism (Figure 7.3, Panel 1 and Figure 7.4, Lane 10, pC-GFP), whereas in E. coli where the

T4 SD sequence by itself was sufficient to drive detectable GFP expression (345).

Figure 7.4 Western blots of the enhanced GFP protein (28 kDa) using anti-GFP antiserum and alkaline phosphatase enzyme-linked secondary antibody conjugate. Note the highest level of GFP expression for the pCT7SD-GFP construct (Lane 1), followed by that of the pCrbcL TCR-GFP (Lane 2) and the pCrbcL58-GFP constructs (Lane 3), the latter two in equivalent amounts. The pCrbcL33-GFP (Lane 4), pCAT-GFP (Lane 6) and pCATP58-GFP (Lane 7) constructs show faint bands indicating marginal GFP expression. All other Lanes (Lanes 5, 8, 9 and 10) are negative for GFP expression.

7.4.3 Effect of the AT-rich sequence from the (AIMV) upstream of the GFP

gene on its translation in A. tumefaciens

AIMV CP RNA is one of the most efficiently translated RNAs known (333) and its sequence has been shown to function as a strong translational enhancer (335). Thirty-three nucleotides containing the 5´-UTR of the AIMV capsid protein gene with SD sequence GAGG were cloned upstream of the GFP coding sequence and then expressed in A. tumefaciens. Data presented in

Figure 7.3, Panel 3 and Figure 7.4, Lane 6, pC AT-GFP, showed weak GFP signals as compared to that of T7 SD construct. This result demonstrated that in A. tumefaciens, the T4 SD sequence did not produce enhanced levels of GFP translation even though in combination with the reportedly translationally robust AIMV CP 5´-UTR sequence.

123

7.4.4 Analysis of 5´ -UTR sequences derived from some natural chloroplastic

genes on translation in A. tumefaciens.

Regulation of expression of chloroplastic genes occurs mainly at the level of translation and has several features similar to that of prokaryotes. However, although the SD complementary sequence of the chloroplast 16SrRNA is highly conserved between prokaryotes and plastids

(346), the putative SD sequence is poorly conserved in chloroplasts, both in terms of primary sequence and location relative to the start codon (306, 347). Also, plastid gene expression is controlled at the posttranscriptional level by protein factors that are encoded in the nucleus and transported into the chloroplast (348, 349), adding a layer of complexity to chloroplast gene expression that is not found in prokaryotes.

In order to compare the above prokaryotic translation initiation sequence context with that of the chloroplast context, and in order to examine the evolutionary closeness of translational regulation between A. tumefaciens and chloroplasts as against E. coli, we made constructs with 5´ initiation contexts from different chloroplast genes and used them to examine the extent of GFP expression in A. tumefaciens.

7.4.5 Identification of the minimal translation initiation sequence of the rbcL

gene required for high-level expression in A. tumefaciens

Ribulose1, 5-bisphosphate carboxylase/oxygenase (RuBisCO) large subunit (rbcL) is encoded by chloroplast genome. The 5´-UTR of rbcL is highly conserved in the region - 1 to -58 and contains an SD sequence (GGAGG) between -4 and -12 (350). When GFP was cloned downstream of the 5´ translation initiator region of the rbcL gene that included the SD-like sequence (GGAGG that is complementary to the CCUCC at the 3´ terminal region of the

Agrobacterium 16SrRNA), there was no detectable translation of the GFP in A. tumefaciens

124

(Figure 7.3, Panel 5, Figure 7.4, Lane 5, pC rbcSD-GFP), demonstrating that the rbcL 5´ translation initiator region (GGGAGGG) by itself is not sufficient for successful translation initiation. When the 5´ TCR (translation control region containing the 58 nucleotide 5´ leader, the SD-like sequence and the N-terminal coding sequence for the first 14 amino acids) of the rbcL gene that was essential for successful translation initiation in chloroplasts (210), was introduced upstream of the ATG of the GFP gene sequence, a robust expression of GFP was detected in Agrobacterium, as demonstrated by confocal microscopy (Figure 7.3, Panel 6) and by immunoblot analysis (Figure 7.4, Lane 2, pC rbcLTCR-GFP). Next, we cloned just the 58 nucleotide 5´ -UTR of the rbcL gene upstream of the GFP gene and transformed it into A. tumefaciens. Confocal microscopy (Figure 7.3, Panel 7) and western blotting (Figure 7.4, Lane

3, pCrbc58-GFP) showed that the GFP expression with this construct was equivalent to that of the 5´ TCR. However, it was comparatively less than what was observed for the construct containing the highly efficient phage T7 5´-UTR context (Figure 7.3, compare Panels 2 and 6,

Figure 7.4, compare Lane 1, pC T7SD-GFP and Lane 2, pC rbcLTCR-GFP). This led us to the conclusion that just the 58 nucleotides at the rbcL 5´-UTR was sufficient to initiate efficient translation in Agrobacteria. Furthermore, it was observed that these 58 nucleotides serve as translational enhancers when located within 5´-untranslated mRNA leaders (Figure 7.5, a) in plants.

125

Figure 7.5 Confocal microscopic observation of GFP in N. tabacum leaves after 72 hr of agro-infiltration with a) pC rbcL58-GFP and b) pC-GFP constructs respectively.

A truncation of the same sequence from 58 to 33 nucleotides from the 5´-terminus resulted in a dramatic reduction of GFP translation (Figure 7.3, Panel 8, Figure 7.4, Lane 4, pC rbcL33-

GFP), showing the importance of the 58 base leader sequence for translation in A. tumefaciens.

In another experiment when SD-like (GGGAGGG) of the 58 base leader sequence was mutated to the TTTATTT sequence, the translation was totally abolished (Figure 7.3, Panel 4, Figure

7.4, Lane 9, pC rbcL58AT-GFP), indicating that SD-like sequence and context sequence are important for successful translation.

7.4.6 Comparison of the 5´-UTRs of both rbcL and Psb A genes for

translation initiation in A. tumefaciens

Testing translational requirements for successful protein expression in A. tumefaciens was performed using the psbA gene that encodes the D1 protein of photosystem II. A construct that contained 85 nucleotides as a 5´-UTR including RBS, AU-rich region and ATG of the psbA gene

(350) upstream of the GFP gene was made and transformed into Agrobacterium. Results showed no detectable GFP expression as judged by confocal microscopy (Figure 7.3, Panel 9) and by western blot analysis (Figure 7.4, Lane 8, pC psbA-GFP). This indicated that there is a major

126

difference in the translatability of the GFP protein between the 5´ non-coding sequences of the rbcL gene and that of the psbA gene, even though both are encoded by the chloroplastic genome and are known to be involved in photosynthesis. The rbcL gene with the SD-like sequence 10 nucleotides away from the AUG codon (along with its 58 nucleotide 5´ leader) satisfies the requirement for successful translation in A. tumefaciens, whereas the psbA gene SD-like sequence is much farther away (40 nucleotides upstream) with unfavorable 5´ sequence context and, therefore, does not allow positive GFP expression.

7.4.7 5´-UTR of the chloroplastic atp1 gene supports low GFP translation

levels in A. tumefaciens

The atpI gene, which encodes the CFo-IV subunit of the ATP synthase complex (351) is an important chloroplastic gene, which possesses an SD-like, sequence at an ideal distance: 5 nucleotides upstream of the start codon. When the SD-like sequence along with the 58 nucleotide

5´ translational determinant of the atpI gene in chloroplasts (352), was cloned upstream of the

GFP coding sequence and expressed in A. tumefaciens, a low level of GFP expression was observed (Figure 7.3, Panel 10; Figure 7.4, Lane 7, pC ATP58-GFP). This result shows that recognition of the translational context in A. tumefaciens is dependent on factors other than just the correctly positioned SD-like sequence and that the upstream sequence that works in chloroplasts may not work in A. tumefaciens. Therefore, of all the chloroplastic constructs used in this study, the rbcL 58 with the ideal spacing of the SD-like sequence from the initiation codon (10 nucleotides) and the ideal upstream sequence was the most robust in supporting GFP expression in A. tumefaciens.

127

7.5 CONCLUSION

In the light of the above findings, it would be interesting to examine if there is any other chloroplastic gene besides the rbcL gene that can be translated to the same level, if not higher than that of the rbcL gene product in A. tumefaciens. Results from such further experiments would enable us to make a firm conclusion on both the cis- and trans-acting factors of the

Agrobacterial translation machinery. It would also help establish the nature of the evolutionary relationship between A. tumefaciens and the chloroplasts as much of the studies in this regard have so far been predominantly performed using E. coli as the major Eubacterial organism.

The current study reveals unique translation initiation requirements for high-level protein expression in A. tumefaciens. This together with the high strength 35S promoter that shows enhanced transcription levels would enable the design of unique, robust protein expression vectors for A. tumefaciens using binary vectors such as pCambia. This system also facilitates transgene design for high-level expression of recombinant proteins using a binary vector in A. tumefaciens before further downstream applications such as generation of transgenic plants and plastid-based expression. Thus preliminarily enhanced translation in A. tumefaciens can be used as a predictor of high-level protein synthesis in transgenic plants considering the time-consuming nature of the latter process.

128

APPENDIX D

8 ANALYSIS OF THE INTERNAL RIBOSOME BINDING SITE (IRBS) OF PVX

8.1 BACKGROUND

In potexviruses, translation of the downstream ORFs, triple gene block, and CP, is believed to take place from a series of capped subgenomic RNAs (sgRNAs) which are generated from the genomic RNA. In vitro translation studies (171, 353) showed that two sgRNAs (sgRNA1 and sgRNA2) of 2.1 and 1.4 kb were necessary for translation of the TGB while a third sgRNA of

0.9 kb (sgRNA3) was required for expression of the viral coat protein. It was also noticed that that the 25 kDa protein was synthesized as a single translation product of the 2.1 kb subgenomic

(sg) RNA and that both the 12 kDa and 8 kDa proteins are expressed from the same 1.4 kb sgRNA. In vitro translation studies also indicated that the CP could not be translated from genomic RNA; rather, it could be readily translated from a smaller, subgenomic RNA encoding the CP gene (171, 354, 355). However, in vitro studies of papaya mosaic virus, narcissus mosaic virus and clover yellow mosaic virus exhibited that expression of the CP could take place from genomic as well as subgenomic RNAs, possibly by means of internal initiation of translation

(356-360).

Previously in our lab Hefferon, et al. (174) demonstrated with transgenic plants that the 8 kDa protein and the CP could be translated from a dicistronic construct corresponding to the C- terminal half of the 12 kDa protein, the complete 8 kDa and CP genes of PVX, indicating that translation of CP could take place either by internal entry of ribosomes or by a termination/reinitiation mechanism. Furthermore, these authors showed that expression of the downstream cistron was persisted in protoplasts electroporated with RNA transcripts of the

129

dicistronic construct, even after stable hairpin structures were placed in front of dicistronic constructs containing either the PVX CP gene or a reporter gene as the downstream cistron. The

8 kDa protein or reporter gene was detected only in the absence of the hairpin structure. Since

CP was detected in the presence or absence of a stable hairpin structure at the 5´ terminus, suggesting that the former model (IRBS) is more likely.

This study aimed to confirm and further investigate (reassess) the IRBS property of the

PVX 8K region using the GFP gene as a reporter (fused with ORF of CP of PVX) in in vivo with stable transgene expression systems and to identify the precise sequence within that region that is responsible for the internal initiation function. Western blot and confocal studies indicate the expression of a downstream cistron (GFP) only in the absence of the hairpin in transgenic tobacco plants harboring the dicistronic construct, suggesting that that translation of GFP could take place by a termination/reinitiation rather internal ribosome binding site (IRBS) mechanism.

8.2 MATERIALS AND METHODS

8.2.1 Construction of GFP expression plasmids

To test the IRBS nature of the PVX sequence, the construct pC8K-GFP, containing the sequence upstream of the ATG codon of the PVX CP gene including the 8 kDa ORF and 177 nucleotides upstream of this 8k ORF, was generated by amplifying the product using pre-existing recombinant pTR:8k as a template and 12KKpnI.F/CPBamHI.R primers. To map the IRBS sequence, pC8K-GFP was truncated to generate pC220K-GFP and pC127K-GFP constructs by amplifying the products using a pC8K-GFP construct as a template, 8K220KpnI.F /CPBamHI.R, and 8K127KpnI.F/CPBamHI.R primers respectively. Subsequently, the obtained products were inserted into the pC-GFP construct in its KpnI/BamHI sites. The start codon of the CP was also retained as part of the constructs, such that it was in frame with the GFP ORF. Furthermore to 130

confirm IRBS sequence, a sequence expected to form a stable hairpin was introduced in KpnI site of all above constructs to generate pChp8K-GFP, pChp220K-GFP, and pChp127K-GFP constructs. This stable hairpin sequence was also inserted into pC-GFP in KpnI/XbaI sites to create a pChp-GFP construct which is believed to block the translation of GFP completely and used as a negative control. The hairpin was ligated into the digested constructs as mentioned in section 2.3.1. The presence and accuracy of the inserted sequence were confirmed by DNA sequencing (The Centre for Applied Genomics, Toronto, Canada) using the GFP-R reverse primer: 5´- AAGTCGTGCTGCTTCATGTG -3´. Table 8.1 shows a list oligonucleotides and

DNA sequence used to generate the plasmids in this study.

Table 8.1 Oligonucleotides/ primers used in the production of different constructs with or without a hairpin structure to investigate the IRBS. Constructs Primers Oligo/Primer sequence* (5´-3´) Cloning sites** pC8K-GFP 12KKpnI.F ATCGGGTACCCTAGAAATAGTTTACCCC KpnI CPBamHI.R CCATGGATCCTCTAGCTGGTGCTGACAT BamHI pC220-GFP 220KKpnI.F AATATTGGTACCCAGGCCTCATATCTCAACGCAATC KpnI CPBamHI.R ATACTAGGATCCTGGTGCTGACATCTTTCGAGTATC BamHI pC127-GFP 127KKpnI AATATTGGTACCCAGGCCTGGAGAATCAATCACAGT KpnI CPBamHI.R ATACTAGGATCCTGGTGCTGACATCTTTCGAGTATC BamHI Hairpin For Sense ACGCGCTCCCCCCGGGGGGTCGACCCCCCGGGGGGA KpnI above three Antisense AAGCAGTAC (inac) construct TGCTTTCCCCCCGGGGGGTCGACCCCCCGGGGGGAG CGCGTGTAC Hairpin for Sense TCGCGCTCCCCCCGGGGGGTCGACCCCCCGGGGGGA KpnI pC-GFP Antisense AAGCT (inac)/ CTAGAGCTTTCCCCCCGGGGGGTCGACCCCCCGGGG XbaI GGAGCGCGAGTAC * Underlined bold letters indicate restriction endonuclease recognition sequences. ** Restriction endonuclease recognition sequences introduced into the oligos to facilitate cloning of fragments into PC-GFP.

8.2.2 Plant transformation for stable gene expression

Stable Agrobacterium-mediated transformation was performed as described in section 2.3.6.

131

8.2.3 Confocal microscopy

Live cell imaging was performed on a confocal microscope (Leica TCS SP5; Leica

Microsystems) using a 40× or 63× oil immersion objective. GFP fluorescence was imaged at an excitation wavelength of 488 nm, and the emission signal was detected between 495 and 530 nm for GFP and between 643 and 730 nm for chlorophyll autofluorescence. Differential interference contrast (DIC) and fluorescence images were acquired simultaneously for comparative studies of all the constructs. Images were analyzed by Leica Application Suite Advanced Fluorescence

(LAS AF) software.

8.2.4 Western Blot

Following plant-transformation, leaf samples were grinded in the presence of liquid nitrogen using pre-cooled pestle and mortar. Using a flame-sterilized spatula, the powder was transferred to 1.5 mL tubes containing 160 µL of protein extraction TMPDTNU (50 mM Tris, 20 mM

MgCl2, 1 mM PMSF, 100 mM DTT, 2% Triton X-100, 0.5% NP-40 and 8 M urea) buffer plus

40 µL of 5× SDS-PAGE loading dye (212). These samples were boiled at 95-100 °C for 5 min and 40 µL of each sample was loaded onto 12% SDS-PAGE gels along with the appropriated protein molecular weight markers (Thermo Fisher Scientific). Protein concentrations were determined by the Bradford Protein Assay reagent kit (Bio-Rad, Hercules, CA). Electrophoresis was performed initially at 150 V until the samples entered the separating gel followed by 100 V until dye reached at the bottom of the gel (218). The proteins were then transferred onto nitrocellulose membrane (0.45 nm pore size, Pall corporation) for 1 hr in transfer buffer (212) using the Bio-Rad protein electrophoresis unit. The membrane containing the transferred proteins was blocked in Tris-buffered saline (TBS buffer: 50 mM Tris and 150 mM sodium chloride) along with 5% skimmed milk for 5 hr. Subsequently, the membrane was incubated at 4°C overnight with mild shaking with (1:1000) Anti-GFP, Rabbit IgG Fraction (Anti-GFP, IgG), 132

polyclonal antibody (Invitrogen) in TBS+3% BSA. The membrane was washed (TBS, 0.3%

Tween-20) 4 times and incubated with (1:3000) Goat Anti-Rabbit IgG (H & L) alkaline phosphatase (Bioshop) for 2 hr at room temperature with mild shaking. The membrane was washed 3 times with TBS-T followed by a final washing with TBS. Finally, signals were developed with alkaline phosphatase substrate solution (BCIP/NBT, Bioshop) according to the manufacturer instructions. The membranes were dried and photographed.

8.3 RESULTS AND DISCUSSION

8.3.1 Expression of GFP using stable gene experiments

To determine the expression strategy of the GFP in dicistronic and deletion constructs where CP

ORF fused in frame to the N-terminus of the GFP ORF (CP-GFP fusion) and to better define the mechanisms (internal ribosome binding or an alternative mechanism such as leaky scanning or termination/reinitiation of translation) on its translation initiation, transgenic tobacco plants harboring different constructs with and without stable hairpin structure were analyzed by western blot and confocal microscopy. Previous studies have shown that secondary structure in the 5′ leader inhibits translation by influencing the binding of 40S ribosomal subunits to the 5′ end of an mRNA (361-364). Kozak (362) also demonstrated the positioning effect of a hairpin in translation, according to the author, the translation was drastically inhibited when a hairpin was inserted within the first 12 nucleotides of the gene, however when the same hairpin was repositioned 52 nucleotides from the 5′ end, it no longer inhibited translation. The stable hairpin structure is placed within 25 nucleotides from the 5′ end in the present studies. The pChp-GFP construct was included as a negative control to test the functionality of hairpin structure to stop the translation. Confocal and western blot studies with transgenic plants show that translation of

GFP gene is completely blocked by inserting the hairpin as depicted in Figure 8.1 (Panel B, D,

F, and H) and Figure 8.2 (Lanes 2,4,5,6 and 7), confirming the stability and functionality of the 133

hairpin in case of stable gene expression. In contrast, expression and accumulation of GFP can be observed clearly in the case of transgenic plants harboring pC-GFP, pC127-GFP, pC220-GFP and pC8K-GFP constructs without hairpin (Figure 8.1: panel A, C, E, and G).

134

Figure 8.1 Confocal microscopic observation of GFP in transgenic N. tabacum leaves harboring constructs without and with hairpin structure (Panels A-I). The first image of each Panel represents the image with a GFP filter; the middle image that of the DIC filter; and the last image is an overlap of GFP over the DIC picture. The red small block represents CP-GFP 'fusion protein' includes the first few amino acids of the CP. Bar =20µM

135

8.3.2 Western blot analysis

Western blot result also confirms the GFP expression in the case of transgenic plants harboring pC8K-GFP construct as shown in Figure 8.2; Lane 1. Finally, when a 0.4 kb cDNA fragment containing the sequence upstream of the AUG codon of the PVX CP gene was placed between two reporter genes, expression of the downstream GFP cistron was lost, suggesting the absence of IRBS in this PVX sequence as shown in Figure 8.1; Panel I and Figure 8.2; Lane 4.

Figure 8.2 Western blot using anti-GFP antiserum to detect GFP (27 kDa) expression in transgenic N. tabacum cv. Xanthi plants harboring constructs in the presence or absence of a hairpin structure. Lanes 1 and 3 contain total proteins extracted from transgenic plants with pC8K-GFP and pC-GFP constructs respectively. Note the lower GFP expression in the case of pC8K-GFP as that of pC-GFP used as a positive control, suggesting an alternative translation mechanism. Lane 4 consists of total protein from the plant where PVX sequence is placed between two reporter genes, indicating non-functionality of PVX sequence as an IRBS. Lanes 2, 5, 6 and 7 contain total proteins from transgenic plants harboring constructs with a stable hairpin, confirming the complete blockage of GFP expression. Lane 5 protein ladder where green band depicts 25 kDa.

The present data provides an evidence for the absence of IRBS sequence which was previously suggested by Hefferon, et al. (174). It is noteworthy that the same PVX sequence, previously believed to be working as an IRBS sequence, is investigated. However, the current findings have ruled out the translation of GFP by the IRBS. These results contradict the previous results (174).

Since 8 KDa was shown to be expressed by dicistron (8K-CP) (174), suggesting that translation of the downstream cistron (CP) could be controlled by leaky scanning and/or with a

136

termination/reinitiation mechanism. The expression of GFP is lower in the case of pC8K-GFP as that of pC-GFP, suggesting the presence of an alternative mechanism(s). Leaky ribosome scanning also contributes in translation from downstream start codons in some positive-stranded

RNA viruses and (365, 366). Verchot, et al. (15) described an in vivo analysis of the

PVX TGB translation strategy, where they presented evidence that the 8K ORF could be translated by leaky ribosome scanning through the 12K ORF. It is also possible the expression of a downstream cistron (CP/GFP) is controlled by termination-reinitiation mechanism as well.

Previous studies showed that translation of the HBV polymerase gene could be controlled by leaky scanning together with a termination-reinitiation mechanism involving an upstream minicistron (367, 368). In the case of PVX, coat protein is a translation by sub-genomic RNA

(sgRNA3) of 0.9 kb, why it requires alternative translation mechanisms? It can be hypothesized that it may be expressed by genomic, larger subgenomic or before sgRNAs are produced and play some roles early in virus infection. This speculation is supported by McCormick, et al. (369) who reported that capsid protein of bovine norovirus could be expressed as a result of translation termination-reinitiation between ORF1 and ORF2. The alternative translation strategies may be common in all polycistronic viruses to assist during their replication cycle for the maximum accumulation of required proteins (174). However relative importance of these alternative translation strategies remains to be determined.

137

APPENDIX E

9 NOVEL AND UNIVERSAL APPROACH TO SILENCE ALL GEMINIVIRUSES IN PLANTS

9.1 SUMMARY

Plant-microbe interactions have been explored for many years. In recent years, molecular dissections of some of those interactions have been investigated, particularly, the role played by a battery of host plant small interfering RNAs with pathogen replication. RNA interference

(RNAi) was shown to play a major role in controlling caused by RNA viruses. Since the begomoviruses are DNA viruses, it was assumed that RNAi does not function against DNA viruses. Recent studies have shown that RNAi may also function against DNA viruses (370-

374). Although the molecular mechanisms are being deciphered, the results indicate that begomoviruses may also be targeted with an engineered RNAi system. Previous studies in this lab were focused on the development of plant resistant to RNA viruses (375). Presently we are focusing on geminiviruses which are known to infect a large number of economically important plants. There are over 680 isolates of geminiviruses infecting over 200 plant species. Most of those viruses are transmitted in the field by white flies. Geminiviruses infecting major crops like cotton, vegetables (tomato, potato, pepper etc.) and ornamental plants cause enormous economic losses not only in the yield of those crops but also in the quality of crops. In this study, I demonstrate that an engineered RNAi system which targeted the conserved control region (CR) of many geminiviruses resulted in the protection of transgenic plants from geminivirus infections. This construct generates a 176 base pair double stranded RNA which encompasses most of the CR region of many begomo- and geminiviruses infecting a large number of economically important crops. This construct was tested against two begomoviruses (Ageratum

138

enation virus (AEV), and Tomato leaf curl New Delhi virus (ToLCNDV) as model studies. Data show that a very strong reduction in virus replication in transgenic Nicotiana benthamiana plants in comparison to non-transgenic healthy control plants. Sequence alignments of our construct to available begomovirus sequences indicate that a large number of those viruses will be protected using this construct. Molecular mechanisms involve in the resistance, as well other molecular approaches for the development of plant resistance will also be discussed.

9.2 INTRODUCTION

Geminiviruses have recently emerged not only as the cause of devastating diseases of important crop plants (376) but also as a tool to study fundamental aspects of RNA interference (RNAi) and virus-induced gene silencing (377). RNA silencing is an evolutionarily conserved mechanism protecting cells from pathogenic RNA and DNA, which is increasingly viewed as an adaptive immune system of plants against viruses (378). Expression of hairpin double-stranded

RNA (dsRNA) homologous to coding sequences of RNA and DNA viruses has been shown to restrict viral infection in plants (379-381). It is assumed that long dsRNA is processed by proteins into small interfering RNAs (siRNA), which then target viral RNA for cleavage and degradation in a sequence specific manner (382, 383). siRNAs have also been implicated in transcriptional gene silencing (TGS) when Mette, et al. (384) found that dsRNA expression could trigger the methylation of a cognate target promoter sequence. Sijen, et al. (385) conclude that DNA methylation is an essential process for regulating TGS and important for reinforcing

Post-transcriptional gene silencing (PTGS). This ability has been correlated with reduced transcription levels (386).

Geminiviruses are known to contain a conserved nine nucleotides (nonanucleotides) at the . The flanking sequences are involved in the recognition of cellular DNA polymerase to the single stranded viral DNA to start the replication process and to produces a

139

double-stranded circular DNA. Furthermore, this nonanucleotide sequence is also nicked by the viral rep protein to allow the viral DNA replication through the rolling circle model (see Figure

9.6). In this study, we report a novel approach which is based on the design of a complementary

RNA sequence to bind to the origin of replication of geminiviruses and consequently blocking their replication. Since in geminiviruses the promoter region and the origin of replication are not normally transcribed, blocking this region of viral DNA will have a detrimental consequence on the viral replication and consequently confers an excellent resistance of plants to geminiviruses infection. Further, the presence of complementary RNA sequences to the non-coding region of geminiviruses may also induce the viral DNA methylation in the promoter and origin of replication regions which will also lead to the blocking of gene transcription and lack of viral gene expression which also will reinforce the lack of replication and consequently improve the resistance of plants to viral infections. This provides a novel method to engineer DNA virus resistance in plants without targeting the coding sequence.

In order to investigate the efficacy of this approach in a stably transformed plant system, we produced transgenic N. benthamiana expressing hairpin dsRNA homologous to the sequences including the bidirectional promoter and common region (CR) of Ageratum enation virus (AEV) a begomovirus of family Geminiviridae. Begomoviruses infect a wide range of economically important dicotyledonous host plants and are transmitted by the whitefly Bemisia tabaci (236,

237). Begomoviruses consist of either monopartite (a single DNA) or bipartite (with two DNA components: DNA-A and DNA-B) genomes (123, 125, 126, 231, 232). The DNA-A of bipartite and the single component of monopartite begomoviruses contain five or six Open Reading

Frames (ORFs) while the DNA-B contains two ORFs (BV1 and BC1, in viral-sense and complementary sense strand, respectively). Both DNA-A and DNA-B are approximately 2.8-3.0 kb in size. Both components are organized into divergent transcription units separated by an

140

intergenic region (IR) of about 200 bp, which contain the replication origin and two divergent promoters (133). The virus AEV consists of a monopartite circular, single-stranded DNA genome (DNA-A) of a size 2.8 Kb enclosed in a characteristic twinned quasi-icosahedral particle

(387). In addition, AEV is also associated with a class of single-stranded DNA satellites known as DNA β which range from 1247-1374 nucleotides in length (388). In this study, we report the development of RNAi-based resistance to AEV (monopartite) and ToLCNDV (bipartite) through the expression of dsRNA homologous to its viral non-coding sequence. These results expand the potential of RNAi strategy against DNA viruses to their entire genome.

9.3 MATERIALS AND METHODS

9.3.1 Vector construction

An infectious clone of Ageratum enation virus (AEV) was used for vector construct. The 176 nucleotides fragment corresponding to the intergenic region (IR) of DNA-A of AEV for antisense was amplified by using PCR primers (AEVKpnI 5’-

CTGACAGGTACCACTCCAATGGCATAATTGTA-3’ and AEVSalI 5’-

GACTGAGTCGACGGGACCACGAAACAATTAAG-3’) from position 2671-96 (GenBank accession number AM261836) (including the underlined sites for KpnI and SalI respectively). A primer pair (AEV ClaI 5’-CTGACAATCGATACTCCAATGGCATAATTGTA-3’ and

AEVNheI 5’-GACTGAGCTAGCGGGACCACGAAACAATTAAG-3’ (including the underlined sites for ClaI and NheI respectively, was used to amplify a 176 bp fragment from the same intergenic region for sense strand. PCR reactions were carried out in a 50 μL solution containing 10-30 ng of DNA, 10 mM Tris-HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 200 µM each dNTP, 0.5 µM each primer, and 0.05 units/µL of Taq DNA polymerase (Sigma, CA,

U.S.A.). The mixture was treated at 95ºC (5 min) and subjected to 30 cycles of amplification

(95ºC for 1 min, 68ºC for 40 sec and 72ºC for 1 min), with a final elongation cycle of 10 min at 141

72ºC. These sense and antisense fragments were cloned into the pHANNIBAL vector (389).

Once the assembly of the inverted repeat was completed and verified by sequencing then this cassette (Figure 9.1) was cloned with NotI into a pART27 binary vector and named pART27-

AEVIR.

Figure 9.1 A partial Schematic diagram of the binary construct pART27-AEVIR used for plant transformation. A) The intergenic common region-containing promoter sequences from positions 2671-2750 and 1-96 of AEV DNA- A (GenBank accession number AM261836) separated by a pyruvate dehydrogenase kinase (Pdk) intron in the reverse and the forward orientations were inserted between CaMV 35S promoter and octopine synthase terminator (OCS). The expression cassette was subcloned in the NotI site of pART27 to generate the binary vector pART-AEVIR. B) Predicted hairpin secondary structure of the RNA transcript.

This pART27-AEVIR vector was transferred to Agrobacterium tumefaciens strain GV3101 competent cells. Recombinant colonies were selected on LB plates supplemented with 100

µg/mL Spectinomycin and 30 µg/mL Gentamycin.

142

9.3.2 Plant transformation

Stable Agrobacterium-mediated transformation of N. benthamiana plants was performed by a standard protocol (390) with some modifications. Three to four weeks old tissue cultured plants were used for transformation. Leaf discs were co-cultivated for 10 min with 36 hr old

Agrobacterium culture incubated at 28°C in a shaker. These leaf discs were cultured on MS medium containing 100 mg/L BAP and 0.4 mg/L NAA. After three days, transformants were selected on MS medium containing 100 mg/L Kanamycin, 400 µg/ml Carbenicillin, 1 mg/L BAP and 0.4 mg/L NAA. Every three weeks, the explants were subcultured to a fresh selection medium for shoot regeneration. Developed shoots were transferred to a phytohormone-free ½

MS medium containing 300 mg/L Kanamycin, and 400 mg/L Carbenicillin for root formation.

Regenerated plants were transferred from Magenta boxes to pots and further grown under greenhouse conditions (23-27°C, 16 hr light and 8 hr dark).

9.3.3 Characterization of transgenic lines

N. benthamiana genomic DNA of transgenic lines was extracted from leaves of tissue cultured plants according to Kang and Yang (391). About 0.5 cm2 leaf of each tissue cultured grown plant was put in a 1.5 mL microfuge tube. The leaf tissue was homogenized in 50 µL DNA extraction buffer (500 mM NaCl, 100 mM Tris-HCl pH 7.5, and 50 mM EDTA pH 7.5), using a hand- operated homogenizer (Sigma, Z35997-1) with a plastic pestle, for 15~20 sec. After an initial homogenization, another 150 µl of DNA extraction buffer was added and homogenized with the same homogenizer for 15~20 sec. Then, 20 µL of 20% SDS were added and vortexed for 30 sec.

Samples were incubated at 65°C for 10 min for cell lysis. An equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) was added to the samples, mixed by vortexing for

30 sec, and then centrifuged at 10,000 g for 3 min at 4°C. The supernatant was transferred to a fresh tube and extracted one more time with phenol/chloroform/isoamyl alcohol (25:24:1) and 143

then with chloroform alone. The supernatant was transferred to a fresh tube, and a double volume of ethanol was added to each sample, mixed well, and the samples were incubated at -

20°C for 30 min. The samples were centrifuged at 10,000 g for 10 min at 4°C. The pellet was washed with 70% ethanol, dried, and resuspended in sterile distilled H2O containing 20 µg/mL

DNase-free RNase A. The concentration and purity were determined from the A260/A280 ratio using a spectrophotometer. PCR amplifications were performed as mentioned before but at 55°C annealing temperature. Primers Pdk 5’- AACAAAGCGCAAGATCTATCA -3’ (forward) and

Ocs 5’- TAGGCGTCTCGCATATCTCA-3’ (reverse) were used to amplify a 456 bp region including IR sense of the transgene T-DNA cassette. Primers 35S 5’-

CCACTATCCTTCGCAAGACC-3’ (forward) and Pdk 5’-

CTTCGTCTTACACATCACTTGTCA-3’ (reverse) were used to amplify a 428 bp region including IR antisense of the transgene T-DNA cassette. The PCR products were resolved by electrophoresis in 2.0% agarose gels. Successful transformation of transgenic plant lines was also confirmed by chromosomal DNA sequencing.

9.3.4 Agroinoculation

A single colony of each infectious AEV clones of DNA-A and DNA-β in Agrobacterium strain of GV3101 was cultured in 5 ml of LB culture containing antibiotics Kanamycin (100 µg/mL) and Gentamycin (50 µg/mL) and grown overnight at 28°C at 225 rpm. A large LB media suspension was then inoculated with the overnight culture and grown at 28°C to an OD600 of

~1.0. The cells were harvested by centrifugation at 1200 g for 10 min and resuspended in

Agrobacterium induction medium (10 mM MgCl2, 10 mM MES pH 5.6 and 150 µM acetosyringone to a final OD595 of 1.0 and incubate at room temperature for 4-6 h with gentle shaking (80-100 rpm). The culture was pelleted again by centrifugation at 1200g for 10 min and resuspended in 10 mM MES buffer and adjust to OD595~0.0005. The both bacterial suspensions

144

were mixed and taken in a syringe and infiltrated through the abaxial surface of two lower leaves of different transgenic lines (T0 generation) and wild-type plants at four leaf stage. Each experiment was repeated five times (five treatments). Five plants were also infiltrated with buffer alone for negative control.

9.3.5 Detection of viral genome in infected plants

Total DNA was extracted from systemic leaves of infected plants of each transgenic line and wild-type plants grown under greenhouse conditions as mentioned in section 3.3.1. One microgram of DNA was used per PCR reaction. Primers AEVCP.F 5’-

GCCCAGGATGTACAGGATGT-3’ (forward) and AEVCP.R 5’-

CACAGGCCTACGATCCCTAA-3’ (reverse) were used to amplify a 283 bp of the coat protein of AEV (GeneBank accession AM698011). Primers TlcvCP.F

5’CCTAGCACTGCCACTGTGAA-3’ (forward) and TlcvCP.R 5’-

CGGGATTAGAGGCGTGAGTA -3’ (reverse) were used to amplify a 232 bp of the coat protein of ToLCNDV (GenBank accession HM134234.1). Primers Actin-F 5’-

ATCCGTGGAGAAGAGCTACG-3’ (forward) and Actin-R 5’-

TGGTACCACCACTGAGGACA-3’ (reverse) were used to amplify a 209 bp of Nicotiana benthamiana actin gene (GeneBank accession AY179605) as an internal control for semi- quantitative PCR.

9.4 RESULTS

9.4.1 Production of transgenic lines

Nicotiana benthamiana plants were regenerated from Kanamycin resistant embryogenic calli that had been transformed with Agrobacterium tumefaciens GV3101 harboring the binary vector pART27-AEVIR. All generated plants had a normal phenotype. The integration of the transgene

T-DNA cassettes has been confirmed by PCR. A simple and reproducible procedure for PCR 145

amplification of was done. Four independent transgenic lines were confirmed by PCR

(Figure 9.2). Expression of the transgene was under the control of the cauliflower mosaic virus

(CaMV) 35S promoter to produce high levels of hp-derived small interfering RNAs (siRNA) in leaves, where virus transmission usually occurs.

Figure 9.2 PCR-verification of transgenic N. benthamiana plants harboring pTR27-AEVIR construct. The expected 456 and 428 bp fragments for regions including IR sense and IR antisense respectively were detected in four transgenic lines (Lanes 1-4). However, these products were absent in wild-type plant (Lane 5).

9.4.2 Transgenic plant evaluation against infectious clones of AEV

To determine the resistance against AEV virus, wild-type and transgenic N. benthamiana plants harboring pART-AEVIR construct were infiltrated with infectious clones of AEV (DNA-A and

DNA-β) in Agrobacterium. Since the optical density value of 1 corresponds to 108 cells/mL culture. This number (OD595~0.5 ) of bacterial cells harboring infectious clones is very high as compared to a number of virus particles during a natural infection by white flies. At an exceptionally high inoculum, the virus resistance mechanism in transgenic plants will certainly be overcome. Consequently, transgenic plants will naturally produce large quantities of virus.

Serial dilutions were produced and used to infect plants. A dilution factor of 1000 fold (i.e. OD

595 = 0.0005, equivalent to about 10 cells/mL) was considered as adequate. All agroinfiltrated plants were observed periodically for the appearance of symptoms. However, both transgenic and non-transgenic plants showed no viral symptoms. Consequently, determination of the virus 146

quantity or viral genome produced in wild-type and transgenic plants was the method of choice to gauge the virus resistance (see Figure 9.3). To investigate the effect of the hairpin sequence on the accumulation of viral DNA (replication), total DNA was extracted from the uppermost fully expanded leaf tissues of all treatments at 21 days post inoculation and 1µg of this DNA was subjected to semi-quantitative PCR using specific primer pairs (AEV-F and AEV-R) for coat protein to detect AEV and primers (Actin-F and Actin-R) to detect the N. benthamiana Actin gene for internal control.

Figure 9.3 Semi-quantitative PCR-based testing of wild-type (Wt) and transgenic N. Benthamiana plants harboring pART27AEV-IR construct for their resistance against AEV after three weeks of challenging with infectious clones of AEV DNA-A and DNA- β in A. tumefaciens strain GV3101. A) Primers specific to the coat protein gene (Tlcv and AEV-CR, 283bp fragment) were used to produce the PCR amplicons: Lane 1; wild-type treated with buffer alone used as a negative control. Lanes 2 and 3; wild-type plants infected with AEV infectious clones. Lanes 4, 5 and 6; three transgenic lines infected with AEV infectious clones. B) Actin gene was included for internal control experiments. The resulting PCR products were analyzed on a 2% Agarose gel.

The capsid protein gene was used to determine the amount of virus in infected plants. The expected size of AEV coat protein fragment (283 bp) could only be amplified from plants challenged with infectious clones of AEV whereas no bands could be detected when DNA extracted from control. The expected 283 bp PCR product is very prominent in wild-type plants

147

(Figure 9.3; Lanes 2 and 3) that indicate high susceptibility of wild-type plants against the virus. In transgenic plants light to the intense band could be detected depending upon the level of resistance that indicates the various level of tolerance or resistance of transgenic lines against

AEV (Figure 9.3). To ascertain the semi-quantitative results, DNA samples from non-transgenic and transgenic plants were amplified by PCR using primers pairs for Actin. The fragment size of

209 bp from Actin gene was detected in both transgenic and non-transgenic plants as shown in

Figure 9.3.

9.4.3 Testing of transgenic plants for resistance against ToLCNDV

Transgenic plants harboring pART27 AEVIR construct were also tested for resistance against another begomovirus; Tomato leaf curl New Delhi virus (ToLCNDV). When wild-type and transgenic N.benthamiana plants were challenged with infectious clones of ToLCNDV (DNA-A and DNA-B), all wild-type plants showed symptoms of virus infection in the upper, newly emerging leaves at 21 days post-inoculation (dpi) consisting of foliar yellowing, curling upwards and thickening of veins (Figure 9.4; B). In contrast, transgenic plants remained symptomless or appeared with mild symptoms (Figure 9.4; A) for first 4 weeks.

148

Figure 9.4 Infectivity of infectious clones of ToLCNDV in tobacco plants. Symptomatic wild-type plants (B) compared to putative transgenic plants showing mild symptoms (A) Photographs were taken at 21 days post-inoculation.

To investigate the resistance and/or tolerance effect on the accumulation of viral DNA

(replication) in transgenic plants, total DNA was extracted from non-inoculated uppermost fully expanded leaf tissues of all treatments inoculated with either infectious clones or buffer alone after three-week post inoculation. One microgram DNA of each plant was subjected to semi- quantitative PCR using specific primer pairs to amplify a 232 bp of the coat protein of

ToLCNDV. The expected size of coat protein gene could only be amplified from plants challenged with infectious clones of ToLCNDV whereas no bands were detected with DNA extracted from buffer treated plants. The CP PCR product is in a range from sharp to faint in different transgenic lines harboring pART27 AEV-IR construct that indicates the various level of tolerance or resistance of transgenic lines against the virus (Figure 9.5; Panel A, Lanes 2-5).

149

Figure 9.5 Semi-quantitative PCR-based testing of wild-type and transgenic N. Benthamiana plants harboring pART27AEV-IR construct for their resistance against ToLCNDV after three weeks of challenging with infectious clones of ToLCNDV (DNA-A and DNA- B) in A. tumefaciens strain GV3101. A) Primers specific to the coat protein gene (TlcvCP.F and Tlcv.R for 232 bp fragment) were used to produce the PCR amplicons: Lane 1; wild-type treated with buffer alone used as a negative control. Lanes 2, 3 and 4; three transgenic lines infected with TolCNDV infectious clones. B) Actin gene was included for internal control experiments. The resulting PCR products were analyzed on a 2% Agarose gel.

To validate the semi-quantitative result, the same DNA samples from non-transgenic and transgenic plants were amplified by PCR using primers pairs for Actin gene as an internal control (Figure 9.5; Panel B)

9.5 CONCLUSION

From the results obtained, we can conclude that the dsRNA strategy confers a good resistance to viral infection. A 176 bp sequence of the non-coding intergenic region (IR) from AEV infectious clone was chosen as the blocking sequence in sense and anti-sense orientations interrupted with a pyruvate dehydrogenase kinase (pdk) intron. The blocking sequence (seen below in Figure 9.6;

B) which spans the origin of replication (Ori) of geminiviruses contains 100% identity to the begomovirus (AEV).

150

Figure 9.6 Organization of a Geminivirus replication origin. A) A diagram of the tomato golden mosaic virus (TGMV) replication origin is presented by Bisaro (392). Shown are the relative positions of Rep-binding sites, the invariant sequence (TAATATTAC), and the site where plus-strand synthesis initiates. Sequences involved in origin recognition/specificity are also depicted (393). The location of sequence elements that interact with the transcription machinery, including TATAA sequence, Rep and CP transcription start sites (references cited in (394)), a putative binding site for G-box family transcription factors, and a putative TrAP response element (the conserved late element; (395)) are also indicated. A sequence that appears to be an additional Rep-binding site in inverted orientation has been identified by sequence analysis (395). Nucleotide coordinates are from TGMV DNA-A. B) Blockage of the origin of replication by an antisense single stranded complementary RNA (depicted in red) sense RNA. The internal sequence is that of geminivirus viral origin of replication (+strand).

This blocking sequence also contains 42-100 % sequence homology to several other published sequences of begomoviruses and expectedly to a large number of geminiviruses which are circulating in the field but are not yet discovered and/or identified. Our blocking sequence is designed to contain in its core region the highly conserved nonanucleotide sequence in geminiviruses. This is also flanked by complementary sequences to the IR control region for geminiviruses. We expect this blocking sequence to target the origin of replication of all major members of begomoviruses. Because this sequence contains several stretches of perfect homology to the origin of replication of begomoviruses, it is expected that inhibition of the replication of these viruses will be carried out (for molecular mechanisms of blockage, see Figure 9.6). An intron-containing hairpin (ihp) transformation construct pART27-

AEVIR was made by using the pHANNIBAL/pART27 system. The 176-bp double-stranded

RNA sequence is the target for the RNA silencing/dicer machinery which could produce 21-25 double-stranded RNA sequences. Binding of the Argonaut and other plant proteins to the double- stranded RNA fragments result in activation of several plant defense mechanisms against the 151

invading begomoviruses. A complementary RNA sequence could be expected to target the hairpin loop (nonanucleotides) at the origin of replication on the viral begomovirus single- stranded (positive-sense) (Figure 9.6). An RNA-DNA hybrid is quite stable which might result in blocking the origin of replication of the virus by the cellular polymerases (there will not be at this stage any viral transcription from single-stranded viral DNA) and consequently, the viral replication could be inhibited at very early stages. Binding of the single-stranded complementary

RNA may also disturb the double-stranded stem-loop of viral DNA rendering it not recognizable by cellular polymerases. Further, the complementary RNA sequences generated by our construct possibly activate the RNA-directed DNA methylation which targets the stem of the hairpin loop which is double-stranded and rich in GC. Consequently, the DNA methylation of the stem of the hairpin loop which constitutes the origin of replication could result in blocking that region of viral DNA of being copied into a double-stranded sequence (replicative form) by cellular enzymes. This stem is quite rich in CG dinucleotides (primary target for DNA methylation).

During viral replication, the viral “rep” protein is responsible for nicking the double-stranded

DNA at the origin of replication to allow the replication to continue through the rolling circle model. Our complementary single-stranded sequences may be responsible for blocking the nicking of the hairpin loop a sine qua none condition for replication by rolling circle model.

Further, the control region (which includes the nonanucleotide) could also be methylated by the

RNA-directed DNA methylation. Consequently, the rolling circle replication and the promoter regions may be entirely methylated which leads not only to blocking replication but also inhibition of transcription of viral essential genes (e.g. rep gene and other viral genes). Viral double-stranded DNA is known to be covered by heterochromatin which also can be targeted by the RNA-directed methylation. The complementary sequences of hairpin may be involved to block the region at the stem-loop which is required in the binding of rep protein (Figure 9.6).

152

The prototype for transgenic plants resistant to geminiviruses is completed and proved to be functional. Based on the results, three major novelties in this system are 1) the targeted control region in Geminiviruses. 2) The universality covering ALL the Geminiviruses. 3) Inhibition of the Rep protein of initiating the replicative cycle of Geminiviruses. In conclusion, our study demonstrates that resistance to geminiviruses in plants can be achieved via TGS and/or PTGS by expressing siRNA derived from non-coding viral sequences.

153

REFERENCES

1. King AM, Adams MJ, Lefkowitz EJ. 2011. Virus taxonomy: classification and nomenclature of viruses: Ninth Report of the International Committee on Taxonomy of Viruses, vol. 9. Elsevier. 2. Adams MJ, Antoniw JF, Bar-Joseph M, Brunt AA, Candresse T, Foster GD, Martelli GP, Milne RG, Zavriev SK, Fauquet CM. 2004. The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation. Archives of virology 149:1045-1060. 3. Morozov SY, Solovyev AG. 2003. Triple gene block: modular design of a multifunctional machine for plant virus movement. Journal of General Virology 84:1351- 1366. 4. Verchot-Lubicz J. 2005. A new cell-to-cell transport model for Potexviruses. Molecular plant-microbe interactions : MPMI 18:283-290. 5. Verchot-Lubicz J, Torrance L, Solovyev AG, Morozov SY, Jackson AO, Gilmer D. 2010. Varied movement strategies employed by triple gene block-encoding viruses. Molecular plant-microbe interactions : MPMI 23:1231-1247. 6. Solovyev AG, Kalinina NO, Morozov SY. 2012. Recent advances in research of plant virus movement mediated by triple gene block. Front Plant Sci 3:276. 7. Park MR, Seo JK, Kim KH. 2013. Viral and nonviral elements in potexvirus replication and movement and in antiviral responses. Advances in virus research 87:75-112. 8. Baulcombe DC, Chapman S, Santa Cruz S. 1995. Jellyfish green fluorescent protein as a reporter for virus infections. The Plant journal : for cell and molecular biology 7:1045- 1053. 9. Chapman S, Hills G, Watts J, Baulcombe D. 1992. Mutational analysis of the coat protein gene of potato virus X: effects on virion morphology and viral pathogenicity. Virology 191:223-230. 10. Niehl A, Heinlein M. 2011. Cellular pathways for viral transport through plasmodesmata. Protoplasma 248:75-99. 11. Schoelz JE, Harries PA, Nelson RS. 2011. Intracellular transport of plant viruses: finding the door out of the cell. Molecular plant 4:813-831. 12. Morozov SY, Solovyev AG. 2003. Triple gene block: modular design of a multifunctional machine for plant virus movement. The Journal of general virology 84:1351-1366. 13. Martelli GP, Adams MJ, Kreuze JF, Dolja VV. 2007. Family Flexiviridae: a case study in virion and genome plasticity. Annual review of phytopathology 45:73-100. 14. Park M-R, Jeong R-D, Kim K-H. 2014. Understanding the intracellular trafficking and intercellular transport of potexviruses in their host plants. Frontiers in plant science 5:60. 15. Verchot J, Angell SM, Baulcombe DC. 1998. In vivo translation of the triple gene block of potato virus X requires two subgenomic mRNAs. Journal of virology 72:8316- 8320. 16. Lin MK, Chang BY, Liao JT, Lin NS, Hsu YH. 2004. Arg-16 and Arg-21 in the N- terminal region of the triple-gene-block protein 1 of Bamboo mosaic virus are essential for virus movement. The Journal of general virology 85:251-259. 17. Gorbalenya AE, Koonin EV. 1993. Helicases: amino acid sequence comparisons and structure-function relationships. Current Opinion in Structural Biology 3:419-429.

154

18. Lim HS, Vaira AM, Domier LL, Lee SC, Kim HG, Hammond J. 2010. Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression. Virology 402:149-163. 19. Bayne EH, Rakitina DV, Morozov SY, Baulcombe DC. 2005. Cell-to-cell movement of potato potexvirus X is dependent on suppression of RNA silencing. The Plant journal : for cell and molecular biology 44:471-482. 20. Mitra R, Krishnamurthy K, Blancaflor E, Payton M, Nelson RS, Verchot-Lubicz J. 2003. The potato virus X TGBp2 protein association with the endoplasmic reticulum plays a role in but is not sufficient for viral cell-to-cell movement. Virology 312:35-48. 21. Cowan GH, Lioliopoulou F, Ziegler A, Torrance L. 2002. Subcellular localisation, protein interactions, and RNA binding of Potato mop-top virus triple gene block proteins. Virology 298:106-115. 22. Hsu HT, Tseng YH, Chou YL, Su SH, Hsu YH, Chang BY. 2009. Characterization of the RNA-binding properties of the triple-gene-block protein 2 of Bamboo mosaic virus. Virology journal 6:50. 23. Krishnamurthy K, Heppler M, Mitra R, Blancaflor E, Payton M, Nelson RS, Verchot-Lubicz J. 2003. The Potato virus X TGBp3 protein associates with the ER network for virus cell-to-cell movement. Virology 309:135-151. 24. Wu CH, Lee SC, Wang CW. 2011. Viral protein targeting to the cortical endoplasmic reticulum is required for cell-cell spreading in plants. J Cell Biol 193:521-535. 25. Tamai A, Meshi T. 2001. Cell-to-Cell Movement of Potato virus X: The Role of p12 and p8 Encoded by the Second and Third Open Reading Frames of the Triple Gene Block. Molecular Plant-Microbe Interactions 14:1158-1167. 26. Haupt S, Cowan GH, Ziegler A, Roberts AG, Oparka KJ, Torrance L. 2005. Two plant-viral movement proteins traffic in the endocytic recycling pathway. Plant Cell 17:164-181. 27. Lough TJ, Shash K, Xoconostle-Cázares B, Hofstra KR, Beck DL, Balmori E, Forster RL, Lucas WJ. 1998. Molecular dissection of the mechanism by which potexvirus triple gene block proteins mediate cell-to-cell transport of infectious RNA. Molecular plant-microbe interactions 11:801-814. 28. Cruz SS, Roberts AG, Prior DA, Chapman S, Oparka KJ. 1998. Cell-to-cell and phloem-mediated transport of potato virus X. The role of virions. The Plant Cell 10:495- 510. 29. Lough TJ, Netzler NE, Emerson SJ, Sutherland P, Carr F, Beck DL, Lucas WJ, Forster RL. 2000. Cell-to-cell movement of potexviruses: evidence for a ribonucleoprotein complex involving the coat protein and first triple gene block protein. Molecular plant-microbe interactions 13:962-974. 30. Beck DL, Guilford PJ, Voot DM, Andersen MT, Forster RL. 1991. Triple gene block proteins of white clover mosaic potexvirus are required for transport. Virology 183:695- 702. 31. Oparka K, Roberts A, Roberts I, Prior D, Cruz S. 1996. Viral coat protein is targeted to, but does not gate, plasmodesmata during cell‐to‐cell movement of potato virus X. The Plant Journal 10:805-813. 32. Yang Y, Ding B, Baulcombe DC, Verchot J. 2000. Cell-to-cell movement of the 25K protein of Potato virus X is regulated by three other viral proteins. Molecular plant- microbe interactions 13:599-605. 33. Verchot-Lubicz J. 2005. A new cell-to-cell transport model for potexviruses. Molecular plant-microbe interactions 18:283-290. 155

34. Baulcombe DC, Chapman S, Cruz S. 1995. Jellyfish green fluorescent protein as a reporter for virus infections. The Plant Journal 7:1045-1053. 35. Forster RL, Beck DL, Guilford PJ, Voot DM, Van Dolleweerd CJ, Andersen MT. 1992. Thecoat protein of white clover mosaic potexvirus has a role in facilitating cell-to- cell transport in plants. Virology 191:480-484. 36. Lucas WJ. 2006. Plant viral movement proteins: agents for cell-to-cell trafficking of viral genomes. Virology 344:169-184. 37. Oparka KJ. 2004. Getting the message across: how do plant cells exchange macromolecular complexes? Trends in plant science 9:33-41. 38. Haupt S, Cowan GH, Ziegler A, Roberts AG, Oparka KJ, Torrance L. 2005. Two plant–viral movement proteins traffic in the endocytic recycling pathway. The Plant Cell 17:164-181. 39. Ju H-J, Samuels TD, Wang Y-S, Blancaflor E, Payton M, Mitra R, Krishnamurthy K, Nelson RS, Verchot-Lubicz J. 2005. The potato virus X TGBp2 movement protein associates with endoplasmic reticulum-derived vesicles during virus infection. Plant physiology 138:1877-1895. 40. Zamyatnin Jr AA, Solovyev AG, Savenkov EI, Germundsson A, Sandgren M, Valkonen JP, Morozov SY. 2004. Transient coexpression of individual genes encoded by the triple gene block of Potato mop-top virus reveals requirements for TGBp1 trafficking. Molecular plant-microbe interactions 17:921-930. 41. Tilsner J, Linnik O, Louveaux M, Roberts IM, Chapman SN, Oparka KJ. 2013. Replication and trafficking of a plant virus are coupled at the entrances of plasmodesmata. The Journal of cell biology 201:981-995. 42. Lough TJ, Netzler NE, Emerson SJ, Sutherland P, Carr F, Beck DL, Lucas WJ, Forster RL. 2000. Cell-to-cell movement of potexviruses: evidence for a ribonucleoprotein complex involving the coat protein and first triple gene block protein. Molecular plant-microbe interactions : MPMI 13:962-974. 43. Tilsner J, Linnik O, Louveaux M, Roberts IM, Chapman SN, Oparka KJ. 2013. Replication and trafficking of a plant virus are coupled at the entrances of plasmodesmata. J Cell Biol 201:981-995. 44. Howard AR, Heppler ML, Ju HJ, Krishnamurthy K, Payton ME, Verchot-Lubicz J. 2004. Potato virus X TGBp1 induces plasmodesmata gating and moves between cells in several host species whereas CP moves only in N. benthamiana leaves. Virology 328:185-197. 45. Samuels TD, Ju HJ, Ye CM, Motes CM, Blancaflor EB, Verchot-Lubicz J. 2007. Subcellular targeting and interactions among the Potato virus X TGB proteins. Virology 367:375-389. 46. Hsu HT, Chou YL, Tseng YH, Lin YH, Lin TM, Lin NS, Hsu YH, Chang BY. 2008. Topological properties of the triple gene block protein 2 of Bamboo mosaic virus. Virology 379:1-9. 47. Lee SC, Wu CH, Wang CW. 2010. Traffic of a viral movement protein complex to the highly curved tubules of the cortical endoplasmic reticulum. Traffic (Copenhagen, Denmark) 11:912-930. 48. Chou YL, Hung YJ, Tseng YH, Hsu HT, Yang JY, Wung CH, Lin NS, Meng M, Hsu YH, Chang BY. 2013. The stable association of virion with the triple-gene-block protein 3-based complex of Bamboo mosaic virus. PLoS pathogens 9:e1003405. 49. Qiao Y, Li HF, Wong SM, Fan ZF. 2009. Plastocyanin transit peptide interacts with Potato virus X coat protein, while silencing of plastocyanin reduces coat protein 156

accumulation in chloroplasts and symptom severity in host plants. Molecular plant- microbe interactions : MPMI 22:1523-1534. 50. Zhang C, Liu Y, Sun X, Qian W, Zhang D, Qiu B. 2008. Characterization of a specific interaction between IP-L, a tobacco protein localized in the thylakoid membranes, and Tomato mosaic virus coat protein. Biochemical and biophysical research communications 374:253-257. 51. Caplan JL, Mamillapalli P, Burch-Smith TM, Czymmek K, Dinesh-Kumar SP. 2008. Chloroplastic protein NRIP1 mediates innate immune receptor recognition of a viral effector. Cell 132:449-462. 52. Abbink TE, Peart JR, Mos TN, Baulcombe DC, Bol JF, Linthorst HJ. 2002. Silencing of a gene encoding a protein component of the oxygen-evolving complex of photosystem II enhances virus replication in plants. Virology 295:307-319. 53. Jimenez I, Lopez L, Alamillo JM, Valli A, Garcia JA. 2006. Identification of a plum pox virus CI-interacting protein from chloroplast that has a negative effect in virus infection. Molecular plant-microbe interactions : MPMI 19:350-358. 54. Jin Y, Ma D, Dong J, Li D, Deng C, Jin J, Wang T. 2007. The HC-pro protein of potato virus Y interacts with NtMinD of tobacco. Molecular plant-microbe interactions : MPMI 20:1505-1511. 55. Cheng YQ, Liu ZM, Xu J, Zhou T, Wang M, Chen YT, Li HF, Fan ZF. 2008. HC- Pro protein of sugar cane mosaic virus interacts specifically with maize ferredoxin-5 in vitro and in planta. The Journal of general virology 89:2046-2054. 56. Kong L, Wu J, Lu L, Xu Y, Zhou X. 2014. Interaction between Rice stripe virus Disease-Specific Protein and Host PsbP Enhances Virus Symptoms. Molecular plant 7:691-708. 57. Zhao J, Liu Q, Zhang H, Jia Q, Hong Y, Liu Y. 2013. The small subunit is involved in tobamovirus movement and Tm-2(2)-mediated extreme resistance. Plant physiology 161:374-383. 58. Lim HS, Vaira AM, Bae H, Bragg JN, Ruzin SE, Bauchan GR, Dienelt MM, Owens RA, Hammond J. 2010. Mutation of a chloroplast-targeting signal in Alternanthera mosaic virus TGB3 impairs cell-to-cell movement and eliminates long-distance virus movement. The Journal of general virology 91:2102-2115. 59. Jang C, Seo EY, Nam J, Bae H, Gim YG, Kim HG, Cho IS, Lee ZW, Bauchan GR, Hammond J, Lim HS. 2013. Insights into Alternanthera mosaic virus TGB3 Functions: Interactions with Nicotiana benthamiana PsbO Correlate with Chloroplast Vesiculation and Veinal Necrosis Caused by TGB3 Over-Expression. Front Plant Sci 4:5. 60. Lin MK, Hu CC, Lin NS, Chang BY, Hsu YH. 2006. Movement of potexviruses requires species-specific interactions among the cognate triple gene block proteins, as revealed by a trans-complementation assay based on the bamboo mosaic virus satellite RNA-mediated expression system. The Journal of general virology 87:1357-1367. 61. Zaitlin M, Boardman N. 1958. The association of tobacco mosaic virus with plastids: I. Isolation of virus from the chloroplast fraction of diseased-leaf homogenates. Virology 6:743-757. 62. Shalla T, Petersen L, Giunchedi L. 1975. Partial characterization of virus-like particles in chloroplasts of plants infected with the U5 strain of TMV. Virology 66:94-105. 63. Siegel A. 1971. Pseudovirions of tobacco mosaic virus. Virology 46:50-59. 64. Rochon DA, Siegel A. 1984. Chloroplast DNA transcripts are encapsidated by tobacco mosaic virus coat protein. Proceedings of the National Academy of Sciences 81:1719- 1723. 157

65. Schoelz JE, Zaitlin M. 1989. Tobacco mosaic virus RNA enters chloroplasts in vivo. Proceedings of the National Academy of Sciences 86:4496-4500. 66. Cheng S-F, Huang Y-P, Chen L-H, Hsu Y-H, Tsai C-H. 2013. Chloroplast phosphoglycerate kinase is involved in the targeting of Bamboo mosaic virus to chloroplasts in Nicotiana benthamiana plants. Plant physiology 163:1598-1608. 67. Baudisch B, Langner U, Garz I, Klosgen RB. 2014. The exception proves the rule? Dual targeting of nuclear-encoded proteins into endosymbiotic organelles. The New phytologist 201:80-90. 68. Peltier J-B, Friso G, Kalume DE, Roepstorff P, Nilsson F, Adamska I, van Wijka KJ. 2000. Proteomics of the Chloroplast: Systematic Identification and Targeting Analysis of Lumenal and Peripheral Thylakoid Proteins. The Plant Cell 12:319-341. 69. Chew O, Whelan J. Just read the message: a model for sorting of proteins between mitochondria and chloroplasts. Trends in Plant Science 9:318-319. 70. Rudhe C, Chew O, Whelan J, Glaser E. 2002. A novel in vitro system for simultaneous import of precursor proteins into mitochondria and chloroplasts. The Plant journal : for cell and molecular biology 30:213-220. 71. Karniely S, Pines O. 2005. Single translation—dual destination: mechanisms of dual protein targeting in eukaryotes. EMBO Reports 6:420-425. 72. Peeters N, Small I. 2001. Dual targeting to mitochondria and chloroplasts. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1541:54-63. 73. Blobel G. 1980. Intracellular protein topogenesis. Proceedings of the National Academy of Sciences of the United States of America 77:1496-1500. 74. Loya A, Pnueli L, Yosefzon Y, Wexler Y, Ziv-Ukelson M, Arava Y. 2008. The 3′- UTR mediates the cellular localization of an mRNA encoding a short plasma membrane protein. RNA 14:1352-1365. 75. Pyhtila B, Zheng T, Lager PJ, Keene JD, Reedy MC, Nicchitta CV. 2008. Signal sequence- and translation-independent mRNA localization to the endoplasmic reticulum. RNA 14:445-453. 76. Marc P, Margeot A, Devaux F, Blugeon C, Corral-Debrinski M, Jacq C. 2002. Genome-wide analysis of mRNAs targeted to yeast mitochondria. EMBO Reports 3:159- 164. 77. Gadir N, Haim-Vilmovsky L, Kraut-Cohen J, Gerst JE. 2011. Localization of mRNAs coding for mitochondrial proteins in the yeast Saccharomyces cerevisiae. Rna 17:1551-1565. 78. Saint-Georges Y, Garcia M, Delaveau T, Jourdren L, Le Crom S, Lemoine S, Tanty V, Devaux F, Jacq C. 2008. Yeast Mitochondrial Biogenesis: A Role for the PUF RNA- Binding Protein Puf3p in mRNA Localization. PLoS ONE 3:e2293. 79. Uniacke J, Zerges W. 2009. Chloroplast protein targeting involves localized translation in Chlamydomonas. Proceedings of the National Academy of Sciences 106:1439-1444. 80. Zipor G, Haim-Vilmovsky L, Gelin-Licht R, Gadir N, Brocard C, Gerst JE. 2009. Localization of mRNAs coding for peroxisomal proteins in the yeast, Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 106:19848-19853. 81. Jambhekar A, Derisi JL. 2007. Cis-acting determinants of asymmetric, cytoplasmic RNA transport. Rna 13:625-642. 82. Munro TP, Magee RJ, Kidd GJ, Carson JH, Barbarese E, Smith LM, Smith R. 1999. Mutational analysis of a heterogeneous nuclear ribonucleoprotein A2 response element for RNA trafficking. The Journal of biological chemistry 274:34389-34395. 158

83. Ainger K, Avossa D, Diana AS, Barry C, Barbarese E, Carson JH. 1997. Transport and Localization Elements in Myelin Basic Protein mRNA. The Journal of Cell Biology 138:1077-1087. 84. Kraut-Cohen J, Gerst JE. 2010. Addressing mRNAs to the ER: cis sequences act up! Trends Biochem Sci 35:459-469. 85. Haim L, Zipor G, Aronov S, Gerst JE. 2007. A genomic integration method to visualize localization of endogenous mRNAs in living yeast. Nature methods 4:409-412. 86. Ule J, Jensen K, Mele A, Darnell RB. 2005. CLIP: a method for identifying protein– RNA interaction sites in living cells. Methods 37:376-386. 87. Daròs JA, Elena SF, Flores R. 2006. Viroids: an Ariadne's thread into the RNA labyrinth. EMBO reports 7:593-598. 88. Molina-Serrano D, Suay L, Salvador ML, Flores R, Daròs J-A. 2007. Processing of RNAs of the family Avsunviroidae in Chlamydomonas reinhardtii chloroplasts. Journal of virology 81:4363-4366. 89. Daròs J-A, Marcos JF, Hernandez C, Flores R. 1994. Replication of avocado sunblotch viroid: evidence for a symmetric pathway with two rolling circles and processing. Proceedings of the National Academy of Sciences 91:12813-12817. 90. Lima M, Fonseca M, Flores R, Kitajima E. 1994. Detection of avocado sunblotch viroid in chloroplasts of avocado leaves by in situ hybridization. Archives of virology 138:385-390. 91. Bussière F, Lehoux J, Thompson D, Skrzeczkowski L, Perreault J-P. 1999. Subcellular localization and rolling circle replication of peach latent mosaic viroid: hallmarks of group A viroids. Journal of virology 73:6353-6360. 92. Navarro J-A, Vera A, Flores R. 2000. A chloroplastic RNA polymerase resistant to tagetitoxin is involved in replication of avocado sunblotch viroid. Virology 268:218-225. 93. Ding B. 2009. The biology of viroid-host interactions. Annual review of phytopathology 47:105-131. 94. Flores R, Hernández C, Alba AEMd, Daròs J-A, Serio FD. 2005. Viroids and viroid- host interactions. Annu. Rev. Phytopathol. 43:117-139. 95. Gomez G, Pallas V. 2010. Noncoding RNA mediated traffic of foreign mRNA into chloroplasts reveals a novel signaling mechanism in plants. PLoS One 5:e12269. 96. Gomez G, Pallas V. 2010. Can the import of mRNA into chloroplasts be mediated by a secondary structure of a small non-coding RNA? Plant signaling & behavior 5:1517- 1519. 97. Hotto AM, Germain A, Stern DB. 2012. Plastid non-coding RNAs: emerging candidates for gene regulation. Trends in plant science 17:737-744. 98. Hotto AM, Schmitz RJ, Fei Z, Ecker JR, Stern DB. 2011. Unexpected diversity of chloroplast noncoding RNAs as revealed by deep sequencing of the Arabidopsis transcriptome. G3: Genes, Genomes, Genetics 1:559-570. 99. Zhelyazkova P, Sharma CM, Förstner KU, Liere K, Vogel J, Börner T. 2012. The primary transcriptome of barley chloroplasts: numerous noncoding RNAs and the dominating role of the plastid-encoded RNA polymerase. The Plant Cell 24:123-136. 100. Vothknecht UC, Soll J. 2005. Chloroplast membrane transport: interplay of prokaryotic and eukaryotic traits. Gene 354:99-109. 101. Buchanan BB, Gruissem W, Jones RL. 2000. Biochemistry & molecular biology of plants, vol. 40. American Society of Plant Physiologists Rockville, MD.

159

102. Harris EH, Boynton JE, Gillham NW. 1994. Chloroplast ribosomes and protein synthesis. Microbiological reviews 58:700. 103. Martin W, Herrmann RG. 1998. Gene transfer from organelles to the nucleus: how much, what happens, and why? Plant physiology 118:9-17. 104. Stengel A, Soll J, Bölter B. 2007. Protein import into chloroplasts: new aspects of a well-known topic. Biological chemistry 388:765-772. 105. Alberts B, Johnson A, Lewis J, Morgan D, Raff M, Roberts K, Walter P. 2014. Molecular Biology of the Cell, 6th ed. Garland Science, New York. 106. Kozak M. 1999. Initiation of translation in prokaryotes and eukaryotes. Gene 234:187- 208. 107. Marín-Navarro J, Manuell AL, Wu J, Mayfield SP. 2007. Chloroplast translation regulation. Photosynthesis Research 94:359-374. 108. Salinas T, Duchêne A-M, Marechal-Drouard L. 2008. Recent advances in tRNA mitochondrial import. Trends in biochemical sciences 33:320-329. 109. Schneider A, Maréchal-Drouard L. 2000. Mitochondrial tRNA import: are there distinct mechanisms? Trends in cell biology 10:509-513. 110. Maréchal-Drouard L, Weil J, Dietrich A. 1993. Transfer RNAs and transfer RNA genes in plants. Annual review of plant biology 44:13-32. 111. Smirnov A, Tarassov I, Mager-Heckel A-M, Letzelter M, Martin RP, Krasheninnikov IA, Entelis N. 2008. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria. Rna 14:749-759. 112. Puranam RS, Attardi G. 2001. The RNase P associated with HeLa cell mitochondria contains an essential RNA component identical in sequence to that of the nuclear RNase P. Molecular and cellular biology 21:548-561. 113. Tarassov I, Kamenski P, Kolesnikova O, Karicheva O, Martin RP, Krasheninnikov IA, Entelis N. 2007. Import of nuclear DNA-encoded RNAs into mitochondria and mitochondrial translation. Cell Cycle 6:2473-2477. 114. Delage L, Duchêne AM, Zaepfel M, Maréchal‐Drouard L. 2003. The anticodon and the D‐domain sequences are essential determinants for plant cytosolic tRNAVal import into mitochondria. The Plant Journal 34:623-633. 115. Salinas T, Schaeffer C, Maréchal-Drouard L, Duchêne A-M. 2005. Sequence dependence of tRNA Gly import into tobacco mitochondria. Biochimie 87:863-872. 116. Small I, Marechal-Drouard L, Masson J, Pelletier G, Cosset A, Weil J, Dietrich A. 1992. In vivo import of a normal or mutagenized heterologous transfer RNA into the mitochondria of transgenic plants: towards novel ways of influencing mitochondrial gene expression? The EMBO journal 11:1291. 117. Delage L, Dietrich A, Cosset A, Maréchal-Drouard L. 2003. In vitro import of a nuclearly encoded tRNA into mitochondria of Solanum tuberosum. Molecular and cellular biology 23:4000-4012. 118. Hanley-Bowdoin L, Settlage SB, Orozco BM, Nagar S, Robertson D. 2000. Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation. Crit Rev Biochem Mol Biol 35:105-140. 119. Hanley-Bowdoin L, Settlage SB, Robertson D. 2004. Reprogramming plant gene expression: a prerequisite to geminivirus DNA replication. Mol Plant Pathol 5:149-156. 120. Lazarowitz SG, Beachy RN. 1999. Viral movement proteins as probes for intracellular and intercellular trafficking in plants. The Plant Cell 11:535-548. 121. Rojas MR, Hagen C, Lucas WJ, Gilbertson RL. 2005. Exploiting chinks in the plant's armor: evolution and emergence of geminiviruses. Annu. Rev. Phytopathol. 43:361-394. 160

122. Jeske H. 2007. Replication of geminiviruses and the use of rolling circle amplification for their diagnosis, p. 141-156, Tomato Yellow Leaf Curl Virus Disease. Springer. 123. Varsani A, Navas-Castillo J, Moriones E, Hernandez-Zepeda C, Idris A, Brown JK, Murilo Zerbini F, Martin DP. 2014. Establishment of three new genera in the family Geminiviridae: Becurtovirus, Eragrovirus and Turncurtovirus. Archives of virology 159:2193-2203. 124. Adams M, King A, Carstens E. 2013. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses (2013). Archives of virology 158:2023-2030. 125. Amin I, Patil BL, Briddon RW, Mansoor S, Fauquet CM. 2011. Comparison of phenotypes produced in response to transient expression of genes encoded by four distinct begomoviruses in Nicotiana benthamiana and their correlation with the levels of developmental miRNAs. Virol J 8:238. 126. Briddon RW, Stanley J. 2001. Geminiviridae, eLS. John Wiley & Sons, Ltd. 127. Fauquet C, Briddon R, Brown J, Moriones E, Stanley J, Zerbini M, Zhou X. 2008. Geminivirus strain demarcation and nomenclature. Archives of virology 153:783-821. 128. Hanley-Bowdoin L, Bejarano ER, Robertson D, Mansoor S. 2013. Geminiviruses: masters at redirecting and reprogramming plant processes. Nature reviews. Microbiology 11:777-788. 129. Idris AM, Shahid MS, Briddon RW, Khan A, Zhu J-K, Brown JK. 2011. An unusual associated with monopartite begomoviruses attenuates symptoms and reduces betasatellite accumulation. Journal of General Virology 92:706-717. 130. Bisaro DM. 2006. Silencing suppression by geminivirus proteins. Virology 344:158-168. 131. Vanitharani R, Chellappan P, Fauquet CM. 2005. Geminiviruses and RNA silencing. Trends in plant science 10:144-151. 132. Sharma P, Ikegami M. 2009. Characterization of signals that dictate nuclear/nucleolar and cytoplasmic shuttling of the capsid protein of Tomato leaf curl Java virus associated with DNAβ satellite. Virus research 144:145-153. 133. Hanley-Bowdoin L, Settlage SB, Orozco BM, Nagar S, Robertson D. 1999. Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation. Critical Reviews in Plant Sciences 18:71-106. 134. Yadava P, Suyal G, Mukherjee SK. 2010. Begomovirus DNA replication and pathogenicity. Current Science 98:360-368. 135. Chakravortty D, Poornima Priyadarshini C, Ambika M, Tippeswamy R, Savithri H. 2011. Functional characterization of coat protein and V2 involved in cell to cell movement of Cotton leaf curl Kokhran virus-Dabawali. PloS one 6:e26929. 136. Zrachya A, Glick E, Levy Y, Arazi T, Citovsky V, Gafni Y. 2007. Suppressor of RNA silencing encoded by Tomato yellow leaf curl virus-Israel. Virology 358:159-165. 137. Sharma P, Gaur RK, Ikegami M. 2011. Subcellular localization of V2 protein of Tomato leaf curl Java virus by using green fluorescent protein and yeast hybrid system. Protoplasma 248:281-288. 138. Nash TE, Dallas MB, Reyes MI, Buhrman GK, Ascencio-Ibañez JT, Hanley- Bowdoin L. 2011. Functional analysis of a novel motif conserved across geminivirus Rep proteins. Journal of virology 85:1182-1192. 139. Hanley‐Bowdoin L, Settlage SB, Robertson D. 2004. Reprogramming plant gene expression: a prerequisite to geminivirus DNA replication. Molecular Plant 5:149-156.

161

140. Choudhury NR, Malik PS, Singh DK, Islam MN, Kaliappan K, Mukherjee SK. 2006. The oligomeric Rep protein of Mungbean yellow mosaic India virus (MYMIV) is a likely replicative helicase. Nucleic acids research 34:6362-6377. 141. Yang X, Baliji S, Buchmann RC, Wang H, Lindbo JA, Sunter G, Bisaro DM. 2007. Functional modulation of the geminivirus AL2 transcription factor and silencing suppressor by self-interaction. Journal of virology 81:11972-11981. 142. Gopal P, Kumar PP, Sinilal B, Jose J, Yadunandam AK, Usha R. 2007. Differential roles of C4 and βC1 in mediating suppression of post-transcriptional gene silencing: evidence for transactivation by the C2 of Bhendi yellow vein mosaic virus, a monopartite begomovirus. Virus research 123:9-18. 143. Mubin M, Amin I, Amrao L, Briddon RW, Mansoor S. 2010. The hypersensitive response induced by the V2 protein of a monopartite begomovirus is countered by the C2 protein. Molecular 11:245-254. 144. Hussain M, Mansoor S, Iram S, Zafar Y, Briddon RW. 2007. The hypersensitive response to tomato leaf curl New Delhi virus nuclear shuttle protein is inhibited by transcriptional activator protein. Molecular Plant-Microbe Interactions 20:1581-1588. 145. Pedersen TJ, Hanley-Bowdoin L. 1994. Molecular characterization of the AL3 protein encoded by a bipartite geminivirus. Virology 202:1070-1075. 146. Settlage SB, See RG, Hanley-Bowdoin L. 2005. Geminivirus C3 protein: replication enhancement and protein interactions. Journal of virology 79:9885-9895. 147. Pasumarthy KK, Mukherjee SK, Choudhury NR. 2011. The presence of tomato leaf curl Kerala virus AC3 protein enhances viral DNA replication and modulates virus induced gene-silencing mechanism in tomato plants. Virology journal 8:1-14. 148. Pandey P, Choudhury NR, Mukherjee SK. 2009. A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector. Virol. J 6:152. 149. Vanitharani R, Chellappan P, Pita JS, Fauquet CM. 2004. Differential roles of AC2 and AC4 of cassava geminiviruses in mediating synergism and suppression of posttranscriptional gene silencing. Journal of virology 78:9487-9498. 150. Amin I, Hussain K, Akbergenov R, Yadav JS, Qazi J, Mansoor S, Hohn T, Fauquet CM, Briddon RW. 2011. Suppressors of RNA silencing encoded by the components of the cotton leaf curl begomovirus-betasatellite complex. Molecular plant-microbe interactions : MPMI 24:973-983. 151. Malik PS, Kumar V, Bagewadi B, Mukherjee SK. 2005. Interaction between coat protein and replication initiation protein of Mung bean yellow mosaic India virus might lead to control of viral DNA replication. Virology 337:273-283. 152. Sanderfoot AA, Ingham DJ, Lazarowitz SG. 1996. A Viral Movement Protein as a Nuclear Shuttle (The Geminivirus BR1 Movement Protein Contains Domains Essential for Interaction with BL1 and Nuclear Localization). Plant physiology 110:23-33. 153. Krenz B, Jeske H, Kleinow T. 2012. The induction of stromule formation by a plant DNA-virus in epidermal leaf tissues suggests a novel intra-and intercellular macromolecular trafficking route. Frontiers in plant science 3. 154. Jeffrey JL, Pooma W, Petty IT. 1996. Genetic requirements for local and systemic movement of tomato golden mosaic virus in infected plants. Virology 223:208-218. 155. Rojas MR, Jiang H, Salati R, Xoconostle-Cázares B, Sudarshana M, Lucas WJ, Gilbertson RL. 2001. Functional analysis of proteins involved in movement of the monopartite begomovirus, Tomato yellow leaf curl virus. Virology 291:110-125.

162

156. Gafni Y, Epel BL. 2002. The role of host and viral proteins in intra-and inter-cellular trafficking of geminiviruses. Physiological and Molecular Plant Pathology 60:231-241. 157. Settlage SB, See RG, Hanley-Bowdoin L. 2005. Geminivirus C3 protein: replication enhancement and protein interactions. Journal of virology 79:9885-9895. 158. Goodin MM, Zaitlin D, Naidu RA, Lommel SA. 2008. Nicotiana benthamiana: its history and future as a model for plant-pathogen interactions. Molecular plant-microbe interactions 21:1015-1026. 159. Saeed M, Zafar Y, Randles JW, Rezaian MA. 2007. A monopartite begomovirus- associated DNA β satellite substitutes for the DNA B of a bipartite begomovirus to permit systemic infection. Journal of General Virology 88:2881-2889. 160. Ito T, Kimbara J, Sharma P, Ikegami M. 2009. Interaction of tomato yellow leaf curl virus with diverse betasatellites enhances symptom severity. Archives of virology 154:1233-1239. 161. Waigmann E, Ueki S, Trutnyeva K, Citovsky V. 2004. The ins and outs of nondestructive cell-to-cell and systemic movement of plant viruses. Critical Reviews in Plant Sciences 23:195-250. 162. Bisaro DM. 1996. DNA Replication in Eukaryofic Cells :30 Geminivirus DNA Replication, In DNA replication in eukaryotic cells, Cold Spring Harbor Laboratory press ed. 163. Fontes EP, Santos AA, Luz DF, Waclawovsky AJ, Chory J. 2004. The geminivirus nuclear shuttle protein is a factor that suppresses transmembrane receptor kinase activity. Genes & development 18:2545-2556. 164. Groning BR, Abouzid A, Jeske H. 1987. Single-stranded DNA from abutilon mosaic virus is present in the plastids of infected Abutilon sellovianum. Proc Natl Acad Sci U S A 84:8996-9000. 165. Bhattacharyya D, Gnanasekaran P, Kumar RK, Kushwaha NK, Sharma VK, Yusuf MA, Chakraborty S. 2015. A geminivirus betasatellite damages the structural and functional integrity of chloroplasts leading to symptom formation and inhibition of photosynthesis. Journal of experimental botany 66:5881-5895. 166. Wei T, Huang T-S, McNeil J, Laliberté J-F, Hong J, Nelson RS, Wang A. 2010. Sequential recruitment of the endoplasmic reticulum and chloroplasts for plant potyvirus replication. Journal of virology 84:799-809. 167. Uhde-Holzem K, Fischer R, Commandeur U. 2007. Genetic stability of recombinant potato virus X virus vectors presenting foreign epitopes. Arch Virol 152:805-811. 168. Batten JS, Yoshinari S, Hemenway C. 2003. Potato virus X: a model system for virus replication, movement and gene expression. Mol Plant Pathol 4:125-131. 169. Huisman MJ, Linthorst HJ, Bol JF, Cornelissen JC. 1988. The complete nucleotide sequence of potato virus X and its homologies at the amino acid level with various plus- stranded RNA viruses. The Journal of general virology 69 ( Pt 8):1789-1798. 170. Fedorkin O, Solovyev A, Yelina N, Zamyatnin A, Jr., Zinovkin R, Makinen K, Schiemann J, Yu Morozov S. 2001. Cell-to-cell movement of potato virus X involves distinct functions of the coat protein. The Journal of general virology 82:449-458. 171. Morozov S, Miroshnichenko NA, Solovyev AG, Fedorkin ON, Zelenina DA, Lukasheva LI, Karasev AV, Dolja VV, Atabekov JG. 1991. Expression strategy of the potato virus X triple gene block. The Journal of general virology 72 ( Pt 8):2039-2042. 172. Soll J, Schleiff E. 2004. Protein import into chloroplasts. Nat Rev Mol Cell Biol 5:198- 208.

163

173. Rochon D, Siegel A. 1984. Chloroplast DNA transcripts are encapsidated by tobacco mosaic virus coat protein. Proceedings of the National Academy of Sciences of the United States of America 81:1719-1723. 174. Hefferon KL, Khalilian H, Xu H, AbouHaidar MG. 1997. Expression of the coat protein of potato virus X from a dicistronic mRNA in transgenic potato plants. The Journal of general virology 78 ( Pt 11):3051-3059. 175. Qiao Y, Li H, Wong S, Fan Z. 2009. Plastocyanin transit peptide interacts with Potato virus X coat protein, while silencing of plastocyanin reduces coat protein accumulation in chloroplasts and symptom severity in host plants. Molecular plant-microbe interactions 22:1523-1534. 176. Schoelz JE, Zaitlin M. 1989. Tobacco mosaic virus RNA enters chloroplasts in vivo. Proceedings of the National Academy of Sciences of the United States of America 86:4496-4500. 177. Xiang Y, Kakani K, Reade R, Hui E, Rochon D. 2006. A 38-amino-acid sequence encompassing the arm domain of the cucumber necrosis virus coat protein functions as a chloroplast transit Peptide in infected plants. Journal of virology 80:7952-7964. 178. Lim HS, Bragg JN, Ganesan U, Ruzin S, Schichnes D, Lee MY, Vaira AM, Ryu KH, Hammond J, Jackson AO. 2009. Subcellular localization of the barley stripe mosaic virus triple gene block proteins. Journal of virology 83:9432-9448. 179. Bedard J, Jarvis P. 2005. Recognition and envelope translocation of chloroplast preproteins. J Exp Bot 56:2287-2320. 180. Erhardt M, Morant M, Ritzenthaler C, Stussi-Garaud C, Guilley H, Richards K, Jonard G, Bouzoubaa S, Gilmer D. 2000. P42 movement protein of Beet necrotic yellow vein virus is targeted by the movement proteins P13 and P15 to punctate bodies associated with plasmodesmata. Mol Plant Microbe Interact 13:520-528. 181. Angell SM, Davies C, Baulcombe DC. 1996. Cell-to-cell movement of potato virus X is associated with a change in the size-exclusion limit of plasmodesmata in trichome cells of Nicotiana clevelandii. Virology 216:197-201. 182. Voinnet O, Rivas S, Mestre P, Baulcombe D. 2003. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. The Plant journal : for cell and molecular biology 33:949-956. 183. Yang Y, Ding B, Baulcombe DC, Verchot J. 2000. Cell-to-cell movement of the 25K protein of potato virus X is regulated by three other viral proteins. Mol Plant Microbe Interact 13:599-605. 184. Lough TJ, Shash K, Xoconostle-Cázares B, Hofstra KR, Beck DL, Balmori E, Forster RLS, Lucas WJ. 1998. Molecular Dissection of the Mechanism by Which Potexvirus Triple Gene Block Proteins Mediate Cell-to-Cell Transport of Infectious RNA. Molecular Plant-Microbe Interactions 11:801-814. 185. Lough TJ, Emerson SJ, Lucas WJ, Forster RL. 2001. Trans-complementation of long- distance movement of White clover mosaic virus triple gene block (TGB) mutants: phloem-associated movement of TGBp1. Virology 288:18-28. 186. Cruz SS, Roberts AG, Prior DA, Chapman S, Oparka KJ. 1998. Cell-to-cell and phloem-mediated transport of potato virus X. The role of virions. Plant Cell 10:495-510. 187. Bolwell GP. 2001. Biochemistry & Molecular Biology of Plants: B.B. Buchanan, W. Gruissem and R.L. Jones (Eds.), American Society of Plant Physiologists. 2000. 1367 pp. ISBN 0-943088-39-9, $100. Phytochemistry 58:185. 188. Ahlquist P. 2006. Parallels among positive-strand RNA viruses, reverse-transcribing viruses and double-stranded RNA viruses. Nature reviews. Microbiology 4:371-382. 164

189. Buck KW. 1999. Replication of tobacco mosaic virus RNA. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 354:613-627. 190. Hwang YT, McCartney AW, Gidda SK, Mullen RT. 2008. Localization of the Carnation Italian ringspot virus replication protein p36 to the mitochondrial outer membrane is mediated by an internal targeting signal and the TOM complex. BMC cell biology 9:54. 191. Salonen A, Ahola T, Kaariainen L. 2005. Viral RNA replication in association with cellular membranes. Current topics in microbiology and immunology 285:139-173. 192. Salonen A, Ahola T, Kääriäinen L. 2005. Viral RNA Replication in Association with Cellular Membranes, p. 139-173. In Marsh M (ed.), Membrane Trafficking in Viral Replication, vol. 285. Springer Berlin Heidelberg. 193. Schaad MC, Jensen PE, Carrington JC. 1997. Formation of plant RNA virus replication complexes on membranes: role of an endoplasmic reticulum-targeted viral protein. The EMBO Journal 16:4049-4059. 194. Carette JE, Stuiver M, Van Lent J, Wellink J, Van Kammen A. 2000. Cowpea Mosaic Virus Infection Induces a Massive Proliferation of Endoplasmic Reticulum but Not Golgi Membranes and Is Dependent on De Novo Membrane Synthesis. Journal of virology 74:6556-6563. 195. Han S, Sanfacon H. 2003. Tomato ringspot virus proteins containing the nucleoside triphosphate binding domain are transmembrane proteins that associate with the endoplasmic reticulum and cofractionate with replication complexes. Journal of virology 77:523-534. 196. Bamunusinghe D, Hemenway CL, Nelson RS, Sanderfoot AA, Ye CM, Silva MA, Payton M, Verchot-Lubicz J. 2009. Analysis of potato virus X replicase and TGBp3 subcellular locations. Virology 393:272-285. 197. Kawakami S, Watanabe Y, Beachy RN. 2004. Tobacco mosaic virus infection spreads cell to cell as intact replication complexes. Proceedings of the National Academy of Sciences of the United States of America 101:6291-6296. 198. Nishikiori M, Dohi K, Mori M, Meshi T, Naito S, Ishikawa M. 2006. Membrane- bound tomato mosaic virus replication proteins participate in RNA synthesis and are associated with host proteins in a pattern distinct from those that are not membrane bound. Journal of virology 80:8459-8468. 199. McCartney AW, Greenwood JS, Fabian MR, White KA, Mullen RT. 2005. Localization of the tomato bushy stunt virus replication protein p33 reveals a peroxisome-to-endoplasmic reticulum sorting pathway. Plant Cell 17:3513-3531. 200. Mochizuki T, Hirai K, Kanda A, Ohnishi J, Ohki T, Tsuda S. 2009. Induction of necrosis via mitochondrial targeting of Melon necrotic spot virus replication protein p29 by its second transmembrane domain. Virology 390:239-249. 201. Prod'homme D, Jakubiec A, Tournier V, Drugeon G, Jupin I. 2003. Targeting of the turnip yellow mosaic virus 66K replication protein to the chloroplast envelope is mediated by the 140K protein. Journal of virology 77:9124-9135. 202. Wei T, Huang TS, McNeil J, Laliberte JF, Hong J, Nelson RS, Wang A. 2010. Sequential recruitment of the endoplasmic reticulum and chloroplasts for plant potyvirus replication. Journal of virology 84:799-809. 203. Laliberte JF, Sanfacon H. 2010. Cellular remodeling during plant virus infection. Annual review of phytopathology 48:69-91.

165

204. Otulak K, Chouda M, Bujarski J, Garbaczewska G. 2015. The evidence of Tobacco rattle virus impact on host plant organelles ultrastructure. Micron (Oxford, England : 1993) 70:7-20. 205. Hefferon KL, Xu J, AbouHaidar MG. 2000. Identification and in vivo expression of a prokaryotic-like ribosome recognition sequence upstream of the coat protein gene of potato virus X. Arch Virol 145:945-956. 206. Arruda AS. 2009. Identification of a chloroplastic "RNA tractor" within the genome of Potato virus X (PVX). Universityof Toronto, Toronto. 207. Gomez G, Pallas V. 2012. Studies on subcellular compartmentalization of plant pathogenic noncoding RNAs give new insights into the intracellular RNA-traffic mechanisms. Plant physiology 159:558-564. 208. Nicolai M, Duprat A, Sormani R, Rodriguez C, Roncato MA, Rolland N, Robaglia C. 2007. Higher plant chloroplasts import the mRNA coding for the eucaryotic translation initiation factor 4E. FEBS letters 581:3921-3926. 209. Cheng SF, Huang YP, Chen LH, Hsu YH, Tsai CH. 2013. Chloroplast phosphoglycerate kinase is involved in the targeting of Bamboo mosaic virus to chloroplasts in Nicotiana benthamiana plants. Plant physiology 163:1598-1608. 210. Kuroda H, Maliga P. 2001. Sequences downstream of the translation initiation codon are important determinants of translation efficiency in chloroplasts. Plant physiology 125:430-436. 211. Hirose T, Sugiura M. 1996. Cis-acting elements and trans-acting factors for accurate translation of chloroplast psbA mRNAs: development of an in vitro translation system from tobacco chloroplasts. The EMBO journal 15:1687-1695. 212. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N. Y. Cold Spring Harbor Laboratory. 213. Tzfira T, Jensen C, Wang W, Zuker A, Vinocur B, Altman A, Vainstein A. 1997. Transgenic Populus tremula: a step-by-step protocol for its Agrobacterium-mediated transformation. Plant Molecular Biology Reporter 15:219-235. 214. Horsch RB, Fry JE, Hoffman NL, Eichholtz D, Rogers SG, Fraley RT. 1985. A simple and general method for transferring genes into plants. Science 227:1229+. 215. AbouHaidar M, Xu H, Hefferon K. 1998. Potexvirus Isolation and RNA Extraction, p. 131-143. In Foster G, Taylor S (ed.), Plant Virology Protocols, vol. 81. Humana Press. 216. Bercks R. 1970. Potato virus X, CMI/AAB Descriptions of Plant Viruses No. 4. 217. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 218. Laemmli UK. 1970. Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4. Nature 227:680-685. 219. Block A, Guo M, Li G, Elowsky C, Clemente TE, Alfano JR. 2010. The Pseudomonas syringae type III effector HopG1 targets mitochondria, alters plant development and suppresses plant innate immunity. Cellular Microbiology 12:318-330. 220. Walker NJ. 2002. Tech.Sight. A technique whose time has come. Science 296:557-559. 221. Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW. 2000. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Anal Biochem 285:194-204. 222. Kopek BG, Perkins G, Miller DJ, Ellisman MH, Ahlquist P. 2007. Three-dimensional analysis of a viral RNA replication complex reveals a virus-induced mini-organelle. PLoS Biol 5:e220.

166

223. Daros JA, Flores R. 2002. A chloroplast protein binds a viroid RNA in vivo and facilitates its hammerhead-mediated self-cleavage. The EMBO journal 21:749-759. 224. Yakhnin AV, Yakhnin H, Babitzke P. 2012. Gel mobility shift assays to detect protein- RNA interactions. Methods in molecular biology (Clifton, N.J.) 905:201-211. 225. Hellman LM, Fried MG. 2007. Electrophoretic mobility shift assay (EMSA) for detecting protein-nucleic acid interactions. Nature protocols 2:1849-1861. 226. Pelle R, Murphy NB. 1993. In vivo UV-cross-linking hybridization: a powerful technique for isolating RNA binding proteins. Application to trypanosome mini-exon derived RNA. Nucleic acids research 21:2453-2458. 227. Luo MJ, Reed R. 2003. Identification of RNA binding proteins by UV cross-linking. Current protocols in molecular biology / edited by Frederick M. Ausubel ... [et al.] Chapter 27:Unit 27.22. 228. Nesvizhskii AI. 2007. Protein identification by tandem mass spectrometry and sequence database searching. Methods in molecular biology (Clifton, N.J.) 367:87-119. 229. Lazarowitz SG, Beachy RN. 1999. Viral movement proteins as probes for intracellular and intercellular trafficking in plants. Plant Cell 11:535-548. 230. Rojas MR, Hagen C, Lucas WJ, Gilbertson RL. 2005. Exploiting chinks in the plant's armor: evolution and emergence of geminiviruses. Annual review of phytopathology 43:361-394. 231. Adams MJ, King AM, Carstens EB. 2013. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses (2013). Arch Virol 158:2023-2030. 232. Fauquet CM, Briddon RW, Brown JK, Moriones E, Stanley J, Zerbini M, Zhou X. 2008. Geminivirus strain demarcation and nomenclature. Arch Virol 153:783-821. 233. Idris AM, Shahid MS, Briddon RW, Khan AJ, Zhu JK, Brown JK. 2011. An unusual alphasatellite associated with monopartite begomoviruses attenuates symptoms and reduces betasatellite accumulation. The Journal of general virology 92:706-717. 234. Selth LA, Randles JW, Rezaian MA. 2004. Host responses to transient expression of individual genes encoded by Tomato leaf curl virus. Mol Plant Microbe Interact 17:27- 33. 235. Sharma P, Ikegami M. 2010. Tomato leaf curl Java virus V2 protein is a determinant of virulence, hypersensitive response and suppression of posttranscriptional gene silencing. Virology 396:85-93. 236. Moffat AS. 1999. Geminiviruses emerge as serious crop threat. Science 286:1835-1835. 237. Varma A, Malathi VG. 2003. Emerging geminivirus problems: A serious threat to crop production. Annals of Applied Biology 142:145-164. 238. Gutierrez C. 1999. Geminivirus DNA replication. Cell Mol Life Sci 56:313-329. 239. Jeske H. 2009. Geminiviruses. Curr Top Microbiol Immunol 331:185-226. 240. Mansoor S, Briddon RW, Zafar Y, Stanley J. 2003. Geminivirus disease complexes: an emerging threat. Trends in plant science 8:128-134. 241. Zhang J, Zhang Y, Du Y, Chen S, Tang H. 2011. Dynamic metabonomic responses of tobacco (Nicotiana tabacum) plants to salt stress. J Proteome Res 10:1904-1914. 242. Sierro N, Battey JN, Ouadi S, Bakaher N, Bovet L, Willig A, Goepfert S, Peitsch MC, Ivanov NV. 2014. The tobacco genome sequence and its comparison with those of tomato and potato. Nat Commun 5:3833. 243. Goodin MM, Zaitlin D, Naidu RA, Lommel SA. 2008. Nicotiana benthamiana: its history and future as a model for plant-pathogen interactions. Mol Plant Microbe Interact 21:1015-1026.

167

244. Gabriels SH, Takken FL, Vossen JH, de Jong CF, Liu Q, Turk SC, Wachowski LK, Peters J, Witsenboer HM, de Wit PJ, Joosten MH. 2006. CDNA-AFLP combined with functional analysis reveals novel genes involved in the hypersensitive response. Mol Plant Microbe Interact 19:567-576. 245. Kanneganti TD, Bai X, Tsai CW, Win J, Meulia T, Goodin M, Kamoun S, Hogenhout SA. 2007. A functional genetic assay for nuclear trafficking in plants. The Plant journal : for cell and molecular biology 50:149-158. 246. Malik PS, Kumar V, Bagewadi B, Mukherjee SK. 2005. Interaction between coat protein and replication initiation protein of Mung bean yellow mosaic India virus might lead to control of viral DNA replication. Virology 337:273-283. 247. Rojas MR, Jiang H, Salati R, Xoconostle-Cazares B, Sudarshana MR, Lucas WJ, Gilbertson RL. 2001. Functional analysis of proteins involved in movement of the monopartite begomovirus, Tomato yellow leaf curl virus. Virology 291:110-125. 248. Saeed M, Zafar Y, Randles JW, Rezaian MA. 2007. A monopartite begomovirus- associated DNA beta satellite substitutes for the DNA B of a bipartite begomovirus to permit systemic infection. The Journal of general virology 88:2881-2889. 249. Sharma P, Gaur RK, Ikegami M. 2011. Subcellular localization of V2 protein of Tomato leaf curl Java virus by using green fluorescent protein and yeast hybrid system. Protoplasma 248:281-288. 250. Sharma P, Ikegami M. 2009. Characterization of signals that dictate nuclear/nucleolar and cytoplasmic shuttling of the capsid protein of Tomato leaf curl Java virus associated with DNA beta satellite. Virus Res 144:145-153. 251. Bisaro DM. 1996. 30 Geminivirus DNA Replication, In DNA replication in eukaryotic cells ed, vol. 31. Cold Spring Harbor Laboratory press. 252. Sanderfoot AA, Lazarowitz SG. 1996. Getting it together in plant virus movement: cooperative interactions between bipartite geminivirus movement proteins. Trends Cell Biol 6:353-358. 253. Zhou Y, Rojas MR, Park MR, Seo YS, Lucas WJ, Gilbertson RL. 2011. Histone H3 interacts and colocalizes with the nuclear shuttle protein and the movement protein of a geminivirus. Journal of virology 85:11821-11832. 254. Carvalho CM, Fontenelle MR, Florentino LH, Santos AA, Zerbini FM, Fontes EP. 2008. A novel nucleocytoplasmic traffic GTPase identified as a functional target of the bipartite geminivirus nuclear shuttle protein. The Plant journal : for cell and molecular biology 55:869-880. 255. Carvalho CM, Machado JP, Zerbini FM, Fontes EP. 2008. NSP-interacting GTPase: A cytosolic protein as cofactor for nuclear shuttle proteins. Plant Signal Behav 3:752- 754. 256. Krenz B, Windeisen V, Wege C, Jeske H, Kleinow T. 2010. A plastid-targeted heat shock cognate 70kDa protein interacts with the Abutilon mosaic virus movement protein. Virology 401:6-17. 257. Krenz B, Jeske H, Kleinow T. 2012. The induction of stromule formation by a plant DNA-virus in epidermal leaf tissues suggests a novel intra- and intercellular macromolecular trafficking route. Frontiers in plant science 3:291. 258. Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19:11-15. 259. Stein VE, Coutts RHA, Buck KW. 1983. Serological Studies on Tomato Golden Mosaic Virus, a Geminivirus. Journal of General Virology 64:2493-2498.

168

260. Swarnalatha P, Mamatha M, Manasa M, Singh RP, Krishnareddy M. 2013. Molecular identification of Ageratum enation virus (AEV) associated with leaf curl disease of tomato(Solanum lycopersicum) in India. Australasian Plant Disease Notes 8:67-71. 261. Tahir M, Amin I, Haider MS, Mansoor S, Briddon RW. 2015. Ageratum enation virus-a begomovirus of weeds with the potential to infect crops. Viruses 7:647-665. 262. Culver JN, Padmanabhan MS. 2007. Virus-induced disease: altering host physiology one interaction at a time. Annual review of phytopathology 45:221-243. 263. Pallas V, Garcia JA. 2011. How do plant viruses induce disease? Interactions and interference with host components. The Journal of general virology 92:2691-2705. 264. Kong LJ, Orozco BM, Roe JL, Nagar S, Ou S, Feiler HS, Durfee T, Miller AB, Gruissem W, Robertson D, Hanley-Bowdoin L. 2000. A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants. EMBO J 19:3485-3495. 265. McGivern DR, Findlay KC, Montague NP, Boulton MI. 2005. An intact RBR-binding motif is not required for infectivity of Maize streak virus in cereals, but is required for invasion of mesophyll cells. The Journal of general virology 86:797-801. 266. Cui X, Tao X, Xie Y, Fauquet CM, Zhou X. 2004. A DNAβ Associated with Tomato Yellow Leaf Curl China Virus Is Required for Symptom Induction. Journal of virology 78:13966-13974. 267. Saeed M, Behjatnia SA, Mansoor S, Zafar Y, Hasnain S, Rezaian MA. 2005. A single complementary-sense transcript of a geminiviral DNA beta satellite is determinant of pathogenicity. Mol Plant Microbe Interact 18:7-14. 268. Saunders K, Norman A, Gucciardo S, Stanley J. 2004. The DNA beta satellite component associated with ageratum yellow vein disease encodes an essential pathogenicity protein (betaC1). Virology 324:37-47. 269. Guo W, Yang X, Xie Y, Cui X, Zhou X. 2009. Tomato yellow leaf curl Thailand virus- [Y72] from Yunnan is a monopartite begomovirus associated with DNAβ. Virus Genes 38:328-333. 270. Amin I, Patil BL, Briddon RW, Mansoor S, Fauquet CM. 2011. A common set of developmental miRNAs are upregulated in Nicotiana benthamiana by diverse begomoviruses. Virol J 8:143. 271. Pandey P, Choudhury NR, Mukherjee SK. 2009. A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector. Virol J 6:152. 272. Vanitharani R, Chellappan P, Pita JS, Fauquet CM. 2004. Differential roles of AC2 and AC4 of cassava geminiviruses in mediating synergism and suppression of posttranscriptional gene silencing. Journal of virology 78:9487-9498. 273. Dogra SC, Eini O, Rezaian MA, Randles JW. 2009. A novel shaggy-like kinase interacts with the Tomato leaf curl virus pathogenicity determinant C4 protein. Plant Mol Biol 71:25-38. 274. Piroux N, Saunders K, Page A, Stanley J. 2007. Geminivirus pathogenicity protein C4 interacts with Arabidopsis thaliana shaggy-related AtSKeta, a component of the brassinosteroid signalling pathway. Virology 362:428-440. 275. Akhtar S, Briddon RW, Mansoor S. 2011. Reactions of Nicotiana species to inoculation with monopartite and bipartite begomoviruses. Virology journal 8:475. 276. Gottula J, Lewis R, Saito S, Fuchs M. 2014. Allopolyploidy and the evolution of plant virus resistance. BMC evolutionary biology 14:149. 169

277. Tsuda S, Kubota K, Kanda A, Ohki T, Meshi T. 2007. Pathogenicity of Pepper mild mottle virus Is Controlled by the RNA Silencing Suppression Activity of Its Replication Protein but Not the Viral Accumulation. Phytopathology 97:412-420. 278. Sanderfoot AA, Ingham DJ, Lazarowitz SG. 1996. A viral movement protein as a nuclear shuttle. The geminivirus BR1 movement protein contains domains essential for interaction with BL1 and nuclear localization. Plant Physiol 110:23-33. 279. Palmer J. 1992. Comparison of Chloroplast and Mitochondrial Genome Evolution in Plants, p. 99-133. In Herrmann R (ed.), Cell Organelles. Springer Vienna. 280. Verma D, Samson NP, Koya V, Daniell H. 2008. A protocol for expression of foreign genes in chloroplasts. Nature protocols 3:739-758. 281. Daniell H, Singh ND, Mason H, Streatfield SJ. 2009. Plant-made vaccine antigens and biopharmaceuticals. Trends in plant science 14:669-679. 282. Floss DM, Falkenburg D, Conrad U. 2007. Production of vaccines and therapeutic antibodies for veterinary applications in transgenic plants: an overview. Transgenic research 16:315-332. 283. Koya V, Moayeri M, Leppla SH, Daniell H. 2005. Plant-based vaccine: mice immunized with chloroplast-derived anthrax protective antigen survive anthrax lethal toxin challenge. Infection and immunity 73:8266-8274. 284. Rochaix JD. 1996. Post-transcriptional regulation of chloroplast gene expression in Chlamydomonas reinhardtii. Plant molecular biology 32:327-341. 285. Sugita M, Sugiura M. 1996. Regulation of gene expression in chloroplasts of higher plants. Plant molecular biology 32:315-326. 286. Danon A. 1997. Translational regulation in the chloroplast. Plant physiology 115:1293- 1298. 287. Bruick RK, Mayfield SP. 1999. Light-activated translation of chloroplast mRNAs. Trends in plant science 4:190-195. 288. Hess WR, Borner T. 1999. Organellar RNA polymerases of higher plants. International review of cytology 190:1-59. 289. Gloser J. 1997. Pessarakli, M. (ed.): Handbook of Photosynthesis. Biologia Plantarum 40:638-639. 290. Tohdoh N, Sugiura M. 1982. The complete nucleotide sequence of 16S ribosomal RNA gene from tobacco chloroplasts. Gene 17:213-218. 291. Kim J, Mullet JE. 1994. Ribosome-binding sites on chloroplast rbcL and psbA mRNAs and light-induced initiation of D1 translation. Plant molecular biology 25:437-448. 292. Gren EJ. 1984. Recognition of messenger RNA during translational initiation in Escherichia coli. Biochimie 66:1-29. 293. Schneider TD, Stormo GD, Gold L, Ehrenfeucht A. 1986. Information content of binding sites on nucleotide sequences. Journal of molecular biology 188:415-431. 294. Van Etten WJ, Janssen GR. 1998. An AUG initiation codon, not codon-anticodon complementarity, is required for the translation of unleadered mRNA in Escherichia coli. Molecular microbiology 27:987-1001. 295. O'Donnell SM, Janssen GR. 2001. The initiation codon affects ribosome binding and translational efficiency in Escherichia coli of cI mRNA with or without the 5' untranslated leader. Journal of bacteriology 183:1277-1283. 296. Shine J, Dalgarno L. 1974. The 3'-terminal sequence of Escherichia coli 16S ribosomal RNA: complementarity to nonsense triplets and ribosome binding sites. Proceedings of the National Academy of Sciences of the United States of America 71:1342-1346.

170

297. Shultzaberger RK, Bucheimer RE, Rudd KE, Schneider TD. 2001. Anatomy of Escherichia coli ribosome binding sites. Journal of molecular biology 313:215-228. 298. Stenstrom CM, Isaksson LA. 2002. Influences on translation initiation and early elongation by the messenger RNA region flanking the initiation codon at the 3' side. Gene 288:1-8. 299. Tats A, Remm M, Tenson T. 2006. Highly expressed proteins have an increased frequency of alanine in the second amino acid position. BMC genomics 7:28. 300. Boni IV, Isaeva DM, Musychenko ML, Tzareva NV. 1991. Ribosome-messenger recognition: mRNA target sites for S1. Nucleic acids research 19:155- 162. 301. Zhang J, Deutscher MP. 1992. A uridine-rich sequence required for translation of prokaryotic mRNA. Proceedings of the National Academy of Sciences of the United States of America 89:2605-2609. 302. Komarova AV, Tchufistova LS, Supina EV, Boni IV. 2002. Protein S1 counteracts the inhibitory effect of the extended Shine-Dalgarno sequence on translation. RNA (New York, N.Y.) 8:1137-1147. 303. Qing G, Xia B, Inouye M. 2003. Enhancement of translation initiation by A/T-rich sequences downstream of the initiation codon in Escherichia coli. Journal of molecular microbiology and biotechnology 6:133-144. 304. Kitakawa M, Isono K. 1982. An amber mutation in the gene rpsA for ribosomal protein S1 in Escherichia coli. Molecular & general genetics : MGG 185:445-447. 305. Sorensen MA, Fricke J, Pedersen S. 1998. Ribosomal protein S1 is required for translation of most, if not all, natural mRNAs in Escherichia coli in vivo. Journal of molecular biology 280:561-569. 306. Hirose T, Sugiura M. 2004. Functional Shine-Dalgarno-like sequences for translational initiation of chloroplast mRNAs. Plant & cell physiology 45:114-117. 307. Plader W, Sugiura M. 2003. The Shine-Dalgarno-like sequence is a negative regulatory element for translation of tobacco chloroplast rps2 mRNA: an additional mechanism for translational control in chloroplasts. The Plant journal : for cell and molecular biology 34:377-382. 308. Yukawa M, Kuroda H, Sugiura M. 2007. A new in vitro translation system for non- radioactive assay from tobacco chloroplasts: effect of pre-mRNA processing on translation in vitro. The Plant journal : for cell and molecular biology 49:367-376. 309. Shinozaki K, Sugiura M. 1982. The nucleotide sequence of the tobacco chloroplast gene for the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase. Gene 20:91- 102. 310. Reinbothe S, Reinbothe C, Heintzen C, Seidenbecher C, Parthier B. 1993. A methyl jasmonate-induced shift in the length of the 5' untranslated region impairs translation of the plastid rbcL transcript in barley. The EMBO journal 12:1505-1512. 311. Allison LA, Simon LD, Maliga P. 1996. Deletion of rpoB reveals a second distinct transcription system in plastids of higher plants. The EMBO journal 15:2802-2809. 312. Ahmad T, Venkataraman S, Hefferon K, AbouHaidar MG. 2014. Viral and chloroplastic signals essential for initiation and efficiency of translation in Agrobacterium tumefaciens. Biochemical and biophysical research communications 452:14-20. 313. Kozak M. 1991. Structural features in eukaryotic mRNAs that modulate the initiation of translation. The Journal of biological chemistry 266:19867-19870.

171

314. Staub JM, Maliga P. 1994. Translation of psbA mRNA is regulated by light via the 5'- untranslated region in tobacco plastids. The Plant journal : for cell and molecular biology 6:547-553. 315. Zou Z, Eibl C, Koop HU. 2003. The stem-loop region of the tobacco psbA 5'UTR is an important determinant of mRNA stability and translation efficiency. Molecular genetics and genomics : MGG 269:340-349. 316. Gallie DR. 1998. A tale of two termini: a functional interaction between the termini of an mRNA is a prerequisite for efficient translation initiation. Gene 216:1-11. 317. Monde RA, Greene JC, Stern DB. 2000. The sequence and secondary structure of the 3'-UTR affect 3'-end maturation, RNA accumulation, and translation in tobacco chloroplasts. Plant molecular biology 44:529-542. 318. Lindahl L, Hinnebusch A. 1992. Diversity of mechanisms in the regulation of translation in prokaryotes and lower eukaryotes. Current opinion in genetics & development 2:720-726. 319. Franch T, Gerdes K. 1996. Programmed cell death in bacteria: translational repression by mRNA end-pairing. Molecular microbiology 21:1049-1060. 320. Rott R, Levy H, Drager RG, Stern DB, Schuster G. 1998. 3'-Processed mRNA is preferentially translated in Chlamydomonas reinhardtii chloroplasts. Molecular and cellular biology 18:4605-4611. 321. Eibl C, Zou Z, Beck a, Kim M, Mullet J, Koop HU. 1999. In vivo analysis of plastid psbA, rbcL and rpl32 UTR elements by chloroplast transformation: tobacco plastid gene expression is controlled by modulation of transcript levels and translation efficiency. The Plant journal : for cell and molecular biology 19:333-345. 322. Katz YS, Danon A. 2002. The 3'-untranslated region of chloroplast psbA mRNA stabilizes binding of regulatory proteins to the leader of the message. The Journal of biological chemistry 277:18665-18669. 323. Dron M, Rahire M, Rochaix JD. 1982. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii. Nucleic acids research 10:7609- 7620. 324. Steege DA, Graves MC, Spremulli LL. 1982. Euglena gracilis chloroplast small subunit rRNA. Sequence and base pairing potential of the 3' terminus, cleavage by colicin E3. The Journal of biological chemistry 257:10430-10439. 325. Maidak BL, Olsen GJ, Larsen N, Overbeek R, McCaughey MJ, Woese CR. 1996. The Ribosomal Database Project (RDP). Nucleic acids research 24:82-85. 326. Lewin A, Jacob D, Freytag B, Appel B. 1998. Gene Expression in Bacteria Directed by Plant-specific Regulatory Sequences. Transgenic Res 7:403-411. 327. Pobjecky N, Rosenberg GH, Dinter-Gottlieb G, Kaufer NF. 1990. Expression of the beta-glucuronidase gene under the control of the CaMV 35s promoter in Schizosaccharomyces pombe. Molecular & general genetics : MGG 220:314-316. 328. Burke C, Yu XB, Marchitelli L, Davis EA, Ackerman S. 1990. Transcription factor IIA of wheat and human function similarly with plant and viral promoters. Nucleic acids research 18:3611-3620. 329. Franzetti B, Carol P, Mache R. 1992. Characterization and RNA-binding properties of a chloroplast S1-like ribosomal protein. The Journal of biological chemistry 267:19075- 19081. 330. Alexander C, Faber N, Klaff P. 1998. Characterization of protein-binding to the spinach chloroplast psbA mRNA 5' untranslated region. Nucleic acids research 26:2265-2272.

172

331. Shteiman-Kotler A, Schuster G. 2000. RNA-binding characteristics of the chloroplast S1-like ribosomal protein CS1. Nucleic acids research 28:3310-3315. 332. Merendino L, Falciatore A, Rochaix J-D. 2003. Expression and RNA binding properties of the chloroplast ribosomal protein S1 from Chlamydomonas reinhardtii. Plant molecular biology 53:371-382. 333. Kozak M. 1983. Comparison of initiation of protein synthesis in procaryotes, eucaryotes, and organelles. Microbiological Reviews 47:1-45. 334. Jobling SA, Gehrke L. 1987. Enhanced translation of chimaeric messenger RNAs containing a plant viral untranslated leader sequence. Nature 325:622-625. 335. Gallie DR, Sleat DE, Watts JW, Turner PC, Wilson TM. 1987. A comparison of eukaryotic viral 5'-leader sequences as enhancers of mRNA expression in vivo. Nucleic acids research 15:8693-8711. 336. Gold L. 1988. Posttranscriptional regulatory mechanisms in Escherichia coli. Annual review of biochemistry 57:199-233. 337. Vimberg V, Tats A, Remm M, Tenson T. 2007. Translation initiation region sequence preferences in Escherichia coli. BMC molecular biology 8:100. 338. Shine J, Dalgarno L. 1974. The 3′-Terminal Sequence of Escherichia coli 16S Ribosomal RNA: Complementarity to Nonsense Triplets and Ribosome Binding Sites. Proceedings of the National Academy of Sciences of the United States of America 71:1342-1346. 339. Brock JE, Paz RL, Cottle P, Janssen GR. 2007. Naturally occurring adenines within mRNA coding sequences affect ribosome binding and expression in Escherichia coli. Journal of bacteriology 189:501-510. 340. Chen H, Bjerknes M, Kumar R, Jay E. 1994. Determination of the optimal aligned spacing between the Shine-Dalgarno sequence and the translation initiation codon of Escherichia coli mRNAs. Nucleic acids research 22:4953-4957. 341. Bonham-Smith PC, Bourque DP. 1989. Translation of chloroplast-encoded mRNA: potential initiation and termination signals. Nucleic acids research 17:2057-2080. 342. Gillham NW, Boynton JE, Hauser CR. 1994. Translational regulation of gene expression in chloroplasts and mitochondria. Annual review of genetics 28:71-93. 343. Höfgen R, Willmitzer L. 1988. Storage of competent cells for Agrobacterium transformation. Nucleic acids research 16:9877. 344. AbouHaidar MG, Xu H, Hefferon KL. 1998. Potexvirus Isolation and RNA Extraction, p. 131-143, vol. 81. 345. Golshani A, Xu J, Kolev V, Abouhaidar MG, Ivanov IG. 2002. Inability of Agrobacterium tumefaciens ribosomes to translate in vivo mRNAs containing non-Shine- Dalgarno translational initiators. Zeitschrift fur Naturforschung. C, Journal of biosciences 57:307-312. 346. Maidak BL, Cole JR, Lilburn TG, Parker CT, Saxman PR, Farris RJ, Garrity GM, Olsen GJ, Schmidt TM, Tiedje JM. 2001. The RDP-II (Ribosomal Database Project). Nucleic acids research 29:173-174. 347. Sugiura M, Hirose T, Sugita M. 1998. Evolution and mechanism of translation in chloroplasts. Annual review of genetics 32:437-459. 348. Raynaud C, Loiselay C, Wostrikoff K, Kuras R, Girard-Bascou J, Wollman F-A, Choquet Y. 2007. Evidence for regulatory function of nucleus-encoded factors on mRNA stabilization and translation in the chloroplast. Proceedings of the National Academy of Sciences 104:9093-9098.

173

349. Wobbe L, Schwarz C, Nickelsen J, Kruse O. 2008. Translational control of photosynthetic gene expression in phototrophic eukaryotes. Physiologia plantarum 133:507-515. 350. Kim J, Mullet J. 1994. Ribosome-binding sites on chloroplastrbcL andpsbA mRNAs and light-induced initiation of D1 translation. Plant molecular biology 25:437-448. 351. Miyagi T, Kapoor S, Sugita M, Sugiura M. 1998. Transcript analysis of the tobacco plastid operon rps2/atpI/H/F/A reveals the existence of a non-consensus type II (NCII) promoter upstream of the atpI coding sequence. Molecular & general genetics : MGG 257:299-307. 352. Baecker JJ, Sneddon JC, Hollingsworth MJ. 2009. Efficient translation in chloroplasts requires element(s) upstream of the putative ribosome binding site from atpI. American journal of botany 96:627-636. 353. Dolja VV, Grama DP, Morozov SY, Atabekov JG. 1987. Potato virus X-related single- and double-stranded RNAs: Characterization and identification of terminal structures. FEBS Letters 214:308-312. 354. Ricciardi RP, Goodman RM, Gottlieb D. 1978. Translation of PVX RNA in vitro by wheat germ I. Characterization of the reaction and product size. Virology 85:310-314. 355. Morozov SY, Miroshnichenko NA, Zelenina DA, Fedorkin ON, Solovijev AG, Lukasheva LI, Atabekov JC. 1990. Expression of RNA transcripts of potato virus X full-length and subgenomic cDNAs. Biochimie 72:677-684. 356. Bendena WG, Abouhaidar M, Mackie GA. 1985. Synthesis in vitro of the coat protein of papaya mosaic virus. Virology 140:257-268. 357. Bendena WG, Bancroft JB, Mackie GA. 1987. Molecular cloning of clover yellow mosaic virus RNA: identification of coat protein coding sequences in vivo and in vitro. Virology 157:276-284. 358. Bendena WG, Mackie GA. 1986. Translational strategies in potexviruses: products encoded by clover yellow mosaic virus, foxtail mosaic virus, and viola mottle virus RNAs in vitro. Virology 153:220-229. 359. White KA, Mackie GA. 1990. Control and expression of 3' open reading frames in clover yellow mosaic virus. Virology 179:576-584. 360. Mackie GA, Bancroft JB. 1986. The longer RNA species in narcissus mosaic virus encodes all viral functions. Virology 153:215-219. 361. Kozak M. 1986. Influences of mRNA secondary structure on initiation by eukaryotic ribosomes. Proceedings of the National Academy of Sciences of the United States of America 83:2850-2854. 362. Kozak M. 1989. Circumstances and mechanisms of inhibition of translation by secondary structure in eucaryotic mRNAs. Molecular and cellular biology 9:5134-5142. 363. Kozak M. 1994. Features in the 5' non-coding sequences of rabbit alpha and beta-globin mRNAs that affect translational efficiency. Journal of molecular biology 235:95-110. 364. Baim SB, Sherman F. 1988. mRNA structures influencing translation in the yeast Saccharomyces cerevisiae. Molecular and cellular biology 8:1591-1601. 365. Futterer J, Hohn T. 1996. Translation in plants--rules and exceptions. Plant molecular biology 32:159-189. 366. Lin CG, Lo SJ. 1992. Evidence for involvement of a ribosomal leaky scanning mechanism in the translation of the hepatitis B virus pol gene from the viral pregenome RNA. Virology 188:342-352.

174

367. Hwang WL, Su TS. 1998. Translational regulation of hepatitis B virus polymerase gene by termination-reinitiation of an upstream minicistron in a length-dependent manner. The Journal of general virology 79 ( Pt 9):2181-2189. 368. Fouillot N, Tlouzeau S, Rossignol JM, Jean-Jean O. 1993. Translation of the hepatitis B virus P gene by ribosomal scanning as an alternative to internal initiation. Journal of virology 67:4886-4895. 369. McCormick CJ, Salim O, Lambden PR, Clarke IN. 2008. Translation termination reinitiation between open reading frame 1 (ORF1) and ORF2 enables capsid expression in a bovine norovirus without the need for production of viral subgenomic RNA. Journal of virology 82:8917-8921. 370. Dhakar K, Gupta V, Rathore M, Gaur R. 2010. Virus resistance and gene silencing in plants infected with begomovirus. Journal of Applied Sciences 10:1787-1791. 371. Aragão FJ, Faria JC. 2009. First transgenic geminivirus-resistant plant in the field. Nature Biotechnology 27:1086-1088. 372. Noris E, Lucioli A, Tavazza R, Caciagli P, Accotto GP, Tavazza M. 2004. Tomato yellow leaf curl Sardinia virus can overcome transgene-mediated RNA silencing of two essential viral genes. Journal of general virology 85:1745-1749. 373. Vanderschuren H, Alder A, Zhang P, Gruissem W. 2009. Dose-dependent RNAi- mediated geminivirus resistance in the tropical root crop cassava. Plant molecular biology 70:265-272. 374. Zrachya A, Kumar PP, Ramakrishnan U, Levy Y, Loyter A, Arazi T, Lapidot M, Gafni Y. 2007. Production of siRNA targeted against TYLCV coat protein transcripts leads to silencing of its expression and resistance to the virus. Transgenic research 16:385-398. 375. Ledere D, AbouHaidar M. 1995. Transgenic tobacco plants expressing a truncated form of the PAMV capsid protein (CP) gene show CP-mediated resistance to potato aucuba mosaic virus. 376. Mansoor S, Briddon RW, Zafar Y, Stanley J. 2003. Geminivirus disease complexes: an emerging threat. Trends in plant science 8:128-134. 377. Turnage MA, Muangsan N, Peele CG, Robertson D. 2002. Geminivirus‐based vectors for gene silencing in Arabidopsis. The Plant Journal 30:107-114. 378. Voinnet O. 2001. RNA silencing as a plant immune system against viruses. TRENDS in Genetics 17:449-459. 379. Chen Y-K, Lohuis D, Goldbach R, Prins M. 2004. High frequency induction of RNA- mediated resistance against Cucumber mosaic virus using inverted repeat constructs. Molecular Breeding 14:215-226. 380. Pandolfini T, Molesini B, Avesani L, Spena A, Polverari A. 2003. Expression of self- complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection. BMC biotechnology 3:7. 381. Wang MB, Abbott DC, Waterhouse PM. 2000. A single copy of a virus‐derived transgene encoding hairpin RNA gives immunity to barley yellow dwarf virus. Molecular plant pathology 1:347-356. 382. Kalantidis K, Psaradakis S, Tabler M, Tsagris M. 2002. The occurrence of CMV- specific short RNAs in transgenic tobacco expressing virus-derived double-stranded RNA is indicative of resistance to the virus. Molecular Plant-Microbe Interactions 15:826-833.

175

383. Smith NA, Singh SP, Wang M-B, Stoutjesdijk PA, Green AG, Waterhouse PM. 2000. Gene expression: total silencing by intron-spliced hairpin RNAs. Nature 407:319- 320. 384. Mette M, Aufsatz W, Van der Winden J, Matzke M, Matzke A. 2000. Transcriptional silencing and promoter methylation triggered by double‐stranded RNA. The EMBO Journal 19:5194-5201. 385. Sijen T, Vijn I, Rebocho A, van Blokland R, Roelofs D, Mol JN, Kooter JM. 2001. Transcriptional and posttranscriptional gene silencing are mechanistically related. Current Biology 11:436-440. 386. Fojtova M, Van Houdt H, Depicker A, Kovarik A. 2003. Epigenetic switch from posttranscriptional to transcriptional silencing is correlated with promoter hypermethylation. Plant Physiology 133:1240-1250. 387. Francki R, Hatta T, Boccardo G, Randles J. 1980. The composition of chloris striate mosaic virus, a geminivirus. Virology 101:233-241. 388. Briddon RW, Stanley J. 2006. Subviral agents associated with plant single-stranded DNA viruses. Virology 344:198-210. 389. Wesley SV, Helliwell CA, Smith NA, Wang M, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA. 2001. Construct design for efficient, effective and high‐ throughput gene silencing in plants. The Plant Journal 27:581-590. 390. Horsch R, Fry J, Hoffmann N, Eichholtz D, Rogers Sa, Fraley R. 1985. A simple and general method for transferring genes into plants. Science 227:1229-1231. 391. Kang T-J, Yang M-S. 2004. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants. BMC biotechnology 4:20. 392. Bisaro DM. 1996. Geminivirus DNA replication, p. 833-854, DNA replication in eukaryotic cells. Cold Spring Harbor Laboratory Press Cold Spring Harbor. 393. Fontes E, Gladfelter HJ, Schaffer RL, Petty I, Hanley-Bowdoin L. 1994. Geminivirus replication origins have a modular organization. The Plant Cell 6:405-416. 394. Lazarowitz SG, Shepherd R. 1992. Geminiviruses: genome structure and gene function. Critical Reviews in Plant Sciences 11:327-349. 395. Argüello-Astorga G, Guevara-Gonzalez R, Herrera-Estrella L, Rivera-Bustamante R. 1994. Geminivirus replication origins have a group-specific organization of iterative elements: a model for replication. Virology 203:90-100.

176