DOCSLIB.ORG

Download (PDF)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Download (PDF) Kubo et al./Breeding Science doi:10.1270/jsbbs.18126 Supplemental Table 1. Detailed list of B. rapa samples used in this study Type Cultivar or line namea Note Source Japanese nabana, "flower-bud type" Cultivar CR Hanakanzashi Hybrid CR cultivarb Marutane Seed Co., Ltd., Kyoto, Japan CR Hanamatsuri Hybrid CR cultivarb Marutane Seed Co., Ltd., Kyoto, Japan CR Hananomai Hybrid CR cultivarb Marutane Seed Co., Ltd., Kyoto, Japan CR Kyobare Hybrid CR cultivarb Marutane Seed Co., Ltd., Kyoto, Japan CR Kyonoharu Hybrid CR cultivarb Marutane Seed Co., Ltd., Kyoto, Japan Eika Hybrid CR cultivarb Sakata Seed Corporation, Yokohama, Japan Hanamusume Hybrid CR cultivarb Sakata Seed Corporation, Yokohama, Japan Shunka Hybrid CR cultivarb Nihon Nousan Shubyo Co., Ltd., Minowa, Nagano, Japan Shunrai Hybrid CR cultivarb Sakata Seed Corporation, Yokohama, Japan 88 go no. 20 Hybrid cultivar Sakata Seed Corporation, Yokohama, Japan Hanaguruma Hybrid cultivar Marutane Seed Co., Ltd., Kyoto, Japan Hanakazari Hybrid cultivar Sakata Seed Corporation, Yokohama, Japan Kanzaki 21 go Hybrid cultivar Sakata Seed Corporation, Yokohama, Japan Shuka Hybrid cultivar Takii & Co., Ltd., Kyoto, Japan Soyo 1 go Hybrid cultivar Sakata Seed Corporation, Yokohama, Japan Toka Hybrid cultivar Takii & Co., Ltd., Kyoto, Japan Ezuki Non-hybrid cultivar Sakata Seed Corporation, Yokohama, Japan Kaneki hanana Non-hybrid cultivar Sakata Seed Corporation, Yokohama, Japan Kanzaki natane Non-hybrid cultivar Taniguchi Hikobe Shouten, Ohtsu, Japan (JP25960) c Kurokawa kanzaki Non-hybrid cultivar Takii & Co., Ltd., Kyoto, Japan Kyoto Fushimi kanzaki Non-hybrid cultivar Takii & Co., Ltd., Kyoto, Japan Nabana (kanzaki hanana) Non-hybrid cultivar Tohoku Seed Co., Ltd., Utsunomiya, Japan Shokuyo nanohana Non-hybrid cultivar Takii & Co., Ltd., Kyoto, Japan Shunyo Non-hybrid cultivar Sakata Seed Corporation, Yokohama, Japan Soshun nabana Non-hybrid cultivar Sakata Seed Corporation, Yokohama, Japan Landrace Awa zairai Landrace in Chiba Prefecture Warm Region Horticulture Institute, Chiba Prefectural Agriculture and Forestry Research Center, Tateyama, Japan Nagaokakyo Landrace in Nagaokakyo, Kyoto Supplied by an anonymous, nabana farmer Prefecture Japanese nabana, "stem-and-leaf type" Cultivar Fukitachina (kasamai-kei) Non-hybrid cultivar Matsushita Seed Co., Kanazawa, Japan Himeji wakana Non-hybrid cultivar Sanyo Seed Co., Ltd., Himeji, Japan Kukitachina Non-hybrid cultivar Tohoku Seed Co., Ltd., Utsunomiya, Japan Nagaokana Non-hybrid cultivar Komesan Corporation, Nagaoka, Japan Orina Non-hybrid cultivar Ogura Jutaro Shouten, Sakata, Japan (JP25938)c Wakana Non-hybrid cultivar Osaka Sosai Genshu Kenkyukai, Habikino, Japan Wakana (kurona) Non-hybrid cultivar Takada Seed Co., Ltd., Osaka, Japan (JP25969)c Landrace Fukidachi (kukidachi) Landrace in Nango, Hachinohe, Hachinohe Agriculture Improvement Extension Center, Aomori Prefecture Hachinohe, Japan (JP25936)a Katsuyama mizuna 1 go Landrace in Fukui Prefecture Fukui Agricultural Experiment Station, Fukui, Japan (JP25937)c Natane G Landrace in Kamitakano, Kyoto, Biotechnology Research Department, Kyoto Prefectural Kyoto Prefecture Agriculture, Forestry and Fisheries Technology Center, Soraku-gun, Japan Orina (fukitachi) Landrace in Toyama Prefecture Kurobe Agriculture Improvement Extension Center, Kurobe, Japan (JP25940)c Sangatsuna Landrace in Kitakuwada, Nantan, Mr. H. Shimoizu, Nantan, Japan (JP25972)c Kyoto Prefecture Chinese flowering cabbage, "zicaitai" (subsp. chinensis var. purpuraria ) Hon tsai tai Non-hybrid cultivar Sakata Seed Corporation, Yokohama, Japan Kosaitai Non-hybrid cultivar Tohoku Seed Co., Ltd., Utsunomiya, Japan Kosaitai (beni nabana) Non-hybrid cultivar Takii & Co., Ltd., Kyoto, Japan Chinese flowering cabbage, "cai-xin", "caitai" or "choy sum" (subsp. chinensis var. parachinensis ) Wasekei saishin Non-hybrid cultivar Takii & Co., Ltd., Kyoto, Japan European flowering cabbage, "broccoletto", "broccoli raab" or "rapini" (subsp. sylvestris var. esculenta ) Cima di rapa Non-hybrid cultivar Fujita Seed Co., Ltd., Osaka, Japan Neep greens (var. oleifera ) Shiroguki hatakena Non-hybrid cultivar Takii & Co., Ltd., Kyoto, Japan Turnip (subsp. rapa ) CR Omasa Hybrid CR cultivarb Musashino Seed Co., Ltd., Tokyo, Japan Golden ball Non-hybrid cultivar Catros Gerand SAS, Carbon Blanc, France Non-heading Chinese cabbage, "Pak choi" (subsp. chinensis ) Pak choi Non-hybrid cultivar Takii & Co., Ltd., Kyoto, Japan Non-heading Chinese cabbage, "tatsoi" or "wutacai" (subsp. narinosa ) Taasai Non-hybrid cultivar Takii & Co., Ltd., Kyoto, Japan Heading Chinese cabbage (subsp. pekinensis ) Muso Hybrid cultivar Takii & Co., Ltd., Kyoto, Japan a Cultivars are sorted according to their categories (CR/non-CR and hybrid/non-hybrid). b CR: clubroot resistant. c Seeds stocked at Genetic Resources Center, National Agriculture and Food Research Organization, Tsukuba, Japan (accession nos. in perentheses). Supplemental Table 2. List of B. rapa SSR markers analyzed Allelic range SSR name Primer sequence (5'-to-3') A a A b observed (bp) R BRMS-033 Forward: gcggaaacgaacactcctcccatgt 217-360 12 6.740 Reverse: cctccttgtgctttccctggagacg BRMS-085 Forward: actccacactctcacttcctctatt 153-378 8 3.651 Reverse: ttacgcttgtttctgtttttgaata BRMS-158 Forward: aaaagacaaaaccatccaaacacta 207-240 17 7.995 Reverse: aagcctttttgaacttctctgtgat BRMS-194 Forward: gatggtggtgagtttataagctctg 177-193 5 3.279 Reverse: cttcaaagcacttctccttcctctc BRMS-208 Forward: ctctctctatcgtcttctcagatgg 220-238 3 2.915 Reverse: gtttaagcctcttctgaaacctctc BRMS-220 Forward: cctgaatgttttaggagtgtacttc 116-126 5 3.264 Reverse: ttgcttcagaaggaaggtcaggaga BRMS-253 Forward: ggactactctttgaagcgatacttg 235-258 9 4.850 Reverse: aatagaatcacaatgcactgaaaca BRMS-269 Forward: aattttcaacgccttcatcctgt 286-313 11 5.639 Reverse: ggtgaatgcatcagtcgacataact a Number of alleles per locus. b Allelic richness based on minimum sample size of 13 individuals. Supplemental Table 3. Assumption of suitable number of subpopulations (K ) for population structure analysis LnP (K )b K a Ln' (K )c |Ln'' (K )|d K e Mean S.D. 1 -20189.020000 0.042164 N.A.f N.A.f N.A.f 2 -18298.563636 0.756667 1890.456364 1104.072727 1459.125665g 3 -17512.180000 1180.673361 786.383636 240.936364 0.204067 4 -16484.860000 69.520136 1027.320000 566.220000 8.144691 5 -16023.760000 237.234461 461.100000 225.730000 0.951506 6 -15336.930000 185.765001 686.830000 357.380000 1.923828 7 -15007.480000 344.935681 329.450000 N.A.f N.A.f a K : number of subpopulation. b LnP (K ): mean and standard deviation (S.D.) of likelihood over 10 runs for each K . c Ln' (K ): mean difference between successive likelihood values of K . d |Ln'' (K )|: absolute value of the difference between successive values of Ln' (K ). e K : mean of |Ln'' (K )| over 10 runs divided by S.D. of LnP (K ). K = Mean(|L'' (K )|)/S.D.(LnP (K )) f N.A.: not analyzed. g The maximum value of K at K = 2 is indicated with red text. Supplemental Table 4. Genotypes of six clubroot resisitance (CR) markers in CR and non-CR B. rapa lines Resistance locus and markerb CRb Crr1 Crr2 Crr3 Linea B1210c KB59N06c BSA7c B359c 523A1Rc OPC11-2Sd CR Shinki (CRb ) 187/211 265/270 357 228/235 162 0.9 Control CR linea G004 (Crr1, Crr2 ) 211 262 332 149 140 0.9 N-WMR-3 (Crr3 ) Nulle 224 332f 149f 162 1.2 Non-CR nabana Hanakazari 211 251/257 357 227/228, 228 162 0.9 cultivar CR Hanakanzashi 187 241/270 332/357 149/228 162 0.9 CR Hanamatsuri 187 228/270 332/357 149/228 162 0.9 240/270, 332, CR Hananomai 187 257/270, 149/228 162 0.9 332/357 270 CR Kyobare 187 270 332 149/228 162 0.9 234/270, CR Kyonoharu 187 332/357 149/228 162 0.9 241/270 CR nabana Eika 187 257/270 332/357 149/228 162 0.9 cultivar 226/270, Kanzaki 21 go 187 332 149/228 162 0.9 270 234/270, Shunka 187 332/357 149/228 162 0.9 241/270 187, 241/270, Shunrai 332/357 149/228 162 0.9 187/211 268/270 227/228, 140/162, Hanamusume 187 257/272 357 0.9, nulle 228 161/162 a Resistance gene(s) contained in each control line are indicated in parentheses. b Alleles detected in each line are indicated with band sizes, in which homozygote and heterozygote are represented with single and dual (two numbers connected with slashes) numbers, respectively. All detected alleles are listed up when more than one kind of allele was detected. Resistance allele is indicated with red text. c Band sizes (bp) were analyzed on a DNA sequencer, whose sizes were larger than those in references (Suwabe et al . 2006, Kato et al . 2013, Matsumoto et al . 2017) because of tag sequences for a post-labeling (Shimizu and Yano 2011). d Approximate band sizes (kb) were estimated in a 1.5% agarose gel. e Null allele, no PCR product was detectable. f Because the CR trait of N-WMR-3 was independent of Crr1 and Crr2 (Hirai et al . 2004), this allele is likely to have occurred accidentally..
Load more

Recommended publications
  • Disease Resistance Enhancer for Plants and Method of Controlling Plant Disease by Using the Same
    (19) & (11) EP 2 241 186 A1 (12) EUROPEAN PATENT APPLICATION published in accordance with Art. 153(4) EPC (43) Date of publication: (51) Int Cl.: 20.10.2010 Bulletin 2010/42 A01N 63/02 (2006.01) A01N 59/16 (2006.01) A01N 59/20 (2006.01) A01P 3/00 (2006.01) (21) Application number: 09700633.2 (86) International application number: (22) Date of filing: 09.01.2009 PCT/JP2009/050216 (87) International publication number: WO 2009/088074 (16.07.2009 Gazette 2009/29) (84) Designated Contracting States: • TAKEDA, Taito AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Kawasaki-shi HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL Kanagawa 210-8681 (JP) PT RO SE SI SK TR • ISHIZAKI, Takashi Designated Extension States: Kawasaki-shi AL BA RS Kanagawa 210-8681 (JP) • TOTSUKA, Kazuhiko (30) Priority: 11.01.2008 JP 2008004833 Kawasaki-shi 29.08.2008 JP 2008221563 Kanagawa 210-8681 (JP) (71) Applicant: Ajinomoto Co., Inc. (74) Representative: HOFFMANN EITLE Tokyo 104-8315 (JP) Patent- und Rechtsanwälte Arabellastrasse 4 (72) Inventors: 81925 München (DE) • IGARASHI, Daisuke Kawasaki-shi Kanagawa 210-8681 (JP) (54) DISEASE RESISTANCE ENHANCER FOR PLANTS AND METHOD OF CONTROLLING PLANT DISEASE BY USING THE SAME (57) Infection of pathogens is controlled by inducing with a disease resistance enhancer comprising an acidic disease resistance with the method of treating a plant heat-treated solution of a microorganism. EP 2 241 186 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 241 186 A1 Description Technical Field 5 [0001] The present invention relates to a disease resistance enhancer for plants produced by using a microorganism as a raw material, which is environmentally friendly and is safe for users and consumers.
    [Show full text]
  • Complete Mitochondrial Genome Sequences of Brassica Rapa (Chinese Cabbage and Mizuna), and Intraspecific Differentiation of Cytoplasm in B
    Breeding Science 67: 357–362 (2017) doi:10.1270/jsbbs.17023 Research Paper Complete mitochondrial genome sequences of Brassica rapa (Chinese cabbage and mizuna), and intraspecific differentiation of cytoplasm in B. rapa and Brassica juncea Saki Hatono1), Kaori Nishimura2), Yoko Murakami2), Mai Tsujimura3) and Hiroshi Yamagishi*2) 1) Graduate School of Life Sciences, Kyoto Sangyo University, Kamigamo, Motoyama, Kita, Kyoto 603­8555, Japan 2) Faculty of Life Sciences, Kyoto Sangyo University, Kamigamo, Motoyama, Kita, Kyoto 603­8555, Japan 3) Plant Organelle Genome Research Center, Kyoto Sangyo University, Kamigamo, Motoyama, Kita, Kyoto 603­8555, Japan The complete sequence of the mitochondrial genome was determined for two cultivars of Brassica rapa. After determining the sequence of a Chinese cabbage variety, ‘Oushou hakusai’, the sequence of a mizuna variety, ‘Chusei shiroguki sensuji kyomizuna’, was mapped against the sequence of Chinese cabbage. The precise sequences where the two varieties demonstrated variation were ascertained by direct sequencing. It was found that the mitochondrial genomes of the two varieties are identical over 219,775 bp, with a single nucleotide polymorphism (SNP) between the genomes. Because B. rapa is the maternal species of an amphidiploid crop species, Brassica juncea, the distribution of the SNP was observed both in B. rapa and B. juncea. While the mizuna type SNP was restricted mainly to cultivars of mizuna (japonica group) in B. rapa, the mizuna type was widely distributed in B. juncea. The finding that the two Brassica species have these SNP types in com­ mon suggests that the nucleotide substitution occurred in wild B. rapa before both mitotypes were domesticat­ ed.
    [Show full text]
  • Aiavitality.Com.Sg
    In partnership with: AIAVitality.com.sg 1 The healthy choices you make today will make a difference tomorrow. Your journey to eating healthy starts from smart choices at the supermarket. As an AIA Vitality member, you can make healthy eating simple with the HealthyFoodTM range at Cold Storage. With more than 6,000 HealthyFoodTM items including fresh fruits and vegetables, great sources of carbohydrates, proteins, and so much more, it’s easy to choose food that’s as nutritious as they are delicious the next time you shop for groceries. To sweeten the deal, enjoy up to 25% cashback and earn up to 400 AIA Vitality Points on your HealthyFoodTM purchases each month. Your journey towards better health begins with AIA Vitality. Cold Storage is one of the premier players in food retailing in Singapore, operating 48 supermarkets across the island. HealthyFoodTM items are subject to updates and changes periodically and are subject to availability at Cold Storage supermarkets. 2 FOOD INDEX Carbohydrates Breads 4 Cereals 4 Crackers 4 Pasta and Noodles 4 Porridge 5 Rice 5 Wholegrain and Fibre 6 Other Starchy Foods 6 Dairy Fat Free Milk 8 Fat Free Yoghurt 8 Soy Milk 8 Fruits Dried Fruits 10 Fresh Fruits 13 Frozen Fruits 43 Tinned Fruits 43 Legumes Dried Legumes 45 Tinned and Bottled Legumes 46 Nuts, Seeds, Oils and Spreads Avocado Oil 48 Canola Oil 48 Canola Oil Spread 48 Nuts 48 Olive Oil 49 Olive Oil Sprays 51 Olive Oil Spread 51 Peanut and Nut Butter 51 Seeds 51 Proteins Chicken (Skinless) 53 Eggs 53 Lean Meats 54 Seafood and Fish 54 Tinned Fish 62 Tofu 64 Vegetables Dried Vegetables 66 Fresh Vegetables 66 Frozen Vegetables 95 Herbs 95 Tinned Vegetables 99 3 Carbohydrates The right type of carbohydrates help to improve your energy levels and ability to perform everyday tasks.
    [Show full text]
  • Your Source for Asian Vegetable Seeds for 104 Years
    $6.00 U.S./Catalog S I N C E 1 9 1 7 Your Source for Asian Vegetable Seeds for 104 Years ORDER # 541 MOMOTARO GOLD HYBRID ONLINE kitazawaseed.com 201 4th Street, #206 Oakland, CA 94607 NON-GMO ph: 510/595-1188 fx: 510/595-1860 K D MORE VARIETIES I T E A E [email protected] kitazawaseed.com ZAWA S ©2021 Kitazawa Seed Company ONLINE S I N C E 1 9 1 7 What's NEW in 2021 As we head into another year of contending We love hearing from our customers, with the COVID-19 global pandemic, we and we are continuing to add varieties know it is vitally important to our customers based on your requests. This year we that we keep our doors open. In response, are very excited to add 51 new varieties we have increased safety measures to celebrating Mexican and Chinese cuisine protect both our staff and our customers. vegetables which expand pepper (chiles) and Like many businesses, this has impacted pak choi options. Customers will be happy to our daily operations. To help us continue to know that we are finally bringing back Romano best serve you, we ask that you place your beans! Our cover vegetable this year is Momotaro order online. Online ordering is the fastest Gold, a spectacular Japanese orange tomato. Momotaro and most secure method of ordering, provides tracking, Gold is perfect for slicing on a sandwich and would also and ensures that your order gets shipped as quickly as make a stunning pico de gallo.
    [Show full text]
  • Brassica Rapa) Cultivars and Landraces Based on Simple Sequence Repeat Markers
    Breeding Science Preview This article is an Advance Online Publication of the authors’ corrected proof. doi:10.1270/jsbbs.18126 Note that minor changes may be made before final version publication. Note Classification of “nabana” (Brassica rapa) cultivars and landraces based on simple sequence repeat markers Nakao Kubo*1,2), Kumiko Onnazaka3,4), Shinji Mizuno5,6) and Gento Tsuji1) 1) Graduate School of Life and Environmental Sciences, Kyoto Prefectural University, 1-5 Hangi-cho, Shimogamo, Sakyo-ku, Kyoto 606-8522, Japan 2) Biotechnology Research Department, Kyoto Prefectural Agriculture, Forestry and Fisheries Technology Center, 74 Oji, Kitainayazuma, Seika-cho, Soraku-gun, Kyoto 619-0244, Japan 3) Kyoto Prefectural Kyoto Otokuni Agriculture Improvement Extension Center, 15 Tokudaiji Dangoden-cho, Nishikyogoku, Ukyo-ku, Kyoto 615-0846, Japan 4) Present address: Kyoto Prefectural Nantan Agriculture Improvement Extension Center, 21 Fujinoki, Oyama Higashi-machi, Sonobe- cho, Nantan, Kyoto 622-0041, Japan 5) Warm Region Horticulture Institute, Chiba Prefectural Agriculture and Forestry Research Center, 1762 Yamamoto, Tateyama, Chiba 294-0014, Japan 6) Present address: College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-0880, Japan Brassica rapa or B. napus vegetables for eating as young inflorescences and stalks are called “nabana”. Japanese nabana includes “flower-bud type” and “stem-and-leaf type”. Chinese and European types are also known (cai-xin, zicaitai, and broccoletto). We classified nabana belonging toB. rapa and other B. rapa vegeta- bles. In a simple sequence repeat-based phylogram, 49 ingroup samples were classified into four groups (I– IV). Flower-bud and stem-and-leaf types were separated into groups I and III, respectively, with a slight over- lap in group II.
    [Show full text]
  • Commodities Covered by PACA (Pdf)
    COMMODITIES SUBJECT UNDER THE PERISHABLE AGRICULTURAL COMMODITIES ACT (PACA) The PACA covers fresh and frozen fruits and vegetables. The legal authority for determining what is covered under PACA can be found in the statute at 7 U.S.C. 499a(4) and in the PACA Requirements at 7 C.F.R. 46.2(u). The following list is being provided in response to numerous requests from our customers for information about what types of items are covered by the PACA. The commodities listed below are covered when they are fresh or frozen (not dry, canned, or cooked). Please note that it is likely that there are additional items not included on this list that are nevertheless covered by the PACA. Given the international scope of today's produce industry there are undoubtedly some items that have inadvertently been left off this list, but that omission should not be interpreted to mean that the item is not covered. If you have a question about an item not on this list, please call the PACA Division at 800-495-7222, Option 2. A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A ABIU ACAI ACEROLA (aka Barbados Cherry) ACHACHA ACKEE (AKEE) ALOE AMARANTH AMBARELLA AMLA (aka Indian Gooseberry) ANGELICA ANISE LEAF APAZ ONION APPLE APPLE PEAR APRICOT APRIUM ARRACACHA ROOT (aka Apio) ARRAYAN FRUIT ARROWHEAD ARROWROOT ARTICHOKE ARUGULA (aka Rocket, Roquette) ASIAN PEAR (aka Nashi Pear) ASPARAGUS ATEMOYA AVOCADO (aka Alligator Pear) B BABACO BALSAM APPLE BAMBOO SHOOT BANANA BANANA STEM BAOBAB FRUIT BASIL BATATA BAY LEAF BAYBERRY BEACH SUGAR APPLE BEAN, GREEN (aka French
    [Show full text]
  • Complete Mitochondrial Genome Sequences of Brassica Rapa (Chinese Cabbage and Mizuna), and Intraspecific Differentiation of Cytoplasm in B
    Breeding Science Preview This article is an Advance Online Publication of the authors’ corrected proof. doi:10.1270/jsbbs.17023 Note that minor changes may be made before final version publication. Research Paper Complete mitochondrial genome sequences of Brassica rapa (Chinese cabbage and mizuna), and intraspecific differentiation of cytoplasm in B. rapa and Brassica juncea Saki Hatono1), Kaori Nishimura2), Yoko Murakami2), Mai Tsujimura3) and Hiroshi Yamagishi*2) 1) Graduate School of Life Sciences, Kyoto Sangyo University, Kamigamo, Motoyama, Kita, Kyoto 603­8555, Japan 2) Faculty of Life Sciences, Kyoto Sangyo University, Kamigamo, Motoyama, Kita, Kyoto 603­8555, Japan 3) Plant Organelle Genome Research Center, Kyoto Sangyo University, Kamigamo, Motoyama, Kita, Kyoto 603­8555, Japan The complete sequence of the mitochondrial genome was determined for two cultivars of Brassica rapa. After determining the sequence of a Chinese cabbage variety, ‘Oushou hakusai’, the sequence of a mizuna variety, ‘Chusei shiroguki sensuji kyomizuna’, was mapped against the sequence of Chinese cabbage. The precise sequences where the two varieties demonstrated variation were ascertained by direct sequencing. It was found that the mitochondrial genomes of the two varieties are identical over 219,775 bp, with a single nucleotide polymorphism (SNP) between the genomes. Because B. rapa is the maternal species of an amphidiploid crop species, Brassica juncea, the distribution of the SNP was observed both in B. rapa and B. juncea. While the mizuna type SNP was restricted mainly to cultivars of mizuna (japonica group) in B. rapa, the mizuna type was widely distributed in B. juncea. The finding that the two Brassica species have these SNP types in com­ mon suggests that the nucleotide substitution occurred in wild B.
    [Show full text]
  • Classification of “Nabana” (Brassica Rapa) Cultivars and Landraces Based on Simple Sequence Repeat Markers
    Breeding Science 69: 179–185 (2019) doi:10.1270/jsbbs.18126 Note Classification of “nabana” (Brassica rapa) cultivars and landraces based on simple sequence repeat markers Nakao Kubo*1,2), Kumiko Onnazaka3,4), Shinji Mizuno5,6) and Gento Tsuji1) 1) Graduate School of Life and Environmental Sciences, Kyoto Prefectural University, 1-5 Hangi-cho, Shimogamo, Sakyo-ku, Kyoto 606-8522, Japan 2) Biotechnology Research Department, Kyoto Prefectural Agriculture, Forestry and Fisheries Technology Center, 74 Oji, Kitainayazuma, Seika-cho, Soraku-gun, Kyoto 619-0244, Japan 3) Kyoto Prefectural Kyoto Otokuni Agriculture Improvement Extension Center, 15 Tokudaiji Dangoden-cho, Nishikyogoku, Ukyo-ku, Kyoto 615-0846, Japan 4) Present address: Kyoto Prefectural Nantan Agriculture Improvement Extension Center, 21 Fujinoki, Oyama Higashi-machi, Sonobe- cho, Nantan, Kyoto 622-0041, Japan 5) Warm Region Horticulture Institute, Chiba Prefectural Agriculture and Forestry Research Center, 1762 Yamamoto, Tateyama, Chiba 294-0014, Japan 6) Present address: College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa, Kanagawa 252-0880, Japan Brassica rapa or B. napus vegetables for eating as young inflorescences and stalks are called “nabana”. Japanese nabana includes “flower-bud type” and “stem-and-leaf type”. Chinese and European types are also known (cai-xin, zicaitai, and broccoletto). We classified nabana belonging toB. rapa and other B. rapa vegeta- bles. In a simple sequence repeat-based phylogram, 49 ingroup samples were classified into four groups (I– IV). Flower-bud and stem-and-leaf types were separated into groups I and III, respectively, with a slight over- lap in group II. Cai-xin and non-heading Chinese cabbages were included in group IV.
    [Show full text]
  • Cruciferae Newsletter
    Cruciferae Newsletter July 2018 – vol. n°37 1 Acknowledgements The current issue of the Cruciferae Newsletter (vol. 37) is published online from the Brassica website (http://www.brassica.info/info/publications/cruciferae-newsletter.php). The present issue contains 6 contributions in three different topics: Agronomy and variety trial; Breeding strategies and General information on Brassica. Members of the editing board would like to acknowledge the authors for the quality of their contributions. For future issues, we would be gratefull if all the authors could read and follow carefully the author recommendations before submitting their manuscript, in order to facilitate the editing process. In particular, it is necessary to mention one of the listed topics that is the most relevant to the presented work (see the list at the end of the present issue). Dr. Nathalie NESI on behalf of the editing group Contact: UMR 1349 INRA-Agrocampus Ouest-Univ. Rennes1 Institute for Genetics, Environment and Plant Protection BP 35327, 35653 Le Rheu cedex, France http://www6.rennes.inra.fr/igepp_eng/ email: [email protected] (NEW EMAIL ADDRESS) 2 AGRONOMY AND VARIETY TRIALS VARIABILITY OF SOME PRODUCTIVITY TRAITS UNDER THE CONDITION OF DIFFERENT DENSITY OF SOWING AT THE FALSE FLAX (Camelina sativa L. Crantz) Yakovleva-Nosar’ Svetlana*, Lyakh Viktor Department of landscape industry and genetics, Biological Faculty Zaporizhzhia National University, Zaporizhzhia, Ukraine *Corresponding author: [email protected] Abstract The relationship between the density of standing and the width of the rows, on the one hand, and, on the other hand, the variability in the number of fruits on the plant and the mass of 1000 pieces of seeds are analyzed of the three varieties of the spring-sowings false flax.
    [Show full text]
  • Introduction Abstract
    Glycative Stress Research Online edition : ISSN 2188-3610 Print edition : ISSN 2188-3602 Received : December 9, 2014 Accepted : January 11, 2015 Published online : March 31, 2015 Original article Antiglycation effect of various vegetables: Inhibition of advanced glycation end product formation in glucose and human serum albumin reaction system Yoshika Ishioka, Masayuki Yagi, Mari Ogura, Yoshikazu Yonei Anti-Aging Medical Research Center and Glycation Stress Research Center, Graduate School of Life and Medical Sciences, Doshisha University, Kyoto, Japan Abstract Purpose: We investigated the antiglycation effect of various commercial vegetables comparatively in an in vitro glycation reaction model using various commercial vegetables in dried, powdered form. Method: We studied 187 commercial vegetables using aminoguanidine (AG) as a positive control. Using glucose/human serum albumin (HSA) as an in vitro glycation reaction model, 8 mg/mL HSA and 0.2 mol/L glucose were brought to reaction in a phosphate buffer solution at 60°C for 40 hours, and formation of advanced glycation end products (AGEs) was measured quantitatively with an excitation wavelength of 370 nm at a fluorescence wavelength of 440 nm. Various experimental materials were added to the model, and the 50% inhibitory concentration (IC50) for AGE formation at such time was calculated. Results: The results for antiglycation activity measured for 187 vegetable samples produced IC50 values for inhibition of fluorescent AGE formation equivalent to or higher than that of AG (0.067-0.100 mg/mL) in the following samples: Chestnut, outer skin (Castanea crenata) 0.015 mg/mL; water chestnut, seed coat (Trapa japonica) 0.017 mg/mL; chestnut, soft layer 0.030 mg/mL; nalta jute (Corchorus olitorius) 0.040 mg/mL; new ginger (Zingiber officinale) 0.054 mg/mL; rosemary (Rosmarinus officinalis) 0.059 mg/mL; mugwort, powder (Artemisia indica) 0.070 mg/mL; lady’s thumb (Polygonum hydropiper) 0.072 mg/mL; red leaf lettuce (Lactuca sativa) 0.075 mg/mL; rice eggplant, peel (Solanum melongena) 0.081 mg/mL.
    [Show full text]
  • Introduction Abstract
    Glycative Stress Research Online edition : ISSN 2188-3610 Print edition : ISSN 2188-3602 Received : December 10, 2014 Accepted : January 18, 2015 Published online : June 30, 2015 Original article Polyphenol content of various vegetables: Relationship to antiglycation activity Yoshika Ishioka, Masayuki Yagi, Mari Ogura, Yoshikazu Yonei Anti-Aging Medical Research Center and Glycation Stress Research Center, Graduate School of Life and Medical Sciences, Doshisha University, Kyoto, Japan Abstract Purpose: Using various commercial vegetables in dried, powdered form, we investigated polyphenol content comparatively and in relation to antiglycation activity as reported previously. Method: Using the same 187 commercial vegetables studied in a previous report, we produced dried, powdered samples and measured their polyphenol content by the Folin-Ciocalteu (FC) method. The results were calculated as catechin equivalents (mg catechin Eq) using (+)-catechin as a standard substance. The relationship of the results to inhibition of fluorescent advanced glycation end product (AGE) formation (as reported previously) was then analyzed in an in vitro glucose/human serum albumin (HSA) glycation model. Results: In decreasing order, polyphenol content in the 187 vegetable samples (units: mg catechin Eq/mg solid content) was highest in the following samples: Chestnut, soft layer (Castanea crenata) 0.509; chestnut, outer skin (Castanea crenata) 0.444; water chestnut, seed coat (Trapa japonica) 0.274; lemon balm (Melissa officinalis) 0.125; spearmint (Mentha spicata) 0.124; rosemary (Rosmarinus officinalis) 0.115; bay leaves (Laurus nobilis) 0.096; lady’s thumb (Polygonum hydropiper) 0.890; thyme (Thymus) 0.080; and mugwort, powder (Artemisia indica var. maximowiczii) 0.077. By vegetable type, polyphenol content (units: mg catechin Eq/mg solid content) was as follows: Nuts (0.105), herbs (0.063), leaf vegetables (0.032), stem vegetables (0.025), fruit vegetables (0.025), beans (0.024), grains (0.019), mushrooms (0.018), and root vegetables (0.017).
    [Show full text]