Development of Ultra-Rapid Reverse Transcription Real-Time PCR for Detection Against Black Queen Cell Virus in Honeybee

Original Article 한국양봉학회지 제25권 제2호 (2010) Journal of Apiculture 30(3) : 171~179 (2015) Development of Ultra-Rapid Reverse Transcription Real-Time PCR for Detection against Black Queen Cell Virus in Honeybee Giang Thi Huong Luong, Joo-Seong Lee, So-Jung Yong and Byoung-Su Yoon* Department of Life Science, College of Natural Science, Kyonggi University, Suwon 443-760, Korea (Received 22 September 2015; Revised 26 September 2015; Accepted 29 September 2015) Abstract | Black Queen Cell Virus (BQCV) is one of the most prevalent viruses in honeybee, and could not be recognized by any infected symptoms in the adult bees. Thus, a newly developed method for rapid RNA isolation and cDNA generation from honeybee samples will be useful and easy to evaluate the presence of BQCV. A significant improvement by only one-step RNA isolation for 10 minutes made possible to detect BQCV RNAs at high quantity. cDNAs were also generated directly from isolated BQCV RNAs by different primer sets for 1 minutes and were subsequently applied to Ultra-Rapid Real-Time PCR by using microchip of 6µl reaction volume with extremely short time in each step of PCR. This system provided the ultra-high speed reaction (30 cycles in less than 10 min) including melting temperature analysis for amplified BQCV products. These results suggest that BQCV detection can be completed within 6 min 42 sec, and the Ultra-Rapid Real-time PCR is sensitive, reliable and time-saving for monitoring BQCV in honeybee. Key words: Black queen cell virus (BQCV), Honeybee, Ultra-Rapid Real-Time PCR INTRODUCTION More controversial issue is the relationship between BQCV and the Varroa destructor mite (Tentcheva et al., Black queen cell virus (BQCV) is one of the prevalent 2004; Chatawannakul et al., 2006) suggesting that this viruses of honeybee, causes the death of queen larvae and virus and mites affect together to bee colonies. The term pupae. And the name of this virus is derived from the dark “bee parasitic mite syndrome” is used to describe a disease colour areas on the wall of cells containing infected pupae complex of bee colonies with mites and viruses infestation. as typical symptoms (Bailey and Woods, 1977). The Consequently, a high mortality of bees is accompanied infection of BQCV in queen cell has been reported in (Shimanuki et al., 1994). Australia (Anderson, 1993). BQCV is a single-stranded For many years, the classical diagnostic methods for the Picorna-like virus and constructs of 8,550 nucleotides with detection of honeybee viruses based on electron two open reading frames (ORFs): a 5’-proximal ORF (a microscopy (EM) and agar gel immunodiffusion (AGID) putative replicase) and a 3’-proximal ORF (a capsid test have been mainly used for the detection of honeybee protein) (Leat et al., 2000). However, BQCV is found out viruses (Allen and Ball, 1996). However, these methods in the co-infection with a Microsporidian parasite, Nosema still have met weak points; time-consuming, low spe- apis (Allen and Ball, 1996; Bailey et al., 1983) and indi- cificity and sensitivity. Since quantitative Real-Time PCR cated that the mortality of bees infested with this parasite. assay (qRT-PCR) has been developed, several studies have *Corresponding author. E-mail: [email protected] 171 172 Giang Thi Huong Luong, Joo-Seong Lee, So-Jung Yong and Byoung-Su Yoon been using this assay for the detection of honeybee viruses (Bakonyi et al., 2002; Benjeddou et al., 2001; Blanchard et al., 2007; Topley et al., 2005) and the application of RT- Cell lysate PCR for simultaneous detection of different viruses in a sample has reduced significantly time, offered cost-saving advantages in case of large numbers of samples are analyzed. Recently, the chip-based thermal cycle has been Centrifuge 13,000 rpm/10 min/4°C developed to focusing on the improvement of low speed and temperature instability inside the reaction tubes Collected RNA phase (Kricka and Wilding, 2003; Mello, 2001). Nowadays, a novel device, chip-based real-time PCR thermal cycle DNA phase GenSpector TMC-1000 (Samsung, Suwon, Korea) is produced to gathering advantages of micro-PCR as well as Protein phase and cell debris of Real-Time PCR (Cho et al., 2006; Huh et al., 2006). Fig. 1. A detailed description of one-step RNA isolation based Several scientists have detected successfully honeybee on a general process (Takara, Japan). viruses by using Ultra-Rapid Real-Time PCR (URRT- PCR) and confirmed constantly this diagnostic assay is Samples consisted of only adult bees were directly taken rapid, reliable, sensitive and specific (Kim et al., 2007; Lee from the bee hive frames by the beekeepers in Kyonggi et al., 2007). This PCR system can complete 40 thermal University, Korea and sent to the laboratory facilities under cycles for less than 20 min (Cho et al., 2006). specific instructions to maintain them frozen until proce- In this study, we describe the development and eval- uation of new protocols for RNA isolation from honeybee ssed in the laboratory. Then, samples of BQCV-infected samples and cDNA synthesis. To date, most of viral detec- honeybees were selected by a simply PCR detection. tion studies over the world have been focusing on viral detection methods without having any time-concerning of 10 min in RNA isolation (Modified Takara protocol) RNA isolation and cDNA generation. Our result should become the first scientific recognition by shortening 2 adult bees were crushed by cleaned mortars and pestles approximately for 10 min in RNA isolation and 1 min in and total RNAs were extracted by using 1ml of RNAiso cDNA synthesis. BQCV is able to detect directly from Plus (Total RNA extraction reagent) (Takara, Japan). cDNA for 5 min 42 sec by applying to Ultra-Rapid Real- Powdery honeybees were collected to 1.5ml Eppendorf Time PCR detection. Finally, the total detection time was tubes and then 1ml of RNAiso Plus was supplemented to reduced remarkably in the whole process, making easily each tube. To separating parts of extraction, 200µl of and time-saving for monitoring BQCV in field. Moreover, chloroform was immediately added. After this step, the this newly advantageous method will be a valuable general process was shortened by only one-step suggestion for further viral detection assays not only centrifugation of cell lysate at 13,000 rpm for 4 min at 4°C. honeybee viruses but also other viral diseases even in Then, total RNAs were collected from the upper phase and human. can be directly used for cDNA generation. The collected volume of solution contained RNAs was 400µl and obtained a very high yield of the viral RNAs. The total MATERIALS AND METHODS RNAs concentration was determined by Biophotometer (Eppendorf, Germany) and maintained at -20°C (Fig. 1). Collection of honeybee samples Development of Ultra-Rapid Reverse Transcription Real-Time PCR for Detection against Black Queen Cell Virus in Honeybee 173 Table 1. Oligonucleotide primers information for BQCV specific amplification GeneBank Position PCR product Template Primer name Primer sequences (5’ 3’) → Accession No. on the genome (bp) BQCV-VP1-F2 GCTTTATCGAGGAGGAGTTCGAG 7894 pBX-BQCV-VP1 AF183905.1 176 BQCV-VP1-R2 GTATTTGGAACTCTGCGACTCCC 8047 BQCV-VP3-F1 CTGGGCGAACATCTACCTTTCC 139 pGEM-BQCV-VP3 KR074231 131 BQCV-VP3-R1 GCAATGGGTAAGAGAGGCTTCG 269 Modified the incubation time of M-MLV Reverse Preparation of DNA templates (pBX-BQCV-VP1 Transcriptase (Bioneer, Korea) in case of using and pGEM-BQCV-VP3) different primer sets PCR amplicons were amplified from structural genes of The extracted RNAs were reverse transcribed by M- BQCV by using specific pairs of primer named BQCV- MLV Reverse Transcriptase (Bioneer, Korea). Briefly, VP1-F2; BQCV-VP1-R2 and BQCV-VP3-F1; BQCV- 2µg of total RNAs were incubated with 100 pmol of oligo VP3-R1 (Table 1). The obtained PCR products were d(T) 18 (Bionics, Korea) or specific reverse primer sets for inserted to pBlueXcm vector (GenClone, Korea) and BQCV detection (BQCV-VP1-R2 and BQCV-VP3-R1) at pGEM-3Zf(+) vector (Promega, USA) and should be used 65°C for 10 min, and then the cDNA synthesis reactions as positive controls for detection of BQCV by Real-Time were performed at 42°C for 60, 30, 15 5, 1 min resp- PCR or URRT-PCR detection. The recombinant DNAs ectively and each reaction was inactivated at 95°C for 5 named as pBX-BQCV-VP1 and pGEM-BQCV-VP3 were min. Subsequently, cDNAs were ready for Real-Time PCR extracted using DNA-spinTM Plasmid DNA Purification or Ultra-Rapid Real-Time PCR detection. Afterward, we Kit (iNtRON Biotechnology, Korea) following tightly to performed the time minimization of RNA denaturation and the manufacturer’s instructions. Plasmid DNAs concen- Reverse Transcriptase inactivation steps, the time was set tration was determined using Biophotometer (Eppendorf, as 10, 5, 3, 1, 0 min for each one and the temperature were Germany) and stored at -20°C. 65°C and 95°C, respectively. Quantitative Real-Time PCR (qRT-PCR) and Specific primers for cDNA synthesis and Ultra- Ultra-Rapid Real-Time PCR (URRT-PCR) rapid real-time PCR amplification Both two pairs of primers were designed to amplify Real-Time PCR assay was developed based on SYBR conserved regions of BQCV genome. The structural green detection. All reactions were carried out with Exi- protein genes which were identified by a previous study on cyclerTM Quantitative Thermal Block (Bioneer, Korea). analysis of the complete genome of BQCV (Leat et al., The procedure was performed in a final volume of 20µl 2000) were selected. Our designs based on different seque- containing HiPi Real-Time PCR 2x Master Mix (SYBR nces published previously in the GenBank database green) (Elpisbio, Korea), 10 pmol of each primer and (accession numbers AF183905.1 and KR074231) and templates DNA or cDNA.

Load more