A Novel Salicylanilide Derivative Induces Autophagy Cell Death in Castration-Resistant

Home , Salicylanilide

Author Manuscript Published OnlineFirst on September 17, 2019; DOI: 10.1158/1535-7163.MCT-19-0387 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

A novel salicylanilide derivative induces autophagy cell death in castration-resistant

prostate cancer via ER stress-activated PERK signaling pathway

Chia-Ling Hsieh 1,2, Hsu-Shan Huang3, Kuan-Chou Chen4,5,6, Teigi Saka4, Chih-Ying Chiang1,

Leland W.K. Chung7, Shian-Ying Sung1,2,8,9*

1The Ph. D. Program for Translational Medicine, College of Medical Science and Technology,

Taipei Medical University, Taiwan

2TMU Research Center of Cancer Translational Medicine, Taipei Medical University, Taiwan

3Graduate Institute of Cancer Molecular Biology and Drug Discovery, College of Medical Science

and Technology, Taipei Medical University, Taiwan

4Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taiwan

5Department of Urology, College of Medicine, Taipei Medical University, Taiwan

6Department of Urology, Taipei Medical University-Shuang Ho Hospital, Taiwan

7Department of Medicine, Cedars-Sinai Medical Center, USA

8Joint Clinical Research Center, Office of Human Research, Taipei Medical University, Taiwan

9Clinical Research Center, Taipei Medical University Hospital, Taipei Medical University, Taiwan

Downloaded from mct.aacrjournals.org on September 30, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on September 17, 2019; DOI: 10.1158/1535-7163.MCT-19-0387 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

*Corresponding author: Shian-Ying Sung, The Ph.D Program for Translational Medicine, Taipei

Medical University, 250 Wu-Hsing Street, Shing-Yi District, Taipei 110, Taiwan; e-mail: [email protected]; Telephone: +886-2-26972035 ext 105; Fax: +886-2-66387537

Running title: Salicylanilide as an autophagy inducer for CRPC therapy

Keywords: metastatic castration-resistant prostate cancer; salicylanilides derivatives;

autophagy-induced cell death; endoplasmic reticulum stress; osteoclastogenesis inhibitor

We have no conflict of interest to declare

Word count: 4996

Total number of figures and tables: 6

Abstract

Metastatic castration-resistant prostate cancer (CRPC) is currently incurable. Cancer growth and progression is intimately affected by its interaction with host microenvironment. Co-targeting of the stroma and prostate cancer is therefore an emerging therapeutic strategy for metastatic CRPC.

Cancer-induced osteoclastogenesis is known to contribute to CRPC bone metastasis. This study is to extend pharmacological value of our synthesized LCC03, a derivative of

5-(2′,4′-difluorophenyl)-salicylanilide that has previously testified for its osteoclastogenesis activity, by exploring its additional cytotoxic properties and underlying mechanism in CRPC cells.

LCC03 was chemically synthesized and examined for cell growth inhibition in a serial of CRPC cell lines. We demonstrated that LCC03 dose-dependently suppressed proliferation and retarded cell cycle progression in CRPC cells. The classical autophagy features including autophagosomes formation and LC3-II conversation were dramatically shown in LCC03-treated CRPC cells, and it was associated with the suppressed AKT/mTOR signaling pathways, a major negative regulator of autophagy, Moreover, an expanded morphology of the ER, increased expression of the ER stress markers GRP78 and PERK, and eIF2α phosphorylation were observed. Blockage of autophagy and PERK pathways using small molecule inhibitors or shRNA knockdown reversed

LCC03-induced autophagy and cell death, thus indicating that the PERK–eIF2α pathway contributed to the LCC03-induced autophagy. Furthermore, treatment of tumor-bearing mice with

intraperitoneal administered LCC03 suppressed the growth of CRPC xenografts in mouse bone

without systemic toxicity. The dual action of 5-(2′,4′-difluorophenyl)-salicylanilide on targeting both the osteoclasts and the tumor cells strongly indicates that LCC03 is a promising anticancer candidate for preventing and treating metastatic CRPC.

Introduction

Despite high response rates to androgen deprivation therapy in men with advanced prostate cancer,

nearly all types of prostate cancer are eventually progression to the androgen-independent stage,

which is termed castration-resistant prostate cancer (CRPC). CRPC is an incurable stage of

prostate cancer, in which approximately 90% of patients develop metastases, mainly in the

skeleton [1]. Bone metastasis and skeletal complications are the major contributing factors to

morbidity and mortality in patients with prostate cancer. Over time, the conventional treatment is

ineffective, and the patients die of CRPC; the survival time is less than 19 months. Although new

therapies (and drugs), including tubulin targeting chemotherapy (cabazitaxel), immunotherapy

(sipuleucel-T), the steroidogenesis inhibitor (abiraterone), AR antagonist (enzalutamide), and

α-emitting radiotherapy (radium-223), have shown promising results in impairing the tumor

growth and extending survival, a considerable proportion of patients with CRPC become

unresponsive or become resistant to these treatment after a short period [2]. The development of

novel therapeutics that target distinct mechanisms of action is necessary to overcome resistance in

patients with CRPC.

The endoplasmic reticulum (ER) plays pivotal roles in cell homeostasis and survival, which

involved in biosynthesis of lipids, regulation of intracellular calcium concentration and

metabolism of carbohydrates, and synthesis and folding of proteins. The accumulation of

misfolded proteins within the ER lumen induces ER stress that triggers the unfolded protein

response (UPR), an evolutionarily adaptive mechanism for restoring ER homeostasis; thus UPR

protects cells against the toxic accumulation of misfolded proteins [3]. Under environmental stress, such as nutrient deprivation or hypoxia, malignant cells are particularly prone to protein

misfolding and UPR activation, which lead to tumor progression and survival [4]. However, in

contrast to cytoprotection, recent studies have highlighted the role of severe or unresolved ER

stress in cell death [5]; unsolved ER stress has been previously associated with various human

diseases, including atherosclerosis [6], neurodegenerative disorders [7], and type 2 diabetes [8].

Therefore, the pharmacological modulation of cellular responses toward ER stress-induced cell

death pathway may prevent tumor development and growth, thus representing an attractive

therapy for different cancers [9], including prostate cancer.

Cancer growth and progression is intimately affected by its interaction with the adjacent host

microenvironment, that comprised of various stromal cell types, growth factors, and extracellular

matrices, and thus presents an attractive target for therapeutic intervention [10]. Salicylanilides

are a key class of aromatic pharmacophore, comprising amides of salicylic acid and aniline.

Salicylanilides derivatives have been reported to possess myriad pharmacological activities, such

as antimicrobial [against bacterial [11] , mycobacteria [12] , viruses [13], and fungi [14] ],

anti-inflammatory [15], and anti-tumor properties [16]. Recently, a novel function of

5-(2′,4′-difluorophenyl)-salicylanilide derivatives as potent inhibitors of osteoclastogenesis has

also been discovered [17-19]. Because pathological osteoclast activation is associated with an

increased risk of tumor progression [20], subsequent skeletal complications and death due to

metastatic CRPC, in the present study, the additional pharmacological value of

5-(2′,4′-difluorophenyl)-salicylanilide was examined by determining its effect and elucidating

mechanism of action underlying its direct cytotoxicity to CRPC cells.

Materials and Methods

Cell lines and cell culture. Human prostate cancer cell lines: PC3, DU145, C4-2 and CWR22Rv1

were originally obtained from American Type Culture Collection (Manassas, VA, USA). Human

benign prostatic hyperplasia (BPH) epithelial cell line BPH-1 was a kind gift of Dr. Su-Hwa Lin

(The University of Texas MD Anderson Cancer Center, TX, USA). No further authentication was

performed by authors. The cells were maintained in RPMI-1640 medium (Thermo Fisher

Scientific, MA, USA) containing 10% FBS (GeneDireX, San Diego, CA, USA), 100 U/ml of

penicillin and 100 μg/ml of streptomycin (Thermo Fisher Scientific) at 37 °C under 5 % CO2 for

less than 25 passages after thawing and routinely testing negative for Mycoplasma contamination using a PCR Mycoplasma Detection Kit (Abcam, Cambridge, MA, USA) to conduct described experiments.

Chemicals. N-(3,4-difluorophenyl)-2',4'-Difluoro-4-hydroxy[1,1'-biphenyl]-3-carboxamide

(C19H11F4NO2; LCC03) was chemically synthesized using previously published procedures [21].

The chemical structure of LCC03 is shown in Figure 1A. 3-Methyladenine (3-MA, PubChem

CID:135398661), an autophagy inhibitor was purchased from Sigma-Aldrich (St. Louis, MO,

USA). Selective PERK inhibitor GSK2606414 (PubChem CID:53469448) was purchased from

EMD Millipore (Billerica, MA, USA).

Cell proliferation and viability assay. The cytotoxic effects of LCC03 was assayed using a

WST-1 cell proliferation assay kit (Roche Applied Science, Mannhein, Germany) following the

manufacturer’s protocol. The IC50 was calculated as the concentration of sample needed to reduce

50% of the absorbance compared with the dimethyl sulfoxide (DMSO)-treated control. The viability of the PC3 and C4-2 cells treated with LCC03 in the absence or presence of 3-MA (2 μM) for 72 hr was assessed through trypan-blue exclusion (Thermo Fisher Scientific). All assays were done in six replicates on at least four independent experiments.

Western blot analysis. Protein expression was analyzed as previously performed [22]. The primary antibodies were listed in Table S1. After incubation with an HRP-conjugated secondary

antibody (1:5000, GE Healthcare Life Sciences, MA, USA), the corresponding bands were

detected using an ECL Kit (Advansta, Menlo Park, CA, USA) and an AI 600

chemiluminescent imaging and analysis system (GE Healthcare Life Sciences). Each blot was

performed at least twice.

Gene knockdown. Small hairpin RNA (shRNA) expression plasmids, including

pLKO.1-shPERK (TRCN0000262373, target sequence TGCATCTGCCTGGTTACTTAA), pLKO.1-shAtg7 (TRCN0000007584, target sequence GCCTGCTGAGGAGCTCTCCAT;

TRCN0000007587, target sequence CCCAGCTATTGGAACACTGTA), and a mammalian nontargeting shRNA control pLKO.1-shGFP (sh-ctr, TRCN0000072178, target sequence,

CAACAGCCACAACGTCTATAT) were obtained from the National RNAi Core Facility

(Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan). The recombinant lentivirus was generated by transfecting shRNA plasmids along with the packaging plasmids pCMV-ψR8.91(Gag/Pol/Rev) and pMD.G (VSV-G envelope) in 293FT cells and used for infecting the PC3 and C4-2 cells according to a previously described protocol [23]. The extent of

gene knockdown was determined through an immunoblotting assay.

Transmission electron microscopy (TEM). Sample preparation for TEM were prepared with aid from the Imaging Core at Taipei Medical University. Briefly, the cells grown on plastic chamber slides were fixed using 2% paraformaldehyde (PFA) and 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.4) for 30 min at room temperature and then subjected to post-fixation with

2% osmium tetroxide. After dehydration in ascending grades of ethanol and propylene oxide, the samples were embedded in Epon. Epon polymerization was conducted at 62 °C for 48 hr. Ultrathin

sections (approximately 70 nm in thickness) were obtained using an ultramicrotome (Leica

Ultracut UCT, Leica Microsystems GmbH, Wetzlar, Germany) and were collected on 100 mesh

copper grids. After double staining with uranyl acetate and lead citrate, the sections were

examined under a Hitach H-600 Transmission Electron Microscope operating at 100 kV.

Immunofluorescence staining. The PC3 and C4-2 cells transfected with the EGFP-LC3 [24]

plasmid (a gift from Karla Kirkegaard; Addgene plasmid # 11546) were grown on coverslips for overnight and treated with DMSO or LCC03 combined with GSK2606414 for 72 hr. After

removing the culture media, the cells were fixed using 4% PFA and washed thrice using PBS.

Subsequently, the cells were stained with DAPI and then mounted in ProLong Gold Antifade reagent (Thermo Fisher Scientific). Images of the cells were acquired using a Carl Zeiss LSM 510

META confocal microscope (Carl Zeiss, Jena, Germany) equipped with a Plan Apochromat 63x

oil/1.4 NA DIC objective.

Animal studies. Animal experiments were approved by the Institutional Animal Care and Use

Committee of Taipei Medical University (LAC-2016-0345) and complied with their regulations.

Six-week-old male nude mice (BALB/cAnN.Cg-Foxn1nu/CrlNarl) were purchased from the

National Laboratory Animal Center (Taipei, Taiwan) and maintained under the specific

pathogen-free conditions and cared for according to the criteria outlined in the National Academy

of Sciences Guide for the Care and Use of Laboratory Animals. To initiate experimental prostate

bone metastasis in the xenograft models, the mice were anesthetized by Zoletil and Rompun mixture, and subjected to an intraosseous injection of 2 × 105 PC3-Luc cells into the mouse tibia

following our previously established protocol [23]. One week after cell injection, the

tumor-bearing mice were randomized and given the following intraperitoneal treatments twice per

week for 4 weeks (n=10 for each group): (a) untreated, (b) DMSO, (c) LCC03 (20 mg/kg), and (d)

LCC03 (40 mg/kg). The tumor growing in the bone were monitored through bioluminescent

imaging (BLI) weekly by using the IVIS™ 2000 system and the Living Image software (Caliper

Life Sciences, Hopkinton, MA) for quantification of luminescence intensity. The body weights of

all the mice were measured thrice per week for 4 weeks. The mice were sacrificed at 5 weeks after

the initial treatment and the heart, lung, kidney, liver, spleen and tibia were excised for histopathological analyses. Before the animals were sacrificed, blood samples were collected to analyze biochemical parameters with aid from the TMU Animal Care Facility.

Immunohistochemical (IHC) staining. Bone specimens were fixed in 10% neutral buffered formalin for 24 hr. They were then decalcified using 14% EDTA (pH 7.2) for 14 days at room temperature and embedded in paraffin. IHC analyses were performed using the Novolink Polymer

Detection System (Leica Microsystems, Newcastle upon Tyne, UK) with the following antibodies: mouse monoclonal anti-Ki-67 antibody (1:100; Clone GM010, Genemed Biotechnologies, South

San Francisco, CA, USA) and rabbit polyclonal anti-human LC3B (1:50; LS-B9807, LifeSpan

BioSciences, Seattle, WA, USA). The extent of apoptosis and osteoclastogenesis was evaluated using an Apo-BrdU-IHC In Situ DNA Fragmentation Assay Kit (BioVision, Inc., Milpitas, CA,

USA) and a TRACP & ALP double-stain kit (TaKaRa, Ohtsu, Japan), respectively following the manufacturer’s instructions.

Statistical analysis. Statistical analysis was performed using GraphPad Prism 6 (GraphPad

Software, San Diego, CA, USA). Data are presented as mean ± SD and % change versus controls.

Difference between two groups was measured by Student t-test. A probability value of p < 0.05 was considered statistically significant.

Results

LCC03 induces growth retardation and cell cycle arrest in prostate cancer cells

Treating patients with CRPC remains a substantial clinical challenge. Thus, we assessed whether

LCC03, a novel derivative of 5-(2′,4′-difluorophenyl)-salicylanilide (Figure 1A), is potentially toxic to a series of CRPC-like cell lines, including androgen receptor (AR)-positive cell lines C4-2 and CWR22rv1 and the AR-negative cell lines PC3 and DU145. A cell proliferation assay revealed that the incubation of prostate cancer cells with LCC03 for 48 hr caused a marked and

dose-dependent growth inhibition (Figure 1B). The IC50 in different cell lines was 0.69 to 4.8 μM

(Table 1). By contrast, the cell proliferation of benign hyperplastic prostatic epithelial cells

(BPH-1) was unaffected by LCC03 at a concentration of <5 μM. The IC50 value of LCC03 for

BPH-1 (15.7 μM) cells was 3–20 times higher than that for the cancerous cells, thus indicating that

LCC03 is selectively more toxic to cancerous cells than to noncancerous cells. The highest IC50 value of LCC03 was observed in the PC3 cell line, which was originally derived from patient bone

metastases. The lowest IC50 value of LCC03 was observed in the C4-2 cells; thus, the C4-2 cells

were most sensitive to LCC03. These two cell lines were selected for subsequent investigation of the anticancer properties of LCC03.

We analyzed the cell cycle distribution in the PC3 and C4-2 cells after 48 h of incubation with

LCC03 to characterize the antiproliferative properties of LCC03 in detail. We observed dose-dependent accumulation of the PC3 cells in the G2/M phase on LCC03 exposure (Figures

S1A and 1C, PC3). The increase in the (G2/M phase) was coupled with a reduction in percentage of cells in the G0/G1 phase. In the C4-2 cells, LCC03 treatment increased the proportion of cells in the G1 phase and reduced the proportion of cells in the G2 phase (Figures S1A and 1C, C4-2). The effect of LCC03 on cell cycle progression was also supported by the result of mRNA array-based gene profiling analysis, which showed a marked change in the cell cycle pathway in the PC3 cells after treatment with LCC03 (Figure S1B). Western blotting analysis further confirmed the time- and dose-dependent repression of cyclin D1 as well as the cdc2/cyclin B complex activity by

LCC03 in both cell lines (Figure 1D), thus indicating a strong effect of LCC03 on the cell cycle checkpoints.

LCC03 causes cytotoxic activity through autophagy but not via an apoptosis-dependent pathway

The cytotoxic effect of LCC03 on prostate cancer cell survival was assessed through the trypan

blue assay after incubating the cells for 3 days with LCC03. LCC03 treatment reduced cell viability in a dose-dependent manner (Figure 2A), which was similar to the effect of LCC03 on cell proliferation. We then assessed whether the cytotoxic effect of LCC03 on prostate cancer cells was correlated with increased apoptosis. Notably, the percentage of annexin V-positive cells

increased only slightly among the PC3 cells and decreased among the C4-2 cells, when the cells

were treated with LCC03 (up to their respective IC50 concentrations) for 72 h (Figure S2A).

Moreover, Western blotting analysis revealed that only minimal cleavage of PARP and caspase 3

was detectable in LCC03-treated cells (Figure S2B). Collectively, these data indicate that

LCC03-induced cytotoxicity was not closely associated with the apoptotic cell death.

Recent studies have identified autophagy as the major mechanism of cell death in addition to

apoptosis in response to cellular stress. Hence, we examined whether autophagy is induced by

LCC03 and whether it has a critical role in mediating cell death. Cyto-ID green fluorescent dye

was used to stain autophagic vacuoles in the cells and the fluorescence intensity was quantified

through flow cytometry. Similar to the treatment with the autophagy inducers tunicamycin and

rapamycin, an increase in fluorescent intensity was observed in the PC3 and C4-2 cells after

treatment of LCC03 for 72 hr, thus suggesting the induction of autophagy (Figure 2B). To confirm

this result, TEM was performed for ultrastructural analysis. Numerous autophagic vacuoles and

empty vacuoles were observed in the LCC03-treated PC3 cells, and most of the autophagic vacuoles contained intact lamellar structure and/or residual digested materials (Figure 2C). The

DMSO-vesicle treated control exhibited only a few autophagic features. The Western blot analysis results (Figure 2D) revealed a time- and dose-dependent increase in the conversion of LC3B-I to

LC3B-II, which is a hallmark of macroautophagy. LCC03 also induced a higher amount of the autophagy factor Atg12-Atg5 conjugate between 48 and 72 hr after treatment, and its induction was associated with increased LC3B conversion in both cell lines. Notably, Beclin-1 protein, a key regulator complexed with class III PI3K for autophagosome formation through dissociation from the anti-apoptotic protein Bcl2, was up-regulated concomitantly with a decreased in Bcl2 in the

C4-2 cells after treatment with LCC03. However, no significant changes were observed in the PC3 cells, thus suggesting that LCC03 elicited a canonical or noncanonical autophagic pathway in a cell-type-dependent manner. Since Bcl-2 is a pro-survival protein, the increased expression of

Bcl-2 seen in PC3 cells after the longer exposure (72 hr) of LCC03 might contribute to helping cell surviving under treatment, by which PC3 cells acquire more resistance than C4-2 cells to the cytotoxic effects of LCC03. In addition, blockage of autophagosome formation by using 3-MA, a

PI3K inhibitor, or genetically knocking down autophagy-related 7 (Atg7) expression significantly attenuated the induction of autophagosome marker expression and restored the viability of cells

treated with LCC03 (Figure 2E-F), thus confirming that LCC03 induced cytotoxicity in prostate cancer cells through activation of autophagy.

LCC03 activates ER-stress-induced PERK–eIF2α–ATF4 signaling pathway

To gain a better insight into the LCC03 induced autophagic pathways, we identified autophagy-related signaling molecules. The kinase mTOR is a critical regulator of autophagy induction. The phosphorylation of mTOR suppresses autophagy, whereas the dephosphorylation of mTOR promotes autophagy. Our results identified significant downregulation of p-mTOR level in C4-2 and PC3 cells treated with LCC03 (Figure 3A). This downregulation of p-mTOR was strongly associated with Akt inactivation by dephosphorylation alone in the PC3 cells or together with reduced expression of total Akt protein in the C4-2 cells. The expression of AMPK, a negative regulator of mTOR, although did not differ significantly between the LCC03- and

DMSO-treated cells, the phosphorylation of AMPK-α was massively induced upon LCC03 treatment. Collectively, these findings indicate that LCC03 triggered autophagy activation in the prostate cancer cells via an AMPK- and Akt-dependent mTOR pathway.

Several reports have reported that ER-stress-activated UPR can trigger several signaling pathways that cause autophagy [25, 26]. In addition to the autophagosome-like vesicles, TEM revealed that the LCC03-treated cells exhibited abnormal ER expansion (Figure 3B). Therefore, we determined

whether LCC03 could induce an ER stress response and subsequently regulate autophagy. The

Western blot analysis results revealed upregulation of GRP78 expression, which indicated the activation of ER stress (Figure 3C). Moreover, LCC03 treatment considerably increased the expression of the ER stress sensor PERK, the levels of phosphorylated eIF2α and ATF4, and the

ATF4 downstream target genes CHOP (a transcription factor known to induce autophagy) and

TRIB3 (a negative regulator of Akt activation) in a time- and dose-dependent manner. These results demonstrated that the PERK- eIF2α-ATF4 signaling pathway was activated during

LCC03-induced ER stress.

Blockage of the PERK activation attenuates the LCC03-induced autophagic cell death

We investigated whether LCC03-induced autophagic cell death in the tested cells was mechanistically related to ER stress signaling pathways by using pharmacological and genetic approaches to inhibit ER stress sensor PERK activity. Stable transfection of PERK-targeting shRNA significantly suppressed PERK expression, blocked LCC03-induced upregulation of

LC3B conversion, and inhibited eIF2α phosphorylation compared with cells transfected with negative control shRNA (Figure 4A). Similarly, inhibition of PERK kinase activity by using the compound GSK2606414 slightly increased the basal levels of PERK; however, it prevented the

phosphorylation of eIF2 α and the conversion of LC3B-I to LC3B-II when the cells were exposed to LCC03 (Figure 4B). We further analyzed autophagosome formation in the PC3 and C4-2 cells that were transfected with a plasmid expressing autophagosome-associated LC3 protein fused to green fluorescent protein (GFP-LC3). In the GFP-LC3 transfected cells, treatment with LCC03 resulted in an increase in the redistribution of green fluorescence from diffused to a punctum pattern in the perinuclear region. Treatment with GSK2606414 also suppressed the

LCC03-induced autophagosome formation, which was indicated by the reduced appearance of

GFP-LC3 puncta (Figure 4C). The PERK signaling pathway attenuated by either shRNA or small molecule inhibitors restored cell survival in response to LCC03 treatment, thus confirming the critical role of PERK-mediated ER-stress-signaling pathway in LCC03-induced cell death (Figure

4D). Interestingly, knocked down of PERK did not reverse the LCC03-mediated mTOR dephosphorylation (Figure 4A). Conversely, activation of mTOR by MHY1485 decreased PERK expression in LCC03-treated PC3 cells (Figure S3), implying that PERK-mediated autophagy by

LCC03, at least in part, is regulated via mTOR pathway.

LCC03 treatment suppresses the growth of osteolytic prostate cancer metastasis in mouse bone

To investigate the therapeutic potential of LCC03 for prostate cancer, particularly targeting CRPC bone metastases and the associated osteoclast activation, PC3 cells that are relatively highly resistant to LCC03 and produce a pure osteolytic reaction in the bone were used in an experimental animal model. Luciferase expressing-PC3 cells (PC3-Luc) were injected directly into the tibia of the nude mice and allowed to form tumors for 10 days, as demonstrated through BLI. The tumor-bearing mice received intraperitoneal administration of LCC03 at a low (20 mg/kg) and high (40 mg/kg) dose or DMSO vesicle every other day (QOD) for 4 weeks. A control group received no treatment. Simultaneously, the body weights of all the mice were also recorded. The responsiveness of the PC3-Luc tumors to this therapy was monitored was monitored through weekly BLI. During the 5-week monitoring period, the bioluminescence signal gradually increased with time in the untreated control group, which indicated that the tumors progressed aggressively (Figure 5A, imaging). A similar imaging pattern was observed in the mice treated with DMSO vesicles and the low-dose LCC03, which indicated that 20 mg/kg QOD of LCC03 was not effective at suppressing tumor growth. By contrast, the mice treated with high-dose (40 mg/kg) LCC03 exhibited a relatively constant or slowly changing profile of bioluminescence signals over time. A quantitative analysis of the BLI data revealed that the average signal intensity in the mice treated with high-dose LCC03 was approximately 75% less than that in the untreated and DMSO-treated control mice (Figure 5A); thus confirmed a significant anti-cancer effect on

tumor growth. These results confirmed dose-dependent inhibition of tumor growth by LCC03 and demonstrated that 40 mg/kg QOD for 4 weeks are the efficacious dose to induce regression.

In addition, the high-dose treatment was not associated with any observed adverse effect in the body weight and cellular structure of nontarget organ tissues (Figure 5B). The biochemical parameters, including BUN (blood urea nitrogen), CREA (creatinine), ALT (alanine aminotransferase), ALP (alkaline phosphatase), and TBIL (total bilirubin) were all within the reference range and no significant changes (p > 0.1) in mice before and after treatment with

LCC03 (40 mg/kg) for 5 weeks (Table S2), which indicated that the administered dose of LCC03 was safe for therapeutic use.

Histological analysis (Figure 5C, H&E) of the affected legs from the sacrificed mice after 5 weeks of treatment revealed healthy and packed tumor cells growing in the marrow cavity of the control groups (no treatment or DMSO-vesicle treatment). The highly proliferative nature of the tumor cells in these control groups was confirmed through ki-67 expression (Figure 5C, ki-67). By contrast, extensive necrotic regions were found in the tumors excised from the mice treated with high-dose LCC03, and only a few ki-67-stained cancer cells were detected in these tumors. IHC staining of LC3B indicated a strong increase in LC3B expression in the tumors from the mice treated with high-dose LCC03. TUNEL staining results of the tumors indicated that apoptotic cells were absent (Figure 5C, LC3B and TUNEL). Collectively, these results confirmed that the

considerable tumor regression caused by systemic LCC03 treatment was associated with autophagy but not apoptosis. Moreover, the tartrate‐resistant acid phosphatase (TRAP)-positive osteoclasts were distributed mainly in osteolytic bone lesions of the control groups but barely detected in the LCC03-treated tumor sections (Figure 5C, TRAP), further confirming the dual targeting of prostate cancer cells and osteoclastogenesis by LCC03.

Discussion

The NF-kB ligand (RANKL) pathways participate in the activation and survival of osteoclasts; therefore, they represent a therapeutic target for osteoclast-induced bone destruction in treatment- and metastatic cancer-induced osteolysis. The RANKL inhibitor denosumab is recently approved by the U.S. FDA for the prevention of skeletal related events in men with metastatic CRPC, but studies on these compounds have not demonstrated a survival benefit [27]. Moreover, recent drug discovery efforts have identified small molecules that impair the ER function for therapeutic intervention. For example, bortezomib, the first FDA-approved proteasome inhibitor that induces severe ER stress and causes apoptosis, was used to treat patients with multiple myeloma

[28]. However, the ineffectiveness of the aforementioned small molecules against several solid tumors including prostate cancer emphasized the need for the development effective drugs.

Autophagy can be stimulated in response to multiple forms of cellular stress, such as intracellular pathogens, nutrient and growth factor deprivation, hypoxia, damaged organelles, and ER stress

[29]. In the present study, we provided the first evidence that LCC03, a derivative of

5-(2′,4′-difluorophenyl)-salicylanilides that was originated reported as a small molecular inhibitor of RANKL-induced osteoclastogenesis, exhibits strong activity against prostate cancer cell growth through ER-stress-mediated autophagy via the PERK/eIF2α signaling pathway. Other salicylanilide derivatives, such as Niclosamide [30] and nitro-substituted hydroxybenzamides

[31-33] that share structure similarities with gefitinib and erlotinib, a class of small molecule inhibitors of the epidermal growth factor receptor (EGFR) exhibited antiproliferative and/or proapoptotic activities against a spectrum of human cancer cell lines. However, therapies targeting the EGFR by using gefitinib, and erlotinib showed nonsignificant clinical benefit in patients with

CRPC [34]. The dual action of 5-(2’,4’-difluorophenyl)-salicylanilides on both the osteoclasts and various CRPC cell lines (both AR-positive and AR-negative) may make it a superior anticancer candidate to EGFR tyrosine kinase inhibitors and AR-targeting agents to prevent and treat metastatic CRPC.

We demonstrated that LCC03 exerts a robust antiproliferative effect, induces cell cycle arrest and reduces the viability in a dose-dependent manner in various prostate cancer cell lines. The tumor suppressor protein p53 is a master regulator with pleiotropic effects on metabolism, anti-oxidant

defense, genomic stability, proliferation, senescence and cell death. The activation of p53 was

shown to inhibit mTOR activity and transactivate autophagy-inducing genes [35]. Four core

autophagy genes: ATG4B, ATG4D, ULK1, and ULK2, were also recently defined as

AR-targeting genes [36]. The higher susceptibility of C4-2 to LCC03 compared with the cell lines

DU145 (AR-null and p53-mutant cells), CWR22r-v1 (AR-positive and p53-mutant cells), and

PC3 (AR-null and p53-null cells) may be attributable to the expression of both functional p53 and

AR to induce autophagy. Thomas et al. [37] has demonstrated a two-signal model for the

regulation of cell proliferation during ER stress. The first signal represents inhibition of protein

translation mediated via the phosphorylation of eIF2α by PERK, leading to impaired G2/M cell

cycle progression. The second signal, which induces G1 at later stages of ER stress, requires

functional p53. Moreover, autophagy is known to be associated with the advancement of the cell

cycle, with a preference for the G1 and S phases [38]. These, in theory, may explain somewhat why LCC03 induced G1 phase arrest in the C4-2 cells but G2 phase arrest with an increased

S-phase population in the PC3 cells. Although TP53 represents one of the most frequent individual

mutated genes in prostate cancer, the frequency of p53 alternations is approximately 10%–15% in

prostate cancer [39], which is lower than in many other cancers. Therefore, prostate cancer,

regardless to the disease status, could be considered as the primary indication of LCC03.

Numerous studies have suggested that autophagy induction is a cell survival mechanism of chemoresistance [40, 41]; therefore, blocking autophagy during cancer treatment can improve clinical outcomes. However, other studies have indicated that autophagy induction sensitizes cancer cells to chemotherapy and radiation [42, 43], suggesting autophagy stimulation for tumor-targeted therapy. Because autophagy is negatively regulated by mTOR, the pharmacological anti-cancer agents, including rapamycin, everolimus, and temsirolimus, which operate at the level of the mTOR pathway level are currently under investigation for clinical induction of autophagy. In the present study, we defined LCC03 as a novel ER stressor that initiates cell death in prostate cancer cells through autophagy induction. Although class III PI3K activation directly affects autophagy, our results reveled that in addition to AMPK pathway,

LCC03 considerably suppressed class I PI3K/Akt activation that regulates autophagy indirectly via the mTOR pathway in both AR-positive and AR-negative prostate cancer cell populations.

Thus, it provides the mechanistic rationale for the efficacy of LCC03 in autophagy induction against prostate cancer and may extend to other tumor types.

Three signaling proteins, IRE1α, ATF6 and PERK, are involved in the initiation of ER-stress response [44]. PERK was associated with ER stress-induced autophagy. Once activated, this kinase directly phosphorylates eIF2α to block translation initiation, leading to the upregulation of autophagy-related genes and inhibition of autophagy suppressors. Although the involvement of

the IRE1α and ATF6 pathways in the anti-cancer property of LCC03 was not addressed in the

present study, we determined that blockage of PERK expression by sequence-specific siRNA or

selective small molecule inhibitors rendered prostate cancer cells resistant to LCC03 to a similar

degree as the untreated group, thus implicating PERK as a major effector of LCC03-induced cell death. Notably, a basal level of LC3-B conversion in response to LCC03 treatment was still retained even when the cell viability was nearly completely restored by PERK antagonist,

suggesting that the other ER-stress signaling pathways, such as the IRE1α and ATF6 pathways,

may contribute to cytoprotective rather than cytotoxic autophagy induction. Our current

knowledge and future work in the area of autophagy regulation should facilitate the development

of improved therapeutic approaches for cancer.

CRPC is well recognized to be resistant to conventional therapies, mainly due to its typical feature of apoptosis resistance [45]. Our in vivo proof of principle study showed the clinical benefit and safety of LCC03 treatment in CRPC bone metastases in the clinically relevant animal models.

Thus, strongly support the translational application of LCC03

(5-(2′,4′-difluorophenyl)-salicylanilide derivative) for potential monotherapy and combination therapy against metastatic CRPC. Additional optimization studies for therapeutic index and biologics formulation are warranted to improve its potency and pharmacological properties.

Acknowledgments

We would like to acknowledge Ms. Huei-Min Chen for her exceptional technical support for TEM at Taipei Medical University Core Facility. This work was supported in part by Ministry of

Science and Technology in Taiwan (Grant No. MOST 107-2320-B-038-057 and

106-2320-B-038-056 to C-L. Hsieh, 106-2320-B-038-055 to S-Y Sung, and 106-2113-M-038-003 to H-S Huang), Taipei Medical University (Grant No. DP2-107-21121-C-01), and the “TMU

Research Center of Cancer Translational Medicine” from The Featured Areas Research Center

Program within the framework of the Higher Education Sprout Project by the Ministry of

Education (MOE).

References

1 Bubendorf L, Schopfer A, Wagner U, Sauter G, Moch H, Willi N et al. Metastatic

patterns of prostate cancer: an autopsy study of 1,589 patients. Hum Pathol 2000; 31:

578-583.

2 Omlin A, Pezaro C, Gillessen Sommer S. Sequential use of novel therapeutics in

advanced prostate cancer following docetaxel chemotherapy. Ther Adv Urol 2014; 6:

3-14.

3 Rao RV, Bredesen DE. Misfolded proteins, endoplasmic reticulum stress and

neurodegeneration. Curr Opin Cell Biol 2004; 16: 653-662.

4 Clarke HJ, Chambers JE, Liniker E, Marciniak SJ. Endoplasmic reticulum stress in

malignancy. Cancer Cell 2014; 25: 563-573.

5 Sano R, Reed JC. ER stress-induced cell death mechanisms. Biochim Biophys Acta 2013;

1833: 3460-3470.

6 Hotamisligil GS. Endoplasmic reticulum stress and atherosclerosis. Nat Med 2010; 16:

396-399.

7 Lindholm D, Wootz H, Korhonen L. ER stress and neurodegenerative diseases. Cell

Death Differ 2006; 13: 385-392.

8 Back SH, Kaufman RJ. Endoplasmic reticulum stress and type 2 diabetes. Annu Rev

Biochem 2012; 81: 767-793.

9 Luo B, Lee AS. The critical roles of endoplasmic reticulum chaperones and unfolded

protein response in tumorigenesis and anticancer therapies. Oncogene 2013; 32: 805-818.

10 Chung LW, Hsieh CL, Law A, Sung SY, Gardner TA, Egawa M et al. New targets for

therapy in prostate cancer: modulation of stromal-epithelial interactions. Urology 2003;

62: 44-54.

11 Kratky M, Vinsova J, Novotna E, Mandikova J, Trejtnar F, Stolakova J. Antibacterial

activity of salicylanilide 4-(trifluoromethyl)-benzoates. Molecules 2013; 18: 3674-3688.

12 Imramovsky A, Vinsova J, Ferriz JM, Dolezal R, Jampilek J, Kaustova J et al. New

antituberculotics originated from salicylanilides with promising in vitro activity against

atypical mycobacterial strains. Bioorg Med Chem 2009; 17: 3572-3579.

13 Kratky M, Vinsova J. Antiviral activity of substituted salicylanilides--a review. Mini Rev

Med Chem 2011; 11: 956-967.

14 Kratky M, Vinsova J. Antifungal Activity of Salicylanilides and Their Esters with

4-(Trifluoromethyl)benzoic Acid. Molecules 2012; 17: 9426-9442.

15 Brown ME, Fitzner JN, Stevens T, Chin W, Wright CD, Boyce JP. Salicylanilides:

selective inhibitors of interleukin-12p40 production. Bioorg Med Chem 2008; 16:

8760-8764.

16 Wang B, Wang Z, Ai F, Tang WK, Zhu G. A monofunctional platinum(II)-based

anticancer agent from a salicylanilide derivative: Synthesis, antiproliferative activity, and

transcription inhibition. J Inorg Biochem 2015; 142: 118-125.

17 Chen CL, Lee CC, Liu FL, Chen TC, Ahmed Ali AA, Chang DM et al. Design, synthesis

and SARs of novel salicylanilides as potent inhibitors of RANKL-induced

osteoclastogenesis and bone resorption. Eur J Med Chem 2016; 117: 70-84.

18 Chen CL, Liu FL, Lee CC, Chen TC, Ahmed Ali AA, Sytwu HK et al. Modified

salicylanilide and 3-phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-dione derivatives as novel

inhibitors of osteoclast differentiation and bone resorption. J Med Chem 2014; 57:

8072-8085.

19 Liu FL, Chen CL, Lee CC, Wu CC, Hsu TH, Tsai CY et al. The Simultaneous Inhibitory

Effect of Niclosamide on RANKL-Induced Osteoclast Formation and Osteoblast

Differentiation. Int J Med Sci 2017; 14: 840-852.

20 Smith MR. Osteoclast targeted therapy for prostate cancer: bisphosphonates and beyond.

Urol Oncol 2008; 26: 420-425.

21 Lee CC, Liu FL, Chen CL, Chen TC, Chang DM, Huang HS. Discovery of

5-(2',4'-difluorophenyl)-salicylanilides as new inhibitors of receptor activator of

NF-kappaB ligand (RANKL)-induced osteoclastogenesis. Eur J Med Chem 2015; 98:

115-126.

22 Hung SC, Wu IH, Hsue SS, Liao CH, Wang HC, Chuang PH et al. Targeting l1 cell

adhesion molecule using lentivirus-mediated short hairpin RNA interference reverses

aggressiveness of oral squamous cell carcinoma. Molecular pharmaceutics 2010; 7:

2312-2323.

23 Sung SY, Wu IH, Chuang PH, Petros JA, Wu HC, Zeng HJ et al. Targeting L1 cell

adhesion molecule expression using liposome-encapsulated siRNA suppresses prostate

cancer bone metastasis and growth. Oncotarget 2014; 5: 9911-9929.

24 Jackson WT, Giddings TH, Jr., Taylor MP, Mulinyawe S, Rabinovitch M, Kopito RR et

al. Subversion of cellular autophagosomal machinery by RNA viruses. PLoS Biol 2005; 3:

e156.

25 Ogata M, Hino S, Saito A, Morikawa K, Kondo S, Kanemoto S et al. Autophagy is

activated for cell survival after endoplasmic reticulum stress. Mol Cell Biol 2006; 26:

9220-9231.

26 Senft D, Ronai ZA. UPR, autophagy, and mitochondria crosstalk underlies the ER stress

response. Trends Biochem Sci 2015; 40: 141-148.

27 Hayes AR, Brungs D, Pavlakis N. Osteoclast inhibitors to prevent bone metastases in

men with high-risk, non-metastatic prostate cancer: A systematic review and

meta-analysis. PloS one 2018; 13: e0191455.

28 Chen D, Frezza M, Schmitt S, Kanwar J, Dou QP. Bortezomib as the first proteasome

inhibitor anticancer drug: current status and future perspectives. Curr Cancer Drug

Targets 2011; 11: 239-253.

29 Murrow L, Debnath J. Autophagy as a stress-response and quality-control mechanism:

implications for cell injury and human disease. Annu Rev Pathol 2013; 8: 105-137.

30 Li Y, Li PK, Roberts MJ, Arend RC, Samant RS, Buchsbaum DJ. Multi-targeted therapy

of cancer by niclosamide: A new application for an old drug. Cancer Lett 2014; 349:

8-14.

31 Imramovsky A, Jorda R, Pauk K, Reznickova E, Dusek J, Hanusek J et al. Substituted

2-hydroxy-N-(arylalkyl)benzamides induce apoptosis in cancer cell lines. Eur J Med

Chem 2013; 68: 253-259.

32 Kauerova T, Kos J, Gonec T, Jampilek J, Kollar P. Antiproliferative and Pro-Apoptotic

Effect of Novel Nitro-Substituted Hydroxynaphthanilides on Human Cancer Cell Lines.

Int J Mol Sci 2016; 17.

33 Zhu XF, Wang JS, Cai LL, Zeng YX, Yang D. SUCI02 inhibits the erbB-2 tyrosine

kinase receptor signaling pathway and arrests the cell cycle in G1 phase in breast cancer

cells. Cancer Sci 2006; 97: 84-89.

34 Rathkopf DE, Larson SM, Anand A, Morris MJ, Slovin SF, Shaffer DR et al. Everolimus

combined with gefitinib in patients with metastatic castration-resistant prostate cancer:

Phase 1/2 results and signaling pathway implications. Cancer 2015; 121: 3853-3861.

35 Feng Z, Zhang H, Levine AJ, Jin S. The coordinate regulation of the p53 and mTOR

pathways in cells. Proc Natl Acad Sci U S A 2005; 102: 8204-8209.

36 Blessing AM, Rajapakshe K, Reddy Bollu L, Shi Y, White MA, Pham AH et al.

Transcriptional regulation of core autophagy and lysosomal genes by the androgen

receptor promotes prostate cancer progression. Autophagy 2017; 13: 506-521.

37 Thomas SE, Malzer E, Ordonez A, Dalton LE, van 't Wout EF, Liniker E et al. p53 and

translation attenuation regulate distinct cell cycle checkpoints during endoplasmic

reticulum (ER) stress. J Biol Chem 2013; 288: 7606-7617.

38 Tasdemir E, Maiuri MC, Tajeddine N, Vitale I, Criollo A, Vicencio JM et al. Cell

cycle-dependent induction of autophagy, mitophagy and reticulophagy. Cell Cycle 2007;

6: 2263-2267.

39 Kluth M, Harasimowicz S, Burkhardt L, Grupp K, Krohn A, Prien K et al. Clinical

significance of different types of p53 gene alteration in surgically treated prostate cancer.

Int J Cancer 2014; 135: 1369-1380.

40 Garcia JA, Danielpour D. Mammalian target of rapamycin inhibition as a therapeutic

strategy in the management of urologic malignancies. Mol Cancer Ther 2008; 7:

1347-1354.

41 Thorburn J, Horita H, Redzic J, Hansen K, Frankel AE, Thorburn A. Autophagy

regulates selective HMGB1 release in tumor cells that are destined to die. Cell Death

Differ 2009; 16: 175-183.

42 Chen YR, Tsou B, Hu S, Ma H, Liu X, Yen Y et al. Autophagy induction causes a

synthetic lethal sensitization to ribonucleotide reductase inhibition in breast cancer cells.

Oncotarget 2016; 7: 1984-1999.

43 Fiorini C, Cordani M, Gotte G, Picone D, Donadelli M. Onconase induces autophagy

sensitizing pancreatic cancer cells to gemcitabine and activates Akt/mTOR pathway in a

ROS-dependent manner. Biochim Biophys Acta 2015; 1853: 549-560.

44 Sano R, Reed JC. ER stress-induced cell death mechanisms. Biochim Biophys Acta 2013;

1833: 3460-3470.

45 Leo S, Accettura C, Lorusso V. Castration-resistant prostate cancer: targeted therapies.

Chemotherapy 2011; 57: 115-127.

Tables

Table 1: Summary of IC50 values for LCC03 in one human benign prostate hyperplasia

(BPH) and four prostate cancer cell lines after 48 hr treatment.

# CELL LINE Mean IC50 ± SD (μM)

BPH-1 15.7322 ± 8.944

C4-2 0.688 ± 0.061

CWR22r-v1 2.57 ± 0.55

PC3 4.48 ± 2.58

DU145 2.64 ± 0.83

#All values were presented as mean ±SD of six replicates in four independent experiments.

Figure Legends

Figure 1. Effect of LCC03 on cell growth and cell cycle progression in prostate cancer cell lines. (A) Rational design synthesis and chemical structures of small molecule LCC03. (B)

Proliferation of benign (BPH) and malignant prostate cancer cell lines treated with a serial of doses of LCC03 for 48 hr was determined using the WST-1 assay. Relative cell proliferation is presented as the mean ± SD percentage of absorbance (at 450 nm) compared with the DMSO-vesicle-treated control (0 μM LCC03) for at least four independent experiments (n ≥ 4). (C) Bar graphs of the percentages of G1, S, and G2/M populations in the PC3 and C4-2 cells treated with the DMSO vesicle control and the indicated concentrations of LCC03 for 48 hr. The results of one of three independent experiments are shown. (D) Western blotting analysis of cell cycle checkpoint markers. ß-actin is shown as the protein loading control. The expected molecular weight of each protein is indicated on the left side of the figure.

Figure 2. Effect of LCC03 on autophagy activation in CRPC cells. (A, F) Trypan blue staining for cell viability assay of the (A) parental and (F) ATG- (sh-ATG) and non-targeting shRNA-expressing (sh-ctr) PC3 and C4-2 cells treated with the indicated concentrations of LCC03, and with or without autophagy blocker 3-MA for 72 hr. Data are presented as mean ± SD of five independent experiments (n=5). *p < 0.05, **p < 0.005 versus vesicle control. (B) Representative

flow cytometry histogram of three independent assays (n=3) for CytoID fluorescence in the PC3 cells. Cells treated with 10 μg/ml tunicamycin or rapamycin as a positive control. Cell acquisition was performed on Attune Nxt flow cytometer (Thermo Fisher Scientific) and analyzed using

FlowJo 10.2 software. (C) TEM images with different magnifications of the PC3 cells treated with

DMSO vesicle control and LCC03. Images are representative of three independent treatments. (D,

E) Western blot analyses of the proteins involved in autophagy from the total cell extracts of the (D) parental and (E) shRNA-expressing PC3 and C4-2 cells treated with the indicated concentrations of LCC3. ß-actin is shown as the protein loading control. The expected molecular weight of each protein is indicated on the left side of the figure. The cells were treated with LCC03 for 72 hr in all assays unless specified otherwise.

Figure 3. Time and dose effect of LCC03 on ER stress activation in CRPC cells. (A, C)

Western blotting analysis of signaling molecules involved in (A) autophagy and (C) ER stress activation in the PC3 and C4-2 cells. ß-actin is shown as the protein loading control. The expected molecular weight of each protein is indicated on the left side of the figure. (B) Ultrastructural analysis of ER stress activation in the PC3 cells treated with DMSO or 10 μM LCC03 for 48 hr through TEM. Asterisks indicate the enlarged ER. Images are representative of three independent treatments.

Figure 4. Effect of PERK antagonists on LCC03-induced cell death in CRPC cells. (A, B)

Western blotting analysis of PERK signaling molecules involved in autophagy activation and in the PC3 and C4-2 cells that (A) stably expressed PERK-targeting shRNA or (B) were treated with

PERK inhibitor GSK2606414 in the presence of the indicated concentration of LCC03 for 48 hr.

Non-targeting shRNA (sh-ctr) and DMSO treatment (0 μM LCC03) are the corresponding negative controls. (C) Representative confocal fluorescent images of the PC3 and C4-2 cells transfected with LC3-GFP followed by the treatment of PERK inhibitor GSK2606414 or

DMSO-vesicle control combined with the indicated concentrations of LCC03 for 48 hr. The right panel is the enlarged images of the boxed regions at the left side. (D) Cell viability as assessed by trypan blue-exclusion assay in PC3 and C4-2 cells that expressing PERK-targeting shRNA or treated with PERK inhibitor GSK2606414 in the presence of the indicated concentration of

LCC03 for 72 hr. Data are presented as mean ± SD of five independent experiments (n=5). *p <

0.05 versus the corresponding nontargeting shRNA (sh-ctr) or DMSO-vesicle control.

Figure 5. Therapeutic effects of LCC03 in an experimental model of prostate cancer bone metastasis. (A) Bioluminescent images of representative individual mice bearing PC3-Luc tumor at tibia 1 day before LCC03 treatment (week 1) and during the 4-week monitoring period after

initial treatment. Signals were adjusted to the same color scale for the entire time course.

Quantification of photon counts of each individual at the end of the experiment (week 5) relative to that 1 day before treatment is shown on the bottom. Bars indicate the mean fold change for each (n

=10). Values of p were calculated through one-way analysis of variance. (B) Toxicity evaluation of LCC03 in tumor-bearing mice. Mean body weight–time profile (top) for each group. Data are expressed as the mean ± SD. Hematoxylin and eosin staining of multiple organs (bottom, ×200) from the representative mice treated with DMSO vesicle control and high-dose LCC03 at the end of the experiment. (C) Representative image of histopathology (H&E), immunohistochemistry for cell proliferation (Ki67), autophagy (LC3B) and apoptosis (TUNEL), and TRAP staining for osteoclasts (stained in red) in serial tumor sections of representative individual mice. The original magnification is indicated.

A novel salicylanilide derivative induces autophagy cell death in castration-resistant prostate cancer via ER stress-activated PERK signaling pathway

Chia-Ling HSIEH, Hsu-Shan Huang, Kuan-Chou Chen, et al.

Mol Cancer Ther Published OnlineFirst September 17, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-19-0387

Supplementary Access the most recent supplemental material at: Material http://mct.aacrjournals.org/content/suppl/2019/09/17/1535-7163.MCT-19-0387.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/early/2019/09/17/1535-7163.MCT-19-0387. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.