Human Multi-Lineage Progenitor Cells in Receptor/Nitric Oxide

A Functionally Coupled µ3-Like Opiate Receptor/Nitric Oxide Regulatory Pathway in Human Multi-Lineage Progenitor Cells

This information is current as Patrick Cadet, Kirk J. Mantione, Wei Zhu, Richard M. of October 2, 2021. Kream, Melinda Sheehan and George B. Stefano J Immunol 2007; 179:5839-5844; ; doi: 10.4049/jimmunol.179.9.5839 http://www.jimmunol.org/content/179/9/5839 Downloaded from

References This article cites 36 articles, 11 of which you can access for free at: http://www.jimmunol.org/content/179/9/5839.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on October 2, 2021

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

A Functionally Coupled ␮3-Like Opiate Receptor/Nitric Oxide Regulatory Pathway in Human Multi-Lineage Progenitor Cells1

Patrick Cadet, Kirk J. Mantione, Wei Zhu, Richard M. Kream, Melinda Sheehan, and George B. Stefano2

Ongoing studies from our group support the existence and biological importance of a distinct cellular signaling pathway involving ␮ endogenously synthesized, chemically authentic, L-morphine, its cognate 3 opiate receptor subtype, and constitutive NO synthase. Based on prior studies indicating evolutionary conservation and adaptation of morphinergic/NO-coupled signaling to mediate ␮ autocrine/paracrine control of cellular functions, our goal was to determine whether a functionally competent 3 opiate receptor/ NO-coupled regulatory pathway exists in human multilineage progenitor cells (MLPC) prepared from umbilical cord blood. ␮ Downloaded from Real-time PCR analysis indicated significant expression of 3 opiate receptor-encoding RNA by undifferentiated human MLPC, ␮ in the absence of traditional 1 opioid receptor-encoding RNA expression. Unpredictably, confirmatory RT-PCR analyses indi- ␮ cated cellular expression of a splice variant of the previously characterized 3 opiate receptor-encoding mRNA. Pharmacological ␮ analyses provided critical validating evidence of functional 3-like opiate receptor/NO-coupled signaling within primary cultures of undifferentiated human MLPC via morphine-evoke real-time release of NO. Control analyses indicated that morphine-stimulated NO release was markedly inhibited by prior treatment with the opiate antagonist L-naloxone or the constitutive NO http://www.jimmunol.org/ synthase inhibitor N(G)-nitro-L-arginine methyl ester and unresponsive to stimulation by the opioid peptide methionine enkepha- ␮ ␦ ␬ lin. Complementary microarray analysis demonstrated that traditional 1, , and opioid receptor gene expression is not detected in both undifferentiated and differentiated MLPC. Chemical differentiation of MLPC into neuronal progenitor cells effected significant phenotypic expression of a variety of neurally-associated genes. Our data provide compelling evidence in support of ␮ both the evolutionary primacy and primordial regulatory role of 3-like opiate receptor/NO signaling in embryogenesis. The Journal of Immunology, 2007, 179: 5839–5844.

considerable body of published work has established a ferentiation into phenotypically distinct clonal lines is temporally

temporal profile of endogenous opioid peptide and opioid defined by the complex chemical profile of their respective micro- by guest on October 2, 2021 A receptor gene expression in the development of mamma- environments (13). Previous studies of opioid regulation of hema- lian brain (1–3). Recently, similar analyses have demonstrated (4, topoesis in adult animals from other groups (14–16) have provided 5) programmed expression of opioid peptide and opioid receptor initial insights into the potential role of opioid processes in MLPC genes in cultured neural progenitor cells at various stages of dif- maturation. ferentiation. Human multilineage progenitor cells (MLPC)3 de- Ongoing studies from our group support the existence and bio- rived from postpartum umbilical cord blood have recently been logical importance of a distinct morphinergic signaling pathway established as a high resolution model (6–12) for studying bio- utilizing endogenously synthesized, chemically authentic, L-mor- chemical and molecular mechanisms underlying differentiation of ␮ ␮ phine, and its cognate 3 opiate receptor subtype. The 3 opiate multipotent progenitor cells into clonal cell lines (e.g., adipocytes, receptor is selectively activated by morphine and related morphi- osteoblasts, myocytes, vascular endothelial cells, neurons, astro- nan opiate alkaloids and is unresponsive to all classes of endoge- cytes, and oligodendrocytes). Because MLPC are nontransformed, nous opioid peptides as well as synthetic phenylpiperidine analgesics and nonimmortalized, their potential for both proliferation and dif- ␮ such as fentanyl (17–19). The 3 opiate receptor is expressed in diverse human tissues including cardiovascular endothelium, leuko- cytes, anterior segment of the eye, CNS neurons, glia, and peripheral Neuroscience Research Institute, State University of New York College, Old West- bury, NY 11568 nerves (17–19), nerves as well as invertebrate hematopoetic and ner- Received for publication May 21, 2007. Accepted for publication August 25, 2007. vous tissues (17–21). ␮ The costs of publication of this article were defrayed in part by the payment of page Morphinergic signaling involves selective coupling of the 3 2ϩ charges. This article must therefore be hereby marked advertisement in accordance opiate receptor to production and release of NO via Ca -stimu- with 18 U.S.C. Section 1734 solely to indicate this fact. lated activation of constitutive nitric oxide synthase (cNOS) and 1 This work was supported in part by Grants DA 09010 and MH 47292, and the New appears to integrate autocrine/paracrine regulatory loops within York State Empire Innovation Award Program. ␮ cellular microdomains (20, 22). It is our contention that 3 opiate 2 Address correspondence and reprint requests to Dr. George B. Stefano, Neuro- science Research Institute, State University of New York College, P.O. Box 210, Old receptor/NO coupled signaling represents a primordial system of Westbury, NY 11568. E-mail adddress: [email protected] intra/intercellular communication that has been functionally con- 3 Abbreviations used in this paper: MLPC, multi-lineage progenitor cells; L-NAME, served via extensive evolutionary adaptation, resulting in the de- N(G)-nitro-L-arginine methyl ester; cNOS, constitutive nitric oxide synthase; DA, velopment and elaboration of endogenous opioid peptide systems dopamine. and their cognate ␮, ␦, and ␬ opioid/G-protein coupled receptor- Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 linked transduction pathways.

www.jimmunol.org 5840 OPIATE PROCESSES IN HUMAN PROGENITOR CELLS

Recent data support a novel regulatory role of tonically released NO to maintain various classes of stem cells in metabolically vi- able, undifferentiated states of biological readiness (23). Accord- ␮ ingly, the present studies were designed to evaluate whether a 3 opiate receptor/NO coupled regulatory pathway exists and is functionally competent in MLPC prepared from umbilical cord blood. Real-time PCR analysis of extracted RNA from undifferentiated ␮ human MLPC indicated significant expression of 3 opiate recep- FIGURE 1. Differentiation of the MLPC cells into neuronal cells. ␮ tor-encoding RNA, in the absence of traditional 1 opioid recep- Day 1 and Day 28, Undifferentiated and differentiated human MLPC, tor-encoding RNA expression. Pharmacological analyses provided respectively. ␮ confirmatory evidence of functional 3 opiate receptor/NO coupling via morphine-evoked real-time release of NO into the bath ATCATCAGCTAGAAAATCTG-GAAGCAGAAACTGCTCCGTTGC medium. Complementary microarray analysis of extracted RNA ␮ CCTA) amplicon is located between 1371 and 1440 of the 1 gene (Table indicated that traditional ␮, ␦, and ␬ opioid receptor gene expres- ␮ I). The selective 3 sequence (bases 853–884) only lines up with the ␮ sion is not detected in both undifferentiated and differentiated first 32 bases of the TaqMan probe and primer for the 1 gene MLPC. Chemical differentiation of MLPC into neuronal pro- (CGGCCAATACAGTGGATAGAACTAATCATCAG). genitor cells effected significant phenotypic expression of a va- Reverse transcription-PCR riety of neurally-associated genes. Our data provide compelling ␮ evidence in support of both the evolutionary primacy and pri- RT-PCR analyses of 3 opiate receptor-encoding mRNA from human mordial regulatory role of ␮ -like opiate receptor/NO signaling MLPC were performed according to our previously published procedures Downloaded from 3 (20). Following first-strand cDNA synthesis, 7 ␮l of the RT product was in embryogenesis. added to the PCR mix containing TaqDNA polymerase (Invitrogen Life Technologies) and specific primers designed to amplify a selective 550 bp ␮ Materials and Methods sequence of the 3 opiate receptor transcript. The PCR was denatured at MLPC preparations 95°C for 5 min, followed by 35 cycles at 95°C for 1 min, 57°C for 1 min, and 72°C for 1 min, and then an extension step cycle at 72°C for 10 min. Frozen MLPC preparations were obtained from BioE, quickly thawed in a PCR products were analyzed on a 2% agarose gel (Sigma-Aldrich) stained http://www.jimmunol.org/ 37°C waterbath and transferred to 75 cm2 tissue culture flasks containing with ethidium bromide. The forward primer sequence was, 5Ј-GGTACT 15 ml of Mesenchymal Stem Cell Growth Medium Bullet kit (Lonza, PT- GGGAAAACCTGCTGAAGATCTGTG-3Ј, and the reverse primer was, 3001). MLPC were incubated overnight in a 5% CO2 incubator at 37°C 5Ј-CAAAAGCCAGTCTTGCTCTGGTT-3Ј. The PCR products were ex- followed by a change of medium. At a confluence of 40%, cells were cised from the gel and purified with the Qiaquick gel extraction kit (Qia- detached using 15 ml of PBS containing 0.1% EGTA, pH 7.3. Detached gen). The PCR product (250 ng) and the forward primer were sent to Lark ϫ g ␮ MLPC were pelleted by centrifugation (500 for 7 min), reseeded or Technologies for direct sequencing. Primers designed to amplify the 1 utilized for pharmacological experiments and/or RNA extraction. opioid receptor had the following sequences 5Ј-CGGATGAGCCTCTGT Total RNA was extracted from 2 ϫ 106 MLPC following lysis in 600 ␮l GAACTACTA-3Ј for the forward primer and 5Ј-GATCCTTCGAAGAT RLT buffer according to procedures outlined in the RNeasy mini kit (Qia- TCCTGTCCT-3Ј for the reverse primer and were designed to amplify a ␮ gen). RNA was eluted in 50 l RNase free H2O and a 750 ng aliquot was 1052 bp fragment of the transcript.

denatured at 95°C and reverse transcribed at 40°C for 1 h using random by guest on October 2, 2021 primers and SuperScript III RNase H-Reverse Transcriptase (Invitrogen Real-time measurement of NO release Life Technologies). Differentiation of MLPC into neural progenitor cells was accomplished Real-time release of NO from MLPC was quantified using a 4-channel ␮ in neural progenitor maintenance media containing human recombinant ESA BioStat with an NO-selective amperometric 600 m nanoprobe (In- basic fibroblast growth factor, human recombinant epidermal growth fac- novative Instruments). The well-established NO donor S-nitroso-N-acetyl- tor, neural survival factor-1 (Lonza, CC-3209) supplemented with fibro- DL-penicillamine was used to calibrate the system daily. For each pharma- ϫ 5 blast growth factor-4 (Sigma-Aldrich), Glutamax I supplement (Invitrogen cological trial, 5 10 pelleted MLPC in defined medium were placed in Life Technologies) and penicillin and streptomycin (Invitrogen Life Tech- a 1.5 ml microcentrifuge tube and the cell medium was immediately re- ϭ nologies). After the development of neurospheres (10 days), the neuro- placed with 1 ml of PBS solution (pH 7.2). The amperometric probe was spheres were further differentiated into neurons by supplementing the allowed to equilibrate for at least 10 min before being transferred to the neural progenitor maintenance media with 10 ng/ml brain-derived neu- well containing the cells. Baseline levels of NO release were determined by evaluation of real-time NO concentration in PBS. Evoked release of NO rotrophic factor (Sigma-Aldrich) and 10 ng/ml neurotrophin-3 (Sigma- Ϫ5 Ϫ7 aldrich) for 21 days (Fig. 1). Medium was changed every 3–4 days. from MLPC was evaluated at final concentrations of 10 Mto10 M morphine in the presence or absence of the ␮ opioid receptor antagonist Ϫ5 TaqMan real-time PCR analyses naloxone at 10 M or the cNOS inhibitor N(G)-nitro-L-arginine methyl Ϫ4 ester (L-NAME) at 10 M. Additional pharmacological trials utilized a ␮ Ϫ Real-time PCR analyses were employed to detect 3 opiate receptor-en- traditionally-employed saturating concentration of 10 5 M methionine en- ␮ coding RNA and traditional 1 opioid receptor-encoding RNA expression kephalin to confirm ␮ opiate receptor selectivity of NO release. by human MLPC. First strand cDNA synthesis was performed using ran- 3 dom hexamers (Invitrogen Life Technologies) and 2 ␮g of extracted cel- Gene array analysis of extracted human MLPC RNA lular RNA. RNA was denatured at 95°C for 5 min and reverse transcribed at 40°C for 1 h using SuperScript III RNase H-RT (Invitrogen Life Tech- Applied Biosystems Human Genome Survey Arrays were used to construct ␮ nologies). Primers and probes specific for the 1 opioid receptor were and differentially analyze by strict statistical criteria transcriptional/gene purchased from Applied Biosystems (part no. Hs00168570_m1). The 2ϫ expression profiles of neuronally differentiated and undifferentiated human universal master mix (Applied Biosystems) containing the PCR buffer,

MgCl2, dNTPs, and the thermal stable AmpliTaq Gold DNA polymerase was used in the PCR. Reactions were done in triplicate using 4 ␮lofRT Table I. Primers and TaqMan Probe for the ␮ opiate receptor product and RNase/DNase-free water was added to the master mix to a sequence used in real-time polymerase chain reactions ﬁnal volume of 50 ␮l. Real-time PCR for the ␤-actin reference gene was performed using Applied Biosystems part no. 401846 and only required 1 ␮l of the RT product. The PCR mixtures were transferred to a MicroAmp Primer/Probe Sequence optical 96-well reaction plate and incubated at 95°C for 10 min to activate Forward primer 5Ј-ATGCCAGTGCTCATCATTAC-3Ј the Amplitaq Gold DNA polymerase and then run for 40 cycles at 95°C for Reverse primer 5Ј-GATCCTTCGAAGATTCCTGTCCT-3Ј 30 s and 60°C for 1 min on the Applied Biosystems GeneAmp 7500 real-time TaqMan probea 5Ј-CGCCTCAAGAGTGTCCGCATGCT-3Ј PCR system. The PCR products were analyzed using the GeneAmp 7500 real-time PCR system software (Applied Biosystems). The TaqMan assay a The TaqMan probe was constructed with the 5Ј-reporter dye, 6-carboxyﬂuores- primer and probe sequence (CGGCCAATACAGTGGATAGAACTA cein, and a 3Ј-quencher dye, 6-carboxy-tetramethyl-rhodoamine. The Journal of Immunology 5841

␮ FIGURE 3. 3 opiate receptor variant partial sequence from PCR product generated by a conventional reverse transcription-PCR. The novel 333 bp sequence (underlined) is located between nucleotide position 874 and ␮ 875 of the 3 transcript.

dent experiments utilizing different pooled samples of human Ϯ MLPC, yielding highly reliable Ct values of 30.46 0.06 and Ϯ ␮ ␤ 36.91 0.16 (SEM) for 3 opiate receptor and actin amplicons, respectively. In contrast, parallel real-time RT-PCR analyses of the ␮ FIGURE 2. RT-PCR analysis of MLPC’s for ␮ -like opiate receptor. same RNA extracts employing previously validated 1 opioid re- 3 Downloaded from Lane 1, m.w. markers (bp); lane 2, undifferentiated MLPC cells; lane 3, ceptor primers, TaqMan amplicon, and ␤ actin reference standard, ␮ Ͼ differentiated MLPC cells; lane 4, 1 gene expression in MLPC cells. The yielded Ct values 40. Thus, real-time RT-PCR analyses indicate ␮ ␮ expected size fragments for 3 is 550 bp and 888 bp for the splice variant. that 1 opioid receptor-encoding RNA is not expressed by Lanes 2 and 3 demonstrate a PCR product clearly larger than the expected human MLPC. ␮ 550 bp fragment previously established for the 3 receptor-encoding ␮ mRNA. Greater expression of the 888 bp PCR product in lane 3 is reﬂected Conﬁrmatory RT-PCR analyses of 3 opiate receptor gene

by a more intense band with an apparent slightly faster migration. The expression by undifferentiated human MLPC http://www.jimmunol.org/ absence of a 1052 bp PCR product in lane 4 indicates that MLPC do not express traditional ␮ receptor encoding mRNA. Sequence analysis of To provide critical confirmation of real-time PCR detection of 1 ␮ bands in lanes 2 and 3 demonstrated that the PCR products contained 3 opiate receptor-encoding mRNA by undifferentiated human 888 bp. MLPC, conventional RT-PCR analyses were performed (20). Sur- ␮ prisingly, RT-PCR analyses utilizing previously validated 3 opiate receptor primers resulted in the amplification of an 888 bp MLPC in three independent experiments. The Applied Biosystems Human fragment, significantly larger than the 550 bp ␮ opiate receptor Genome Survey Array contains 31,700 60-mer oligonucleotides probes 3 representing a set of 27,868 individual human genes and Ͼ1,000 control fingerprint (Fig. 2). Additionally, the RT-PCR analysis failed to ␮ probes. Sequences used for microarray probe design are from curated amplify a 1052 bp fragment indicative of 1 opiate receptor-en- by guest on October 2, 2021 transcripts from the Celera Genomics Human Genome Database (www. coding mRNA expression by human MLPC. celeradiscoverysystem.com), RefSeq transcripts that have been struc- Analysis of the amplified 888 bp fragment indicated a novel 333 turally curated from the LocusLink public database (http://ncbi.nlm.nih. nucleotide sequence (underlined in Fig. 3) located between nucle- bov/LocusLink/refseq.html), high-quality cDNA sequences from the ␮ Mammalian Gene Collection (http://mgc.nci.nih.gov) and transcripts otide positions 874 and 875 of the 3 transcript. Accordingly, the that were experimentally validated at Applied Biosystems. amplified 888 bp fragment is representative of cellular expression ␮ ␮ Pelleted MLPC were resuspended in 600 l of RLT buffer and homog- of a splice variant of 3 opiate receptor-encoding mRNA, in the enized by passing the lysate 20 times througha1mlpipette tip. The samples were then processed according to the manufacturer’s detailed in- structions. In the final step, the RNA was eluted with 50 ␮l of RNase-free water by centrifugation for 1 min at 10,000 rpm. The RNA was analyzed on a model 2100 bioanalyzer (Agilent) using a total RNA nanochip according to the manufacturer’s protocol. Digoxigenin-UTP labeled cRNA was generated and linearly amplified from 1 ␮g of total RNA using Ap- plied Biosystems Chemiluminescent RT-IVT Labeling Kit v 2.0 and manufacturer’s protocol. Array hybridization, chemiluminescence detection, image acquisition, and analysis were performed using Applied Biosystems Chemilumines- cence Detection kit and Applied Biosystems 1700 Chemiluminescent Mi- croarray Analyzer according to protocols supplied by ABI. A total of 15 ␮g of labeled cRNA targets were hybridized to each chip at 55°C for 19 h. AB1700 Expression System software was used to extract assay signal, and assay signal to noise ratio values from the microarray images. The specific genes noted were selected for their relationship to endogenous morphine biosynthesis when their signal to noise ratio was Ͼ2. Results ␮ Real-time RT-PCR detection of 3 opiate receptor gene expression by undifferentiated human MLPC ␮ FIGURE 4. Representative real-time amperometric NO release from Real-time RT-PCR analyses of 3 opiate receptor gene expression 500,000 multilineage progenitor cells stimulated with 10Ϫ5 M morphine have been previously validated by our group and employ a custom- sulfate. Cells were transferred to 1.5 ml tubes and allowed to adhere for synthesized TaqMan probe and a ␤ actin TaqMan amplicon as the 18 h before assay. Cells were exposed to the noted drugs as described in the ␮ Ϫ5 Ϫ4 internal reference standard (21). Presently, the expression of 3 text, including to naloxone (10 M) and L-NAME (10 M) alone (data opiate receptor-encoding RNA was demonstrated in three indepen- not shown), which yielded no response (see Table II). 5842 OPIATE PROCESSES IN HUMAN PROGENITOR CELLS

Ϫ4 Table II. Nitric oxide release from5X105 MLPCa L-NAME at 10 M resulted in marked attenuation of the morphine-evoked release of NO into the PBS/tissue bath (Fig. 4), dem- Treatment NO levels nM (ϮSEM) onstrating the specificity of the response. In contrast to previous ␮ observations of 3 opiate receptor-stimulated NO release (17–19), Control ND Ϫ6 Ϫ7 Morphine 10Ϫ5 M 60 Ϯ 7.2 morphine concentrations of 10 and 10 M were without effect, Ϫ4 ␮ Morphine ϩ L-NAME (10 M) 5.2 Ϯ 1.3 suggesting that the splice variant of 3 opiate receptor expressed Morphine ϩ Naloxone (10Ϫ5 M) 6.3 Ϯ 2.2 by human MLPC possesses a lower intrinsic affinity for morphine. Ϫ5 Methionine Enkephalin (10 M) ND Importantly, a traditionally-employed saturating concentration of L-NAME ND the prototype opioid peptide methionine enkephalin of 10Ϫ5 M Naloxone ND was observed to be without effect on evoked release of NO from a The experiment was replicated three times. The peak height of NO release was human MLPC and indistinguishable from basal NO release (Table combined from the replicates and the SEM determined (see Fig. 2). Drugs were administered as described in the text. All values compared to the control value were II). The representative analyses depicted in Fig. 4 are supported by significant at p Ͻ 0.01 level of significance as determined via a two-way analysis of tabulated and statistically analyzed data from three independent variance. ND, None detected. series of pharmacological trials (Table II). In sum, the pharmacological trials provide strong corroborative evidence that cellular expression of a splice variant of ␮ opiate receptor-encoding absence of previously characterized ␮ opiate receptor- and ␮ 3 3 1 mRNA results in functional expression of a ␮ -like opiate receptor opiate receptor-encoding mRNAs. 3 by human MLPC that selectively transduces morphine/NO-coupled regulatory signaling.

Real-time release of NO from undifferentiated human MLPC Downloaded from Pharmacological analyses were performed to provide critical con- ␮ Gene array analysis of extracted RNA from undifferentiated and ﬁrmation that cellular expression of a splice variant of 3 opiate receptor-encoding mRNA produced functional morphinergic/NO- neuronally differentiated human MLPC coupled in primary cultures of undifferentiated human MLPC. Complementary microarray analysis of extracted RNA indicated Morphine at a ﬁnal concentration of 10Ϫ5 M promoted a strikingly that traditional ␮, ␦, and ␬ opioid receptor gene expression is not

rapid release of NO into the PBS/tissue bath to achieve a maximal detected in both undifferentiated and differentiated MLPC, sup- http://www.jimmunol.org/ concentration of 60 nM at 60 s, with an apparent exponential de- porting the earlier observations (Table III). Additionally, of the crease of extracellular NO concentration between 60 and 160 s three major types of dopamine (DA) receptor, only the D2 receptor (Fig. 4). The morphology of the morphine/NO time-effect trace is was found to be weakly expressed in undifferentiated MLPC, dis- characteristic of rapid opiate-coupled cNOS responses observed in playing an approximate 2-fold increase in differentiated MLPC. our previous work (17–19). Chemical differentiation of MLPC into neuronal progenitor cells ␮ In separate pharmacological trials, prior incubation with the 3 effected signiﬁcant increases in phenotypic expression of a variety antagonist naloxone at 10Ϫ5 M or the competitive cNOS inhibitor of neurally-associated genes including neuron speciﬁc enolase, by guest on October 2, 2021 Table III. Detection of genes of interest by microarray before and after differentiationa

Gene Symbol Gene Name S/N Pre S/N Post

Dopamine genes TH tyrosine hydroxylase nd nd D2 dopamine receptor 2.49 4.56 D1 dopamine receptor nd nd D3 dopamine receptor nd nd SLC6A3 dopamine transporter 10.57 10.12 SLC18A2 vesicular monoamine transporter nd nd Neural markers GFAP glial ﬁbrillary acidic protein nd 2.84 NTRK1 neurotrophic tyrosine kinase, receptor, type 1 nd 5.45 NTRK2 neurotrophic tyrosine kinase, receptor, type 2 nd nd NTRK3 neurotrophic tyrosine kinase, receptor, type 3 nd nd NES nestin 7.6 9.1 ENO1 enolase 1, (␣) 29.2 80.41 NRXN3 neurexin 3 27.71 52.2 NRXN2 neurexin 2 30.54 29.12 NLGN3 neuroligin 3 6.52 14.52 NLGN1 neuroligin 1 15.61 12.69 Receptor genes OPRD1 ␦ opioid receptor 1 nd nd OPRK1 ␬ opioid receptor 1 nd nd OPRM1 ␮ opioid receptor 1 nd nd TACR1 tachykinin receptor 1 nd 4.27 HTR2B 5-hydroxytryptamine (serotonin) receptor 2B nd 4.52 Morphine biosynthetic genes DDC dopa decarboxylase nd nd COMT catechol-O-methyl transferase 58.26 61.07 PNMT phenylethanolamine N-methyltransferase 2.41 2.49 CYP2D6 cytochrome P450, family 2, subfamily D, 13.58 46.66 polypeptide 6

a Applied Biosystems calculated signal to noise ratios were reported when found to be Ͼ2. nd, Not Ͼ2. The Journal of Immunology 5843

neurexin 3, neuroligin 3, nestin, neurotrophic tyrosine kinase recent studies (23) demonstrate that a NO-cGMP signaling system ceptor type 1, and glial fibrillary acidic protein (Table III). exists in embryonic stem cells and may be involved in forming committed precursor cells. Discussion Importantly, mammalian and human cells have the ability to ␮ The present study demonstrates the functional expression of a 3 make morphine via a multienzyme mediated process, containing opiate receptor subtype variant by human MLPC. The functional numerous feedback inhibitory steps (24, 25), and pharmacological ␮ role and potential biological importance of expressed 3 opiate administration of high concentrations of exogenous morphine may receptors are supported by independent lines of pharmacological alter one or all of these regulatory steps (26). Our recent work evidence demonstrating that morphine-evoked release of NO from provides compelling prima facie evidence that chemically authen- MLPC is inhibited either by a selective receptor antagonist or by tic morphine is endogenously synthesized by diverse animal cel- L-NAME, a competitive inhibitor of cNOS. Importantly, a saturat- lular systems from L-tyrosine-derived small molecules within a ing concentration of the prototype opioid peptide methionine en- strikingly similar biochemical pathway to that described in opium ␮ ␦ ␬ kephalin, capable of activating traditional 1, , and opioid re- poppy (24, 25, 37, 38). ceptors, was observed to be without effect on evoked release of NO In conclusion, we have identified, for the first time in human ␮ from human MLPC. MLPC, the expression of a 3-like opiate receptor variant of the Complementary microarray analysis of extracted RNA indicated opiate receptor gene family. These progenitor cells not only ex- that traditional ␮, ␦, and ␬ opioid receptor gene expression is not pressed this variant, but also the protein produced from this tran- ␮ detected in both undifferentiated and differentiated MLPC, and script exhibits the biochemical characteristic of the 3 receptor by other prominent classes of neural receptors such as the tachykinin the production of NO in the presence of morphine. This finding is and 5-HT2B are only weakly expressed following differentiation. important in further understanding the role of endogenous opiates Downloaded from Incomplete expression of an active DA system is also indicated by and opiate receptors in the developmental process, which may the lack of expression of DA1 and DA3 receptors and the vesicular have a strong implication in the development of tolerance in pain DA transporter. The strong expression of the cellular DA trans- and in drug addiction. Our data also provide compelling evidence porter suggests that peripherally synthesized DA may be taken up in support of both the evolutionary primacy and primordial regu- ␮ and utilized for nonsynaptic functions or for the synthesis of latory role of a 3-like opiate receptor/NO in embryogenesis. endogenous morphine (24, 25). Importantly, candidate genes in- http://www.jimmunol.org/ volved in endogenous morphine biosynthesis including catechol-O- Disclosures methyltransferase, cytochrome P450 2D6, and phenylethanolamine The authors have no financial conflict of interest. N-methyltransferase are expressed in both undifferentiated and differentiated MLPC (26) (Table III), suggesting that MLPC have the References potential for morphine expression. Taken together, for the first 1. Zamir, N., R. Quirion, and M. Segal. 1985. Ontogeny and regional distribution of time, we show elements of an endogenous morphine signaling in proenkephalin- and prodynorphin-derived peptides and opioid receptors in rat hippocampus. Neuroscience 15: 1025–1034. progenitor stem cells, suggesting the presence and physiological 2. Leslie, F. M., Y. Chen, and U. H. Winzer-Serhan. 1998. Opioid receptor and significance of a ␮ –like receptor, during early development. peptide mRNA expression in proliferative zones of fetal rat central nervous sys- 3 by guest on October 2, 2021 ␮ ␮ tem. Can. J. Physiol. Pharmacol. 76: 284–293. The 3 receptor cDNA, compared with 1, is truncated at the Ј 3. Zhu, Y., M. S. Hsu, and J. E. Pintar. 1998. Developmental expression of the ␮, 5 -end, missing several hundred nucleotides, but the middle and ␬, and ␦ opioid receptor mRNAs in mouse. J. Neurosci. 18: 2538–2549. ␮ Ј conserved region sequences are identical with 1 (20). The 3 end 4. Ventura, C., and M. Maioli. 2000. Opioid peptide gene expression primes car- of ␮ exhibits 100% identity to a portion of the 3Ј end of the ␮ diogenesis in embryonal pluripotent stem cells. Circ. Res. 87: 189–194. 3 1 5. Kim, E., A. L. Clark, A. Kiss, J. W. Hahn, R. Wesselschmidt, C. J. Coscia, and variant, followed by a new fragment of 263 bases, and then a M. M. Belcheva. 2006. ␮- and ␬-opioids induce the differentiation of embryonic Ј ␮ stem cells to neural progenitors. J. Biol. Chem. 281: 33749–33760. 201-bp fragment of the 3 end of the 1 gene untranslated region (20). As observed presently, the ␮ -like opiate receptor represents 6. McGuckin, C. P., N. Forraz, Q. Allouard, and R. Pettengell. 2004. Umbilical cord 3 blood stem cells can expand hematopoietic and neuroglial progenitors in vitro. a typical transmembrane G protein-coupled receptor with a novel Exp. Cell Res. 295: 350–359. 7. Collins, D. P. 2006. Isolation and characterization of umbilical cord blood-de- linkage to cNOS (17–19, 27–31) as well as having an additional ϩ ϩ ␮ rived multipotent stem cells arising from an adherent CD45 CD34 cell subset. 333 bases inserted within the coding region of the 3 transcript. In 4th Annual International Umbilical Cord Blood Transplantation Symposium, The novelty and selectivity of this G protein-coupled, naloxone- May 19–20. St. Paul, MN. sensitive receptor was made apparent when a variety of opioid 8. McGuckin, C. P., N. Forraz, M. O. Baradez, S. Navran, J. Zhao, R. Urban, R. Tilton, and L. Denner. 2005. Production of stem cells with embryonic char- peptides were found to be ineffective in displacing specifically acteristics from human umbilical cord blood. Cell Prolif. 38: 245–255. bound dihydromorphine as well as in stimulating NO release, 9. McGuckin, C., N. Forraz, M. O. Baradez, C. Basford, A. M. Dickinson, whereas opiate alkaloids were quite potent (17, 20). In this report, S. Navran, and J. D. Hartgerink. 2006. Embryonic-like stem cells from umbilical cord blood and potential for neural modeling. Acta Neurobiol. Exp. 66: 321–329. we found that only one set of ␮-specific primers used in the PCR 10. Forraz, N., R. Pettengell, and C. P. McGuckin. 2004. Characterization of a lin- (from map position 896-1336) yielded a specific PCR product (32). eage-negative stem-progenitor cell population optimized for ex vivo expansion and enriched for LTC-IC. Stem Cells 22: 100–108. This segment of the cDNA encodes the third extracellular loop of 11. Goodwin, H. S., A. R. Bicknese, S. N. Chien, B. D. Bogucki, C. O. Quinn, and the receptor that is important for ␮ agonist selectivity (33, 34). D. A. Wall. 2001. Multilineage differentiation activity by cells isolated from Functional expression of a ␮ -like opiate receptor by embryonic umbilical cord blood: expression of bone, fat, and neural markers. Biol. Blood 3 Marrow Transplant. 7: 581–588. stem cells suggests a role as a primordial or progenitor opiate 12. Lee, O. K., T. K. Kuo, W. M. Chen, K. D. Lee, S. L. Hsieh, and T. H. Chen. 2004. signaling system. Morphine-mediated NO production may there- Isolation of multipotent mesenchymal stem cells from umbilical cord blood. fore represent an original transductive pathway underlying the cel- Blood 103: 1669–1675. 13. Horowitz, D., J. F. Callahan, L. M. Pelus, S. Fukuda, and A. G. King. 2002. lular actions of opiates. NO signaling has been demonstrated in Inhibition of hematopoietic progenitor cell growth by Tyr-MIF, an endogenous embryonic cells, adding and supporting the current findings (23, opiate modulator, and its degradation products. Int. Immunopharmacol. 2: 721–730. 35). NO inhibits subventricular zone-derived neural stem cells pro- 14. Rameshwar, P., A. Poddar, and P. Gascon. 1997. Hematopoietic regulation me- liferation, which was found not to involve cGMP synthesis (36). diated by interactions among the neurokinins and cytokines. Leuk. Lymphoma. These neurosphere cells expressed the neuronal and endothelial 28: 1–10. 15. Broome, C. S., A. D. Whetton, and J. A. Miyan. 2000. Neuropeptide control of isoforms of NO and produced NO in culture. This study further bone marrow neutrophil production is mediated by both direct and indirect effects suggests NO may be acting in a autocrine/paracrine manner. Re- on CFU-GM. Br. J. Haematol. 108: 140–150. 5844 OPIATE PROCESSES IN HUMAN PROGENITOR CELLS

16. Sharp, B. M., S. Roy, and J. M. Bidlack. 1998. Evidence for opioid receptors on 27. Stefano, G. B., A. Hartman, T. V. Bilfinger, H. I. Magazine, Y. Liu, F. Casares, cells involved in host defense and the immune system. J. Neuroimmunol. 83: and M. S. Goligorsky. 1995. Presence of the ␮3 opiate receptor in endothelial 45–56. cells: coupling to nitric oxide production and vasodilation. J. Biol. Chem. 270: 17. Stefano, G. B., A. Digenis, S. Spector, M. K. Leung, T. V. Bilfinger, 30290–30293. M. H. Makman, B. Scharrer, and N. N. Abumrad. 1993. Opiate-like substances 28. Magazine, H. I., Y. Liu, T. V. Bilfinger, G. L. Fricchione, and G. B. Stefano. in an invertebrate, an opiate receptor on invertebrate and human immunocytes, 1996. Morphine-induced conformational changes in human monocytes, granulo- and a role in immunosuppression. Proc. Natl. Acad. Sci. USA 90: 11099–11103. cytes, and endothelial cells and in invertebrate immunocytes and microglia are 18. Makman, M. H., T. V. Bilfinger, and G. B. Stefano. 1995. Human granulocytes mediated by nitric oxide. J. Immunol. 156: 4845–4850. contain an opiate receptor mediating inhibition of cytokine-induced activation 29. Liu, Y., D. Shenouda, T. V. Bilfinger, M. L. Stefano, H. I. Magazine, and and chemotaxis. J. Immunol. 154: 1323–1330. G. B. Stefano. 1996. Morphine stimulates nitric oxide release from invertebrate 19. Stefano, G. B., A. Hartman, T. V. Bilfinger, H. I. Magazine, Y. Liu, F. Casares, microglia. Brain Res. 722: 125–131. and M. S. Goligorsky. 1995. Presence of the ␮3 opiate receptor in endothelial 30. Stefano, G. B., B. Scharrer, E. M. Smith, T. K. Hughes, H. I. Magazine, cells: coupling to nitric oxide production and vasodilation. J. Biol. Chem. 270: T. V. Bilfinger, A. Hartman, G. L. Fricchione, Y. Liu, and M. H. Makman. 1996. 30290–30293. Opioid and opiate immunoregulatory processes. Crit. Rev. Immunol. 16: 20. Cadet, P., K. J. Mantione, and G. B. Stefano. 2003. Molecular identification and 109–144. functional expression of ␮3, a novel alternatively spliced variant of the human ␮ 31. Stefano, G. B., and B. Scharrer. 1996. The presence of the ␮3 opiate receptor in opiate receptor gene. J. Immunol. 170: 5118–5123. invertebrate neural tissues. Comp. Biochem. Physiol. C 113: 369–373. 21. Cadet, P., K. J. Mantione, T. V. Bilfinger, and G. B. Stefano. 2004. Differential 32. Cadet, P., T. V. Bilfinger, C. Fimiani, D. Peter, and G. B. Stefano. 2000. Human expression of the human ␮ opiate receptor from different primary vascular en- vascular and cardiac endothelia express ␮ opiate receptor transcripts. Endothe- dothelial cells. Med. Sci. Monit. 10: BR351–BR355. lium 7: 185–191. 22. Prevot, V., C. Rialas, D. Croix, M. Salzet, J.-P. Dupouy, P. Puolain, 33. Sonetti, D., E. Ottaviani, and G. B. Stefano. 1997. Opiate signaling regulates J. C. Beauvillain, and G. B. Stefano. 1998. Morphine and anandamide coupling microglia activities in the invertebrate nervous system. Gen. Pharmacol. 29: to nitric oxide stimulated GnRH and CRF release from rat median eminence: 39–47. neurovascular regulation. Brain Res. 790: 236–244. 34. Matthes, H. W., R. Maldonado, F. Simonin, O. Valverde, S. Slowe, I. Kitchen, 23. Madhusoodanan, K. S., and F. Murad. 2007. NO-cGMP signaling and regener- K. Befort, A. Dierich, M. Le meur, P. Dolle´, et al. 1996. Loss of morphine- ative medicine involving stem cells. Neurochem. Res. 32: 681–694. induced analgesia, reward effect and withdrawal symptoms in mice lacking the ␮ 24. Zhu, W., K. J. Mantione, L. Shen, P. Cadet, T. Esch, Y. Goumon, E. Bianchi, opioid receptor gene. Nature 383: 819–823. Downloaded from D. Sonetti, and G. B. Stefano. 2005. Tyrosine and tyramine increase endogenous 35. Mujoo, K., J. S. Krumenacker, Y. Wada, and F. Murad. 2006. Differential ex- ganglionic morphine and dopamine levels in vitro and in vivo: CYP2D6 and pression of nitric oxide signaling components in undifferentiated and differenti- tyrosine hydroxylase modulation demonstrates a dopamine coupling. Med. Sci. ated human embryonic stem cells. Stem Cells Dev. 15: 779–787. Monit. 11: BR397–BR404. 36. Torroglosa, A., M. Murillo-Carretero, C. Romero-Grimaldi, E. R. Matarredona, 25. Zhu, W., P. Cadet, G. Baggerman, K. J. Mantione, and G. B. Stefano. 2005. A. Campos-Caro, and C. Estrada. 2007. Nitric oxide decreases subventricular Human white blood cells synthesize morphine: CYP2D6 modulation. J. Immunol. zone stem cell proliferation by inhibition of epidermal growth factor receptor and 175: 7357–7362. phosphoinositide-3-kinase/Akt pathway. Stem Cells 25: 88–97.

26. Mantione, K. J., P. Cadet, W. Zhu, R. M. Kream, M. Sheehan, G. L. Fricchione, 37. Kream, R. M., and G. B. Stefano. 2006. De novo biosynthesis of morphine in http://www.jimmunol.org/ Y. Goumon, T. Esch, and G. B. Stefano. 2007. Endogenous morphine signaling animal cells: an evidence-based model. Med. Sci. Monit. 12: RA207–RA219. via nitric oxide regulates the expression of CYP2D6 and COMT: autocrine/para- 38. Kream, R. M., and G. B. Stefano. 2006. Morphine synthesis in animals (Edito- crine feedback inhibition. Addict. Biol. doi: 10.111/j.1369–1600.2007.00072.X. rial). Med. Sci. Monit. 12: ED1–ED2. by guest on October 2, 2021