DOCSLIB.ORG

WO 2014/152940 Al 25 September 2014 (25.09.2014) P O P C T

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2014/152940 Al 25 September 2014 (25.09.2014) P O P C T (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2014/152940 Al 25 September 2014 (25.09.2014) P O P C T (51) International Patent Classification: DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12N 15/00 (2006.01) C12N 15/88 (2006.01) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, A61K 48/00 (2006.01) KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, (21) International Application Number: OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, PCT/US2014/028330 SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, (22) International Filing Date: TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, 14 March 2014 (14.03.2014) ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 61/784,766 14 March 2013 (14.03.2013) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, (71) Applicant: SHIRE HUMAN GENETIC THERAPIES, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, INC. [US/US]; 300 Shire Way, Lexington, Massachusetts TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, 0242 1 (US). KM, ML, MR, NE, SN, TD, TG). (72) Inventor: HEARTLEIN, Michael; c/o SHIRE HUMAN Declarations under Rule 4.17 : GENETIC THERAPIES, INC., 300 Shire Way, Lexington, — as to applicant's entitlement to apply for and be granted a Massachusetts 02421 (US). patent (Rule 4.1 7(H)) (74) Agents: CHEN, Fangli et al; Choate, Hall & Stewart Published: LLP, Two International Place, Boston, Massachusetts 021 10 (US). — with international search report (Art. 21(3)) (81) Designated States (unless otherwise indicated, for every — before the expiration of the time limit for amending the kind of national protection available): AE, AG, AL, AM, claims and to be republished in the event of receipt of AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, amendments (Rule 48.2(h)) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, (54) Title: MRNA THERAPEUTIC COMPOSITIONS AND USE TO TREAT DISEASES AND DISORDERS (57) Abstract: Disclosed are compositions and methods for producing therapeutic fusion proteins in vivo. The compositions and methods disclosed herein are capable of ameliorating diseases by providing therapeutic protein delivery. MRNA THERAPEUTIC COMPOSITIONS AND USE TO TREAT DISEASES AND DISORDERS CROSS REFERENCE TO RELATED APPLICATIONS [0001] This patent application claims the benefit of United States Provisional Patent Application serial number 61/784,766, filed March 14, 2013, the entirety of which is incorporated herein by reference. BACKGROUND OF THE INVENTION [0002] Conventional gene therapy involves the use of DNA for insertion of desired genetic information into host cells. The DNA introduced into the cell is usually integrated into the genome of one or more transfected cells, allowing for long- lasting action of the introduced genetic material in the host. While there may be preceived benefits to such sustained action, integration of exogenous DNA into a host genome may also have many deleterious effects. For example, it is possible that the introduced DNA will be inserted into an intact gene, resulting in a mutation which impedes or even totally eliminates the function of the endogenous gene. Thus, gene therapy with DNA may result in the impairment of a vital genetic function in the treated host, such as e.g., elimination or deleteriously reduced production of an essential enzyme or interruption of a gene critical for the regulation of cell growth, resulting in unregulated or cancerous cell proliferation. In addition, with conventional DNA based gene therapy it is necessary for effective expression of the desired gene product to include a strong promoter sequence, which again may lead to undesirable changes in the regulation of normal gene expression in the cell. It is also possible that the DNA based genetic material will result in the induction of undesired anti-DNA antibodies, which in turn, may trigger a possibly fatal immune response. [0003] In contrast to DNA, the use of RNA as a gene therapy agent is substantially safer because RNA is not integrated into the genome of the transfected cell, thus eliminating the concern that the introduced genetic material will disrupt the normal functioning of an essential gene, or cause a mutation that results in deleterious or oncogenic effects. RNA therapy also does not require extraneous promoter for effective translation of the encoded protein, again avoiding possible deleterious side effects. In addition, any deleterious effects that do result from mRNA based on gene therapy would be of limited duration due to the relatively short half-life Consequently, for many applications the transient nature of mRNA and short life span of the resulting protein can be desirable, compared to the longer lasting stable integration achieved using DNA based gene therapy. [0004] However, in some cases, mRNA instability and short half-life limits its therapeutic effects. Therefore, there is a need for enhancing mRNA stability and prolong half-life for more effective and successful therapeutic use. SUMMARY OF THE INVENTION [0005] The invention provides improved mRNA therapy that has increased mRNA stability and prolonged half-life, among other things. In particular, the invention is based on mRNA encoding a therapeutic protein fused to a polypeptide that is capable of binding to an Fc receptor ("Therapeutic Fusion Protein"), for delivery to one or more target cells for production of therapeutic levels of functional protein. Without wishing to be bound by any theory, it is contemplated that such therapeutic fusion protein is readily transported from the target cell into systemic circulation via an Fc receptor and/or secreted from the cell, recaptured by an Fc receptor and then transcytosed into the systemic circulation. In certain embodiments, the therapeutic protein encoded is naturally secreted and thus naturally associated with an appropriate signal sequence. In other embodiments mRNA encoding a protein that is not normally secreted may be operatively linked to an appropriate signal sequence that results in the secretion of the translated protein. [0006] In certain embodiments, the compositions of the invention are able to translocate, i.e., move intact by either active or passive means from initial target cells (e.g., lung cells) to the systemic blood supply where they are then deposited in different tissues (e.g., liver cells). In these embodiments, the cells where the mRNA is deposited act as a depot for the production of therapeutic protein, which is then readily transported out of the depot cells into systemic circulation via an Fc receptor. [0007] In some embodiments, the compositions of the invention are administered to the lung by inhalation, aerosolization, nebulization, or instillation. Pulmonary delivery provides significant advantages over intravenous infusions or local injections. It eliminates injection site or infusion reactions and should reduce pain upon administration. [0008] Thus, the invention provides compositions and methods for delivery of therapeutic proteins through non-invasive pulmonary applications that result in the production of therapeutically effective levels of protein in both lung and non-lung cells, which is then readily transported into systemic circulation via an Fc receptor. This results in the accumulation of therapeutically effective systemic concentrations of the encoded protein by simple inhalation of the synthetic mRNA compositions of the invention. In addition to facilitating delivery of the fusion protein to the circulatory system, the polypeptide that is capable of binding to an Fc receptor also improves systemic exposure by extending protein half-life. [0009] The compositions and methods of the invention are useful in the management and treatment of a large number of diseases, including but not limited to diseases which result from protein and/or enzyme deficiencies or malfunction. In some embodiments, individuals suffering from such diseases may have underlying genetic defects that lead to the compromised expression of a protein or enzyme, including, for example, the non-synthesis of the secreted protein, the reduced synthesis of the secreted protein, or synthesis of a secreted protein lacking or having diminished biological activity. In some embodiments, the methods and compositions of the invention are useful for the treatment of lysosomal storage disorders and/or urea cycle metabolic disorders that occur as a result of one or more defects in the biosynthesis of secreted enzymes involved in the urea cycle. [0010] The compositions of the invention comprise an mRNA encoding a therapeutic protein fused to a polypeptide that is capable of binding to an Fc receptor (i.e., mRNA that encodes a Therapeutic Fusion Protein). Optionally, the mRNA may include one or more untranslated regions. The compositions of the invention may further comprise a transfer vehicle, such as, e.g., a lipid nanoparticle or a polymeric carrier. The mRNA can encode any clinically useful secreted protein or any clinically useful protein that has been engineered to include a signal sequence that allows the protein to be secreted. In one aspect of the invention, the therapeutic protein is chosen from proteins listed in Tables 1-3, mammalian homologs thereof, and homologs from animals of veterinary or industrial interest thereof. The polypeptide that binds to an Fc receptor can be, e.g., an immunoglobulin Fc domain or an FcRn binding peptide.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Educational Paper Ciliopathies
    Eur J Pediatr (2012) 171:1285–1300 DOI 10.1007/s00431-011-1553-z REVIEW Educational paper Ciliopathies Carsten Bergmann Received: 11 June 2011 /Accepted: 3 August 2011 /Published online: 7 September 2011 # The Author(s) 2011. This article is published with open access at Springerlink.com Abstract Cilia are antenna-like organelles found on the (NPHP) . Ivemark syndrome . Meckel syndrome (MKS) . surface of most cells. They transduce molecular signals Joubert syndrome (JBTS) . Bardet–Biedl syndrome (BBS) . and facilitate interactions between cells and their Alstrom syndrome . Short-rib polydactyly syndromes . environment. Ciliary dysfunction has been shown to Jeune syndrome (ATD) . Ellis-van Crefeld syndrome (EVC) . underlie a broad range of overlapping, clinically and Sensenbrenner syndrome . Primary ciliary dyskinesia genetically heterogeneous phenotypes, collectively (Kartagener syndrome) . von Hippel-Lindau (VHL) . termed ciliopathies. Literally, all organs can be affected. Tuberous sclerosis (TSC) . Oligogenic inheritance . Modifier. Frequent cilia-related manifestations are (poly)cystic Mutational load kidney disease, retinal degeneration, situs inversus, cardiac defects, polydactyly, other skeletal abnormalities, and defects of the central and peripheral nervous Introduction system, occurring either isolated or as part of syn- dromes. Characterization of ciliopathies and the decisive Defective cellular organelles such as mitochondria, perox- role of primary cilia in signal transduction and cell isomes, and lysosomes are well-known
    [Show full text]
  • Genome-Wide Association Studies Identify Genetic Loci Associated With
    SUPPLEMENTARY DATA Genome-wide Association Studies Identify Genetic Loci Associated with Albuminuria in Diabetes SUPPLEMENTAL MATERIALS This work is dedicated to the memory of our colleague Dr. Wen Hong Linda Kao, a wonderful person, brilliant scientist and central member of the CKDGen Consortium. 1 ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1313/-/DC1 SUPPLEMENTARY DATA Table of Contents SUPPLEMENTARY FIGURE 1: QQ PLOTS FOR ALL GWAS META-ANALYSES ............................................. 3 SUPPLEMENTARY FIGURE 2: MANHATTAN PLOTS FOR ALL GWAS META-ANALYSES ............................. 4 SUPPLEMENTARY FIGURE 3: REGIONAL ASSOCIATION PLOTS............................................................... 6 SUPPLEMENTARY FIGURE 4: EVALUATION OF GLOMERULOSCLEROSIS IN RAB38 KO, CONGENIC AND TRANSGENIC RATS. ........................................................................................................................... 17 SUPPLEMENTARY TABLE 1: CHARACTERISTICS OF THE STUDY POPULATIONS ..................................... 18 SUPPLEMENTARY TABLE 2: INFORMATION ABOUT STUDY DESIGN AND UACR MEASUREMENT .......... 20 SUPPLEMENTARY TABLE 3: STUDY-SPECIFIC INFORMATION ABOUT GENOTYPING, IMPUTATION AND DATA MANAGEMENT AND ANALYSIS ................................................................................................ 31 SUPPLEMENTARY TABLE 4: SNPS ASSOCIATED WITH UACR AMONG ALL INDIVIDUALS WITH A P-VALUE OF <1E-05. .......................................................................................................................................
    [Show full text]
  • Versican V2 Assembles the Extracellular Matrix Surrounding the Nodes of Ranvier in the CNS
    The Journal of Neuroscience, June 17, 2009 • 29(24):7731–7742 • 7731 Cellular/Molecular Versican V2 Assembles the Extracellular Matrix Surrounding the Nodes of Ranvier in the CNS María T. Dours-Zimmermann,1 Konrad Maurer,2 Uwe Rauch,3 Wilhelm Stoffel,4 Reinhard Fa¨ssler,5 and Dieter R. Zimmermann1 Institutes of 1Surgical Pathology and 2Anesthesiology, University Hospital Zurich, CH-8091 Zurich, Switzerland, 3Vascular Wall Biology, Department of Experimental Medical Science, University of Lund, S-221 00 Lund, Sweden, 4Center for Biochemistry, Medical Faculty, University of Cologne, D-50931 Cologne, Germany, and 5Department of Molecular Medicine, Max Planck Institute of Biochemistry, D-82152 Martinsried, Germany The CNS-restricted versican splice-variant V2 is a large chondroitin sulfate proteoglycan incorporated in the extracellular matrix sur- rounding myelinated fibers and particularly accumulating at nodes of Ranvier. In vitro, it is a potent inhibitor of axonal growth and therefore considered to participate in the reduction of structural plasticity connected to myelination. To study the role of versican V2 during postnatal development, we designed a novel isoform-specific gene inactivation approach circumventing early embryonic lethality of the complete knock-out and preventing compensation by the remaining versican splice variants. These mice are viable and fertile; however, they display major molecular alterations at the nodes of Ranvier. While the clustering of nodal sodium channels and paranodal structures appear in versican V2-deficient mice unaffected, the formation of the extracellular matrix surrounding the nodes is largely impaired. The conjoint loss of tenascin-R and phosphacan from the perinodal matrix provide strong evidence that versican V2, possibly controlled by a nodal receptor, organizes the extracellular matrix assembly in vivo.
    [Show full text]
  • Case Report a Fetus with Kabuki Syndrome 2 Detected by Chromosomal Microarray Analysis
    Int J Clin Exp Pathol 2020;13(2):302-306 www.ijcep.com /ISSN:1936-2625/IJCEP0104334 Case Report A fetus with Kabuki syndrome 2 detected by chromosomal microarray analysis Chen-Zhao Lin1, Bi-Ru Qi1, Jian-Su Hu2, Xiu-Qiong Huang3 Departments of 1Obstetrics and Gynecology, 2Ultrasound, 3Laboratory Medicine, Fuzhou Municipal First Hospital Affiliated to Fujian Medical University, Fuzhou 350009, Fujian Province, The People’s Republic of China Received November 1, 2019; Accepted January 26, 2020; Epub February 1, 2020; Published February 15, 2020 Abstract: Background: Kabuki syndrome is a rare multiple congenital anomaly syndrome characterized by distinct facial features, intellectual disability, cardiovascular and musculoskeletal abnormalities, persistence of fetal finger- tip pads, and postnatal growth deficiency. Currently, the diagnosis mainly depends on clinical manifestations and genetic testing. To date, there is no report on the identification Kabuki syndrome in fetuses using chromosomal microarray analysis (CMA). Case presentation: A fetus was identified with growth retardation and cardiovascular abnormality on color Doppler ultrasonography; however, non-invasive prenatal testing (NIPT) revealed a low risk and G-banding karyotyping revealed no abnormal karyotype detected. CMA identified a 1.3 Mb deletion on the X chromosome (Xp11.3) containing KDM6A, DUSP21, MIR222, MIR221 and CXorf36 genes. The fetus was diagnosed with Kabuki syndrome 2, and labor was induced. In addition, CMA detected a 1.3 Mb deletion in the chromosome Xp11.3 in the mother, which contains 5 genes namely KDM6A, DUSP21, MIR222, MIR221 and CXorf36, while no chromosomal abnormality was identified in the father. Conclusions: We report a fetus with Kabuki syndrome 2 detected using CMA.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Synergistic Genetic Interactions Between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models
    BASIC RESEARCH www.jasn.org Synergistic Genetic Interactions between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models Rory J. Olson,1 Katharina Hopp ,2 Harrison Wells,3 Jessica M. Smith,3 Jessica Furtado,1,4 Megan M. Constans,3 Diana L. Escobar,3 Aron M. Geurts,5 Vicente E. Torres,3 and Peter C. Harris 1,3 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background Autosomal recessive polycystic kidney disease (ARPKD) and autosomal dominant polycystic kidney disease (ADPKD) are genetically distinct, with ADPKD usually caused by the genes PKD1 or PKD2 (encoding polycystin-1 and polycystin-2, respectively) and ARPKD caused by PKHD1 (encoding fibrocys- tin/polyductin [FPC]). Primary cilia have been considered central to PKD pathogenesis due to protein localization and common cystic phenotypes in syndromic ciliopathies, but their relevance is questioned in the simple PKDs. ARPKD’s mild phenotype in murine models versus in humans has hampered investi- gating its pathogenesis. Methods To study the interaction between Pkhd1 and Pkd1, including dosage effects on the phenotype, we generated digenic mouse and rat models and characterized and compared digenic, monogenic, and wild-type phenotypes. Results The genetic interaction was synergistic in both species, with digenic animals exhibiting pheno- types of rapidly progressive PKD and early lethality resembling classic ARPKD. Genetic interaction be- tween Pkhd1 and Pkd1 depended on dosage in the digenic murine models, with no significant enhancement of the monogenic phenotype until a threshold of reduced expression at the second locus was breached.
    [Show full text]
  • Characterization of Α-L-Fucosidase and Other Digestive Hydrolases From
    Acta Tropica 141 (2015) 118–127 Contents lists available at ScienceDirect Acta Tropica journal homepage: www.elsevier.com/locate/actatropica Characterization of ␣-L-fucosidase and other digestive hydrolases from Biomphalaria glabrata Natalia N. Perrella a,b, Rebeca S. Cantinha c,d, Eliana Nakano c, Adriana R. Lopes a,∗ a Laboratory of Biochemistry and Biophysics—Instituto Butantan, São Paulo, Brazil b Programa de Pós Graduac¸ ão Interunidades em Biotecnologia PPIB, Universidade de São Paulo, São Paulo, SP, Brazil c Laboratory of Parasitology—Instituto Butantan, São Paulo, Brazil d Instituto de Pesquisas Energéticas e Nucleares, Universidade de São Paulo, São Paulo, SP, Brazil article info abstract Article history: Schistosoma mansoni is one of the major agents of the disease Schistosomiasis, which is one of the Received 10 February 2014 major global public health concerns. Biomphalaria glabrata is an obligate intermediate mollusc host of Received in revised form 3 July 2014 S. mansoni. Although the development of S. mansoni occurs in the snail hepatopancreas, studies that Accepted 12 August 2014 focus on this organ remain limited. In this study, we biochemically identified five distinct carbohy- Available online 16 September 2014 drases (amylase, maltase, ␣-glucosidase, trehalase, and ␣-L-fucosidase), lipases, and peptidases in the B. glabrata hepatopancreas and focused on the isolation and characterization of the activity of ␣-L- Keywords: fucosidase. The isolated ␣-L-fucosidase has a molecular mass of 141 kDa, an optimum pH of 5.8, and Hepatopancreas ␣ Enzymes is inhibited by Tris, fucose, and 1-deoxyfuconojirimycin. B. glabrata -L-fucosidase is an exoglycosidase ␮ ␣-L-Fucosidase that can hydrolyze the natural substrate fucoidan to fucose residues.
    [Show full text]
  • Glycoproteomics-Based Signatures for Tumor Subtyping and Clinical Outcome Prediction of High-Grade Serous Ovarian Cancer
    ARTICLE https://doi.org/10.1038/s41467-020-19976-3 OPEN Glycoproteomics-based signatures for tumor subtyping and clinical outcome prediction of high-grade serous ovarian cancer Jianbo Pan 1,2,3, Yingwei Hu1,3, Shisheng Sun 1,3, Lijun Chen1, Michael Schnaubelt1, David Clark1, ✉ Minghui Ao1, Zhen Zhang1, Daniel Chan1, Jiang Qian2 & Hui Zhang 1 1234567890():,; Inter-tumor heterogeneity is a result of genomic, transcriptional, translational, and post- translational molecular features. To investigate the roles of protein glycosylation in the heterogeneity of high-grade serous ovarian carcinoma (HGSC), we perform mass spectrometry-based glycoproteomic characterization of 119 TCGA HGSC tissues. Cluster analysis of intact glycoproteomic profiles delineates 3 major tumor clusters and 5 groups of intact glycopeptides. It also shows a strong relationship between N-glycan structures and tumor molecular subtypes, one example of which being the association of fucosylation with mesenchymal subtype. Further survival analysis reveals that intact glycopeptide signatures of mesenchymal subtype are associated with a poor clinical outcome of HGSC. In addition, we study the expression of mRNAs, proteins, glycosites, and intact glycopeptides, as well as the expression levels of glycosylation enzymes involved in glycoprotein biosynthesis pathways in each tumor. The results show that glycoprotein levels are mainly controlled by the expression of their individual proteins, and, furthermore, that the glycoprotein-modifying glycans cor- respond to the protein levels of glycosylation enzymes. The variation in glycan types further shows coordination to the tumor heterogeneity. Deeper understanding of the glycosylation process and glycosylation production in different subtypes of HGSC may provide important clues for precision medicine and tumor-targeted therapy.
    [Show full text]
  • Histatin-1 Attenuates LPS-Induced Inflammatory Signaling in RAW264
    International Journal of Molecular Sciences Article Histatin-1 Attenuates LPS-Induced Inflammatory Signaling in RAW264.7 Macrophages Sang Min Lee 1 , Kyung-No Son 1, Dhara Shah 1, Marwan Ali 1, Arun Balasubramaniam 1, Deepak Shukla 1,2 and Vinay Kumar Aakalu 1,3,* 1 Department of Ophthalmology and Visual Sciences, University of Illinois at Chicago, Chicago, IL 60612, USA; [email protected] (S.M.L.); [email protected] (K.-N.S.); [email protected] (D.S.); [email protected] (M.A.); [email protected] (A.B.); [email protected] (D.S.) 2 Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612, USA 3 Research and Surgical Services, Jesse Brown VA Medical Center, Chicago, IL 60612, USA * Correspondence: [email protected] Abstract: Macrophages play a critical role in the inflammatory response to environmental triggers, such as lipopolysaccharide (LPS). Inflammatory signaling through macrophages and the innate immune system are increasingly recognized as important contributors to multiple acute and chronic disease processes. Nitric oxide (NO) is a free radical that plays an important role in immune and inflammatory responses as an important intercellular messenger. In addition, NO has an important role in inflammatory responses in mucosal environments such as the ocular surface. Histatin peptides are well-established antimicrobial and wound healing agents. These peptides are important in multiple biological systems, playing roles in responses to the environment and immunomodulation. Citation: Lee, S.M.; Son, K.-N.; Shah, Given the importance of macrophages in responses to environmental triggers and pathogens, we D.; Ali, M.; Balasubramaniam, A.; Shukla, D.; Aakalu, V.K.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Novel Secretion and Online-Cleavage Strategy for Production of Cecropin a in Escherichia Coli
    www.nature.com/scientificreports OPEN A novel secretion and online- cleavage strategy for production of cecropin A in Escherichia coli Received: 14 March 2017 Meng Wang 1, Minhua Huang1, Junjie Zhang1, Yi Ma1, Shan Li1 & Jufang Wang1,2 Accepted: 23 June 2017 Antimicrobial peptides, promising antibiotic candidates, are attracting increasing research attention. Published: xx xx xxxx Current methods for production of antimicrobial peptides are chemical synthesis, intracellular fusion expression, or direct separation and purifcation from natural sources. However, all these methods are costly, operation-complicated and low efciency. Here, we report a new strategy for extracellular secretion and online-cleavage of antimicrobial peptides on the surface of Escherichia coli, which is cost-efective, simple and does not require complex procedures like cell disruption and protein purifcation. Analysis by transmission electron microscopy and semi-denaturing detergent agarose gel electrophoresis indicated that fusion proteins contain cecropin A peptides can successfully be secreted and form extracellular amyloid aggregates at the surface of Escherichia coli on the basis of E. coli curli secretion system and amyloid characteristics of sup35NM. These amyloid aggregates can be easily collected by simple centrifugation and high-purity cecropin A peptide with the same antimicrobial activity as commercial peptide by chemical synthesis was released by efcient self-cleavage of Mxe GyrA intein. Here, we established a novel expression strategy for the production of antimicrobial peptides, which dramatically reduces the cost and simplifes purifcation procedures and gives new insights into producing antimicrobial and other commercially-viable peptides. Because of their potent, fast, long-lasting activity against a broad range of microorganisms and lack of bacterial resistance, antimicrobial peptides (AMPs) have received increasing attention1.
    [Show full text]