Development of Microsatellite Markers for a Giant Water Bug, Appasus Japonicus, Distributed in East Asia

Genes Genet. Syst. (2020) 95, p. 1–7 Microsatellite markers for Appasus japonicus 1 Development of microsatellite markers for a giant water bug, Appasus japonicus, distributed in East Asia

Tomoya Suzuki1*, Akira S. Hirao2,3, Masaki Takenaka4, Koki Yano1 and Koji Tojo1,5* 1Faculty of Science, Shinshu University, Matsumoto, Nagano 390-8621, Japan 2Sugadaira Research Station, Mountain Science Center, University of Tsukuba, Ueda, Nagano 386-2204, Japan 3Faculty of Symbiotic Systems Science, Fukushima University, Fukushima, Fukushima 960-1296, Japan 4Division of Evolutionary Developmental Biology, National Institute for Basic Biology, Okazaki, Aichi 444-8585, Japan 5Institute of Mountain Science, Shinshu University, Matsumoto, Nagano 390-8621, Japan

(Received 24 June 2020, accepted 28 August 2020; J-STAGE Advance published date: 24 January 2021)

We developed microsatellite markers for Appasus japonicus (Heteroptera: Belostomatidae). This belostomatid bug is distributed in East Asia (Japanese Archipelago, Korean Peninsula and mainland China) and often listed as an endangered species in the Red List or the Red Data Book at the national and local level in Japan. Here, we describe twenty novel polymorphic microsatellite loci developed for A. japonicus, and marker suitability was evaluated using 56 individuals from four A. japonicus populations (Nagano, Hiroshima and Yamaguchi prefectures, Japan, and Chungcheongnam-do, Korea). The number of alleles per locus ranged from 1 to 12 (mean = 2.5), and the average observed and expected heterozygosity and fixation index per locus were 0.270, 0.323 and 0.153, respectively. In addition, a population structure analysis was conducted using the software STRUCTURE, and its result suggested that the 20 markers described here will be useful for investigating the genetic structure of A. japonicus populations, which should contribute to population genetics studies of this species.

Key words: endangered species, giant water bug, genetic variation, Ion PGM, microsatellite

Freshwater biodiversity, including that of aquatic and species diversity (e.g., Tojo et al., 2017; Saito et al., invertebrates, is the overriding conservation priority 2018; Sekiné and Tojo, 2019; Takenaka and Tojo, 2019; of the International “Water for Life” Decade for Action Takenaka et al., 2019; Yano et al., 2019). The freshwater (Dudgeon et al., 2006; Doi et al., 2017). Recently, stud- giant water bug, Appasus japonicus, which we focus on ies of phylogenetic evolution of freshwater invertebrates, in this study, is likewise known to have an interesting which have weak dispersal ability, have been attracting evolutionary history (Suzuki et al., 2013, 2014). much attention, because they establish the freshwater Appasus japonicus is an aquatic insect that is distrib- invertebrates’ strong associations with geohistory and uted throughout the Japanese Archipelago, the Korean provide substantial information on the creation of genetic Peninsula and mainland China. This species is often listed as endangered in the Red List or the Red Data Edited by Aya Takahashi Book at the national and local level in Japan (Ministry * Corresponding authors. [email protected] (TS) of the Environment, 2006). Its evolutionary history has [email protected] (KT) been revealed by our previous research using the mtDNA DOI: http://doi.org/10.1266/ggs.20-00033 COI and 16S rRNA regions. In previous studies we Copyright: ©2020 The Author(s). This is identified three largely divided genetic lineages within an open access article distributed under this species, and their evolution is strongly associated the terms of the Creative Commons BY 4.0 with geohistory (Suzuki et al., 2013, 2014). Further- International (Attribution) License (https://creativecommons.org/ licenses/by/4.0/legalcode), which permits the unrestricted distri- more, “back dispersal” of A. japonicus, i.e., dispersal from bution, reproduction and use of the article provided the original the Japanese Archipelago to the Eurasian continent, was source and authors are credited. suggested from that work (Suzuki et al., 2014). Such 2 T. SUZUKI et al. a back dispersal phenomenon is an extremely rare and PCR primers. QDD detected 10,760 loci, each containing interesting case, since almost all biogeographic studies a microsatellite consisting of at least five repeats. We of Japanese organisms have been focused on when and/ selected primer pairs according to the following criteria: or how they reached the Japanese Archipelago. Detailed amplification products within the size range of 90–200 bp; studies of such dispersal patterns are very important in optimal melting temperature range 58–62 °C. A total of understanding the biodiversity creation process of the 50 primer pairs were obtained for screening. Twenty Japanese Archipelago, and further fine-scale biogeo- primer pairs showing clear peak patterns were selected graphical analyses are needed to elucidate it. However, after an initial primer screening using eight samples fine-scale analyses using population genetic approaches from the Matsumoto, Nagano, population, and eight sam- have not yet been conducted for this species. Microsatel- ples from the Shimonoseki, Hiroshima, population (Table lite markers are one of the most useful tools for detecting 1). We selected primer pairs that not only showed clear fine-scale population structure (e.g., Phillipsen and Lytle, peak patterns in both populations but also were missing 2013; Phillipsen et al., 2015; Hirao et al., 2017; Komaki in one of the two populations, because we want to use et al., 2017; Yamazaki et al., 2020). Furthermore, infor- these primer pairs for wide-scale to fine-scale population mation on population genetic structure obtained from genetic structure analyses. microsatellite markers is very important for conserva- To test the genetic variation of the 20 selected mic- tion. Such information is expected even to detect gene rosatellite loci, 20 samples from Matsumoto, Nagano, flow between populations with high sensitivity. There- 10 samples from Mihara, Hiroshima, 10 samples from fore, in this study, we developed 20 microsatellite mark- Shimonoseki, Yamaguchi, and 16 samples from Daechi, ers for A. japonicus and evaluated their suitability for Chungcheongnam-do, were used. PCR amplification population genetic analyses. with fluorescent dye-labeled primers was performed using Whole-genome shotgun sequencing was performed a protocol described by Shimizu and Yano (2011). PCR using the Ion PGM system (Life Technologies). Library amplification was done in 10μ l reactions with KOD FX preparation and PGM sequencing were conducted at Neo DNA polymerase (TOYOBO). Each reaction con- the Sugadaira Research Station, Mountain Science Cen- tained the following components: 1 μl of total genomic ter, University of Tsukuba, Japan. Total genomic DNA DNA, 4.8 μl of 2 × buffer, 1.6 μl of 2.0 mM dNTP mix, was extracted from ethanol-preserved tissue of a speci- 0.05 μl of forward primer, 0.2 μl of reverse primer, 0.05 μl men collected at Matsumoto, Nagano, and purified using of fluorescent dye-labeled primer and 2.3μ l of SQ. The a DNeasy Blood & Tissue Kit (QIAGEN) in accordance PCR protocol was: 94 °C for 2 min; 30 cycles of 98 °C with the manufacturer’s instructions. The concentra- for 10 s, 58 °C for 10 s and 68 °C for 30 s; and 68 °C tion of genomic DNA was quantified using a Qubit 2.0 for 5 min. We labeled BStag primers with the following Fluorometer (Life Technologies), and 13.6 ng/μl of DNA fluorescent dyes: F9GAC-FAM (5′-CTAGTATCAGGAC- was used for the following processes. The genomic DNA GAC-3′), F9GTC-HEX (5′-CTAGTATGAGGACGTC-3′), was sheared to approximately 350–450 bp using Ion F9TAC-NED (5′-CTAGTATCAGGACTAC-3′), F9GCC- Shear Plus Reagents (Life Technologies), and adapter PET (5′-CTAGTATTAGGACGCC-3′) and F9CCG-FAM ligation, nick-repair and purification of the ligated DNA (5′-CTAGTATTAGGACCCG-3′). Product sizes were were conducted using an Ion Plus Fragment Library Kit determined using an ABI 3130xl Genetic Analyzer (Life Technologies). After size selection (target insert and GeneMapper software (Applied Biosystems) with sizes 300–400 bp) was performed using an E-Gel Agarose GeneScan 500 LIZ dye Size Standard v2.0 (Applied Gel Electrophoresis System (Life Technologies), library Biosystems). We calculated observed heterozygosity amplification was conducted using an Ion Plus Fragment (HO), expected heterozygosity (HE), inbreeding coefficients

Library Kit (Life Technologies). The library was assessed (FIS) and pairwise population genetic subdivision (FST) and quantified using a Bioanalyzer (Agilent Technolo- values between populations using GenAlEx 6.5 (Peakall gies), and then diluted to 8 pM for template preparation and Smouse, 2012). We tested whether the FIS values using an Ion PGM Template OT2 400 kit (Life Technolo- of each of the four populations were significantly differ- gies) and enriched. Sequencing was performed using an ent from zero by χ2-test. We also tested deviation from Ion PGM Sequencing 400 kit (Life Technologies) with 850 Hardy-Weinberg equilibrium (HWE) and linkage disequi- flows on the Ion 314 Chip V2 (Life Technologies) in accor- librium among the polymorphic loci using GENEPOP dance with the manufacturer’s protocol. After sequenc- 4.7 (Rousset, 2008), and checked for the presence of null ing, signal processing and base-calling were performed alleles using MICRO-CHECKER 2.2.3 (Van Oosterhout using Torrent Suite 3.6 (Life Technologies), and a library- et al., 2004). We used STRUCTURE v2.3.4 (Pritchard specific FASTQ file was generated. The data sets were et al., 2000) to determine the number of distinct genetic collated and applied to the QDD bioinformatics pipeline clusters. STRUCTURE simultaneously identifies poten- (Meglécz et al., 2010) to filter sequences containing mic- tial populations (clusters) and probabilistically assigns rosatellites with appropriate flanking sequences to define individuals to each of the K populations based on the Microsatellite markers for Appasus japonicus 3

Table 1. Characteristics of 20 microsatellite primers developed for Appasus japonicus

Repeat Size range DDBJ Locus Primer sequences (5′-3′) T (°C) BStag a motif (bp) accession no.

AJP01 F: CCCTGTAACAGTTGAGGATTTACA 58 F9GAC-FAM (TA)7 119–127 LC548110 R: AAACCTAATGTGTTCCGATATTCA

AJP02 F: CTGACACCAATCGGAGGAGT 58 F9TAC-NED (AT)6 (AC)4 95–105 LC548111 R: GATCTCATGCCCGTTGAGAG

AJP04 F: TGAAACTCACGAGATTGTTATTCA 58 F9GTC-HEX (CT)7 105–133 LC548112 R: GGAGTCGATGAGTGAGCCAG

AJP07 F: GTTCGTAACCGATCATGCG 58 F9GAC-FAM (GT)16 129–154 LC548113 R: ACCCAAGTCATACTCGGAGG

AJP08 F: GACGTGGAATGAATTGTGTAAGT 58 F9GCC-PET (AT)7 151–155 LC548114 R: TTTACAAGCTCAATAACAAGCTGA

AJP09 F: ACAGGGACTGCTTTGATCGT 58 F9GTC-HEX (CT)5 120–124 LC548115 R: CCCTCTCCTGTGGAAGAGAA

AJP10 F: CGAAGGGACAGACAGAAATGA 58 F9GTC-HEX (AT)9 95–113 LC548116 R: CGCATAATAAGCTTCCAGGC

AJP11 F: AAATGGGCTGTAGTGCCA 58 F9TAC-NED (ATA)7 129–147 LC548117 R: TTGCAACGAGTTGTTGATCG

AJP12 F: TCACGCGGATATAAATTGCC 58 F9TAC-NED (AT)7 118–122 LC548118 R: CGGAAATTAATGTGAGTCCAGG

AJP20 F: TTCCAGTCTGTGGGTTCCAT 58 F9GTC-HEX (AT)7 180–190 LC548119 R: CAGAGGTCAAACCTCAAACACA

AJP21 F: CGGAACTCCATCCCAGTAGT 58 F9GCC-PET (TA)7 119–128 LC548120 R: CTGTCGCCCACATTTAGGTT

AJP24 F: TCAGGTACGCAGAGGTCTCTAA 58 F9GCC-PET (AG)11 136–150 LC548121 R: TGAGAGCCCGATTAATTCCC

AJP28 F: TTTGGAGTTTGTTCAAGTCATGT 58 F9GAC-FAM (TTA)7 182–191 LC548122 R: TGCAGGCGTCATTCTCTAAA

AJP31 F: TGTTTCGGATTAAACCACTCG 58 F9GAC-FAM (AAC)7 154–160 LC548123 R: CCACGCCCAGTAATAATCAA

AJP34 F: AACGAAATTGGCACGTGTTAC 58 F9GTC-HEX (CT)7 154–156 LC548124 R: CAAAGCAATATGTTTGTCTGTTATGC

AJP36 F: ACGGGTATCGACATGCTGAC 58 F9TAC-NED (AT)8 149–155 LC548125 R: AATTAGAGCCCAACAATGCG

AJP38 F: TCGTTAATACACGGGACAGAAA 58 F9GAC-FAM (AG)7 111–119 LC548126 R: GACCCACTGCTCTTCTTCCA

AJP39 F: ATCTGAGTTCACCCACGTCA 58 F9GCC-PET (GT)9 120–126 LC548127 R: GCAGGGCACGAAGTTAGGTA

AJP43 F: GCGCAGAACGCATAATTTGT 58 F9TAC-NED (TG)9 191–195 LC548128 R: AAACCGGTCTTTCTCACGAC

AJP47 F: TGAAACGACCACTCGGGTA 58 F9GCC-PET (GA)7 112–116 LC548129 R: CAAAGTTGAACTGTTCCGCA

Ta = annealing temperature. sample genotypes. We did not use loci that significantly as missing data. Finally, 15 loci were used for STRUC- deviated from HWE and detected the null alleles; these TURE analysis (Table 2). STRUCTURE runs were per- loci did not show clear peak patterns and were treated formed using the admixture model and correlated allele 4 T. SUZUKI et al. frequencies, with 100,000 iterations of the Markov Chain A. japonicus collected from Daechi (Chungcheongnam-do, Monte Carlo (MCMC) used as “burn-in” that were followed Korean Peninsula) was lower than that from the Japanese by 1,000,000 MCMC iterations; the probability to observe populations. Our previous study revealed that there has the data [Ln P(D)] was calculated for values of K ranging been no gene flow between the Japanese and continental from 1 to 10, with 10 iterations for each K-value. The populations since the formation of the Tsushima Strait best estimate of K was taken to be the maximum value (ca. 1.55 Ma; Suzuki et al., 2014). Therefore, it is consid- observed before the plateau of the curve Ln P(D) against ered that the individuals of the continental populations K (Pritchard et al., 2000). STRUCTURE HARVESTER may have some nucleotide mutations within their PCR v0.6.94 (Earl and vonHoldt, 2012) was also used to iden- primer region(s). tify the most pronounced level of population structure The number of alleles per locus across the four popu- using the method of Evanno et al. (2005). CLUMPP lations was between 1 and 12 (mean = 2.5). Four and v1.1 (Jakobsson and Rosenberg, 2007) was used to find three loci were not polymorphic in the Hiroshima and the optimal alignment from replicate STRUCTURE runs, Yamaguchi populations, respectively (Table 2). The with the summary of results generated using DISTRUCT ranges of HO, HE and FIS per locus were 0.000–0.800 v1.1 (Rosenberg, 2004). (mean = 0.270), 0.000–0.900 (mean = 0.323) and As a result, all 20 microsatellite markers identified in −0.414–1.000 (mean = 0.153), respectively (Table 2). No this study had meaningful polymorphism. Seventeen loci significant differences from zero for the FIS values were were stably amplified and genotyped in the Matsumoto, observed in any of the four populations (P > 0.05). Some Nagano population, 15 loci were stably amplified and loci significantly deviated from HWE in each population genotyped in the Mihara, Hiroshima and Shimonoseki, (Table 2; P < 0.05), and loci that were positive for link- Yamaguchi populations, and 11 loci were stably ampli- age disequilibrium were not detected. The result of the fied and genotyped in the Daechi, Chungcheongnam-do MICRO-CHECKER 2.2.3 analysis suggested null alleles population (Table 2). The number of genotyped loci of in AJP20, AJP31 and AJP43 in the Matsumoto, Nagano

Table 2. Genetic variation of the 20 microsatellite loci for four populations of Appasus japonicus

Matsumoto, Nagano Mihara, Hiroshima Shimonoseki, Yamaguchi Daechi, Chungcheongnam-do Locus (n = 20) (n = 10) (n = 10) (n = 16)

A HO HE FIS A HO HE FIS A HO HE FIS A HO HE FIS AJP01 2 0.600 0.500 −0.200 3 0.333 0.568 0.413 3 0.700 0.595 −0.176 7 0.750 0.805 0.068 AJP02 4 0.400 0.336 −0.190 − − − − − − − − 5 0.438 0.564 0.225 AJP04 2 0.150 0.139 −0.081 2 0.100 0.095 −0.053 3 0.400 0.515 0.223 − − − − AJP07 3 0.600 0.609 0.014 2 0.100 0.095 −0.053 3 0.500 0.545 0.083 12 0.750 0.900 0.167 AJP08 3 0.100 0.096 −0.039 1 0.000 0.000 NA 1 0.000 0.000 NA 3 0.438 0.461 0.051 AJP09 3 0.600 0.586 −0.023 1 0.000 0.000 NA 1 0.000 0.000 NA 2 0.250 0.219 −0.143 AJP10 5 0.450 0.451 0.003 3 0.600 0.445 −0.348 3 0.300 0.515 0.417 4 0.200 0.296 0.323 AJP11 − − − − 3 0.500 0.555 0.099 4 0.500 0.645 0.225 − − − − AJP12 3 0.450 0.436 −0.032 1 0.000 0.000 NA 1 0.000 0.000 NA 4 0.000 0.711 1.000 AJP20 3 0.250 0.509 0.509 − − − − − − − − 5 0.438 0.418 −0.047 AJP21 3 0.600 0.514 −0.168 − − − − − − − − − − − − AJP24 4 0.300 0.341 0.121 5 0.800 0.685 −0.168 4 0.700 0.700 0.000 − − − − AJP28 2 0.050 0.049 −0.026 1 0.000 0.000 NA 2 0.200 0.420 0.524 − − − − AJP31 3 0.250 0.386 0.353 2 0.400 0.320 −0.250 2 0.500 0.495 −0.010 2 0.313 0.404 0.227 AJP34 − − − − 2 0.200 0.480 0.583 2 0.100 0.255 0.608 − − − − AJP36 3 0.600 0.531 −0.129 2 0.700 0.495 −0.414 3 0.700 0.505 −0.386 4 0.563 0.451 −0.247 AJP38 3 0.100 0.096 −0.039 − − − − − − − − 4 0.375 0.525 0.286 AJP39 − − − − 2 0.111 0.105 −0.059 4 0.500 0.415 −0.205 − − − − AJP43 2 0.000 0.260 1.000 2 0.100 0.455 0.780 3 0.222 0.370 0.400 − − − − AJP47 3 0.700 0.601 −0.164 − − − − − − − − − − − −

n, number of individuals analyzed; A, number of alleles; HO, observed heterozygosity (in bold numbers, if values deviate significantly

from HWE); HE, expected heterozygosity; FIS, fixation index. Microsatellite markers for Appasus japonicus 5 population, and AJP12 in the Daechi, Chungcheongnam- lite markers, which were newly developed in this study, do population (estimated null allele frequency: 0.16, 0.12, are useful for discussing finer-scale phylogeography of A. 0.22 and 0.42, respectively). An examination of the like- japonicus than can be achieved by mtDNA markers. We lihood probabilities from the 10 replicate runs across K-values ranging from 1 to 10 indicated that the optimal K-value was 4 (i.e., K = 4), suggesting that four genetic Table 3. Pairwise FST values between four populations of groups exist within our dataset (Fig. 1, Supplementary Appasus japonicus Fig. S1). In the result where K = 4, the four populations 1 2 3 4 that were used for STRUCTURE analysis were clearly 1. Matsumoto, Nagano 0.000 divided into distinct genetic clusters (Fig. 1). The result 2. Mihara, Hiroshima 0.416 0.000 of pairwise comparisons of FST values also suggested 3. Shimonoseki, Yamaguchi 0.446 0.472 0.000 clear genetic differentiation between each population (Table 3). Therefore, we consider that these microsatel- 4. Daechi, Chungcheongnam-do 0.543 0.627 0.585 0.000

Fig. 1. Clustering analysis of the multilocus microsatellite data of Appasus japonicus performed using STRUCTURE (K = 2–4), and sampling localities of A. japonicus used in this study. The photo on the right shows an egg-carrying male of A. japonicus. 6 T. SUZUKI et al. will therefore conduct population genetic analyses based M., Ikeda, K., Yano, K., and Tojo, K. (2017) Detection of on nDNA (SSRs) using more samples and populations, an endangered aquatic heteropteran using environmental DNA in a wetland ecosystem. R. Soc. Open Sci. 4, 170568. in order to confirm the validity of this in a future study. Dudgeon, D., Arthington, A. H., Gessner, M. O., Kawabata, Z.-I., In addition, the result in the case of K = 2 revealed Knowler, D. J., Lévêque, C., Naiman, R. J., Prieur-Richard, that the Shimonoseki (Yamaguchi Prefecture) and Korean A.-H., Soto, D., Stiassny, M. L. J., et al. (2006) Freshwater populations of A. japonicus were within the same cluster biodiversity: importance, threats, status and conservation (Fig. 1). It was also shown in our previous study based challenges. Biol. Rev. Camb. Philos. Soc. 81, 163–182. Earl, D. A., and vonHoldt, B. M. (2012) STRUCTURE on their mtDNA sequences that these two populations HARVESTER: a website and program for visualizing of A. japonicus (i.e., populations of western Honshu and STRUCTURE output and implementing the Evanno the Korean Peninsula) constitute a monophyletic group method. Conserv. Genet. Resour. 4, 359–361. (Suzuki et al., 2014). Therefore, the result of the popu- Evanno, G., Regnaut, S., and Goudet, J. (2005) Detecting the lation structure analysis where K = 2 based on the SSR number of clusters of individuals using the software STRUCTURE: a simulation study. Mol. Ecol. 14, 2611– (nDNA) markers appears to support strongly the results 2620. of our previous phylogenetic analyses based on mtDNA. Hirao, A. S., Watanabe, M., Tsuyuzaki, S., Shimono, A., Li, Furthermore, in the result where K = 3, the Mihara X., Masuzawa, T., and Wada, N. (2017) Genetic diversity (Hiroshima Prefecture) and Shimonoseki (Yamaguchi within populations of an arctic-alpine species declines with Prefecture) populations were identified as being within decreasing latitude across the Northern Hemisphere. J. Biogeogr. 44, 2740–2751. the same cluster (Fig. 1). Similarly, in our previous Jakobsson, M., and Rosenberg, N. A. (2007) CLUMPP: a clus- study based on the mtDNA sequences, it was also sug- ter matching and permutation program for dealing with gested that this geographic area corresponded to a sec- label switching and multimodality in analysis of population ondary contact zone of the two Japanese clades (Suzuki et structure. Bioinformatics 23, 1801–1806. al., 2014). We consider that it would be very interesting Komaki, S., Lin, S.-M., Nozawa, M., Oumi, S., Sumida, M., and Igawa, T. (2017) Fine-scale demographic processes resulting to conduct finer-scale population genetic analyses using from multiple overseas colonization events of the Japanese SSR markers in this area, and we will work to do so in stream tree frog, Buergeria japonica. J. Biogeogr. 44, a future study. 1586–1597. In conclusion, we sequenced A. japonicus genomic DNA Meglécz, E., Costedoat, C., Dubut, V., Gilles, A., Malausa, T., Pech, using Ion PGM and found microsatellite regions. Based N., and Martin, J.-F. (2010) QDD: a user-friendly program to on these data, we developed 20 polymorphic microsatel- select microsatellite markers and design primers from large sequencing projects. Bioinformatics 26, 403–404. lite markers for this species. These polymorphic mark- Ministry of the Environment (2006) Threatened Wildlife of ers are the first developed for A. japonicus. Appasus Japan—Red Data Book, 2nd ed., vol. 5. Japan Wildlife japonicus has high potential as a model organism for the Research Center, Tokyo, Japan (in Japanese). study of arthropod evolution (e.g., speciation and evolu- Peakall, R., and Smouse, P. E. (2012) GenAlEx 6.5: genetic anal- tion of a paternal care system). These microsatellite ysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 28, 2537–2539. markers are useful for elucidating broad- and fine-scale Phillipsen, I. C., Kirk, E. H., Bogan, M. T., Mims, M. C., Olden, population genetic structure and evolution of the unique J. D., and Lytle, D. A. (2015) Dispersal ability and habitat paternal care mating system in A. japonicus, as well as for requirements determine landscape-level genetic patterns in conservation genetics research (c.f. Tomita et al., 2020). desert aquatic insects. Mol. Ecol. 24, 54–69. Phillipsen, I. C., and Lytle, D. A. (2013) Aquatic insects in a sea of desert: population genetic structure is shaped by limited We are sincerely thankful to Professor Emeritus K. Suzuki of dispersal in a naturally fragmented landscape. Ecography Shinshu University for arranging the study environment. We 36, 731–743. also express our thanks to Dr. M. Konishi (Shinshu University) Pritchard, J. K., Stephens, M., and Donnelly, P. (2000) Infer- and Dr. S. Komaki (Iwate Medical University) for their advice ence of population structure using multilocus genotype and assistance with experiments, Dr. S. Ohba (Nagasaki Uni- data. Genetics 155, 945–959. versity) for his many valuable comments on this study, Mr. M. Rosenberg, N. A. (2004) DISTRUCT: a program for the graphi- Shimono (Iwakuni City) and Ms. K. Momose (Shinshu Univer- cal display of population structure. Mol. Ecol. Notes 4, sity) for their cooperation with the field research and collec- 137–138. tion of specimens, and Dr. H. Matsumura (Shinshu University) Rousset, F. (2008) genepop’007: a complete re-implementation of for providing facilities for genetic analysis. This study was the genepop software for Windows and Linux. Mol. Ecol. supported by JSPS KAKENHI Grant Numbers JP20687005, Resour. 8, 103–106. JP23657046, JP16K14807 (K. T.), 285211031 (K. T.), and Saito, R., Kato, S., Kuranshi, R. B., Nozaki, T., Fujino, T., and JP26891010, JP19K16209 (T. S.), the River Fund of The River Tojo, K. (2018) Phylogeographic analyses of the Stenopsyche Foundation, Japan [27-1215-013 (K. T.), and 27-1263-012 (T. S.)], caddisflies (Trichoptera: Stenopsychidae) of the Asian and the Sasakawa Scientific Research Grant (26-529; T. S.). Region. Freshw. Sci. 37, 562–572. Sekiné, K., and Tojo, K. (2019) A mayfly’s rapid transition REFERENCES toward unisexual population. Biol. J. Linn. Soc. Lond. 127, 472–478. Doi, H., Katano, I., Sakata, Y., Souma, R., Kosuge, T., Nagano, Shimizu, T., and Yano, K. (2011) A post-labeling method for mul- Microsatellite markers for Appasus japonicus 7

tiplexed and multicolored genotyping analysis of SSR, indel T., and Schoville, S. D. (2017) Species diversity of insects and SNP markers in single tube with bar-coded split tag in Japan: their origins and diversification processes. Ento- (BStag). BMC Res. Notes 4, 161. mol. Sci. 20, 357–381. Suzuki, T., Kitano, T., and Tojo, K. (2014) Contrasting genetic Tomita, K., Suzuki, T., Yano, K., and Tojo, K. (2020) Community structure of closely related giant water bugs: phylogeog- structure of aquatic insects adapted to lentic water environ- raphy of Appasus japonicus and Appasus major (Insecta: ments, and fine-scale analyses of local population structure Heteroptera, Belostomatidae). Mol. Phylogenet. Evol. 72, and the genetic structures of an endangered giant water 7–16. bug Appasus japonicus. Insects 11, 389. Suzuki, T., Tanizawa, T., Sekiné, K., Kunimi, J., and Tojo, K. Van Oosterhout, C., Hutchinson, W. F., Wills, D. P. M., and (2013) Morphological and genetic relationship of two closely- Shipley, P. (2004) MICRO-CHECKER: software for iden- related giant water bugs: Appasus japonicus Vuillefroy and tifying and correcting genotyping errors in microsatellite Appasus major Esaki (Heteroptera: Belostomatidae). Biol. data. Mol. Ecol. Notes 4, 535–538. J. Linn. Soc. Lond. 110, 615–643. Yamazaki, H., Sekiya, T., Nagayama, S., Hirasawa, K., Tokura, Takenaka, M., and Tojo, K. (2019) Ancient origin of a diptero- K., Sasaki, A., Ichiyanagi, H., and Tojo, K. (2020) Develop- mimid mayfly family endemic to the Japanese Islands and ment of microsatellite markers for a soricid water shrew, its genetic differentiation across tectonic faults. Biol. J. Chimarrogale platycephalus, and their successful use for Linn. Soc. Lond. 126, 555–573. individual identification. Genes Genet. Syst. 95, 201–210. Takenaka, M., Tokiwa, T., and Tojo, K. (2019) Concordance between Yano, K., Takenaka, M., and Tojo, K. (2019) Genealogical position molecular biogeography of Dipteromimus tipuliformis and of Japanese populations of the globally distributed mayfly geological history in the local fine scale (Ephemeroptera, Cloeon dipterum and related species (Ephemeroptera, Dipteromimidae). Mol. Phylogenet. Evol. 139, 106547. Baetidae): a molecular phylogeographic analysis. Zool. Sci. Tojo, K., Sekiné, K., Takenaka, M., Isaka, Y., Komaki, S., Suzuki, 36, 479–489. Supplementary Fig. S1. (a) Log-likelihood values of data, LnP (K), as a function of K for 10 replicates, and (b) Second-order changes of the log-likelihood values of the data (Delta K) as a function of K, calculated over 10 replicates.