Solenostemma Argel) on Obese Rats Fed a High Fat Diet

Accepted Manuscript

Anti-obesity effect of argel (Solenostemma argel) on obese rats fed a high fat diet

Riham A. El-shiekh, Dalia A. Al-Mahdy, Samar M. Mouneir, Mohamed S. Hifnawy, Essam A. Abdel-Sattar

PII: S0378-8741(18)34926-2 DOI: https://doi.org/10.1016/j.jep.2019.111893 Article Number: 111893 Reference: JEP 111893

To appear in: Journal of Ethnopharmacology

Received Date: 22 December 2018 Revised Date: 9 April 2019 Accepted Date: 14 April 2019

Please cite this article as: El-shiekh, R.A., Al-Mahdy, D.A., Mouneir, S.M., Hifnawy, M.S., Abdel-Sattar, E.A., Anti-obesity effect of argel (Solenostemma argel) on obese rats fed a high fat diet, Journal of Ethnopharmacology (2019), doi: https://doi.org/10.1016/j.jep.2019.111893.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. ACCEPTED MANUSCRIPT

Anti-obesity Effect of Argel ( Solenostemma argel ) on Obese Rats Fed a High

Fat Diet

MANUSCRIPT

ACCEPTED ACCEPTED MANUSCRIPT

Anti-obesity Effect of Argel ( Solenostemma argel ) on Obese Rats Fed a High

Fat Diet

Riham A. El-shiekh a, Dalia A. Al-Mahdy a*, Samar M. Mouneir b, Mohamed S. Hifnawy a, Essam A. Abdel-

Sattar a

aDepartment of Pharmacognosy, Faculty of Pharmacy, Cairo University, Egypt

bDepartment of Pharmacology, Faculty of Veterinary Medicine, Cairo University, Egypt

*Corresponding Author:

Dalia A. Al-Mahdy, PhD

Pharmacognosy Dept, Faculty of Pharmacy, Cairo University, El-Kasr El-Aini Street, 11562 Cairo, Egypt MANUSCRIPT Mobile No.:+20-1223814218

Email: [email protected]

E-mail addresses:

Riham A. El-shiekh: [email protected]

Samar M. Mouneir: [email protected]

Mohamed S. Hifnawy: [email protected]

Essam A. Abdelsattar: [email protected], [email protected] ACCEPTED

ACCEPTED MANUSCRIPT

Abstract

Ethnopharmacological relevance : Solenostemma argel (Argel) is a desert plant commonly used in Egyptian and Sudanese traditional medicine to suppress appetite, for treatment of diabetes, and as antispasmodic and anti-inflammatory agents. Previously the anti-diabetic, hypolipidemic and lipase inhibitory activities of Argel were reported in animal studies and in-vitro assays.

However, its specific mechanism of action as an anti-obesity agent has not been studied before.

Aim of the study : Assessment of the possible anti-obesity effect of Solenostemma argel on diet- induced obesity and elucidation of its mechanism of action, as well as, standardization of the active plant extract.

Materials and methods: The ethanolic extract (EtOH-E) and its fractions (CH 2Cl 2-F: methylene chloride & BuOH-F: n -butanol) were prepared from the aerial parts of S. argel and studied at two dose levels; 200 and 400 mg kg −1 in a model of high fat diet (HFD) fed rats. The animals (72 Male Wister rats) were assigned into 9 groups: grou MANUSCRIPTp (i) fed with normal diet and groups (ii-iv) fed with high fat diet (HFD) for 16 weeks and treated with orlistat, EtOH-E, CH 2Cl 2-F and

BuOH-F in the beginning of the 8 th week. At the end of the experiment, blood samples were analysed for lipid and liver biomarkers, glucose and insulin levels, as well as, adipokines and inflammatory markers. Liver and adipose tissues were examined histopathologically and their homogenates were used to determine levels of oxidative stress markers and lipogenesis-related genes. Body weight was monitored weekly during the experiment.

Results: Our data showed that consumption of S. argel significantly controlled weight gain, attenuated liver steatosis,ACCEPTED improved the lipid profile, modulated adipokines activities, increased

β-oxidation gene expression, as well as, decreased the expression of lipogenesis-related genes

ACCEPTED MANUSCRIPT

and ameliorated inflammatory and lipid peroxidation derangement. The ethanolic extract was also standardized using LC–MS analysis for its content of stemmoside C.

Conclusions : The current study revealed that S. argel is a promising Egyptian natural drug, rich in pregnane glycosides, and could be considered a new therapeutic candidate targeting obesity.

Keywords: Diet-induced obesity; Solenostemma argel ; stemmoside C; body weight gain control; adipokines; lipolysis.

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

1. Introduction

Obesity is one of the most serious public health challenges of the 21 st century (Alarcon-Aguilar et al., 2007), with more than 312 million clinically obese subjects worldwide (Kopelman, 2000).

Fat deposition in adipose tissue and other internal organs is one of the characteristic features of obesity (WHO, 2000; Ahima, 2006). Obesity could induce many chronic disorders such as type 2 diabetes, heart diseases, systemic hypertension, hyperlipidemia, arteriosclerosis, certain types of cancers and osteoarthritis (Alarcon-Aguilar et al., 2007). Obesity has also led to an increase in morbidity and mortality rates worldwide with high social and health costs. Therefore, great efforts have been devoted to discovering anti-obesity drugs worldwide (Hossain et al., 2007).

Anti-obesity preparations of natural origin are appealing to consumers because of the general perception that if it is natural it must be more effective and safer than conventional treatments. In particular, many serious adverse effects were reported for synesthetic drugs; sibutramine, orlistat and rimonabant, including gastrointestinal disturba MANUSCRIPTnces and significant side effects on the cardiovascular system (Padwal and Majumdar, 2007). Therefore, continuous search for new anti- obesity drugs from natural sources has become the current approach, due to their desirable pharmacological profiles and fewer side-effects (Chandrasekaran et al., 2012).

Solenostemma argel (Delile) Hayne is an Egyptian wild perennial dessert shrub, whose local

Arabic name is ‘Argel’ (Harghel), and belongs to the family Asclepiadaceae (Plaza et al., 2005).

It is distributed widely in Egypt, Sudan, Libya and Saudi Arabia (Hassan et al., 2001). The native

Sudanese have commonly used the plant to suppress stomach pain and loss of appetite (El-

Kamali and Khaled,ACCEPTED 1996; Mudawi et al., 2015; Shafek et al., 2012). Argel was also used traditionally as an anti-inflammatory, anti-rheumatic, antispasmodic agent and for the treatment of diabetes mellitus (Ibrahim et al., 2015; Innocenti et al., 2005; Khalid et al., 2012). The leaves

ACCEPTED MANUSCRIPT

were used as a remedy for neuralgia, sciatica and for the treatment of abdominal cramps, jaundice and cystitis (Ibrahim et al., 2015). Recently, the ethanolic extract of S. argel was proved to have a strong inhibitory activity against pancreatic lipase enzyme (Elbashir et al., 2018), in addition, it showed hypoglycemic (Deen and Al-naqeb, 2014) and hypolipidemic effects in rats

(Osman et al., 2014). Previous chemical investigations in S. argel showed the presence of monoterpenes, pregnane glycosides, and acylated phenolic glycosides in the leaves (Kamel,

2003; Perrone et al., 2008, 2006).

Diet induced obesity animal model is considered one of the most popular and reliable models used in anti-obesity studies due to its similarity in modelling the common route of obesity in humans and related metabolic effects. It results in increased food intake, body weight gain, body fat accumulation, disruption in lipid profile, defects in anti-oxidant stability, and increased insulin resistance parameters (Buettner et al., 2007; Hariri and Thibault, 2010). The present work aimed to investigate the potential of the ethanolic MANUSCRIPT extract (EtOH-E) of S. argel and its corresponding fractions in controlling weight gain associated with high fat (HF) feeding in rats and the possible underlying mechanisms. Due to the importance of the standardization of plant extracts for assessing the efficacy of herbal medicine, the EtOH-E of S. argel was standardized using LC-MS analysis for the isolated pregnane glycoside; stemmoside C.

2. Materials and methods

2.1 Plant material The aerial parts ACCEPTED of Solenostemma argel (Delile) Hayne. was purchased at Haraz herbal store, Cairo, Egypt in 2016, and authenticated by Dr. Mohamed El-Gibali, Senior Botanist at El-Orman

Botanic Garden. A voucher specimen was deposited in the Herbarium of Pharmacognosy

Department, Faculty of Pharmacy, Cairo University (No. 2016-9-18).

ACCEPTED MANUSCRIPT

2.2 Chemicals and reagents

Solvents used for plant extraction, fractionation and isolation were purchased from El-

Gomhouria Co. (Cairo, Egypt) and were all analytical grade. For the pharmacological assay; orlistat was kindly supplied as a gift from Eva pharma, Egypt. Cholesterol and bile salts used in the high-fat diet (HFD) were purchased from GFS chemicals and reagents (Mumbai, India) and

SAS Chemicals Co. (Mumbai, India). Formalin 10% and tween 80 were purchased from Sigma

Aldrich (St. Louis, MO, USA). For LC-MS assay; methanol of HPLC grade was purchased from

Sigma Aldrich (St. Louis, MO, USA).

2.3 Preparation of the ethanolic extract of S. argel and its fractions

One kilogram of the powdered plant material was exhaustively extracted with 70% ethanol

(4×850 mL) using an Ultra-Turrax® T25 homogenizer (Janke & Kunkel IKA-Lab., Staufen, Germany). The ethanolic extract (EtOH-E) was evaporMANUSCRIPTated under reduced pressure to dryness (800 g). An aliquot of the dry residue (150 g) was then suspended in water (450 mL) and partitioned successively with methylene chloride (5×500 mL) and n-butanol saturated with water

(5×500 mL). The solvents were evaporated under reduced pressure to give methylene chloride fraction (CH 2Cl 2-F, 55 g), and n-butanol fraction (BuOH-F, 43 g). The extract and fractions were kept in the desiccator over anhydrous CaCl 2.

2.4 Isolation of stemmoside C (1)

The CH 2Cl 2-F (20ACCEPTED g) was chromatographed on a VLC column (15 x 4.5 cm, 300 g) packed with silica gel 60 (270-400 mesh). Gradient elution was performed starting with 100% n-hexane, followed by mixtures of n-hexane/ methylene chloride (20-80%), 100% methylene chloride, 20-

ACCEPTED MANUSCRIPT

80% of ethyl acetate/ methylene chloride then 100% ethyl acetate to give five collective fractions

(Fr I-V). Fraction IV (1 g, 60-80% methylene chloride in ethyl acetate) was further chromatographed on a silica gel RP-18 column (20 × 2.5 cm) using methanol-water (7:3 v/v) as the mobile phase (flow rate 4 mL/min) to afford compound 1 (50 mg).

+ - Stemmoside C ( 1): m/z 1079.5709 [M+Na] and 1057.5534 [M-H] , calcd for C 54 H88 O20 Na and

+ 1 13 C54 H87 O20 [M+H] . H and C NMR: (Supplementary Material).

2.5 LC–MS analysis of stemmoside C in EtOH-E

2.5.1 LC–MS conditions

The UPLC system consisted of an Agilent system equipped with a solvent delivery module, quaternary pump, 1290 infinity auto sampler, and column compartment (Agilent Technology,

Germany). The column effluent was connected to an Agilent 6420 Triple Quad. Mass detector and the column temperature were set at 25±2 ºC. AnaMANUSCRIPTlytes were separated on an Acquity UPLC ® BEH C18 column (150 mm length x 2.1 mm i.d., 1.7 µm particle diameter) protected with an

Agilent-Zorbax SB-C18 pre-column (Agilent Technologies, Palo Alto, CA, USA). The mobile phase was 20% formic acid (0.1%) and 80% acetonitrile with isocratic elution at a flow rate of

0.3 mL/min as previously reported by Abdel-Sattar et al. (2013).

2.5.2 ESI–MS ion trap conditions

The MS conditions were set to positive polarity, Nebulizer 35 psi, dry gas 12 l/min, and dry temp

350ºC, end plateACCEPTED offset -500 v, ICC smart target 200,000, max accumulation 200 ms. Data was integrated by applying Auto-extract-MS (i), where (i) is the m/z defined by the acquisition MS program that represent each molar ion mass using Mass Hunter Software.

ACCEPTED MANUSCRIPT

2.5.3 Sample and standard preparation

For constructing the calibration curve, five different concentrations (1, 10, 50, 100 and 150 ng/µL) of stemmoside C ( 1) were prepared in methanol. The correlations of peak areas versus concentrations (ng/µL) were linear over the studied concentration range with regression coefficient ( r2) of not less than 0.994. A sample of 20 mg of the EtOH-E was dissolved in 20 mL methanol using ultra sonication for 5 min. A volume of 1 µl from each standard or sample solution was injected in triplicate for LC–ESI–MS analysis in positive ionization mode.

2.6 Biological study

2.6.1 HFD Diet Composition

A high fat diet (HFD) containing 90.5% basal diet (w/w), 10% Lard fat (w/w), 2% cholesterol (w/w) and 0.25% bile salts (w/w) was used to induce MANUSCRIPT body weight gain in rats (Pan et al., 2006). 2.6.2 Animals

Male Wistar rats (120-170 g; 3-4 months of age) were obtained from the Veterinary Unit for

Laboratory Animals (Cairo, Egypt). They were housed in plastic cages with stainless steel covers in the Experimental Animal House, Faculty of Veterinary Medicine, Cairo University, Egypt

(eight per cage) and maintained at a temperature of 22±1°C and a humidity of 55–60% in a light- controlled room. The animals were kept for 1 week to acclimatize, and then they were randomly divided into control and experimental groups prior to the beginning of the experiment. All adopted proceduresACCEPTED were in accordance with the guidelines of the EEC Directive 1986;

86/609/EEC for animal experiments and were approved by the Institutional Research Ethics

Committee at the Faculty of Pharmacy, Cairo University, Egypt (No. 1574) and the Institutional

ACCEPTED MANUSCRIPT

Animal Care and Use Committee (IACUC), Faculty of Science, Cairo University, Egypt (CU III

F 8518).

2.6.3 Drugs and treatment

The EtOH-E, CH 2Cl 2-F and BuOH-F were suspended in saline solution by ultra-sonication with the aid of 1% tween 80 and used at two dose levels; 200 and 400 mg kg −1. The reference anti- obesity drug; orlistat was prepared in saline solution and used at a dose of 5 mg kg −1. The normal group and the positive control group (HFD only) received the vehicle (saline solution containing tween 80 of the same concentration and volume). In general, all drugs were administered by oral gavage in a volume of 0.5 mL in saline.

2.6.4 Experimental design Following the adaptation period, rats were fed with MANUSCRIPT a normal palatable diet (NPD, normal group) or HFD in accordance with each experimental group for 16 weeks. Obese rats were selected based on 20% or more weight gain in comparison to the normal control group (Shabbir et al.,

2016). Rats were then allocated into nine groups (n=8) and the following regimen was followed:

(i) normal group: rats fed on NPD for 16 weeks; (ii) HFD control rats: fed on HFD for 16 weeks,

(iii) HFD fed rats treated with orlistat (5 mg kg −1 body weight), (iv - ix) HFD fed rats treated

−1 with EtOH-E, CH 2Cl 2-F and BuOH-F (200 and 400 mg kg body weight). All pharmacological treatments started at the beginning of the eighth week and were continued until the end of the experiment (end ACCEPTEDof 16 th week) with HF in diet. Rats in group (i and ii) received equal volumes of vehicle at the same day time. Body weight was recorded weekly. In the 16 th week, rats were fasted overnight and anaesthetized using sodium thiopental. Serum samples were then collected

ACCEPTED MANUSCRIPT

by retro-orbital puncture, centrifuged at 2000 ×g for 15 min and stored at -80 °C until laboratory analysis.

2.6.5 Measurement of body weight, % weight gain, body mass index (BMI) and adiposity levels

(LI)

The bodyweights over the course of the experiment (16 weeks) were calculated weekly and compared. Liver and adipose tissues were removed from each rat, washed with ice-cold phosphate-buffered saline (pH = 7.4) and weighed. Body mass index (BMI) was determined as follows; BMI= Body weight (g)/length 2 (cm 2) (Mashmoul et al., 2014). Adiposity was determined by the Lee index (LI), which is the cubic root of body weight (gm) divided by the naso-anal length (cm). Lee index is positively correlated with the percentage of body fat (Novelli et al., 2007; Shabbir et al., 2016). MANUSCRIPT 2.6.6 Histopathological analysis

The right lobe of rats’ liver and adipose tissues were fixed in 10% phosphate buffered formalin for one day and processed to generate 3 - 5 µm thick paraffin sections, which were stained with hematoxylin and eosin (H&E) and subjected to microscopic examination at x400 magnification.

The adipose sections were examined for the numbers of crown-like structures (CLS) within the different groups using the ocular grid method and a standard light microscope (Zeiss,

Goettingen, Germany), equipped with an ocular grid reticle in the eyepiece and standard objective lenses.ACCEPTED CLS within the squares of the ocular reticle were counted at x400 magnification.

ACCEPTED MANUSCRIPT

2.6.7 Determination of serum lipid profile and liver enzymes activity

In serum, total cholesterol (TC), high density lipoprotein cholesterol (HDL-c), triglyceride (TG), alanine transaminase (ALT), aspartic transaminase (AST) and alkaline phosphatase (ALP) were determined using colorimetric kits from Biodiagnostic (Cairo, Egypt). Free fatty acids (FFA) were determined using colorimetric kit from Cell Biolabs, Inc. (San Diego, USA). All parameters were determined using a UV-visible spectrophotometer (UV-1601PC, Shimadzu,

Japan).

Low density lipoprotein cholesterol (LDL) and very low-density lipoprotein cholesterol (vLDL- c) were calculated indirectly as follows: LDL = [TC – (HDL + (TG/5)] and vLDL-c = [TC –

(HDL + LDL)] (Adeneye et al., 2010).

2.6.8 Determination of atherogenic index (AI) and coronary risk index (CRI) Atherogenic index (AI) and coronary risk index (CRI MANUSCRIPT) were calculated as: LDL-c (mg/dL)/HDL- c (mg/dL) and TC (mg/dL)/HDL-c (mg/dL), respectively (Adeneye et al., 2010).

2.6.9 Determination of liver index and adipose tissue index

The liver index and adipose tissue index were calculated as: (liver weight/bodyweight) x 100 and

(adipose tissue weight/bodyweight) x 100, respectively (Abdel-Sattar et al., 2018).

2.6.10 Determination of fasting glucose, fasting serum insulin, HOMA-IR index and R-QUICKI

index ACCEPTED

Fasting blood glucose and insulin were determined using Biodiagnostic colorimetric kits (Cairo,

Egypt) and the rat insulin ultrasensitive ELISA kit (RayBio, Norcross, GA, USA). Insulin

ACCEPTED MANUSCRIPT

resistance and insulin sensitivity were assessed using the homeostasis model assessment index for insulin resistance (HOMA-IR) and the revised quantitative insulin sensitivity check index (R-

QUICKI), respectively as follows: HOMA-IR = [fasting glucose (mg/dL) × fasting insulin

(µU/mL)] / 22.5] and R-QUICKI = 1/ [log fasting insulin (in lU/mL) + log fasting glucose (in mmol/L)] (Abdel-Sattar et al., 2018).

2.6.11 Determination of serum leptin, resistin, adiponectin and ghrelin

Serum leptin, resistin, adiponectin and ghrelin were assayed using the rat leptin antibody ELISA kit (Cloud-Clone Corp, Houston, TX 77084, USA), the rat resistin antibody ELISA kit (Creative

Diagnostics, NY 11967, USA), the rat adiponectin ELISA kit (ALPCO Diagnostics; Salem, NH,

USA) and the rat ghrelin antibody ELISA kit (Elabsciences biotechnology co ltd, Hubei province, China), according to the manufacturers’ directions. MANUSCRIPT 2.6.12 Determination of serum level of TNF-α and IL-1β

Serum TNF-α and IL-1β were determined using the rat tumor necrosis factor alpha (TNF-α)

ELISA kit (CUSABIO, Wuhan, Hubei, China (CSB-E1207r) and the rat interleukin-1 beta (IL-

1β) ELISA kit (Cohesion Biosciences, London, UK (CEK1987), according to the manufacturers’ directions.

2.6.13 Determination of hepatic malondialdehyde (MDA) and reduced glutathione (GSH)

A portion of frozenACCEPTED liver samples (0.2 g) was homogenized in phosphate buffer solution (pH 7.4) using a Teflon homogenizer (Glass Col homogenizer system, Vernon hills, USA). Homogenates were then centrifuged at 3,000×g for 10 min at 4°C and clear supernatants were separated and

ACCEPTED MANUSCRIPT

employed for the estimation of both malondialdehyde (MDA) and reduced glutathione (GSH) using Biodiagnostic assay kits (Cairo, Egypt).

2.6.14 Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

Quantitative real-time PCR was employed for the determination of fatty acid synthase (FAS) and carnitine palmitoyl transferase-1 (CPT-1) expression in samples from adipose tissues. RNA was extracted from tissues using TRIzol RNA mini kit (Cat. No. 71341, Invitrogen, CA). RNA was reverse transcribed using the Superscript III reverse transcription kit (Invitrogen, CA) and an

ABI PRISM 7000 sequence detection system (Applied Biosystems, Foster City, CA). Fatty acid synthase (FAS) transcript was quantified using FAS PCR Fluorescence Quantitative Diagnostic

Kit (Cat. No. AAP 09S5) strictly following the manufacturer’s protocol. Briefly, aliquots of reverse transcription product were mixed with the master mix (45 µl), start Taq RNA polymerase, specific sets of primers for both targe MANUSCRIPTt gene and β-actin; as a housekeeping gene. The PCR mixture was incubated for 5 min at 50°C, then an initial denaturation was carried out at

95°C for 40 s, followed by 34 cycles of amplification for 40 s and at 59°C for 40 s, 72°C for 40 s and annealing/extension for 2 min at 72°C. Fluorescence was recorded at the endpoint of each cycle. Multiplex real time PCR approach was adopted in which both target and housekeeping genes were simultaneously determined. Target gene concentration (copies/ml) was determined from a standard curve established from 4 positive references, of varying concentrations, included in the kit. PCR quantification was carried out using Rotor-Gene Q 5 plex real-time rotary analyzer (CorbettLifeACCEPTED Science, USA). Carnitine palmitoyl transferase (CPT-1) was quantified using CPT-1 PCR Fluorescence Quantitative Diagnostic Kit (Cat. No. SRT 1607) following the same procedure with β -2 microglobulin as the housekeeping gene. The PCR mixture was

ACCEPTED MANUSCRIPT

incubated for 5 min at 37°C then an initial denaturation at 95°C for 5 min, followed by 40 cycles of amplification for 10 s at 95°C and finally annealing/extension for 20 s at 60°C and 1 s at

70°C.

2.6.15 Food and water intake

Food and water intakes were monitored periodically, and changes were recorded.

2.7 Statistical analysis

Data are presented as the mean ± SD and were analyzed by one-way analysis of variance

(ANOVA) followed by Tukey's test for multiple comparison using SPSS software (Chicago, IL,

USA) and a trial version of Graph Pad Prism. Differences were significant at p ˂ 0.05.

3. Results MANUSCRIPT 3.1 Effect on body weight (g), % weight gain, BMI and LI of rats fed with HFD

HFD fed animals exhibited a significant increase in body weight (101.63%) compared to the control group received a normal diet (393.96±32.43 g vs. 195.38±18.90 g; P ˂ 0.05). Treatment of rats with EtOH-E, CH 2Cl 2-F and BuOH-F significantly ( P ˂ 0.05) suppressed the body weight gain by 11–27% after 4 weeks of treatment and this difference significantly increased ( P ˂ 0.05) by 29–44% after 8 weeks of treatment (Table 1). The most significant suppression in body

−1 −1 weight gain was achieved with the EtOH-E, 400 mg kg ; CH 2Cl 2-F, 200 mg kg and BuOH-F,

400 mg kg −1 withACCEPTED percentage changes of 41.60, 43.95 and 40.77%, respectively compared to the normal group and comparable to orlistat group which showed reduction of 44.77 % after 8 weeks of treatment.

ACCEPTED MANUSCRIPT

Additionally, HFD group was characterized by a clearly elevated Lee obesity index, which is positively correlated with the increase in body fat mass. However, the S. argel -treated groups showed a significant decrease in Lee index values (Table 1). BMI was insignificant between healthy control and treated rats but were significantly lower than HFD obese rats as shown in table 1.

3.2 Effect on histopathology of liver and adipose tissues

The liver of HFD group exhibited a characteristic appearance via the presence of micro- and macrosteatosis, which was virtually absent in the groups treated with S. argel (Fig. 1).

Examination of adipose tissue sections within the treated groups (Table 1 and Fig. 2) showed reduction in crown-like structures (5-10 CLS/mm 2) compared to rats fed HFD only (25

CLS/mm 2). Furthermore, all sections of treated groups showed almost normal hepatocytes and

Effect on obesity related biochemical parameters 3.2.1 Effect on serum lipid profile, atherogenic index MANUSCRIPT (AI) and coronary risk index (CRI) S. argel treatments successfully improved the lipid profile in a manner comparable to orlistat; where the EtOH-E, 200 mg kg −1 and EtOH-E, 400 mg kg −1 showed nearly normal values of TC,

HDL, LDL, and FFA (Table 2). The HFD group showed high risk values in both AI and CRI, whereas all the treated groups showed no significant differences from the normal group (Table

2).

ACCEPTED

ACCEPTED MANUSCRIPT

1A 1B 1C

1D 1E 1F

1G 1H 1I

MANUSCRIPT

Fig.1 . Photomicrographs of the liver sections ( H&E, x400). 1A : Normal; 1B : HFD; 1C : HFD+orlistat; 1D : HFD+EtOH-E, 200 mg/kg; 1E : HFD+EtOH-E, 400

mg/kg; 1F : HFD+CH 2Cl 2-F, 200 mg/kg; 1G : HFD+CH 2Cl 2-F, 400 mg/kg; 1H : HFD+BuOH-F, 200 mg/kg; 1I : HFD+BuOH-F, 400 mg/kg. Brown arrow: thin plates of normal hepatocytes; red arrow: micro steatosis; black arrow: macro steatosis; yellow arrow: congested central vein; green arrow: congested and dilated sinuosoids.

ACCEPTED

ACCEPTED MANUSCRIPT

2A 2B 2C

2D 2E 2F

2G 2H 2I

MANUSCRIPT

Fig.2. Photomicrographs of the adipose sections (H&E, x400). 2A : Normal; 2B : HFD; 2C : HFD+orlistat; 2D : HFD+EtOH-E, 200 mg/kg; 2E : HFD+EtOH-E, 400 mg/kg;

2F : HFD+CH 2Cl 2-F, 200 mg/kg; 2G : HFD+CH 2Cl 2-F, 400 mg/kg; 2H : HFD+BuOH-F, 200 mg/kg; 2I : HFD+BuOH-F, 400 mg/kg. Black arrow: normal adipocytes; red arrow: scattered number of crown-like structures.

3.2.2 Effect on liver index and liver enzymes activity

Liver index was greater in HFD group than normal (3.36±0.23 vs. 2.13±0.23), while serum liver enzymes (AST,ACCEPTED ALT and ALP) were twice higher than normal (Table 3). However, the treated groups showed significant reduction ( P ˂ 0.05) in liver indices and all tested enzymes

(Table 3). EtOH-E, 400 mg kg −1 showed the most significant reduction in liver index, AST, ALT

and ALP compared to HFD group (1.92±0.40, 45.80±3.29 mg/dL, 16.60±2.02 mg/dL &

ACCEPTED MANUSCRIPT

46.35±5.55 U/L vs. 3.36±0.23, 88.60±2.30 mg/dL, 31.20±3.42 mg/dL & 121.75±10.15 U/L, respectively).

3.2.3 Effect on fasting blood glucose, insulin, insulin resistance and insulin sensitivity

BuOH-F, 400 mg kg −1 showed significant reduction in blood glucose levels compared to

HFD group (107.60±3.85 mg/dL vs. 135.2±2.17 mg/dL). Moreover, all treated groups showed no significant difference from the normal group in serum insulin, HOMA-IR and R-QUICKI values (Table 3).

3.2.4 Effect on adipose index, serum leptin, resistin, adiponectin and ghrelin levels

EtOH-E, 400 mg kg −1 and BuOH-F, 400 mg kg −1 successfully decreased the adipose index compared to HFD group (0.43±0.09 & 0.53±0.10, respectively vs. 3.28±0.63), and clearly improved levels of adipokines (secreted from the adMANUSCRIPTipose tissue), in addition to ghrelin hormone towards the normal levels (Table 4).

3.2.5 Effect on serum inflammatory cytokines (TNF-α and IL-1β)

Rats fed with the HFD for 16 weeks showed about 2 to 3-fold increase in serum TNF-α and

IL-1β, where S. argel treatments downregulated this increase (Table 5). EtOH-E, 400 mg kg −1 significantly decreased the values of pro-inflammatory cytokines compared to HFD and orlistat groups (153.75±12.50 pg/mL vs. 337.50±20.70 pg/mL and 221.90±22.47 pg/mL, respectively for TNF-α andACCEPTED 116.40±6.16 pg/mL vs. 260.86±18.94 pg/mL and 161.44±7.64 pg/mL, respectively for IL-1β).

ACCEPTED MANUSCRIPT

3.2.6 Effect on MDA and GSH in liver homogenate

−1 −1 −1 EtOH-E, 400 mg kg ; CH 2Cl 2-F, 200 mg kg and BuOH-F, 400 mg kg decreased hepatic

MDA level which is an indicator of lipid peroxidation and increased hepatic GSH level to extremely promising levels compared to HFD group (15.55±1.88 & 1.6±0.13 nmole/dL;

15.02±0.95 & 1.65±0.23 nmole/dL; 10.42±2.06 & 2.31±0.43 nmole/dL vs. 24.15±0.65 &

0.53±0.06 nmole/dL, respectively) (Table 5).

3.2.7 Real-Time Quantitative RT-PCR

Forward and reverse primers and annealing temperatures utilized for the PCR reactions are shown in Table 6. The results showed that the EtOH-E, 400 mg kg −1 significantly (P ˂ 0.05) reduced HFD feeding induced increase in FAS expression; gene involved in lipogenesis, and activated CPT-1 gene expression which is related to β-oxidation in adipose tissues compared to

HFD group (1.61±0.16 & 5.39±0.63 copies/mL vs. 4.85±0.10 & 3.69±0.32 copies/mL, respectively) (Fig. 3). MANUSCRIPT

ACCEPTED Fig. 3. Effect of Solenostemma argel ethanolic extract, 400 mg kg −1 on the mRNA expression of fatty acid synthase (FAS) and carnitine palmitoyl transferase-1 (CPT-1) in adipose tissue of rats fed with HFD. Data are expressed as mean ± SD (n=8). Statistical analysis was carried out by one-way ANOVA followed by Tukey's multiple comparison test. aSignificant difference from control group at P ˂ 0.05. bSignificant difference from HFD-inducted group at P ˂ 0.05.

ACCEPTED MANUSCRIPT

3.2.8 Food and water intake

The food and water intake were monitored periodically for the control groups and the EtOH-

E, 400 mg kg −1 and the percentage of change was determined by the difference in average food and water consumption at the beginning and end of the experimental period. The results showed a 25% and 20% decrease in food and water intakes, respectively for the HFD treated with the

EtOH-E, 400 mg kg −1 by the end of the experimental period compared to the increase observed for the HFD group (41.5% and 36%, respectively for food and water intakes) (Table 7).

3.2.9 LC–MS analysis of EtOH-E

The amount of the major constituent; (stemmoside C, Fig. 4) of S. argel was calculated from the corresponding calibration curve using the peak area of the extracted m/z. LC-MS analysis showed that the content of stemmoside C was estimated to be 21.43 ± 1.28 mg/g of the total ethanolic extract. MANUSCRIPT

Fig. 4. Structure of the standard compound

ACCEPTED

ACCEPTED MANUSCRIPT

4. Discussion

Obesity and overweight are serious public health problems of high-risk factors. They are associated with several chronic disorders such as diabetes, heart diseases, hypertension, hyperlipidemia, arteriosclerosis, and osteoarthritis (Alarcon-Aguilar et al., 2007). Discovering new therapeutic agents for the management of obesity is a challenging goal. In continuation of our interest in natural medicines with anti-obesity effects, Solenostemma argel (Argel) was chosen for the current study. Argel is an Egyptian herbal plant used as anti-diabetic, antispasmodic, anti-inflammatory and anti-rheumatic agent (Ibrahim et al., 2015; Innocenti et al.,

2005; Khalid et al., 2012). In a previous study by the authors (El-shiekh et al., 2019), S. argel showed a good in-vitro inhibitory activity towards lipase, α-glucosidase and α-amylase enzymes, in addition to its anti-oxidant power determined using DPPH and iron reducing power assays.

However, nothing could be traced on the effects and specific mechanisms of action of Argel on obesity or its associated complications which encou MANUSCRIPTraged us to study the potential anti-obesity effect of S. argel on a model of high fat diet (HFD) fed rats.

It is well established that the only outcome that should qualify a product as an anti-obesity preparation is its ability to induce weight loss and it is considered successful if it induces suitable weight loss from the initial body weight (5-10%), prevents further weight gain and allows long term keeping of the achieved weight loss (Vermaak et al., 2011b). The HFD feeding successfully induced obesity in the rats (H. H. Lim et al., 2013), as evidenced by a signiﬁcance increment of body weight (101.63%) compared to normal group in agreement with data previously reported by Abdel-Sattar ACCEPTED et al., 2018 and Tunapong et al., 2018). While, S. argel extract and fractions efficiently reduced body weight in a short period of time which qualifies the plant as a promising natural product to be used in weight control (Table 1).

ACCEPTED MANUSCRIPT

Fatty liver and crown like structures are one of the well-known features resulting from feeding rats with HFD due to increased accumulation of fatty acids in the liver and reduced oxidation of free fatty acids (Jang and Choung, 2013; Tinkov et al., 2014). Adipose tissue of obese animals and humans is usually infiltered by macrophages that are arranged around dead adipocytes, forming characteristic crown-like structures (Murano et al., 2008). The histopathological examination showed macrovesicular steatosis in liver and an increase in the number of crown-like structures in adipose tissue of HFD group (Figs. 1 & 2), resulting in liver and adipose tissue weight gains (Table 1) by 219.13 and 90.4 %, respectively. However, S. argel supplementation markedly attenuated the extent of steatosis and decreased the number of crown- like structures (Figs. 1 & 2), suggesting that Argel may regulate the lipid storage along with high fats in diet and undoubtedly reduce signiﬁcantly liver and adipose weight gains, as well as, body fat expressed by Lee index (Table 1). The decrease in the number of crown-like structures reflects a decrease in inflammation and insulin res MANUSCRIPTistance usually associated with obesity (Cinti et al., 2005).

The serum levels of TG, TC, LDL-C, vLDL-C and FFA in HFD-fed rats were signiﬁcantly higher than those of the normal group (Table 2), in agreement with reported data by Abo-Elmatty and Zaitone, 2011; Friedewald et al., 1972; Hsiao et al., 2008; Seböková et al., 2002. Reduction in serum free fatty acid levels is a highly recommended approach for treatment of obesity as they are linked to insulin resistance and restricted glucose utilization in obese patients (Moreno et al.,

2003). The systemic FFA elevation may be responsible for insulin resistance displayed in the rats fed with the HFDACCEPTED (elevated HOMA-IR) (Tables 2 & 3). Although feeding HFD in rats caused hyperlipidemia, S. argel treated groups signiﬁcantly ameliorated these changes (Table 2).

Furthermore, AI and CRI are considered reliable indicators of whether cholesterol is deposited

ACCEPTED MANUSCRIPT

into tissues, metabolized and excreted or not, where their normal reference values in humans should not be higher than 4 and 2.5, respectively (D. W. Lim et al., 2013). The patients with higher cardiac risk indices than normal values are susceptible to ischemic heart disease and thrombotic cardiovascular incidences (Basu et al., 2007; D. W. Lim et al., 2013). In the present study, a significant reduction in the AI and CRI (Table 2) was observed within the treated groups. Consequently, S. argel showed significant hypolipidemic action with strong cardioprotective potential which could be considered one of the plant’s mechanistic anti-obesity effects.

ALT, AST and ALP are useful markers for measurement of liver function as they are released after hepatocellular damage (Loeb and Quimby, 1999). S. argel EtOH-E, CH 2Cl 2-F and n-BuOH-F reduced liver indices and inhibited the diet induced elevation of ALT, AST and ALP

(Table 3) with levels comparable to that of orlistat treated group. These effects were associated with improved insulin sensitivity, as revealed by a MANUSCRIPTlower HOMA-IR index (Table 3), as well as, improvement in liver histopathology which further reinforced the serum biochemical findings.

This indicated the curative action of S. argel towards fatty liver and obesity-induced insulin resistance caused by the HFD.

Adipose tissue is the active endocrine organ which has a fundamental role in metabolism and homeostasis regulation through the secretion of several biologically active adipokines; leptin, resistin, adiponectin, and inflammatory cytokines; TNF-α and IL-1β (Arçari et al., 2009). Leptin and resistin are found to be positively correlated with the extent of the TG stored in adipocytes or body fat mass andACCEPTED insulin resistance, respectively (Dardeno et al., 2010; Jung and Choi, 2014;

Lazar, 2007; Myers et al., 2008; Taylor and Macqueen, 2010). On the other hand, adiponectin and ghrelin are inversely correlated with body fat percentage, positive energy balance, adipocyte

ACCEPTED MANUSCRIPT

size, and leptin levels (Díez and Iglesias, 2003; Kang et al., 2007; Taylor and Macqueen, 2010;

Vendrell et al., 2004; Wu and Kral, 2004; You et al., 2013). In addition, leptin and ghrelin are known to affect appetite, where a decline in ghrelin levels has an appetite lowering action while leptin decline causes appetite stimulating effects (Jain and Singh, 2013). Treatment with S. argel for two months modulated the adipose index and the secreted adipokines from adipose tissues, as well ghrelin hormone (Table 4). These findings further support the efficacy of S. argel in moderation of calorie intake and metabolic disorders.

Obesity results in upregulation of pro-inflammatory cytokines secreted by macrophages in the adipose tissue such as IL-1β and TNF-α, where obesity is considered a state of chronic inflammation (Ballak et al., 2015; Hotamisligil et al., 1996; Jang and Choung, 2013; Zaitone et al., 2015). The downregulation of inflammatory mediators by S. argel is linked to the improvement of the HOMA-IR index and the decrease in CLS in the adipose tissue (Cinti et al., 2005; Hotamisligil et al., 1996; Zaitone et al., 2015) MANUSCRIPT (Tables 3 & 5). Oxidative stress is one of the major consequences encountered during induction of obesity

(Fernández-Sánchez et al., 2011; Furukawa et al., 2017). Diets rich in lipid are also capable of generating reactive oxygen species (ROS) because they can alter oxygen metabolism, induce insulin resistance and increase hepatic oxidative stress (Abd El-Kader and Saiem Al-Dahr,

2016). S. argel treated groups showed significant downregulation of MDA levels and upregulation of GSH levels (Table 5). The BuOH-F, 400 mg kg -1 was the most effective compared with the group fed with HFD (10.42±2.06 and 2.31±0.43 vs. 24.15±0.65 and

0.53±0.06, respectively).ACCEPTED The ability of a natural agent to effectively modulate oxidative stress markers is considered an important target for the development of efficient products for weight control.

ACCEPTED MANUSCRIPT

To gain insight into the molecular mechanism underlying the anti-obesity effects of Argel described above, we also determined its effect on the expression of genes involved in obesity and lipid metabolism. The EtOH, 400 mg kg -1 suppressed the expression of FAS, the rate-limiting enzyme in lipogenesis, as well as activated the mRNA expression of CPT-1, the rate-limiting enzyme of mitochondrial fatty acid oxidation, which consequently led to loss of body fat (Li et al., 2015). It is also proven that inhibition of FAS can reduce food intake and body weight therefore; FAS inhibition is a potential therapeutic target to suppress appetite and induce weight loss (Loftus et al., 2000). Upregulation of CPT-1 gene was linked to enhanced lipolysis, decreased TGs & FFA levels, where the released free fatty acids are transported to the mitochondria through the activated CPT-1 enzyme (Abdel-Sattar et al., 2018). So, we can conclude from this the appetite suppressant and lipolysis enhancement actions of S. argel .

Furthermore, the decrease in food and water intake of the rats exhibited by the EtOH-E, 400 mg kg -1 further confirms the traditional use of Argel MANUSCRIPTby the Sudanese people for inducing loss of appetite (El- Kamali and Khaled, 1996; Mudawi et al., 2015; Shafek et al., 2012).

We can therefore conclude that the anti-obesity action of Argel could be attributed to multiple mechanisms including hypolipidemic, enhanced lipolysis, hypoglycemic and adipokines modulating power, as well as, anti-inflammatory, decreased lipogenesis, increased fatty acid oxidation and appetite suppression actions. These results provided scientific evidence to the use

S. argel in controlling weight gain.

The observed activity of the EtOH-E and both fractions (CH 2Cl 2-F and n-BuOH-F) could be attributed to theirACCEPTED content of pregnane glycosides (stemmoside A-G and a rgelosides A-O, respectively ), in addition to flavonoid glycosides (El-shiekh et al., 2019; Hamed, 2001; Perrone et al., 2008).

ACCEPTED MANUSCRIPT

Pregnane glycosides are the key phytochemical ingredients in S. argel , they are a class of phytochemicals particularly abundant in plants belonging to family Asclepiadaceae and

Apocynaceae. Several reports related the anti-obesity action of Caralluma fimbriata and Hoodia gordonii ; well-known appetite suppressant plants, to their content of pregnane glycosides, in addition to reported anti-obesity activity for isolated pregnane glycosides (Abdel-Sattar et al.,

2018; Kuriyan et al., 2007; Liu et al., 2013; van Heerden et al., 2007; Vermaak et al., 2011a;

Yun, 2010). These plants are gaining more credibility in the scientific community as anti-obesity agents. They reached clinical trials and are now available as nutraceuticals in the international markets as appetite suppressant preparations. Stemmoside C; the major pregnane glycoside in the active CH 2Cl 2-F was isolated through bioassay-guided fractionation in a previous study by our group, where the compound and its parent methylene chloride fraction showed significant in- vitro pancreatic lipase inhibitory activity which was higher than that of standard orlistat (El-

-1 shiekh et al., 2019). Furthermore, the CH 2Cl 2-F, MANUSCRIPT200 mg kg showed significant in-vivo anti- obesity activity as demonstrated in the current study which could suggest the possible role of stemmoside C and its related compounds in the activity. Further in-vivo studies on stemmoside

C are needed to ascertain its efficacy and to verify its mechanism of action. Therefore, stemmoside C was used as a marker for standardization of the ethanolic extract. Our study is the first to report on the potential use of Argel for controlling weight gain and improvement of some of the deleterious effects accompanying obesity, as well as, investigation of its mechanism of action. Finally, a standardized extract of S. argel could be used for treatment of obesity and should subsequentlyACCEPTED reach clinical trials.

Conclusion

ACCEPTED MANUSCRIPT

The alarming statistics on obesity unambiguously evidences that it should be considered a threat to the general health of the global population since it is associated with an increased risk for many serious diseases. In this study, we used an HFD-induced obesity rat model to verify the anti-obesity effects of S. argel in-vivo . S. argel controlled weight gain, attenuated liver steatosis, improved lipid profile, decreased lipogenesis, modulated adipokines activities, increased β- oxidation gene expression and enhanced inflammatory and oxidative stress derangement. LC–

MS analysis of the major pregnane, stemmoside C was used as a method of standardization of the extract. And we can conclude that, S. argel species is rich in pregnane glycosides and could be a new therapeutic candidate targeting obesity. Future studies are needed to investigate the pharmacological actions of S. argel and stemmoside C on important body organs and to further explore its mechanisms against the metabolic effects of HF feeding in rats.

Conflict of interest None. MANUSCRIPT Authors contribution

Conceiving and Design of the experiment: E. A. Abdelsattar, D.A. Al-Mahdy, M.S. Hifnawy.

Writing of the paper: R.A. El- El-shiekh, D.A. Al-Mahdy, E. A. Abdelsattar. Performing the chemical study: R.A. El- El-shiekh. Performing the pharmacological Study: S.M. Mouneir, R.A.

El- El-shiekh.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit ACCEPTEDsectors.

References

Abd El-Kader, S.M., Saiem Al-Dahr, M.H., 2016. Impact of weight loss on oxidative stress and

ACCEPTED MANUSCRIPT

inflammatory cytokines in obese type 2 diabetic patients. Afr. Health Sci. 16, 725–733.

https://doi.org/10.4314/ahs.v16i3.12

Abdel-Sattar, E., Mehanna, E.T., El-Ghaiesh, S.H., Mohammad, H.M.F., Elgendy, H.A.,

Zaitone, S.A., 2018. Pharmacological Action of a Pregnane Glycoside, Russelioside B, in

Dietary Obese Rats: Impact on Weight Gain and Energy Expenditure. Front. Pharmacol. 9,

990. https://doi.org/10.3389/fphar.2018.00990

Abdel-Sattar, E.A., Abdallah, H.M., Khedr, A., Abdel-Naim, A.B., Shehata, I.A., 2013.

Antihyperglycemic activity of Caralluma tuberculata in streptozotocin-induced diabetic rats.

Food Chem. Toxicol. 59, 111–117. https://doi.org/10.1016/j.fct.2013.05.060

Abo-Elmatty, D.M., Zaitone, S.A., 2011. Topiramate induces weight loss and improves insulin

sensitivity in dietary obese rats: Comparison to sibutramine. Eur. Rev. Med. Pharmacol. Sci. 15, 1187–1195. https://doi.org/10.1016/S0305-4179(0 MANUSCRIPT0)00017-6

Adeneye, A.A., Adeyemi, O.O., Agbaje, E.O., 2010. Anti-obesity and antihyperlipidaemic effect

of Hunteria umbellata seed extract in experimental hyperlipidaemia. J. Ethnopharmacol.

130, 307–314. https://doi.org/10.1016/j.jep.2010.05.009

Ahima, R.S., 2006. Obesity Epidemic in Need of Answers. Gastroenterology 131, 991.

https://doi.org/10.1053/j.gastro.2006.08.061

Alarcon-Aguilar, F.J., Zamilpa, A., Perez-Garcia, M.D., Almanza-Perez, J.C., Romero-Nuñez,

E., Campos-Sepulveda,ACCEPTED E.A., Vazquez-Carrillo, L.I., Roman-Ramos, R., 2007. Effect of

Hibiscus sabdariffa on obesity in MSG mice. J. Ethnopharmacol. 114, 66–71.

https://doi.org/10.1016/j.jep.2007.07.020

ACCEPTED MANUSCRIPT

Arçari, D.P., Bartchewsky, W., Dos Santos, T.W., Oliveira, K.A., Funck, A., Pedrazzoli, J., De

Souza, M.F.F., Saad, M.J., Bastos, D.H.M., Gambero, A., Carvalho, P. de O., Ribeiro, M.L.,

2009. Antiobesity effects of yerba maté extract (ilex paraguariensis) in high-fat diet-induced

obese mice. Obesity 17, 2127–2133. https://doi.org/10.1038/oby.2009.158

Ballak, D.B., Stienstra, R., Tack, C.J., Dinarello, C.A., van Diepen, J.A., 2015. IL-1 family

members in the pathogenesis and treatment of metabolic disease: Focus on adipose tissue

inflammation and insulin resistance. Cytokine. https://doi.org/10.1016/j.cyto.2015.05.005

Basu, M., Prasad, R., Jayamurthy, P., Pal, K., Arumughan, C., Sawhney, R.C., 2007. Anti-

atherogenic effects of seabuckthorn (Hippophaea rhamnoides) seed oil. Phytomedicine 14,

770–777. https://doi.org/10.1016/j.phymed.2007.03.018

Buettner, R., Schölmerich, J., Bollheimer, L.C., 2007. High-fat Diets: Modeling the Metabolic Disorders of Human Obesity in Rodents. Obesity MANUSCRIPT 15, 798–808. https://doi.org/10.1038/oby.2007.608

Chandrasekaran, C. V., Vijayalakshmi, M.A., Prakash, K., Bansal, V.S., Meenakshi, J., Amit, A.,

2012. Review Article: Herbal Approach for Obesity Management. Am. J. Plant Sci. 03,

1003–1014. https://doi.org/10.4236/ajps.2012.327119

Cinti, S., Mitchell, G., Barbatelli, G., Murano, I., Ceresi, E., Faloia, E., Wang, S., Fortier, M.,

Greenberg, A.S., Obin, M.S., 2005. Adipocyte death defines macrophage localization and function in adiposeACCEPTED tissue of obese mice and humans. J. Lipid Res. 46, 2347–2355. https://doi.org/10.1194/jlr.M500294-JLR200

Dardeno, T.A., Chou, S.H., Moon, H.S., Chamberland, J.P., Fiorenza, C.G., Mantzoros, C.S.,

ACCEPTED MANUSCRIPT

2010. Leptin in human physiology and therapeutics. Front. Neuroendocrinol.

https://doi.org/10.1016/j.yfrne.2010.06.002

Deen, A.T.A.-, Al-naqeb, G., 2014. Hypoglycemic effect and in vitro antioxidant activity of

methanolic extract from Argel ( Solenostemma Argel ) plant. Int. J. Herb. Med. 2, 128–131.

Díez, J.J., Iglesias, P., 2003. The role of the novel adipocyte-derived hormone adiponectin in

human disease. Eur. J. Endocrinol. https://doi.org/10.1530/eje.0.1480293

El- Kamali, H.H., Khaled, S.A., 1996. The most common herbal remedies in Central Sudan.

Fitoterapia 67, 301–306.

El-shiekh, R.A., Al-Mahdy, D.A., Hifnawy, M.S., Abdel-Sattar, E.A., 2019. In-vitro screening of

selected traditional medicinal plants for their anti-obesity and anti-oxidant activities. S. Afr.

J. Bot. 123, 43-50. https://doi.org/10.1016/j.sajb.2019.01.022 MANUSCRIPT Elbashir, S.M.I., Devkota, H.P., Wada, M., Kishimoto, N., Moriuchi, M., Shuto, T., Misumi, S.,

Kai, H., Watanabe, T., 2018. Free radical scavenging, α-glucosidase inhibitory and lipase

inhibitory activities of eighteen Sudanese medicinal plants. BMC Complement. Altern.

Med. 18, 282. https://doi.org/10.1186/s12906-018-2346-y

Fernández-Sánchez, A., Madrigal-Santillán, E., Bautista, M., Esquivel-Soto, J., Morales-

González, Á., Esquivel-Chirino, C., Durante-Montiel, I., Sánchez-Rivera, G., Valadez-

Vega, C., Morales-González, J.A., 2011. Inflammation, oxidative stress, and obesity. Int. J.

Mol. Sci. https://doi.org/10.3390/ijms12053117ACCEPTED

Friedewald, W.T., Levy, R.I., Fredrickson, D.S., 1972. Estimation of the concentration of low-

density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge.

ACCEPTED MANUSCRIPT

Clin. Chem. 18, 499–502.

Furukawa, S., Fujita, T., Shimabukuro, M., Iwaki, M., Yamada, Y., Nakajima, Y., Nakayama,

O., Makishima, M., Matsuda, M., Shimomura, I., 2017. Increased oxidative stress in obesity

and its impact on metabolic syndrome. J. Clin. Invest. 114, 1752–1761.

https://doi.org/https://doi.org/10.1172/JCI21625

Hamed, A.I., 2001. New steroids from Solenostemma argel leaves. Fitoterapia 72, 747–755.

https://doi.org/10.1016/S0367-326X(01)00308-2

Hariri, N., Thibault, L., 2010. High-fat diet-induced obesity in animal models Nutrition Research

Reviews. Nutr. Res. Rev. 57–60. https://doi.org/10.1017/S0954422410000168

Hassan, H.A., Hamed, A.I., El-Emary, N.A., Springuel, I. V., Mitome, H., Miyaoka, H., 2001. Pregnene derivatives from Solenostemma argelMANUSCRIPT leaves. Phytochemistry 57, 507–511. https://doi.org/10.1016/S0031-9422(01)00121-2

Hossain, P., Kawar, B., El Nahas, M., 2007. Obesity and Diabetes in the Developing World — A

Growing Challenge. N. Engl. J. Med. 356, 213–215. https://doi.org/10.1056/NEJMp068177

Hotamisligil, G.S., Peraldi, P., Budavari, A., Ellis, R., White, M.F., Spiegelman, B.M., 1996.

IRS-1-mediated inhibition of insulin receptor tyrosine kinase activity in TNF-alpha- and

obesity-induced insulin resistance. Science. 271, 665–668.

Hsiao, P.J., Hsieh,ACCEPTED T.J., Kuo, K.K., Hung, W.W., Tsai, K.B., Yang, C.H., Yu, M.L., Shin, S.J., 2008. Pioglitazone retrieves hepatic antioxidant DNA repair in a mice model of high fat

diet. BMC Mol. Biol. 9, 82. https://doi.org/10.1186/1471-2199-9-82

Ibrahim, E.A., Gaafar, A.A., Salama, Z.A., El Baz, F.K., 2015. Anti-inflammatory and

ACCEPTED MANUSCRIPT

antioxidant activity of Solenostemma argel extract. Int. J. Pharmacogn. Phytochem. Res. 7,

635–641.

Innocenti, G., Dall’Acqua, S., Sosa, S., Altinier, G., Della Loggia, R., 2005. Topical anti-

inflammatory activity of Solenostemma argel leaves. J. Ethnopharmacol. 102, 307–310.

https://doi.org/10.1016/j.jep.2005.06.007

Jain, S., Singh, S.N., 2013. Metabolic effect of short term administration of Hoodia gordonii, an

herbal appetite suppressant. S. Afr. J. Bot. 86, 51–55.

https://doi.org/10.1016/j.sajb.2013.02.002

Jang, W.S., Choung, S.Y., 2013. Antiobesity effects of the ethanol extract of Laminaria japonica

Areshoung in high-fat-diet-induced obese rat. Evidence-based Complement. Altern. Med.

2013, 492807. https://doi.org/10.1155/2013/492807 MANUSCRIPT Jung, U.J., Choi, M.S., 2014. Obesity and its metab olic complications: The role of adipokines

and the relationship between obesity, inflammation, insulin resistance, dyslipidemia and

nonalcoholic fatty liver disease. Int. J. Mol. Sci. https://doi.org/10.3390/ijms15046184

Kamel, M.S., 2003. Acylated phenolic glycosides from Solenostemma argel. Phytochemistry 62,

1247–1250. https://doi.org/10.1016/S0031-9422(03)00022-0

Kang, J.H., Kim, C.S., Han, I.S., Kawada, T., Yu, R., 2007. Capsaicin, a spicy component of hot

peppers, modulates adipokine gene expression and protein release from obese-mouse

adipose tissuesACCEPTED and isolated adipocytes, and suppresses the inflammatory responses of

adipose tissue macrophages. FEBS Lett. 581, 4389–4396.

https://doi.org/10.1016/j.febslet.2007.07.082

ACCEPTED MANUSCRIPT

Khalid, H., Abdalla, W.E., Abdelgadir, H., Opatz, T., Efferth, T., 2012. Gems from traditional

north-African medicine: medicinal and aromatic plants from Sudan. Nat. Products

Bioprospect. 2, 92–103. https://doi.org/10.1007/s13659-012-0015-2

Kopelman, P.G., 2000. Obesity as a medical problem - Review. Nature 404, 635–43.

https://doi.org/https://doi.org/10.1038/35007508 .

Kuriyan, R., Raj, T., Srinivas, S.K., Vaz, M., Rajendran, R., Kurpad, A. V., 2007. Effect of

Caralluma Fimbriata extract on appetite, food intake and anthropometry in adult Indian men

and women. Appetite 48, 338–344. https://doi.org/10.1016/j.appet.2006.09.013

Lazar, M.A., 2007. Resistin- and obesity-associated metabolic diseases, in: Hormone and

Metabolic Research. pp. 710–716. https://doi.org/10.1055/s-2007-985897 Li, H., Kang, J.-H., Han, J.-M., Cho, M.-H., Chung,MANUSCRIPT Y.-J., Park, K.H., Shin, D.-H., Park, H.-Y., Choi, M.-S., Jeong, T.-S., 2015. Anti-Obesity Effects of Soy Leaf via Regulation of

Adipogenic Transcription Factors and Fat Oxidation in Diet-Induced Obese Mice and 3T3-

L1 Adipocytes. J. Med. Food 18, 899–908. https://doi.org/10.1089/jmf.2014.3388

Lim, D.W., Kim, Y.T., Jang, Y.J., Kim, Y.E., Han, D., 2013. Anti-obesity effect of Artemisia

capillaris extracts in high-fat diet-induced obese rats. Molecules 18, 9241–9252.

https://doi.org/10.3390/molecules18089241

Lim, H.H., Yang, S.J., Kim, Y., Lee, M., Lim, Y., 2013. Combined Treatment of Mulberry Leaf

and Fruit ExtractACCEPTED Ameliorates Obesity-Related Inflammation and Oxidative Stress in High

Fat Diet-Induced Obese Mice. J. Med. Food 16, 673–680.

https://doi.org/10.1089/jmf.2012.2582

ACCEPTED MANUSCRIPT

Liu, S., Chen, Z., Wu, J., Wang, L., Wang, H., Zhao, W., 2013. Appetite suppressing pregnane

glycosides from the roots of Cynanchum auriculatum. Phytochemistry 93, 144–153.

https://doi.org/10.1016/j.phytochem.2013.03.010

Loeb, W., Quimby, F., 1999. The clinical chemistry of laboratory animals.

Loftus, T.M., Jaworsky, D.E., Frehywot, C.L., Townsend, C.A., Ronnett, G. V., Daniel Lane,

M., Kuhajda, F.P., 2000. Reduced food intake and body weight in mice treated with fatty

acid synthase inhibitors. Science. 288, 2379–2381.

https://doi.org/10.1126/science.288.5475.2379

Mashmoul, M., Azlan, A., Yusof, B.N.M., Khaza’ai, H., Mohtarrudin, N., Boroushaki, M.T.,

2014. Effects of saffron extract and crocin on anthropometrical , nutritional and lipid profile

parameters of rats fed a high fat diet. J. Funct. Foods 8, 180–187. https://doi.org/https://doi.org/10.1016/j.jff.2014. MANUSCRIPT03.017

Moreno, D.A., Ilic, N., Poulev, A., Brasaemle, D.L., Fried, S.K., Raskin, I., 2003. Inhibitory

effects of grape seed extract on lipases. Nutrition 19, 876–879.

https://doi.org/10.1016/S0899-9007(03)00167-9

Mudawi, M., Chidrawar, V., Yassin, A., Yassin, H., Habeballa, R., Abd E l-wahab, M.,

Sulaiman, M., 2015. Analgesic activity of solenostemma argel by modulating pain. World J.

Pharm. Res. 4, 187–197.

Murano, I., Barbatelli,ACCEPTED G., Parisani, V., Latini, C., Muzzonigro, G., Castellucci, M., Cinti, S.,

2008. Dead adipocytes, detected as crown-like structures, are prevalent in visceral fat

depots of genetically obese mice. J. Lipid Res. 49, 1562–1568.

ACCEPTED MANUSCRIPT

https://doi.org/10.1194/jlr.M800019-JLR200

Myers, M.G., Cowley, M.A., Münzberg, H., 2008. Mechanisms of Leptin Action and Leptin

Resistance. Annu. Rev. Physiol. 70, 537–556.

https://doi.org/10.1146/annurev.physiol.70.113006.100707

Novelli, E.L.B., Diniz, Y.S., Galhardi, C.M., Ebaid, G.M.X., Rodrigues, H.G., Mani, F.,

Fernandes, A.A.H., Cicogna, A.C., Novelli Filho, J.L.V.B., 2007. Anthropometrical

parameters and markers of obesity in rats. Lab. Anim. 41, 111–119.

https://doi.org/10.1258/002367707779399518

Osman, H.M., Shayoub, M.E., Babiker, E.M., Munzir, M.E., 2014. The effect of Solenostemma

argel leaves extract on lipid profile in albino rats. Int. J. Dev. Res. 2, 2010–2013. Padwal, R.S., Majumdar, S.R., 2007. Drug treatmentsMANUSCRIPT for obesity: orlistat, sibutramine, and rimonabant. Lancet. https://doi.org/10.1016/S0140-6 736(07)60033-6

Pan, M., Song, Y.L., Xu, J.M., Gan, H.Z., 2006. Melatonin ameliorates nonalcoholic fatty liver

induced by high-fat diet in rats. J. Pineal Res. 41, 79–84. https://doi.org/10.1111/j.1600-

079X.2006.00346.x

Perrone, A., Plaza, A., Ercolino, S.F., Hamed, A.I., Parente, L., Pizza, C., Piacente, S., 2006.

14,15-Secopregnane derivatives from the leaves of Solenostemma argel. J. Nat. Prod. 69, 50–54. https://doi.org/10.1021/np050263cACCEPTED Perrone, A., Plaza, A., Hamed, A., Pizza, C., Piacente, S., 2008. Solenostemma argel: A rich

source of very unusual pregnane and 14,15-secopregnane glycosides with antiproliferative

activity. Curr. Org. Chem. 12. https://doi.org/10.2174/138527208786786282

ACCEPTED MANUSCRIPT

Plaza, A., Perrone, A., Balestrieri, C., Balestrieri, M.L., Bifulco, G., Carbone, V., Hamed, A.,

Pizza, C., Piacente, S., 2005. New antiproliferative 14,15-secopregnane glycosides from

Solenostemma argel. Tetrahedron 61, 7470–7480.

https://doi.org/10.1016/J.TET.2005.05.048

Seböková, E., Kürthy, M., Mogyorosi, T., Nagy, K., Demcáková, E., Ukropec, J., Koranyi, L.,

Klimes, I., 2002. Comparison of the extrapancreatic action of BRX-220 and pioglitazone in

the high-fat diet-induced insulin resistance. Ann. N. Y. Acad. Sci. 967, 424–30.

Shabbir, F., Khan, S., Yousaf, M.J., Khan, M.A., Rajput, T.A., 2016. Comparison of Effect of

High Fat Diet Induced Obesity and Subsequent Atorvastatin Administration on Different

Anthropometric Measures in Sprague Dawley Rats. Pak Armed Forces Med J 66, 699–704.

Shafek, R., Shaﬁk, N., Michael, H., 2012. argel anti bactrial activity.pdf. Asian J. plant Sci. 11, 143–147. MANUSCRIPT

Taylor, V.H., Macqueen, G.M., 2010. The role of adipokines in understanding the associations

between obesity and depression. J. Obes. 2010. https://doi.org/10.1155/2010/748048

Tinkov, A.A., Nemereshina, O.N., Popova, E. V., Polyakova, V.S., Gritsenko, V.A., Nikonorov,

A.A., 2014. Plantago maxima leaves extract inhibits adipogenic action of a high-fat diet in

female Wistar rats. Eur. J. Nutr. 53, 831–842. https://doi.org/10.1007/s00394-013-0587-6

Tunapong, W., Apaijai, N., Yasom, S., Tanajak, P., Wanchai, K., Chunchai, T., Kerdphoo, S.,

Eaimworawuthikul,ACCEPTED S., Thiennimitr, P., Pongchaidecha, A., Lungkaphin, A.,

Pratchayasakul, W., Chattipakorn, S.C., Chattipakorn, N., 2018. Chronic treatment with

prebiotics, probiotics and synbiotics attenuated cardiac dysfunction by improving cardiac

ACCEPTED MANUSCRIPT

mitochondrial dysfunction in male obese insulin-resistant rats. Eur. J. Nutr. 57, 2091–2104.

https://doi.org/10.1007/s00394-017-1482-3 van Heerden, F.R., Marthinus Horak, R., Maharaj, V.J., Vleggaar, R., Senabe, J. V., Gunning,

P.J., 2007. An appetite suppressant from Hoodia species. Phytochemistry 68, 2545–2553.

https://doi.org/10.1016/j.phytochem.2007.05.022

Vendrell, J., Broch, M., Vilarrasa, N., Molina, A., Gómez, J.M., Gutiérrez, C., Simón, I., Soler,

J., Richart, C., 2004. Resistin, adiponectin, ghrelin, leptin, and proinflammatory cytokines:

Relationships in obesity. Obes. Res. 12, 962–971. https://doi.org/10.1038/oby.2004.118

Vermaak, I., Hamman, J.H., Viljoen, A.M., 2011a. Hoodia gordonii: An up-to-date review of a

commercially important anti-obesity plant. Planta Med. https://doi.org/10.1055/s-0030-

1250643 MANUSCRIPT Vermaak, I., Viljoen, A.M., Hamman, J.H., 2011b. Natural products in anti-obesity therapy. Nat.

Prod. Rep. https://doi.org/10.1039/c1np00035g

World Health Organization., 2000. Obesity : preventing and managing the global epidemic :

report of a WHO consultation. World Health Organization, Geneva, Switzerland.

Wu, J.T., Kral, J.G., 2004. Ghrelin: integrative neuroendocrine peptide in health and disease.

Ann. Surg. 239, 464–74.

You, J.S., Zhao, ACCEPTEDX., Kim, S.H., Chang, K.J., 2013. Positive Correlation Between Serum Taurine and Adiponectin Levels in High-Fat Diet-Induced Obesity Rats BT - Taurine 8, in:

Springer. pp. 105–111.

Yun, J.W., 2010. Possible anti-obesity therapeutics from nature - A review. Phytochemistry.

ACCEPTED MANUSCRIPT

https://doi.org/10.1016/j.phytochem.2010.07.011

Zaitone, S.A., Barakat, B.M., Bilasy, S.E., Fawzy, M.S., Abdelaziz, E.Z., Farag, N.E., 2015.

Protective effect of boswellic acids versus pioglitazone in a rat model of diet-induced non-

alcoholic fatty liver disease: Influence on insulin resistance and energy expenditure.

Naunyn. Schmiedebergs. Arch. Pharmacol. 388, 587–600. https://doi.org/10.1007/s00210-

015-1102-9

MANUSCRIPT

ACCEPTED

ACCEPTED MANUSCRIPT

Table 1 Effect of the total ethanol extract and fractions of S. argel on body weight, % body weight gain, body mass index (BMI), Lee index (LI) and scoring of crown-like structures in rats fed with HFD.

% Body weight Crown-like structures Groups Body wt. (g) BMI LI gain (CLS/mm 2) 195.38±18.90 - 0.46±0.029 0.276±0.008 i- Control 4 393.96±32.43 a + 56 0.82±0.069 a 0.333±0.011 a ii- HFD control 25 217.56±30.83 b - 47.08 0.47±0.056 b 0.271±0.005 b iii- HFD + orlistat, 5 mg/kg b.wt 10 249.00±10.01 ab - 29 0.52±0.05 b 0.293±0.007 b iv- HFD + EtOH-E, 200 mg/kg b.wt 7 230.08±28.60 b - 41.60 0.48±0.05 b 0.285±0.006 b v- HFD + EtOH-E, 400 mg/kg b.wt 5 220.81±25.31 b - 43.95 0.47±0.02 b 0.279±0.005 b vi- HFD + CH 2Cl 2-F, 200 mg/kg b.wt 6 271.53±5.99 ab - 17.85 0.51±0.01 b 0.281±0.002 b vii- HFD + CH 2Cl 2-F, 400 mg/kg b.wt MANUSCRIPT 8 ab b b 278.86±24.51 - 14.75 0.56±0.07 0.289±0.014 viii- HFD + BuOH-F, 200 mg/kg b.wt 10 233.34±25.50 b - 40.77 0.48±0.04 b 0.276±0.009 b ix- HFD + BuOH-F, 400 mg/kg b.wt 8

Data are expressed as mean ± SD (n=8). Statistical analysis was carried out by one-way ANOVA followed by Tukey's multiple comparison test. aSignificant difference from control group at P ˂ 0.05. bSignificant difference from HFD-inducted group at P ˂ 0.05. ab Significant difference from control group and HFD-inducted group at P ˂ 0.05. ACCEPTED

ACCEPTED MANUSCRIPT

Table 2

Effect of the total ethanol extract and fractions of S. argel on lipid profile, atherogenic index (AI) and coronary risk index (CRI) in rats fed with HFD.

Serum Serum total Serum Serum Serum VLDL-c FFA Groups triglycerides cholesterol HDL-c LDL-c AI CRI (mg/dL) (µmole/L) (mg/dL) (mg/dL) (mg/dL) (mg/dL) i- Control 28.14 ±6.64 164.35±3.90 46.57±1.39 111.99±2.39 5.62±1.32 85.21±12.26 2.40±0.08 3.52±0.1 ii- HFD control 377.0 ±17.23 a 245.35±4.54 a 37.50±0.86 a 132.45±2.27 a 75.40±3.44 a 166.34±8.96 a 3.53±0.08 a 6.54±0.14 a iii- HFD + orlistat, 5 mg/kg b.wt 89.80 ±15.49 ab 172.65±8.58 b 45.30±3.79 b 109.39±8.99 b 17.96±3.09 ab 114.87±4.84 ab 2.43±0.34 b 3.83±0.41 b iv- HFD + EtOH-E, 200 mg/kg 70.20 ±17.02 ab 168.08±2.44 b 49.50±4.5 b 104.53±4.6 b 14.04±3.58 ab 93.59±10.64 b 2.13±0.25 b 3.42±0.31 b b.wt v- HFD + EtOH-E, 400 mg/kg 105.20 ±4.02 ab 167.40±1.7 b 47.00±1.0 b 99.36±0.96 ab 21.04±0.80 ab 83.94±11.57 b 2.11±0.03 b 3.56±0.39 b b.wt MANUSCRIPT vi- HFD + CH 2Cl 2-F, 200 mg/kg 78.60 ±14.70 ab 186.60±4.41 ab 51.75±2.48 b 119.13±5.15 b 15.72±2.94 ab 101.58±4.84 b 2.30±0.13 b 3.61±0.14 b b.wt vii- HFD + CH 2Cl 2-F, 400 mg/kg 116.60 ±2.60 ab 165.75±8.25 b 45.25±1.63 b 97.18±8.74 ab 23.32±0.52 ab 119.01±3.89 ab 2.15±0.24 b 3.67±0.26 b b.wt viii- HFD + BuOH-F, 200 mg/kg 118.0±5.61 ab 166.30±3.3 b 49.50±4.97 b 93.20±3.42 ab 23.60±1.12 ab 133.36±15.27 ab 1.90±0.25 b 3.38±0.31 b b.wt ix- HFD + BuOH-F, 400 mg/kg 93.0±4.84 ab 164.95±1.95 b 44.80±3.19 b 101.55±5.01 b 18.60±0.97 ab 87.27±1.15 b 2.28±0.28 b 3.69±0.30 b b.wt

Data are expressed as mean ± SD (n=8). Statistical analysis was carried out by one-way ANOACCEPTEDVA followed by Tukey's multiple comparison test. aSignificant difference from control group at P ˂ 0.05. bSignificant difference from HFD-inducted group at P ˂ 0.05. ab Significant difference from control group and HFD-inducted group at P ˂ 0.05.

ACCEPTED MANUSCRIPT

Table 3

Effect of the total ethanol extract and fractions of S. argel on liver profile, blood glucose, insulin and insulin resistance index in rats fed with HFD.

Glucose Insulin HOMA-IR AST ALT R-QUICK Groups Liver index ALP (U/L) (mg/dL) (mg/dL) (mg/dL) (µIU/mL) index (x 10) i- Control 2.13±0.23 46.0±8.75 13.00±2.55 57.75±6.10 99.0±6.86 16.24±0.25 3.97±0.33 5.13±0.09 ii- HFD control 3.36±0.23 a 88.60±2.30 a 31.20±3.42 a 121.75±10.15 a 135.2±2.17 a 19.14±0.49 a 6.39±0.23 a 4.60±0.03 a iii- HFD + orlistat, 5 mg/kg b.wt 2.48±0.25 b 50.40±4.98 b 20.20±2.49 ab 68.65±3.05 b 108.4±4.03 b 16.03±0.77 b 4.29±0.21 b 5.04±0.06 b iv- HFD + EtOH-E, 200 mg/kg b.wt 2.75±0.47 b 46.0±7.93 b 19.20±1.05 ab 55.30±5.95 b 117.20±2.04 ab 16.19±1.38 b 4.45±0.33 b 5.00±0.08 b v- HFD + EtOH-E, 400 mg/kg b.wt 1.92±0.24 b 45.80±3.29 b 16.60±2.02 b 46.35±5.55MANUSCRIPTb 111.40±1.73 ab 14.57±1.05 b 4.22±0.32 b 5.06±0.08 b ab b ab ab ab b b b vi- HFD + CH 2Cl 2-F, 200 mg/kg b.wt 2.84±0.43 46.20±3.35 18.60±2.30 76.72±9.71 112.80±9.47 16.79±1.27 4.68±0.59 4.95±0.14 vii- HFD + CH Cl -F, 400 mg/kg b b b b 2 2 2.65±0.29 60.0±9.87 ab 27.0±1.58 a 85.52±7.31 ab 119.20±3.49 ab 14.36±1.04 4.22±0.32 5.06±0.09 b.wt viii- HFD + BuOH-F, 200 mg/kg b b b b 2.50±0.29 48.0±2.00 b 20.40±1.67 ab 100.90±6.35 ab 119.20±3.19 ab 15.10±1.34 4.45±0.48 5.00±0.12 b.wt ix- HFD + BuOH-F, 400 mg/kg b.wt 2.58±0.54 b 44.20±3.56 b 17.40±1.34 b 61.20±4.20 b 107.60±3.85 b 16.31±0.26 b 4.33±0.20 b 5.02±0.05 b

Data are expressed as mean ± SD (n=8). Statistical analysis was carried out by one-way ANOVA followed by Tukey's multiple comparison test. aSignificant difference from control group at P ˂ 0.05. bSignificant difference from HFD-inducted group atACCEPTED P ˂ 0.05. ab Significant difference from control group and HFD-inducted group at P ˂ 0.05.

ACCEPTED MANUSCRIPT

Table 4

Effect of the total ethanol extract and fractions of S. argel on adipose index and serum levels of leptin, resistin, adiponectin and ghrelin in rats fed with HFD.

Resistin Adiponectin Groups Adipose index Leptin (ng/mL) Ghrelin (ng/mL) (ng/mL) (ng/mL)

i- Control 0.62±0.07 4.52±1.06 2.21±0.29 7.05±0.10 2.60±0.59

a a a a a ii- HFD control 3.28±0.63 17.82±0.61 4.38±0.12 3.78±0.92 0.89±0.02

iii- HFD + orlistat, 5 mg/kg b.wt 0.48±0.07 b 6.97±1.11 ab 3.52±0.09 ab 6.50±0.44 b 1.83±0.22 ab

b iv- HFD + EtOH-E, 200 mg/kg b.wt 0.93±0.14 4.35±0.19 b 2.84±0.20 ab 6.70±0.37 b 2.53±0.07 b

b b b b b v- HFD + EtOH-E, 400 mg/kg b.wt 0.43±0.09 4.13±0.72 MANUSCRIPT 2.55±0.13 6.75±0.28 2.71±0.36

vi- HFD + CH Cl -F, 200 mg/kg b.wt 1.04±0.23 b 5.44±0.42 b 2.98±0.70 ab 6.28±0.31 b 1.91±0.40 ab 2 2 b ab ab b ab vii- HFD + CH 2Cl 2-F, 400 mg/kg b.wt 0.87±0.04 8.40±0.63 3.84±0.04 6.19±0.66 1.57±0.09

viii- HFD + BuOH-F, 200 mg/kg b.wt 1.53±0.08 ab 14.91±2.31 ab 3.91±0.16 ab 5.67±0.06 b 1.04±0.12 a

b ix- HFD + BuOH-F, 400 mg/kg b.wt 0.53±0.10 3.99±0.32 b 2.49±0.25 b 6.88±0.18 b 2.74±0.15 b

Data are expressed as mean ± SD (n=8). Statistical analysis was carried out by one-way ANOVA followed by Tukey's multiple comparison test. aSignificant difference from control group at P ˂ 0.05.ACCEPTED bSignificant difference from HFD-inducted group at P ˂ 0.05. ab Significant difference from control group and HFD-inducted group at P ˂ 0.05.

ACCEPTED MANUSCRIPT

Table 5 Effect of the total ethanol extract and fractions of S. argel on levels of serum TNF-α and IL-1β and levels of hepatic MDA and GSH in rats fed with HFD. MDA Groups GSH (RF) (nmole/dL) TNF -α (pg/mL) IL-1β (pg/mL) (nmole/dL)

i- Control 16.70±2.12 1.34±0.04 144.42±18.04 109.60±11.98 24.15±0.65 a a ii- HFD control 337.50±20.70 a 260.86±18.94 a 0.53±0.06 17.67±2.19 b b iii- HFD + orlistat, 5 mg/kg b.wt 221.90±22.47 ab 161.44±7.64 ab 0.95±0.09

b b iv- HFD + EtOH-E, 200 mg/kg b.wt b b 15.95±3.22 1.44±0.04 174.25±8.29 122.22±13.69

b b v- HFD + EtOH-E, 400 mg/kg b.wt b b 15.55±1.88 1.6±0.13 153.75±12.50 116.40±6.16

15.02±0.95 b b vi- HFD + CH 2Cl 2-F, 200 mg/kg b.wt 187.65±7.19 ab 132.32±6.68 ab 1.65±0.23 MANUSCRIPTb b vii- HFD + CH Cl -F, 400 mg/kg b.wt ab ab 15.72±1.03 1.33±0.25 2 2 231.05±15.25 181.58±1.11

b ab viii- HFD + BuOH-F, 200 mg/kg b.wt ab ab 17.32±1.64 2.21±0.43 268.70±18.49 183.62±7.57 10.42±2.06 ab ab ix- HFD + BuOH-F, 400 mg/kg b.wt 174.22±12.18 b 128.84±5.19 b 2.31±0.43

ACCEPTED MANUSCRIPT

Table 6 Primers and annealing temperatures used in real-time PCR reactions.

Target Annealing Amplicon Direction Primer sequence (5’ →3’) gene temperature size (bp)

Forward AGCCTAACTCCTCGCTGCAAT Reverse TCCTTGGAACCGTCTGTGTTC FAM-TCCTGCGGCATCCACGAGACCACC- FAS Probe 72 ºC 34 Eclipse Housekeeping β -actin gene Forward AGGGCCACTGATGGTGAAC Reverse TGCCTGAATCGAAGTGGGT CPT-1 FAM- 60 ºC 40 Probe CAACTACTATGCCATGGACTTGCTGTACGT C-TAMRA Housekeeping β-2 microglobulin gene

Table 7 Effect of the total ethanol extract of S. argel on food and water intake. MANUSCRIPT Groups Food intake (g) Water intake (mL)

i-Control 29.99±1.01 31.78±1.5

ii-HFD control 50.71±3.02 a 49.28±1.01 a

v-HFD + EtOH-E, 400 mg/kg b.wt 23.56±3.03 b 27.49±1.5 b

Data are expressed as mean ± SD (n=8). Statistical analysis was carried out by one-way ANOVA followed by Tukey's multiple comparison test. a Significant difference from control group at P< 0.05. b Significant difference from HFD-inducted group at P<0.05.

ACCEPTED