Study on Inter-Taxon Population Structure and Diversity Variation Of

Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

HOSTED BY Contents lists available at ScienceDirect

Annals of Agricultural Sciences

journal homepage: www.elsevier.com/locate/aoas

Study on inter-taxon population structure and diversity variation of hosta inferring from trnG-trnS regional cpDNA ⁎ Hasan Mehraja,c, , Subarna Sharmaa,c, Kouhei Ohnishib, Kazuhiko Shimasakic a The United Graduate School of Agricultural Sciences, Ehime University, Ehime 790-8556, Japan b Research Institute of Molecular Genetics, Kochi University, B200 Monobe, Nankoku, Kochi 783-8502, Japan c Laboratory of Vegetable and Floricultural Science, Faculty of Agriculture and Marine Science, Kochi University, Kochi 783-8502, Japan

ARTICLE INFO ABSTRACT

Keywords: Diversity studies are now a key tool in genetic conservation work. The perennial herb genus Hosta showed a Giboshi complex radiation of numerous species in mountains and riversides around the Shikoku Island, Japan. The Plantain lily purpose of this study was to evaluate trnS-trnG regional genetic structure and the genetic divergence within hosta Shikoku Island taxa populations in this area. We sequenced trnS-trnG regional (chloroplast DNA) cpDNA in 81 populations Taxa comprising 399 individuals of 11 Hosta taxa collected from Shikoku area. The diﬀerent numbers of haplotypes Haplotype network were found in diﬀerent taxon. The divergences of population of Hosta genus and individual taxon were shown in Phylogenetic tree NJ phylogenetic tree. The highest number of haplotypes (14) was found in H. longipes var. gracillima. H. sieboldiana and H. kiyosumiensis populations showed the maximum haplotype diversity (1.0), and H. alismifolia showed maximum nucleotide diversity (π: 0.012). The genetic structures of the H. tardiva with H. kikutii var.

caput-avis (FST divergence: 52.7%) and H. sieboldiana with H. tardiva (FST divergence: 52.2%) populations were

greatly diﬀerentiated from each other (FST value: > 0.15 to 0.25). We found maximum evolutionary divergence (0.009) between H. alismifolia and H. kikutii var. polyneuron populations. The signiﬁcant negative neutrality test values are the evidence of expansion of the total population. H. sieboldiana and H. kiyosumiensis are more widely distributed than other taxa. H. sieboldiana, H. alismifolia, H. longipes var. gracillima and H. kikutii var. polyneuron showed the excessive low frequency variants.

Introduction 1976). H. shikokiana had already been placed on the endangered species list in this area (Schmid, 1991). Among the habitats around Shikoku, Genus Hosta, a member of the Asparagaceae family, is a shade-tol- hosta plants show numerous numbers of taxa with phenotypic varia- erant perennial garden plant. It is also known as plantain lily (giboshi in tions which has not been studied yet at genetical level. Hosta plants are Japan). It is preferred by gardeners for its striking foliage, and creation frequently found in this area; but a number of taxa are placed under the of a landscape focal point. Islands are unique but have not been pro- list of extinction. It may be caused by the continuous changes of allelic tected from human activities. Evolutionary processes works differently frequency through adaptation to locality that resulted from selection in any island thus results faster species variation in an island archipe- potency, quantity of gene flow, efficient population size (Andre et al., lago than on the larger continuous landmass of a larger continent. Hosta 2011) and ecological factors as well (Pilot et al., 2006). Neutrality tests has approximately 43 species which was originated in Japan, Korea and are generally indicated the abuses of mutation equilibrium flow caused China (Schmid, 1991). Fujita (1976) identified 18 species and 7 vari- by selection or alter in population size (Tajima, 1989; Fu and Li, 1993) eties of the Hosta genus in Japan. The Japanese archipelago has many and Fu’s test is done for the past population expansion (Fu, 1997). FST islands; Hokkaido, Honshu, Shikoku, and Kyushu are the main four matrix provides the insights the genetic structure variation (Holsinger (Millien-Parra and Jaeger, 1999). Hosta taxa are widely distributed and Weir, 2009) and searches the associations between allele fre- throughout all of these four islands in Japan. Though Shikoku is the quencies with particular habitats (Bierne et al., 2011). smallest among these major islands, but it is a major center for the Molecular markers have been used as effective and dominant tools distribution of genus Hosta. Shikoku is considered as the home of some for inference of the current and previous demographic progression of taxa, including H. shikokiana and H. kikutii var. polyneuron (Fujita, plant species (Maki et al., 2008). Genetic structure, diversity, and

Peer review under responsibility of Faculty of Agriculture, Ain-Shams University. ⁎ Corresponding author at: Laboratory of Vegetable and Floricultural Science, Faculty of Agriculture and Marine Science, Kochi University, Kochi 783-8502, Japan. E-mail addresses: [email protected] (H. Mehraj), [email protected] (S. Sharma), [email protected] (K. Ohnishi), [email protected] (K. Shimasaki). https://doi.org/10.1016/j.aoas.2017.12.003 Received 26 February 2017; Received in revised form 7 December 2017; Accepted 8 December 2017 0570-1783/ 2017Production and hosting by Elsevier B.V. on behalf of Faculty of Agriculture, Ain Shams University. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Please cite this article as: Mehraj, H., Annals of Agricultural Sciences (2017), https://doi.org/10.1016/j.aoas.2017.12.003 H. Mehraj et al. Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

Table 1 Hosta genus sample collection locality around Shikoku, Japan with geographical data and accession number.

Pcode NInd Locality N E Accession number

Hosta sieboldiana A1 3 Shiozuka highland roadside, Tairano, Yamashiro-cho, Miyoshi-shi, Tokushima 33.9900 133.8800 LC152207 A2 5 Shiozuka highland roadside, Tairano, Yamashiro-cho, Miyoshi-shi, Tokushima 33.9300 133.8500 LC152208 A3 3 Yamashiro-cho, Miyoshi-shi, Tokushima 34.0500 134.5200 LC152209 A4 6 Yamashiro-cho, Miyoshi-shi, Tokushima 34.0700 134.5200 LC152210

Hosta alismifolia B1 12 Itachino, Nankoku-shi, Kochi 33.5600 133.6300 LC152211 B2 2 Mihara-mura, Hata-gun, Kochi 32.8800 132.9100 LC152212 B3 3 Sakawa-cho, Takaoka-gun, Kochi 33.5200 133.2200 LC152213 B4 5 Sakawa-cho, Takaoka-gun, Kochi 33.5000 133.2300 LC152214 B5 6 Sakawa-cho, Takaoka-gun, Kochi 33.5100 133.2300 LC152215 B6 5 Koda, Kochi-shi, Kochi 33.5200 133.5100 LC152216 B7 4 Koda, Kochi-shi, Kochi 33.5100 133.5100 LC152217

Hosta sieboldii C1 6 Otoyo-cho, Nagaoka-gun, Kochi 33.4147 133.4130 LC152218 C2 4 Yoshiuno Otsu, Tsuno-cho, Takaoka-gun, Kochi 33.2726 133.0170 LC152219 C3 5 Yoshiuno Otsu, Tsuno-cho, Takaoka-gun, Kochi 33.2715 133.0140 LC152220 C4 5 Yoshiuno Otsu, Tsuno-cho, Takaoka-gun, Kochi 33.2735 133.0370 LC152221 C5 5 Nagatake, Kamo, Sakawa-cho, Takaoka-gun, Kochi 33.3060 133.1940 LC152222 C6 4 Higashi Iya, Higashimiyoshi-cho, Miyoshi-gun, Tokushima 34.0870 134.5586 LC152223 C7 6 Sedo (Akutagawa), Tosa-cho, Tosa-gun, Kochi 33.7100 133.4100 LC152224

Hosta longissima D1 4 Kochi kada (Warei shrine), Ino-cho, Agawa-gun, Kochi 33.5358 133.5141 LC152225 D2 6 Kochi koda dais, Kochi-shi, Kochi 33.5339 133.0879 LC152226 D3 2 Tengu highland, Tsuno-cho, Takaoka-gun, Kochi 33.4707 132.9780 LC152227

Hosta tardiva E1 5 Sedo, Tosa-cho, Tosa-gun, Kochi 33.3902 133.2584 LC152228 E2 7 Higashiishihara, Tosa-cho, Tosa-gun, Kochi 33.4145 133.2773 LC152229 E3 6 Higashiishihara, Tosa-cho, Tosa-gun, Kochi 33.4029 133.2695 LC152230 E4 5 Higashiishihara, Tosa-cho, Tosa-gun, Kochi 33.4168 133.2789 LC152231 E5 4 Nishiyamagumi, Sakawa-cho, Takaoka-gun, Kochi 33.2853 133.1540 LC152232 E6 4 Oishi, Motoyama-cho, Nagaoka-gun, Kochi 33.4517 133.3550 LC152233 E7 8 Itachino, Nankoku-shi, Kochi 33.5637 133.3749 LC152234 E8 4 Itachino, Nankoku-shi, Kochi 33.5648 133.3749 LC152235 E9 5 Itachino, Nankoku-shi, Kochi 33.5666 133.3748 LC152236 E10 4 Kochi koda dais, Kochi-shi, Kochi 33.5308 133.5250 LC152237

Hosta longipes var. gracillima F1 5 Tosayama-mura, Kochi-shi, Kochi 33.3758 133.2981 LC152238 F2 3 Tosayama-mura, Kochi-shi, Kochi 33.3799 133.2965 LC152239 F3 6 Kagamiogachi, Kochi-shi, Kochi 33.5789 133.4730 LC152240 F4 4 Kagamiogachi, Kochi-shi, Kochi 33.5798 133.4730 LC152241 F5 5 Kagamikariyama, Kochi-shi, Kochi 33.5994 133.4704 LC152242 F6 6 Kagamikariyama, Kochi-shi, Kochi 33.5994 133.4707 LC152243 F7 1 Kuroson valley, Shimanto-shi, Kochi 33.1317 132.8970 LC152244 F8 3 Kuroson valley, Shimanto-shi, Kochi 33.1389 132.8910 LC152245 F9 6 Nametoko valley, Uwajima-shi, Ehime 33.1275 132.4840 LC152246 F10 3 Kankakedori, Shodoshima-cho, Shozu-gun, Kagawa 34.5173 134.3201 LC152247 F11 4 Kozukushi-cho, Sukumo-shi, Kochi 32.9407 132.7510 LC152248 F12 4 Kozukushi-cho, Sukumo-shi, Kochi 32.8307 132.7610 LC152249 F13 9 Onaro, Shimanto-cho, Takaoka-gun, Kochi 33.2309 132.9831 LC152250 F14 7 Shimotsui, Shimanto-cho, Takaoka-gun, Kochi 33.2996 132.9449 LC152251 F15 4 Shimotsui, Shimanto-cho, Takaoka-gun, Kochi 33.2936 132.9559 LC152252 F16 8 Hashikami, Hashikami-cho, Sukumo-shi, Kochi 33.0400 132.7200 LC152253

Hosta nakaiana G1 4 Hongawa-Erimon, Ino-cho, Agawa-gun, Kochi 33.7269 133.2398 LC152254 G2 2 Omorikawa valley, Hongawa, Ino-cho, Agawa-gun, Kochi 33.4248 133.1780 LC152255 G3 2 Omorikawa valley, Hongawa, Ino-cho, Agawa-gun, Kochi 33.4136 133.1810 LC152256

Hosta kikutii var. caput-avis H1 5 Tosayamahirose, Kochi-shi, Kochi 33.4734 133.3520 LC152257 H2 5 Tosayamahirose, Kochi-shi, Kochi 33.4634 133.3620 LC152258 H3 7 Hibihara, Tosayamahirose, Kochi-shi, Kochi 33.4791 133.3830 LC152259 H4 3 Hibihara, Tosayamahirose, Kochi-shi, Kochi 33.4841 133.3530 LC152260 H5 6 Tosayama, Kochi-shi, Kochi 33.3816 133.3031 LC152261 H6 4 Hibihara, Tosayamahirose, Kochi-shi, Kochi 33.5324 133.7682 LC152262

Hosta kikutii var. polyneuron I1 7 Nishitosanakaba, Shimanto-shi, Kochi 33.0997 132.8218 LC152263 I2 4 Nishitosanakaba, Shimanto-shi, Kochi 33.1997 132.8399 LC152264 I3 6 Nishitosanakaba, Shimanto-shi, Kochi 33.0527 132.8669 LC152265 I4 10 Hidaka-mura, Takaoka-gun, Kochi 33.3354 133.2150 LC152266 I5 5 Hidaka-mura, Takaoka-gun, Kochi 33.3924 133.2030 LC152267 (continued on next page)

2 H. Mehraj et al. Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

Table 1 (continued)

Pcode NInd Locality N E Accession number

I6 5 Kuwagauchi, Tsuno-cho, Takaoka-gun, Kochi 33.2273 133.2010 LC152268 I7 4 Kuwagauchi, Tsuno-cho, Takaoka-gun, Kochi 33.2114 133.1910 LC152269 I8 2 Kuwagauchi, Tsuno-cho, Takaoka-gun, Kochi 33.2414 133.1710 LC152270 I9 9 Kuwagauchi, Tsuno-cho, Takaoka-gun, Kochi 33.2614 133.1410 LC152271 I10 10 Kuwagauchi, Tsuno-cho, Takaoka-gun, Kochi 33.2114 133.1810 LC152272 I11 5 Kuwagauchi, Tsuno-cho, Takaoka-gun, Kochi 33.2675 133.1610 LC152273 I12 5 Hidaka-mura, Takaoka-gun, Kochi 33.2400 132.9800 LC152274 I13 2 Hidaka-mura, Takaoka-gun, Kochi 33.9210 133.3670 LC152275 I14 4 Hidaka-mura, Takaoka-gun, Kochi 33.7000 133.5270 LC152276 I15 3 Oboke, Yamashiro-cho, Miyoshi-shi, Tokushima 33.8783 133.76.04 LC152277 I16 5 Oboke, Yamashiro-cho, Miyoshi-shi, Tokushima 33.8851 133.76.04 LC152278

Hosta longipes var. caduca J1 10 Besshi, Niyodogawa-cho, Agawa-gun, Kochi 33.5300 133.0500 LC152279 J2 2 Tengu highland, Tsuno-cho, Takaoka-gun, Kochi 33.2756 133.1520 LC152280 J3 2 Tengu highland, Tsuno-cho, Takaoka-gun, Kochi 33.4653 133.0050 LC152281 J4 4 Besshi, Niyodogawa-cho, Agawa-gun, Kochi 33.3985 133.1350 LC152282 J5 4 Shimonanokawa, Niyodogawa-cho, Agawa-gun, Kochi 33.5800 133.0980 LC152283

Hosta kiyosumiensis K1 5 Taniuchi, Naka-cho, Naka-gun, Tokushima 33.9800 134.4900 LC152284 K2 5 Taniuchi, Naka-cho, Naka-gun, Tokushima 33.8900 134.5500 LC152285 K3 6 Taniuchi, Naka-cho, Naka-gun, Tokushima 33.8100 134.4700 LC152286 K4 6 Ousakayama, Ikku, Kochi 33.5200 133.5900 LC152287

Pcode = Population code; NInd = No. of individuals, N = Latitude, E = Longitude and RS = River system. interspecific or intraspecific genetic relationship of plant species can be determined through study of their cpDNA sequences (Ayele et al., 2009; Table 2 Neutrality test for whole population of Hosta genus. Taberlet et al., 1991). The low evolutionary rate of this molecule is a fi serious limitation at the intraspeci c level. The non-coding regions mn S π DT Tajima Fu and Li’sDFu Fu and Li’sFFu display the highest frequency of mutations. Therefore, sequencing of (1989) and Li (1993) and Li (1993) the non-coding regions, the resolution of cpDNA can be increased both 81 982 60 0.00450 −2.26319** −5.18127** −4.81023** for evolutionary studies, and for identifying intraspecific genetic markers. Non-coding regions of chloroplast such as the intergenic spacer Abbreviations: m = number of sequences, n = total number of sites, S = Number of

[between the trnL-trnF or, rpl20-rps12 gene] can be used for successful segregating sites, π = nucleotide diversity, DT = Tajima’s D test. variation and relationships among closely related species or genera DT: **, P < .01. (Van Ham et al., 1994; Gielly and Taberlet, 1994; Cros et al., 1998; Fu and Li’s D and F: **, P < .02. Khan and Azim, 2011). The key idea in the current study was to place NB: calculation was done for the whole data set. the primers for the polymerase chain reaction (PCR) in a conserved DNA extraction and amplification region. The succession of conserved trn genes and several hundred base pairs of non-coding regions have a higher rate of nucleotide substitution Young leaves were used for DNA extraction. Leaves (40–80 mg) of the single-copy regions (Wolfe et al., 1987). We selected an inter- were washed in 70% ethanol, kept in microcentrifuge tube with a genic spacer (trnS-trnG) from the cpDNA sequences for tobacco Zirconia bead and Nuclei Lysis solution (600 µl); and disrupted at (Hamilton, 1999). It was hypothesized that region between the trnS- 3500 rpm for 3 min by Micro Smash MS-100 bead beater (Tomy Seiko, trnG genes was suitable for the genetic structure and diversity variation. Tokyo, Japan). The genomic DNA was purified in accordance with the Concerning the hypotheses, we estimated the trnS-trnG regional cpDNA manufacture’s instructions (Wizard® Genomic DNA Purification Kit, structure and diversity with a view to evaluate the genetic structure Promega, Wisconsin, USA). Finally, DNA was dehydrated with 100 µl within taxa; and the genetic divergence among taxa of the genus Hosta DNA Rehydration solution. We amplified chloroplast intergenic regions in Shikoku, Japan. with a pair of primers trnS (GCU) (GCCGCTTTAGTCCACTCAGC) and trnG (UCC) (GAACGAATCACACTTTTACCAC) (Hamilton, 1999) with following conditions: 95 °C (incubation) for 1 min, then 30 cycles of Materials and methods incubation at 95 °C for 30 s, 60 °C for 60 s, 68 °C for 60 s and finally extension at 68 °C for 5 min. The reaction volume for the cpDNA am- Plant materials plification was 40 µl [27 µl distilled water, 4 µl thermo reaction buffer, 4 µl dNTPs, 2 µl trn S (GCU) primer, 2 µl trn G (UCC) primer, 1 µl DNA Leaves of hosta plant (1–12 individuals) were collected from dif- and 0.2 µl Taq DNA polymerase]. ferent locations around Shikoku Island, Kochi prefecture, Japan (Table 1 and supplementary Fig. S1) between October 2014 and June 2015. The locations data were recorded using Garmin eTrex20J. DNA sequencing and repositories Sample within one meter wasn’t collected from each location to avoid fi fi ® the collection error as much as possible. The collected leaves were Ampli ed PCR products were puri ed using Wizard SV Gel and preserved in ziplock plastic bags and stored them in deep freezer PCR Clean-Up System (Promega, Wisconsin, USA). Nucleotides were ™ (−80 °C) until DNA extraction. In total, 399 individuals of 11 taxa sequenced using BigDye Terminator Cycle Sequencing Ready Reaction [identified morphologically (Schmid, 1991)] of Hosta genus were se- Kit (Applied Biosystems, California, USA), and analyzed on Genetic quenced (Table 1). Analyzer Models 3100 and 3130 (Applied Biosystems). For all variants, sequencing was performed at least twice to verify the variations. After sequencing, sequence data chromatograms were edited using SeqEd

3 H. Mehraj et al. Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

Table 3

Estimation of the number of polymorphic sites (NPS), haplotype diversity (h), nucleotide diversity (π) and the neutrality test (Tajima's D test, Fu and Li’s D* and F* and Fu's FS test) for eleven hosta taxa.

Statistics Gp_1 Gp_2 Gp_3 Gp_4 Gp_5 Gp_6 Gp_7 Gp_8 Gp_9 Gp_10 Gp_11

NPS 4.0 24.0 8.0 4.0 6.0 62.0 7.0 5.0 39.0 8.0 5.0 h 1.0 0.714 0.286 0.667 0.533 0.975 0.667 0.8 0.967 0.9 1.0 π 0.002 0.012 0.0 0.0 0.003 0.004 0.0 0.003 0.008 0.005 0.003

Tajima's D test Tajima (1989) Tajima's D −0.065 −0.311 NA NA 0.956 −1.546 NA 1.541 −1.227 0.687 0.372

Fu and Li’s D* and F* Fu and Li (1993) Fu and Li’sD −0.065 −0.312 NA NA 0.956 −1.742 NA 1.541 −1.271 0.687 0.372 Fu and Li’sF −0.060 −0.323 NA NA 0.904 −1.936 NA 1.456 −1.441 0.676 0.351

Fu's FS test Fu (1997) FS −1.741 2.562 3.644 1.609 0.388 −1.963 0.000 0.067 −3.843 0.212 −1.322

N/A = not applicable and neutrality test were not signiﬁcant at P > .10. Gp_1: H. sieboldiana, Gp_2: H. alismifolia, Gp_3: H. sieboldii, Gp_4: H. longissima, Gp_5: H. tardiva, Gp_6: H. longipes var. gracillima, Gp_7: H. nakaiana, Gp_8: H. kikutii var. caput-avis, Gp_9: H. kikutii var. polyneuron, Gp_10: H. longipes var. caduca and Gp_11: H. kiyosumiensis. NB: calculation was done for each species independently; number of individuals sequenced and the sequence length for each species are presented in the supplementary Tables S1 and S2.

(Applied Biosystems, Foster City, CA) version 1.0.3 (Hagemann and corrected manually. Evolutionary analyses for whole population were Kwan, 1997) and deposited in DNA Data Bank of Japan (DDBJ) under analyzed by MEGA7. DnaSP v5 (Librado and Rozas, 2009) was used to the accession number LC152207 to LC152287. estimate the number of segregating sites (S) for the dataset of whole

genus; number of haplotypes and number of polymorphic sites (NPS) Data analysis and haplotype diversity (h) for the dataset of each taxon; nucleotide diversity (π) and neutrality test (Tajima’s D, Fu and Li’sD∗ and F∗) for Alignment was done by ClustalW process (Thompson et al., 1994) the dataset of whole genus and each individual taxon. Neutrality test using MEGA7 (Kumar et al., 2016) and the aligned regions were (Fu's FS) (intra-population methods) for individual taxon and pairwise

Table 4

Assessment of population pairwise ﬁxation index (FST) (distance method) over sequence pairs from cpDNA for eleven hosta taxa.

Gp_1 Gp_2 Gp_3 Gp_4 Gp_5 Gp_6 Gp_7 Gp_8 Gp_9 Gp_10 Gp_11

Gp_1 0 Gp_2 0.208 0 Gp_3 0.450 0.206 0 Gp_4 0.465 −0.201 0.305 0 Gp_5 0.522 0.282 −0.007 0.374 0 Gp_6 0.076 0.113 0.089 −0.012 0.128 0 Gp_7 0.449 0.042 0.306 0.400 0.365 −0.066 0 Gp_8 0.364 0.269 0.468 0.450 0.527 0.044 0.381 0 Gp_9 0.233 0.176 0.038 0.121 0.106 0.100 0.082 0.118 0 Gp_10 0.376 0.145 0.135 0.223 0.229 0.006 0.170 0.163 −0.069 0 Gp_11 0.444 0.150 0.379 0.368 0.451 0.045 0.289 0.347 0.108 0.075 0

Table 5 Estimation of evolutionary divergence over sequence pairs between the hosta taxa population from cpDNA.

Gp_1 Gp_2 Gp_3 Gp_4 Gp_5 Gp_6 Gp_7 Gp_8 Gp_9 Gp_10 Gp_11

Gp_1 0.002 0.001 0.002 0.002 0.002 0.002 0.001 0.002 0.002 0.002 Gp_2 0.007 0.002 0.001 0.002 0.002 0.001 0.002 0.002 0.002 0.002 Gp_3 0.004 0.006 0.001 0.001 0.001 0.001 0.002 0.001 0.001 0.001 Gp_4 0.004 0.004 0.003 0.001 0.001 0.001 0.002 0.002 0.001 0.002 Gp_5 0.004 0.006 0.002 0.003 0.001 0.001 0.002 0.001 0.001 0.001 Gp_6 0.005 0.007 0.004 0.004 0.004 0.001 0.001 0.001 0.001 0.001 Gp_7 0.005 0.006 0.005 0.003 0.004 0.005 0.002 0.002 0.002 0.001 Gp_8 0.004 0.007 0.005 0.005 0.005 0.004 0.005 0.001 0.001 0.001 Gp_9 0.007 0.009 0.005 0.006 0.005 0.006 0.007 0.006 0.001 0.001 Gp_10 0.005 0.007 0.004 0.004 0.004 0.004 0.005 0.004 0.005 0.001 Gp_11 0.005 0.006 0.004 0.004 0.004 0.005 0.005 0.004 0.006 0.004

Gp_1: H. sieboldiana, Gp_2: H. alismifolia, Gp_3: H. sieboldii, Gp_4: H. longissima, Gp_5: H. tardiva, Gp_6: H. longipes var. gracillima, Gp_7: H. nakaiana, Gp_8: H. kikutii var. caput-avis, Gp_9: H. kikutii var. polyneuron, Gp_10: H. longipes var. caduca and Gp_11: H. kiyosumiensis. The numbers of base substitutions per site from averaging over all sequence pairs between groups are shown. Above the diagonal of the table represents Standard error estimate(s). The analysis involved 81 nucleotide sequences. All positions with less than 95% site coverage were eliminated. That is, fewer than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position. There were a total of 982 positions in the ﬁnal dataset. We used ML model for analysis (Tamura et al., 2004) where the diﬀerences in the composition bias among sequences were considered in evolutionary comparisons (Tamura and Kumar, 2002).

4 H. Mehraj et al. Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

Fig. 1. SNP Haplotype network for eleven taxa of Hosta genus (a) H. sieboldiana, (b) H. alismifolia, (c) H. sieboldii, (d) H. longissima, (e) H. tardiva, (f) H. longipes var. gracillima, (g) H. nakaiana, (h) H. kikutii var. caput-avis, (i) H. kikutii var. polyneuron, (j) H. longipes var. caduca, and (k) H. kiyosumiensis collected from Shikoku areas of Japan based on trnS-trnG regional cpDNA sequences. Pie circles indicated the origin of haplotypes with proportional size of the number of records in diﬀerent color and cross mark into the connecting line between pie circles noted the number of nucleotide substitution. Here, Kochi, Tokushima, Kagawa and Ehime are the four prefectures in Shikoku Island, Japan.

FST difference (distance method) for the population of among taxa were for Tajima’sD(−2.263), Fu and Li’sD(−5.181) and Fu and Li’sF estimated using Arlequin ver. 3.11 (Excoffier et al., 2005). Evolutionary (−4.810) indicated an excess of low frequency variants caused by in- divergence both for individual taxa and whole genus was estimated by creasing population size (Table 2). MEGA7. Population relationships i.e. phylogenetic tree was constructed as NJ tree (Saitou and Nei, 1987) using MEGA7, and bootstrap values Variation in neutrality and diversity test were reconfirmed by PAUP 4.0a147 (Swofford, 2003). PopART was used for TCS statistical parsimony haplotypes networks for the dataset The number of polymorphic sites was 4, 24, 8, 4, 6, 62, 7, 5, 39, 8 of whole genus and each individual taxon to determine the relationship and 5 for all taxa in chronological order (Table 3) and the polymorphic among the haplotypes (Clement et al., 2000). sites were shown in supplementary Table S1. The maximum haplotype diversity was found from H. sieboldiana and H. kiyosumiensis popula- Results tions (h: 1.000); maximum nucleotide diversity from H. alismifolia (π: 0.012) and the minimum haplotype diversity from H. sieboldii (h: 0.286) The trnS-trnG intergenic regions of cpDNA were analyzed for 81 (Table 3). It was found the higher value for haplotype diversity (h) than hosta plant populations containing up to 982 bp and found 60 numbers that of nucleotide diversity (π) for all taxa (Table 3). Tajima’s D, Fu and of segregating sites with 0.005 nucleotide diversity. The negative values Li’s D and Fu and Li’s test were not significant at P > .10 level of

5 H. Mehraj et al. Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

Fig. 2. SNP Haplotype network for 57 haplotypes from eleven Hosta species from Shikoku areas of Japan based on cpDNA sequences. Pie circles indicated the origin of haplotypes with proportional size of the number of records in different color and cross mark into the connecting line between pie circles noted the number of nucleotide substitutions. Some of the node level consisted identical sequences like Hap._5 (Hap._5, Hap._11); Hap._19 (Hap._19, Hap._33); Hap._39 (Hap._39, Hap._56); Hap._8 (Hap._8, Hap._9, Hap._12, Hap._13, Hap._40, Hap._53) and Hap._21 (Hap._21, Hap._41, Hap._50). significance. It was found the negative values for Tajima’s D, Fu and Li’s Variation in genetic structure D and Fu and Li’s test from the population of H. sieboldiana, H. alismifolia, H. longipes var. gracillima and H. kikutii var. polyneuron. Negative We found different levels of genetic differentiation: little (FST Tajima’s D signifies an excess of low frequency polymorphisms relative value: > 0 to 0.05); moderate (FST value: > 0.05 to 0.15); high (FST to expectation while positive value refer low levels of both low and high value: > 0.15 to 0.25); and very high (FST value: > 0.25). However, we frequency polymorphisms. It was found negative values for Fu’s Fs test found maximum FST divergence (52.7%) between H. tardiva and H. in H. sieboldiana, H. longipes var. gracillima, H. kikutii var. polyneuron kikutii var. caput-avis populations i.e., these two taxa were greatly dif- and H. kiyosumiensis. The negative value of Fu’s Fs is the evidence for an ferentiated, that were closely followed by the H. sieboldiana and H. excess number of alleles than that expected from a recent population tardiva population (52.2%). It wasn’t found genetic differentiation expansion. On the other hand, positive value of Fu’s Fs is the evidence among some taxa (FST value: ≤0) (Table 4). The highest evolutionary for the deficiency of alleles, which would be expected from a recent divergence (0.009) was found between populations from H. alismifolia population bottleneck. The mean pairwise difference, locus wise nu- and H. kikutii var. polyneuron (Table 5). cleotide diversity and gene diversity was varied from taxon to taxon (supplementary Table S2). Haplotype network

Diﬀerent numbers of haplotypes were found for each taxon from diﬀerent prefectures (Fig. 1a–k). Maximum fourteen haplotypes [Kochi:

6 H. Mehraj et al. Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

Table 6 branches of the populations [e.g., I8 and B3 (97%)] were supported by Number and percentage of haplotypes for each hosta taxa and prefecture. considerable bootstrap value.

Taxa Number of haplotypes % Prefectures Number of % haplotypes Discussion Gp_1 4 (Kochi 4) 7.02 Gp_2 4 (Kochi 4) 7.02 It was observed that results of Tajima’s D test, Fu and Li’s D and F Gp_3 2 (Kochi 1, Tokushima 1) 3.51 test had significant negative values for the whole population (Table 2), Gp_4 2 (Kochi 2) 3.51 which was evidence for purifying selection at this locus or for increase Gp_5 4 (Kochi 4) 7.02 Gp_6 14 (Kochi 12, Kagawa 1, 24.55 in the population size. These negative values also indicated the pre- Ehime 1) sence of excess low frequency polymorphism/mutations and an excess Gp_7 2 (Kochi 2) 3.51 Kochi 49 85.97% of rare mutations in these genes of hosta populations. Results of the Gp_8 4 (Kochi 4) 7.02 Tokushima 6 10.53% current study confirmed that Hosta genus around Shikoku area had rare Gp_9 13 (Kochi 11, Tokushima 2) 22.80 Kagawa 1 1.75% Gp_10 4 (Kochi 4) 7.02 Ehime 1 1.75% alleles at low frequencies due to recent discriminating sweep up, ex- Gp_11 4 (Kochi 1, Tokushima 3) 7.02 pansion of the population after a recent bottleneck or some linkage to a swept gene. Our results indicated very high haplotype diversity (h) and Gp_1: H. sieboldiana, Gp_2: H. alismifolia, Gp_3: H. sieboldii, Gp_4: H. longissima, Gp_5: H. low nucleotide diversity (π) for the population of all taxa, and it means tardiva, Gp_6: H. longipes var. gracillima, Gp_7: H. nakaiana, Gp_8: H. kikutii var. caput-avis, all of the studied taxa have many haplotypes but very similar between Gp_9: H. kikutii var. polyneuron, Gp_10: H. longipes var. caduca and Gp_11: H. kiyosumiensis. them (Table 3 and supplementary Table S1). It is also clear from the haplotype network, which shows very low nucleotide differences between haplotypes (Figs. 1 and 2). From these results, we can say that 12; Kagawa; 1 (haplotype 8); both Kochi and Ehime: 1 (haplotype 3: F3, each of the studied hosta taxa expanded their population after a period F7 and F9 populations) were detected for H. longipes var. gracillima of low effective population size; and their rapid population growth (Fig. 1f). H. kikutii var. polyneuron was the second highest haplotype enhanced the retention of new mutations (Grant and Bowen, 1998; (13) providing taxon [Kochi: 11; Tokushima: 1 (haplotype 13); both Avise et al., 1984; Rogers and Harpending, 1992) interpretation of the Kochi and Tokushima: (haplotype 4: I4, I13, and I15 populations)] interrelation of gene vs. nucleotide diversity. (Fig. 1i). For H. kiyosumiensis, in total four haplotypes were detected. Though neutrality test for individual taxon didn’t show any sig- Only one haplotype was found from Kochi (haplotype 4) and rest three nificant value (Table 3) but the results indicated (1) there was no evi- from Tokushima (Fig. 1 k). The 81 sequences of hosta from four geo- dence for H. sieboldii, H. longissima, H. nakaiana regarding change in graphic locations (Kochi, Tokushima, Kagawa and Ehime prefectures) population size or pattern for selection; (2) there was evidence of over showed 57 haplotypes around Shikoku. Fifty-seven haplotypes were dominant selection at this locus or a recent population bottleneck for H. used for constructing haplotype networks (Fig. 2). However, the hap- tardiva, H. kikutii var. caput-avis, H. longipes var. caduca and H. kiyosu- lotype network revealed 47 haplotypes without consideration of taxa, miensis (D > 0 and Fu and Li’s D & F > 0); and (3) there was evi- ff T i.e., some of the haplotypes from di erent taxa contained identical dence similar to that for the whole population in H. sieboldiana, H. genetic material. From the haplotype network, it was found that all alismifolia, H. longipes var. gracillima, H. kikutii var. polyneuron (DT <0 haplotypes were clustered in three major groups. The sequences of the and Fu and Li’s D & F < 0). The excessive low frequency variants re- H. alismifolia haplotype 1 and H. longissima haplotype 1 were identical. sulted from increasing population size in H. sieboldiana, H. alismifolia, ff Similarly, some other haplotypes from di erent taxa also contained H. longipes var. gracillima and H. kikutii var. polyneuron. We found identical genetic material [the following groups had identical genetic limited samples for H. longissima and H. nakaiana here which have a material: H. kikutii var. polyneuron haplotype 3&H. kiyosumiensis hap- great possibility to quick reduction of population size. H. tardiva, H. lotype 3; H. longipes var. gracillima haplotype 3&H. kikutii var. caput-avis kikutii var. caput-avis, H. longipes var. caduca and H. kiyosumiensis taxa haplotype 1; H. alismifolia haplotype 4, H. sieboldii haplotype 1, H. long- need immediate recovery from extinction in this area. These genetic issima haplotype 2, H. tardiva haplotype 1, H. kikutii var. polyneuron differences could be inferred from differences in relative recruitment of haplotype 4 and H. longipes var. caduca haplotype 4; and H. longipes var. immigrant neutrality test (Oddou-Muratorio et al., 2004). Tajima’sD gracillima haplotype 5, H. kikutii var. polyneuron haplotype 5 and H. test and Fu and Li’s D and F tests were used for neutrality testing longipes var. caduca haplotype 1]. Table 6 represents the number and through cpDNA sequence in many plants, including rye (Li et al., 2011) percentage of the haplotypes for each of the hosta taxa and prefectures and pine species (Suharyanto and Shiraishi, 2011). of Shikoku Island as well. It was found maximum 24.55% haplotypes High haplotype and low nucleotide diversity was found in trnS-trnG from H. longipes var. gracillima while 22.80% haplotypes from H. kikutii region of cpDNA for each Hosta taxon suggested the low difference be- var. polyneuron (Table 6). Maximum haplotypes were found from Kochi tween haplotypes. It might be an indication of recent population expan- prefecture (85.97%) (Table 6). sion resulting from bottlenecks (González-Wangüemert et al., 2011)or break-up of habitat (Zhou et al., 2010). It was clear that most of the Phylogenetic tree polymorphic sites had emerged during demographic expansion and that SNP had been built up through mutations and failure to gather nucleotide NJ phylogenetic tree was constructed to show the inherent re- sequence diversity (Zhou et al., 2010). Nucleotide and haplotype diversity lationship among the indels of the populations for each taxon (Fig. 3) were also examined in different cpDNA region in different plants (Li et al., and whole genus (Fig. 4). The topology of the NJ tree generally reflects 2011; Lijavetzky et al., 2007; Kolkman et al., 2007). Different levels of the divergence of population of each taxon. The phylogenetic tree was haplotype diversity (ranging from 0.286 to 1.000) were found (Table 3). constructed for the H. sieboldiana, H. alismifolia, H. sieboldii, H. tardiva, H. sieboldiana and H. kiyosumiensis (h: 1.0) were widely distributed H. longipes var. gracillima, H. kikutii var. caput-avis, H. kikutii var. poly- whereas H. sieboldii (h: 0.286) was narrowly distributed taxon. It was neuron, H. longipes var. caduca and H. kiyosumiensis (Fig. 3). Due to less confirmed that geographical distribution of the studied Hosta taxa was than four operational taxonomic units phylogenetic tree was not con- restricted, in terms of chronological order for H. sieboldiana & H. kiyosu- structed for H. longissima and H. nakaiana taxa. Hosta genus was greatly miensis, H. longipes var. gracillima, H. kikutii var. polyneuron, H. longipes var. influenced by those taxa and geographic locations (Fig. 4) but we did caduca, H. kikutii var. caput-avis, H. alismifolia, H. longissima & H. nakaiana, not find any geographical clustering of the studied hosta population. H. tardiva, H. sieboldii around Shikoku (Table 3). Lee and Maki (2013) Variations were clearly observed among the single nucleotide poly- stated that H. sieboldiana occupied a restricted habitat in Japan but this morphisms (SNPs) of all studied taxa. The early divergence of long taxon distributed widely in Shikoku area.

7 H. Mehraj et al. Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

Fig. 3. Inference of evolutionary history for individual taxon based on trnS-trnG regional cpDNA variations using NJ phylogenetic tree (500 bootstrap replicates). Evolutionary distance computed by maximum composite likelihood. Bootstrap value ≤50 was not shown in the phylogenetic tree. The analysis involved all nucleotide sequences with 985 positions in the ﬁnal dataset. Codon position includes 1st + 2nd+3rd + Noncoding position. Less than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position. Series A to K in the phylogenetic tree represents the hosta plant population as in Table 1. Note: H. longissima and H. nakaiana had less than four operational taxonomic units (OTUs) but for construction of a tree it should be OTUs ≥4.

Maximum FST value between H. tardiva and H. kikutii var. caput-avis Most of the haplotypes were detected in Kochi areas. Mountains run- (Table 4) population noted the diﬀerences in their allelic frequency. H. ning east and west divide Shikoku into a narrow northern and southern kikutii var. caput-avis originated from west-central Shikoku Island; while H. sub region. Kochi prefecture comprises the southwestern part of Shi- tarvida originated from central part of Kochi Prefecture and southwestern koku, facing the Paciﬁc Ocean. It is bordered by Ehime to the north- part of the Tokushima Prefecture of Shikoku Island, Japan. Less than zero west and Tokushima to the north-east. It is the largest but least popu-

FST value between H. alismifolia and H. longissima, H. sieboldii and H. tar- lous of Shikoku's four prefectures. Most of this province is mountainous, vida, H. longissima and H. longipes var. gracillima, H. nakaiana and H. and in only a few areas is coastal plain. Numerous numbers of moun- longipes var. gracillima, H. kikutii var. polyneuron and H. longipes var. caduca tains with least disturbance by human activities lead Kochi prefecture

(Table 4) indicated that these taxon pairs had similar allelic frequency. FST as a great source of hosta plant. H. longissima and H. nakaiana showed had been used for evaluating population genetic differentiation (Whitlock, small population sizes in Shikoku, and it may lead to a secondary ge- 2011; Rousset, 2013)fordifferent plant species, including orchids (Pandey netic variation loss due to the result of bottleneck and genetic drift. and Sharma, 2015)andsunflower (Renaut et al., 2013). Identical genetic material was found in different taxa throughout Different numbers of haplotypes were found for each taxon but none the haplotype identification. Sharing the haplotypes across the taxa is of these were widely distributed throughout the entire Shikoku (Fig. 1). the evidence for the occurrence of the natural mutation or hybridization

8 H. Mehraj et al. Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

Conclusion

Complementary information was found for the population structure of studied taxa. The negative values for Tajima’s D, Fu and Li’s D and Fu and Li’s F test was found thus indicated the overall hosta plant populations are going to increase in Shikoku Island, Japan. All studied hosta taxa have many haplotypes but very similar between them. The max-

imum FST divergence was between H. tardiva and H. kikutii var. caput- avis populations, and H. sieboldiana and H. tardiva populations as well, which means these pairs were greatly differentiated from each other. Identical haplotypes shared by two different taxa notified the occurrence of natural mutation or hybridization. We can conclude that single source of information should not be used to determine variation or relationships among the closely related but highly diversified Hosta taxa; but can be used for the generic level. It needs further study of the studied taxa using multiple markers (including marker used in this study) for assessing the variations in the actual extent and evolutionary significance of introgression between hosta taxa.

Acknowledgement

The authors are most grateful to the Research Institute of Molecular Genetics (RIMG), Kochi University, for access to instrumental facilities for the conduct of the research. We are highly indebted to the United Graduate School of Agricultural Science of Ehime University, Japan; and to the Japanese Ministry of Education, Culture, Sports, Science and Technology to support the study. Special thanks go to Sultana Umma Habiba. We are also most thankful to the lab mates who helped us with the collection of the samples.

Appendix A. Supplementary material

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.aoas.2017.12.003.

References

Andre, C., Larsson, L.C., Laikre, L., Bekkevold, D., Brigham, J., Carvalho, R., Dahlgren, T.G., Hutchinson, W.F., Mariani, S., Mudde, K., Ruzzante, E., Ryman, N., 2011. Detecting population structure in a high gene-flow species, Atlantic herring (Clupea harengus): direct, simultaneous evaluation of neutral vs putatively selected loci. Heredity 106, 270–280. Avise, J.C., Neigel, J.E., Arnold, J., 1984. Demographic influences on mitochondrial DNA lineage survivorship in animal populations. J. Mol. Evol. 20 (2), 99–105. Ayele, T.B., Gailing, O., Umer, M., Finkeldey, R., 2009. Chloroplast DNA haplotype diversity and postglacial recolonization of Hagenia abyssinica (Bruce) J.F. Gmel. in Ethiopia. Plant Syst. Evol. 280 (3), 175–185. Bierne, N., Welch, J., Loire, E., Bonhomme, F., David, P., 2011. The coupling hypothesis: why genome scans may fail to map local adaptation genes. Mol. Ecol. 20 (10), Fig. 4. Inference of evolutionary history for 81 hosta individuals based on cpDNA var- 2044–2072. iations using NJ phylogenetic tree (500 bootstrap replicates), evolutionary distance Clement, M., Posada, D., Crandall, K.A., 2000. TCS: a computer program to estimate gene genealogies. Mol. Ecol. 9 (10), 1657–1659. computed by maximum composite likelihood (ML) considering both transitional and Cros, J., Combes, M.C., Trouslot, P., Anthony, F., Hamon, S., Charrier, A., Lashermes, P., transversional nucleotide substitutions. The optimal tree with the sum of branch length is 1998. Phylogenetic analysis of chloroplast DNA variation in Coffea L. Mol. 0.09535407. Bootstrap value ≤50 was not shown in the phylogenetic tree. The analysis Phylogenet. Evol. 9 (1), 109–117. involved 81 nucleotide sequences with 985 positions in the final dataset. Codon position Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin ver. 3.0: an integrated software – includes 1st + 2nd+3rd + Noncoding position. Less than 5% alignment gaps, missing package for population genetics data analysis. Evol. Bioinform. Online 1, 47 50. Fu, Y.X., 1997. Statistical tests of neutrality of mutations against population growth, data, and ambiguous bases were allowed at any position. Series A to I in the phylogenetic hitchhiking and background selection. Genetics 147 (2), 915–925. tree represents the hosta plant population represented as in Table 1. Fu, Y.X., Li, W.H., 1993. Statistical tests of neutrality of mutations. Genetics 133 (3), 693–709. Fujita, N., 1976. The genus hosta (Liliaceae) in Japan (in Japanese). Acta Phytotax. (Ley and Hardy, 2014) of hosta plant taxa. Hosta can fertilize by selfing Geobot. 27 (3-4), 66–96. or cross pollination which can resulted this genetic variability. Our Gielly, L., Taberlet, P., 1994. The use of chloroplast DNA to resolve plant phylogenies: non-coding versus rbcL sequences. Mol. Biol. Evol. 11 (5), 769–777. study was restricted to the Shikoku area and trnS-trnG region of cpDNA, González-Wangüemert, M., Froufe, E., Pérez-Ruzafa, A., Alexandrino, P., 2011. which may be reason for the uniformity of the population throughout Phylogeographical history of the white seabream Diplodus sargus (Sparidae): im- the geographical distribution. We found that the phylogeographic re- plications for insularity. Mar. Biol. Res. 7 (3), 250–260. ff Grant, W.A.S., Bowen, B.W., 1998. Shallow population histories in deep evolutionary lationship for the population of a taxon was di erentiated or lineages of marine fishes: insights from sardines and anchovies and lessons for con- not to their geographical distribution. The previous study on servation. J. Hered. 89 (5), 415–426. Cryptomeria japonica (not differentiated to geographical distribution) Hagemann, T.L., Kwan, S.P., 1997. SeqEd: manipulation of sequence data and chromatograms from the ABI DNA sequencer analysis files. Sequence Data Analysis (Kado et al., 2003) and hosta (showed wide geographical variation) Guidebook Volume 70 of the series Methods in Molecular Medicine™ Springer New (Lee and Maki, 2013) were agreed our findings. York. pp. 55–63. Hamilton, M.B., 1999. Four primer pairs for the amplification of chloroplast intergenic

9 H. Mehraj et al. Annals of Agricultural Sciences xxx (xxxx) xxx–xxx

regions with intraspecific variation. Primer Notes. Mol. Ecol. 8 (3), 521–523. Funk, S.M., 2006. Ecological factors influence population genetic structure of Holsinger, K.E., Weir, B.S., 2009. Genetics in geographically structured populations: de- European grey wolves. Mol. Ecol. 15 (14), 4533–4553. fining, estimating and interpreting FST. Nat. Rev. Genet. 10, 639–650. Renaut, S., Grassa, C.J., Yeaman, S., Moyers, B.T., Lai, Z., Kane, N.C., Bowers, J.E., Burke, Kado, T., Yoshimaru, H., Yoshihiko, T., Hidenori, H., 2003. DNA variation in a conifer, J.M., Rieseberg, L.H., 2013. Genomic islands of divergence are not affected by geo- Cryptomeria japonica (Cupressaceae sensu lato). Genet. 164 (4), 1547–1559. graphy of speciation in sunflowers. Nat. Commun. 4, Article no., 1827. Khan, I.A., Azim, M.K., 2011. Variations in intergenic spacer rpl20-rps12 of mango Rogers, A.R., Harpending, H., 1992. Population growth makes waves in the distribution of (Mangifera indica) chloroplast DNA: implications for cultivar identification and pairwise genetic differences. Mol. Biol. Evol. 9 (3), 552–569. phylogenetic analysis. Plant Syst. Evol. 292 (3–4), 249–255. Rousset, F., 2013. Exegeses on maximum genetic differentiation. Genetics 194 (3), Kolkman, J.M., Berry, S.T., Leon, A.J., Slabaugh, M.B., Tang, S., Gao, W., Shintani, D.K., 557–559. Burke, J.M., Knapp, S.J., 2007. Single nucleotide polymorphisms and linkage dis- Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing equilibrium in sunflower. Genetics 177 (1), 457–468. http://dx.doi.org/10.1534/ phylogenetic trees. Mol. Biol. Evol. 4 (4), 406–425. genetics.107.074054. Schmid, W.G., 1991. The genus Hosta – Giboshi Zoku (ギボウシ属). Batsford/Timber Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular evolutionary genetics Press, London and Portland. analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33 (7), 1870–1874. Suharyanto, Shiraishi, S., 2011. Nucleotide Diversities and Genetic Relationship in the Lee, S., Maki, M., 2013. Comparative phylogeographic study of Hosta sieboldiana and Three Japanese Pine Species; Pinus thunbergii, Pinus densiflora, and Pinus luchuensis. Hosta albomarginata (Asparagaceae) in Japan. Ecol. Evol. 3 (14), 4767–4785. Diversity 3 (1), 121–135. Ley, A.C., Hardy, O.J., 2014. Contrasting patterns of gene flow between sister plant Swofford, D.L., 2003. PAUP*[Phylogenetic analysis using parsimony (and other species in the understorey of African moist forests – The case of sympatric and methods)]. Version 4.0a147. Sinauer Associates, Sunderland, Massachusetts, USA. parapatric Marantaceae species. Mol. Phylogenet. Evol. 77, 264–274. Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for amplification of Li, Y., Haseneyer, G., Schön, C.C., Ankerst, D., Korzun, V., Wilde, P., Bauer, E., 2011. High three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17 (5), 1105–1109. levels of nucleotide diversity and fast decline of linkage disequilibrium in rye (Secale Tajima, F., 1989. Statistical method for testing the neutral mutation hypothesis by DNA cereale L.) genes involved in frost response. BMC Plant Biol. 11, Article no. 6. polymorphism. Genetics 123 (3), 585–595. Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of DNA Tamura, K., Kumar, S., 2002. Evolutionary distance estimation under heterogeneous polymorphism data. Bioinformatics 25 (11), 1451–1452. substitution pattern among lineages. Mol. Biol. Evol. 19 (10), 1727–1736. Lijavetzky, D., Cabezas, J.A., Ibáñez, A., Rodríguez, V., Martínez-Zapater, J.M., 2007. Tamura, K., Nei, M., Kumar, S., 2004. Prospects for inferring very large phylogenies by High throughput SNP discovery and genotyping in grapevine (Vitis vinifera L.) by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 101 (30), combining a re-sequencing approach and SNPlex technology. BMC Genomics 8, 424. 11030–11035. Maki, M., Matsumua, S., Yamashiro, T., 2008. Allozyme diversity and history of dis- Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity tribution expansion in the maritime perennial plant Hedyotis strigulosa (Rubiaceae), of progressive multiple sequence alignment through sequence weighting, position- distributed over the wide latitudes in the Japanese Archipelago. Boil. J. Linn. Soc. 93 specific gap penalties and weight matrix choice. Nucl. Acids Res. 22 (22), 4673–4680. (4), 679–688. Van Ham, R.C.H.J., Hart, H., Mes, T.H.M., Sandbrink, J.M., 1994. Molecular evolution of Millien-Parra, V., Jaeger, J.J., 1999. Island biogeography of the Japanese terrestrial noncoding regions of the chloroplast genome in the Crassulaceae and related species. mammal assemblages: an example of a relict fauna. J. Biogeogr. 26 (5), 959–972. Curr. Genet. 25 (6), 558–566. Oddou-Muratorio, S., Demesure-Musch, B., Pelissier, R., Gouyon, P.H., 2004. Impacts of Whitlock, M.C., 2011. G′ST and D do not replace FST. Mol. Ecol. 20 (6), 1083–1091. gene flow and logging history on the local genetic structure of a scattered tree species Wolfe, K.H., Li, W.H., Sharp, P.M., 1987. Rates of nucleotide substitutions vary greatly Sorbus torminalis L. Mol. Ecol. 13 (12), 3689–3702. among plant mitochondrial, chloroplast, and nuclear DNAs. Proc. Natl. Acad. Sci. Pandey, M., Sharma, J., 2015. Disjunct populations of a locally common North American USA 84 (24), 9054–9058. orchid exhibit high genetic variation and restricted gene flow. Open J. Genet. 5, Zhou, G., Yang, L., Li, C., Xu, W., Chen, G., 2010. Genetic diversity in endangered 159–175. Notopterygium forbesii Boissieu based on intraspecies sequence variation of chlor- Pilot, M., Jedrzejewski, W., Branicki, W., Sidorovich, V.E., Jedrzejewska, B., Stachura, K., oplast DNA and implications for conservation. Biochem. Syst. Ecol. 38 (5), 911–916.