Functional Gene Analysis of Resistance QTL Towards Phytophthora Sojae on Soybean

Functional Gene Analysis of Resistance QTL towards Phytophthora sojae on Soybean

Chromosome 19

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

Anna K. Stasko

Graduate Program in Plant Pathology

The Ohio State University

2018

Dissertation Committee

Anne E. Dorrance, Advisor

Joshua J. Blakeslee

Leah K. McHale

Christopher G. Taylor

Feng Qu

Copyrighted by

Anna Kathryn Stasko

2018

Abstract

Phytophthora sojae is the causal agent of Phytophthora root and stem rot of soybean. One of the most effective disease management strategies against this pathogen is the use of resistant cultivars, primarily through single gene, Rps-mediated resistance.

However, numerous populations of P. sojae have adapted to most Rps genes that are deployed in modern soybean cultivars, rendering them susceptible to this pathogen.

Quantitative resistance, conferred by quantitative disease resistance loci (QDRL), offers an alternative to Rps-based resistance. Previous studies mapped two QDRL to chromosome 19 in the soybean cultivar Conrad, which has a high level of quantitative resistance. A recombinant inbred line (RIL) population derived from a cross of Conrad by

Sloan (a moderately susceptible cultivar) used for mapping these QDRL was advanced to the F9:11 generation. This population was used to map/re-map the QDRL towards three isolates of P. sojae, and one isolate each of Pythium irregulare and Fusarium graminearum, using the SoySNP6K BeadChip for high-density marker genotyping. A total of ten, two, and three QDRL and suggestive QDRL were found that confer resistance to P. sojae, Py. irregulare, and F. graminearum, respectively. Individual

QDRL explained 2-13.6% of the phenotypic variance (PV). One QDRL for both Py. irregulare and F. graminearum co-localized on chromosome 19. This resistance was contributed by Sloan and was juxtaposed to a QDRL for P. sojae with resistance

ii contributed from Conrad. Alleles for resistance to different pathogens contributed from different parents in the same region, the number of unique QDRL for each pathogen, and the lack of correlation of resistance suggest that different mechanisms are involved in resistance towards these three pathogens. Interestingly, the QDRL located on chromosome 19 contained several genes related to auxin processes, which are known to contribute to susceptibility to several pathogens in Arabidopsis and may contribute to susceptibility of soybean to P. sojae. In this study, auxin metabolites were measured in P. sojae mycelia, media from P. sojae liquid cultures, and inoculated soybean roots. Auxin precursors were detected in the mycelia of P. sojae as well as the synthetic media. More importantly, auxin levels were significantly higher in inoculated roots than the mock controls in both resistant and susceptible genotypes at 48 hours after inoculation (hai). To examine the role of auxin transport in susceptibility to P. sojae, the nucleotide sequences and expression of root-related soybean auxin efflux transporters, GmPINs, were compared between Conrad and Sloan. There were sequence differences between the two cultivars; however, experimental variability prevented accurate detection of expression differences through a quantitative PCR approach. An auxin transport inhibitor and a synthetic auxin were applied to Conrad and Sloan to assess changes in infection of these cultivars with chemically altered auxin processes. As with the gene expression analysis, experimental variation prevented us from determining the exact effect of these treatments. Finally, several different approaches were used to begin developing a system for functional gene analysis, including composite plant-based hairy roots, cotyledon- based hairy roots, and virus-induced gene silencing (VIGS). Composite plant-based hairy

iii roots were difficult to inoculate with P. sojae, Py. irregulare, and F. graminearum.

Cotyledon-based hairy roots allowed for more consistent inoculation with P. sojae and expedited experimental testing of RNAi constructs targeting candidate genes. One of these constructs was able to reduce the expression of its target gene in three soybean genetic backgrounds. A Bean pod mottle virus (BPMV) VIGS vector used here moved systemically into soybean roots but was not effective at silencing candidate gene targets in this tissue. Future studies should continue to refine environmental/experimental conditions to reduce variation and develop a reliable method of assessing change in quantitative disease resistance to define the roles of candidate genes.

Dedication

To Great Uncle Michael Stasko, who laid the foundation for this work, and to Our Lady of Perpetual Help, who championed it.

Acknowledgments

If it takes a village to raise a child, it certainly takes a department to train a PhD.

This journey would not have been possible without the help and support of many people.

I would like to thank Anne Dorrance, my advisor, for all of her help, guidance, and patience during this process. I also thank my committee members for their time, advice, and lab space. To all past and present members of the Dorrance lab, especially Chrissy

Balk, Damitha Wickramasinghe, Clifton Martin, Cassidy Gedling, Deloris Veney, and

Jonell Wenger, thanks for all your help will all of my experiments, no matter how tedious they were. I also extend a special thank you to Leslie Taylor, Shuang Xie, Brittany

Tangevald, Dee Marty, Junping Han, Yun Lin, and Ella Lin for their help and expertise.

To the unsung heroes of Selby Hall, Lynn West, Ken Nanes, Lee Wilson, and Bob James, you take care of many details that make all of this work possible. Thanks for making life a little easier for the rest of us.

Thanks to plant pathology graduate students and members of the SoyRes team, especially Ellie Walsh, Anna Testen, Tim Frey, and Rebecca Kimmelfield. Thanks also to the faculty at Ohio State and Concordia College, especially Mark Jensen and Laura

Aldrich-Wolfe, who helped to build the foundation for this this journey. Thanks also to the Center for Applied Plant Sciences, SEEDS, the Ohio Soybean Council, and the

United Soybean Board for funding this project and my fellowship.

Finally, I would like to thank my family and friends. Maren, your friendship means so much to me. Thanks for being a bright presence in my life. To my biking partners Susan and Joanne, and the members of my extended “family” at St. Mary’s,

Gina, Joe, Barb, Rich, Bernie, Tencha, MaryAnn, Marjorie, Kaalyn, and Caitlyn, thanks for helping me lead a somewhat balanced life. To Nick, Mom, and Dad, thank you for all of the phone calls, support, advice, and other countless help. Thanks be to God, who makes all things possible. Soli Deo Gloria.

vii

Vita

February 1990 Born-San Antonio, TX

May 2012 B.A. in Biology and Chemistry, Concordia College

August 2012- August 2014 Graduate Research Associate, The Ohio State University

May 2016 M.S. Plant Pathology, The Ohio State University

August 2014-present Graduate Research Fellow, The Ohio State University

Publications

Stasko, A.K., Wickramasinghe, D., Nauth, B.J., Acharya, B., Ellis, M.L., Taylor, C.G., McHale, L.K., and Dorrance, A.E. 2016. High density mapping of resistance QTL towards Phytophthora sojae, Pythium irregulare, and Fusarium graminearum in the same soybean population. Crop Sci. 56:2476-2492

Liu, Z.H., Zhong, S., Stasko A.K., Edwards M.C., and Friesen, T.L. 2012. Virulence profile and genetic structure of a North Dakota population of Pyrenophora teres f. teres, the causal agent of net form net blotch of barley. Phytopathology 102:539-546.

Fields of Study

Major Field: Plant Pathology

viii

Table of Contents

Abstract ...... ii Dedication ...... v Acknowledgments...... vi Vita ...... viii Table of Contents ...... ix List of Tables ...... xiii List of Figures ...... xv Chapter 1: Introduction ...... 1 Soybean and Phytophthora sojae...... 1 Quantitative resistance ...... 3 Plant susceptibility factors ...... 6 Auxin’s role in plant roots ...... 8 Auxin’s role in plant-microbe interactions ...... 12 Research Objectives ...... 16 Hypothesis: ...... 16 Objectives: ...... 16 Chapter 2: High density mapping of resistance QTL towards Phytophthora sojae, Pythium irregulare, and Fusarium graminearum in the same soybean population ...... 17 Abstract ...... 17 Introduction ...... 18 Materials and Methods ...... 22 Plant materials ...... 22 Resistance to P. sojae assay ...... 22 Resistance to Py. irregulare assay ...... 23 Resistance to F. graminearum assay ...... 25

SNP genotyping and genetic mapping ...... 26 QTL analysis ...... 27 Gene annotation and categorization ...... 27 Results ...... 28 Phenotypic assays ...... 28 Linkage map construction ...... 32 QTL mapping ...... 33 Discussion ...... 45 Chapter 3: The role of auxin in quantitative disease susceptibility in soybean towards Phytophthora sojae ...... 54 Abstract ...... 54 Introduction ...... 55 Materials and Methods ...... 60 Phytophthora sojae material and tissue collection for auxin metabolite analysis .... 60 Plant material and tissue collection for auxin metabolite analysis ...... 61 Auxin metabolite extraction and quantification ...... 63 GmPIN gene sequence comparison ...... 66 Quantitative real-time PCR of GmPINs ...... 67 NPA and NAA applications in an adapted vertical mesh transfer system ...... 72 Results and Discussion ...... 75 Auxinic metabolites in Phytophthora sojae mycelia and associated media ...... 75 Quantification of auxin metabolites in soybean root tissue during infection with P. sojae ...... 77 Nucleotide sequence variation and expression of PIN genes in Conrad and Sloan .. 85 Effect of application of NPA or 1-NAA to soybean root on infection with P. sojae 93 Conclusions ...... 96 Chapter 4: Approaches to studying quantitative resistance in the soybean-Phythophthora sojae system ...... 97 Abstract ...... 97 Introduction ...... 98 Materials and Methods ...... 100 Selection of genes for hairy root assays ...... 100 Construction of plasmids for hairy roots ...... 101

Generation of composite plant-based hairy roots ...... 108 Inoculation of composite plant-based hairy roots with P. sojae, Py. irregulare, and F. graminearum ...... 109 Generation of cotyledon-based hairy roots ...... 111 Confirmation of silencing in hairy roots ...... 112 Inoculation of hairy roots with P. sojae and GUS staining ...... 113 VIGS vector construction ...... 113 Plant material and VIGS inoculation ...... 115 P. sojae inoculation of VIGS plants ...... 115 Confirmation of virus-induced silencing of target genes in leaves and roots ...... 116 Results and Discussion ...... 117 Promoter::GUS composite plant hairy root assays ...... 117 Inoculation of composite plant hairy roots containing RNAi constructs ...... 121 Cotyledon-based RNAi hairy-roots ...... 127 Confirmation of gene silencing in hairy roots ...... 128 GUS staining in DR5::GUS roots inoculated with P. sojae ...... 131 VIGS in Conrad and Sloan leaves and roots ...... 134 Conclusions ...... 138 Bibliography ...... 141 Appendix A. Genetic linkage maps generated in chapter 2 ...... 165 Appendix B. Markers used to generate genetic maps in chapter 2 ...... 168 Appendix C. Loci of interest associated with resistance to Phytophthora sojae from chapter 2 ...... 219 Appendix D. Comparison of QTL conferring resistance to P. sojae in three genearations of Conrad x Sloan RILs ...... 221 Appendix E. Comparison of QTL conferring resistance to F. graminearum in two generations of Conrad x Sloan RILs ...... 228 Appendix F. Genes associated with QTL conferring resistance to P. sojae mapped in chapter 2 ...... 230 Appendix G. Genes associated with QTL conferring resistance to Pythium irregulare and/or Fusarium graminearum from chapter 2 ...... 291 Appendix H. Protocol for inoculating soybean with the tray assay ...... 313 Preparation ...... 313 Week One: Day one ...... 313 xi

Week One: Day two ...... 314 Week One: Day three or four ...... 314 Week Two: Day one (at least one day before inoculation) ...... 314 Week Two: Day two (7 days after planting)-seedling prep ...... 315 Week Two: Day two-inoculation ...... 315 Week Three: Rating ...... 317 Clean up ...... 317 Appendix I. Production of zoospores from Phytophthora sojae ...... 319 At least one week before inoculation ...... 319 Day before inoculation ...... 320 Clean up ...... 321 Appendix J. Protocol for soybean VMT NPA and 1-NAA experiments ...... 323 Seed germination and VMT box set up ...... 323 NPA and 1-NAA solutions ...... 326 NPA/1-NAA application ...... 327 P. sojae inoculation and rating...... 328 Suggestions for future experiments ...... 330 Appendix K. Stock solutions for Hoagland’s solution ...... 332

1 M Ca(NO3)2 ● 4 H2O ...... 332

1 M KNO3 ...... 332

1 M MgSO4 ● 7 H2O ...... 332

KH2PO4 (monobasic) ...... 332

xii

List of Tables

Table 2.1. Means of checks and the recombinant inbred line (RIL) population following inoculations with three isolates of Phytophthora sojae (tray test), an isolate of Pythium irregulare (greenhouse cup assay), and an isolate of Fusarium graminearum (rolled towel assay) to measure levels of resistance...... 29 Table 2.2. Pearson’s correlation coefficients above the diagonal and p-values below for the comparison of resistance phenotypes among a recombinant inbred line F9:11 population derived from a cross of Conrad x Sloan between pathogens and between isolates of Phytophthora sojae...... 32 Table 2.3 Quantitative trait loci (QTL) for quantitative resistance to Phytophthora sojae, Pythium irregulare, and Fusarium graminearum identified by composite interval mapping (CIM) using 316 F 9:11 recombinant inbred lines (RILs) of Conrad x Sloan. .... 39 Table 2.4. Number of genes in each functional category within each QTL and associated with quantitative resistance to Phytophthora sojae, a hemibiotroph (H), or Pythium irregulare (Py) and Fusarium graminearum (F), which are necrotrophs (N). Only genes within significant and overlapping QTL are shown...... 44 Table 3.1. Amounts and sources of internal standards added to samples in LC/MS experiments...... 65 Table 3.2. Primers used for quantitative real-time PCR (qRT-PCR) in this study...... 70 Table 3.3. Levels of tryptophan (Trp), tryptamine (TRA), and indole-3-acetic acid (IAA) in P. sojae mycelia (ng/g) and minimal medium (ng/L)...... 77 Table 3.4. Number of sequence variations in AtPIN1, AtPIN2, and AtPIN3/AtPIN4/AtPIN7 soybean homologs among Conrad, Sloan, and Williams 82 reference...... 86 Table 3.5. Primer efficiencies of GmPIN targets and tested reference genes in this study...... 89 Table 3.6. Type III p-values of NPA and 1-NAA application experiments across all seven reps generated using PROC GLM in SAS...... 93 Table 4.1. Genes selected for promoter::GUS analysis in composite plant hairy roots and primers and annealing temperatures used to amplify 2 kb upstream of the transcription start site with Phusion polymerase...... 103 Table 4.2. List of target genes for silencing by RNAi in soybean hairy roots...... 105 Table 4.3 List of genes used in VIGS silencing assays with their VIGS code...... 114 Table 4.4. Presence/absence of GUS staining in composite plant hairy roots transformed with a constitutive control or Glyma.19g254000 promoter. Data are from two reps. +positive for GUS staining, -negative for GUS staining, . missing from rep ...... 118

xiii

Table 4.5. Presence/absence of GUS staining in composite plant hairy roots transformed with a constitutive control or Glyma.19g221700 promoter. Data are from three reps. +positive for GUS staining, -negative for GUS staining, . missing from rep ...... 119 Table 4.6. Presence/absence of GUS staining in composite plant hairy roots transformed with a constitutive control or Glyma.19g170400 promoter. Data are from two reps. +positive for GUS staining, -negative for GUS staining, . missing from rep ...... 120 Table 4.7. Percent of hairy roots positive for GUS staining when driven by the promoter of Glyma.19g170400 cloned from Conrad (C) or Sloan (S) or a constitutive promoter 24 hours after inoculation (hai) with P. sojae...... 120 Table B.1. SNP and SSR marker names, SNP identifications (IDs), genetic positions (cM), and physical position (bp) of the 1,063 SNPs and SSR markers used in the genetic map of Conrad x Sloan F9:11 RIL population...... 168 Table C.1 Loci of interest for resistance at or near QTL for resistance to at least two isolates of Phytophthora sojae...... 220 Table D.1. Comparison of quantitative trait loci (QTL) conferring resistance to Phytophthora sojae in three generations of Conrad x Sloan recombinant inbred lines (RILs)...... 222 Table E.1. Comparison of quantitative trait loci (QTL) conferring resistance to F. graminearum in two generations of Conrad x Sloan recombinant inbred lines (RILs) using the rolled towel method...... 229 Table F.1. Genes between flanking markers of quantitative trait loci (QTL) conferring resistance to Phytophthora sojae in a Conrad x Sloan F9:11 recombinant inbred line (RIL) population...... 230 Table G.1. Genes between flanking markers of quantitative trait loci (QTL) conferring resistance to Pythium irregulare and Fusarium graminearum in a Conrad x Sloan F9:11 recombinant inbred line (RIL) population...... 292

xiv

List of Figures

Figure 1.1. Signaling pathway of auxin. (A) At low levels of IAA, TIR1 does not bind to the AUX/IAA protein, which binds to an ARF and prevents transcription. (B) When high levels of IAA are present, TIR1 binds to the AUX/IAA protein, which is then ubiquitinated and degraded by the 26S proteasome. The ARF protein is released, and transcription of IAA-responsive genes is activated. After Robert-Seilaniantz et al. 2011. 9 Figure 1.2. Summary of model of auxin transport in plant cells. H+-ATPase pumps hydrogen ions from the cytosol into the apoplast, raising the intracellular pH. In the apoplast, IAA is protonated and enters the cell by diffusion and transport through AUX1/LAX proteins. Inside the cell, IAAH is deprotonated to IAA- and is then exported from the cell by ABCB and PIN proteins. Modified from Taiz and Zeiger 2010...... 12 Figure 2.1. Frequency distribution of BLUP values of mean lesion length of Conrad x Sloan F9:11 RIL families for resistance to Phytophthora sojae isolates (A) C2.S1, (B) 1.S.1.1, and (C) OH25 evaluated with tray phenotyping assay. Arrows indicate values of parents and/or checks. A smaller BLUP value indicates a higher level of resistance...... 30 Figure 2.2. Frequency distribution of BLUP values of mean root weights and disease severity index (DSI) of Conrad x Sloan F9:11 RIL families for resistance to (A) Pythium irregulare and (B) Fusarium graminearum, root pathogens of soybean A larger BLUP value indicates a higher level of resistance due to higher root weight for Py. irregulare. A smaller BLUP value indicates a higher level of resistance for F. graminearum...... 31 Figure 2.3. QTL mapped in Conrad x Sloan F9:11 RIL population conferring resistance to Phytophthora sojae isolates C2.S1, 1.S.1.1, and OH25 with a genome wide LOD threshold of 3.2...... 35 Figure 2.4. QTL conferring resistance to Pythium irregulare mapped in Conrad x Sloan F9:11 RIL population with a genome wide LOD threshold of 3.2...... 36 Figure 2.5. QTL conferring resistance to Fusarium graminearum mapped in Conrad x Sloan F9:11 RIL population with a genome wide LOD threshold of 3.2...... 37 Figure 2.6. QTL on chromosome 19 conferring resistance to Phytophthora sojae, Pythium irregulare, and Fusarium graminearum (genome wide LOD threshold of 3.2). Resistant alleles for P. sojae were contributed from Conrad while resistance for Py. irregulare and F. graminearum was from Sloan...... 38 Figure 3.1. Soybean seedlings arranged on a VMT glass plate for NPA or 1-NAA applications...... 74 Figure 3.2. Mean lesion length of Conrad and Sloan in metabolite tray tests 7 days after inoculation with Phytophthora sojae in experiments 1(A) and 2 (B). Error bars represent standard deviation. Bars with different letters are significantly different from each other by Fisher’s protected LSD (p<0.001)...... 78 xv

Figure 3.3. Mean levels (ng/g frozen weight) of auxin and auxin catabolites in Conrad (C) and Sloan (S) mock (M) and inoculated (I) root tissue at 12, 24, 48, and 72 hai in experiment one (left) and 0, 24, 48, and 72 hai in experiment two (right). Bars with different letters are significantly different from each other within a time point by Tukey’s test at 95% confidence. Asterisks indicate significant difference between M and I within cultivar at a given time point by Student’s t-test (*p<0.05, **p<0.01). Error bars represent standard deviation...... 80 Figure 3.4. Amounts of auxin precursor tryptamine (TRA) in Conrad (C) and Sloan (S) mock (M) and inoculated (I) root tissue at 12, 24, 48, and 72 hai in experiment one (left) and at 0, 24, 48, and 72 hai in experiment two (right). Bars with different letters are significantly different from each other within a time point by Tukey’s test at 95% confidence. Asterisks indicate significant difference between M and I within cultivar at a given time point by Student’s t-test (*p<0.05, **p<0.01). Error bars represent standard deviation...... 81 Figure 3.5. Amounts of salicylic acid (SA), jasmonic acid (JA), and jasmonic acid leucine/isoleucine (JA-Leu/Ile) in Conrad (C) and Sloan (S) mock (M) and inoculated (I) root tissue at 12, 24, 48, and 72 hai in experiment one (left) and 0, 24, 48, and 72 hai in experiment two (right). Bars with different letters are significantly different from each other within a time point by Tukey’s test at 95% confidence. Asterisks indicate significant difference between M and I within cultivar at a given time point by Student’s t-test (*p<0.05, **p<0.01, ***p<0.001). Error bars represent standard deviation...... 82 Figure 3.6. Auxin precursors and catabolites and abscisic acid (ABA) only detected or quantified in soybean root metabolite experiment one. Bars with different letters are significantly different from each other within a time point by Tukey’s test at 95% confidence. Asterisks indicate significant difference between M and I within cultivar at a given time point by Student’s t-test (*p<0.05, **p<0.01, ***p<0.001). Error bars represent standard deviation...... 83 Figure 3.7. Indole-3-acetyl-phenylalanine (IAPhe) in Conrad (C) and Sloan (S) mock (M) and inoculated (I) roots at 0, 24, 48, and 72 hai in experiment two. Bars with the same letter are not significantly different by Tukey’s test. Error bars represent standard deviation...... 84 Figure 3.8. Adjusted mean lesion lengths of Conrad and Sloan 7 dai with P. sojae for qRT-PCR experiments (p<0.001). Error bars indicate standard deviation. Bars with the same letter are not significantly different from each other by Fisher’s protected LSD. ... 88 Figure 3.9. Mean relative transcript abundance of GmPIN3a (Glyma.07g217900), GmPIN3b (Glyma.20g014300), and GmPIN1d (Glyma.03g126000) in mock and inoculated roots of Conrad and/or Sloan. Error bars represent standard deviation...... 91 Figure 3.10. Infection response of GmPIN1d (Glyma.03g126000) in Conrad and Sloan. Error bars represent standard deviation...... 92 Figure 3.11. Box plots of adjusted mean lesion length in Conrad (A and B) and Sloan (C and D) 3 dai with P. sojae by rep (A, C) and NPA concentration (B, D)...... 94 Figure 3.12. Box plots of adjusted mean lesion length in Conrad (A and B) and Sloan (C and D) cultivars 3 dai with P. sojae by rep (A, C) and 1-NAA concentration (B, D)...... 95

xvi

Figure 4.1. Conrad (A-D), Sloan (E-H), and Williams 82 (I-L) composite plant hairy roots transformed with AKK1467b (empty vector). (A, E, and I) Inoculation with Phytophthora sojae OH25 zoospores 7 days after inoculation (dai) (B, F, and J) Inoculation with P. sojae OH25 mycelial slurry 7 dai (C, G, and K) Inoculation with Pythium irregulare Br2-3-5 7 dai (D, H, and L) Inoculation with Fusarium graminearum 14 dai...... 122 Figure 4.2. Root oxidation in composite plant hairy roots generated with the RNAi vector targeting Glyma.19g176000 (CGT11065). Conrad (A) and (B). Sloan (C) and (D). Mock inoculated (A) and (C). Inoculated with Phythophthora sojae OH25 zoospores (B) and (D)...... 123 Figure 4.3. Composite plant-based hairy roots transformed with the RNAi vector targeting Glyma.19g176000 (CGT11065) inoculated with zoospores (B) and (D) or mock inoculated with sterile distilled water (A) and (C) placed beneath pots used for growing. (A) and (B) Conrad. (C) and (D) Sloan...... 124 Figure 4.4. Composite plant-based hairy roots transformed with the RNAi construct targeting Glyma.19g224600 (CGT11077) inoculated with zoospores (B) and (D) or mock inoculated with sterile distilled water (A) and (C) poured into pots used for growing from the top. (A) and (B) Conrad. (C) and (D) Sloan...... 125 Figure 4.5. Composite plant-based hairy roots transformed with the RNAi construct targeting Glyma.03g169600 and its homologs (CGT11085) inoculated with P. sojae OH25 (B) and (D) or mock inoculated nonclarified V8 plugs (A) and (C). (A) and (B) Conrad. (C) and (D) Sloan...... 126 Figure 4.6. Sloan composite plant hairy roots transformed with is the RNAi construct targeting Glyma.02g254300 and its homologs (CGT11092). Plants on the left were inoculated with a layer of agar containing a P. sojae culture. Plants on the right are the non-inoculated control...... 127 Figure 4.7. Conrad (A) and (B) and Sloan (C) and (D) cotyledon-based hairy roots transformed with the RNAi construct targeting Glyma.13g101900 and its homolog (CGT11088). (A) and (C) mock inoculated with sterile, distilled H2O. (B) and (D) inoculated with P. sojae OH25 zoospores...... 128 Figure 4.8. Testing for gene silencing in composite plant-based hairy roots transformed with the RNAi construct targeting Glyma.16g209400 (CGT11080). A F-box gene, cons6, (Libault et al. 2008) was used as a reference. Wt-wild type, non-transformed root, +root expressed GFP (likely transgenic), -root did not express GFP (adventious, non- transgenic) ...... 130 Figure 4.9. Testing for gene silencing in cotyledon-based hairy roots transformed with RNAi constructs targeting GmPIN1 (Glyma.08g547000 and homologs, CGT11087), GmPIN2 (Glyma.13g101900 and its homolog, CGT11088) and YUCCA group 6 (Glyma.19g206200 and its homologs, CGT11086) by semi-quantitative PCR. Ubiquitin (Zhou et al. 2009) was used as a reference. W82-Williams 82, C-Conrad, N-non-template control, +-root expressed GFP (likely transgenic), - root did not express GFP (adventious, non-transgenic) ...... 131 Figure 4.10. Conrad hairy roots transformed with DR5::GUS construct inoculated with P. sojae zoospores (A-B) or mock inoculated (C-F) with sterile, distilled water and stained xvii with ½ X-gluc for 30 min. Roots were flattened with a coverslip and viewed under 10x objective. (A), (C), and (E) root tips. (B), (D), (F) vascular tissue in upper portion of the root tip shown in (A), (C), or (E), respectively...... 132 Figure 4.11. Sloan hairy roots transformed with DR5::GUS construct inoculated with P. sojae zoospores (A-D, I) or mock inoculated (E-H) with sterile, distilled water and stained with ½ X-gluc for 30 min. Roots were flattened with a coverslip and viewed under 10x objective. (A), (C), (E), and (G) root tips. (B), (D), (F), and (H) vascular tissue in upper portion of the root tip shown in (A), (C), (E), or (G), respectively. (I) lateral root from root shown in (A) and (B)...... 133 Figure 4.12. Conrad hairy roots transformed with CGT5205 consitutive GUS construct inoculated with P. sojae zoospores (A-D) or mock inoculated (E-H) with sterile, distilled water and stained with ½ X-gluc for 30 min. Roots were flattened with a coverslip and viewed under 10x objective. (A), (C), (E), and (G) root tips. (B), (D), (F), and (H) vascular tissue in upper portion of the root tip shown in (A), (C), (E), or (G), respectively...... 133 Figure 4.13. Sloan hairy roots transformed with CGT5205 consitutive GUS construct inoculated with P. sojae zoospores (A-D) or mock inoculated (E-F) with sterile, distilled water and stained with ½ X-gluc for 30 min. Roots were flattened with a coverslip and viewed under 10x objective. (A), (C), and (E) root tips. (B), (D), and (F) vascular tissue in upper portion of the root tip shown in (A), (C), or (E), respectively...... 134 Figure 4.14. Expression of Glyma.19g181900 (AS5), Glyma.19g183700 (AS7a) and Glyma.19g183900 (AS9) in Conrad leaves inoculated with VIGS constructs. Mock- leaves rubbed with buffer without virus, GUS-GUS RNAi silencing control, VIGS-AS5- inoculated with construct targeting Glyma.19g181900, VIGS-AS7a-inoculated with construct targeting Glyma.19g183700, VIGS-AS9-inoculated with construct targeting Glyma.19g183900, Rep#-biological rep used to isolate RNA, RT+-reverse transcriptase positive sample, Cons4-reference gene (Libault et al. 2008), BR2-presence of BPMV, # x-number of cycles used in semi-quantitative PCR ...... 135 Figure 4.15. Expression of Glyma.19g181900 (AS5), Glyma.19g183700 (AS7a) and Glyma.19g183900 (AS9) in Sloan leaves inoculated with VIGS constructs. Mock-leaves rubbed with buffer without virus, GUS-GUS RNAi silencing control, VIGS-AS5- inoculated with construct targeting Glyma.19g181900, VIGS-AS7a-inoculated with construct targeting Glyma.19g183700, VIGS-AS9-inoculated with construct targeting Glyma.19g183900, Rep#-biological rep used to isolate RNA, RT+-reverse transcriptase positive sample, Cons4-reference gene (Libault et al. 2008), BR2-presence of BPMV, # x-number of cycles used in semi-quantitative PCR ...... 136 Figure 4.16. Expression of Glyma.19g181900 (AS5), Glyma.19g183700 (AS7a) and Glyma.19g183900 (AS9) in Conrad roots inoculated with VIGS constructs. Mock-leaves rubbed with buffer without virus, GUS-GUS RNAi silencing control, VIGS-AS5- inoculated with construct targeting Glyma.19g181900, VIGS-AS7a-inoculated with construct targeting Glyma.19g183700, VIGS-AS9-inoculated with construct targeting Glyma.19g183900, P.s.-roots inoculated with P. sojae, M- roots inoculated with lima bean agar, RT+-reverse transcriptase positive sample, Cons4-reference gene (Libault et

xviii al. 2008), BR2-presence of BPMV, # x-number of cycles used in semi-quantitative PCR ...... 137 Figure 4.17. Expression of Glyma.19g181900 (AS5), Glyma.19g183700 (AS7a) and Glyma.19g183900 (AS9) in Conrad roots inoculated with VIGS constructs. Mock-leaves rubbed with buffer without virus, GUS-GUS RNAi silencing control, VIGS-AS5- inoculated with construct targeting Glyma.19g181900, VIGS-AS7a-inoculated with construct targeting Glyma.19g183700, VIGS-AS9-inoculated with construct targeting Glyma.19g183900, P.s.-roots inoculated with P. sojae, M- roots inoculated with lima bean agar, RT+-reverse transcriptase positive sample, Cons4-reference gene (Libault et al. 2008), # x-number of cycles used in semi-quantitative PCR ...... 138 Figure A.1. Chromosome maps generated from 1032 single nucleotide polymorphism and 31 PCR based markers in JoinMap 4.0 (van Ooijen, 2006)...... 165 Figure H.1. Styrofoam cup set-up for tray test. Fill bottom ⅓ with coarse vermiculite (there is a line inside the cup that becomes visible near the bottom once some vermiculite has been added). Then add fine vermiculite to line near the top of the cup. Place 20 seeds on top of fine vermiculite. Cover seeds with coarse vermiculite...... 314 Figure I.1. Schematic layout of the hemacytometer. Zoospores should be counted in squares A, B, C, D, and E...... 321

xix

Chapter 1: Introduction

Soybean and Phytophthora sojae

Soybean (Glycine max L. Merr.) is one of the most important crops produced throughout the world. In 2016, it was grown on over 83 million acres in the United States (NASS 2016;

SoyStats 2012). It has many uses including human and animal consumption and several industrial applications (SoyStats 2016). The United States (U.S.) was the second largest exporter of soybeans in 2015, accounting for 35% of total soybean exports worldwide (SoyStats 2016). In

2016, approximately 4750 acres of soybeans were planted in Ohio, and in 2015 soybeans accounted for 46.3% of the total value of principal crops (NASS 2016; SoyStats 2016).

Phytophthora sojae Kaufm. and Gerd. is a major pathogen of soybean where production occurs on poorly drained soils. Symptoms include pre- and post-emergence damping off, root and stem rot, and yellowing and wilting of lower leaves (Erwin and Ribeiro 1996; Grau et al.

2004). First reported in Indiana in 1948, the disease is now found worldwide (Grau et al. 2004).

P. sojae is a major cause of yield loss in Ohio (Miller et al. 1996; Schmitthenner 1985). From

2010-2014, it is estimated that Phytophthora rot accounted for a yield loss of approximately 24.7 to 40.0 thousand bushels each year (Allen et al. 2017).

Phytophthora sojae persists in the soil as oospores. When conditions are favorable, the oospores germinate and produce the asexual reproductive structures, sporangia. If the soil is saturated, the sporangia release zoospores, which are attracted to soybean root exudates (Erwin and Ribeiro 1996; Schmitthenner 1985). Once zoospores reach the roots, they encyst, forming a

1 cell wall and losing their flagella (Erwin and Ribeiro 1996; Schmitthenner 1985). A germ tube is formed and penetrates host roots intercellularly (Beagle-Ristaino and Rissler 1983; Enkerli et al.

1996). Hyphal growth continues intercellularly into the root cortex, and haustoria form during the early, biotrophic stage of infection (Beagle-Ristaino and Rissler 1983; Enkerli et al. 1997).

During this stage, P. sojae releases immediate-early and early effectors into the host to suppress soybean defense responses, including programmed cell death (Wang et al. 2011). As the infection progresses, the pathogen switches from a biotrophic to a necrotrophic lifestyle; therefore, it is considered a hemi-biotroph. During the necrotrophic stage of infection, hyphae ramify intracellularly in the root, causing damage to the host cells and necrosis (Beagle-Ristaino and Rissler 1983; Enkerli et al. 1997). Oospores form in host tissue (Beagle-Ristaino and Rissler

1983; Erwin and Ribeiro 1996).

Host resistance has been the most successful management strategy used against P. sojae to date. It occurs through qualitative resistance, conferred by single genes, and through quantitative resistance (Grau et al. 2004; Schmitthenner 1985). Qualitative or single gene resistance occurs through Resistance to Phytophthora sojae (Rps) genes. To date, over 20 Rps genes have been identified in soybean cultivars including several recently discovered genes

(Cheng et al. 2017; Li et al. 2017; Lin et al. 2013; Ping et al. 2016; Sun et al. 2014; Zhang et al.

2013; Zhong et al. 2018). However, the pathogen has adapted to many of these genes, and in

Ohio there are numerous isolates present that have adapted to most U.S. identified Rps genes.

Under these conditions, most Rps genes last only eight to twenty years (Dorrance et al. 2016;

Grau et al. 2004; Mideros 2006; Mideros et al. 2007). Therefore, a more durable form of host resistance is needed as part of a long-term management strategy.

Quantitative resistance

Quantitative resistance, also called partial resistance, horizontal resistance, or field resistance, is conferred by quantitative trait loci (QTL), more specifically referred to as quantitative disease resistance loci (QDRL), to distinguish them from QTL that contribute to other traits. Unlike qualitative or single-gene resistance, quantitative resistance slows pathogen development, limits the overall colonization, and is generally thought to not be race-specific

(Parlevliet 1979; St. Clair 2010; Tian et al. 2006). In terms of durability, quantitative resistance in this host-pathogen system is often considered to be more durable than R-gene resistance as there are multiple genes involved, thus making it more difficult for the pathogen to adapt (Grau et al. 2004; Wang et al. 2012b). An example of the durability of quantitative resistance is the moderately resistant cultivar, Conrad. It was registered in 1989 (Fehr et al. 1989) and once it had good stand in the field, showed no symptoms of root rot in recent field studies (Dorrance et al.

2003, 2009; Vargas and Scott in prep). In constrast, the cultivar Sloan, which has low levels of quantitative resistance, had higher levels of disease severity (Dorrance et al. 2003, 2009).

Several hypotheses have emerged to explain the function of genes involved in quantitative resistance. Poland et al. (2009) summarized six hypotheses for the role of genes in expression of quantitative resistance towards plant pathogens as follows:

 genes that contribute to growth and development with pleiotropic effects that also

contribute to defense

 mutated alleles of genes already involved in basal defenses

 genes involved in defense signal transduction

 mutated genes that code for defensive chemicals

 “weak R-genes” (less effective alleles or mutated versions of their qualitative

counterparts)

 genes whose functions have not been previously described.

Due to the multi-genic nature of quantitative resistance, it is unlikely that any single hypothesis can adequately describe the action of all QDRL. Rather, it is more likely that a combination of hypotheses is in play for a given QDRL in a given pathosystem (Poland et al.

2009; St. Clair 2010), and there is evidence to support each of these hypotheses for the expression of quantitative resistance in Conrad (Wang et al. 2010, 2012b).

Some QDRL in other host-pathogen systems are only effective during specific stages of development, such as before flowering or after germination, suggesting that development-related genes may somehow contribute to defense (Mideros 2006; Mideros et al. 2007; Poland et al.

2009). As for genes involved in basal defenses, examples of variations in microbe/pathogen associated molecular pattern (MAMP/PAMP) recognition proteins have been found in

Arabidopsis and in some Brassica spp. There is also some evidence for differences in PAMP response among soybean lines. LD00-2817P generated more reactive oxygen species (ROS) when treated with the PAMPs flg22, chitin, or both compared to the line LDX011-65. It was also more resistant to Pseudomonas syringae pv. glycinea after pre-treatment with PAMPs compared to the mock treated control (Valdés-Lópéz et al. 2011). Mutations in signaling genes such as

WRKY33 and MPK4 in Arabidopsis have been linked to variation in expression of resistance

(reviewed in Poland et al. 2009). Detoxifying enzymes and phytoalexins are recognized components of plant defense, especially against necrotrophs, and there is some evidence that the genes encoding or associated with them are correlated with QDRL in the Arabidopsis-Botrytis

4 system (reviewed in Poland et al. 2009). In rice, a QDRL associated with quantitative resistance to Rhizoctonia solani was found to contain several chitinase genes (Richa et al. 2016). In some cases, QDRL co-localize to regions of known R-genes (reviewed in Poland et al. 2009; St. Clair

2010), as is the case for QDRL 18-2 in the soybean cultivar Conrad (Wang et al. 2012b). One hypothesis is that these regions contain alternate alleles of known R-genes that have weaker effects in defense pathways. Finally, genes with no known function can allow for novel approaches to defense (Poland et al. 2009).

Over twenty QTL have been mapped in soybean associated with resistance to P. sojae (Lee et al. 2013a, 2013b). Of these, at least fifteen have been mapped in the cultivar Conrad, which has a relatively high level of quantitative resistance to P. sojae, including two QDRL on chromosome 19 (Burnham et al. 2003; Li et al. 2010; Wang et al. 2012b). These QDRL account for 4 to 27.7% of the phenotypic variation (Wang et al. 2010; 2012a; 2012b). Chromosome 19 is of particular interest for numerous reasons. First, these two QDRL (19-1 and 19-2) have been detected consistently using two different phenotypic methods, the tray test and the layer test, and three different isolates of P. sojae (Wang et al. 2012a). In field assays, selected recombinant inbred lines (RILs) of a Conrad x Sloan F4:6 population had higher yield when they contained the alleles from Conrad at these QDRL (Wang et al. 2012a). Finally, unlike the QDRL regions of soybean chromosome 18, which also have many of the qualities described above, the genes underlying QDRL 19-1 and QDRL 19-2 do not have a known R-gene-like motif in the Williams

82 reference genome (Schmutz et al. 2010; Wang et al. 2012b). Therefore, it seems unlikely that the genes underlying this region are weak or defeated R-genes and instead rely on potentially unique defense mechanisms (Wang et al. 2012b).

Two QDRL, 19-1 and 19-2, mapped to large regions of chromosome 19, ~0.5Mb and 1.5

Mb respectively (Wang et al. 2012b). Therefore, it is likely that not all of the genes within these regions contribute to quantitative resistance. A better understanding of the mechanisms involved in quantitative resistance, as well as the genes with significant roles in those mechanisms, can help narrow these QDRL for more effective marker assisted breeding (St. Clair 2010).

Recent sequence and expression analysis of QDRL 19-1 and 19-2 in Conrad and Sloan indicated that there were eleven genes with single nucleotide polymorphisms (SNPs) unique to

Conrad compared to Sloan and Williams 82 (Wang et al. 2012b). In previous studies, fifteen genes from QDRL 19-1 and sixty-four genes from QDRL 19-2 had significantly different expression in either Conrad or Sloan during infection (Wang et al. 2010; 2012b), and sixteen genes had significant differences in transcription levels between Conrad and Sloan in quantitative real time PCR analysis (Wang et al. 2012b).

In the region with QDRL 19-2, several auxin-related genes were up-regulated in Sloan.

These included an auxin-induced protein (Glyma.19g161000), a PIN1-like auxin transporter

(Glyma.19g128800), and an auxin-responsive transcription factor (Glyma.19g221900; Wang et al. 2010; 2012b). This suggests that changes in the local auxin activity and concentration may play a role in making soybean more susceptible to P. sojae.

Plant susceptibility factors

In addition to having R-genes and other defense-related genes that contribute to resistance, plants can also have genes that pathogens can use to promote disease. These so-called susceptibility genes or susceptibility factors can contribute to disease by enabling pathogen penetration, negatively regulating plant immunity, or contributing to pathogen metabolism and

6 reproduction (Hückelhoven et al. 2013; Lapin and Van den Ackervenken 2013; van Schie and

Takken 2014). If these factors can be identified, it might be possible to select against them as an alternative approach to breeding for resistance (Pavan et al. 2010; van Schie and Takken 2014).

A well-known example of this approach is the mlo gene. In barley, the dominant form of this gene appears to be involved in vesicle trafficking (Panstruga 2005) and cytoskeletal actin (Miklis et al. 2007), and allows penetration by the powdery mildew pathogen, Blumeria graminis f. sp. hordei (Consonni et al. 2006; Humphry et al. 2006). The recessive allele, mlo, has been widely effective against numerous isolates of B.graminis f. sp. hordei for about forty years (Jørgensen

1977; 1992). Non-functional, recessive homologs of mlo were also shown to be effective against powdery mildews in Arabidopsis thaliana, pea, and tomato (Bai et al. 2008; Consonni et al.

2006; Humphry et al. 2011).

However, breeding against susceptibility factors can prove to be challenging because they may have pleiotropic effects. Several of these genes are important for normal plant growth and development (Hückelhoven et al. 2013; van Schie and Takken 2014). Barley lines containing mlo tend to develop leaf necrosis and have reduced yield (reviewed in Jørgensen 1992). They also are more susceptible to other diseases such as Ramularia leaf spot (McGrann et al. 2014).

The severity of these effects seems to depend on the environment and the genetic background for this particular gene (Jørgensen 1992; McGrann et al. 2014).

Pleiotropic effects on growth and development are a common theme for both susceptibility factors (Hückelhoven et al. 2013; van Schie and Takken 2014) and for quantitative resistance (Poland et al. 2009). Therefore, it will be interesting to see if susceptibility factors contribute to quantitative resistance in the soybean-Phytophthora sojae system.

Auxin’s role in plant roots

Many plant processes, including defense responses, are dependent upon crosstalk between hormonal pathways. Some pathogens disrupt the required hormone balance by synthesizing host hormones or by altering their host’s signaling, metabolic, and/or transport processes through use of effectors (reviewed in Ma and Ma 2016; Robert-Seilaniantz et al.

2011).

Auxins are one of the primary growth hormones in plants. They typically consist of an aromatic ring and a carboxylic acid. The primary auxin active in most plants is indole-3-acetic acid (IAA). It is involved in numerous events including root and shoot growth, apical dominance, vascular differentiation, and response to light and gravity. Many of these activities occur due in part to differences in auxin concentrations and distribution. In roots, higher levels of auxin can inhibit primary root elongation and promote lateral root development (Taiz and Zeiger

2010). Auxins are laterally redistributed in response to light and gravity. This causes an accumulation of auxin on one side of the plant tissue, which leads to differences in cell growth and tissue bending (Peer et al. 2011; Taiz and Zeiger 2010).

In Arabidopsis, the signaling pathway begins when auxin binds to TRANSPORT

INHIBITOR RESISTANT 1/Auxin F-box Binding (TIR1/AFB) proteins, F-box components of

SCF ubiquitin E3 ligase complexes (Fig. 1.1; Robert-Seilaniantz et al. 2011; Taiz and Zeiger

2010; Weijers and Wagner 2016). When auxin is present, TIR1/AFBs bind to auxin/indole-3- acetic acid (AUX/IAA) proteins. AUX/IAA proteins usually bind to class A auxin response factors (ARFs) and repress their ability to activate early auxin-response genes. Auxin stabilizes

TIR1/AFB-AUX/IAA binding, resulting in the ubiquitination and subsequent degradation of

AUX/IAA proteins. The freed ARF proteins can then activate auxin-response genes (Robert-

Seilaniantz et al. 2011; Taiz and Zeiger 2010; Weijers and Wagner 2016).

A subset of the GH3 gene family is involved in the early auxin response (Hagen and

Guilfoyle 1985; 2002; Westfall et al. 2010). These genes encode enzymes that play a role in maintaining the homeostasis of IAA by conjugating it to amino acids, which deactivates it

(Domingo et al. 2008; Singh et al. 2015; Staswick et al. 2005). There are nineteen GH3 genes in

Arabidopsis and at least thirteen putative GH3 genes in rice (Hagen and Guilfoyle 2002;

Domingo et al. 2008). Since GH3 proteins reduce the amount of free IAA in the plant cell, they can also affect the expression of other auxin-related genes. In transgenic rice that overexpressed

OsGH3.1, auxin biosynthesis genes were activated, while AUX/IAAs were repressed (Domingo et al. 2008).

Some of auxin’s effects are controlled by the concentration of auxin in a given tissue.

Local auxin concentrations are regulated by auxin transporters (Fig.1. 2). In Arabidopsis, there are three main groups of auxin transporters AUXIN RESISTANT 1/LIKE AUX 1

(AUX1/LAX1), ATP-binding cassette subfamily B (ABCB), and PIN-FORMED (PIN) proteins.

The AUX1/LAX1proteins are responsible for auxin influx. They set up a source-sink relationship that is critical for long-distance transport. In roots, they play a role in the gravitropic response of the primary root and in the formation of lateral roots (Peer et al. 2011). The ABCB proteins play several roles. ABCB1 and ABCB19 are the main ABCB transporters involved in the long-distance transport of auxin and are responsible for moving it out of apical tissues

(Blakeslee et al. 2007; Peer et al. 2011). ABCB4 is involved in shoot ward auxin transport out of the roots. It also plays a role in regulating primary root growth and root hair elongation (Kubeš et al. 2012; Peer et al. 2011). The PIN-FORMED (PIN) protein family is responsible for auxin efflux. There are eight total in Arabidopsis, each with specialized roles (Peer et al. 2011). For example, AtPIN1 is involved in auxin transport towards the roots (Muday et al. 2012).

Several studies have characterized the AUX/LAX, ABCB, and/or PIN families in other plant species, including watermelon (Citrullus lanatus), sorghum (Sorghum bicolor), rice (Oryza sativa), maize (Zea maize), and Medicago truncatula (Paponov et al. 2005; Peng et al. 2013;

Schnabel and Frugoli 2004; Shen et al. 2010; Wang et al. 2009; Yu et al. 2017; Yue et al. 2015).

The number of AUX/LAX genes present in each species ranged from 5-7, the number of ABCB genes ranged from 15-35, and the number of PIN genes ranged from 10-15. Many of these genes had differential expression after treatment with IAA or other hormones (Shen et al. 2010; Yu et al. 2017; Yue et al. 2015). Their expression also changed in sorghum, watermelon, and maize during abiotic stress such as high salinity, drought, and/or cold stress (Shen et al. 2010; Yu et al.

2017; Yue et al. 2015). In M. truncatula, the PIN genes have been implicated in the formation of nodules (Huo et al. 2006).

More recent studies identified twenty-one to twenty-three putative PIN genes in soybean

(Peng et al. 2013; Wang et al. 2015). Of these, there were nine pairs that are likely to be duplicated, as they have more than 90% nucleotide identity (Wang et al. 2015). Like

Arabidopsis, the GmPIN genes are predicted to encode proteins of long (578-666 aa long) and short lengths (353-377 aa long; Wang et al. 2015). Unlike Arabidopsis, some GmPIN proteins are predicted to have an intermediate protein length (443-531 aa long; Wang et al. 2015). Wang et al. (2015) also demonstrated that fifteen, eight, and seven of these genes were differentially regulated during drought stress, during salinity stress, and during dehydration, respectively.

Additionally, eighteen and seventeen were responsive to abscisic acid (ABA) or IAA treatment, respectively (Wang et al. 2015). This list of putative PIN genes included Glyma.19g128800

(Wm82.a1.v1.1 name Glyma19g30900), which was down-regulated in Conrad and up-regulated

Sloan at 3 and 5 dai after inoculation with P. sojae (Wang et al. 2010).

Figure 1.2. Summary of model of auxin transport in plant cells. H+-ATPase pumps hydrogen ions from the cytosol into the apoplast, raising the intracellular pH. In the apoplast, IAA is protonated and enters the cell by diffusion and transport through AUX1/LAX proteins. Inside the cell, IAAH is deprotonated to IAA- and is then exported from the cell by ABCB and PIN proteins. Modified from Taiz and Zeiger 2010.

It is suspected that some auxin transporters have dual roles, which in some cases allows for crosstalk between separate hormone pathways or between hormones and nutrients. For example, the Arabidopsis nitrate transporter NRT1.1 has been reported to transport auxin in the epidermal cells of lateral root primordia when external nitrate levels are low (Krouk et al. 2010).

Auxin’s role in plant-microbe interactions

There is some evidence that the auxin and salicylic acid (SA) signaling pathways are antagonistic. Auxin signaling suppresses SA biosynthesis and signaling (reviewed in Robert-

Seilaniantz et al. 2011). SA has been shown to contribute to the defense response against biotrophic and hemibiotrophic pathogens such as P. sojae (Navarro et al. 2008; Vlot et al. 2009).

Thus, active auxin signaling pathways could make the host plant more susceptible during the initial infection stage of the pathogen. Additionally, WES1, a protein encoded by a GH3 gene in

Arabidopsis, has been shown to conjugate both IAA and SA, which suggests it may play a role in the crosstalk between these two hormones (Park et al. 2007).

Auxin and jasmonic acid (JA) are subtrates of the GH3 family of proteins and use similar signaling machinery (Robert-Seilaniantz et al. 2011). In the case of jasmonic acid, it is first conjugated to isoleucine by the GH3 protein JAR1 producing JA-Ile, which is the active form of the hormone (Staswick and Tiryaki 2004). Similar to IAA and TIR1/ABF proteins, JA-Ile binds to the F-box protein coronative insensitive 1 (COI1, Robert-Seilaniantz et al. 2011). This allows

COI1 to bind to the JAZ proteins, negative regulators of JA-responsive genes, which are then ubiquitinated and degraded. Tiryaki and Staswick (2002) found the Arabidopsis mutant axr1-24 was insensitive to methyl jasmonate and has a phenotype similar to the axr1-3 auxin insensitive mutant. They speculate that Axr1 mediates crosstalk between these pathways by acting upstream of COI1.

Additionally, perception of flg22 results in accumulation of the miRNA miR393, which leads to cleavage of the TIR1 transcript and those of its homologs AFB2 and AFB3 (Navarro et al. 2006). Therefore, auxin signaling is down regulated during normal MAMP/PAMP triggered immunity (MTI/PTI; Bostock et al. 2014; Liu et al. 2014; Navarro et al. 2006).

Auxin biosynthesis occurs via several different pathways in many organisms including plants, fungi, and bacteria. In many of these pathways, the amino acid tryptophan serves as a precursor, while the intermediates differ (Spaepen et al. 2007; Soeno et al. 2010). Some plant pathogens, such as Agrobacterium tumefaciens, are known to induce auxin biosynthesis in the host by the introducing auxin biosynthesis genes into the host genome (Taiz and Zeiger 2010).

Beneficial bacteria, such as Bradyrhizobium can also synthesize auxin, and in some cases use a similar biosynthetic pathway as Agrobacterium. Auxin produced by bacteria can block plant hypersensitive response and, in some instances, enhances bacterial colonization (Spaepen et al.

2007).

Bacterial pathogens may also benefit when auxin signaling/response is activated.

Overexpressing AFB1, which is more resistant to miR393-mediated cleavage, in the Arabidopsis tir1-1 background increased susceptibility to Pseudomonas syringae pv. tomato DC3000, while overexpression of miR393 lead to increased resistance compared to wild type (Navarro et al.

2006). Beneficial bacteria also modify host-auxin processes to facilitate host-microbe interactions. Inhibition of auxin transport and modification of auxin signaling/response via miRNA pathways have been implicated in nodulation (Turner et al. 2013; Rightmyer and Long

2011; Rosendahl and Jochimsen 1995).

Nematodes also appear to rely on auxin for infection of host plants. Auxin transport proteins were shown to have cell-specific expression in root knot nematode feeding sites in

Arabidopsis (Kyndt et al. 2016). Additionally, the Arabidopsis pin1, aux1, and lax3 auxin transport mutants and the aux1lax3 double mutant had fewer nematodes in the roots and fewer feeding sites at 3 and 7 dai compared to their respective wild types. The pin3 mutant had fewer nematodes at 7 dai, while the pin4 mutant had more nematodes (Kyndt et al. 2016). During the later stages of infection, the aux1 and lax3 mutants and the aux1lax3 double mutant had fewer and smaller galls compared to wild type. The pin1, pin2, and pin3 mutants had fewer galls that were similar in size to the wild type. The pin4 mutant had a similar number of galls but appeared to have adverse effects on female development and gall size (Kyndt et al. 2016).

Auxin has also been implicated in susceptibility to certain fungal pathogens. Fusarium oxysporum utilizes several auxin processes including biosynthesis, signaling, and transport to increase susceptibility in Arabidopsis by altering auxin homeostasis in roots. The auxin signaling mutants axr1, axr2, axr3, and sgt1b and the transport mutants pin2/eir1, aux1, and axr4 were more resistant to F. oxysporum than the wild type. Treatment with the auxin transport inhibitors

2,3,5-triiodobenzoic acid (TIBA) or 1-N-naphthylphthalamic acid (NPA) before inoculation also increased resistance (Kidd et al. 2011). Overexpression of GH3.1 in transgenic rice increased host resistance to Magnaporthe grisea, possibly due to a decrease in the amount of free IAA

(Domingo et al. 2009). Medicago truncatula GH3.3 is up regulated during infection with the necrotrophic fungus Macrophomina phaseolina, though it is not yet clear what role this has in defense (Mah et al. 2012). The beneficial fungi Trichoderma atroviride and Laccaria bicolor also make use of auxin synthesis and signaling/response, respectively, to modify host roots

(Contreras-Cornejo et al. 2015; Pieterse et al. 2014).

Previous studies also indicate that auxin plays a role in susceptibility to oomycete pathogens. The Phytophthora parasitica effector Penetration-specific effector 1 (PSE1) negatively affected root growth and root hair development in transgenic Arabidopsis thaliana lines expressing the gene. These lines were also more susceptible to P. parasitica than wild type plants. Additionally, wild type plants treated with the synthetic auxins 2,4-dichloropenoxyacetic acid (2,4-D) and naphthaleneacetic acid (NAA) had slightly more severe symptoms (Evangelisti et al. 2013). Soybean cell suspensions that were 2,4-D starved or treated with a P. sojae glucan elicitor both accumulate the phytoalexin glyceollin. These treatments also appear to have similar effects on changes to protein accumulation, although treatment with the elicitor caused these changes within 9 h, while the 2,4-D starvation effects were not seen until 5 d after treatment

(Leguay and Jouanneau 1987). This suggests that the absence of auxin allows for the promotion of plant defense responses in soybean, and that these responses are similar to the responses to P. sojae. Thus, if P. sojae could increase the level of auxin present, it could potentially promote disease.

Research Objectives

Hypothesis:

Auxin makes soybean more susceptible to P. sojae. This could occur through the pathogen’s manipulation of host auxin machinery or the pathogen’s own production of auxin.

Conrad is better able to prevent or to adapt to these changes compared to Sloan, which contributes to its phenotype of quantitative resistance.

Objectives:

1. To refine the mapping of QTL conferring resistance to P. sojae, and to compare these to

QTL conferring resistance to Py. irregulare and F. graminearum.

2. To measure auxinic metabolites in P. sojae mycelia and inoculated Conrad and Sloan

roots.

3. To determine the role of auxin in host susceptibility/resistance to P. sojae by

investigating the role of auxin transporters and of auxin signaling and auxin-responsive

genes in response to P. sojae infection.

Chapter 2: High density mapping of resistance QTL towards Phytophthora sojae, Pythium irregulare, and Fusarium graminearum in the same soybean population

Work presented in this chapter was originally published as Stasko, A.K., Wickramamsinghe, D., Nuath, B.J., Acharya, B., Ellis, M.L., Taylor, C.G., McHale, L.K., and Dorrance, A.E. 2016. High density mapping of resistance QTL towards Phytophthora sojae, Pythium irregulare, and Fusarium graminearum in the same soybean population. Crop Sci. 56:2476-2492. doi:10.2135/cropsci2015.12.0749 A.K. Stasko performed P. sojae phenotyping, P. sojae and Py. irregulare phenotype data analysis, correlation analyses, compilation of gene and QTL lists, and wrote the article.

Abstract

Phytophthora sojae Kaufm. and Gerd., Pythium irregulare Busiman, and Fusarium graminearum Schwabe (teleomorph: Gibberella zeae (Schwien.) Petch) are important pathogens of soybean (Glycine max (L.) Merr.), and are all capable of causing seed rot, damping-off, and root rot. The objective of this study was to identify quantitative trait loci (QTL) for resistance to

Py. irregulare and to refine previously mapped QTL for resistance to P. sojae and F. graminearum in a larger, more advanced Conrad x Sloan F9:11 recombinant inbred line population. The population was mapped with 1032 SNPs from the SoySNP6K BeadChip and 31

PCR-based molecular markers. Families were evaluated for resistance response to three isolates of P. sojae, one isolate of Py. irregulare, and one isolate of F. graminearum. A total of ten, two, and three QTL and suggestive QTL were found that confer resistance to P. sojae, Py. irregulare, and F. graminearum, respectively. Individual QTL explained 2-13.6% of the phenotypic variance (PV). QTL for resistance towards both Py. irregulare and F. graminearum co-localized on chromosome 19. This resistance was contributed by Sloan and was juxtaposed to a QTL for

P. sojae with resistance contributed from Conrad. Alleles for resistance to different pathogens 17 contributed from different parents in the same region, the number of unique QTL for each pathogen and the lack of correlation of resistance suggest that different mechanisms are involved in resistance towards P. sojae, Py. irregulare, and F. graminearum.

Introduction

Phytophthora sojae, Pythium irregulare, and Fusarium graminearum (teleomorph:

Gibberella zeae) are three common pathogens of soybean which cause seed rot, damping-off, and root rot in Ohio and the north central region of the United States (Broders et al. 2007a,

2007b, 2009; Ellis et al. 2011; Grau et al. 2004; Xue et al. 2007). P. sojae is often the second leading cause of yield loss in the United States, especially when production occurs on poorly drained soils (Grau et al. 2004; Miller et al. 1996; Schmitthenner 1985; Wrather and Koenning

2009). Several different Pythium spp. have been recovered from the same field where extensive seedling blight was known to occur (Dorrance et al. 2004; Broders et al. 2007a). However, Py. irregulare was the most prevalent species recovered from fields with a history of poor stands in

Ohio (Broders et al. 2009). While F. graminearum is best known for causing Fusarium head blight on wheat (Triticum aestivum L.), barley (Hordeum vulgare L.), oat (Avena sativa L.) and

Gibberella ear and stalk rot on maize (Zea mays L.), it has also been reported from several regions as a pathogen of soybean (Broders et al. 2007b; Díaz Arias et al. 2013a; Ellis et al. 2011;

Pioli et al. 2004; Xue et al. 2007). Seed and seedling diseases caused by these pathogens have become more prevalent in Ohio and in several soybean growing areas of the north central region as indicated by recent surveys in Iowa, Illinois, North Dakota, and Ontario, Canada (Broders

2007a, 2007b; Díaz Arias et al. 2013a, 2013b; Ellis et al. 2011; Jiang et al. 2012; Marchand et al.

2014; Murillo-Williams and Pedersen 2008; Rizvi and Yang 1996; Zhang and Yang 2000;

Zitnick-Anderson and Nelson 2014). This may be due to changes in management practices such as earlier planting dates, which delays germination due to cool soil conditions and increases the amount of time seeds are exposed to pathogens, and the long term use of no-till and reduced-till systems, which increases the amount of inoculum in the seed bed (Broders et al. 2007a; Ellis et al. 2011, 2012, 2013; Workneh et al. 1998, 1999). Fungicides are often applied as seed treatments to manage these diseases. However, there have been changes in fungicide chemistries in recent years, and several of these fungicides have limited efficacy towards one or more of these pathogens (Broders et al. 2007a, 2007b; Ellis et al. 2011).

Other management strategies for seed and seedling pathogens include tiling fields to improve drainage and rotating crops to prevent inoculum build-up. Most growers in Ohio use a corn-soybean or corn-soybean-wheat rotation (Broders et al. 2007b). This rotation strategy might be effective against P. sojae, which primarily infects soybean, but would not be effective against Py. irregulare and F. graminearum as these pathogens can infect both corn and wheat as well. Host resistance offers a more cost-effective management strategy for producers. It has been used effectively to manage P. sojae for more than fifty years (Bernard et al. 1957; Grau et al. 2004; Schmitthenner 1985), but very little is known about resistance to Py. irregulare (Ellis et al. 2013) and F. graminearum (Acharya et al. 2015; Ellis et al. 2012).

The soybean cv. ‘Conrad’ (Fehr et al. 1989) has been identified as a source of resistance to P. sojae and F. graminearum (Burnham et al. 2003; Li et al. 2010; Ellis et al. 2012; Wang et al. 2010, 2012a, 2012b) while the cultivar ‘Sloan’ (Bahrenfus and Fehr 1980) is moderately to highly susceptible to these same pathogens (Ellis et al. 2012; Wang et al. 2010, 2012a, 2012b).

Both cultivars have similar levels of moderate susceptibility to Py. irregulare (Ellis et al. 2013).

Quantitative trait loci (QTL) to P. sojae and F. graminearum were mapped in an earlier

19 generation of a recombinant inbred line (RIL) population derived from a cross between Conrad and Sloan (Ellis et al. 2012; Wang et al. 2010, 2012a, 2012b). Ten QTL were associated with resistance towards P. sojae and mapped to chromosomes 1, 12, 13, 14, 17, 18, and 19 in the F4:6 and F6:8 generations (Wang et al. 2010, 2012b). In the F6:8 generation, four QTL conferring resistance to F. graminearum were mapped to chromosomes 8, 13, 15, 16, and 19 (Ellis et al.

2012). QTL for both P. sojae and F. graminearum overlapped on chromosomes 13, 16, and 19

(Ellis et al. 2012). For both pathogens, only minor QTL, which contribute less than 20% phenotypic variance (PV; St. Clair 2010), were detected (Ellis et al. 2012; Wang et al. 2010,

2012a, 2012b).

In these earlier studies some of the QTL encompassed large regions of the chromosome.

For example, the markers that flanked two QTL mapped to chromosome 19, conferring resistance to P. sojae, were ~0.5 Mb and 1.5 Mb apart and explained 4.8 and 11.9% PV (Wang et al. 2012b). In a breeding program, it is impractical to introduce such large chromosomal regions into adapted germplasm. Additionally, it is expected that only a single or few genes underlying a resistance QTL contribute to the resistance response. As well as in some cases, genes underlying a QTL for a specific trait may contribute undesirable agronomic traits (Brouwer and St. Clair

2004). Identifying key genes involved in defense and refining QTL to regions more narrowly defined by markers would greatly assist breeding efforts to incorporate quantitative resistance into adapted germplasm. It would also facilitate the targeting of candidate genes for cloning and functional analysis. Thus, from approximately 400 RILs derived from a cross between Conrad and Sloan, 186 to 262 lines were used for mapping in previous studies (Ellis et al. 2012; Wang et al. 2010, 2012a, 2012b), and the whole population was advanced to the F9:11 generation. In the current study, this larger, advanced population of 316 remaining lines was used to map QTL

20 conferring resistance to P. sojae, Py. irregulare, and F. graminearum. In addition to a larger population size, more markers were used to increase the mapping resolution compared to previous studies (Ellis et al. 2012; Wang et al. 2010, 2012a, 2012b). P. sojae is a hemibiotroph, and Py. irregulare, and F. graminearum have been regarded both as necrotrophs, and in more recent discussions, as hemibiotrophs (Adie et al. 2007; Brown et al. 2010; Trail 2009). One difference that has been used to characterize necrotrophs from hemibiotrophs is the formation of specialized feeding structures within the host cell. F. graminearum does not form haustoria within infected plant tissue on wheat (Brown et al. 2010) while P. sojae does on soybean

(Enkerli et al. 1997). Py. irregulare was reported to form haustoria-like structures in

Arabidopsis thaliana (L.) Heynh. (Adie et al. 2007), but no studies have been reported to date of similar structures in soybean. Additionally, no RxLR effector type sequences were identified in

Py. irregulare (Adhikar et al. 2013).

Thus, this RIL population, segregating for resistance towards three pathogens, affords a unique look into the inheritance of resistance towards a hemibiotroph and two necrotrophs within the same population. Therefore, the objectives of this work were to: (i) identify and compare

QTL conferring resistance to one or more pathogens, (ii) confirm and more narrowly define the

QTL identified in previous studies on a larger, more advance population, and (iii) identify candidate genes for further functional analysis to determine the mechanisms involved in quantitative resistance.

Materials and Methods

Plant materials

A RIL population derived from a cross between Conrad and Sloan was advanced from the F6:8 population (Wang et al. 2012b) by single seed descent to the F9 generation. Single rows of F9:10 plants were bulk harvested in 2012 to generate F9:11 RILs used in this study. For P. sojae

OH25 phenotypic assays, seed of single rows of F9:12 were bulk harvested in 2014.

Resistance to P. sojae assay

A population of 316 F9:11 RILs was phenotyped for resistance to P. sojae by means of the tray assay as described previously (Burnham et al. 2003; Lee et al. 2013a, 2013b; Wang et al.

2010, 2012a, 2012b). In brief, plants were grown in vermiculite (Perlite Vermiculite Packing

Industries, Inc., North Bloomfield, OH) in the greenhouse for 7 d, and the roots were washed in tap water to remove vermiculite. Ten plants from each RIL were placed on a polyester cloth, which was on top of a cotton wicking pad on a plastic tray. A small scratch was made on the main tap root of the plants approximately 2 cm below the crown region. The wound was covered with a mycelial slurry of a 7 to 9-d-old isolate of P. sojae grown on dilute lima bean (Phaseolus lunatus L.) agar. Following inoculation, trays were placed in buckets and kept in a growth chamber at 25 o C, 14 h light:10 h dark, and 20% relative humidity. Seven days after inoculation

(dai), the lesion length was measured from the top of the inoculation site to the leading edge of the lesion margin.

Three different isolates of P. sojae were used to identify QTL in separate experiments,

PT2004C2.S1 (hereafter C2.S1), 1.S.1.1. (both vir 1a, 1b, 1k, 2, 3a, 3c, 4, 5, 6, and 7), and OH25

(vir 1a, 1b, 1c, 1k. and 7). Each experiment used a randomized incomplete block design, and each block contained at least 110 RILs that were divided into six buckets for C2.S1, 40 to 116

RILs divided into two-to-ten buckets for 1.S.1.1, and at least 164 RILs divided into nine buckets for OH25. The parents were used as checks in each bucket. Each RIL was evaluated three separate times for both isolates. Best linear unbiased predictor (BLUP) values for each RIL were calculated from the mean of the lesion measurements within each bucket using PROC MIXED in

SAS v.9.1 as previously described. The model was Yijklm= μ + Gi + R(G)ij + S(RG)ijk + Cl +

L(C)lm + εijklm where, µ is overall mean, Gi is the effect of the ith group, R(G)ij is the effect of the jth replication in the ith group, S(RG)ijk is the effect of the kth set in jth replication in the ith group, C1 is the effect of the lth class of entry (Conrad, Sloan, or experimental line), L(C)lm is the

2 effect of the mth genotype with class (genotypic variance, σg ) and εijklm is the experimental error

(σ2). (Acharya et al. 2015; Burnham et al. 2003; Ellis et al. 2012; Stroup 1989; Wang et al.

2010, 2012a, 2012b). Class was treated as fixed, all other effects were treated as random.

Variance components were estimated using the restricted maximum likelihood (REML) method

2 2 (Patterson and Thompson 1971). Broad-sense heritability was calculated as σ G(C) / (σ G(C) +

2 2 2 σ ε/r), where σ G(C) is the genetic variance within the RILs, σ ε is the variance of error, and r is the number of replications per RIL. To examine possible relationships between resistance for a given isolate to resistance for another isolate, BLUP values were correlated using PROC CORR in SAS. In a separate analysis to examine possible effects due to an isolate x genotype interaction, the adjusted mean lesion lengths of a given RIL for all three isolates of P. sojae were analyzed using PROC GLM in SAS.

Resistance to Py. irregulare assay

Three hundred and sixteen RILs of the same population used for the resistance to P. sojae were screened for resistance to Py. irregulare using a sand-cornmeal cup assay as previously described (Broders et al. 2007; Ellis et al. 2013; Kirkpatrick et al. 2006). In summary, each

23 spawn bag (Myco Supply Pittsburgh, PA) was filled with 50 mL of cornmeal, 950 mL of sand, and 250 mL of deionized water then sterilized on two successive days for 60 min. Eight 10 mm plugs of Py. irregulare isolate Brown 2-3-5, which was chosen because of its high pathogenicity on soybean (Ellis et al. 2012), from a 3-d-old culture grown on potato carrot agar (PCA) were added to the bags. The spawn bags were sealed, incubated at room temperature (approximately

24 to 26 oC), and shaken every other day to ensure even colonization of the sand-cornmeal mixture by Py. irregulare. After 10 d, inoculum from each bag was mixed with fine vermiculite in a 1:4 (vol:vol) ratio of inoculum to vermiculite. Styrofoam cups (0.5 L) with holes in the bottom for drainage were filled with 100 mL of coarse vermiculite and 300 mL of inoculum- vermiculite mixture. Eight seeds were placed directly on top of the inoculum-vermiculite mixture in each cup and covered with 100 mL of coarse vermiculite.

Fresh root weight was collected 14 d after planting. To do this, plants were removed from the cups, and the inoculum-vermiculite mixture was washed from the roots. This experiment was arranged as a randomized complete block design with four replications over time. A total of thirty-two seedlings were evaluated from each F9:11 family for resistance to Py. irregulare.

Best linear unbiased predictor (BLUP) values for each RIL were calculated from the fresh root weight of each RIL using PROC MIXED. The model applied was Yilm= μ + Ri + Cl +

G(C)lm + εilm. Variables are defined and effects are treated as described above for the P. sojae lesion length tray assay. Variance components were estimated using the REML method

2 2 2 (Patterson and Thompson 1971), and broad-sense heritability was calculated as σ g / (σ g + σε /r),

2 2 where σ g is the genetic variance, r and σε are as described above.

Resistance to F. graminearum assay

A total of 316 F9:11 RILs of the same population used for the P. sojae and Py. irregulare assays was also screened for resistance to F. graminearum by means of a rolled towel assay modified from Ellis et al. (2011). F. graminearum isolate Fay11, which was collected from soybean and is highly aggressive (Ellis et al. 2011), was cultured on mung bean (Vigna radiate

(L.) R. Wilczek) agar for 10 d. Sterile water was added to the plates, and macroconidia were dislodged using a sterile glass rod. The suspension was filtered through cheese cloth to remove any mycelia in the solution. The concentration of macroconidia was calculated using a hemocytometer (Bright-Line Hemacytometer, Hausser Scientific, Horsham, PA) and was adjusted to 2.5 x 104 macroconidia mL-1 by adding sterile water as needed. Fifteen seeds from each RIL were placed on a moistened germination towel and inoculated with 100 μL of macroconidia suspension. A second moistened towel was placed on top of inoculated seedlings.

The towels were then rolled and placed on a wire mesh in a 25 L bucket, covered with a black plastic bag and kept in the dark at room temperature (approximately 24 to 26 oC). Ten dai, the towels were removed from the bucket. Lesion length and total plant length were measured on each seedling. The disease severity index (DSI) was calculated by dividing the lesion length by the total plant length and multiplying by 100. The mean DSI of the seedlings in each F9:11 family was used to obtain BLUP values as described previously (Ellis et al. 2012; Stroup 1989). The population was evaluated in an incomplete block design with three replications. Each replication consisted of multiple subsets of the population and contained F9:11 families; two parents; and PI

567301B, a resistant line (Acharya et al. 2015); ‘Wyandot’ (Ohio State University-Ohio

Agricultural Research and Development Center), a moderately resistant cultivar (Acharya et al.

2015); and Williams (Bernard and Lindahl 1972) a susceptible cultivar (Ellis et al. 2012). The model applied was the same as for the calculation of BLUPs from the P. sojae lesion length tray 25 assay described above with the exception that the C1 is the effect of the lth class of entry

(Conrad, Sloan, PI 567301B, Wyandot, Williams, and experimental lines). Variance components were estimated using the REML method, and broad-sense heritability was calculated

2 2 2 as σ g / (σ g + σ /r).

SNP genotyping and genetic mapping

Fresh leaf tissue was collected from 316 RILs of the Conrad x Sloan population, and

DNA was extracted using hexadecyltrimethylammonium bromide (CTAB) extraction modified from Doyle and Dickson (1987). DNA concentration and quality were checked with a ND-1000

Nanodrop (Nanodrop Technologies, Wilmington, DE), with PicoGreen dsDNA quantification using a Beckman Coulter multimode detector (Beckman Coulter Inc, CA), and by electrophoresis on a 1% agarose gel. Samples were diluted to 50 ng/μl and sent for single nucleotide polymorphism (SNP) genotyping at the Genome Center, University of California,

Davis, using the Illumina Infinium SoySNP6K BeadChip, a subset of the SoySNP50K BeadChip

(Song et al. 2013). A total of 5,403 SNPs out of 6,000 SNPs passed manufacturing quality control and were used in the genotyping. The resulting marker genotypes were analyzed in

GenomeStudio software v2011.1 (Illumina Inc., SanDiego, CA) with a GenCall threshold of

0.15. RILs with a call rate less than 80% and SNPs that were monomorphic or displayed ambiguous clustering were removed from the analysis. The SNP data for the remaining samples was exported and used for genetic mapping. Individual lines and SNP markers with more than

10% missing genotypes or more than 10% heterozygous genotypes were removed from the data set. Markers with a significantly different segregation ratio from the expected ratio calculated by chi-square goodness-of-fit test were also removed. Genetic maps were created using Kosambi’s mapping function in JoinMap 4.0 (van Ooijen 2006). The maximum likelihood mapping

26 algorithm was used with LOD threshold of 2 for grouping. Additional Simple Sequence Repeat markers (SSR) and PCR amplification of multiple specific alleles (PAMSA) markers that were localized to the previously known QTL were added to the map to fill in gaps as previously described (Song et al. 2010; Wang et al. 2012b). The graphical presentation of genetic maps was carried out using custom script in Biopython (https://github.com/ajwije/chromosome_map; Cock et al. 2009).

QTL analysis

BLUP values for the adjusted mean lesion length following inoculation with P. sojae, root weights for Py. irregulare, and for disease severity from F. graminearum were used for

QTL analysis. Composite interval mapping (CIM) was carried out using MapQTL 5 to identify putative QTL locations (van Oijen 2004). Permutation tests with 1000 iterations were carried out on a genome-wide and chromosome-wide basis to identify significant LOD threshold levels

(Churchill and Doerge 1994). Genome-wide thresholds were applied to identify significant QTL and chromosome-wide thresholds were applied to identify suggestive QTL (Lander and

Kruglyak 1995; van Oijen 1999). Graphs were created with ggplot2 package (Wickham 2009) in

R (R Development Core Team 2012).

Gene annotation and categorization

Genes underlying each QTL were identified from the soybean genome browser on

SoyBase (Grant et al. 2010) by entering the physical map coordinates of the flanking markers.

Genes were categorized based on Panther, GO, and PFAM terms from SoyBase. Only genes associated with QTL with suggestive or significant CIM LOD scores and overlapping for at least two isolates of P. sojae are reported here.

Results

Phenotypic assays

Phytophthora sojae: For all three isolates of P. sojae, C2.S1, 1.S.1.1 and OH25, lesions developed on most seedlings in each of the F9:11 RIL families. In some cases for 1.S.1.1 and

OH25, 20-40% of seedlings on a tray for a given RIL did not have lesions in a given replication.

For the final analysis, these few seedlings with no lesions were not included in the final means as lack of lesion development could be due to failed inoculation or infection efficiency. The lesion lengths were significantly different (p<0.0001, Fisher’s protected LSD) between the parents for all three isolates (Table 2.1). The mean lesion length of the RILs ranged from 15.3 mm to 51.7 mm for C2.S1, 7.3 mm to 61.5 mm for 1.S.1.1, and 7.0 mm to 59.1 mm for OH25. For all three isolates, BLUP values were calculated and had a normal distribution (Fig. 2.1), indicating that resistance is quantitative. Where a lower BLUP value indicates a higher level of resistance, the

BLUP values for Conrad were estimated at -12.63, at -16.96, and at -14.65 for C2.S1, 1.S.1.1, and OH25 respectively. The BLUP values for Sloan were estimated at 0.00 for all three isolates.

The broad-sense heritability for mean lesion length was 0.54 for C2.S1, 0.53 for 1.S.1.1, and

0.67 for OH25.

Cultivar P. sojae P. sojae P. sojae Py. irregulare F. graminearum C2.S1 1.S.1.1 OH25 (g)‡ (DSI)§ (mm)† (mm)† (mm)† Conrad 24.1 a¶ 21.9 a 22.8 a 2.2 43.2 a Sloan 36.8 b 38.7 b 34.3 b 3.1*** 80.7 b PI 567301B –# – – – 8.1 c Wyandot – – – – 40.6 a Williams – – – – 60.6 d RILs range 15.3-51.7 7.3-61.5 7.0-59.1 0.27-6.87 11.2-89.9 †Mean lesion length (mm) ‡Least squared means of root weight (g) §Disease severity index (DSI) = (lesion length/plant length)*100 ¶Values within columns followed by the same letter are not significantly different by Fisher’s protected LSD (0.05). #Not tested ***significantly different by ANOVA, p-value<0.0001

Figure 2.1. Frequency distribution of BLUP values of mean lesion length of Conrad x Sloan F9:11 RIL families for resistance to Phytophthora sojae isolates (A) C2.S1, (B) 1.S.1.1, and (C) OH25 evaluated with tray phenotyping assay. Arrows indicate values of parents and/or checks. A smaller BLUP value indicates a higher level of resistance.

Pythium irregulare. Pre-emergence damping-off occurred in approximately 66-90% of the F9:11 RIL families and the parents in the greenhouse assay. Root rot developed in all families and on both parents. There was a significant difference (p<0.0001) among the RILs and the two parents for root weight (Table 2.1). The data were normally distributed, indicating a quantitatively inherited trait (Fig. 2.2A). Fifteen RILs had root weights significantly greater than

Sloan, indicating transgressive segregation for resistance. The broad-sense heritability was 0.52.

Fusarium graminearum: The mean DSI was significantly different among the two parents and the checks indicating that Conrad had moderate level of resistance and Sloan was

30 susceptible to F. graminearum as previously reported (Ellis et al., 2012; Table 2.1). The means of parents and checks were separated by Fisher’s Protected LSD (p< 0.0001; Table 2.1). The mean DSI among the F9:11 RILs ranged from 11.2% to 89.9%, and the overall mean DSI of all the RILs was 49.7%. The BLUP values calculated from the DSI were normally distributed in this population (Fig. 2.2B). The BLUP values were -8.5 and 29.1 for Conrad and Sloan, respectively.

The BLUP values of checks PI 567301B, Wyandot, and Williams were -43.5, -11.0, and 9.0, respectively. Sixty-one RILs had BLUP values lower than Conrad, indicating transgressive segregation for resistance. The broad-sense heritability for the mean DSI was 0.73.

Figure 2.2. Frequency distribution of BLUP values of mean root weights and disease severity index (DSI) of Conrad x Sloan F9:11 RIL families for resistance to (A) Pythium irregulare and (B) Fusarium graminearum, root pathogens of soybean A larger BLUP value indicates a higher level of resistance due to higher root weight for Py. irregulare. A smaller BLUP value indicates a higher level of resistance for F. graminearum.

To investigate isolate specific interactions to P. sojae, correlations between the BLUP values for each RIL for both isolates were examined. Pearson’s correlation coefficient was 0.50

(p<0.001) for resistance to C2.S1 and resistance to 1.S.1.1, 0.41 (p<0.001) for resistance to

C2.S1 and resistance to OH25, and 0.36 (p <0.001) for resistance to 1.S.1.1 and to OH25, indicating a moderate correlation between resistance of the different isolates (Table 2.2).

Additionally, no significant isolate x genotype interaction for the mean lesion length of each RIL was observed (p=0.1934).

The correlation among the responses to the three pathogens from the RILs was also investigated. There was no significant correlation between two of the P. sojae isolates (C2.S1 and 1.S.1.1) and the resistance response of the RILs towards Py. irregulare or F. graminearum

(Table 2.2). However, there was a significant but very minor negative correlation between resistance to P. sojae isolate OH25 and resistance to Py. irregulare (-0.13; p=0.02). There was also a moderate correlation (-0.52; p<0.0001) between resistance to Py. irregulare and F. graminearum for BLUP values calculated from root weight and DSI, respectively.

Pathogen/Isolate P. sojae P. sojae P. sojae Pythium Fusarium C2.S1† 1.S.1.1 OH25 irregulare graminearum Br2-3-5 Fay 11 Phytophthora sojae – 0.50 0.41 -0.04 -0.0 C2.S1 Phytophthora sojae *** – 0.36 -0.02 0.03 1.S.1.1 Phytophthora sojae *** *** – -0.13 0.01 OH25 Pythium irregulare ns ns * – -0.52 Br2-3-5 Fusarium ns ns ns *** – graminearum Fay 11 * P value <0.05, *** P value <0.0001, ns not significant

Table 2.2. Pearson’s correlation coefficients above the diagonal and p-values below for the comparison of resistance phenotypes among a recombinant inbred line F9:11 population derived from a cross of Conrad x Sloan between pathogens and between isolates of Phytophthora sojae.

Linkage map construction

Among the 6000 SNP markers from the Soy6KSNP BeadChip, 5403 markers were scored in the array, but only 1133 markers were polymorphic between the two parents. From these, 1032 markers formed 23 linkage groups that matched with 20 chromosomes. Four

32 chromosomes, 7, 13, 17, and 19, were represented by two linkage groups each (Fig. A.1). There were insufficient polymorphic SNP markers to form chromosome 10. An additional 30 PCR- based markers, and one phenotype marker, flower color, were used to fill gaps in the preliminary genetic map. Following the addition of these 31 markers, the total map length was 1908.7cM.

The average marker interval was 1.8 cM per marker. There were a total of 13 gaps that were larger than 20 cM in the map, and the largest was 43 cM located on chromosome 7. The highest number of gaps (> 20cM) per chromosome was four on chromosome 6 and three on chromosome

7. The marker order position on the genetic map was mostly aligned with the physical positions of markers annotated on Glyma.Wm82.a2.v1 (SoyBase; Table B.1).

QTL mapping

Phytophthora sojae: Three QTL (including suggestive QTL which were significant at the chromosome wide threshold) conferring resistance to all three P. sojae isolates C2.S1, and

1.S.1.1, and OH25 were mapped to chromosomes 1, 18, and 19-1 (Table 2.3). Two QTL conferring resistance to C2.S1 and 1.S.1.1 but not to OH25 were mapped to chromosomes 4 and

16. A suggestive QTL on chromosome 16 for OH25 mapped to a different location than the QTL for C2.S1 and 1.S.1.1. A second QTL on chromosome 19-2 and a QTL on chromosome 9 were detected for C2.S1 and OH25 but were not significant for 1.S.1.1 (Fig. 2.3; Table 2.3; Table

C.1). Isolate specific QTL on chromosome 15 and 19-3 were detected for C2.S1 and OH25, respectively. The resistant alleles at each QTL were primarily contributed by the resistant parent

Conrad except for QTL on chromosomes 4, 16-1, and 16-2, which were contributed by the susceptible parent Sloan. The CIM LOD values ranged from 2.06 to 5.25, from 2.70 to 7.13, and from 2.06 to 10.01 for C2.S1, 1.S.1.1, and OH25, respectively. The QTL were all minor and

33 individually explained approximately 2 to 13.6% of the PV across each isolate with the highest contributed by the QTL on chromosome 18 of 13.6% for isolate OH25 (Table 2.3).

Figure 2.3. QTL mapped in Conrad x Sloan F9:11 RIL population conferring resistance to Phytophthora sojae isolates C2.S1, 1.S.1.1, and OH25 with a genome wide LOD threshold of 3.2.

Pythium irregulare. Two QTL associated with resistance to Py. irregulare with significant LOD scores were identified through CIM. The first QTL was located on chromosome

14 and was flanked by markers BARC_2.0_Gm14_16152064 and BARC_2.0_Gm14_2131853 and was responsible for 6.6% of the PV. The second QTL on 19-2, flanked by PAMSA markers

Glyma19g41390 (Wm82.a2.v1 name Glyma.19G226100) and Glyma19g41870 (Wm82.a2.v1 name Glyma.19G230600), was responsible for 5.5% of the PV (Fig. 2.4; Table 2.3). Resistance alleles for both QTL were contributed from Sloan.

Figure 2.4. QTL conferring resistance to Pythium irregulare mapped in Conrad x Sloan F9:11 RIL population with a genome wide LOD threshold of 3.2.

Fusarium graminearum. Three QTL conferring resistance to F. graminearum were identified on chromosomes 13 (suggestive), 14, and 19-2 by CIM (Fig. 2.5; Table 2.3). The suggestive QTL on chromosome 13, flanked by markers BARC_2.0_Gm13_16811968 and

BARC_2.0_Gm13_17047053, explained 3.1% of the PV, and alleles conferring resistance were contributed from Conrad (Table 2.3). The QTL on chromosome 14 was flanked by markers

BARC_2.0_Gm14_2405177 and BARC_2.0_Gm14_2762413, and QTL on chromosome 19-2 was flanked by PAMSA markers Glyma19g41390 (Wm82.a2.v1 name Glyma.19G226100) and

Glyma19g41870 (Wm82.a2.v1 name Glyma.19G230600), which explained 4.8 and 8.6% of the

PV, respectively (Table 2.3). These overlap the QTL for Py. irregulare, and the resistance alleles were also contributed by Sloan (Table 2.3; Fig. 2.6).

Figure 2.5. QTL conferring resistance to Fusarium graminearum mapped in Conrad x Sloan F9:11 RIL population with a genome wide LOD threshold of 3.2.

Figure 2.6. QTL on chromosome 19 conferring resistance to Phytophthora sojae, Pythium irregulare, and Fusarium graminearum (genome wide LOD threshold of 3.2). Resistant alleles for P. sojae were contributed from Conrad while resistance for Py. irregulare and F. graminearum was from Sloan.

All QTL detected in the current study can be classified minor QTL because they explained less than 15% of PV (St. Clair 2010). Therefore, it seems more likely that there are several to many genes with small effects involved in these resistances, rather than few genes at a major QTL, as can be the case for other quantitative traits (Young 1996). Additionally, Wang et al. (2012b) reported that several genes between the markers flanking QTL on chromosome 19 had sequences differences and/or expression differences between Conrad and Sloan. As multiple mechanisms are likely to be contributing to quantitative resistance (Poland et al. 2009), genes within the markers flanking QTL were sorted into categories based on Panther, GO, and PFAM information from SoyBase to begin to identify potential candidates and pathways that may be involved in resistance to each pathogen. Here, we report on genes within eight QTL regions at which at least two QTL were co-localized.

GW QTL PV LOD Additive Chra Nearest markerb Left marker Right marker Isolate CIMc Sourcee LOD name %d thrf effecth thrg Phytophthora sojae

BARC_2.0_Gm01 BARC_2.0_Gm BARC_2.0_Gm 1i 1.S.1.1 3.08 4.5 Conrad 1.9 3.2 -0.765514 _50206347 01_50164447 01_50295635 BARC_2.0_Gm0 BARC_2.0_Gm BARC_2.0_Gm 1 OH25 5.86 8.2 Conrad 1.8 3.2 -0.883177 1_50295635 01_50206347 01_50287274 BARC_2.0_Gm0 BARC_2.0_Gm BARC_2.0_Gm 1 C2.S1 5.43 7.6 Conrad 1.8 3.2 -0.964129 1_50654766 01_50572171 01_50797061 BARC_2.0_Gm04 BARC_2.0_Gm BARC_2.0_Gm 4 1.S.1.1 2.91 3.2 Sloan 1.8 3.2 0.763224 _46096228 04_45977762 04_46204517 BARC_2.0_Gm0 BARC_2.0_Gm BARC_2.0_Gm 4 C2.S1 3.28 3.2 Sloan 1.9 3.2 0.653519 39 4_46203344 04_46096228 04_46536196

Continued aChromosome bName of SNP marker (“BARC”_Glyma.Wm82 assembly version_chromosome_physical position), simple sequence repeat, or polymerase chain reaction amplification of multiple specific alleles (PAMSA) marker c LOD value for Composite interval mapping calculated in MapQTL (van Ooijen, 2004) d Phenotypic variation explained by individual QTL as calculated in MapQTL (van Ooijen, 2004) e Source of resistance f Chromosome-wide LOD threshold based on permutation tests of 1000 iterations (Churchill and Doerge, 1994) g Genome-wide LOD threshold based on permutation tests of 1000 iterations hAdditive effects of nearest markers as calculated in MapQTL (van Ooijen, 2004) i Suggestive QTL are italicized. Table 2.3 Quantitative trait loci (QTL) for quantitative resistance to Phytophthora sojae, Pythium irregulare, and Fusarium graminearum identified by composite interval mapping (CIM) using 316 F 9:11 recombinant inbred lines (RILs) of Conrad x Sloan.

Table 2.3. Continued GW QTL PV LOD Additive Chra Nearest markerb Left marker Right marker Isolate CIMc Sourcee LOD name %d thrf effecth thrg BARC_2.0_Gm0 BARC_2.0_Gm 9 C2.S1 4.51 4.5 Conrad 1.7 3.2 -0.8996 9_15487393 09_15487393 BARC_2.0_Gm0 BARC_2.0_Gm 9 OH25 4.99 7.4 Conrad 1.7 3.2 -0.824665 9_15487393 09_15487393 BARC_2.0_Gm15 BARC_2.0_Gm BARC_2.0_Gm 15 C2.S1 2.06 2.0 Conrad 2.0 3.2 -0.514491 _3591774 15_3639988 15_3591774 BARC_2.0_Gm16 BARC_2.0_Gm BARC_2.0_Gm 16 16-1 OH25 2.06 5.1 Sloan 1.8 3.2 0.542714 _759723 16_486741 16_807114

40 BARC_2.0_Gm1 BARC_2.0_Gm BARC_2.0_Gm 16 16-2 1.S.1.1 4.69 5.4 Sloan 2.0 3.2 0.862835 6_3124736 16_3124736 16_3362395 BARC_2.0_Gm1 BARC_2.0_Gm BARC_2.0_Gm 16 16-2 C2.S1 3.49 3.5 Sloan 1.8 3.2 0.745062 6_3271365 16_3124736 16_3362395 BARC_2.0_Gm1 BARC_2.0_Gm BARC_2.0_Gm 18 1.S.1.1 7.13 8.0 Conrad 1.9 3.2 -1.05516 8_56710850 18_56710850 18_56766936 BARC_2.0_Gm1 BARC_2.0_Gm BARC_2.0_Gm 10.0 13. 18 OH25 Conrad 1.9 3.2 -1.13668 8_56710850 18_56710850 18_56876857 1 6 BARC_2.0_Gm1 BARC_2.0_Gm BARC_2.0_Gm 18 C2.S1 5.25 5.3 Conrad 1.9 3.2 -0.857802 8_56876857 18_56710850 18_56766936 BARCSOYSSR_1 BARC_047496_ BARC_2.0_Gm 19 19-1 C2.S1 2.92 4.6 Conrad 2.0 3.2 -0.70458 9_1286 12943 19_46116996 BARCSOYSSR_1 BARCSOYSSR_ BARCSOYSSR_ 19 19-1 1.S.1.1 2.70 3.1 Conrad 2.0 3.2 -0.444551 9_1286 19_1243 19_1286

Continued

Table 2.3. Continued

GW QTL PV LOD Additive Chra Nearest markerb Left marker Right marker Isolate CIMc Sourcee LOD name %d thrf effecth thrg BARC_2.0_Gm1 BARCSOYSSR BARC_2.0_Gm 19 19-1 OH25 3.34 9.1 Conrad 1.8 3.2 -0.825898 9_46116996 _19_1286 19_46116996 Glyma19g41210 Glyma19g4139 (Wm82.a2.v1 0 (Wm82.a2.v1 BARCSOYSSR_ 19 19-2 name name C2.S1 2.86 4.1 Conrad 2.0 3.2 -0.713022 19_1452 Glyma.19G22420 Glyma.19G226 0) 100)

41 Glyma19g41210 Glyma19g4139

(Wm82.a2.v1 0 (Wm82.a2.v1 BARCSOYSSR 19 19-2 name name OH25 4.87 7.8 Conrad 1.8 3.2 -1.34067 _19_1452 Glyma.19G22420 Glyma.19G226 0) 100) BARC-041915- BARC_2.0_Gm BARC-014385- 6.5 19 19-3 OH25 3.03 Conrad 1.8 3.2 -0.710646 08133 19_50305134 01342 5 Pythium irregulare

BARC_2.0_Gm1 BARC_2.0_Gm BARC_2.0_Gm 14 5.17 6.6 Sloan 2.0 3.2 -0.163303 4_2013931 14_1615206 14_2131853 Glyma19g4139 Glyma19g4187 BARC_2.0_Gm1 0 (Wm82.a2.v1 0 (Wm82.a2.v1 19-2 name name 4.22 5.5 Sloan 2.0 3.2 -0.149914 9_47784141 Glyma.19G226 Glyma.19G230 100) 600) Continued

Table 2.3. Continued

GW QTL PV LOD Additive Chra Nearest markerb Left marker Right marker Isolate CIMc Sourcee LOD name %d thrf effecth thrg Fusarium graminearum BARC_2.0_Gm13 BARC_2.0_Gm BARC_2.0_Gm 13 2.46 3.1 Conrad 1.7 3.2 -1.90569 _16926707 13_16811968 13_17047053 BARC_2.0_Gm1 BARC_2.0_Gm BARC_2.0_Gm 14 3.86 4.8 Sloan 2.0 3.2 2.35321 4_2523881 14_2405177 14_2762413 Glyma19g4139 Glyma19g4187 0 (Wm82.a2.v1 0 (Wm82.a2.v1 BARC_2.0_Gm1 19-2 name name 6.13 8.6 Sloan 2.0 3.2 2.71471 9_47784141

42 Glyma.19G226 Glyma.19G230

100) 600)

For P. sojae, many of the genes (91 genes) within the eight QTL regions have unknown functions. Of those with known annotations, 44 and 26 genes were involved in metabolism and signal transduction, respectively (Table 2.4). Interestingly, no genes encoding PR proteins were within the QTL of this particular study and only 11 were annotated as playing a role in stress response.

On chromosome 1, 53 genes were associated with the QTL, including genes predicted to encode two leucine-rich repeats, an E2 ubiquitin conjugating enzyme, a thioredoxin, and several transcription factors. Forty -nine genes were associated with the QTL on chromosome 4, including an ubiquitin-like protease. There were 28 genes associated with the QTL on chromosome 16, which included genes predicted to encode a leucine-rich repeat containing,

Rps4 related protein. The QTL on chromosome 18 was associated with 21 genes, including an

NB-ARC-encoding gene, an oxidoreductase-encoding gene, and several unknown genes (Table

F.1). The QTL 19-1 was associated with 156 genes and 19-2 was associated with 32 genes

(Table 2.4). In previous studies, QTL 19-1 was more narrowly delimited and found to be associated with 53 genes, while QTL 19-2 was broader and associated with 175 genes (Wang et al. 2012b).

The genes between the flanking markers of 19-1 include genes predicted to encode an alcohol dehydrogenase, myosin, a GDSL-like lipase, a 26S protease subunit, a heat shock protein, a

WKRY transcription factor, MYB-like transcription factors, several leucine-rich repeat proteins, as well as a Mlo family gene. The QTL 19-2 associated-genes included genes encoding bHLH and MYB transcription factors, a nitrate transporter, a two-component sensor histidine kinase, and a pectinesterase (Table F.1).

Genes associated Genes associated Total No. of genes per QTL with resistance to with resistance to Function† No. of Hemibiotroph Necrotrophs genes 1 4 14 14 16 18 19-1 19-2 H H N-F N-Py H H H H N Signal 39 4 1 4 8 3 3 12 3 1 26 13 transduction Metabolism 65 6 7 3 9 7 4 15 5 9 44 21 Protein 27 3 5 3 4 1 0 4 1 6 14 13 modification Transcription 30 3 3 1 3 3 1 9 3 4 22 8 factor Transporter 21 1 1 1 3 1 0 8 2 4 13 8 Cell wall 6 0 1 0 0 0 0 1 3 1 5 1 RNA regulation 22 2 2 2 3 0 2 9 1 1 16 6 Energy 10 0 1 0 0 3 0 4 1 1 9 1 44 Stress response 14 1 0 1 5 1 4 5 0 1 11 7 Cytoskeleton 4 1 0 0 0 0 0 2 0 1 3 1 Oxidation 15 7 1 0 1 1 0 3 0 2 12 3 DNA 31 3 6 3 5 1 1 10 1 1 22 9 modification Vesical 9 0 1 2 1 0 0 3 0 2 4 5 trafficking Other 62 8 11 5 4 4 1 22 1 6 47 15 Unknown 128 14 9 12 19 3 5 49 11 6 91 37 †Putative gene function based off of Panther, GO, and PFAM information from SoyBase

Table 2.4. Number of genes in each functional category within each QTL and associated with quantitative resistance to Phytophthora sojae, a hemibiotroph (H), or Pythium irregulare (Py) and Fusarium graminearum (F), which are necrotrophs (N). Only genes within significant and overlapping QTL are shown.

For Py. irregulare, there were 65 genes associated with the QTL on chromosome 14, including genes predicted to encode TIR domain containing leucine-rich repeat proteins, heat shock proteins, a WRKY transcription factor, and a sucrose synthase. On chromosome 19, there were 46 genes within the flanking markers of the QTL, including genes predicted to encode a clathrin coat assembly protein, a thioredoxin, and a stress response protein (Table G.1).

For the F. graminearum QTL, on chromosome 14, 37 genes were associated with the QTL, including genes predicted to encode a heat shock transcription factor, a leucine-rich repeat receptor-like kinase, a serine/threonine kinase, and several chromatin remodeling genes (Table

G.1). On chromosome 13a there were 23 genes within the flanking markers of the QTL. These included genes predicted to encode a serine/threonine kinase, lipases, a cytochrome P450, and a peroxidase. The resistance QTL on chromosome 19 was associated with the same 46 genes as described above for Py. irregulare (Table 2.4; Table G.1).

Discussion

Host resistance is a key component of managing soil-borne seed, seedling, and root pathogens on many field crops, particularly soybean. Quantitative resistance is also effective against pathotypes (races) of biotrophic pathogens (Kou and Wang 2010; Hulbert and Pumphrey

2014; Parlevliet and Zadoks 1977; Poland et al. 2009; St. Clair 2010; Umaerus 1970).

Additionally, it is often the only source of resistance for necrotrophic pathogens such as Py. irregulare and F. graminearum (Glazebrook 2005; Kou and Wang 2010; Kou and Wang 2012).

Prior to cloning genes from resistant genotypes associated with quantitative disease resistance in plants, characterizing the type of resistance, identifying and mapping the loci, and narrowing the

locus requires a population that is both advanced in generation and large in size to capture the greatest number of recombination events (St. Clair 2010; Xu et al. 2013). There have been several advancements in this arena where genes associated with quantitative resistance have been cloned and identified. In wheat, two genes for “slow rusting” in cereals were cloned, Yr36 and

Lr34, which encode a kinase START lipid binding domain (Fu et al. 2009) and an ATP-binding cassette (ABC) transporter (Krattinger et al. 2009). Interestingly, Lr34 also contributes resistance to leaf rust, stripe rust, and powdery mildew as well as leaf-tip necrosis.

Kou and Wang (2012) reviewed the mechanisms associated with characterized genes that contribute to QTL for disease resistance in rice and broke them into categories. The first and the largest number of characterized genes are those that were classified as defense responsive gene class that lead to the expression of R gene mediated or basal resistance such as WRKY transcription factors and other defense responsive genes. One example was GH3-2, which codes for an identical protein but the promoter region is different between resistant and susceptible genotypes. Following inoculation, this gene is activated in the resistant genotypes earlier than in the susceptible genotypes (Fu et al. 2011). The second category was types of NBS-LRR protein, such as Pb1, which contributes to a major QTL for Magnaporthe oryzae but has an atypical NBS domain. The third were “undetermined type of genes” such as pi21 for resistance towards

Magnaporthe oryzae first reported by Fukuoka et al. (2009) which encodes a metal transport/detoxification protein and different alleles of this gene are found in resistant and susceptible genotypes. Finally there are QTL with multiple physically clustered genes as well as co-localized QTL that confer resistance towards different pathogens (Kou and Wang 2012).

In a study more closely related to the present work, Cook et al. (2012) characterized a QTL for SCN, rhg1-b; which contains genes for an amino acid transporter, an α-SNAP protein, and a

wound inducible protein. Interestingly, in susceptible cultivars, there was only 1 copy of each of these genes, but in resistant lines there were 10 tandem copies. Overexpression of each gene individually in a susceptible background did not improve the resistance levels, only the simultaneous overexpression of all of the genes increased the expression of resistance to soybean cyst nematode.

Previously we had mapped earlier generations of this Conrad x Sloan population for resistance to P. sojae isolates 1.S.1.1, C2.S1, and OH25 (Wang et al. 2010, 2012a, 2012b) and F. graminearum (Ellis et al. 2012). This is our first report of resistance to Py. irregulare for this population. Additionally, it was expected that the QTL would map to narrower regions of the chromosome due to the larger mapping population as these tend to give better estimates of QTL location and genetic variance (Utz et al. 2000; Vales et al. 2005). In this study 316 lines were used, compared to previous studies in which 186 lines (Wang et al. 2010) and 246 lines (Wang et al. 2012b) for P. sojae resistance, and 262 lines were used to map for F. graminearum resistance

(Ellis et al. 2012). The development of the SoySNP6K BeadChip (Song et al. 2013) also allowed for the generation of a denser genetic map albeit there were still large gaps (Fig. 2.5) in this map due to the large number of monomorphic markers and potential identity by descent between Conrad and Sloan (Fehr et al. 1980; Bahrenfus and Fehr 1980).

P. sojae: In a previous study by Wang et al. (2012b), five resistance QTL were contributed by Conrad, two on chromosome 19, two on chromosome 18, and one on chromosome 1. A QTL was confirmed on chromosome 1 in this study with both isolates, though it was flanked by markers which mapped 1.2 Mb below the previous markers. This QTL is also near other QTL conferring resistance to P. sojae from populations derived from six plant introductions (Lee et al.

2013a, 2013b, 2014). A QTL conferring resistance to soybean cyst nematode (SCN; Heterodera

glycines Riggs and Niblack) was also reported in this region (Wu et al. 2009). In the current study, only one QTL on chromosome 18 was confirmed. In the earlier study in the F4:6 population, this QTL was not detected with CIM but was detected with IM (Wang et al. 2012a).

Other QTL in the region include resistance to P. sojae (Lee et al. 2013a, 2013b, 2014), SCN

(Kabelka et al. 2005), southern root-knot nematode (Meloidogyne incognita (Kofoid and White)

Chitwood; Tamulonis et al. 1997), and iron efficiency (Lin et al. 1997). Both QTL on chromosome 19 were confirmed with C2.S1 and OH25, but with 1.S.1.1, only one was detected.

The second QTL on chromosome 19 may be environmentally sensitive or otherwise unstable, as Wang et al. (2012a) reported that this QTL was detected for 1.S.1.1 and OH25 but not for C2.S1. In the present study, QTL 19-1 was flanked by markers which mapped below the previous markers on the chromosome for 1.S.1.1 and OH25 and was broader than expected for

C2.S1 based on previous studies (Table D.1; Wang et al. 2012a, 2012b). The QTL 19-2 was narrower in this study compared to the F6:8 generation, though as noted above it was detected with different isolates (Wang et al. 2012b). Additionally, a third, potentially novel QTL on chromosome 19 was detected with OH25. It is important to note however, that QTL on the same chromosome can be difficult to resolve (Young 1996) and may account for the varied QTL localization on chromosome 19 for the three isolates in this study compared to previous studies.

We observe a similar phenomenon on chromosome 16 for OH25, where the QTL mapped to a region approximately 2.6 Mb higher than the QTL 16-2 for C2.S1 and 1.S.1.1. QTL 16-2 was about 30 Mb away from a QTL for resistance to P. sojae from PI 427105B (Lee et al. 2014). A novel QTL on chromosome 4, with the resistant allele contributed from Sloan, was detected in this study that was not reported in previous generations but was reported from PI 398841 (Lee et al. 2013b). A QTL conferring resistance to Fusarium virguliforme is also in this region

(Abdelmajid et al. 2012). An additional, novel suggestive QTL on chromosome 15 was detected with the isolate C2.S1 but not with the isolates 1.S.1.1 or OH25. Isolate specific QTL have been previously observed (Lee et al. 2014; Wang et al. 2012a) and could indicate a minor-gene-for- minor-gene interaction is involved in some of the resistance conferred by Conrad. However, in at least one instance (chromosome 19-2), our further study showed that a QTL identified as isolate specific in an earlier study was more likely environmental influenced or unstable. Isolate specific resistance QTL have been detected for other diseases including Puccina hordei on barley

(Gonzalez et al. 2012; Qi et al. 1999), and Puccina triticina on wheat (Azzimonti et al. 2014).

However, this study would need to be repeated and tested with several other isolates of P. sojae to confirm that the QTL are stable and isolate-specific.

Py. irregulare: This is our first report of resistance to Py. irregulare in this population.

While Conrad was previously identified as a possible source of resistance to Py. irregulare (Ellis et al. 2013); in this study the two QTL conferring resistance came from the second parent, Sloan.

One of the QTL directly overlapped (QTL 19-2) or was near (273 kb) the QTL on chromosome

14 for F. graminearum. The QTL on chromosome 14 is approximately 12 kb away from a previously reported QTL conferring resistance to Py. irregulare in a (Williams x PI424354) x

OH303 population (Ellis et al. 2013).

F. graminearum: In a previous study by Ellis et al. (2012), four QTL for resistance towards F. graminearum on chromosomes 8, 13, 15 and 16 had resistance alleles contributed by

Conrad, and one QTL on chromosome 19 had the resistant allele contributed from Sloan. In the present study, a QTL on chromosome 19 with resistance contributed from Sloan mapped to approximately the same region (about 26 kb below) as reported in the previous study by Ellis et al. (2012). The QTL on chromosome 13 was about 3.3 Mb away from a QTL previously

reported on the same chromosome (Ellis et al. 2012). While the same assay methods and same isolates were used, the differences in the QTL locations in this study compared to the study by

Ellis et al. (2012) may be due to the use of a more advanced population with higher number of

RILs and denser genetic map. QTL were not detected on chromosomes 8, 15, and 16 in this study compared to the earlier study by Ellis et al. (2012; Table E.1). A novel QTL with resistance contributed from Sloan was detected on chromosome 14, this QTL was not detected in the previous study by Ellis et al. (2012). Interestingly, the QTL on chromosome 13 conferring resistance to F. graminearum also overlapped with QTL conferring resistance to the necrotroph

Sclerotinia sclerotiorum (Lib.) de Bary (Guo et al. 2008) and F. virguliforme as previously reported (Kassem et al. 2006).

Most QTL were unique to each pathogen. However, QTL 19-2 had resistant alleles contributed from Conrad for P. sojae and was immediately adjacent to a QTL from Py. irregulare and F. graminearum with resistant alleles contributed from Sloan. One QTL on chromosome 14 for resistance to Py. irregulare was adjacent a QTL for resistance to F. graminearum (Table 2.3). In addition, little to no correlation in the RILs was found for resistance to P. sojae and resistance to either Py. irregulare or F. graminearum (Table 2.2). This indicates that different mechanisms contribute to the defense against P. sojae compared to Py. irregulare, and F. graminearum. This is expected as P. sojae is a host-specific hemibiotroph, while Py. irregulare and F. graminearum have broader host ranges and more of a necrotrophic lifestyle.

Additionally, comparative genomics between P. sojae and Pythium spp. indicates that the effectors released by the two pathogens differ, as Py. irregulare contains no predicted RxLR effectors unlike P. sojae (Adhikari et al. 2013; De Coninck et al. 2015; Jiang et al. 2008; Tyler et al. 2006).

Biotrophic and necrotrophic pathogens differ in the types of effectors that are released during infection, as biotrophs rely on maintaining living host cells while necrotrophs actively kill host cells (Glazebrook 2005; McDowell 2013; Oliver and Ipcho 2004). Hemibiotrophic pathogens are characterized by an initial biotrophic phase during the early stages of infection, followed by a necrotrophic phase. This shift in lifestyle is likely accompanied by changes in the pathogen’s transcriptome (McDowell 2013). Therefore, a more rapid response during the biotrophic phase of infection could improve host resistance to hemibiotrophs. A faster, stronger response to the pathogen is one hypothesis to explain mechanisms underlying quantitative resistance (Poland et al. 2009). While the initial host response to any of these types of pathogens appears to be similar, defenses are likely fine-tuned based on the attacking pathogen and the portion of the root under attack (De Coninck et al. 2015; Glazebrook 2005; Mengiste 2012).

Defense responses to Py. irregulare and F. graminearum may have common mechanisms, as two QTL conferring resistance were either overlapping (QTL 19-2) or near each other, as on chromosome 14, with resistance contributed from the same parent at both QTL for both pathogens (Table 2.3). Overall trends differed for genes associated with QTL for the hemibiotrophic versus necrotrophic pathogens in the gene ontology categories of protein modification, vesicle trafficking, transporters, signal transduction and metabolism (Table 2.4).

Different types of candidate genes were found associated with QTL against P. sojae compared to those associated with QTL controlling resistance to Py. irregulare and F. graminearum (Tables

F.1 and G.1). For example, Mlo family genes were found within QTL 1 and QTL 19-1 conferring resistance to P. sojae. The recessive mlo allele confers resistance to powdery mildew in barley (Hordeum vulgare L.), Arabidopsis, tomato (Solanum lycopersicum L.) and pea (Pisum sativum L.; Bai et al. 2008; Humphry et al. 2006, 2011; Jørgensen 1977). This same allele in

barley is also associated with susceptibility to other fungal pathogens such as Ramularia collo- cygni (B. Sutton and J.M. Waller; McGrann et al. 2014). However, none of these genes were found within QTL conferring resistance to Py. irregulare or F. graminearum.

Numerous genes which have been previously shown to contribute to the defense response in other host pathogen systems were between the flanking markers of the QTL. Several genes containing domains known to occur in R-genes (Bent 1996) were found under QTL conferring resistance to P. sojae, Py. irregulare, and F. graminearum. These included leucine-rich repeat encoding proteins, an NB-ARC containing genes, and genes encoding serine/threonine kinases.

Defeated R-genes has been one of the many hypotheses for potential mechanisms of quantitative resistance (Poland et al. 2009).

Several transcription factors were between the markers flanking the QTL for Py. irregulare and F. graminearum compared to P. sojae. Many of these belonged to families that have previously been implicated in defense, such as WRKY transcription factors (Yin et al. 2013), which have previously been shown to be involved in the salicylic acid defense pathway and in salicylic acid-jasmonic acid cross talk both in Arabidopsis and in soybean (Euglem and

Somssich 2007; Liu et al. 2011). MYB transcription factors have also been shown to play a role in defense against the soybean rust pathogen, Phakopsora pachyrhizi Syd. and P. Syd (Aoyagi et al. 2014). Two putative heat shock transcription factors were identified between the markers for the QTL on chromosome 14 conferring resistance to Py. irregulare and one was found between the markers for the QTL conferring resistance to F. graminearum on the same chromosome.

Heat shock proteins are involved in response to both abiotic and biotic stress, including heat, cold, oxidative stress, and infection by bacteria, fungi, and nematodes (Lopes-Caitar et al. 2013).

There were also several genes involved in oxidation or host redox homeostasis within the flanking regions of QTL (Tables F.1 and G.1). Oxidation and reduction are known to change the structure and function of proteins within the host cell (Chi et al. 2013). Additionally, reactive oxygen species are known to act both upstream and downstream of salicylic acid signaling pathways (Herrera-Vásquez et al. 2015). Therefore, changes in the redox state of the cell can directly affect the defense signaling and response. However, further studies that measure the redox state or characterize the genes that are potentially involved are needed to confirm their role in quantitative resistance.

Overall, the wide variety of putative gene functions associated with the resistant QTL to each of the three pathogens identified in this study suggests that there may be a variety of mechanisms that contribute to quantitative resistance, which is in agreement with previous hypotheses (Poland et al. 2009) as well as our earlier reports (Wang et al. 2012b). There are numerous pathways and candidate genes for further analysis to explore what appear to be multifaceted and potentially differentiated defense responses to these pathogens.

Chapter 3: The role of auxin in quantitative disease susceptibility in soybean towards Phytophthora sojae

Phytophthora sojae, media, and the first soybean root metabolite extractions were performed by Ella Lin and Yun Lin at the OARDC Metabolite Analysis Cluster. A.K. Stasko and Joshua Blakeslee performed the second soybean root metabolite extraction. Bryan Cassone assembled the Conrad and Sloan gene sequences, which were then provided to A. K. Stasko for further analysis. A. K. Stasko performed all other work presented here.

Abstract

The phytohormone auxin (indole-3-acetic acid, IAA) has been implicated in susceptibility of Arabidopsis to numerous plant pathogens. Previous studies have shown that auxin-related genes are differentially expressed between the moderately resistant soybean cultivar Conrad and the moderately susceptible cultivar Sloan during infection with

Phytophthora sojae. In the current work, the role of auxin in susceptibility of soybean towards P. sojae was investigated using metabolomic, molecular, and physiological approaches. Levels of auxinic metabolites were measured in mycelia and media used to growth P. sojae as well as in inoculated soybean roots. The auxin efflux GmPIN genes were examined for sequence and expression differences between the two cultivars. Finally, an auxin transport inhibitor and a synthetic auxin were applied to soybean plants before inoculation with P. sojae to measure their effect on disease. Overall, auxin precursors were identified in the mycelia of P. sojae. More interestingly, IAA and related metabolites were significantly higher in inoculated roots of both

Conrad and Sloan at 48 hai compared to mock indicating that this hormone could be playing a

role in the infection process. However, further experiments are needed to refine the role of this hormone.

Introduction

Seilaniantz et al. 2011). An early example of this effect of enhancing susceptibility was observed with the fungal pathogen Gibberella fujikuroi, which releases gibberellin to promote its own colonization and establishment in rice (reviewed in Hedden and Sponsel 2015). The phytohormone auxin is best known for its role in plant development. Several recent studies suggest that it may also play a role in susceptibility of rice to fungi (Domingo et al. 2009) and of

Arabidopsis thaliana to various pathogens including bacteria (Navarro et al. 2006), nematodes

(Kyndt et al. 2016), fungi (Kidd et al. 2011), and the oomycete Phytophthora parasitica

(Evangelisti et al. 2013).

In addition to having resistance (R)-genes and other defense-related genes that contribute to resistance, plants can also have genes that pathogens use to promote disease. These so-called susceptibility genes or susceptibility factors can contribute to disease by enabling pathogen penetration, negatively regulating plant immunity, or contributing to pathogen metabolism and reproduction (Hückelhoven et al. 2013; Lapin and Van den Ackervenken 2013; van Schie and

Takken 2014). If these factors can be identified, it might be possible to select against them as an alternative approach to breeding for resistance (Pavan et al. 2010; van Schie and Takken 2014).

Perhaps the most well-known example of this approach is the MLO gene. In barley, the dominant allele allows penetration by the powdery mildew pathogen, Blumeria graminis f. sp. hordei

(Consonni et al. 2006; Humphry et al. 2006). The recessive, non-functional allele, mlo, has been widely effective against numerous isolates for about forty years (Jørgensen 1977; 1992). The recessive allele was also shown to be effective against powdery mildews in Arabidopsis thaliana, pea, and tomato (Bai et al. 2008; Consonni et al. 2006; Humphry et al. 2011). Other well-known examples of susceptibility factors include eukaryotic initiation factor 4E, which binds to the VPg of potyviral RNA in several plant species (reviewed in Wang and Krishnaswamy 2012), and the rice sugar transporter OsSWEET11, which is activated by a transcription activator-like (TAL) effector of Xanthomonas oryzae pv. oryzae (Chen et al. 2010; Römer et al. 2010).

Quantitative resistance, also called partial resistance, horizontal resistance, or field resistance, is conferred by quantitative disease resistance loci (QDRL). Unlike R-gene mediated resistance, which usually results in a hypersensitive response preventing colonization of the pathogen, quantitative resistance slows pathogen development, limits the overall colonization, and is generally thought to not be race-specific (Parlevliet 1979; Poland et al. 2009; St. Clair

2010; Tian et al. 2006). The molecular mechanisms behind quantitative resistance are poorly understood. This is especially true in systems such as the soybean-Phytophthora sojae system, where several minor QDRL contribute to the overall phenotype (Stasko et al. 2016; Wang et al.

2010, 2012b). In these cases, it is not clear which genes underlying the QDRL actually contribute to the trait. While this complexity makes it more difficult for the pathogen population to adapt

(Grau et al. 2004; Poland et al. 2009; Wang et al. 2010; 2012b), it also makes broad QDRL, such as two mapped to soybean chromosome 19 (Stasko et al. 2016; Wang et al. 2012b), difficult to use in breeding, as genes contributing to undesired traits could also be present in these regions

(St. Clair 2010). Therefore, a better understanding of the molecular mechanisms of quantitative resistance can not only improve the overall understanding of the disease process, but also provide needed information about which genes should be the targets of breeding efforts (St. Clair

2010).

Over seventy genes associated with the QDRL 19-1 and 19-2 were differentially expressed in the moderately resistant cultivar Conrad versus moderately susceptible cultivar

Sloan following inoculation with P. sojae (Wang et al. 2010; 2012b). These included

Glyma.19g128800, an AtPIN1 homolog, Glyma.19g161000, an auxin-induced gene, and

Glyma.19g221900, an auxin-responsive transcription factor (Wang et al. 2010; 2012b).

Additionally, there were eight auxin-related genes underlying these QDRL identified in a more recent map developed with a higher density of genotypic markers (Stasko et al. 2016).

Many of auxin’s effects rely on its concentration gradients, which are generated by metabolism (including biosynthesis, and catabolism via conjugation and oxidation) and intracellular and intercellular transport (Domingo et al. 2008; Korasick et al. 2013; Staswick et al. 2005; Woodward and Bartel 2005; Zhang et al. 2016). Indole-3-acetic acid (IAA), the primary auxin in Arabidopsis, is synthesized by several tryptophan-dependent and tryptophan- independent pathways (Korasick et al. 2013; Soeno et al. 2010; Spaepen et al. 2007). To reduce the amount of active IAA in the cell, plants rely on catabolism, which occurs by oxidation or by conjugation to sugars, amino acids, or proteins. Oxidation of auxin is also not reversible and serves as the primary route of auxin catabolism (Korasick et al. 2013; Ludwig-Müller 2011;

Woodward and Bartel 2005; Zhang et al. 2016). Conjugation can be reversible or irreversible, depending on the specific group added. In the case of amino acids, some, such as leucine and alanine, can be removed, converting the conjugate (indole-3-acetyl leucine or indole-3-acetyl

alanine) back to free IAA, as these conjugates are most often used for storage (Korasick et al.

2013; Ludwig-Müller 2011; Woodward and Bartel 2005; Zhang et al. 2016). However, conjugation to other amino acids, such as aspartate and glutamate, which produces indole-3- acetyl-aspartic acid (IAAsp) and indole-3-acetyl-glutamic acid (IAGlu), is not reversible and reduces the amount of active IAA in a plant cell (Korasick et al. 2013; Ludwig-Müller 2011;

Woodward and Bartel 2005; Zhang et al. 2016).

Auxin transport in Arabidopsis is mediated by three major groups of proteins, AUXIN

RESISTANT 1/LIKE AUX 1 (AUX1/LAX1), ATP-binding cassette subfamily B (ABCB), and

PIN-FORMED (PIN) proteins. The AUX1/LAX1 proteins transport auxin into plant cells (Peer et al. 2011). The ABCB proteins primarily contribute to auxin efflux out of cell (Kubeš et al.

2012; Noh et al. 2001). Members of the PIN-FORMED family are divided into two groups based on protein length. The long family members range from 612 to 640 amino acids long (Gälweiler et al. 1998; Schwacke et al. 2003) and include AtPIN1, AtPIN2, AtPIN3, AtPIN4, and AtPIN7.

They are responsible for auxin efflux out of cells, with each one active in a different plant tissue.

In roots, AtPIN1 mediates transport from the shoot to the roots, and AtPIN2 transports auxin from the root apex to the shoot (Gälweiler et al. 1998; Luschnig et al. 1998; Müller et al. 1998;

Peer et al. 2011; Utsuno et al. 1998). AtPIN3 and AtPIN4 are responsible for transport out of the root meristem (Friml et al. 2002a, 2002b). The short PIN proteins, AtPIN5, AtPIN6, and

AtPIN8, range from 351-570 amino acids long (Schwacke et al. 2003). They are located in the endomembrane system rather than the plasma membrane and are thought to mediate intracellular compartmentalization of IAA (Geisler and Murphy 2006; Mravec et al. 2009; Peer et al. 2011;

Wang et al. 2015). For example, AtPIN5 is located in the endoplasmic reticulum (Mravec et al.

2009).

Several studies have characterized the AUX/LAX, ABCB, and/or PIN gene families in other plant species, including watermelon (Citrullus lanatus), sorghum (Sorghum bicolor), rice

(Oryza sativa), maize (Zea maize), and Medicago truncatula (Paponov et al. 2005; Schnabel and

Frugoli 2004; Shen et al. 2010; Wang et al. 2009; Yu et al. 2017; Yue et al. 2015). The number of AUX/LAX genes present in each species ranged from 5-7, the number of ABCB genes ranged from 15-35, and the number of PIN genes ranged from 10-15. Many of these genes were differentially expressed after treatment with IAA or other hormones (Shen et al. 2010; Yu et al.

2017; Yue et al. 2015). Some of these homologs in sorghum, watermelon, and maize were also differentially expressed during abiotic stress such as high salinity, drought, and/or cold stress

(Shen et al. 2010; Yu et al. 2017; Yue et al. 2015). In M. truncatula, the PIN genes have been implicated in the formation of nodules (Huo et al. 2006).

Recently, Wang et al. (2015) profiled the soybean homologs of the AtPIN gene family, including Glyma.19g128800. They found that soybean has twice as many PIN genes as

Arabidopsis and M. truncatula, likely due to genome duplication. Like Arabidopsis, the GmPIN genes are predicted to encode proteins of long (578-666 aa long) and short lengths (353-377 aa long). Unlike Arabidopsis, some GmPIN proteins are predicted to have an intermediate protein length (443-531 aa long). They also demonstrated that fifteen, eight, and seven were differentially regulated during drought stress, during salinity stress, and during dehydration, respectively. Additionally, eighteen and seventeen were responsive to abscisic acid (ABA) or

IAA treatment, respectively (Wang et al. 2015).

Given the number and type of auxin-related genes underlying the QTL on chromosome

19 and the hormone’s role in other pathosystems, we hypothesized that auxin may be involved in susceptibility to P. sojae in soybean. Further, Conrad is able to avoid or adapt to changes in

auxin processes induced by the pathogen, which contributes to its quantitative resistant phenotype. To examine this relationship, we detected auxin-related metabolites in both pathogen and plant tissues and characterized several root-associated GmPIN genes during infection. Thus our approach was to first look for the presence of IAA or its precursors in mycelia and culture media of P. sojae. Secondly, inoculated and mock inoculated roots of resistant and susceptible genotypes were examined for differences in: (i) auxinic metabolites, (ii) expression of root- associated GmPIN auxin transport genes, and (iii) disease development following application of an auxin transport inhibitor or a synthetic auxin.

Materials and Methods

Phytophthora sojae material and tissue collection for auxin metabolite analysis

The P. sojae isolates OH1, OH4, OH7, OH25, and OH12168-05-01 were analyzed for auxinic metabolites in two separate experiments. In the first experiment, five approximately 5 x 5 mm colonized agar plugs of each isolate were placed in separate flasks containing 50 ml of a synthetic medium (sucrose, asparagine, KH2PO4, K2HPO4, cholesterol, ascorbic acid, thiamine

HCl, ZnSO4 ● 7H2O, FeSO4 ● 7H2O, MnCl2 ● 4H2O; Hoitink and Schmitthenner, 1969; Qutob et al. 2000). Four flasks were prepared for each isolate and were kept in the dark at room temperature (approximately 24-26 oC) for one week. Mycelia and media were transferred to a

Büchner funnel with a 11.0 cm diameter Whatman #5 nitrocellulose disc filter placed in the bottom, and the liquid medium was separated from the mycelia using vacuum filtration. The four flasks for each isolate were pooled into a single sample, to ensure that enough mycelia were available for auxinic metabolite extraction. The agar plugs were removed, and the mycelia were transferred to a 2 ml microcentrifuge tube. The tube was wrapped in aluminum foil, immediately

frozen in liquid nitrogen, and stored at -80 оC until metabolite analyses. Ten ml of the filtered minimal medium used to grow each isolate were also collected in separate 50 ml conical centrifuge tube. These tubes were wrapped in foil and immediately stored at -80оC. In the second experiment, the same isolates were grown in 25 ml of synthetic medium, to increase aeration of the cultures. Once again, four flasks were prepared for each isolate. Samples were once again pooled by isolate and collected as described above including 10 ml of medium without any P. sojae growth, which served as a negative control.

Plant material and tissue collection for auxin metabolite analysis

Seeds of the moderately resistant cultivar Conrad and the moderately susceptible cultivar

Sloan were sterilized with chlorine gas as previously described (Govindarajulu et al. 2008;

2009). Briefly, Petri plates with a single layer of seed were placed in a vacuum desiccator in a fume hood with a 250 ml beaker containing 100 ml of sodium hypochlorate. One ml of reagent grade hydrochloric acid (HCl) was added to the beaker. A vacuum was applied to the desiccator for about 5 min, after which the vacuum was stopped and the beaker was stored overnight.

Soybean plants of both cultivars were inoculated by means of a modified tray test (Burnham et al. 2003; Lee et al. 2013a, 2013b 2014; Tucker et al. 2010; Wang et al. 2010, 2012a, 2012b) in two separate experiments. Briefly, fifteen-to-twenty seeds of Conrad and Sloan were planted in fine vermiculite (Perlite Vermiculite Packing Industries, Inc., North Bloomfield, OH) in 0.5 liter polystyrene cups. After 7 days, plants were removed from the cups, and the roots were gently washed in tap water. Eight-to-ten plants were then placed on a polyester cloth on top of a cotton wicking pad on a plastic tray. Each tray represented one replication, and there were three replications per cultivar, treatment, and time point.

Preparation of zoospore inoculum of P. sojae was modified from Qutob et al. (2000) and

Mideros et al. (2007). To inoculate each tray of soybean seedlings, the first sterile paper towel strip (0.5-1.0 cm wide and 25.5 cm long) was placed under the roots, 4 cm from the crown region. A 100 μl of aliquot of the zoospore suspension, 0.5 x 104 to 0.9 x 104 zoospores/ml, was pipetted onto the strip to the immediate right of the main tap root of each plant. The second sterile paper towel strip was placed over the roots at the same location, and an additional 100 μl of zoospores was pipetted onto the strip directly over the main tap root for a total of approximately 1,000-1,800 zoospores per plant. This was done to ensure that the root was inoculated from both sides and to reduce tissue dilution effects. For the mock inoculated plants,

100 μl of sterile, distilled water (pH 6.9-7.1) was used on each strip in place of the zoospore suspension. Trays were stacked by time point to minimize the manipulation of the plants.

One cm root sections were harvested from each plant between the paper towel strips at the inoculation site at 0, 12, 24, and 48 hours after inoculation (hai) and from the upper edge of the lesion margin at 72 hai in the first experiment. In the second experiment, trays were drained for about 1 h prior to tissue collection to remove excess water. Tissue was collected from the same locations as the first experiment, but the 12 hai time point was dropped. In both experiments, lateral roots were removed from each section. Sections from seven-to-ten plants per tray were pooled into one sample, excluding plants that had extensive black coloration on the tap root, if possible. Three replicates were collected at each time point for each treatment for a total of twenty-four to thirty plants per cultivar. Plant samples were frozen and stored as indicated above for the mycelial samples.

Three additional trays of each cultivar were inoculated and three were mock inoculated and kept until 7 days after inoculation (dai), at which point the lesion length was measured from

the top of the inoculation site to the upper edge of the lesion margin. This was done to ensure that the inoculation was successful and that there was a significant difference between the two cultivars. Individual plants with a lesion length of 0 mm were treated as missing data to account for infection efficiency. The lesion lengths were then analyzed by ANOVA using PROC GLM in

SAS v9.4 (SAS Institute Inc., Cary, NC). The lesion lengths of individual plants were included in the SAS model due to the level of specificity needed in these assays.

Auxin metabolite extraction and quantification

Auxin metabolites were extracted and purified using a protocol modified from Novák et al. (2012) and Blakeslee and Murphy (2016). Mycelia in both P. sojae experiments or roots in the first inoculated soybean experiment were finely ground with plastic pestles in 1.5 to 2.0 ml microcentrifuge tubes. The tubes were kept in liquid nitrogen during the grinding process to prevent the tissue from thawing. Ground tissue was suspended in 1 ml of 50 mM sodium phosphate buffer (pH 7.0, 1% diethyldithiocarbamate, DETC). The internal standards listed in

Table 3.1 were then added to each tube. Roots were weighed in a 2 ml microcentrifuge tube.

Due to the fibrous nature of the roots and to increase homogeneity of sample grinding and assay throughput, the plant material in second inoculated soybean experiment were homogenized using a Mixer Mill 301(Retsch, Hann, Germany) and metal beads. In these assays, the root tissue was first broken into approximately 2-4 mm pieces in liquid nitrogen using a mortar and pestle. Root fragments were then transferred to a 2 ml microcentrifuge tube containing two 4 mm diameter metal beads. Microcentrifuge tubes were placed in a pre-chilled aluminum block in a liquid nitrogen bath. To homogenize tissues, aluminum blocks were loaded

into the Mixer Mill and shaken at 20 Hz, 4οC for 2 min. This process was repeated, after which 1 ml of sample buffer and internal standards (Table 3.1) were added to each sample.

Compound Amount (ng) Source OlchemIm Ltd, Olomouc, [2H ] indole-3 acetic acid (d5-IAA) 12.5 5 Czech Republic [2H ] Indole-3-[15N] acetamide (DN- 5 6.25 IAM) 2 [ H4] indole-3-acetonitrile (d4-IAN) 7.5 [2H ] indole-3-acetyl-L-[15N] alanine 5 3.75 (DN-IAAla ) [2H ] indole-3-acetyl-L-[15N] 5 phenylalanine (DN-IAPhe) [2H ] indole-3-acetyl-L-[15N] valine 5 (DN-IAVal) [2H ] indole-3-acetyl-L-[15N] leucine 5 5 (DN-IALeu) [2H ] indole-3-acetyl-L-[15N] aspartic 5 7.5 acid (DN-IAAsp) [2H ] indole-3-acetyl-L-[15N] 5 6.25 glutamic acid (DN-IAGlu) [2H ] indole-3-acetyl-L-[15N] 5 tryptophan (DN-IATrp) 2 [ H3] tryptophan (d3-Trp) 25 CDN isotopes, Quebec, Canada Table 3.1. Amounts and sources of internal standards added to samples in LC/MS experiments.

In all experiments, auxins were extracted from tissues by shaking the tubes containing ground tissue on a lab nutator at 4οC for 20 min. Samples were then centrifuged at 12,000 g at

4οC for 15 min. The supernatant was transferred to a new tube, and the pH was adjusted to 3.0 with 1N HCl. Auxin metabolites were purified on an Oasis HLB solid phase extraction column

(Waters Corp, Milford, MA) at 4οC. The column was conditioned with 1 ml methanol, followed by 1 ml of water, and then by 0.5 ml of 15 mM sodium phosphate buffer (pH 2.7). After conditioning, the sample was run through the column, which was then washed with 5% methanol and eluted with 80% methanol. In the second inoculated root experiment, column steps were sped up by using a low-pressure system to feed buffer and samples through the columns. In all experiments, samples were dried under nitrogen gas and re-dissolved in 100% methanol. For LC-

MS/MS analyses, samples were injected (injection volume of 0.4 μl for IAA analyses or 1 μl for

ABA, JA, and SA analyses) into an Agilent 6460 triple quadrupole LC-MS/MS system (Agilent

Technologies), as described previously (Blakeslee and Murphy 2016).

For the synthetic media samples, 5 ml of the non-colonized or colonized and filtered media were transferred to a new 15 ml tube. One milliliter of sodium phosphate buffer (pH 2.7), and the internal standards (Table 3.1) were added to each tube. The pH of the samples was adjusted to 3.0 with 1 N HCl. Metabolites were then purified using solid-phase extraction and analyzed as described above.

GmPIN gene sequence comparison

DNA was extracted from Conrad and Sloan using a hexadecyltrimethylammonium bromide (CTAB) extraction modified from Doyle and Dickson (1987) and sequenced using

Illumina Hi-SeqTM. The reads were preprocessed and assembled in CLC Bio (Qiagen, Valencia,

CA). The Williams 82 reference DNA sequence for each GmPIN, including 2000kb upstream of the ATG start site, was obtained from Phytozome (Goodstein et al. 2012), with the exception of

Glyma09g30900, which is only in the Wm82.a1 of the genome and was obtained from SoyBase

(Grant et al. 2010).

The consensus sequences for a particular gene from each cultivar were put into a single

FASTA file. After removing excess nucleotides from the 5’ and 3’ ends (Hall, 2011), the sequences were aligned by Muscle in MEGA6 (Tamura et al. 2013). Sequences were then visually examined for variations among the Conrad, Sloan, and the Williams 82 reference.

Quantitative real-time PCR of GmPINs

Conrad and Sloan were inoculated with zoospores from P. sojae isolate OH25 in the modified tray test as described above, except that plants were inoculated at 2 cm below the crown region. The experiment was repeated three times, with two-to-three biological replicates of eight-to-ten plants each that were inoculated or mock inoculated in each experiment. The concentration of the zoospore suspension ranged from 0.75 x 104 to 1.0 x 104 zoospores per ml depending on the experiment. In two of the three experiments, to reduce the effects of inoculation efficiency or unsuccessful inoculations, a second set of plants was inoculated with a higher zoospore concentration of 2.2 x 104 to 2.4 x 104 zoospores per ml. There were also two- to-three replications of eight-to-ten plants each for this higher inoculation level. A 1 cm section was collected at the inoculation site from at 0, 24, and 48 hai, excluding plants with extensive black or gray coloration on the tap roots. At 72 hai, 1 cm sections were taken at the upper edge of the lesion margin or from the equivalent location in mock inoculated plants. Lateral roots were removed from each section, and sections from all plants per tray were pooled into one sample.

For experiment six 24 hai plants, there were a large number of plants with black tap roots, so twenty plants across the three trays were pooled into two samples (ten plants per sample). Two- to-three replicates were collected at each time point for each treatment for a total of sixteen to thirty plants per cultivar, except for experiment six Conrad inoculated 24 hai, which only had one rep as the other was lost during tissue collection. Samples were placed in a sterile 2.0 ml microcentrifuge tube, frozen in liquid nitrogen, and stored at stored at -80οC until used.

As with the tray test for the metabolite analyses, two-to-three additional reps of each cultivar were kept for 7 dai to measure the lesion length. In experiment eight, thick germination paper was used in place of the cotton pad and polyester cloth as none were available. Data was

analyzed for each individual experiment as indicated above. The adjusted mean lesion length of each tray in each experiment was then combined and analyzed by ANOVA. Adjusted mean lesion length was used instead of mean lesion length to minimize the potential influence of disease escape.

Tissue from each of the biological reps within each experiment of a given cultivar and treatment within each time point were pooled for RNA extraction to increase the RNA concentration. RNA was extracted using the QIAGEN RNeasy Plant Mini Prep Kit (Qiagen,

Valencia, CA) with the optional on-column DNase treatment as previously described (Wang et al. 2010, 2012b). RNA quality was assessed on a ND-1000 Nanodrop (Nanodrop Technologies,

Wilmington, DE) and by electrophoresis on a 1% agarose gel. The RNA concentration was determined using the QubitTM RNA BR Assay kit (Invitrogen Inc., Carlsbad, CA) on a Qubit®

2.0 Flourometer. Samples with a 260/280 or 260/230 value of less than 1.8 were cleaned with the

QIAGEN MinElute clean up kit (Qiagen, Valencia, CA) using the clean-up protocol described in the RNeasy kit handbook. For cDNA synthesis, 1μg of RNA was reverse transcribed with the

SuperScript III kit (Invitrogen Inc., Carlsbad, CA). To test for the presence of contaminating genomic DNA, non-reverse transcriptase (NRT) controls were also generated and were used in a qPCR reaction with cons6 primers (Libault et al. 2008). The products were run on a 2% agarose gel to check for the presence or absence of a band. Samples that generated a band were subjected to a second DNase treatment using amplification grade DNase I (Invitrogen Inc., Carlsbad, CA) before repeating the cDNA synthesis and NRT PCR test steps. After this second DNase treatment, no product was seen in the NRT controls.

For qRT-PCR, three reference genes, cons6 (a F-box gene), cons7 (a metalloprotease,

Libault et al. 2008), and a putative ubiquitin gene (Zhou et al. 2009) were tested with both

NormFinder (Andersen et al. 2004) and geNorm (Vandesompele et al. 2002) to determine which was the most consistently or stably expressed across cDNA samples. In NormFinder, the stability values ranged from 0.123 to 1.768, with ubiquitin being the lowest (most stable) and cons6 being the highest (least stable). In geNorm, cons6 had the highest M value, indicating that it was least stablely expressed across the samples, whereas cons7 had the lowest M value, indicating that it was most stable. Ubiquitin was the second most stable gene in the geNorm test. Since previous studies examining gene expression in Conrad and Sloan had used the ubiquitin as a reference gene (Wang et al. 2010; 2012b) and the efficiencies were 106% for Conrad and 98% for Sloan when Ct values were averaged across technical reps at an annealing temperature of 60οC, it was selected as the reference gene. The twelve PIN genes were selected based on their homology to

Arabidopsis PIN proteins or their expression in soybean roots (Wang et al 2015). Primers for

GmPIN1e (Glyma.19g128800) were from Wang et al. (2012b). Primers for GmPIN3c

(Glyma.07g164600), GmPIN9d (Glyma.15g208600), and GmPIN2b (Glyma.17g057300) were from Wang et al. (2015). All other primers were designed using PrimerBLAST at NCBI (Table

3.2; Ye et al. 2012). The product size was set to 80 to 150 bp, and the organism was set to

Glycine max (taxid:3847). Primers were then checked for product specificity by BLASTn search against the soybean genome at both Phytozome (phytozome.jgi.doe.gov) and SoyBase

(soybase.org).

GmPINIDa GlymaID (Wm82.a2) Forward Primer Reverse Primer Reference GmPIN1e Glyma.19g128800 CTACATTTTGCTTGGGCTTTG GGTAGTTTGATCCACACTGCAA Wang et al. 2010 GmPIN1d Glyma.03g126000 TGTGGGACTTGTACCACGTT GCATTGGTCAGGGGTGAAGA This study GmPIN1b Glyma.07g102500 GCAGCTCTTCCCCAAGGAAT GGCAAAGCAATCAACATCCCA This study GmPIN1c Glyma09g30700 (v1 GCAGCTCTTCCCCAAGGAAT GGCAAAGCAATCAGCATCCC This study only) GmPIN1a Glyma.08g054700 TCAAAGGCGTTCTCTTGCAC GTACACGAGCGTAATGGGCA This study GmPIN3c Glyma.07g164600 GTGACGGTAGCTTCTCCTCG GAATTCTGGCTCTGGCTCTG Wang et al. 2015 GmPIN3d Glyma.09g117900 CGCAGTGGTCCCACTCTAC GGCGAAGATCGCGACAAAAC This study GmPIN3a Glyma.07g217900 GCTCCGATCAAGGTGCCAA CTCCTTCTGCAGCAGCTTTGTT This study GmPIN3b Glyma.20g014300 AAAGCTGCAGCAGAAGGAGAGT CACCGGGTCCTGCTTTTTCTC This study

70 GmPIN2a Glyma.13g101900 TGGTCGTAGAGGGAACGGAG TCTGGCAGGTGGTGTATGGA This study

GmPIN2b Glyma.17g057300 ATTGCATTGCCCATAACCAT CGTGACATTGGGTTTACATAG Wang et al. 2015 GmPIN9d Glyma.15g208600 GCCATCAATTGCAAAAGGTT GAACCGAGCCACCATAGAAA Wang et al. 2015 Ubiquitin GATCAAGGAACGCGTTGAAG CTCAATGCAAGCACCAAGTG Zhou et al. (Glyma.15g259200) 2009 cons6 AGATAGGGAAATGGTGCAGGT CTAATGGCAATTGCAGCTCTC Libault et al. (Glyma.12g051100) 2008 cons7 Libault et al. (Glyma.03g137100/ 2008 Glyma.19g139800) aGmPIN identification according to Wang et al. 2015. Table 3.2. Primers used for quantitative real-time PCR (qRT-PCR) in this study.

To ensure that the primers amplified the desired gene, amplicons were generated via conventional PCR on cDNA collected from the 24 hai mock treatment of one experiment for each cultivar. The products were run on a 1% agarose gel to ensure that only one band was present, and then cleaned with the DNA Clean and ConcentratorTM-5 kit (Zymo Research, Irvine,

CA). To ensure successful sequencing of these small amplicons, they were ligated to the TOPO pCR2.1 vector (Invitrogen Inc., Carlsbad, CA). Ligation products were transformed into

OneShot Chemically competent Escherichia coli cells (Invitrogen, Inc. Carlsbad, CA). The vector was purified from liquid cultures started from a single E. coli colony using the Wizard®

Plus SV Minipreps DNA Purification System (Promega, Madison, WI). The presence of an insert in three to five colonies was confirmed by restriction digestion with EcoRI followed by electrophoresis on a 1% agarose gel. One representative plasmid containing the desired insert for each gene was then sequenced on an ABI Prism 3100xl genetic analyzer. The insert sequence was aligned against the gene sequence from the respective cultivar with BLASTn suite-two sequences (NCBI), except for Glyma09g30700 and Glyma.15g208600, which were aligned to the Williams 82 reference from Soybase or Phytozome, as the Conrad and Sloan sequences for these genes were not available.

To determine the efficiency of each primer set, cDNA from the mock 0 hai time point from each of the three experiments was diluted to 50 ng/μl and then pooled by cultivar. Serial dilutions were made from the pools for final concentrations of 0.4 ng/μl, 2 ng/μl, and 10 ng/μl.

The reaction mixture contained 300 nM of forward and reverse primers, 10 μl of iQ SYBR Green

Supermix (Bio-Rad, Hercules, CA), 2 μl of 10x diluted cDNA, and Ultrapure H2O (Invitrogen

Inc., Carlsbad, CA) for a final volume of 20 μl. Quantitative real-time PCR (qRT-PCR) was

performed in a CFX96 Real-time System on a C1000 touch thermocycler (Bio-Rad, Hercules,

CA) using the SYBR/fam detection mode. Reaction conditions were as follows: 95οC for 3 min,

35 cycles of 95οC for 10 s and 60οC for 45s min followed by 95οC for 1min and 60οC for 1min

31 s. To generate melt curves, samples were then run at 60οC for 10 s, with the temperature increasing 0.5οC each cycle for 70 cycles. Two-to-three technical replicates were used for all samples and standards. The mean Ct of two-to-three technical replicates for each cultivar at each concentration was plotted against the log10 of the cDNA concentration. A regression line was fit to the data, and the slope was used to calculate the primer efficiency with the following equation:

E = 10-1/slope (Pfaffl 2001). To check for the variation of efficiency among technical reps, the individual Ct value for each technical rep was plotted against the log10 concentration of the cDNA. Regression line fitting and efficiency calculations were as described above.

For the qRT-PCR, the cDNA of each cultivar/treatment/time point/experiment was diluted to 40 ng/μl. The reaction mix and conditions were as described above. The mean Ct was calculated for each gene from two-three technical replicates. The relative transcript abundance in mock and inoculated samples was calculated as 2-Ctpin-Ctref (Schmittgen and Livak 2008). The

Ctmock-Ctinoc Ctmock-Ctinoc infection response was calculated using the following equation: EPIN /Eref

(Pfaffl 2001). Relative transcript abundances between mock and inoculated samples within cultivar and infection response between cultivars were analyzed for each time point by ANOVA using PROC GLM in SAS.

NPA and NAA applications in an adapted vertical mesh transfer system

The auxin transport inhibitor 1-N-naphthylphthalamic acid (NPA) and the synthetic auxin

1-naphthaleneacetic acid (NAA) were applied to soybean seedlings using a modified vertical

mesh transfer system (Murphy and Taiz 1995; Murphy et al. 2000). Soybean seeds were sterilized with chlorine gas as described above. Seeds were then placed on a sterile piece of 9 cm x 10 cm thick germination paper in a sterile glass Petri plate. The germination paper was moistened with sterilized, distilled water. Ten seeds were placed on a plate. Some sterile water was left standing in the plate to maintain moisture for higher germination. Plates were kept in a plastic bag in the dark at room temperature (approximately 24-26οC) for three days.

Whatman chromatography paper was sterilized and placed on a 28 cm x 28 cm glass plate as previously described (Murphy and Taiz 1995; Murphy et al. 2000). To hold the seedlings on the plate, an approximately 1 cm wide x 28-31 cm long strip of sterile filter paper was placed under the seedlings 8.5 cm from the top of the plate. Six to seven 3-d-old seedlings were placed on the strip. A second strip was placed over the seedlings and then pressed down between seedlings so it stuck to the paper beneath. Two additional strips were placed on either end of the strip holding the seedlings at a ninety degree angle from the first strip to hold the edges down

(Fig. 3.1). Plates were then placed in a test tube rack (Endicott-Seymour, MI) in a Nalgene box

(30.48 cm x 30.48 cm x 30.48 cm) with 6 liters of sterile, distilled water. A large 33.9 cm x 33.9 cm glass plate was used as a lid for the VMT box. The box was sealed with MicroporeTM tape

(3M, Maplewood, MN). Boxes were kept under constant light. For later reps, to prevent root desiccation, a sterile piece of 12.5 cm x 28 cm thin germination paper was placed 11.5 cm from the top of the plate. Seedlings were then placed on the plate as described above. Two days later, a second piece of 12.5 cm x 28 cm germination paper was placed directly over the first piece to cover the roots. It was then saturated with sterile, distilled water.

Figure 3.1. Soybean seedlings arranged on a VMT glass plate for NPA or 1-NAA applications.

Six days later, NPA or 1-NAA was added to a 0.25% agarose solution (25 mM 2-(N- morpholino)ethanesulfonic acid (MES), 2% DMSO) at 1, 5, and 10 μM. One hundred μl of the agarose solution was placed on each seedling at the root-shoot transition zone. Two days later, seedlings were scratched about 2 cm below the crown region, and the wound was covered with a mycelial slurry of 7-d-old P. sojae OH25. At 3 dai, the lesion length was measured from the top of the inoculation site to the upper edge of the lesion margin.

Results and Discussion

Auxinic metabolites in Phytophthora sojae mycelia and associated media

Auxins are synthesized via three primary pathways in most plant tissues. In tryptophan- dependent IAA biosynthesis, the amino acid tryptophan (Trp) is the primary auxin precursor, and tryptamine (TRA) serves as one of the key metabolite intermediates (Korasick et al. 2013; Soeno et al. 2010; Spaepan et al. 2007). To assess whether P. sojae could be a source of IAA or these precursors, five isolates, OH1, OH4, OH7, OH25, and OH12168-05-01, were evaluated for their ability to accumulate IAA, TRP, and TRA in both mycelia and synthetic media (assayed to determine whether or not P. sojae was capable of secreting Trp or TRA). Mycelia and media were collected and analyzed for the presence of Trp, TRA, and IAA via LC-MS/MS in two separate experiments (Table 3.3). As expected for an amino acid essential for cellular protein synthesis, tryptophan was detected in the mycelia of all isolates ranging from 3405.15 to

16347.81 ng/g across both experiments. Tryptamine levels in mycelia ranged from 0.00 to 0.56 ng/g. Indole-3-acetic acid was only detected in the mycelia in the second experiment, but it was below the limit of quantification. Therefore, the amount of IAA in mycelia was estimated based on the standard curve. Tryptophan, TRA, and IAA were detected in the media from all isolates in both experiments, although IAA was below the limit of quantification in the first experiment. In the second experiment, IAA levels in media used to grow P. sojae ranged from 6.26 ng/liter to

31.92 ng/liter. Only TRA was detected above the limit of quantification in the negative control in the second experiment. The presence of Trp and TRA in media used to grow isolates suggests that P. sojae secretes these precursors into its surroundings.

Previous studies have shown that other plant-associated microbes including

Agrobacterium tumefaciens (Thomashow et al. 1984), several Pseudmonas syringae and

Pseudomonas savastanoi pathovars (Glickmann et al. 1998), the fungal pathogen Traphina deformans (Perley and Stowe 1966), and wheat rust pathogen, Puccinia graminis f. sp. tritici

(Yin et al. 2014) produce IAA. It has been suggested that IAA may act as a signaling molecule for plant-associated bacteria and in the yeast Saccharomyces cerevisiae (reviewed in Kunkel and

Harper 2018; Spaepan et al. 2007).

Auxin has also been shown to play a role in diseases caused by other oomycete pathogens through different mechanisms that the potential one investigated here. Phytophthora parasitica produces an effector, Penetration-specific effector 1 (PSE1). Transgenic Arabidopsis plants containing this effector had shortened root growth, an increased number of lateral roots in dark- grown seedlings, and abnormal root hair development (Evangelisti et al. 2013). Treating wild type Arabidopsis with the synthetic auxins 2,4-dicholorpenoxyacetic acid (2,4-D) and NAA resulted in slightly more severe disease symptoms after inoculation with P. parasitica, indicating that increased levels of auxin contribute to disease development (Evangelisti et al. 2013). Further work to investigate whether or not the production of IAA originates from P. sojae, results from increased tryptophan provided by P. sojae, or is part of the susceptibility response in the host is needed. Additionally, the presence of known or novel IAA biosynthesis genes or homologs of

PSE1 in P. sojae should be investigated.

Exp. 1 Exp. 2 Sample Type Trp TRA IAA Trp TRA IAA

OH1 Mycelia 1639.91 0.00 0.00 16347.81 0.56 0.034a

OH4 5511.58 0.00 0.00 16501.25 0.36 0.19a

OH7 3405.15 0.00 0.00 7337.62 0.18 0.00a

OH25 5115.18 0.00 0.00 12328.93 0.53 0.00a

OH12168-05-01 4356.54 0.00 0.00 11303.78 0.33 0.00a

HSb Media n/ac n/a n/a 0.00 5.94 3.09a

OH1-HS 591.93 7.22 6.26a 1424.65 56.22 7.89

OH4-HS 994.07 9.60 25.55a 733.77 41.33 16.26

OH7-HS 556.17 14.03 23.24a 1194.50 28.99 31.92

OH25-HS 1131.71 25.14 0.00a 1218.89 30.70 7.84

OH12168-05- 916.27 14.04 10.32a 1414.84 28.83 24.96 01-HS aValue was below the limit of quantification and was calculated based on the standard curve. bHoitink-Schmitthenner minimal medium (Hoitink and Schmitthenner 1969) for the corresponding P. sojae isolate. HS is the medium without P. sojae. cNon-colonized media was measured only in the second experiment.

Table 3.3. Levels of tryptophan (Trp), tryptamine (TRA), and indole-3-acetic acid (IAA) in P. sojae mycelia (ng/g) and minimal medium (ng/L).

Quantification of auxin metabolites in soybean root tissue during infection with P. sojae

At 7 dai, the adjusted mean lesion length was significantly different between Conrad and

Sloan (p<0.001; Fig. 3.2), indicating that the zoospore inoculation was successful.

Figure 3.2. Mean lesion length of Conrad and Sloan in metabolite tray tests 7 days after inoculation with Phytophthora sojae in experiments 1(A) and 2 (B). Error bars represent standard deviation. Bars with different letters are significantly different from each other by Fisher’s protected LSD (p<0.001).

IAA, indole-3-acetyl-valine (IAVal), indole-3-acetyl-glutamic acid (IAGlu; Fig. 3.3),

TRA, (Fig. 3.4), jasmonic acid (JA), jasmonyl-leucine/isoleucine (JALeu/Ile), and salicylic acid

(SA; Fig. 3.5) were detected in the roots of both cultivars in both experiments. OxIAA, indole-3- acetyl alanine (IAAla), indole-3-acetyl-aspartic acid (IAAsp) and indole-3-acetonitrile (IAN;

Fig. 3.6) were only detected in the first experiment. Quantification of Trp and ABA in the second experiment is in progress, as the quantification curves for these compounds need to be repeated.

Values of IAA from the second experiment are also preliminary as a refined qualification curve is needed. Indole-3-acetyl-phenylalanine (IAPhe) was measured only in the second experiment

(Fig. 3.7).

In the first experiment, none of the metabolite levels were significantly different between the two cultivars or between the mock and inoculated treatment within cultivars at 12 hai; therefore, this time point was dropped in the second experiment. In both experiments, IAA levels increased at 48 and 72 hai. In the first experiment, it was significantly higher in the Sloan inoculated sample than in all other samples measured. In the second experiment, it was significantly higher in the inoculated sample of both cultivars at 48 and 72 hai. IAGlu tended to

increase in the inoculated samples of both cultivars at 48 and 72 hai, although the statistical significance varied by experiment. As expected based on the increased levels of IAA observed after inoculation, TRA levels showed a tendency to increase in the inoculated samples of both cultivars at 48 and 72 hai. At 24 hai, there was an increase in the Conrad inoculated root sample in experiment one and in the Sloan inoculated root sample in experiment two. SA levels tended to be higher in inoculated roots of both cultivars compared to their respective mock controls at

48 and 72 hai. JA levels also tended to increase in the inoculated root samples at 48 and 72 hai, although in experiment two, JA concentrations in inoculated roots initially decreased from 0 hai to 24 hai. JALeu/Ile levels were higher in Conrad and Sloan inoculated roots compared to their mock controls in the first experiment but were unchanged in the second experiment.

There were no significant differences in IAVal between cultivars or treatments in any of the time points examined in both experiments or in IAN or ABA in the first experiment. This was also true for IAPhe in the second experiment, although levels of this metabolite were quite variable. In the first experiment, Trp was higher in Sloan vs Conrad infected roots at 48 hai, and

IAAsp and Trp levels were higher in Sloan inoculated roots compared to its mock control. IAAsp and oxIAA were higher in the inoculated Sloan compared to its mock control at 72 hai.

Figure 3.4. Amounts of auxin precursor tryptamine (TRA) in Conrad (C) and Sloan (S) mock (M) and inoculated (I) root tissue at 12, 24, 48, and 72 hai in experiment one (left) and at 0, 24, 48, and 72 hai in experiment two (right). Bars with different letters are significantly different from each other within a time point by Tukey’s test at 95% confidence. Asterisks indicate significant difference between M and I within cultivar at a given time point by Student’s t-test (*p<0.05, **p<0.01). Error bars represent standard deviation.

Figure 3.5. Amounts of salicylic acid (SA), jasmonic acid (JA), and jasmonic acid leucine/isoleucine (JA-Leu/Ile) in Conrad (C) and Sloan (S) mock (M) and inoculated (I) root tissue at 12, 24, 48, and 72 hai in experiment one (left) and 0, 24, 48, and 72 hai in experiment two (right). Bars with different letters are significantly different from each other within a time point by Tukey’s test at 95% confidence. Asterisks indicate significant difference between M and I within cultivar at a given time point by Student’s t-test (*p<0.05, **p<0.01, ***p<0.001). Error bars represent standard deviation.

Figure 3.6. Auxin precursors and catabolites and abscisic acid (ABA) only detected or quantified in soybean root metabolite experiment one. Bars with different letters are significantly different from each other within a time point by Tukey’s test at 95% confidence. Asterisks indicate significant difference between M and I within cultivar at a given time point by Student’s t-test (*p<0.05, **p<0.01, ***p<0.001). Error bars represent standard deviation.

Figure 3.7. Indole-3-acetyl-phenylalanine (IAPhe) in Conrad (C) and Sloan (S) mock (M) and inoculated (I) roots at 0, 24, 48, and 72 hai in experiment two. Bars with the same letter are not significantly different by Tukey’s test. Error bars represent standard deviation.

From these experiments, it is unclear whether the Trp, TRA, and IAA detected in root samples were derived from the plant or the pathogen. To fully determine this, it would be necessary to feed either the plant or the pathogen an isotopically labeled auxin, or an auxin precursor (such as Trp). Higher levels of SA in at 24 hai may also suggest a potential role for auxin in susceptibility, as SA is antagonistic to IAA signaling/response pathways (Robert-

Seilaniantz et al. 2011). Therefore, an increase in SA would attenuate IAA responses and help prevent the spread of the pathogen. McDonald and Cahill (1999) reported a potential role of

ABA induction of qualitative resistance in the cultivar Haro 1272 to P. sojae. So far, we have not detected differences between our two cultivars. However, this could be due to differences in the tissue sampled, as McDonald and Cahill (1999) worked primarily with leaf tissue, while we sampled root tissue. Another study indicated that SA was upregulated in the Rps-gene mediated response at 24 hai (Jing 2015). However, our results indicate that SA and JA both be increase in inoculated roots at 48 and 72 hai, suggesting that both play a role in quantitative resistance. 84

Therefore, the relative importance of plant hormones in a given plant-pathogen system may vary depending on the type of host tissue as well as the cultivar and nature of the resistance. This work is also supported by a study examining the role of SA, JA, and ET pathways in the quantitative resistance of four potato cultivars to P. infestans. Only one of the two varieties with higher quantitative resistance had an increase in SA during infection (Saubeau et al. 2016).

Nucleotide sequence variation and expression of PIN genes in Conrad and Sloan

Ten of the twelve PIN homologs had sequences available from Conrad and Sloan. Of these, eight had putative sequence differences among the Conrad, Sloan, and the reference genome, Williams 82, which has a resistance level between the two cultivars (Table 3.4). Of these, five had differences in Conrad compared to Sloan and Williams 82, seven were different in Sloan compared to Conrad and Williams 82, and seven were different in Williams 82 compared to Conrad and Sloan. All eight had putative single nucleotide polymorphisms (SNPs), and six had putative insertions/deletions (indels). However, these differences will need to be confirmed in future studies. Long-range PCR and sequencing of the genes at a greater coverage would allow for more accurate SNP calls. Additionally, PCR amplification of multiple specific alleles (PAMSA) or Kompetative Allele Specific PCR (KASP) markers could be developed to confirm the presence of the SNPs detected here (Chen et al. 2017; Shi et al. 2015; Wang et al.

2012b).

AtPIN GmPIN Gene ID Expressiona SNPsc Indelsd homologa IDa (Wm82.a2.v1/ C v S v W v C v S v W v a1.v1.1)b SWe CWf CSg SW CW CS AtPIN1 GmPIN1a Glyma.08g054700/ apical meristem, root, stem, root tip, 1 3 9 0 0 0 Glyma08g05900 flowers, pods, seeds GmPIN1b Glyma.07g102500/ apical meristem, root, root tip, stem, seed 9 2 25 2 0 7 Glyma07g11550 GmPIN1d Glyma.03g126000/ apical meristem, root, root tip 0 99 3 0 9 0 Glyma03g28130 GmPIN1e Glyma.19g128800/ apical mersitem, root, root tip, immature 0 1 0 0 0 2 Glyma19g30900 leaf (somewhat), seed AtPIN2 GmPIN2a Glyma.13g101900/ apical meristem, root, stem, root tip, 22 0 0 5 0 0 Glyma13g00390 flowers, pods, seeds 86 GmPIN2b Glyma.17g057300/ apical meristem, root, root tip, stem, seed 0 0 0 0 0 0 Glyma17g06460 AtPIN3/ GmPIN3a Glyma.07g217900/ apical meristem, stem, root, root tip, flower, 0 0 0 0 0 0 AtPIN4/ Glyma07g34190 pod, seeds AtPIN7 GmPIN3b Glyma.20g014300/ apical meristem, root, root tip 0 21 1 0 5 0 Glyma20g01760 Continued a According to Wang et al. 2015 b Gene id in version Wm82.a2.v1 and/or version Wm82.a1.v1.1 of the soybean genome. c single nucleotide polymorphisms d insertions/deletions e Sequence unique to Conrad (C) compared to Sloan (S) and Williams 82 (W) f Sequence unique to S compared to C and W g Sequence unique to W compared to C and S

Table 3.4. Number of sequence variations in AtPIN1, AtPIN2, and AtPIN3/AtPIN4/AtPIN7 soybean homologs among Conrad, Sloan, and Williams 82 reference.

Table 3.4. Continued AtPIN GmPIN Gene ID Expressiona SNPsc Indelsd a a homolog ID (Wm82.a2.v1/ C v S v W v C v S v W v b a1.v1.1) SWe CWf CSg SW CW CS AtPIN3/ GmPIN3c Glyma.07g164600/ apical mersitem, root, root tip, immature 3 3 10 1 0 2 AtPIN4/ Glyma07g22340 leaf (somewhat), seed AtPIN7 GmPIN3d Glyma.09g117900/ apical meristem, root, stem, root tip, 5 4 66 0 0 0 Glyma09g20580 flowers, pods, seeds

The adjusted mean lesion length was significantly different between Conrad and Sloan across all three experiments (p<0.001; Fig. 3.8). There was no significant difference due to experiment (p=0.2727), rep (p=0.1658), or inoculation level (p=0.4307). Therefore, only the root tissue inoculated with the lower zoospore concentration was used for RNA extraction and qRT-

PCR.

Figure 3.8. Adjusted mean lesion lengths of Conrad and Sloan 7 dai with P. sojae for qRT-PCR experiments (p<0.001). Error bars indicate standard deviation. Bars with the same letter are not significantly different from each other by Fisher’s protected LSD.

The sequences of the qRT-PCR primer target regions matched the desired gene for eleven of the twelve genes selected (98-100% identity). The region targeted by the primers for

Glyma.08g054700 did not match the sequence for this gene. Therefore, it was excluded from further analysis.

Despite numerous attempts, the primer efficiencies of most genes were outside of the ideal range of 90-110% (Table 3.5). Additionally, the reference gene, ubiquitin, had variation in efficiency in the Conrad sample in one of three technical replicates. Examination of this data is in progress to narrow down the contributing factors. In earlier experiments in this study,

variation in expression values was due to poor RNA quality. Pipetting error is another possible contributing factor. While a calibration test is planned to rule out machine error, there was no particular well in the primer efficiency plates that was consistently variable. Due to problems with a contaminant in the non-template control wells in early experiments, the reaction conditions in this study were modified from Wang et al. (2010). Namely, the annealing temperature was increased from 55 to 60οC and the number of cycles was reduced from 40 to 35.

This may account for the inability to reproduce the results from Wang et al. (2010). Finally, in

Arabidopsis, the AtPINs are known to vary in expression (Peer et al. 2004), and all GmPINs examined here are expressed at low levels in soybean roots (Wang et al. 2015). Therefore, a reference gene that also has low expression levels may be a better choice (Libault et al. 2008).

Additionally, multiple and/or more stably expressed reference genes would reduce the effect of

RNA degradation on transcript abundance and infection response (reviewed in Fleige and Pfaffl

2006).

Gene ID (Wm82.a2.v1) Cultivar Na R2 Primer Percent efficiency efficiency (%) Ubiquitin (Glyma.15g259200) Conrad 2 0.95 2.06 106 Sloan 3 1.00 1.98 98 GmPIN1e (Glyma.19g128800) Conrad 3 0.94 2.24 124 Sloan 3 0.99 1.80 80 GmPIN1d (Glyma.03g126000) Conrad 3 0.99 2.00 100 Sloan 2 0.98 2.08 108 GmPIN1b (Glyma.07g102500) Conrad 3 0.96 1.85 85 Sloan 3 1.00 1.80 80 GmPIN1c (Glyma09g30700b) Conrad 3 1.00 1.89 89 Sloan 3 0.98 1.67 67 Continued anumber of technical reps used to calculate the efficiency bOnly in Glyma.Wm82.a1 cPrimer efficiency varies among technical reps. Gene expression not reported here.

Table 3.5. Primer efficiencies of GmPIN targets and tested reference genes in this study.

Table 3.5 Continued Gene ID (Wm82.a2.v1) Cultivar Na R2 Primer Percent efficiency efficiency (%) GmPIN3c (Glyma.07g164600) Conrad 3 0.99 2.08 108c Sloan 3 0.92 3.18 218 GmPIN3d (Glyma.09g117900) Conrad 3 1.00 1.80 80 Sloan 3 1.00 1.94 94c GmPIN3a (Glyma.07g217900) Conrad 3 0.99 1.93 93 Sloan 3 0.92 2.37 137 GmPIN3b (Glyma.20g014300) Conrad 3 0.99 1.73 73 Sloan 3 0.99 1.99 99 GmPIN2a (Glyma.13g101900) Conrad 3 0.96 1.74 74 Sloan 3 0.99 1.92 92c GmPIN2b (Glyma.17g057300) Conrad 3 0.90 2.17 117 Sloan 3 0.99 1.86 86 GmPIN9d (Glyma.15g208600) Conrad 3 1.00 1.74 74 Sloan 3 0.92 2.05 105c cons6 (Glyma.12g051100) Conrad 3 0.99 1.98 98 Sloan 3 1.00 1.89 89 cons7 (Glyma.03g137100/ Conrad 3 0.97 2.15 115 Glyma.19g139800) Sloan 3 1.00 1.80 80

The expression of eleven GmPINs was explored but due to the variability outlined above, statistical analysis could only be examined for GmPIN3a (Glyma.07g217900), GmPIN3b

(Glyma.20g014300), and GmPIN1d (Glyma.03g126000). The relative transcript abundance of

GmPIN3a in Conrad, of GmPIN3b in Sloan, and of GmPIN1d in Conrad or Sloan was not significantly different between the mock and inoculated treatments (Fig. 3.9), although variability within the experiment may mask some of these differences. Variability within the experiment also prevented testing the relative transcript abundance of GmPIN3a in Sloan and of

GmPIN3b in Conrad.

Figure 3.9. Mean relative transcript abundance of GmPIN3a (Glyma.07g217900), GmPIN3b (Glyma.20g014300), and GmPIN1d (Glyma.03g126000) in mock and inoculated roots of Conrad and/or Sloan. Error bars represent standard deviation.

The infection response of GmPIN1d was not significantly different between Conrad and

Sloan (Fig. 3.10). GmPIN1d is the nearest homolog of GmPIN1e (Glyma.19g128800). While experimental variation prevent accurate measurement of transcript abundance and infection response of GmPIN1e in this study, Wang et al. (2010) reported that it was up regulated in Sloan and down regulated in Conrad at 72 hai. Therefore, the different homologs might act differently during infection with P. sojae.

Figure 3.10. Infection response of GmPIN1d (Glyma.03g126000) in Conrad and Sloan. Error bars represent standard deviation.

PIN proteins are known to undergo post-transcriptional regulation, especially cycling between the endomembrane system and the plasma membrane (Friml et al. 2002b; Grunewald and Friml 2010; Woodward and Bartel 2005). As we only examined gene expression, we cannot rule out the possibility that the PIN proteins undergo differential subcellular localization, especially since several genes related to vesicle trafficking are also associated with our QDRL of interest (Stasko et al. 2016; Wang et al. 2012b). There were also auxin-responsive genes and an auxin biosynthesis gene (Stasko et al. 2016; Wang et al. 2012b) underlying the QDRL, which could be potential targets for P. sojae. This would agree with other studies, as other oomycete pathogens including Pseudoperonospora cubensis and P. infestans, are known to target susceptibility factors in their hosts (reviewed in Boevink et al. 2016; Burkhardt and Day 2016).

Therefore, the ability of P. sojae to target soybean auxin processes should be further investigated.

Effect of application of NPA or 1-NAA to soybean root on infection with P. sojae

A total of seven biological replicates were completed for both Conrad and Sloan. A region of necrosis developed on upper hypocotyl/stem of both cultivars, including plants that were not treated with either NPA or 1-NAA in three of seven reps when NPA was applied and in four of seven reps when 1-NAA was applied. This necrosis did not appear to be related to the lesion, as it was located several cm above the lesion margin. There was a large variation in inoculation efficiency/number of successful inoculations, and environmental conditions among the reps of this experiment, as early reps were done during winter and spring, and later reps occurred during the summer and early fall. Additionally, the temperature for some reps was about 20οC, which is cooler than the 25οC optimal temperature for P. sojae (Grau et al. 2004).

Therefore, the decrease in infection efficiency may have been due, in part, to cooler conditions.

During the statistical analysis, there was a significant rep effect, but an insignificant treatment effect (Table 3.6; Fig. 3.11; Fig. 3.12). This rep effect could be masking the treatment effects.

Cultivar Treatment Rep p-value Treatment p-value Conrad NPA 0.0135 0.4659 1-NAA 0.0023 0.0771 Sloan NPA 0.2099 0.8638 1-NAA 0.0651 0.5161 Table 3.6. Type III p-values of NPA and 1-NAA application experiments across all seven reps generated using PROC GLM in SAS.

Figure 3.11. Box plots of adjusted mean lesion length in Conrad (A and B) and Sloan (C and D) 3 dai with P. sojae by rep (A, C) and NPA concentration (B, D).

Figure 3.12. Box plots of adjusted mean lesion length in Conrad (A and B) and Sloan (C and D) cultivars 3 dai with P. sojae by rep (A, C) and 1-NAA concentration (B, D).

Removing plants with the upper necrosis phenotype and reps that did not have successful inoculation of the controls resulted in too few plants remaining to perform statistical analysis.

Keller (in prep) has continued this work, using a modified rolled towel approach (Dorrance et al.

2004) in place of the VMT system. However, there is still variation in inoculation efficiency/success as well as the upper necrosis on plants with and without NPA treatment. In both the VMT and the modified rolled towel assay, the boxes/buckets are covered with glass or clear plastic and sealed with tape. This may cause changes in the relative humidity that are contributing to the upper necrosis phenotype, as regular rolled towel and tray assays occur in buckets that are not sealed with tape (Dorrance et al. 2004; Stasko et al. 2016).

Conclusions

The data presented here suggest that infection with P. sojae secretes the auxin precursors

Trp and TRA into its surroundings. Whether or not this contributes to susceptibility or resistance remains unclear. In addition, auxin levels increased in Sloan in two experiments and in Conrad in one experiment at 48 hai. In any case, auxin processes are only one of the potential components that may contribute to the overall resistance or susceptible response. A limitation in many of these experiments was the environmental variation due to fluctuating temperatures in buildings and growth chambers. To better control for the environmental variation observed in our experiments, future studies should increase the number of individuals and identify better facilities for these assays.

Chapter 4: Approaches to studying quantitative resistance in the soybean-Phythophthora sojae system

RNAi constructs and testing of silencing in cotyledon hairy roots was performed by Wenshuang Xie with technical assistance from Damitha Wickramasinghe and Leslie Taylor. Feng Qu, Junping Han, and their lab generated the VIGS constructs used here, and the DR5::GUS plasmid was a kind gift of Henry Nguyen, University of Missouri. Joel Mercado-Reyes performed the testing of silencing in composite plant hairy roots under the supervision of A. K. Stasko. A. K. Stasko performed all promoter::GUS cloning and DR5::GUS experiments, composite plant and cotyledon hairy root generation with technical assistance from L. Taylor and J. Mercado-Reyes, treatment of Conrad and Sloan with VIGS constructs with technical assistance from J. Han, and P. sojae inoculations of hairy roots and VIGS plants and associated rating. She also assisted J. Han with RNA extraction from the VIGS leaves and roots and wrote the chapter.

Abstract

There are few gene silencing or knock-down methods in soybean for functional gene analysis, including hairy roots induced by Agrobacterium rhizogenes in composite plants and cotyledons as well as virus induced gene silencing (VIGS). These methods were explored for gene silencing in roots in the soybean-Phytophthora sojae system to determine the function of specific candidate genes in quantitative disease resistance. Hairy roots based on both composite plants and cotyledons were tested. Both cotyledon-based hairy roots and composite plants were readily generated in 6 and 8 weeks. However, disease severity ratings were difficult in composite plants due to the level of browning that occurred on roots when exposed to air or was variable when exposure to air was avoided. Infections on cotyledon-based hairy roots were more apparent. Virus-induced gene silencing (VIGS) using a Bean pod mottle virus (BPMV) vector was not able to silence target genes in the roots even though the virus was present in root tissue.

Cotyledon-based hairy roots are recommended for future studies with either RNAi constructs or reporter genes.

Introduction

Host resistance has been the most successful management strategy used against

Phythophthora sojae to date. It occurs through qualitative resistance and through quantitative resistance (Grau et al. 2004; Schmitthenner 1985). Qualitative or single gene resistance occurs through Resistance to Phytophthora sojae (Rps) genes. To date, over 20 Rps genes have been identified in soybean cultivars including several recently discovered genes (Cheng et al. 2017; Li et al. 2017; Lin et al. 2013; Ping et al. 2016; Sun et al. 2014; Zhang et al. 2013; Zhong et al.

2018). However, the pathogen has adapted to many of these genes, and in Ohio there are numerous isolates present that have adapted to most U.S. identified Rps genes. Under these conditions, most Rps genes last only eight to twenty years (Dorrance et al. 2016; Grau et al.

2004; Mideros 2006; Mideros et al. 2007). Therefore, a more durable form of host resistance is needed as part of a long-term management strategy.

Quantitative resistance, also called partial resistance, horizontal resistance, or field resistance, is conferred by quantitative disease resistance loci (QDRL). Unlike Rps gene- mediated resistance, quantitative resistance slows pathogen development, limits the overall colonization, and is generally thought to not be race-specific (Parlevliet 1979; St. Clair 2010;

Tian et al. 2006). In terms of durability, quantitative resistance in this host-pathogen system is often considered to be more durable than R-gene resistance as there are multiple genes involved, thus making it more difficult for the pathogen to adapt (Grau et al. 2004; Wang et al. 2012b). An example of the durability of quantitative resistance is the moderately resistant cultivar, Conrad. It

was registered in 1989 (Fehr et al. 1989) and once it had good stand in the field, showed no symptoms of root rot in recent field studies (Dorrance et al. 2003, 2009; Vargas and Scott in prep). In constrast, the cultivar Sloan, which has low levels of quantitative resistance, had higher levels of disease severity (Dorrance et al. 2003, 2009).

 Genes that contribute to growth and development with pleiotropic effects that also

contribute to defense

 mutated alleles of genes already involved in basal defenses

 genes involved in defense signal transduction

 mutated genes that code for defensive chemicals

 “weak R-genes” (less effective alleles or mutated versions of their qualitative

counterparts)

 genes whose functions have not been previously described.

2010), and there is evidence to support each of these hypotheses for the expression of quantitative resistance in Conrad (Wang et al. 2010, 2012b).

In order to test various hypotheses associated with the molecular mechanisms of QDRL conferring resistance to P. sojae, an assay that allows the rapid screening of numerous genes is needed. Many methods currently exist to transform soybean to knock-down or knock-out genes.

Gene knock-down/silencing approaches include using a Bean pod mottle virus (BPMV)-based virus induced-gene silencing (VIGS; Zhang et al. 2010) and using Agrobacterium rhizogenes generated hairy roots on both plant stems and cotyledons (Collier et al. 2005; Cook et al. 2012;

Graham et al. 2007; Taylor et al. 2006; Xiong et al. 2014). Gene knock-out approaches include particle bombardment of cotyledons (Finer and McMullen 1991; Hernandez-Garcia et al. 2010) and fast neutron and T-DNA mutagenesis (Bolon et al. 2011; Clemente et al. 2000; Sato et al.

2004; Zhang et al. 1999). Newer technologies for transforming soybean include the use of designer nucleases, including zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs, Curtin et al. 2012), and Crisper/Cas9 (Jacobs et al. 2015; Michno et al. 2015)

VIGS has been used to study qualitative resistance to soybean rust (Pandey et al. 2011).

Soybean hairy roots have been used to study nodulation (Libault et al. 2010), qualitative resistance to P. sojae and/or function of P. sojae effectors, (Graham et al. 2007; Xiong et al.

2014), and resistance to soybean cyst nematode (SCN; Cook et al. 2012; Guo et al. 2015).

In this chapter, several approaches to adapt existing soybean hairy roots and VIGS methods to evaluate candidate genes for their role in quantitative resistance towards P. sojae were examined.

Materials and Methods

Selection of genes for hairy root assays

Five genes associated with QDRL from chromosome 19 were selected for promoter::GUS assays (Table 4.1). Three of these, Glyma.19g220100, Glyma.19g169500 (both encoding WD repeat containing proteins), and Glyma.19g221700 (WRKY transcription factor) were selected based on sequence and/or expression differences between Conrad and Sloan

100

(Wang et al. 2012b). One gene, Glyma.19g254000 (GH3 auxin-responsive) was selected based on its potential role in auxin responses, and the last gene, Glyma.19g170400 (encoding a WD repeat containing protein) was selected due to its similar annotation to Glyma.19g220100 and

Glyma.19g169500.

Genes for RNAi assays were selected based on their association with QDRL conferring resistance to P. sojae (Stasko et al. 2016; Wang et al. 2010, 2012b) or on their homology to known Arabidopsis genes involved in auxin transport, biosynthesis, and signaling pathways

(Table 4.2). Soybean homologs of Arabidopsis YUCCA and TIR1 genes were identified by a

BLASTP of the Arabidopsis protein sequence (TAIR v. 10) against the soybean proteome in

Phytozome. Soybean genes were grouped as homologs within soybean via Clustal W in the San

Diego Supercomputer Center Biology Workbench.

Construction of plasmids for hairy roots

Promoter::GUS constructs were generated by amplifying an approximately 2 kb region upstream of the transcription start site of each gene with Phusion Polymerase (New England

Biolabs). PCR was set up as follows: 10 μl of 5x Phusion HF buffer, 26 μM of dNTPs, 0.2 μM of each primer, 0.5 μl of Phusion polymerase, and 0.4 μM of genomic DNA. The reaction conditions were 98οC for 30 s, followed by 35 cycles of 98οC for 10s, 65 or 68οC for 1 min

(depending on the gene, Table 4.1), and 72οC for 1 min 15s, and ending with a final extension of

72οC for 10 min. PCR products were separated by electrophoresis on a 1% agarose gel, excised, and purified with QIExII Gel Extraction Kit (Qiagen, Valencia, CA). Due to the low concentration of the PCR products, they were ligated into a blunt-end vector (Invitrogen Inc.,

Carlsbad, CA) and cloned into E. coli DH5α cells. Plasmids were purified from the cells using a

Wizard® Plus SV Minipreps DNA Purification System (Promega, Madison, WI), and the insert

101

was removed with the appropriate restriction enzymes (Table 4.1). The fragment was purified with phenol:chloroform and ligated into the plasmid CGT5201 (Govindarajulu et al. 2008) upstream of a GUS reporter gene. The promoter::GUS construct was removed from CGT5201 with AscI, and ligated into the binary vector AKK1467b (Collier et al. 2005; Govindarajulu et al.

2009). Plasmids with the insert in the correct orientation were electroporated into Agrobacterium rhizogenesis K599 as previously described (Collier et al. 2005; Taylor et al. 2006). The

DR5::GUS plasmid was kindly provided by Henry Nguyen (University of Missouri) and inserted into A. rhizogenesis K599.

102

Gene ID Annotationa Vector Primer Sequence Primer Restriction Annealing (Wm82.a.2.v1/ NTI Direction Enzyme Site in temperature Wm82.a1.v1.1) Primer Primer (οC) Code Glyma.19g220100/ WD repeat ESI CCCCTCGAGGACTGAAACATCAAATGGCA F XhoI 68 Glyma19g40800 containing GTTTATCCGA protein ESJ GGGGGATCCGAGGGAAACTAGAAGCGAT R BamHI TCCGTGGACGC Glyma.19g169500/ WD repeat ESG CCCCTCGAGAATTTATAGTGCATCGTATA F XhoI 65 Glyma19g35280 containing CATGCATGTG protein ESH GGGCCATGGTCTTCTTTCTTTACACAAACT R NcoI TCTACTACC Glyma.19g170400/ WD repeat ESE CCCCTCGAGCGCAAACTCATTGAGAAATT F XhoI 68

103 Glyma19g35380 containing GATCTATCTC

protein ESF GGGCCATGGGCACTAATAAGATGCATGA R NcoI ATATTGACC Glyma.19g254000/ GH3 auxin- ESC CCCCTCGAGATATAACATAAACACGTATA F XhoI 65 Glyma19g44310 responsive TAACCTAAGG ESD GGGCCATGGCTGGGGGAGAATCTTGGTCT R NcoI TGTTTGAGGA Glyma.19g221700/ WRKY ESA CCCCTCGAGCACCATCAAAACCAAACAAG F XhoI 65 Glyma19g40950 transcription CATTACCAAT factor ESB GGGCCATGGGTATGTATGTATTTAGTGAG R NcoI ATGCAGAGAG aAccording to Wang et al. 2012b. Table 4.1. Genes selected for promoter::GUS analysis in composite plant hairy roots and primers and annealing temperatures used to amplify 2 kb upstream of the transcription start site with Phusion polymerase.

In order to investigate the effects of reduced gene expression of candidate genes associated with QDRL, RNAi binary vectors were generated using the Gateway system (Table

4.2; Wesley et al. 2001). Conrad (moderately resistant) and Sloan (moderately susceptible) plants were inoculated with P. sojae in a tray test. RNA was extracted RNeasy Plant Mini Prep Kit

(Qiagen, Valencia, CA) with the optional on-column DNase treatment, and cDNA was synthesized from 1 μg of RNA with the SuperScript III kit (Invitrogen Inc., Carlsbad, CA). A

400 bp target sequence was selected in each gene or in a conserved region for all the gene members of a given PIN/YUCCA group at a time using siRNA analysis (Massachusetts Institute of Technology) or RNAi designer (Invitrogen, Inc., Carlsbad, CA). Conserved regions were selected in PIN and YUCCA groups to avoid any functional redundancy among homologs. The target region was amplified from Conrad and Sloan cDNA with Phusion polymerase via PCR as follows: 94οC for 30 s, followed by 30 cycles of 94οC for 15 s, 48.5οC for 15 s, and 72οC for 30 s. This fragment was then ligated into the entry vector CGT11050 (Libault et al. 2009). The insert was then transferred into the destination vector CGT11017A (Libault et al. 2009). PCR and sequencing were used to confirm the presence and correct orientation of the insert for each vector. As a control, a construct that targeted the GUS gene for silencing was also generated using this method. Plasmids were then inserted into A. rhizogenes K599 as described above.

104

Gene ID Annotationa Construct Used in Used in Tested for (Wm82.a2.v1) name composite plants cotyledons silencing N/A (RNAi control) GUS CGT11066 Y Y N Glyma.01g044600 Transcription factor HEX, contains CGT11061 Y N N HOX and HALZ domains Glyma.18g155700 NADH-ubiquinone oxidoreductase CGT11062 Y Y N Glyma.18g284100 LEUCINE-RICH REPEAT CGT11063 N Y N RECEPTOR-LIKE PROTEIN KINASE, (description unavailable) Glyma.19g224400 nitrate transporter CGT11064 Y N N Glyma.19g176000 ABC transporter CGT11065 Y Y N Glyma.19g170400 WD40 repeat protein CGT11068 N Y N Glyma.18g155800 ycf1 protein/protein binding CGT11069 N Y N

105 Glyma.18g266000 UDP-Glycosyltransferase CGT11070 N Y N

superfamily protein Glyma.12g232900 Apocytochrome F, C-terminal CGT11071 N N N Glyma.18g283200 LEUCINE-RICH REPEAT- CGT11073 N Y N CONTAINING PROTEIN, (description unavailable) Glyma.19g169400 ABC transporter CGT11074 Y Y N Glyma.18g282200 SERINE CARBOXYPEPTIDASE- CGT11075 N Y N LIKE 20-RELATED, SERINE PROTEASE FAMILY S10 SERINE CARBOXYPEPTIDASE Glyma.19g224600 Transcription factor: Myb-related CGT11077 Y N N Continued aAnnotation from SoyBase (Grant et al. 2010) unless otherwise noted. bAnnotation based on nearest Arabidopsis homolog found by BLASTp in Phytozome. cAnnotation from Wang et al. 2015. Table 4.2. List of target genes for silencing by RNAi in soybean hairy roots.

Table 4.2. Continued Gene ID Annotationa Construct Used in Used in Tested for (Wm82.a2.v1) name composite plants cotyledons silencing Glyma.16g209400 Transporter, ABC superfamily CGT11080 Y Y Y (Breast cancer resistance protein)/ATP-binding Cassette transporter Glyma.19g245200 AUX/IAA family CGT11082 Y N Y Glyma.18g242300 Isopentenyl pyrophosphate: CGT11084 Y Y N dimethylallyl pyrophosphate isomerase 2 Glyma.03g169600 YUCCA pathway group 1b CGT11085 Y N N Glyma.19g206200 YUCCA pathway group 6b CGT11086 Y Y Y

106 (targets conserved

region of multiple genes) Glyma.08g547000 AtPIN1 homologc CGT11087 Y Y Y (targets conserved region of multiple genes) Glyma.13g101900 AtPIN2 homologc CGT11088 Y Y Y (targets conserved region of multiple genes) Glyma.04g0797000 YUCCA pathway group 2b CGT11089 Y N N (targets conserved region of multiple genes) Continued

Table 4.2. Continued Gene ID Annotationa Construct Used in Used in Tested for (Wm82.a2.v1) name composite plants cotyledons silencing Glyma.06g095400 TIR1 homolog group 3b CGT11090 Y N N (targets conserved region of multiple genes) Glyma.19g235200 MEKK and related serine/threonine CGT11091 Y Y N protein kinases/mitogen-activated kinase kinase kinase Glyma.02g254300 TIR1 homolog group 2b CGT11092 Y N N (targets conserved region of multiple

107 genes)

Glyma.19g171100 terpinoid biosynthetic process CGT11093 Y Y N Glyma.03g209400 TIR1 homolog group 1b CGT11094 Y N N (targets conserved region of multiple genes) Glyma.07g217900 AtPIN3/AtPIN4/AtPIN7 homologc CGT11095 N Y N (targets conserved region of multiple genes)

Generation of composite plant-based hairy roots

Seeds were sterilized as follows. The seeds were placed in a single layer in a Petri dish, without the lid. Petri dishes were placed in a vacuum desiccator in a fume hood. One hundred ml of sodium hypochlorate was placed in a 250 ml beaker. The beaker was placed inside the desiccator. One ml of concentrated hydrochloric acid was then added to the beaker. The lid of the desiccator was immediately put on, and a vacuum was generated by turning on a UN86KTP

Laboport® mini pump (KNF lab, Trenton, NJ) for 2-5 min. The desiccator was then sealed, and the pump was shut off. The seed remained in the desiccator in the fume hood overnight

(Govindarajulu et al. 2008; 2009). After sterilization, the seeds were planted in potting mix and kept in the greenhouse until the seedlings reached the V1 stage.

A. rhizogenes containing the vector of interest or the control vectors CGT5205

(constitutive GUS expression, control for promoter::GUS assays; Govinddarajulu et al. 2008,

2009) or CGT11066 (RNAi-GUS construct, control for RNAi vectors) was grown in 50 to 100 ml of Luria-Bertani (LB) broth plus 50 units of Kanamyacin at 30оC 200 to 218 rpm overnight.

Fifty ml of the culture was centrifuged at 4,000 rpm for 10 min at 23оC. The supernatant was discarded, and the pellet was re-suspended in ¼ Murashige and Skoog (Phytotechnology

Labooratories, Shawnee Mission, KS) basal medium (¼ MS, pH 5.8). The optical density (OD) of the suspension was measured on a Cary 50 Bio UV-visible spectrophotometer (Varian) at 600 nm and adjusted to 0.2-0.4 with ¼ MS as needed (Coller et al. 2006; Govindarajulu et al. 2008;

2009; Taylor et al. 2006).

Soybean seedlings were cut at a 45-degree angle at the stem just below the uppermost fully expanded trifoliate. Cuttings were placed in the A. rhizogenes suspension and subjected to a

108

vacuum for about 2-5 min. Cuttings were then placed on a damp paper towel in a sealed plastic bag and dried for 1 week (Coller et al. 2006; Govindarajulu et al. 2008; 2009; Taylor et al. 2006).

During early experiments, cuttings were planted in flats ¼ full of coarse vermiculite (Perlite

Vermiculite Packing Industries, Inc., North Bloomfield, OH) topped with fine vermiculite or with a mixture of 1liter fine vermiculite (Perlite Vermiculite Packing Industries, Inc., North

Bloomfield, OH) to 10 ml Osmocote® (The Scotts Company, Marysville, OH). In later experiments, flats were replaced with 10.16 cm pots.

Inoculation of composite plant-based hairy roots with P. sojae, Py. irregulare, and F. graminearum

Several different approaches were used to inoculate composite plant-based hairy roots.

For the promoter::GUS studies and the initial RNAi silencing work, the roots were washed in tap water and placed in a sterile beaker with 40-100 ml of either 1.0 x 103 to 1.0 x 104 zoospores/ml or sterile deionized/distilled water (pH between 6.8 and 7.2) for twenty to thirty minutes. The roots were then removed from the beaker and placed on trays as in a tray test (Wang et al. 2010;

Stasko et al. 2016). Roughly equal numbers of plants were placed on each tray; however, the exact number of plants and roots varied by rep as not all plants survived the transformation process. Roots were checked for GFP-expression under a 480 nm excitation/515 emission fluorescein isothiocyante long pass filter on a Zeiss Stemi SV11 microscope (Govindarajulu et al. 2008; 2009) to confirm that the roots were transgenic and not adventitious. In promoter::GUS studies, all GFP positive roots were collected for GUS staining.

In an effort to speed up the inoculation process and to reduce the total volume of zoospores needed, two variations of the tray test were attempted for the RNAi silencing constructs. In one variation, a paper towel strip was placed across the roots 2 cm or 6 cm below

109

the root/shoot transition zone. Phytophthora sojae OH25 zoospores (100 μl of 2.7 x 103 to 1.3 x

104 zoospores/ml) were transferred onto the strips near each plant with a pipette. As the plants were older than the seedlings commonly used in the regular tray test assay, they tended to decline rapidly in the buckets. Therefore, 2 liters of Hoagland’s solution (Ca(NO3)2, KNO3,

MgSO4 ● 7H2O, KH2PO4, minor elements(H3BO3, MnCl2 ● 4H2O, ZnSO4 ● 7H2O, CuSO4 ●

5H2O, H2MoO4 ● H2O), modified from Hoagland and Arnon 1950) were added to the buckets instead of deionized water. After inoculation, deionized water was added to the buckets as needed to maintain moist conditions.

As an alternative to zoospore-based inoculation, a mycelial slurry-based inoculation was also used. In this case, a mycelial slurry of either P. sojae OH25 grown on dilute lima bean agar

(Schmitthenner and Bhat 1994) or Pythium irregulare Br2-3-5 grown on potato carrot agar was applied directly over the roots 2 cm from the root-shoot transition zone. The plants were then placed in buckets and checked for disease symptoms 7 d later. Additionally, a set of plants were inoculated with a suspension of Fusarium graminearum spores on trays with germination paper in place of the pad and cloth. Plants were checked for disease symptoms at 7 and 14 dai.

As the zoospores gave more consistent and obvious disease symptoms than the mycelial slurry, they were used in further experiments. However, with the tray test method, the roots had a tendency to oxidize while being exposed to the air during the set-up, making it difficult to determine if a brown root phenotype was due to oxidation or to disease. Therefore, an alternative approach that did not require the roots to be exposed was developed.

We adapted a method (Dorrance and McClure 2001) that used zoospores to inoculate soybeans grown in polystyrene cups. In place of the flats, two-to-three Agrobacterium infiltrated composite plants were placed in 10.16 cm pots filled with ⅓ coarse vermiculite and ⅔ of the fine

110

vermiculite/Osmocote mixture described above. When plants were ready for inoculation with P. sojae, a solution of 7.5 x 103 to 1.2 x 104 zoospores/ml was added to the pots in various ways. In one approach, 25 ml of zoopores were put into plastic bags that were placed under each pot.

Mock treated pots had bags of 25 ml of sterile, distilled H2O placed under them. In another experiment, the zoospores were poured directly into the pots. Plugs of OH25 growing on nonclarified agar were also added to the pots next to each root. Of these, putting the bags underneath the pots was most effective. However, we still did not have consistent infection.

Finally, a modified layer test was evaluated. After allowing the composite plants to re- root, the vermiculite/Osomocote mix and the plants were gently removed from the pots. The roots were kept in a container of tap water to prevent them from drying out and oxidizing. The pots were refilled ⅔ of the way with the same vermiculite/Osmocote mixture and a plate of 7-d- old P. sojae OH25 on lima bean agar was placed on top of the vermiculite. The plants were then placed on top, with the roots directly touching the agar. Roots were then covered with the remaining vermiculite/Osomocote mixture. Mock inoculated plants had a plate of lima bean agar with no P. sojae placed in the pot. For all pot-inoculations, the roots were washed 7-10 dai, photographed (before and/or after separating for GFP expression), separated based on presence or absence of GFP expression, and collected for RNA extraction.

Generation of cotyledon-based hairy roots

Cotyledon hairy roots were generated as follows. Seed was sterilized with chlorine gas twice as described above. In later reps, to decrease contamination, seeds were first surface disinfested with 10% bleach for 1 min, rinsed in sterile diH2O for 1 min, and allowed to dry before the two chlorine gas treatments. They were then placed on ¼ MS (pH 5.8) agar plates.

111

Plates were sealed with Parafilm and kept in a humidity box in an incubator at 23-25оC with a

18h light:6h dark for 7-10 d.

Agrobacterium rhizogenes was prepared as described above. Cotyledons were excised from the hypocotyl, placed in the bottom of a plastic Petri plate with 15-25 ml of the A. rhizogenes K599 solution described above, and left in a laminar flow hood for 20 min. The A. rhizogenes was removed with a serological pipet. The plates were sealed with Parafilm and incubated at the same conditions as germinating seeds for 3 d. They were washed for 30 min. with ¼ MS plus carbenicillin (500 mg/liter) broth to eliminate any remaining bacteria and inserted into ¼ MS plus carbenicillin plates. Cotyledons were placed abaxial side up, with the cut surface facing out of the media. Three-to-four weeks later, roots were examined for GFP expression as described above. GFP-expressing roots were placed on separate ¼ MS plus carbenicillin plates from roots not expressing GFP.

Confirmation of silencing in hairy roots

To test if the gene expression was decreased by the construct, RNA was extracted from both GFP expressing (GFP+) and non-GFP expressing (GFP –) composite plant-based roots with the RNeasy Plant Mini Prep Kit as described above. RNA was extracted from cotyledon-based roots using TRIzolTM (Invitrogen Inc., Carlsbad, CA) modified from the manufacturer’s instructions by adding the reagent directly to the mortar containing the ground tissue and performing all centrifuge steps at room temperature (approximately 24-26οC). The level of gene expression from all roots was assessed using semi-quantitative (sq) PCR. An F-box gene (cons6;

Libault et al. 2008) or a ubiquitin gene (Zhou et al. 2009) was used as a reference. The reaction conditions were as follows: 94οC for 30 s, followed by 25-35 cycles of 94οC for 15 s, 48.5-52οC

112

for 15 s, and 72οC for 30 s. Gene expression was considered reduced if the GFP + sample had a fainter band than the GFP- samples on a 1% agarose gel.

Inoculation of hairy roots with P. sojae and GUS staining

In promoter::GUS experiments, GFP expressing hairy roots were placed in a 6-well plate at 0, 12, 24, 48, and 72 hai and submerged in ½ X-gluc (modified from Jeffereson et al. 1987).

They were incubated at 37οC for 1-12 h. Roots were then examined for GUS staining.

For DR5::GUS experiments, ten-to-fifteen roots of each construct and treatment per cultivar were stained with ½ X-gluc for 30 min at 37οC. For the CGT5205 control, ten-to-fifteen roots of GFP expressing and of non-GFP expressing roots were inoculated and stained. The ½ X- gluc was removed from the each well and replaced with 0.1 M NaH2PO4 (pH 7.0). The roots were first examined under a dissecting scope at 6.5 to 10x magnification for the presence of GUS staining. Ten roots of each construct and treatment per cultivar were examined under a compound light microscope at 100 to 400x total magnification to view tissue-specific expression of GUS and location of P. sojae oospores and mycelia. Pictures of the roots were taken with a

MU503 camera equipped with a FMA050 fixed microscope adapter (AMScope). Due to the number of roots examined and the level of detail required for these observations, only a few roots were examined at a time. Unexamined roots were stored at 4οC.

VIGS vector construction

Three auxin-responsive genes associated with the QDRL on chromosome 19,

Glyma.19g181900, Glyma.19g183700, and Glyma.19g183900, were selected for silencing with

VIGS (Table 4.3). The coding sequence of each gene from Conrad was checked for introns and uncalled base pairs. Once these were trimmed, the sequence was checked for homology to

113

sequences at NCBI and was used to search for a siRNA target in BLOCK-iT Designer

(Invitrogen, Carlsbad, CA). A 300-400 nt region was selected as the target insert. Additional sites were added to either end of the target sequences to allow for use with Gibson Assembly cloning. The inserts were then synthesized as gBlocks (Intergrated DNA Technologies, Inc.) and moved into the VIGS vector using Gibson Assembly (New England Biolabs).

Gene ID (Wm82a2.v1) VIGS code Annotationa

Glyma.19g181900 AS5 AUX/IAA family, B3 DNA binding domain, auxin response factor Glyma.19g183700 AS7a Auxin responsive protein Glyma.19g183900 AS9 Auxin responsive protein aFrom Stasko et al. 2016. Table 4.3 List of genes used in VIGS silencing assays with their VIGS code.

The vector used for VIGS was a BPMV RNA2 modified from Zhang et al. (2010). In this modified vector, named VAL, the insert was placed in the 5’ untranslated region (UTR). VAL was co-bombarded with the RNA1 segment of BPMV (Zhang et al. 2010) into lima bean cotyledons as previously described (Hernandez-Garcia et al. 2010). Both contain 35S promoter and nopaline synthase (NOS) terminator, which can be recognized by plant RNA-dependent polymerases to synthesize RNA from the DNA-based construct. A small percentage of the bombardment contained a GFP-expressing RNA2 to allow for visualization of the virus infection and movement. Infected lima beans are then ground and used to inoculate soybean leaves to increase the viral titer for subsequent inoculations. Either ground lima beans or soybean leaf sap was used to inoculate Conrad and Sloan.

114

Plant material and VIGS inoculation

For the last four replicates, Conrad and Sloan seed were sterilized with chlorine gas as described above. For all replications, fine vermiculite was mixed with of Osmocote in a ratio of 2 liters to 10 ml. Approximately 0.5 liter polystyrene cups were filled with 240 ml of the vermiculite-Osmocote mixture. Ten seeds were planted in each cup and then were covered with an additional 120 ml of vermiculite plus Osmocote. The cups were placed in 28.5 cm x 20 cm x

6 cm plastic trays. Enough tap water was added to the trays to allow the vermiculite to become completely wet when absorbing water from the bottom. The plants were kept in a growth chamber at the following conditions: 22о C, 50% relative humidity, and 16 h of light.

Plants were inoculated with VIGS vectors at the early VC stage, before the unifoliate was fully expanded. Plants were first thinned to three-to-five plants per cup. Frozen leaf sap from plants or lima bean cotyledons previously inoculated with VIGS constructs were thawed and kept on ice until use. The construct GUS-MR1, which targets the non-native GUS gene, was used as a silencing control. Buffer control plants were mock inoculated with buffer only. A cotton swab was dipped into the sap or buffer and then gently rubbed over the entire upper surface of both unifoliates on each plant. Plants were then placed back in the growth chamber.

Beginning 5-6 d after VIGS treatment up until inoculation with P. sojae, plants were checked every other day for GFP expression, indicating the presence of the VIGS construct, under a hand-held UVL-56 365 nm UV light (UVP LLC., Upland, CA).

P. sojae inoculation of VIGS plants

Two weeks after inoculation with the VIGS constructs, the plant height of each plant was measured from the soil line to the tip of the leaf primordia. The plants were then removed from the cups, and the roots were washed in tap water to remove the vermiculite. A cotton wicking 115

pad and a polyester cloth were laid on top of a plastic tray with one edge removed as previously described (Burnham et al. 2003; Wang et al. 2010, 2012a; 2012b; Stasko et al. 2016). Plants were laid on the polyester cloth, and a small scratch was made 4 cm from the crown on the main tap root of each plant. The scratch was covered with a mycelial slurry of 7-d-old P. sojae OH25 grown on dilute lima bean agar. One plant from each construct was mock inoculated with dilute lima bean agar alone. The trays were stacked together and placed in a plastic bucket with 4 liters of diH2O. The bucket was kept in the same growth chamber conditions as described above for one week. The lesion length was then measured from the upper part of the inoculation site to the upper edge of the lesion margin. For the second replication, the root weight of all the plants on the tray was measured.

Confirmation of virus-induced silencing of target genes in leaves and roots

To test if silencing was successful, the middle leaflet was collected from two plants 7, 10, and 14 d after virus inoculation and a 1 cm section of the main tap root was collected from the lesion margin or from 2 cm above the inoculation site (on inoculated trays where all plants were non-symptomatic) 7 dai with P. sojae. On mock inoculated plants, the region closest to the lesion margin of the corresponding inoculated plants was sampled. Root sections for all plants on the same tray were pooled into a single sample. Inoculated trays had four-to-eight plants per tray.

Mock trays had one-to-two plants per tray.

RNA was extracted using TRIsureTM (Bioline, London, United Kingdom) with Direct- zolTM RNA Mini-prep Kit (Zymo Research, Irvine, CA). The RNA concentration was measured on a ND-1000 Nanodrop (Nanodrop Technologies, Wilmington, DE) and adjusted to 200 ng/μl.

RNA integrity was checked on a 1% agarose gel (Fig. 4.14; Fig. 4.15; Fig. 4.16; Fig.4.17). First-

116

strand cDNA synthesis was performed using Fermentas RevertAid reverse transcriptase and

RiboLock RNase inhibitor (ThermoFisher Scientific, Inc.). A non-reverse transcriptase control, containing all reaction components except the enzyme, was also generated. Semi-quantitative

PCR was performed on cDNA with the following conditions: 94οC for 2 min followed by 27-38 cycles of 94οC for 15 s, 54οC for 15 s, and 72οC for 30 s with a final extension of 72οC for 7 min.

The number of cycles was adjusted as needed to increase or decrease the intensity of the product bands compared to the DNA ladder on a 1% agarose gel. Cons4 (Libault et al. 2008) was used as the reference gene. Absence of genomic DNA in RNA samples was confirmed by using the non- reverse transcriptase controls as a template for sqPCR with the reference.

Results and Discussion

Promoter::GUS composite plant hairy root assays

Promoters of three genes associated with the QDRL on chromosome 19 were successfully cloned into CGT5201 and were tested for the induction of GUS in composite plant- based hairy roots at 12, 24, 48, and 72 hai. However, none of the genes had consistent GUS expression at any of the time points over two-to-three replicates (Table 4.4; Table; 4.5; Table

4.6). However, Glyma.19g254000 from Conrad was activated at 72 hai in mock roots in Sloan, but not in inoculated roots in either cultivar. The same promoter from Conrad was activated in inoculated roots of Conrad background at 24 hai, but not in the Sloan background in both reps

(Table 4.4). GUS staining was not consistently observed with the promoter of Glyma.19g22170, but when present, it occurred primarily in roots transformed with the Conrad promoter, regardless of genetic background (Table 4.5). The Glyma.19g170400 promoter from either cultivar only had occasional GUS staining regardless of background or treatment (Table 4.6).

117

To monitor the GUS expression in more roots, the Glyma.19g170400 promoter constructs were also examined at 24 hai only. Again, none of the roots transformed with the promoter::GUS construct were positive for GUS staining, whereas 55.56% of the control were

GUS positive in Conrad hairy roots and 27.78-57.45% were GUS positive in Sloan hairy roots

(Table 4.7). Therefore, it seems unlikely that the promoters of these genes respond to inoculation in the quantitative resistance phenotype.

Promoter GeneID Cultivar of Cultivar Treatment Time point (hai) (Wm82.a2.v1) Promoter transformed 0 12 24 48 72 Origin Constitutive GUS N/A Conrad Mock -- .+ .+ ++ ++ Control Constitutive GUS N/A Sloan Mock ++ +- ++ ++ -+ Control Glyma.19g254000 Conrad Conrad Mock -+ .+ -+ -- .. Glyma.19g254000 Conrad Sloan Mock ++ -+ -+ -+ ++ Glyma.19g254000 Sloan Conrad Mock -- -+ -+ -- -- Glyma.19g254000 Sloan Sloan Mock -+ -. ++ -- -- Constitutive GUS N/A Conrad Inoculated -+ ++ ++ ++ ++ Control Constitutive GUS N/A Sloan Inoculated -+ -+ ++ -+ ++ Control Glyma.19g254000 Conrad Conrad Inoculated -. -- ++ +. -- Glyma.19g254000 Conrad Sloan Inoculated -+ -+ -- -+ -- Glyma.19g254000 Sloan Conrad Inoculated -- -+ -- -+ -+ Glyma.19g254000 Sloan Sloan Inoculated -- -+ -- -- +- Table 4.4. Presence/absence of GUS staining in composite plant hairy roots transformed with a constitutive control or Glyma.19g254000 promoter. Data are from two reps. +positive for GUS staining, -negative for GUS staining, . missing from rep

118

Promoter Cultivar of Cultivar Treatment Time point (hai) GlymaID Promoter transformed 0 12 24 48 72 Origin Constitutive GUS N/A Conrad Mock .++ +++ -++ .++ .++ Control Constitutive GUS N/A Sloan Mock +.. +++ -++ +++ -++ Control Glyma.19g221700 Conrad Conrad Mock -++ -+- -+- -+- -+. Glyma.19g221700 Conrad Sloan Mock -++ +-- -+- .++ .++ Glyma.19g221700 Sloan Conrad Mock --+ ------.-- --. Glyma.19g221700 Sloan Sloan Mock -.a. -.- -.- -.- -.- Constitutive GUS N/A Conrad Inoculated --+ -++ -++ -++ --- Control Constitutive GUS N/A Sloan Inoculated -+. ++. --+ -++ --. Control Glyma.19g221700 Conrad Conrad Inoculated --- -+- -+- -++ --+ Glyma.19g221700 Conrad Sloan Inoculated .+. -+- -+. .-- --- Glyma.19g221700 Sloan Conrad Inoculated ------+- Glyma.19g221700 Sloan Sloan Inoculated -.- -.- -.- -.- -.- aSloan plants transformed with the Sloan promoter were lost in rep 2 due to aphid infestation.

119

Promoter Source of Cultivar Treatment Time point (hai) GlymaID Promoter transformed 0 12 24 48 72 Amplified Constitutive GUS N/A Conrad Mock -+ ++ -+ ++ -- Control Constitutive GUS N/A Sloan Mock -+ ++ ++ ++ ++ Control Glyma.19g170400 Conrad Conrad Mock ------.+ .- Glyma.19g170400 Conrad Sloan Mock .- -+ -- .- .- Glyma.19g170400 Sloan Conrad Mock -- -- -+ -- .- Glyma.19g170400 Sloan Sloan Mock -- -- -+ -- -- Constitutive GUS N/A Conrad Inoculated +- -- ++ -+ -+ Control Constitutive GUS N/A Sloan Inoculated ++ ++ -+ ++ ++ Control Glyma.19g170400 Conrad Conrad Inoculated ------.- -- Glyma.19g170400 Conrad Sloan Inoculated ------+ .- Glyma.19g170400 Sloan Conrad Inoculated ------+- -- Glyma.19g170400 Sloan Sloan Inoculated +------Table 4.6. Presence/absence of GUS staining in composite plant hairy roots transformed with a constitutive control or Glyma.19g170400 promoter. Data are from two reps. +positive for GUS staining, -negative for GUS staining, . missing from rep

Construct/Cultivar Treatment Percent Roots with GUS Expression 24 hai Glyma.19g170400C/Conrad Inoculated 0 Glyma.19g170400C/Sloan Inoculated 0 Glyma.19g170400S/Conrad Inoculated 0 Glyma.19g170400S/Sloan Inoculated 0 Constitutive GUS control Conrad Inoculated 55.56 Constitutive GUS control Sloan Inoculated 27.78 Glyma.19g170400C/Conrad Mock 0 Glyma.19g170400C/Sloan Mock 0 Glyma.19g170400S/Conrad Mock 0 Glyma.19g170400S/Sloan Mock 0 Constitutive GUS control Conrad Mock 55.56 Constitutive GUS control Sloan Mock 57.45 Table 4.7. Percent of hairy roots positive for GUS staining when driven by the promoter of Glyma.19g170400 cloned from Conrad (C) or Sloan (S) or a constitutive promoter 24 hours after inoculation (hai) with P. sojae.

120

Inoculation of composite plant hairy roots containing RNAi constructs

We next tested several different approaches to inoculate and assess disease in composite plant hairy roots. A modified tray test was used to test two different P. sojae inoculation methods (zoospores and mycelial slurry), a Py. irregulare inoculation

(mycelial slurry), and a F. graminearum inoculation (conidia suspension). For the P. sojae inoculations, the zoospore method produced more severe symptoms than the mycelial slurry (Fig. 4.1 A-B, E-F, I-J). The Py. irregulare and F. graminearum inoculations produced symptoms on only a few plants (Fig. 4.1 C-D, G-H, K-L).

Therefore, we proceeded with a zoospore inoculation-based tray test for the RNAi transformed hairy roots.

121

However, as these studies progressed, the roots oxidized when exposed to air.

Therefore, it was difficult to distinguish this from true disease symptoms, as the oxidation was also present on mock inoculated plants (Fig. 4.2).

122

Figure 4.2. Root oxidation in composite plant hairy roots generated with the RNAi vector targeting Glyma.19g176000 (CGT11065). Conrad (A) and (B). Sloan (C) and (D). Mock inoculated (A) and (C). Inoculated with Phythophthora sojae OH25 zoospores (B) and (D).

To decrease the chance of oxidation, we next moved to methods were the zoospores were placed underneath or poured into pots of composite plants. This removed the need to expose the roots to the air during inoculation. However, these approaches

123

produced inconsistent disease symptoms (Fig. 4.3) or required more time (10 dai instead of 7 dai) for symptoms to appear (Fig. 4.4).

Figure 4.3. Composite plant-based hairy roots transformed with the RNAi vector targeting Glyma.19g176000 (CGT11065) inoculated with zoospores (B) and (D) or mock inoculated with sterile distilled water (A) and (C) placed beneath pots used for growing. (A) and (B) Conrad. (C) and (D) Sloan.

124

Figure 4.4. Composite plant-based hairy roots transformed with the RNAi construct targeting Glyma.19g224600 (CGT11077) inoculated with zoospores (B) and (D) or mock inoculated with sterile distilled water (A) and (C) poured into pots used for growing from the top. (A) and (B) Conrad. (C) and (D) Sloan.

Placing plugs of P. sojae mycelia in the vermiculite/Osmocote mix near the roots produced mild disease symptoms (Fig. 4.5).

125

Figure 4.5. Composite plant-based hairy roots transformed with the RNAi construct targeting Glyma.03g169600 and its homologs (CGT11085) inoculated with P. sojae OH25 (B) and (D) or mock inoculated nonclarified V8 plugs (A) and (C). (A) and (B) Conrad. (C) and (D) Sloan.

Finally, we tested a modified layer test, where a layer of agar with or without P. sojae was placed in the pot, and the hairy roots were placed directly onto the agar. This approach produced consistent disease symptoms while preventing root oxidation (Fig.

4.6).

126

Figure 4.6. Sloan composite plant hairy roots transformed with is the RNAi construct targeting Glyma.02g254300 and its homologs (CGT11092). Plants on the left were inoculated with a layer of agar containing a P. sojae culture. Plants on the right are the non-inoculated control.

Cotyledon-based RNAi hairy-roots

In an effort to expedite the hairy-root assays and to provide a means to look first at gene silencing, cotyledon-based hairy root approach was also tested. In preliminary experiments, we found that dipping the roots in a 400 µl of P. sojae OH25 zoospores

(Xiong et al. 2014) successfully produced disease symptoms (Fig. 4.7). This seems to be the best approach moving forward to test other candidate genes at this time.

127

Figure 4.7. Conrad (A) and (B) and Sloan (C) and (D) cotyledon-based hairy roots transformed with the RNAi construct targeting Glyma.13g101900 and its homolog (CGT11088). (A) and (C) mock inoculated with sterile, distilled H2O. (B) and (D) inoculated with P. sojae OH25 zoospores.

Confirmation of gene silencing in hairy roots

RNA was extracted from the composite plant-based hairy roots transformed with

CGT11080 and CGT11082 and from cotyledon-based hairy roots transformed with

CGT11086, CGT11087, and CGT11088. Of these five constructs, CGT11080 appeared to be somewhat successful in silencing the target Glyma.16g209400 in Conrad inoculated roots (Fig. 4.8). However, the reference F-box gene (cons6; Libault et al. 2008) was not detected in all samples. Therefore, this construct should be retested.

128

The construct CGT11087 reduced the expression of GmPIN1 genes in all three cultivars, while CGT11088 was only partially successful in silencing GmPIN2 genes in

Conrad and Williams 82 and was not successful in Sloan. CGT11086, targeting the

YUCCA group 6 genes, had mixed results in Conrad and Williams 82 and was not successful in Sloan (Fig. 4.9). Cotyledon-based hairy roots are commonly used for functional gene analysis in the soybean-P. sojae system (Graham et al. 2007; Xiong et al.

2014) and are easier to inoculate than composite plant-based hairy roots. While some of the RNAi constructs appear promising, others, such as CGT11086, need to be redesigned.

Additionally, Agrobacterium is known to alter host hormone pathways (reviewed in in

Spaepen et al. 2007; Robert-Seilaniantz et al. 2011), making hairy roots a less ideal system for studies with auxin. Another challenge is accurately assessing disease in order to determine if there has been any change to the quantitative phenotype. Root oxidation in the composite plants made it difficult to visually or digitally rate the disease.

Cotyledon-based hairy roots get around many of those challenges but are small and difficult to cut open to visualize the lesion. A qRT-PCR approach measuring the amount of P. sojae actin has been used with hairy roots in the past (Xiong et al. 2014) and may be useful here.

129

Figure 4.8. Testing for gene silencing in composite plant-based hairy roots transformed with the RNAi construct targeting Glyma.16g209400 (CGT11080). A F-box gene, cons6, (Libault et al. 2008) was used as a reference. Wt-wild type, non-transformed root, +root expressed GFP (likely transgenic), -root did not express GFP (adventious, non- transgenic)

130

Figure 4.9. Testing for gene silencing in cotyledon-based hairy roots transformed with RNAi constructs targeting GmPIN1 (Glyma.08g547000 and homologs, CGT11087), GmPIN2 (Glyma.13g101900 and its homolog, CGT11088) and YUCCA group 6 (Glyma.19g206200 and its homologs, CGT11086) by semi-quantitative PCR. Ubiquitin (Zhou et al. 2009) was used as a reference. W82-Williams 82, C-Conrad, N-non-template control, +-root expressed GFP (likely transgenic), - root did not express GFP (adventious, non-transgenic)

GUS staining in DR5::GUS roots inoculated with P. sojae

For both Conrad and Sloan, GUS staining was observed in the root tips but not the vascular tissue of the primary roots (Fig. 4.10 A-B; Fig. 4.11 A-D) transformed with the

DR5::GUS construct. GUS staining did occur in the vascular tissue and root tips of inoculated lateral roots (Fig. 4.11 I). In contrast, GUS staining was present in the root tip and vascular tissue of mock inoculated roots of both varieties (Fig. 4.10 C-F; Fig. 4.11 E-

131

H). The CGT5205 GUS constative control was expressed in the root tips and vascular tissue in mock and inoculated roots in both culitvars (Fig. 4.12; Fig. 4.13).

Figure 4.10. Conrad hairy roots transformed with DR5::GUS construct inoculated with P. sojae zoospores (A-B) or mock inoculated (C-F) with sterile, distilled water and stained with ½ X-gluc for 30 min. Roots were flattened with a coverslip and viewed under 10x objective. (A), (C), and (E) root tips. (B), (D), (F) vascular tissue in upper portion of the root tip shown in (A), (C), or (E), respectively.

132

Figure 4.11. Sloan hairy roots transformed with DR5::GUS construct inoculated with P. sojae zoospores (A-D, I) or mock inoculated (E-H) with sterile, distilled water and stained with ½ X-gluc for 30 min. Roots were flattened with a coverslip and viewed under 10x objective. (A), (C), (E), and (G) root tips. (B), (D), (F), and (H) vascular tissue in upper portion of the root tip shown in (A), (C), (E), or (G), respectively. (I) lateral root from root shown in (A) and (B).

Figure 4.12. Conrad hairy roots transformed with CGT5205 consitutive GUS construct inoculated with P. sojae zoospores (A-D) or mock inoculated (E-H) with sterile, distilled water and stained with ½ X-gluc for 30 min. Roots were flattened with a coverslip and viewed under 10x objective. (A), (C), (E), and (G) root tips. (B), (D), (F), and (H) vascular tissue in upper portion of the root tip shown in (A), (C), (E), or (G), respectively.

133

Figure 4.13. Sloan hairy roots transformed with CGT5205 consitutive GUS construct inoculated with P. sojae zoospores (A-D) or mock inoculated (E-F) with sterile, distilled water and stained with ½ X-gluc for 30 min. Roots were flattened with a coverslip and viewed under 10x objective. (A), (C), and (E) root tips. (B), (D), and (F) vascular tissue in upper portion of the root tip shown in (A), (C), or (E), respectively.

VIGS in Conrad and Sloan leaves and roots

The BPMV vector was detected in both leaves and roots of VIGS-treated Conrad and Sloan (Fig. 4.14; Fig. 4.15, Fig. 4.16; Fig. 4.17) However, silencing of the targeted genes was only successful in the leaves. The following trends in gene expression were observed. Glyma.19g183700 appears to be expressed in the leaves but has low or no expression in the roots for both cultivars. Glyma.19g181900 is expressed in both tissues in both cultivars. Glyma.19g183900 is expressed in the roots but has low or no expression in leaves of Conrad and Sloan.

While BPMV has been used as a VIGS vector in soybean in previous studies, it has mainly been effective when studying foliar traits such as resistance to soybean rust

(Pandey et al. 2011). A study examining the role of CLE receptors in resistance to SCN

134

also found that BPMV-based vectors did not silence the target genes in the roots (Guo et al. 2015). Instead, they found hairy roots to be more effective (Guo et al. 2015).

However, additional studies using a more virulent RNA1 of BPMV or other viruses are still needed, especially for auxin-centered experiments.

Figure 4.14. Expression of Glyma.19g181900 (AS5), Glyma.19g183700 (AS7a) and Glyma.19g183900 (AS9) in Conrad leaves inoculated with VIGS constructs. Mock- leaves rubbed with buffer without virus, GUS-GUS RNAi silencing control, VIGS-AS5- inoculated with construct targeting Glyma.19g181900, VIGS-AS7a-inoculated with construct targeting Glyma.19g183700, VIGS-AS9-inoculated with construct targeting Glyma.19g183900, Rep#-biological rep used to isolate RNA, RT+-reverse transcriptase positive sample, Cons4-reference gene (Libault et al. 2008), BR2-presence of BPMV, # x-number of cycles used in semi-quantitative PCR

135

Figure 4.15. Expression of Glyma.19g181900 (AS5), Glyma.19g183700 (AS7a) and Glyma.19g183900 (AS9) in Sloan leaves inoculated with VIGS constructs. Mock-leaves rubbed with buffer without virus, GUS-GUS RNAi silencing control, VIGS-AS5- inoculated with construct targeting Glyma.19g181900, VIGS-AS7a-inoculated with construct targeting Glyma.19g183700, VIGS-AS9-inoculated with construct targeting Glyma.19g183900, Rep#-biological rep used to isolate RNA, RT+-reverse transcriptase positive sample, Cons4-reference gene (Libault et al. 2008), BR2-presence of BPMV, # x-number of cycles used in semi-quantitative PCR

136

Figure 4.16. Expression of Glyma.19g181900 (AS5), Glyma.19g183700 (AS7a) and Glyma.19g183900 (AS9) in Conrad roots inoculated with VIGS constructs. Mock-leaves rubbed with buffer without virus, GUS-GUS RNAi silencing control, VIGS-AS5- inoculated with construct targeting Glyma.19g181900, VIGS-AS7a-inoculated with construct targeting Glyma.19g183700, VIGS-AS9-inoculated with construct targeting Glyma.19g183900, P.s.-roots inoculated with P. sojae, M- roots inoculated with lima bean agar, RT+-reverse transcriptase positive sample, Cons4-reference gene (Libault et al. 2008), BR2-presence of BPMV, # x-number of cycles used in semi-quantitative PCR

137

Figure 4.17. Expression of Glyma.19g181900 (AS5), Glyma.19g183700 (AS7a) and Glyma.19g183900 (AS9) in Conrad roots inoculated with VIGS constructs. Mock-leaves rubbed with buffer without virus, GUS-GUS RNAi silencing control, VIGS-AS5- inoculated with construct targeting Glyma.19g181900, VIGS-AS7a-inoculated with construct targeting Glyma.19g183700, VIGS-AS9-inoculated with construct targeting Glyma.19g183900, P.s.-roots inoculated with P. sojae, M- roots inoculated with lima bean agar, RT+-reverse transcriptase positive sample, Cons4-reference gene (Libault et al. 2008), # x-number of cycles used in semi-quantitative PCR

Conclusions

Of the two methods tested here, RNAi in hairy roots was more effective at silencing genes in the roots than VIGS. Composite plant-based hairy roots proved to be very difficult to inoculate with P. sojae, as the roots were prone to oxidation, making it difficult to use tray test-based inoculations. A modified layer test was the most successful inoculation technique, but the plants needed 1.5 to 2 months before they were ready for

138

inoculation with P. sojae. Cotyledon-based hairy roots were more quickly generated, were easier to inoculate with P. sojae, and were fewer in number making it easier to distinguish GFP expressing roots from non-GFP expressing roots. However, as there is no stem in this system, signals from the upper portion of the plant will be absent, which could affect some soybean genes’ response to P. sojae. The remaining challenge going forward with hairy roots are to accurately assess disease to be able to measure an impact of gene silencing on quantitative resistance.

Cotyledon-based hairy roots containing the DR5::GUS construct are promising as a method to visualize auxin in soybean roots during infection with P. sojae. However, there are limitations with this approach. The staining product can diffuse into surrounding tissues (Holt and Withers 1958), which can give false positives, especially if the reaction proceeds for long periods of time. Jefferson (1987) suggests only short incubation times are needed to visualize acurrate results. Additionally, auxin accumulation is measured based on the response of the DR5 promoter rather than measuring auxin itself. Therefore, this method will provide a general location within the root were auxin may be present but is not a direct measurement of auxin levels in the root (Blakeslee and Murphy 2016).

The VAL version of the BPMV VIGS vector did not silence the target gene in the roots of the soybean plant. Therefore, other VIGS vectors should be tested. The advantage of the VIGS approach over hairy roots is that Agrobacterium is known to alter host auxin levels (reviewed in in Spaepen et al. 2007; Robert-Seilaniantz et al. 2011).

Since VIGS does not rely on Agrobacterium, drastic alterations in host auxin processes could be avoided. However, the plants are approximately 24-d-old when they are

139

inoculated with P. sojae. Age might play a role in quantitative resistance in soybean towards P. sojae, as suggested by previous studies (Mideros et al. 2007). Therefore, it might be necessary to test inoculating younger parts of the roots of VIGS-treated plants.

140

Bibliography

Abdelmajid, K., Ramos, L., Leandro, L., Mbofung, G., Yten, D., Santratzi, S., Grier, R., Njiti, V., Cianzia, S., and Meksem, S. 2012. The ‘PI 438489B’ by ‘Hamilton’ SNP-based genetic linkage map of soybean (Glycine max (L.) Merr.) identified quantitative trait loci that underlie seedling SDS resistance. J. Plant Geno. Sci. 1:18-30.

Acharya, B., Lee, S., Mian, M.A.R., Jun, T., McHale, L.K., Michel, A.P., and Dorrance, A.E. 2015. Identification and mapping of quantitative trait loci (QTL) conferring resistance to Fusarium graminearum from soybean PI 567301B. Theor. Appl. Genet. 128:827-838.

Adhikari, B.N., Hamilton, J.P., Zerillo, M.M., Tesserat, N., Lévesque, C.A., and Buell, C.R. 2013. Comparative genomics reveals insight into virulence strategies of plant pathogenic oomycetes. PLoS ONE 8:e75072.

Adie, B.A.T., Pérez-Pérez, J., Pérez-Pérez, M.M., Godoy, M., Sánchez-Serrano, J.J., Schmelz, E.A., and Solano, R. 2007. ABA is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defenses in Arabidopsis. Plant Cell 19:1665-1681.

Allen, T.W., Bradley, C.A., Sisson, A.J., Byamukama, E., Chilvers, M.I., Coker, C.M., Collins, A.A., Damicone, J.P, Dorrance, A.E., Dufault, N.S., Esker, P.D., Faske, T.R., Giesler, L.J., Grybausks, A.P., Hershman, D.E., Hollier, C.A., Isakeit, T., Jardine, D.J., Kelly, H.M., Kemerait, R.C., Kleczewski, N.M., Koenning, S.R., Kurle, J.E., Malvick, D.K., Markell, S.G., Mehl, H.L., Mueller, D.S., Mueller, J.D., Mulrooney, R.P, Nelson, B.D. et al. 2017. Soybean yield loss estimates due to diseases in the United States and Ontario, Canada, from 2010 to 2014. Plant Health Prog. 18:1927.

Andersen, C.L., Jensen, J. L., and Ørntoft, T.F. 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004:5245-5250.

Aoyagi, L.N., Lopes-Caitar, V.S., de Carvalho, M.C.C.G., Darben, L.M., Polizel- Podanosque, A., Kuwahara, M.K., Nepomuceno, A.L., Abdelnoor, R.V., and Marcelino- Guimarães, F.C. 2014. Genomic and transcriptomic characterization of the transcription

141

factor family R2R3-MYB in soybean and its involvement in the resistance responses to Phakopsora pachyrhizi. Plant Sci. 229:32-42.

Azzimonti, G., Marcel, T.C., Robert, O., Paillard, S., Lannou, C., and Goyeau, H. 2014. Diversity, specificity, and impacts on field epidemics of QTLs involved in components of quantitative resistance in the wheat leaf rust pathosystem. Mol. Breeding 34:549-567.

Bahrenfus, J.B., and Fehr, W.R. 1980. Registration of ‘Sloan’ soybean. Crop Sci. 20:673.

Bai, Y., Pavan, S., Zhung, Z., Zappel, N.F., Reinstädler, A., Lotti, C., De Giovanni, C., Ricciardi, L., Lindhout, P., Visser, R., Theres, K., and Panstruga, R. 2008. Naturally occurring broad-spectrum powdery mildew resistance in a Central American tomato accession is caused by loss of Mlo function. Mol. Plant Microbe Interact. 21:30-39.

Beagle-Ristaino, J.E., and Rissler, J.F. 1983. Histopathology of susceptible and resistant soybean roots inoculated with zoospores of Phytophthora megasperma f. sp. glycinea. Phytopathology 73:590-595.

Bent, A.F. 1996. Plant disease resistance genes: function meets structure. Plant Cell 8:1757-1771.

Bernard, R.L., and Lindahl, D.A. 1972. Registration of Williams soybean. Crop Sci. 12:716.

Bernard, R.L., P.E. Smith, M.J. Kaufmann, and A.F. Schmitthenner. 1957. Inheritance of resistance to Phytophthora root and stem rot in soybean. Agron. J. 49:391.

Blakeslee, J.J., Banyopadhyay, A., Lee, O.K., Mravec, J., Titapiwatanakun, B., Sauer, M., Makam, S.N., Cheng, Y., Bouchard, R., Adamec, J., Geisler, M., Nagashima, A., Sakai, T., Martinoia, E., Friml, J., Peer, W.A., and Murphy, A.S. 2007. Interactions among PIN-FORMED and P-glycoprotein auxin transporters in Arabidopsis. Plant Cell 19:131-147.

Blakeslee, J.J. and Murphy, A.S. 2016. Microscopic and biochemical visualization of auxins in plant tissues. In Enviromental Responses in Plants: Methods and Protocols. ed. Duque, P. Methods in Mol. Biol. 1398:37-53. New York, NY: Springer Science+Business Media.

Boevink, P.C., McLellan, H., Gilroy, E.M., Naqvi, S.H.Q., Yang, L., Wang, X., Turnbull, D., Armstrong, M.I., Tian, Q., and Birch, P.R.J. 2016. Oomycetes seek help from the plant: Phytophthora infestans targets host susceptibility factors. Mol. Plant 9:636-638.

Bolon, Y.-T., Huan, W.J., Xu, W.W., Grant, D., Stacey, M.G., Nelson, R.T., Gerhardt, D.J., Jeddeloh, J.A., Stacey, G., Muehlbauer, G.J., Orf, J.H., Naeve, S.L., Stupar, R.M., 142

and Vance, C.P. 2011. Phenotypic and genomic analyses of a fast neutron mutant population resource in soybean. Plant Physiol. 156:240-253.

Bostock, R.M., Pye, M.F., and Roubtsova, T.V. 2014. Predisposition in plant disease: exploiting the nexus in abiotic and biotic stress perception and response. Annu. Rev. Phytopathol. 52:517-549.

Broders, K.D., Lipps, P.E., Paul, P.A., and Dorrance, A.E. 2007a. Characterization of Pythium spp. associated with corn and soybean seed and seedling disease in Ohio. Plant Dis. 91:727-735.

Broders, K.D., Lipps, P.E., Paul, P.A., and Dorrance, A.E. 2007b. Evaluation of Fusarium graminearum associated with corn and soybean seed and seedling disease in Ohio. Plant Dis. 91:1155-1160.

Broders, K.D., Wallhead, M.W., Austin, G.D., Lipps, P.E., Paul, P.A., Muller, R.W., and Dorrance, A.E. 2009. Association of soil chemical and physical properties with Pythium spp. diversity, community composition, and disease incidence. Phytopathology 99:957- 967.

Brouwer, D.J., and St. Clair, D.A. 2004. Fine mapping of three quantitative trait loci for late blight resistance in tomato using near isogenic lines (NILs) and sub-NILs. Theor. Appl. Genet. 108:628-638.

Brown, N.A., Urban, M., van de Meene, A.M.L., and Hammond-Kosack, K.E. 2010. The infection biology of Fusarium graminearum: defining the pathways of spikelet colonization in wheat ears. Fungal Biol. 114:555-571.

Burkhardt, A., and Day, B. 2016. Plant pathogenic oomycetes: counterbalancing resistance, susceptibility, and adaptation. Can. J. Plant Pathol. 38:31-40.

Burnham, K.D., Dorrance, A.E., Van Toai, T.T., and St. Martin, S.K. 2003. Quantitative trait loci for partial resistance to Phytophthora sojae in soybean. Crop Sci. 43:1610-1617.

Chen, P., Gedling, R., Patil, G., Vuong, T.D., Shannon, J.G., and Dorrance, A.E. 2017. Genetic mapping and haplotype analysis of a locus for quantitative resistance to Fusarium graminearum in soybean accession PI567516C. Theor. Appl. Genet. 130:999- 1010.

Chen, R., Hilson, P., Sedbrook, J., Rosen, E., Caspar, T., and Masson, P.H. 1998. The Arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin- transport efflux carrier. Proc. Nat. Acad. Sci. 95:15112-15117.

143

Chen, L.-Q., Hou, B.-H., Lalonde, S., Takanaga, H., Hartung, M.L., Qu, X.-Q., Guo, W.J., Kim, J.-G., Underwood, W., Chaudhuri, B., Chermak, D., Antony, G., White, F.F., Somerville, S.C., Mudgett, M.B., and Frommer, W.B. 2010. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature. 468:527-532.

Cheng, Y., Ma, Q., Ren, H., Xia, Q., Song, E., Tan, Z., Li, S., Zhang, G., and Nian, H. 2017. Fine mapping of a Phytophthora-resistance gene RpsWY in soybean (Glycine max L.) by high-throughput genome-wide sequencing. Theor. Appl. Genet. 130:1041-1051.

Chi, Y.H., Paeng, S.K., Kim, M.J., Huang, G.Y., Melencion, S.M.B., Oh, H.T., and Lee, S.Y. 2013. Redox-dependent functional switching of plant proteins accompanying with their structural changes. Frontiers Plant Sci. 4:1-7.

Churchill, G.A., and Doerge, R.W. 1994. Empirical threshold values for quantitative trait mapping. Genetics 138:963-971.

Clemente, T. E., LaVallee, B.J., Howe, A.R., Conner-Ward, D., Rozman, R.J., Hunter, P.E., Broyles, D.L., Kasten, D.S., and Hinchee, M.A. 2000. Progeny analysis of glyphosate selected transgenic soybeans derived from Agrobacterium-mediated transformation. Crop Sci. 40:797-803.

Cock, P.J.A., Antao, T., Chang, J.T., Chapman, B.A., Cox, C.J., Dalke, A., Friedberg, I., Hamelryck, T., Kauff, F., Wilczynski, B., and de Hoon M.J.L. 2009. Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics 25:1422-1423.

Collier, R., Burgwyn, B., Walter, N., Lutke, K., and Taylor, C.G. 2005. Ex vitro composite plants: an inexpensive, rapid method for root biology. Plant J. 43:449-457.

Consonni, C., Humphry, M., Hautmann, H.A., Livaja, M., Durner, J., Westphal, L. , Vogel, J., Lipka, V., Kemmerling, B., Schulze-Lefert, P., Somerville, S.C., and Panstruga, R. 2006. Conserved requirement for a plant host cell protein in powdery mildew pathogenesis. Nature Genet. 38:716-720.

Contreras-Cornejo, H.A., López-Bucio, J. S. Méndez-Bravo, A., Macías-Rodríguez, L., Ramos-Vega, M., Guevara-García, Á.A., and López-Bucio, J. 2015. Mitogen-activated protein kinase 6 and ethylene and auxin signaling pathways are involved in Arabidopsis root-system architecture alterations by Trichoderma atroviride. Mol. Plant Microbe Interact. 28:701-710.

Cook, D.E., Lee, T.G., Guo, X., Melito, S., Wang, K., Bayless, A.M., Wang, J., Hughes, T.J., Willis, D.K., Clemente, T.E., Diers, B.W., Jiang, J., Hudson, M.E., and Bent, A.F. 2012. Copy number variation of multiple genes at Rhg1 mediates nematode resistance in soybean. Science 338:1206-1209. 144

Curtin, S.J., Voytas, D.F., and Stupar, R.M. 2012. Genome engineering of crops with designer nucleases. Plant Genome 5:42-50.

De Conick, B., Timmermans, P., Vos., C., Cammue, B.P.A., and Kazan, K. 2015. What lies beneath: belowground defense strategies in plants. Trends Plant Sci. 20:91-101.

Díaz Arias, M.M., Leandro, L.F., and Munkvold, G.P. 2013a. Aggressiveness of Fusarium species and impact of root infection on growth and yield of soybeans. Phytopathology 103:822-832.

Díaz Arias, M.M., Munkvold, G.P., Ellis, M.L., and Leandro, L.F.S. 2013b. Distribution and frequency of Fusarium species associated with soybean roots in Iowa. Plant Dis. 97:1557-1562.

Domingo, C., Andrés, F., Tharreau, D., Iglesias, D.J., and Talón, M. 2009. Constitutive expression of OsGH3.1 reduces auxin content and enhances defense response and resistance to a fungal pathogen in rice. Mol. Plant Microbe Interact. 22:201-210.

Dorrance, A.E., Jia, H., and Abney, T.S. 2004. Evaluation of soybean differentials for their interaction with Phytophthora sojae. Plant Health Progress.

Dorrance, A.E. Kurle, J., Robertson, A.E., Bradley, C.A., Giesler, L., Wise, K., Concibido, V.C. 2016. Pathotype diversity of Phytophthora sojae in eleven states in the United States. Plant Dis. 100:1429-1437.

Dorrance, A.E., McClure, S.A., and St. Martin, S.K. 2003. Effect of partial resistance on Phytophthora stem rot incidence and yield of soybean in Ohio. Plant Dis. 87:308-312.

Dorrance, A.E., and McClure, S.A. 2001. Beneficial effects of fungicide seed treatments for soybean cultivars with partial resistance to Phytophthora sojae. Plant Dis. 85:1063- 1068.

Dorrance, A.E., Robertson, A.E., Cianzo, S., Giesler, L.J., Draper, M.A., Tenuta, A.U., and Anderson, T.R. 2009. Integrated management strategies for Phytophthora sojae combining host resistance and seed treatments. Plant Dis. 93:875-882.

Doyle, J.J. and Dickson, E.E. 1987. Preservation of plant samples for DNA restriction endonuclease analysis. Taxon. 36:715-722.

Ellis, M.L., Broders, K.D., Paul, P.A., and Dorrance, A.E. 2011. Infection of soybean seed by Fusarium graminearum and effect of seed treatments on disease under controlled conditions. Plant Dis. 95:401-407.

145

Ellis, M.L., McHale, L.K., Paul, P.A., St. Martin, S.K., and Dorrance, A.E. 2013. Soybean germplasm resistant to Pythium irregulare and molecular mapping of resistance quantitative trait loci derived from the soybean accession PI 424354. Crop Sci. 53:1008- 1021.

Ellis, M.L., Wang, H., Paul, P.A., St. Martin, S.K., McHale, L.K., and Dorrance, A.E. 2012. Identification of soybean genotypes resistant to Fusarium graminearum and genetic mapping of resistance quantitative trait loci in the cultivar Conrad. Crop Sci. 52:2224-2232.

Enkerli, K., Hahn, M.G., and Mims, C.W.1997. Ultrastructure of compatible and incompatible interactions of soybean roots infected with the plant pathogenic oomycete Phytophthora sojae. Can. J. Bot. 75:1493-1508.

Erwin, D.C., and Ribeiro, O.K. 1996. Phytophthora diseases worldwide. St. Paul, MN: The American Phytopathological Society.

Euglem, F., and Somssich, I.E. 2007. Networks of WRKY transcription factors in defense signaling. Curr. Opin. Plant Biol. 10:366-371.

Evangelisti, E., Govetto, B., Minet-Kebdani, N., Kuhn, M., Attard, A. Ponchet, M., Panabières, F., and Gourgues, M. 2013. The Phytophthora parasitica RXLR effector Penetration-specific effector 1 favors Arabidopsis thaliana infection by interfering with auxin physiology. New Phytologist 199:476-489.

Fehr, W.R., Cianzo, S.R., Voss, B.K., and Schultz, S.P. 1989. Registration of ‘Conrad’ soybean. Crop Sci. 29:830-831.

Finer, J.J., and McMullen, M.D. 1991. Transformation of soybean via particle bombardment of embryogenic suspension culture tissue. In Vitro Cell. Dev. Biol. 27P:175-182.

Fleige, S., and Pfaffl, M.W. 2006. RNA integrity and the effect on the real-time qRT- PCR performance. Mol. Aspects Med. 27:126-139.

Friml, J., Benková, E., Blilou, I., Winiewska, J., Hamann, F., Ljung, K., Woody, S., Sandberg, G., Scheres, B., Jürgens, G., and Palme, K. 2002a. AtPIN4 mediates sink- driven auxin gradients and root patterning in Arabidposis. Cell 108:661-673.

Friml, J. Winśniewska, J., Benková, E., Mendgen, K., and Palme, K. 2002b. Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415:806-809.

146

Fu, J., Liu, H., Li, Y., Yu, H., Li, X., Xiao, J., and Wang, S. 2011. Manipulating broad- spectrum disease resistance by suppressing pathogen-induced auxin accumulation in rice. Plant Physiol. 155: 589-602.

Fu, D., Uauy, C., Distelfeld, A., Blechl, A., Epstein, L., Chen, X., Sela, H., Fahima, T., and Dubcovsky, J. l. 2009. A kinase-START gene confers temperature dependent resistance to wheat stripe rust. Science 323:1357–1360.

Fukuoka, S., Saka, N., Koga, H., Ono, K., Shimizu, T., Ebana, K., Hayashi, N., Takahashi, A., Hirochika, H., and Okuno, K. 2009. Loss of function of a proline- containing protein confers durable disease resistance in rice. Science 325: 998–1001.

Gälweiler, L., Guan, C., Müller, A., Wisman, E., Mendgen, K., Yephremov, S., and Palme, K. 1998. Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science 282:2226-2230.

Geisler, M. and Murphy, A.S. 2006. The ABC of auxin transport: the role of p- glycoproteins in plant development. FEBS Lett. 580:1094-1102.

Glazebrook, J. 2005. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43:205-227.

Glickmann, E., Gardan, L., Jacquet, S., Hussain, S., Elasri, M., Petit, A., and Dessaux, Y. 1998. Auxin production is a common feature of most pathovars of Pseudomonas syringae. Mol. Plant-Microbe Interact. 11:156-162.

Goodstein, D.M., Shu, S., Howson, R., Neupane, R., Hayes, R.D., Mitros, T., Dirks, W., Hellsten, U., Putnam, N, and Rokhsar, D.S. 2012. Phytozome: a comparative platform for green plant genomics. Nucl. Acids Res. 40:D1178-D1186.

Govindarajulu, M., Elmore, J.M., Fester, T., and Taylor, C.G. 2008. Evaluation of constitutive viral promoters in transgenic soybean roots and nodules. Mol. Plant-Microbe Interact. 21:1027-1035.

Govindarajulu, M., Kim, S.-Y., Libault, M., Berg, R.H., Tanaka, K., Stacey, G., and Taylor, C.G. 2009. GS52 ecto-apyrase plays a critical role during soybean nodulation. Plant Physiol. 149:944-1004.

Gonzalez, A.M., Marcel, T.C., and Niks, R.E. 2012. Evidence for a minor-gene-for- minor-gene interaction explaining polygenic partial disease resistance. Phytopathology. 102:1086-1093.

147

Graham, T.L., Graham, M.Y., Subramanian, S., and Yu, O. 2007. RNAi silencing of genes for elicitation or biosynthesis of 5-deoxyisoflavonoids suppresses race-specific resistance and hypersensitive cell death in Phytophothora sojae infected tissues. Plant Physiol. 144:728-740.

Grant, M., and Jones, J.D.G. 2009. Hormone (dis)harmony moulds plant health and disease. Science 324:750-752.

Grant, D., Nelson, R.T., Cannon, S.B., and Shoemaker, R.C. 2010. SoyBase, the USDA- ARS soybean genetics and genomics database. Nucl. Acids Res. 38:D843-D846.

Grau, C.R., Dorrance, A.E., Bond, J., and Russin, J.S. 2004. Fungal diseases. In soybeans: improvement, production and uses. ed. Boerma H.R., Specht, J.E. Madison, WI: American Society of Agronomy; Crop Science Society of American; Soil Science Society of America.

Grunewald, W., and Friml, J. 2010. The march of the PINs: developmental plasticity by dynamic polar targeting in plant cells. EMBO J. 29:2700-2714.

Guo, X., Chronis, D., De La Torre, C.M., Smeda, J., Wang, X., and Mitchum, M.G. 2015. Enhanced resistance to soybean cyst nematode Heterodera glycines in transgenic soybean by silencing putative CLE receptors. Plant Biotech. J. 13:801-810.

Guo, X., Wang, D., Gordon, S.G., Helliwell, E., Smith, T., Berry, S.A., St. Martin, S.K., and Dorrance, A.E. 2008. Genetic mapping of QTLs underlying resistance to Sclerotinia sclerotiorum in soybean PI 391589A and PI 391589B. Crop Sci. 48:1129-1139.

Hagen, G. and Guilfoyle, T.J. 1985. Rapid induction of selected transcription by auxins. Mol. Cell. Biol. 5:1197-1203.

Hagen, G. and Guilfoyle, T.J. 2002. Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol. Biol. 49:373-385.

Hall, B.G. 2011. Phylogenetic trees made easy: a how-to manual. 4th ed. Sunderland, MA: Sinauer Associates, Inc.

Hedden, P. and Sponsel, V. 2015. A century of gibberellin research. J. Plant Growth Regul. 34:740-760.

Hernandez-Gracia, C.M., Chiera, J.M., and Finer, J.J. 2010. Robotics and dynamic image analysis for studies of gene expression in plant tissues. J. Vis. Exp. 1733.

148

Herrera-Vásquez, A., Salinas, P., and Holuigue, L. 2015. Salicylic acid and reactive oxygen species interplay in the transcriptional control of defense genes expression. Frontiers Plant Sci. 6:1-9.

Hoagland, D.R., and Arnon, D.I. 1950. The water-culture method for growing plants without soil. California Agricultural Experimental Station, Circular-347.

Hoitink, H.A.J. and Schmitthenner, A.F. 1969. Rhododendron wilt caused by Phytophthora citricola. Phytopathology 59:708-709.

Holt, S.J, and Withers, R.F.J. 1958. V. An appraisal of indigogenic reactions for esterase localization. Proc. R. Soc. Lond. B 148:520-532.

Hückelhoven, R., Eichmann, R., Weis, C.., Hoefle, C., and Proels, R.K. 2013. Genetic loss of susceptibility: a costly route to disease resistance? Plant Pathol. 61:56-62.

Hulbert, S, and Pumphrey, M.. 2014. A time for more booms and fewer busts? Unraveling cereal-rust interactions. Mol. Plant Microbe Interact. 27:207-214.

Humphry, M., Consonni, C., and Panstruga, R. 2006. Mlo-based powdery mildew immunity: silver bullet or simply non-host resistance? Mol. Plant Pathol. 7:605-610.

Humphry, M., Reinstädler, A., Ivanov, S., Bisseling, T., and Panstruga, R. 2011. Durable broad-spectrum resistance in pea er1 plants is conferred by natural loss-of-function mutations in PsMLO1. Mol. Plant Pathol. 12:866-878.

Huo, X., Schnabel, E., Hughes, K., and Frugoli, J. 2006. RNAi phenotypes and the localization of a protein::GUS fusion imply a role for Medicago truncatula PIN genes in nodulation. J. Plant Growth Regul. 25:156-165.

Jacobs, T.B., LaFayette, P.R., Schmitz, R.J., and Parrott, W.A. 2015. Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnol. 15:16.

Jefferson, R.F. 1987. Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Reporter 5:387-405.

Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. 1987. GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6:3901-3907.

Jiang, R.H.Y., Tripathy, S., Grovers, F., and Tyler, B.M. 2008. RXLR effector reservoir in two Phytophthora species is dominated by a single rapidly evolving superfamily with more than 700 members. Proc. Nat. Acad. Sci. 105:4874-4879.

149

Jiang, Y.N., Haudenshield, J.S., and Hartman, G.L. 2012. Characterization of Pythium spp. from soil samples in Illinois. Can. J. of Plant Pathol. 34: 448-454.

Jing, M., Ma, H., Li, H., Guo, B., Zhang, X., Ye, W., Wang, H., Wang, Q., Wang, Y. 2015. Differential regulation of defense-related proteins in soybean during compatible and incompatible interations between Phytophthora sojae and soybean by comparing proteomic analysis. Plant Cell Reports 34:1263-1280.

Jørgensen, J.H. 1977. Spectrum of resistance conferred by ML-O powdery mildew resistance genes in barley. Euphytica 26:55-62.

Jørgensen, J.H. 1992. Discovery, characterization and exploitation of Mlo powdery mildew resistance in barley. Euphytica. 63:141-152.

Kabelka, E.A., Carlson, S.R., and Diers, B.W. 2005. Localization of two loci that conference resistance to soybean cyst nematode from Glycine soja PI 468916. Crop Sci. 45:2473-2481.

Kassem, M.A., Shultz, J., Meksem, K., Cho, Y., Wood, A.J., Iqbal, M.J., and Lightfoot, D.A. 2006. An updated 'Essex' by 'Forrest' linkage map and first composite interval map of QTL underlying six soybean traits. Theor. Appl. Genet. 113:1015-1026.

Kidd, B.N., Kadoo, N.Y., Dombrecht, B., Tekeoğlu, M., Gardiner, D.M., Thatcher, L.F., Aitken, E.A.B., Schenk, P.M., Manners, J.M., and Kazan, K. 2011. Auxin signaling and transport promote susceptibility to the root-infecting fungal pathogen Fusarium oxysporum in Arabidopsis. Mol. Plant Microbe Interact. 24:733-748.

Kirkpatrick, M.T., Rupe, J.C., and Rothrock, C.S. 2006. Soybean response to flooded soil conditions and the association with soilborne plant pathogenic genera. Plant Dis. 90:592- 596.

Korasick, D.A., Enders, T.A., and Strader, L.C. 2013. Auxin biosynthesis and storage forms. J. Exp. Bot. 64:2541-2555.

Kou, Y. and Wang, S. 2010. Broad-spectrum and durability: understanding of quantitative disease resistance. Curr. Opin. Plant Biol. 13:181-185.

Kou, Y. and Wang, S.. 2012. Towards an understanding of the molecular basis of quantitative disease resistance in rice. J. of Biotech. 159: 283-290.

Krattinger, S.G., Lagudah, E.S., Spielmeyer, W., Singh, R.P., Huerta-Espino, J., McFadden, H., Bossolini, E., Selter, L.L., and Keller, B. 2009. A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Science 323:1360-1363. 150

Krouk, G., Lacombe, B., Bielach, A., Perrine-Walker, F., Malinska K., Mounier E., Hoyevova, K., Tillard, P., Leon, S., Ljung, K., Zazimalova, E., Benkova, E., Narcry, P., and Gojon, A., 2010. Nitrate-regulated auxin transport by NRT1.1 defines a mechanism for nutrient sensing in plants. Dev. Cell 18:927-937.

Kubeš, M., Yang, H., Richter, G.L., Cheng, Y., Młodzińska, E., Wang, X., Blakeslee, J.J., Carraro, N., Petrášek, J., Zažímalová, E., Hoyerová, K., Peer, W.A., and Murphy, A.S. 2012. The Arabidopsis concentration-dependent influx/efflux transporter ABCB4 regulates cellular auxin levels in the root epidermis. Plant J. 69:640-654.

Kunkel, B.N., and Harper, C.P. 2018. The roles of auxin during interactions between bacterial plant pathogens and their hosts. J. Exp. Bot. 69:245-254.

Kyndt, T., Goverse, A., Haegeman, A., Warmerdam, S., Wanjau, C., Jahani, M., Engler, G., de Almeida Engler, J., and Gheysen, G. 2016. Redirection of auxin flow in Arabidopsis thaliana roots after infection by root-knot nematodes. J. Exp. Botany 67:4559-4570.

Lander, E. and Kruglyak. L. 1995. Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat Genet 11:241–247.

Lapin, D. and Van den Ackervenken, G. 2013. Susceptibility to plant disease: more than a failure of host immunity. Trends Plant Sci. 18:546-554.

Lee, S., Mian, M.A.R. McHale, L.K., Sneller, C.H., and Dorrance, A.E. 2013a. Identification of quantitative trait loci conditioning partial resistance to Phytophthora sojae in soybean PI 407861A. Crop Sci. 53:1022-1031.

Lee, S., Mian, M.A.R., McHale, L.K., Wijeratne, A.J., Sneller, C.H., and Dorrance, A.E. 2013b. Novel quantitative trait loci for partial resistance to Phytophthora sojae in soybean PI 398841. Theor. App. Genet. 126:1121-1132.

Lee, S., Mian, M.A.R., Sneller, C., Wang, H., Dorrance, A.E., and McHale, L.K. 2014. Joint QTL analysis for partial resistance to Phytophthora sojae in soybean using six nested soybean recombinant inbred populations with heterogeneous conditions. Theor. Appl. Genet. 127:429-444.

Leguay, J.J. and Jouanneau, J.P. 1987. Auxin (2,4-dichlorophenoxyacetic acid) starvation and treatment with glucan elicitor isolated from Phytophthora megasperma induces similar response in soybean-cultured cell suspensions. Dev. Genet. 8:351-364.

151

Li, X., Han, Y., Teng, W., Poysa, V., Anderson, T., Dong, J., and Li, W. 2010. Pyramided QTL underlying tolerance to Phytophthora root rot in mega-environments from soybean cultivars ‘Conrad’ and ‘Hefeng 25’. Theor. Appl. Genet. 121:651-658.

Li, Y., Sun, S., Zhong, C., Wang, X., Wu, X., and Zhu, Z. 2017. Genetic mapping and development of co-segregating marker of RpsQ, which provides resistance to Phytophthora sojae in soybean. Theor. Appl. Genet. 130:1223-1233.

Libault, M., Thibivilliers, S., Bilgin, D.D., Radwan, O., Benitez, M., Clough, S.J., and Stacey, G. 2008. Identification of four soybean reference genes for gene expression normalization. Plant Gen. 1:44-54.

Libault, M., Joshi, T., Takahashi, K., Hurley-Sommer, A., Puricelli, K., Blake, S., Finger, R.E., Taylor, C.G., Xu, D., Nguyen, H.T., and Stacey, G. 2009. Large-scale analysis of putative soybean regulatory gene expression identifies a Myb gene involved in soybean nodule development. Plant Physiol. 2009. 151:1207-1220.

Libault, M., Zhang, X.-C., Govindarajulu, M., Qiu, J., Ong, Y.T., Brechenmacher, L., Berg, R.H., Hurley-Sommer, A., Taylor, C.G., and Stacey, G. 2010. A member of the highly conserved FWL (tomoto FW2.2-like) gene family is essential for soybean nodule organogenesis. Plant J. 62:852-864.

Lin, S., Cianzio, R.R., and Shoemaker, R.C. 1997. Mapping genetic loci for iron deficiency chlorosis in soybean. 1997. Mol. Breeding 3:219-229.

Lin, F., Zhao, M., Pin, J., Johnson, A., Zhang, B., Abney, T.S., Hughes, T.J., and Ma, J. 2013. Molecular mapping of two genes conferring resistance to Phytophthora sojae in a soybean landrace PI 567139B. Theor. Appl. Genet. 126:2177-2185.

Liu, J.Z., Horstman, H.D., Braun, E., Graham, M.A., Zhang, C., Navarre, D., Qiu, W.L., Lee, Y., Nettleton, D., Hill, J.H., and Whitham, S.A. 2011. Soybean homologs of MPK4 negatively regulate defense responses and positively regulate growth and development. Plant Physiol. 157:1363-1378.

Liu, W., Liu, J., Triplett, L., Leach, J.E., and Wang, G.L. 2014. Novel insights into rice innate immunity against bacterial and fungal pathogens. Annu. Rev. Phytopathol. 52:213- 241.

Lopes-Caitar, V.S., de Carvalho, M.C.C.G., Darben, L.M., Kuwahara, M.K., Nepomuceno, A.L., Dias, W.P., Abdelnoor, R.V., and Marcelino-Guimarães, F.C. 2013. Genome-wide analysis of the Hsp20 gene family in soybean: comprehensive sequence, genomic organization and expression profile analysis under abiotic and biotic stresses. BMC Genomics 14:577.

152

Luschnig, C., Gaxiola, R.A., Grisafi, P., and Fink, G.R. 1998. EIR1, a root-specific protein involved in auxin transport, is required for gravitropism in Arabidopsis thaliana. Genes Dev. 12:2175-2187.

Ludwig-Müller, J. 2011. Auxin conjugates: their role for plant development and in the evolution of land plants. J. Exp. Bot. 62:1757-1773.

Ma, K.W., and Ma, W. 2016. Phytohormone pathways as targets of pathogens to facilitate infection. Plant Mol. Biol. 91:713.

Mah, K.M., Uppalapati, S.R., Tang, Y., Allen, S., and Shuai, B. 2012. Gene expression profiling of Macrophomina phaseolina infected Medicago truncatula roots reveals a role for auxin in plant tolerance against the charcoal rot pathogen. Physiol. and Mol. Plant Pathol. 79:21-30.

Marchand, G., Chen, Y., Berhane, N.A., Wei, L., Lévesque, C.A., and Xue, A.G. 2014. Identification of Pythium spp. from the rhizosphere of soybeans in Ontario, Canada. Can. J. Plant Pathol. 36:246-251.

McCabe, D.E., Swain, W.F., Martinell, B.J., and Christou, P. 1988. Stable transformation of soybean (Glycine max) by particle acceleration. Nature Biotechnol. 6:923-926.

McDonald, K.L., and Cahill, D.M. 1999. Influence of abscisic acid and the abscisic acid biosynthesis inhibitor, norflurazon, on interactions between Phytophthora sojae and soybean (Glycine max). Eur. J. Plant Pathol. 105:651-658.

McDowell, J.M. 2013. Genomic and transcriptomic insights into lifestyle transitions of a hemibiotrophic fungal pathogen. New Phytolog. 197:1032-1034.

McGrann, G.R.D., Stavrinides, A., Russell, J., Corbitt, M.M., Booth, A., Chartrain., L., Thomas, W.T.B., and Brown, J.K.M. 2014. A trade off between mlo resistance to powdery mildew and increased susceptibility of barley to a newly important disease, Ramularia leaf spot. J. of Exp. Bot. 65:1025-10.37.

Mengiste, T. 2012. Plant immunity to necrotrophs. Annu. Rev. Phytopathol. 50:267-294.

Michno, J.-M., Wang, X., Liu, J., Curtin, S.J., Kono, T.J.Y., and Stupar, R.M. 2015. CRISPR/Cas mutagenesis of soybean and Medicago truncatula using a new web-tool and a modified Cas9 enzyme. GM Crops & Food. 6:243-252.

Mideros, S. 2006. Study of incomplete resistance to Phytophthora sojae in soybean. M.Sc. Thesis. The Ohio State University.

153

Mideros, S., Nita, M., and Dorrance, A.E. 2007. Characterization of components of partial resistance, Rps2, and root resistance to Phytophthora sojae in soybean. Phytopathol. 97:655-662.

Miklis, M., Consonni, C., Bhat, R.A., Lipka, V., Schulze-Lefeit, P., and Panstruga, R. 2007. Barley MLO modulates actin-dependent and actin-independent antifungal defense pathways at the cell periphery. Plant Physiol. 144:1132-1143.

Miller, S.A., Madden, L.V., and Schmitthenner, A.F. 1996. Distribution of Phytophthora spp. in field soils determined by immunoassay. Phytopathol. 87:101-107.

Mravec, J., Skůpa, P., Bailly, A., Hoynrová, K., Kŕeček, P., Bielach, A., Petrášek, J., Zhang, J., Gaykova, V., Stierhof, Y.-D., Dolrev, P.I., Schwarzerová, K., Rolčík, J., Seifertová, D., Luschnig, C., Benková, E., Geisler, M., and Friml, J. 2009. Subcellular homeostasis of phytohormone auxin is mediated by the ER-localized PIN5 transporter. Nature 459:1136-1140.

Muday, G.K., Rahman, A., and Binder, B.M. 2012. Auxin and ethylene: collaborators or competitors? Trends Plant Sci. 17:181-195.

Müller, A., Guan, C., Gälweiler, L., Tänzler, P., Huijer, P., Marchant, A., Parry, G., Bennett, M., Wisman, E., and Palme, K. 1998. AtPIN2 defines a locus of Arabidopsis for root gravitropism control. EMBO J. 17:6903-6911.

Murillo-Williams, A. and Pedersen, P. 2008. Early incidence of soybean seedling pathogens in Iowa. Agron. J. 100:1481-1487.

Murphy, A., and Taiz, L. 1995. A new vertical mesh transfer technique for metal- tolerance studies in Arabidopsis. Plant Physiol. 108:29-38.

Murphy, A., Peer, W.A., and Taiz, L. 2000. Regulation of auxin transport by aminopeptidases and endogenous flavonoids. Planta 211:351-324.

National Agricultural Statistics Service (NASS). 2016. Stats by subject: National statistics for soybean. United States Department of Agriculture. Accessed Aug. 2016.

Navarro, L., Bari, R., Achard, P., Lison, P., Menri, A., Harberd, N.P., and Jones, J.D.G. 2008. DELLAs control plant immune responses by modulating the balance of jasmonic acid and salicylic acid signaling. Curr. Biol. 18:650-655.

Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, O., and Jones, J.D.G. 2006. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312:436-439.

154

Noh, B., Murphy, A.S., and Spalding, E.P. Multidrug resistance-like genes of Arabidopsis required for auxin transport and auxin-mediated development. 2001. Plant Cell 13:2441-2454.

Novák, O., Hényková, Sairanen, I., Kowalczyk, M., Pospíšil, T., and Ljung, K. 2012. Tissue-specific profiling of the Arabidopsis thaliana auxin metabolome. Plant J. 72:523- 536.

Oliver, R.P. and Ipcho, S.V.S. 2004. Arabidopsis pathology breathes new life into the necrotrophs-vs-biotrophs classification of fungal pathogens. Mol. Plant Pathol. 5:347- 352.

Pandey, A.K., Yang, C., Zhang, C., Graham, M.A., Horstman, H.D., Lee, Y., Zabotina, O.A., Hill, J.H., Pedley, K.F., and Whitham, S.A. 2011. Functional analysis of the Asian soybean rust resistance pathway mediated by Rpp2. Mol. Plant-Microbe Interact. 24:194- 206.

Panstruga, R. 2005. Serpentine plant MLO proteins as entry portals for powdery mildew fungi. Biochem. Soc. Trans. 33:389-392.

Paponov, I.A., Teale, W.D., Trebar, M., Blilou, I., and Palme, K. 2005. The PIN auxin efflux facilitators: evolutionary and functional perspectives. Trends Plant Sci. 10:1360- 1385.

Park, J.E., Park J.Y., Kim Y.S., Staswick P.E., Jeon J., Kim, S.Y., Kim, J., Lee, Y.H., and Park, C.M. 2007. GH3-mediated auxin homeostasis links growth regulation with stress adaptation response in Arabidopsis. J. Biol. Chem. 282:10036-10046.

Parlevliet, J.E. 1979. Components of resistance that reduce the rate of epidemic development. Annu. Rev. Phytopathol. 17:203-222

Parlevliet, J.E. and Zadoks, J.C. 1977. The integrated concept of disease resistance: a new view including horizontal and vertical resistance in plants. Euphytica 26:5-21.

Patterson, H.D. and Thompson, R. 1971. Recovery of inter-block information when block sizes are unequal. Biometrika 58:545–554

Pavan, S., Jacbosen, E., Visser, R.G.F., and Bai, Y. 2010. Loss of susceptibility as a novel breeding strategy for durable and broad-spectrum resistance. Mol. Breeding 25:1- 12.

Peer, W.A., Bandyopadhyay, A., Blakeslee, J.J., Makam, S.I., Chen, R.J., Masson, P.H., and Murphy, A.S. 2004. Variation in expression and protein localization of the PIN

155

family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin transport in Arabidopsis thaliana. Plant Cell 16:1898-1911.

Peer, W.A., Blakeslee, J.J., Yang, H., and Murphy, A.S. 2011. Seven things we think we know about auxin transport. Mol. Plant 4:487-504.

Peng, J., Ge, L., Wang, Y., and Chen, R. 2013. Signaling and transport of auxin and plant development. In Polar auxin transport. ed. Chen, R. and Baluška, F. Signaling and Communication in Plants 17:239-258. New York, NY:Springer-Velag Berlin Heidelberg.

Perley, J.E., and Stowe, B.B. 1966. On the ability of Taphrina deformans to produce indoleacetic acid from tryptophan by way of tryptamine. Plant Physiol. 41:234-237.

Pieterse, C.M.J., Zamioudis, C., Berendsen, R.L, Weller, D.M., Van Wees, S.C.M., and Bakker, P.A.H.M. 2014. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 52:347-375.

Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:2002-2007.

Ping, J., Fitzgerald, J.C., Zhang, C., Lin, F., Bai, Y., Wang, D., Aggarwal, R., Rehman, M., Crasta, O., and Ma, J. 2016. Identification and molecular mapping of Rps 11, a novel gene conferring resistance to Phytophthora sojae in soybean. Theor. Appl. Genet. 129:445-451.

Pioli, R.N., Mozzoni, L., and Morandi, E.N. 2004. First report of pathogenic association between Fusarium graminearum and soybean. Plant Dis. 88:220.

Poland, J.A., Balint-Kurti, P.J., Wisser, R.J., Pratt, R.C., Nelson, R.J. 2009. Shades of gray: the world of quantitative disease resistance. Trends Plant Sci. 14:21-29.

Qi, X., Jiang, G., Chen, W., Niks, R.E., Stam, P., and Lindhout, P. 1999. Isolate-specific QTLs for partial resistance to Puccinia hordei in barley. Theor. Appl. Genet. 99:877-884.

Qutob, D., Hraber, P.T., Sobral, B.W.S., and Gijzen, M. 2000. Comparative analysis of expressed sequences in Phytophthora sojae. Plant Physiol. 123:243-254.

R Development Core Team 2012. R: A language and environment for statistical computing. R Foundation for Statistical Computing. Vienna, Austria.

Richa, K., Tiwari, I.M., Kumari, M, Devanna, B.N., Sonah, H., Kumari, A., Nagar, R., Sharma, V., Botella, J.R., and Sharma, T.R. 2016. Functional characterization of novel chitinase genes present in the sheath blight resistance QTL: qSBR11-1 in rice line Tetep. Front. Plant Sci. 7:244. 156

Rightmyer, A.P., and Long, S.R. 2011. Pseudonodule formation by wild type and symbiotic mutant Medicago truncatula in response to auxin transport inhibitors. Mol. Plant Microbe Interact. 24:1372-1384.

Rizvi, S.S.A., and Yang, X.B. 1996. Fungi associated with soybean seedling disease in Iowa. Plant Dis. 80: 57-60.

Robert-Seilaniantz, A., Grant, M., and Jones, J.D.G. 2011. Hormone crosstalk in plant disease and defense: More than just jasmonate-salicylate antagonism. Annu. Rev. Phytopathol. 49:317-343.

Römer, P., Recht, S., Strauβ, Elsaesser, J., Schornack, S., Boch, J., Wang, S., and Lahye, T. 2010. Promoter elements of rice susceptibility genes are bound and activated by specific TAL effectors from the bacterial blight pathogen, Xanothomonas oryzae pv. oryzae.

Rosendahl, L., and Jochimsen, B.U. 1995. In vitro indole-3-acetic acid uptake in symbiosomes from soybean (Glycine max L.) root nodules. Symbiosis 19:99-110

Sato, S., Xing, A., Ye, X., Schweiger, B., Kinney, A., Graef, G., and Clemente, T. 2004. Production of γ-linolenic acid and stearidonic acid in seeds of marker-free transgenic soybean. 2004. Crop Sci. 44:646-652

Saubeau, G., Perrin, F., Marnet, N., Andrivon, D., and Val, F. 2016. Hormone signaling pathways are differentially involved in quantitative resistance of potato to Phytophthora infestans. Plant Pathol. 65:342-352. doi:10.1111/ppa.12420

Schmittgen, T.D., and Livak, K.J. 2008. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3:1101-1108. doi:10.1038/nprot.2008.73

Schmitthenner, A.F. 1985. Problems and progress in control of Phytophthora root rot of soybean. Plant Dis. 69:362-368.

Schmitthenner, A.F., and Bhat, R.G. 1994. Useful methods for studying Phytophthora in the laboratory. OARDC Special Circular 143. Wooster, OH: Department of Plant Pathology Ohio Agricultural Research and Development Center The Ohio State University.

Schmutz, J., Cannon, S.B., Schlueter, J., Ma, J., Mitros, T., Nelson, W., Hyten, D.L., Song, Q., Thelen, J.J., Cheng, J., Xu, D., Hellsten, U., May, G.D., Yu, Y., Sakurai, T., Umezawa, T., Bhattacharyya, M.K., Sandhu, D., Valliyodan, B., Lindquist, E., Peto, M., Grant, D., Shu, S., Goodstein, D., Barry, K., Futrell-Griggs, M., Abernathy, B., Du, J.,

157

Tian, Z., Zhu, L., et al. 2010. Genome sequence of the paleopolyploid soybean. Nature 463:178-183.

Schnabel, E. L., and Frugoli, J., 2004. The PIN and LAX families of auxin transport genes in Medicago truncatula. Mol. Gen. Genomics 272:420-432.

Schwacke, R., Schneider, A., van der Graaff, E., Fischer, K., Catoni, E., Desimone, M., Frommer, W.B., Flügge, U.-I., and Kunze, R. 2003. ARAMEMNON, a novel database for Arabidopsis integral membrane proteins. 2003. Plant Physiol. 131:16-26.

Shen, C., Bai, Y., Wang, S., Zhang, S., Wu, Y., Chen, M., Jiang, D., and Zi, Y. 2010. Expression profile of PIN, AUX/LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stresses. FEBS J. 277:2954-2969.

Shi, Z., Liu, S., Noe, J., Arelli, P., Meksem, K., and Li, Z. 2015. SNP indentification and marker assay development for high-throughput selection of soybean cyst nematode resistance. BMC Genomics 16:314.

Singh, V.K., Jain, M., and Garg, R. 2015. Genome-wide analysis and expression profiling suggest diverse roles of GH3 genes during development and abiotic stress responses in legumes. Front. Plant Sci. 5:789.

Soeno, K., Goda, H., Ishii, T., Ogura, T., Tachikawa, T., Saski, E., Yoshida, S., Fujioka, S., Asami, T., and Shimada, Y. 2010. Auxin biosynthesis inhibitors, identified by a genomics-based approach, provides insights into auxin biosynthesis. Plant Cell Physiol. 51:524-536.

Song, Q., Hyten, D.L., Jia, G., Quigley, C.V., Fickus, E.W., Nelson, R.L., and Cregan, P.B. 2013. Development and evaluation of SoySNP50K, a high-density genotyping array for soybean. PLoS ONE. 8:e54985.

Song, Q.J., Jia, G.F., Zhu, Y.L., Grant, D., Nelson, R.T., Hwang, E.Y., Hyten, D.L., and Cregan, P.B. 2010. Abundance of SSR motifs and development of candidate polymorphic SSR markers (BARCSOYSSR_1.0) in soybean. Crop Sci. 50:1950-1960.

SoyStats. 2016. The American Soybean Association. Accessed Feb. 15 2017.

Spaepen, S., Vanderleyden, J., and Remans, R. 2007. Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiol. Rev. 31:425-448.

St. Clair, D.A. 2010. Quantitative disease resistance and quantitative resistance loci in breeding. Annu. Rev. Phytopathol. 48:247-268.

158

Staswick, P.E., Serban, B., Rowe, M., Tiryaki, I., Maldonado, M.T., Maldonado, M.C., and Suza, W. 2005. Characterization of an Arabidopsis enzyme family that conjugates amino acids to indole-3-acetic acid. Plant Cell 17:616-627.

Staswick, P.E., and Tiryaki, I. 2004. The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell. 16:2117-2127.

Stroup, W.W. 1989. Why mixed models? In: Application of Mixed Models in Agriculture and Related Disciplines. Southern Coop. Serv. Bull. Vol. 343. Louisiana Agricultural Experiment Station. Baton Rouge, Louisiana. p 1-8.

Sun, J., Li, L., Zhao, J., Huang, J., Yan, Q., Xing, H., and Guo, N. 2014. Genetic analysis and fine mapping of RpsJS, a novel resistance gene to Phytophthora sojae in soybean [Glycine max (L.) Merr.]. Theor. Appl. Genet. 127:913-919.

Taiz, L. and Zeiger, E. 2010. Plant Physiology 5th ed. Sunderland, MA: Sinauer Associates Inc.

Tamulonis, J.P., Luzzi, B.M., Hussey, R.S., Parrott, W.A., and Boerma, H.R. 1997. RFLP mapping of resistance to southern rot-knot nematode in soybean. Crop Sci. 37:1903- 1909.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. and Evol. 30:2725-2729.

Taylor, C.G., Fuchs, B., Collier, R., and Lutke, W.K. 2006. Generation of composite plants using Agrobacterium rhizogenes. In Agrobacterium Protocols ed. Wang, K. Methods in Mol. Biol. 343:155-167. Totowa, NJ:Humana Press.

Thomashow, L.S., Reeves, S., and Thomashow, M.F. 1984. Crown gall oncogenesis: evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalysis synthesis of indoleacetic acid. Proc. Natl. Acad. Sci. 81:5071-5075.

Tian, Q.D., Lin, J., Wang, B.L., Xie, C.H. 2006. Screening and expression of Phytophthora infestans induced genes in potato leaves with horizontal resistance. Plant Cell Rep. 25:1094-1103.

Trail, F. 2009. For blighted waves of grain: Fusarium graminearum in the postgenomics era. Plant Physiol. 149:103-110. 159

Tiryaki, I. and Staswick, P.E. 2002. An Arabidopsis mutant defective in jasmonate response is allelic to the auxin-signaling mutant axr1. Plant Physiol. 130:887-894.

Tucker, D.M., Maroof, M.A.S., Mideros, S., Skoneczka, J.A., Nabati, D.A., Buss, G.R., Hoeschele, I., Tyler, B.M., St. Martin, S.K., and Dorrance, A.E. 2010. Mapping quantitative trait loci for partial resistance to Phytophthora sojae in a soybean interspecific cross. Crop Sci. 50:628-635.

Turner, M., Nizampatnam, N.R., Baron, M., Cappin, S., Damodaran, S., Adihikari, S., Arunachdam, S.P., Yu, O., and Subramanian, S. 2013. Ectopic expression of miR160 results in auxin hypersensitivity, cytokinin hyposensitivity, and inhibition of symbiotic nodule development in soybean. Plant Physiol. 162: 2042-2055.

Tyler, B.M., Tripathy, S., Zhang, X., Dehal, P., Jiang, R.H.Y., Aerts, A., Arredondo, F.D., Baxter, L., Bensasson, D., Beynon J.L., et al. 2006. Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 313:1261-1266.

Umaerus, V. 1970. Studies on field resistance to Phytophthora infestans 5. Mechanisms of resistance and applications to potato breeding. Z. Pflanzenzüch. 63:1-23.

Utsuno, K., Shikanai, T., Yamada, Y., and Hashimoto, T. 1998. AGR, an agravitropic locus of Arabidopsis thaliana, encodes a novel membrane-protein family member. Plant Cell Physiol. 39:1111-1118.

Utz, H.F., Melchinger, A.E., and Schön, C.C. 2000. Bias and sampling error of the estimated proportion of genotypic variance explained by quantitative trait loci determined from experimental data in maize using cross validation and validation with independent samples. Genetics 154:1839-1849.

Valdés-Lópéz, O., Thibivilliers, S., Qui, J., Xu, W.W., Nguyen, T.H.N., Libault, M., Le, B.H., Goldberg, R.B., Hill, C.B., Hartman, G.L., Diers, B., and Stacey, G. 2011. Identification of quantitative trait loci controlling gene expression during the innate immunity response of soybean. Plant Physiol. 157:1975-1986.

Vales, M.I., Schön, C.C., Capettini, F., Chen, S.M., Corey, A.E., Mather, D.E., Mundt, C.C., Richardson, K.L., Sanoval-Islas, J.S., Utz, H.F., and Hayes, P.M. 2005. Effect of population size on the estimation of QTL: a test using resistance to barley stripe rust. Theor. Appl. Genet. 111: 1260-1270. van Ooijen, J.W. 1999. LOD significance thresholds for QTL analysis in experimental populations of diploid species. Hered. 83: 613–624.

160

van Ooijen, J.W. 2004. MapQTL 5, Software for the calculation of quantitative trait loci in experimental populations. Kyazma B.V. Wageningen, the Netherlands. van Ooijen, J.W. 2006. JoinMap 4.0, Software for the calculation of genetic linkage maps in experimental populations. Kyazma B.V. Wageningen, the Netherlands. van Schie, C.C.N., and Takken, F.L.W. 2014. Susceptibility genes 101: how to be a good host. Annu. Rev. Phytopathol. 52:551-581.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B.,. Van Roy, N., De Paepe, A., and Speleman, F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.

Vlot, A.C., Dempsey, D.A., and Klessig, D.F. 2009. Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 47:177-206.

Wang, Y., Chai, C., Valliyodan, B., Maupin, C., Annen, B., and Nguyen, H.T. 2015. Genome-wide analysis and expression profiling of the PIN auxin transporter gene family in soybean (Glycine max). BMC Genomics 16:951

Wang, Q., Han, C., Ferreira, A.O., Yu, X., Ye, W., Tripathy, S., Kale, S.D., Gu, B., Sheng, Y., Sui, Y., Wang, X., Zhang, Z., Cheng, B., Dong, S., Shan, W., Zheng, X., Dou, D., Tyler, B.M., and Wang, Y. 2011. Transcriptional programming and functional interactions within the Phytophthora sojae RXLR effector repertoire. Plant Cell 23:2064- 2086.

Wang, J.-R., Hu, H., Ang, G.-H., Li, J., Chen, J.-Y., and Wu, P. 2009. Expression of PIN genes in rice (Oryza sativa L.): tissue specificity and regulation by hormones. Mol. Plant 2:823-831.

Wang, A., and Krishnaswamy, S. 2012. Eukaryotic translation initiation factor 4E- mediated recessive resistance to plant viruses and its utility in crop improvement. Mol. Plant Pathol. 13:795-803.

Wang, H., St. Martin, S.K., and Dorrance, A.E. 2012a. Comparison of phenotypic methods and yield contributions of quantitative trait loci for partial resistance to Phytophthora sojae in soybean. Crop Sci. 52:609-622.

Wang, H., Waller, L., Tripathy, S., St. Martin, S.K., Zhou, L., Krampis, K., Tucker, D.M., Mao, Y., Hoeschele, I., Maroof, M.A.S., Tyler, B.M., and Dorrance, A.E. 2010. Analysis of genes underlying soybean quantitative trait loci conferring partial resistance to Phytophthora sojae. Plant Gen. 3:23-40.

161

Wang, H., Wijeratne, A., Wijeratne, S., Lee, S., Taylor, C.G., St. Martin, S.K., McHale, L.K., and Dorrance, A.E. 2012b. Dissection of two soybean QTL conferring partial resistance to Phytophthora sojae through sequence and gene expression analysis. BMC Genomics 12:428.

Weijers, D. and Wagner, D. 2016. Transcriptional responses to the auxin hormone. Annu. Rev. Plant Biol. 67:539-574.

Wesley, S.V., Helliwell, C.A., Smith, N.A., Wang, M., Rouse, D.T., Liu, Q., Gooding, P.S., Singh, S.P., Abbott, D., Stoutjesdijk, P.A., Robinson, S.P, Gleave, A.P, Green, A.G., and Waterhouse, P.M. 2001. Construct design for efficient, effective and high- throughput gene silencing in plants. Plant J. 27:581-590.

Westfall, C.S., Herrmann, J., Chen, Q., Wang, S., and Jez, J. 2010. Modulating plant hormones by enzyme action: the GH3 family of acyl amido synthetases. Plant Signal. Behav. 5:1607-1612.

Wickham, H. 2009. Ggplot2: Elegant Graphics for Data Analysis (Use R!). New York, NY:Springer-Verlag.

Wrather, J.A., and Koenning, S.R. 2009. Effects of diseases on soybean yields in the United States 1996 to 2007. Plant Health Progress doi: 10.10941PHP-2009-0401-01-RS.

Woodward, A.W. and Bartel, B. 2005. Auxin: regulation, action, and interaction. Ann. Bot. 95:707-735.

Workneh, F., Tylka, G.L., Yang, X.B., Faghihi, J., and Ferris, J.M. 1999. Regional assessment of soybean brown stem rot, Phytophthora sojae, and Heterodera glycines using area-frame sampling: prevalence and effects of tillage. Phytopathology 89:204-211.

Workneh, F.,Yang, X.B., and Tylka, G.L. 1998. Effect of tillage practices on vertical distribution of Phytophthora sojae. Plant Dis. 82:1258-1263.

Wu, X., Blake, S., Sleper, D.A., Shannon., J.G., Cregan, P.F., and Nguyen, H.T. 2009. QTL, additive and epistatic effects for SCN resistance in PI 437654. Theor. Appl. Genet. 118:1093-1105.

Xiong, Q., Ye, W., Choi, D., Wong, J., Qiao, Y., Tao, K., Wang, Y., and Ma, W. 2014. Phytophthora suppressor of RNA silencing 2 is a conserved RxLR effector that promotes infection in soybean and Arabidopsis thaliana. Mol. Plant-Microbe Interact. 27:1379- 1389.

Xu, X., Zeng, L., Toa, Y., Vuong, T., Wan, J., Boerma, R., Noe, J., Li, Z., Finnerty, S., Pathan, S.M., Shannon, J.G., and Nguyen, H.T. 2013. Pinpointing genes underlying the 162

quantitative trait loci for root-knot nematode resistance in paleopolyploid soybean by whole genome resequencing. Proc. Nat. Acad. Sci. 110:13469-13474.

Xue A.G., Cober, E.R., Voldeng, H.D., Babcook, C., and Clear, R.M. 2007. Evaluation of the pathogenicity of Fusarium graminearum and Fusarium pseudograminearum on soybean seedlings under controlled conditions. Can. J. Plant Pathol. 29:35-40.

Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., and Madden, T.L. 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13:134.

Yin, C., Park, J., Gang, D.R., and Hulbert, S.H. 2014. Characterization of a tryptophan 2- monooxygenase gene from Puccinia graminis f. sp. tritici involved in auxin biosynthesis and rust pathogenicity. Mol. Plant-Microbe Interact. 27:227-235.

Yin, G., Xu, H., Xiao, S., Qin, Y., Li, Y., Yan, Y., and Hu, Y. 2013. The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups. BMC Plant Biol. 13:148

Young, N.D. 1996. QTL mapping and quantitative resistance in plants. Annu. Rev. Phytopathol. 34:479-501.

Yu, C., Dong, W., Zhan, Y., Huang, Z., Li, Z., Kim, I.S., and Zhang, C. 2017. Genome- wide identification and expression analysis of ClLAX, ClPIN, and ClABCB genes families in Citrullus lanatus under various abiotic stresses and grafting. BMC Gen. 18:33.

Yue, R., Tie, S., Sun, T., Zhang, L., Yang, Y., Qi, J., Yan, S., Han, X., Wang, H., and Shen, C. 2015. Genome-wide identification and expression profiling analysis of ZmPIN, ZmPILs, ZmLAX, and ZmABCB auxin transporter gene families in maize (Zea mays L.) under various abiotic stresses. PLoS One 10:e0118751.

Zhang, C., Bradshaw, J.D., Whitham, S.A., and Hill, J.H. 2010. The development of an efficient multipurpose Bean pod mottle virus viral vector set for foreign gene expression and RNA silencing. Plant Physiol. 153:52-65.

Zhang, J., Liu, J.E., Harris, C., Pareira, F.C.M., Wu, F., Blakeslee, J.J., and Peer, W.A. 2016. DAO1 catalyzes temporal and tissue-specific oxidative inactivation of auxin in Arabidopsis thaliana. Proc. Nat. Acad. Sci. 113:11010-11015.

Zhang, J., Xia, C., Wang, X., Duan, C., Sun, S., Wu, X., and Zhu, Z. 2013. Genetic characterization and fine mapping of the Phytophthora resistance gene in a Chinese soybean cultivar. Theor. Appl. Genet. 126:1555-1561.

163

Zhang, Z., Xing, A., Staswick, P., and Clemente, T.E. 1999. The use of glufosinate as a selective agent in Agrobacterium-mediated transformation of soybean. Plant Cell, Tissue and Organ Culture. 56:37-46.

Zhang, B.Q. and Yang, X.B. 2000. Pathogenicity of Pythium populations from corn- soybean rotation fields. Plant Dis. 84:94-99. doi:10.1094.PDIS.2000.84.1.94

Zhong, C., Sun, S., Li, Y., Duan, C., and Zhu, Z. 2018. Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean. Theor. Appl. Genet. 131:525-538.

Zhou, L., Mideros, S. X., Bao, L., Hanlon, R., Arredondo, F.D., Tripathy, S., Krampis, K., Jerauld, A., Evans, C., St. Martin, S.K., Maroof, M.A.S., Hoeschele, I., Dorrance, A.E., and Tyler, B.M. 2009. Infection and genotype remodel the entire soybean transcriptome. BMC Genomics 10:49.

Zitnick-Anderson, K.K., and Nelson, B.D. 2014. Identification and pathogenicity of Pythium on soybean in North Dakota. Plant Dis. 99:31-38.

164

Appendix A. Genetic linkage maps generated in chapter 2

Continued Figure A.1. Chromosome maps generated from 1032 single nucleotide polymorphism and 31 PCR based markers in JoinMap 4.0 (van Ooijen, 2006).

165

Figure A.1. Continued

Continued

166

Figure A.1. Continued

167

Appendix B. Markers used to generate genetic maps in chapter 2

Genetic Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs position (cM) physical position (bp) Gm01 BARC_1.01_Gm01_2708722_C_T BARC_2.0_Gm01_2724688 715578848 0 2724688 Gm01 BARC_1.01_Gm01_2813785_C_T BARC_2.0_Gm01_2829751 715578885 1.487 2829751 Gm01 BARC_1.01_Gm01_3016694_A_G BARC_2.0_Gm01_3033126 715578942 5.667 3033126 Gm01 BARC_1.01_Gm01_3221969_C_A BARC_2.0_Gm01_3237203 715579001 8.866 3237203 Gm01 BARC_1.01_Gm01_3327321_A_C BARC_2.0_Gm01_3342559 715579040 9.534 3342559 Gm01 BARC_1.01_Gm01_3519206_T_C BARC_2.0_Gm01_3530881 715579104 9.894 3530881 Gm01 BARC_1.01_Gm01_3585713_C_A BARC_2.0_Gm01_3597388 715579141 10.478 3597388 Gm01 BARC_1.01_Gm01_3596804_A_C BARC_2.0_Gm01_3608479 715579147 10.52 3608479 Gm01 BARC_1.01_Gm01_3770764_A_C BARC_2.0_Gm01_3791530 715579224 10.865 3791530 Gm01 BARC_1.01_Gm01_3638269_G_A BARC_2.0_Gm01_3649944 715579164 10.871 3649944 Gm01 BARC_1.01_Gm01_3832790_G_T BARC_2.0_Gm01_3853942 715579255 11.395 3853942 Gm01 BARC_1.01_Gm01_4517478_T_C BARC_2.0_Gm01_4539492 715579529 22.313 4539492 Gm01 BARC_1.01_Gm01_4642545_A_G BARC_2.0_Gm01_4664561 715579578 23.948 4664561 Continued aChromosome

Table B.1. SNP and SSR marker names, SNP identifications (IDs), genetic positions (cM), and physical position (bp) of the 1,063 SNPs and SSR markers used in the genetic map of Conrad x Sloan F9:11 RIL population.

Table B.1. Continued Genetic Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs position (cM) physical position (bp) Gm01 BARC_1.01_Gm01_4726775_C_A BARC_2.0_Gm01_4748809 715579689 25.206 4748809 Gm01 BARC_1.01_Gm01_5159361_A_G BARC_2.0_Gm01_5181297 715580248 27.514 5181297 Gm01 BARC_1.01_Gm01_5300057_T_C BARC_2.0_Gm01_5313416 715580423 29.155 5313416 Gm01 BARC_1.01_Gm01_5453015_T_G BARC_2.0_Gm01_5466375 715580578 29.601 5466375 Gm01 BARC_1.01_Gm01_5555585_C_T BARC_2.0_Gm01_5568956 715580702 29.61 5568956 Gm01 BARC_1.01_Gm01_23586582_C_A BARC_2.0_Gm01_22123142 715578751 38.408 22123142 Gm01 BARC_1.01_Gm01_11835461_T_C BARC_2.0_Gm01_11872068 715578446 38.408 11872068 Gm01 BARC_1.01_Gm01_21883574_G_A BARC_2.0_Gm01_20384801 715578705 38.408 20384801 Gm01 BARC_1.01_Gm01_21804377_G_T BARC_2.0_Gm01_20305604 715578702 38.427 20305604 Gm01 BARC_1.01_Gm01_27463902_G_T BARC_2.0_Gm01_25928596 715578859 38.706 25928596

Gm01 BARC_1.01_Gm01_28628358_A_C BARC_2.0_Gm01_27098957 715578900 39.753 27098957 Gm01 BARC_1.01_Gm01_29091115_A_G BARC_2.0_Gm01_27562614 715578909 40.271 27562614 Gm01 BARC_1.01_Gm01_15851740_A_C BARC_2.0_Gm01_31278484 715578564 40.388 31278484 Gm01 BARC_1.01_Gm01_14097047_T_C BARC_2.0_Gm01_29270116 715578504 40.388 29270116 Gm01 BARC_1.01_Gm01_14818197_C_T BARC_2.0_Gm01_30442329 715578521 40.388 30442329 Gm01 BARC_1.01_Gm01_16388569_G_A BARC_2.0_Gm01_31804544 715578580 40.388 31804544 Gm01 BARC_1.01_Gm01_30080907_T_C BARC_2.0_Gm01_28567716 715578938 40.388 28567716 Gm01 BARC_1.01_Gm01_29169958_A_G BARC_2.0_Gm01_27641493 715578911 40.388 27641493 Gm01 BARC_1.01_Gm01_31506268_T_C BARC_2.0_Gm01_32803083 715578984 40.406 32803083 Gm01 BARC_1.01_Gm01_28848622_A_G BARC_2.0_Gm01_27319719 715578904 40.525 27319719 Gm01 BARC_1.01_Gm01_28759367_G_A BARC_2.0_Gm01_27230466 715578901 40.615 27230466 Continued

Table B.1. Continued Genetic Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs position (cM) physical position (bp) Gm01 BARC_1.01_Gm01_31906055_A_G BARC_2.0_Gm01_33203133 715578992 40.71 33203133 Gm01 BARC_1.01_Gm01_27164384_T_G BARC_2.0_Gm01_25626349 715578851 41.435 25626349 Gm01 BARC_1.01_Gm01_20542501_C_T BARC_2.0_Gm01_19044380 715578681 41.472 19044380 Gm01 BARC_1.01_Gm01_38661096_A_G BARC_2.0_Gm01_40040347 715579274 43.912 40040347 Gm01 BARC_1.01_Gm01_37767294_A_G BARC_2.0_Gm01_39140734 715579229 43.912 39140734 Gm01 BARC_1.01_Gm01_48222840_C_T BARC_2.0_Gm01_49097595 715579816 65.555 49097595 Gm01 Satt198 69.001 49435179 Gm01 BARC_1.01_Gm01_49196746_A_G BARC_2.0_Gm01_50078206 715579938 77.153 50078206 Gm01 BARC_1.01_Gm01_49281276_T_G BARC_2.0_Gm01_50164447 715579950 79.649 50164447 Gm01 BARC_1.01_Gm01_49322760_C_A BARC_2.0_Gm01_50206347 715579958 80.4 50206347

Gm01 BARC_1.01_Gm01_49412063_T_G BARC_2.0_Gm01_50295635 715579975 82.611 50295635 Gm01 BARC_1.01_Gm01_49403702_A_G BARC_2.0_Gm01_50287274 715579973 82.628 50287274 Gm01 BARC_1.01_Gm01_49687691_C_T BARC_2.0_Gm01_50572171 715580023 84.476 50572171 Gm01 BARC_1.01_Gm01_49770288_T_C BARC_2.0_Gm01_50654766 715580035 88.24 50654766 Gm01 BARC_1.01_Gm01_49912586_C_A BARC_2.0_Gm01_50797061 715580047 90.365 50797061 Gm01 BARC_1.01_Gm01_49987647_C_T BARC_2.0_Gm01_50871946 715580057 93.669 50871946 Gm01 BARC_1.01_Gm01_50098348_G_T BARC_2.0_Gm01_50982643 715580075 94.38 50982643 Gm01 BARC_1.01_Gm01_50262496_T_C BARC_2.0_Gm01_51147675 715580100 95.51 51147675 Gm01 BARC_1.01_Gm01_50507289_A_G BARC_2.0_Gm01_51392814 715580117 98.621 51392814 Gm01 BARC_1.01_Gm01_50644671_A_C BARC_2.0_Gm01_51530195 715580131 101.628 51530195 Gm01 BARC_1.01_Gm01_50744456_A_C BARC_2.0_Gm01_51629974 715580144 102.94 51629974 Continued

Table B.1. Continued Genetic Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs position (cM) physical position (bp) Gm01 BARC_1.01_Gm01_50889550_T_C BARC_2.0_Gm01_51774753 715580166 104.233 51774753 Gm01 BARC_1.01_Gm01_51034693_A_C BARC_2.0_Gm01_51921479 715580183 104.915 51921479 Gm02 BARC_1.01_Gm02_1830094_T_C BARC_2.0_Gm02_1853600 715581419 0 1853600 Gm02 BARC_1.01_Gm02_1878469_A_G BARC_2.0_Gm02_1901965 715581433 0 1901965 Gm02 BARC_1.01_Gm02_2467152_C_T BARC_2.0_Gm02_2497896 715581593 7.53 2497896 Gm02 BARC_1.01_Gm02_2885598_C_A BARC_2.0_Gm02_2933055 715581732 9.797 2933055 Gm02 BARC_1.01_Gm02_2920341_C_T BARC_2.0_Gm02_2967798 715581751 9.797 2967798 Gm02 BARC_1.01_Gm02_3091665_T_G BARC_2.0_Gm02_3142154 715581813 10.647 3142154 Gm02 BARC_1.01_Gm02_3316379_A_C BARC_2.0_Gm02_3366836 715581892 11.753 3366836 Gm02 BARC_1.01_Gm02_3364524_C_T BARC_2.0_Gm02_3415435 715581908 12.122 3415435

Gm02 BARC_1.01_Gm02_3429963_G_A BARC_2.0_Gm02_3480874 715581929 12.911 3480874 Gm02 BARC_1.01_Gm02_3594255_T_G BARC_2.0_Gm02_3646075 715581991 13.665 3646075 Gm02 BARC_1.01_Gm02_3644248_T_C BARC_2.0_Gm02_3696068 715582009 13.795 3696068 Gm02 BARC_1.01_Gm02_3835570_T_C BARC_2.0_Gm02_3887461 715582094 14.17 3887461 Gm02 BARC_1.01_Gm02_3954305_C_T BARC_2.0_Gm02_4006063 715582137 15.032 4006063 Gm02 BARC_1.01_Gm02_4319761_C_T BARC_2.0_Gm02_4371521 715582547 17.02 4371521 Gm02 BARC_1.01_Gm02_4618881_T_C BARC_2.0_Gm02_4670640 715582963 19.909 4670640 Gm02 BARC_1.01_Gm02_4688093_C_A BARC_2.0_Gm02_4739852 715583031 20.487 4739852 Gm02 BARC_1.01_Gm02_4785649_G_T BARC_2.0_Gm02_4845732 715583146 20.962 4845732 Gm02 BARC_1.01_Gm02_4909353_C_T BARC_2.0_Gm02_4969441 715583267 21.473 4969441 Gm02 BARC_1.01_Gm02_4957187_A_G BARC_2.0_Gm02_5017274 715583297 21.858 5017274 Continued

Table B.1. Continued Genetic Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs position (cM) physical position (bp) Gm02 BARC_1.01_Gm02_5107836_C_A BARC_2.0_Gm02_5167931 715583486 23.049 5167931 Gm02 BARC_1.01_Gm02_5155733_T_G BARC_2.0_Gm02_5215843 715583557 23.632 5215843 Gm02 BARC_1.01_Gm02_5202276_T_C BARC_2.0_Gm02_5262408 715583580 23.838 5262408 Gm02 BARC_1.01_Gm02_5595797_G_A BARC_2.0_Gm02_5654145 715583626 25.82 5654145 Gm02 BARC_1.01_Gm02_5853742_A_C BARC_2.0_Gm02_5912968 715583673 27.12 5912968 Gm02 BARC_1.01_Gm02_5929459_C_T BARC_2.0_Gm02_5988587 715583691 27.247 5988587 Gm02 BARC_1.01_Gm02_5987005_C_T BARC_2.0_Gm02_6046134 715583696 27.394 6046134 Gm02 BARC_1.01_Gm02_6225129_T_G BARC_2.0_Gm02_6301450 715583715 29.45 6301450 Gm02 BARC_1.01_Gm02_6180795_T_G BARC_2.0_Gm02_6257116 715583710 29.456 6257116 Gm02 BARC_1.01_Gm02_6418567_A_G BARC_2.0_Gm02_6494883 715583737 30.117 6494883

Gm02 BARC_1.01_Gm02_6503793_A_G BARC_2.0_Gm02_6580109 715583750 31.109 6580109 Gm02 BARC_1.01_Gm02_6889619_C_T BARC_2.0_Gm02_6967983 715583795 36.208 6967983 Gm02 BARC_1.01_Gm02_7039787_G_T BARC_2.0_Gm02_7118150 715583813 37.549 7118150 Gm02 BARC_1.01_Gm02_7135561_T_C BARC_2.0_Gm02_7213937 715583834 37.641 7213937 Gm02 BARC_1.01_Gm02_7333018_A_G BARC_2.0_Gm02_7420481 715583863 37.819 7420481 Gm02 BARC_1.01_Gm02_7219124_A_G BARC_2.0_Gm02_7306587 715583847 37.888 7306587 Gm02 BARC_1.01_Gm02_7641044_T_C BARC_2.0_Gm02_7730289 715583897 39.684 7730289 Gm02 Satt211 43.366 8742474 Gm02 BARC_1.01_Gm02_9370878_G_T BARC_2.0_Gm02_9467609 715584196 43.999 9467609 Gm02 BARC_1.01_Gm02_10843145_C_T BARC_2.0_Gm02_10935557 715580960 51.416 10935557 Gm02 BARC_1.01_Gm02_11540598_C_T BARC_2.0_Gm02_11877262 715581023 52.846 11877262 Continued

Table B.1. Continued Genetic Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs position (cM) physical position (bp) Gm02 BARC_1.01_Gm02_11257077_A_G BARC_2.0_Gm02_11349126 715580997 52.976 11349126 Gm02 BARC_1.01_Gm02_12244605_A_G BARC_2.0_Gm02_12582331 715581101 54.796 12582331 Gm02 BARC_1.01_Gm02_12168684_T_G BARC_2.0_Gm02_12506411 715581097 54.866 12506411 Gm02 BARC_1.01_Gm02_11998056_T_C BARC_2.0_Gm02_12334435 715581063 54.928 12334435 Gm02 BARC_1.01_Gm02_12078209_G_A BARC_2.0_Gm02_12414985 715581080 54.928 12414985 Gm02 BARC_1.01_Gm02_11628896_T_C BARC_2.0_Gm02_11965390 715581032 55.005 11965390 Gm02 BARC_1.01_Gm02_11638087_T_C BARC_2.0_Gm02_11974580 715581033 55.173 11974580 Gm02 BARC_1.01_Gm02_11870846_C_T BARC_2.0_Gm02_12206518 715581051 55.331 12206518 Gm02 BARC_1.01_Gm02_13476678_G_A BARC_2.0_Gm02_13674975 715581190 59.707 13674975 Gm02 BARC_1.01_Gm02_14127417_A_G BARC_2.0_Gm02_14330827 715581250 67.826 14330827

Gm02 BARC_1.01_Gm02_14215487_T_G BARC_2.0_Gm02_14419208 715581263 68.271 14419208 Gm02 BARC_1.01_Gm02_14345423_T_G BARC_2.0_Gm02_14549144 715581286 68.984 14549144 Gm02 BARC_1.01_Gm02_14508130_C_T BARC_2.0_Gm02_14710975 715581307 69.726 14710975 Gm02 BARC_1.01_Gm02_16287798_T_C BARC_2.0_Gm02_16571664 715581373 86.944 16571664 Gm02 BARC_1.01_Gm02_16980821_T_C BARC_2.0_Gm02_17264749 715581390 87.129 17264749 Gm02 BARC_1.01_Gm02_18273334_A_G BARC_2.0_Gm02_18559493 715581417 87.259 18559493 Gm02 BARC_1.01_Gm02_29528097_T_C BARC_2.0_Gm02_24269404 715581761 87.446 24269404 Gm02 BARC_1.01_Gm02_19218365_T_C BARC_2.0_Gm02_19505166 715581444 87.446 19505166 Gm02 BARC_1.01_Gm02_30996860_A_G BARC_2.0_Gm02_27822018 715581816 87.446 27822018 Gm02 BARC_1.01_Gm02_32605960_T_C BARC_2.0_Gm02_29435127 715581871 87.447 29435127 Gm02 BARC_1.01_Gm02_32043775_T_C BARC_2.0_Gm02_28871127 715581851 87.447 28871127 Gm02 BARC_1.01_Gm02_32904473_T_C BARC_2.0_Gm02_29728401 715581881 87.447 29728401 Continued

Table B.1. Continued Genetic Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs position (cM) physical position (bp) Gm02 BARC_1.01_Gm02_21065065_T_C BARC_2.0_Gm02_21397827 715581484 87.447 21397827 Gm02 BARC_1.01_Gm02_30439101_A_G BARC_2.0_Gm02_27274732 715581794 87.447 27274732 Gm02 BARC_1.01_Gm02_30787675_T_G BARC_2.0_Gm02_27627995 715581808 87.454 27627995 Gm02 BARC_1.01_Gm02_33117418_G_T BARC_2.0_Gm02_30015938 715581889 87.455 30015938 Gm02 BARC_1.01_Gm02_32487728_T_C BARC_2.0_Gm02_29316845 715581867 87.455 29316845 Gm02 BARC_1.01_Gm02_25466460_A_G BARC_2.0_Gm02_23740649 715581613 87.568 23740649 Gm02 BARC_1.01_Gm02_42355637_A_G BARC_2.0_Gm02_39283955 715582382 96.079 39283955 Gm02 BARC_1.01_Gm02_42788887_A_G BARC_2.0_Gm02_39712323 715582464 98.673 39712323 Gm02 BARC_1.01_Gm02_43139891_G_A BARC_2.0_Gm02_40063716 715582537 100.917 40063716

Gm02 BARC_1.01_Gm02_43641969_C_A BARC_2.0_Gm02_40565506 715582607 101.994 40565506 Gm02 BARC_1.01_Gm02_43725963_A_G BARC_2.0_Gm02_40649856 715582627 102.197 40649856 Gm02 BARC_1.01_Gm02_43952429_A_G BARC_2.0_Gm02_40875934 715582664 103.528 40875934 Gm02 BARC_1.01_Gm02_44033150_T_C BARC_2.0_Gm02_40956596 715582685 103.673 40956596 Gm02 BARC_1.01_Gm02_44190678_C_T BARC_2.0_Gm02_41114125 715582717 104.252 41114125 Gm02 BARC_1.01_Gm02_44156636_G_T BARC_2.0_Gm02_41080083 715582709 104.255 41080083 Gm02 BARC_1.01_Gm02_44354376_T_C BARC_2.0_Gm02_41277852 715582740 104.481 41277852 Gm02 BARC_1.01_Gm02_44401175_C_T BARC_2.0_Gm02_41324651 715582747 104.819 41324651 Gm02 BARC_1.01_Gm02_44510528_T_C BARC_2.0_Gm02_41432839 715582768 105.185 41432839 Gm02 BARC_1.01_Gm02_44620331_A_G BARC_2.0_Gm02_41544174 715582782 105.604 41544174 Gm02 BARC_1.01_Gm02_44863895_G_T BARC_2.0_Gm02_41787747 715582813 110.431 41787747 Gm02 BARC_1.01_Gm02_44923400_G_T BARC_2.0_Gm02_41847331 715582821 111.026 41847331 Continued

Table B.1. Continued Genetic Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs position (cM) physical position (bp) Gm02 BARC_1.01_Gm02_45366539_A_G BARC_2.0_Gm02_42291659 715582866 112.152 42291659 Gm02 BARC_1.01_Gm02_45445720_T_C BARC_2.0_Gm02_42370864 715582873 112.433 42370864 Gm02 BARC_1.01_Gm02_45533271_C_A BARC_2.0_Gm02_42458613 715582884 112.975 42458613 Gm02 BARC_1.01_Gm02_45602331_C_T BARC_2.0_Gm02_42527503 715582897 113.328 42527503 Gm02 BARC_1.01_Gm02_45596920_A_G BARC_2.0_Gm02_42522092 715582893 113.355 42522092 Gm02 BARC_1.01_Gm02_45805567_A_G BARC_2.0_Gm02_42730709 715582916 113.653 42730709 Gm02 BARC_1.01_Gm02_47528737_C_T BARC_2.0_Gm02_44441196 715583115 125.317 44441196 Gm02 BARC_1.01_Gm02_47515175_G_A BARC_2.0_Gm02_44427664 715583112 125.317 44427664 Gm02 BARC_1.01_Gm02_47394316_A_G BARC_2.0_Gm02_44306758 715583097 125.506 44306758

Gm02 BARC_1.01_Gm02_47314350_T_C BARC_2.0_Gm02_44226448 715583084 125.506 44226448 Gm02 BARC_1.01_Gm02_47790307_C_T BARC_2.0_Gm02_44702951 715583137 126.618 44702951 Gm02 BARC_1.01_Gm02_48248895_A_C BARC_2.0_Gm02_45170092 715583175 128.968 45170092 Gm02 BARC_1.01_Gm02_48702118_T_G BARC_2.0_Gm02_45623364 715583215 131.932 45623364 Gm03 BARC_1.01_Gm03_206707_G_A BARC_2.0_Gm03_205937 715584722 0 205937 Gm03 BARC_1.01_Gm03_345478_G_A BARC_2.0_Gm03_344529 715585247 1.712 344529 Gm03 BARC_1.01_Gm03_426154_C_A BARC_2.0_Gm03_425209 715586167 1.9 425209 Gm03 BARC_1.01_Gm03_1077329_C_T BARC_2.0_Gm03_1094327 715584359 9.161 1094327 Gm03 BARC_1.01_Gm03_1209205_G_T BARC_2.0_Gm03_1226007 715584399 9.161 1226007 Gm03 BARC_1.01_Gm03_1302748_T_C BARC_2.0_Gm03_1324758 715584434 9.373 1324758 Gm03 BARC_1.01_Gm03_1441844_C_A BARC_2.0_Gm03_1463842 715584477 10.846 1463842 Gm03 BARC_1.01_Gm03_4718162_C_A BARC_2.0_Gm03_4527306 715586612 31.952 4527306 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm03 BARC_1.01_Gm03_4901669_A_G BARC_2.0_Gm03_4710949 715586703 32.143 4710949 Gm03 BARC_1.01_Gm03_5106459_T_G BARC_2.0_Gm03_5009334 715586748 32.367 5009334 Gm03 BARC_1.01_Gm03_4782127_T_C BARC_2.0_Gm03_4591270 715586676 32.569 4591270 Gm03 BARC_1.01_Gm03_21347065_C_T BARC_2.0_Gm03_17644304 715584752 36.7 17644304 Gm03 BARC_1.01_Gm03_8228940_G_A BARC_2.0_Gm03_7872384 715586976 37.016 7872384 Gm03 BARC_1.01_Gm03_14228358_T_C BARC_2.0_Gm03_13442097 715584470 37.205 13442097 Gm03 BARC_1.01_Gm03_14840739_T_G BARC_2.0_Gm03_14005577 715584491 37.206 14005577 Gm03 BARC_1.01_Gm03_22189671_C_T BARC_2.0_Gm03_16814269 715584783 37.206 16814269 Gm03 BARC_1.01_Gm03_10982565_T_C BARC_2.0_Gm03_10515241 715584368 37.206 10515241

Gm03 BARC_1.01_Gm03_11396505_C_T BARC_2.0_Gm03_10950353 715584382 37.206 10950353 Gm03 BARC_1.01_Gm03_13015481_T_C BARC_2.0_Gm03_12292048 715584433 37.206 12292048 Gm03 BARC_1.01_Gm03_13642775_C_T BARC_2.0_Gm03_15422329 715584452 37.206 15422329 Gm03 BARC_1.01_Gm03_22259196_C_A BARC_2.0_Gm03_16738385 715584789 37.206 16738385 Gm03 BARC_1.01_Gm03_21918775_A_G BARC_2.0_Gm03_17085614 715584770 37.206 17085614 Gm03 BARC_1.01_Gm03_23324209_C_T BARC_2.0_Gm03_13387006 715584830 37.206 13387006 Gm03 BARC_1.01_Gm03_15615896_C_T BARC_2.0_Gm03_14778473 715584513 37.206 14778473 Gm03 BARC_1.01_Gm03_22371830_G_A BARC_2.0_Gm03_16621811 715584793 37.206 16621811 Gm03 BARC_1.01_Gm03_12163115_T_G BARC_2.0_Gm03_11688292 715584404 37.209 11688292 Gm03 BARC_1.01_Gm03_10408873_C_T BARC_2.0_Gm03_9929019 715584347 37.34 9929019 Gm03 BARC_1.01_Gm03_9641204_C_A BARC_2.0_Gm03_9111573 715587016 37.343 9111573 Gm03 BARC_1.01_Gm03_9789580_G_T BARC_2.0_Gm03_9259491 715587021 37.343 9259491 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm03 BARC_1.01_Gm03_6844115_A_C BARC_2.0_Gm03_6692130 715586928 38.188 6692130 Gm03 BARC_1.01_Gm03_6459920_A_G BARC_2.0_Gm03_6278920 715586915 38.588 6278920 Gm03 BARC_1.01_Gm03_6631189_A_G BARC_2.0_Gm03_6477854 715586921 38.821 6477854 Gm03 BARC_1.01_Gm03_5796468_A_G BARC_2.0_Gm03_5652619 715586892 39.583 5652619 Gm03 BARC_1.01_Gm03_35330372_G_T BARC_2.0_Gm03_33292135 715585319 49.606 33292135 Gm03 BARC_1.01_Gm03_35913889_T_C BARC_2.0_Gm03_33884116 715585379 54.968 33884116 Gm03 BARC_1.01_Gm03_35968599_G_A BARC_2.0_Gm03_33938840 715585384 54.968 33938840 Gm03 BARC_1.01_Gm03_36018412_T_C BARC_2.0_Gm03_33988654 715585392 55.092 33988654 Gm03 BARC_1.01_Gm03_36058927_T_C BARC_2.0_Gm03_34029176 715585399 55.886 34029176

Gm03 BARC_1.01_Gm03_36178327_G_A BARC_2.0_Gm03_34147379 715585411 56.284 34147379 Gm03 BARC_1.01_Gm03_37432542_C_A BARC_2.0_Gm03_35405797 715585588 63.838 35405797 Gm03 BARC_1.01_Gm03_37488779_G_A BARC_2.0_Gm03_35462187 715585601 64.429 35462187 Gm03 BARC_1.01_Gm03_38931849_C_A BARC_2.0_Gm03_36914473 715585771 73.731 36914473 Gm03 BARC_1.01_Gm03_38976026_C_T BARC_2.0_Gm03_36959274 715585773 73.871 36959274 Gm03 BARC_1.01_Gm03_38862467_A_G BARC_2.0_Gm03_36845347 715585767 74.032 36845347 Gm03 BARC_1.01_Gm03_38761991_G_T BARC_2.0_Gm03_36745144 715585759 74.109 36745144 Gm03 BARC_1.01_Gm03_38469714_C_T BARC_2.0_Gm03_36449357 715585730 75.138 36449357 Gm03 BARC_1.01_Gm03_39491355_G_T BARC_2.0_Gm03_37473452 715585820 78.312 37473452 Gm03 BARC_1.01_Gm03_39574966_T_C BARC_2.0_Gm03_37557065 715585837 78.317 37557065 Gm03 BARC_1.01_Gm03_40115297_C_T BARC_2.0_Gm03_38100814 715585882 81.87 38100814 Gm03 BARC_1.01_Gm03_41020834_T_C BARC_2.0_Gm03_39009305 715586013 88.077 39009305 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm03 BARC_1.01_Gm03_43504459_G_A BARC_2.0_Gm03_41491337 715586235 106.07 41491337 Gm03 BARC_1.01_Gm03_43525455_A_G BARC_2.0_Gm03_41512333 715586240 106.07 41512333 Gm03 BARC_1.01_Gm03_43599557_T_C BARC_2.0_Gm03_41595432 715586248 106.235 41595432 Gm03 BARC_1.01_Gm03_43707104_A_G BARC_2.0_Gm03_41703528 715586252 106.933 41703528 Gm04 BARC_1.01_Gm04_40545788_G_A BARC_2.0_Gm04_43702009 715587993 0 43702009 Gm04 BARC_1.01_Gm04_40811025_C_A BARC_2.0_Gm04_43971465 715588036 1.138 43971465 Gm04 BARC_1.01_Gm04_41071612_A_G BARC_2.0_Gm04_44218913 715588062 2.351 44218913 Gm04 BARC_1.01_Gm04_41249369_T_C BARC_2.0_Gm04_44396642 715588076 3.434 44396642 Gm04 BARC_1.01_Gm04_42832910_C_T BARC_2.0_Gm04_45977762 715588255 12.042 45977762

Gm04 BARC_1.01_Gm04_42951376_G_A BARC_2.0_Gm04_46096228 715588277 13.798 46096228 Gm04 BARC_1.01_Gm04_43059665_A_C BARC_2.0_Gm04_46204517 715588307 15.969 46204517 Gm04 BARC_1.01_Gm04_43058492_T_G BARC_2.0_Gm04_46203344 715588306 15.969 46203344 Gm04 BARC_1.01_Gm04_43390997_A_C BARC_2.0_Gm04_46536196 715588347 17.406 46536196 Gm04 BARC_1.01_Gm04_43800862_C_T BARC_2.0_Gm04_46948720 715588398 21.744 46948720 Gm04 BARC_1.01_Gm04_43885291_A_G BARC_2.0_Gm04_47033150 715588410 22.158 47033150 Gm04 BARC_1.01_Gm04_43966863_G_A BARC_2.0_Gm04_47114807 715588424 22.591 47114807 Gm04 BARC_1.01_Gm04_44170480_C_A BARC_2.0_Gm04_47296603 715588460 24.427 47296603 Gm04 BARC_1.01_Gm04_44220515_C_T BARC_2.0_Gm04_47346638 715588473 24.504 47346638 Gm04 BARC_1.01_Gm04_44290827_T_C BARC_2.0_Gm04_47416922 715588488 24.819 47416922 Gm04 BARC_1.01_Gm04_44383936_C_T BARC_2.0_Gm04_47510218 715588503 25.614 47510218 Gm04 BARC_1.01_Gm04_44873112_T_C BARC_2.0_Gm04_48002103 715588542 32.405 48002103 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm04 BARC_1.01_Gm04_44924553_A_G BARC_2.0_Gm04_48053544 715588548 32.94 48053544 Gm04 BARC_1.01_Gm04_45004787_A_G BARC_2.0_Gm04_48133794 715588554 34.715 48133794 Gm04 BARC_1.01_Gm04_45093386_G_A BARC_2.0_Gm04_48222393 715588571 35.219 48222393 Gm04 BARC_1.01_Gm04_45221708_C_T BARC_2.0_Gm04_48350713 715588597 35.831 48350713 Gm04 BARC_1.01_Gm04_45313496_C_T BARC_2.0_Gm04_48442502 715588613 36.651 48442502 Gm04 BARC_1.01_Gm04_45514250_A_G BARC_2.0_Gm04_48643257 715588639 39.228 48643257 Gm04 BARC_1.01_Gm04_45613405_T_C BARC_2.0_Gm04_48742467 715588649 40.05 48742467 Gm04 BARC_1.01_Gm04_45999196_C_A BARC_2.0_Gm04_49127886 715588669 42.805 49127886 Gm04 BARC_1.01_Gm04_46086046_G_A BARC_2.0_Gm04_49214232 715588681 43.971 49214232

Gm04 BARC_1.01_Gm04_46280438_G_A BARC_2.0_Gm04_49408492 715588694 44.909 49408492 Gm04 BARC_1.01_Gm04_47092275_T_C BARC_2.0_Gm04_50223267 715588830 50.823 50223267 Gm04 BARC_1.01_Gm04_47718975_A_C BARC_2.0_Gm04_50850285 715588903 57.833 50850285 Gm04 BARC_1.01_Gm04_47981836_T_C BARC_2.0_Gm04_51113353 715588919 58.37 51113353 Gm04 BARC_1.01_Gm04_48140577_G_A BARC_2.0_Gm04_51272076 715588940 59.41 51272076 Gm04 BARC_1.01_Gm04_48198636_G_A BARC_2.0_Gm04_51330095 715588949 59.61 51330095 Gm04 BARC_1.01_Gm04_48244118_G_A BARC_2.0_Gm04_51375575 715588954 59.618 51375575 Gm04 BARC_1.01_Gm04_48414788_T_C BARC_2.0_Gm04_51546265 715588972 60.55 51546265 Gm04 BARC_1.01_Gm04_48856621_C_T BARC_2.0_Gm04_52002411 715589016 63.308 52002411 Gm04 BARC_1.01_Gm04_48812166_A_G BARC_2.0_Gm04_51957955 715589007 63.372 51957955 Gm04 BARC_1.01_Gm04_48726831_C_T BARC_2.0_Gm04_51872562 715589000 63.686 51872562 Gm04 BARC_1.01_Gm04_48977363_C_T BARC_2.0_Gm04_52122999 715589027 64.437 52122999 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm05 BARC_1.01_Gm05_285672_T_C BARC_2.0_Gm05_1960856 715590397 0 1960856 Gm05 BARC_1.01_Gm05_394764_T_C BARC_2.0_Gm05_2069948 715591802 2.014 2069948 Gm05 BARC_1.01_Gm05_429856_A_G BARC_2.0_Gm05_2105040 715592268 2.339 2105040 Gm05 BARC_1.01_Gm05_492138_C_T BARC_2.0_Gm05_2167334 715592317 2.444 2167334 Gm05 BARC_1.01_Gm05_538322_G_T BARC_2.0_Gm05_2213518 715592346 2.794 2213518 Gm05 BARC_1.01_Gm05_682648_A_G BARC_2.0_Gm05_2357871 715592433 4.226 2357871 Gm05 BARC_1.01_Gm05_765761_G_T BARC_2.0_Gm05_2440984 715592477 4.654 2440984 Gm05 BARC_1.01_Gm05_1744708_G_A BARC_2.0_Gm05_3467767 715590056 13.792 3467767 Gm05 BARC_1.01_Gm05_2674662_T_G BARC_2.0_Gm05_4395428 715590297 27.193 4395428

Gm05 BARC_1.01_Gm05_2647363_C_T BARC_2.0_Gm05_4368128 715590284 27.215 4368128 Gm05 BARC_1.01_Gm05_2708074_T_C BARC_2.0_Gm05_4423839 715590313 28.113 4423839 Gm05 BARC_1.01_Gm05_3284858_A_G BARC_2.0_Gm05_5001282 715590818 34.593 5001282 Gm05 BARC_1.01_Gm05_3764264_C_T BARC_2.0_Gm05_5480565 715591532 37 5480565 Gm05 BARC_1.01_Gm05_3859212_C_T BARC_2.0_Gm05_5575791 715591650 37.762 5575791 Gm05 BARC_1.01_Gm05_3905135_T_C BARC_2.0_Gm05_5621714 715591712 38.984 5621714 Gm05 BARC_1.01_Gm05_4037530_A_G BARC_2.0_Gm05_5753185 715591938 39.533 5753185 Gm05 BARC_1.01_Gm05_27460724_A_G BARC_2.0_Gm05_27856064 715590333 48.694 27856064 Gm05 BARC_1.01_Gm05_33843473_C_T BARC_2.0_Gm05_34112269 715590971 66.761 34112269 Gm05 BARC_1.01_Gm05_33785297_T_C BARC_2.0_Gm05_34054092 715590953 67.231 34054092 Gm05 BARC_1.01_Gm05_33737561_T_C BARC_2.0_Gm05_34006356 715590942 67.236 34006356 Gm05 BARC_1.01_Gm05_33618722_T_C BARC_2.0_Gm05_33887621 715590919 67.878 33887621 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm05 BARC_1.01_Gm05_36749252_T_C BARC_2.0_Gm05_37039750 715591385 93.82 37039750 Gm05 BARC_1.01_Gm05_36849833_T_C BARC_2.0_Gm05_37139944 715591399 94.212 37139944 Gm05 BARC_1.01_Gm05_37071607_G_A BARC_2.0_Gm05_37361399 715591421 95.209 37361399 Gm05 BARC_1.01_Gm05_37043636_A_C BARC_2.0_Gm05_37333428 715591417 95.209 37333428 Gm05 BARC_1.01_Gm05_37115396_A_G BARC_2.0_Gm05_37405444 715591437 95.346 37405444 Gm05 BARC_1.01_Gm05_37027716_G_A BARC_2.0_Gm05_37317508 715591412 95.351 37317508 Gm05 BARC_1.01_Gm05_37194257_T_C BARC_2.0_Gm05_37484301 715591449 95.732 37484301 Gm05 BARC_1.01_Gm05_37305888_A_G BARC_2.0_Gm05_37595926 715591467 96.086 37595926 Gm05 BARC_1.01_Gm05_37260149_A_G BARC_2.0_Gm05_37550193 715591463 96.093 37550193

Gm05 BARC_1.01_Gm05_37592640_T_C BARC_2.0_Gm05_37882533 715591523 97.705 37882533 Gm05 BARC_1.01_Gm05_37611048_C_T BARC_2.0_Gm05_37900941 715591526 97.705 37900941 Gm05 BARC_1.01_Gm05_37744939_G_T BARC_2.0_Gm05_38035040 715591550 97.893 38035040 Gm05 BARC_1.01_Gm05_37848366_C_A BARC_2.0_Gm05_38138511 715591562 97.893 38138511 Gm05 BARC_1.01_Gm05_37834044_A_G BARC_2.0_Gm05_38124189 715591558 97.893 38124189 Gm05 BARC_1.01_Gm05_37990846_C_T BARC_2.0_Gm05_38280990 715591594 98.081 38280990 Gm05 BARC_1.01_Gm05_41740936_C_T BARC_2.0_Gm05_38597425 715592240 99.735 38597425 Gm05 BARC_1.01_Gm05_41658399_C_T BARC_2.0_Gm05_38679910 715592231 99.829 38679910 Gm05 BARC_1.01_Gm05_41481303_T_C BARC_2.0_Gm05_38856557 715592199 100.886 38856557 Gm05 BARC_1.01_Gm05_41446899_T_C BARC_2.0_Gm05_38890959 715592192 101.041 38890959 Gm05 BARC_1.01_Gm05_40642754_C_A BARC_2.0_Gm05_39696120 715591991 105.184 39696120 Gm05 BARC_1.01_Gm05_40452052_G_T BARC_2.0_Gm05_39886822 715591954 106.673 39886822 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm05 BARC_1.01_Gm05_39374746_C_T BARC_2.0_Gm05_40974254 715591790 112.547 40974254 Gm05 BARC_1.01_Gm05_39083568_A_G BARC_2.0_Gm05_41265253 715591728 115.758 41265253 Gm05 BARC_1.01_Gm05_38674350_C_T BARC_2.0_Gm05_41674471 715591659 118.376 41674471 Gm05 BARC_1.01_Gm05_38636402_G_A BARC_2.0_Gm05_41712419 715591655 118.511 41712419 Gm06 BARC_1.01_Gm06_5829396_G_A BARC_2.0_Gm06_5835215 715595367 0 5835215 Gm06 BARC_1.01_Gm06_5847946_T_G BARC_2.0_Gm06_5853765 715595369 0.06 5853765 Gm06 BARC_1.01_Gm06_6094090_G_T BARC_2.0_Gm06_6099232 715595392 2.236 6099232 Gm06 BARC_1.01_Gm06_7072768_A_G BARC_2.0_Gm06_7078527 715595478 10.231 7078527 Gm06 BARC_1.01_Gm06_7259462_T_C BARC_2.0_Gm06_7265304 715595487 11.582 7265304

Gm06 BARC_1.01_Gm06_8079300_T_C BARC_2.0_Gm06_8085085 715595583 16.89 8085085 Gm06 BARC_1.01_Gm06_8338093_G_A BARC_2.0_Gm06_8343876 715595598 17.855 8343876 Gm06 BARC_1.01_Gm06_8630236_C_T BARC_2.0_Gm06_8636013 715595616 19.358 8636013 Gm06 BARC_1.01_Gm06_8802768_C_T BARC_2.0_Gm06_8808577 715595637 19.549 8808577 Gm06 BARC_1.01_Gm06_9153377_A_G BARC_2.0_Gm06_9163989 715595659 20.133 9163989 Gm06 BARC_1.01_Gm06_9081030_C_A BARC_2.0_Gm06_9087027 715595654 20.133 9087027 Gm06 BARC_1.01_Gm06_9216536_A_C BARC_2.0_Gm06_9227148 715595663 20.334 9227148 Gm06 BARC_1.01_Gm06_10993554_A_G BARC_2.0_Gm06_11019800 715592742 41.628 11019800 Gm06 BARC_1.01_Gm06_11098210_C_T BARC_2.0_Gm06_11124796 715592752 42.255 11124796 Gm06 BARC_1.01_Gm06_14058543_A_C BARC_2.0_Gm06_14094641 715593161 78.152 14094641 Gm06 BARC_1.01_Gm06_15910152_A_G BARC_2.0_Gm06_15959069 715593448 98.636 15959069 Gm06 BARC_1.01_Gm06_16207402_T_C BARC_2.0_Gm06_16256683 715593501 100.151 16256683 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm06 BARC_1.01_Gm06_45768166_A_G BARC_2.0_Gm06_46295298 715594534 130.193 46295298 Gm06 BARC_1.01_Gm06_46186757_C_T BARC_2.0_Gm06_46719374 715594569 130.375 46719374 Gm06 BARC_1.01_Gm06_46564658_C_A BARC_2.0_Gm06_47112305 715594630 132.074 47112305 Gm06 BARC_1.01_Gm06_48582951_G_A BARC_2.0_Gm06_48211587 715595003 140.412 48211587 Gm06 BARC_1.01_Gm06_47723155_T_C BARC_2.0_Gm06_48344234 715594872 140.612 48344234 Gm07a BARC_1.01_Gm07_16979586_C_T BARC_2.0_Gm07_17065562 715596625 0 17065562 Gm07a BARC_1.01_Gm07_17615932_A_G BARC_2.0_Gm07_17699946 715596673 0.89 17699946 Gm07a BARC_1.01_Gm07_18633505_T_C BARC_2.0_Gm07_18723135 715596707 3.331 18723135 Gm07a BARC_1.01_Gm07_35194991_A_G BARC_2.0_Gm07_35058752 715597298 5.612 35058752

Gm07a BARC_1.01_Gm07_21193861_G_A BARC_2.0_Gm07_21255540 715596792 5.86 21255540 Gm07a BARC_1.01_Gm07_20527016_C_T BARC_2.0_Gm07_20626887 715596775 5.867 20626887 Gm07a BARC_1.01_Gm07_21217603_T_C BARC_2.0_Gm07_21293829 715596794 5.867 21293829 Gm07a BARC_1.01_Gm07_24960162_C_A BARC_2.0_Gm07_25078333 715596886 6.192 25078333 Gm07a BARC_1.01_Gm07_28865848_T_C BARC_2.0_Gm07_28935619 715597036 6.192 28935619 Gm07a BARC_1.01_Gm07_26960074_A_G BARC_2.0_Gm07_27011688 715596955 6.192 27011688 Gm07a BARC_1.01_Gm07_24197913_T_G BARC_2.0_Gm07_22970212 715596862 6.192 22970212 Gm07a BARC_1.01_Gm07_30018015_T_C BARC_2.0_Gm07_29946583 715597074 6.192 29946583 Gm07a BARC_1.01_Gm07_27445113_A_G BARC_2.0_Gm07_27503018 715596983 6.192 27503018 Gm07a BARC_1.01_Gm07_22686796_T_C BARC_2.0_Gm07_24489733 715596828 6.192 24489733 Gm07a BARC_1.01_Gm07_23710284_A_G BARC_2.0_Gm07_23456879 715596853 6.192 23456879 Gm07a BARC_1.01_Gm07_22668340_A_G BARC_2.0_Gm07_24508189 715596826 6.193 24508189 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm07a BARC_1.01_Gm07_35142318_A_G BARC_2.0_Gm07_35006083 715597296 6.755 35006083 Gm07a BARC_1.01_Gm07_35547398_T_C BARC_2.0_Gm07_35411154 715597327 10.322 35411154 Gm07a BARC_1.01_Gm07_35619623_G_A BARC_2.0_Gm07_35483387 715597336 10.538 35483387 Gm07a BARC_1.01_Gm07_35992034_T_G BARC_2.0_Gm07_35868100 715597365 13.305 35868100 Gm07a BARC_1.01_Gm07_40945201_C_T BARC_2.0_Gm07_40896029 715597998 55.754 40896029 Gm07a BARC_1.01_Gm07_42102555_A_G BARC_2.0_Gm07_42048848 715598078 63.936 42048848 Gm07a BARC_1.01_Gm07_42275940_A_C BARC_2.0_Gm07_42222270 715598089 64.355 42222270 Gm07a BARC_1.01_Gm07_42450573_A_G BARC_2.0_Gm07_42396323 715598109 66.375 42396323 Gm07a BARC_1.01_Gm07_42643191_A_G BARC_2.0_Gm07_42588941 715598121 70.993 42588941

Gm07a BARC_1.01_Gm07_42851461_T_C BARC_2.0_Gm07_42797211 715598131 73.371 42797211 Gm07a BARC_1.01_Gm07_42923420_G_A BARC_2.0_Gm07_42869168 715598139 73.798 42869168 Gm07a BARC_1.01_Gm07_44621109_A_G BARC_2.0_Gm07_44567848 715598241 85.901 44567848 Gm07a BARC_1.01_Gm07_44451098_G_A BARC_2.0_Gm07_44397815 715598228 85.911 44397815 Gm07b BARC_1.01_Gm07_8112122_C_T BARC_2.0_Gm07_8151504 715598762 0 8151504 Gm07b BARC_1.01_Gm07_8166605_T_C BARC_2.0_Gm07_8206004 715598774 0 8206004 Gm07b BARC_1.01_Gm07_7579367_G_A BARC_2.0_Gm07_7618741 715598641 1.295 7618741 Gm07b BARC_1.01_Gm07_7666127_T_C BARC_2.0_Gm07_7705501 715598665 1.296 7705501 Gm07b BARC_1.01_Gm07_7369745_C_T BARC_2.0_Gm07_7409086 715598608 3.697 7409086 Gm07b BARC_1.01_Gm07_7160924_T_C BARC_2.0_Gm07_7199289 715598582 4.399 7199289 Gm07b BARC_1.01_Gm07_7032715_G_A BARC_2.0_Gm07_7070970 715598569 4.834 7070970 Gm07b BARC_1.01_Gm07_7096376_G_T BARC_2.0_Gm07_7134727 715598573 4.916 7134727 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm07b BARC_1.01_Gm07_6947362_A_G BARC_2.0_Gm07_6985620 715598558 5.214 6985620 Gm07b BARC_1.01_Gm07_6859582_A_G BARC_2.0_Gm07_6898693 715598542 5.405 6898693 Gm07b BARC_1.01_Gm07_6521175_T_C BARC_2.0_Gm07_6559823 715598498 7.499 6559823 Gm07b BARC_1.01_Gm07_6555810_T_C BARC_2.0_Gm07_6594458 715598506 7.509 6594458 Gm07b BARC_1.01_Gm07_6161800_A_G BARC_2.0_Gm07_6200435 715598450 7.681 6200435 Gm07b BARC_1.01_Gm07_5900018_A_G BARC_2.0_Gm07_5938285 715598413 7.736 5938285 Gm07b BARC_1.01_Gm07_6604493_G_A BARC_2.0_Gm07_6643125 715598514 7.792 6643125 Gm07b BARC_1.01_Gm07_6352113_T_G BARC_2.0_Gm07_6390761 715598478 7.939 6390761 Gm07b BARC_1.01_Gm07_6405598_A_G BARC_2.0_Gm07_6444246 715598483 7.939 6444246

Gm07b BARC_1.01_Gm07_5490895_G_T BARC_2.0_Gm07_5529532 715598353 8.262 5529532 Gm07b BARC_1.01_Gm07_5352313_T_C BARC_2.0_Gm07_5391104 715598329 8.796 5391104 Gm07b BARC_1.01_Gm07_5226366_C_T BARC_2.0_Gm07_5265136 715598313 9.177 5265136 Gm07b BARC_1.01_Gm07_5152231_A_G BARC_2.0_Gm07_5191003 715598301 9.665 5191003 Gm07b BARC_1.01_Gm07_4837493_A_G BARC_2.0_Gm07_4885291 715598267 12.645 4885291 Gm07b BARC_1.01_Gm07_3318193_T_C BARC_2.0_Gm07_3337039 715597201 34.961 3337039 Gm07b BARC_1.01_Gm07_3281799_T_G BARC_2.0_Gm07_3300645 715597185 35.602 3300645 Gm07b BARC_1.01_Gm07_1630335_G_A BARC_2.0_Gm07_1632501 715596541 57.197 1632501 Gm07b BARC_1.01_Gm07_1382983_T_G BARC_2.0_Gm07_1385153 715596094 58.669 1385153 Gm07b BARC_1.01_Gm07_1246890_T_G BARC_2.0_Gm07_1249059 715595950 59.689 1249059 Gm07b BARC_1.01_Gm07_1119462_A_G BARC_2.0_Gm07_1121927 715595856 59.969 1121927 Gm07b BARC_1.01_Gm07_954565_G_A BARC_2.0_Gm07_957723 715599068 60.136 957723 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm08 BARC_1.01_Gm08_2288307_A_G BARC_2.0_Gm08_2292177 715600970 0 2292177 Gm08 BARC_1.01_Gm08_2394647_G_A BARC_2.0_Gm08_2398166 715601139 0.204 2398166 Gm08 BARC_1.01_Gm08_2467547_G_T BARC_2.0_Gm08_2471066 715601166 0.406 2471066 Gm08 BARC_1.01_Gm08_2837248_T_C BARC_2.0_Gm08_2840929 715601296 5.457 2840929 Gm08 BARC_1.01_Gm08_3018731_A_C BARC_2.0_Gm08_3022795 715601362 6.113 3022795 Gm08 BARC_1.01_Gm08_3178655_C_A BARC_2.0_Gm08_3182921 715601417 6.831 3182921 Gm08 BARC_1.01_Gm08_3272385_G_T BARC_2.0_Gm08_3276651 715601444 6.831 3276651 Gm08 BARC_1.01_Gm08_3285222_T_C BARC_2.0_Gm08_3289486 715601449 6.831 3289486 Gm08 BARC_1.01_Gm08_3369110_G_A BARC_2.0_Gm08_3373388 715601478 7.408 3373388

Gm08 BARC_1.01_Gm08_4266625_A_C BARC_2.0_Gm08_4272701 715602078 15.646 4272701 Gm08 BARC_1.01_Gm08_5701842_C_T BARC_2.0_Gm08_5709053 715602602 30.091 5709053 Gm08 BARC_1.01_Gm08_6188267_T_G BARC_2.0_Gm08_6196069 715602631 34.222 6196069 Gm08 BARC_1.01_Gm08_7418586_T_C BARC_2.0_Gm08_7425389 715602678 42.194 7425389 Gm08 BARC_1.01_Gm08_7714968_T_C BARC_2.0_Gm08_7721316 715602701 43.892 7721316 Gm08 BARC_1.01_Gm08_8695745_A_C BARC_2.0_Gm08_8725772 715602796 52.576 8725772 Gm08 BARC_1.01_Gm08_9484695_T_C BARC_2.0_Gm08_9476804 715602869 59.611 9476804 Gm08 BARC_1.01_Gm08_9700052_T_G BARC_2.0_Gm08_9692119 715602895 61.745 9692119 Gm08 BARC_1.01_Gm08_9741542_T_C BARC_2.0_Gm08_9733609 715602897 62.153 9733609 Gm08 BARC_1.01_Gm08_9789047_T_C BARC_2.0_Gm08_9781116 715602899 62.18 9781116 Gm08 BARC_1.01_Gm08_9885021_T_C BARC_2.0_Gm08_9877098 715602909 62.405 9877098 Gm08 BARC_1.01_Gm08_9970013_G_T BARC_2.0_Gm08_9962057 715602924 62.98 9962057 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm08 BARC_1.01_Gm08_10048490_G_A BARC_2.0_Gm08_NA 715599137 63.195 NA Gm08 BARC_1.01_Gm08_10073125_T_C BARC_2.0_Gm08_NA 715599141 63.245 NA Gm08 BARC_1.01_Gm08_10172600_G_A BARC_2.0_Gm08_10085363 715599150 63.914 10085363 Gm08 BARC_1.01_Gm08_10330658_A_C BARC_2.0_Gm08_10243564 715599171 65.104 10243564 Gm08 BARC_1.01_Gm08_10418912_C_T BARC_2.0_Gm08_10331662 715599180 65.357 10331662 Gm08 BARC_1.01_Gm08_10621107_C_A BARC_2.0_Gm08_10533831 715599209 65.946 10533831 Gm08 BARC_1.01_Gm08_10670190_C_T BARC_2.0_Gm08_10582175 715599214 66.668 10582175 Gm08 BARC_1.01_Gm08_10735245_T_G BARC_2.0_Gm08_10646123 715599225 66.668 10646123 Gm08 BARC_1.01_Gm08_11359720_A_G BARC_2.0_Gm08_11270610 715599268 72.143 11270610

Gm08 BARC_1.01_Gm08_11685418_C_T BARC_2.0_Gm08_11602284 715599303 74.016 11602284 Gm08 BARC_1.01_Gm08_11759489_C_T BARC_2.0_Gm08_11676355 715599311 74.78 11676355 Gm08 BARC_1.01_Gm08_12055669_A_G BARC_2.0_Gm08_11973143 715599356 76.314 11973143 Gm08 BARC_1.01_Gm08_12251183_T_C BARC_2.0_Gm08_12168750 715599375 77.221 12168750 Gm08 BARC_1.01_Gm08_15131577_A_G BARC_2.0_Gm08_15062941 715599654 91.32 15062941 Gm08 BARC_1.01_Gm08_15153503_G_T BARC_2.0_Gm08_15084953 715599658 91.775 15084953 Gm08 BARC_1.01_Gm08_17399376_A_G BARC_2.0_Gm08_17333566 715599932 116.995 17333566 Gm08 BARC_1.01_Gm08_17444010_T_G BARC_2.0_Gm08_17378200 715599938 117.031 17378200 Gm08 BARC_1.01_Gm08_17273651_T_C BARC_2.0_Gm08_17207837 715599905 117.047 17207837 Gm08 BARC_1.01_Gm08_17579484_C_T BARC_2.0_Gm08_17514307 715599950 117.47 17514307 Gm08 BARC_1.01_Gm08_18101486_A_G BARC_2.0_Gm08_18036698 715600011 121.322 18036698 Gm08 Satt437 123.622 18871647 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm08 BARC_1.01_Gm08_18748606_T_G BARC_2.0_Gm08_18694242 715600103 125.212 18694242 Gm08 BARC_1.01_Gm08_19292385_T_C BARC_2.0_Gm08_19249481 715600190 127.84 19249481 Gm08 BARC_1.01_Gm08_19414487_A_G BARC_2.0_Gm08_19371483 715600223 128.073 19371483 Gm08 BARC_1.01_Gm08_19525771_A_G BARC_2.0_Gm08_19482774 715600253 128.292 19482774 Gm08 BARC_1.01_Gm08_19635121_T_C BARC_2.0_Gm08_19592124 715600304 128.3 19592124 Gm08 BARC_1.01_Gm08_19835719_T_G BARC_2.0_Gm08_19793071 715600381 128.492 19793071 Gm08 BARC_1.01_Gm08_19887196_G_A BARC_2.0_Gm08_19844613 715600388 128.718 19844613 Gm08 BARC_1.01_Gm08_20536534_C_T BARC_2.0_Gm08_20493647 715600538 130.726 20493647 Gm08 BARC_1.01_Gm08_21170988_C_T BARC_2.0_Gm08_21127737 715600609 132.436 21127737

Gm08 BARC_1.01_Gm08_21172458_T_C BARC_2.0_Gm08_21129207 715600614 132.481 21129207 Gm08 BARC_1.01_Gm08_21443387_G_T BARC_2.0_Gm08_21398730 715600683 134.052 21398730 Gm08 BARC_1.01_Gm08_21425355_G_A BARC_2.0_Gm08_21380698 715600672 134.113 21380698 Gm08 BARC_1.01_Gm08_22013366_G_A BARC_2.0_Gm08_21968675 715600813 134.782 21968675 Gm08 BARC_1.01_Gm08_21933156_G_A BARC_2.0_Gm08_21888120 715600773 134.785 21888120 Gm08 BARC_1.01_Gm08_22123551_G_A BARC_2.0_Gm08_22078860 715600833 135.781 22078860 Gm08 BARC_1.01_Gm08_22502686_T_C BARC_2.0_Gm08_22458655 715600879 136.654 22458655 Gm08 BARC_1.01_Gm08_22702507_C_T BARC_2.0_Gm08_22658482 715600943 137.703 22658482 Gm08 BARC_1.01_Gm08_23245678_A_G BARC_2.0_Gm08_23164827 715601105 138.867 23164827 Gm08 BARC_1.01_Gm08_25518395_C_A BARC_2.0_Gm08_25435928 715601199 139.671 25435928 Gm08 BARC_1.01_Gm08_34085111_C_T BARC_2.0_Gm08_34690104 715601489 139.671 34690104 Gm08 BARC_1.01_Gm08_23691942_G_A BARC_2.0_Gm08_23614953 715601127 139.671 23614953 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm08 BARC_1.01_Gm08_29497457_C_A BARC_2.0_Gm08_30133773 715601331 139.671 30133773 Gm08 BARC_1.01_Gm08_27721821_G_A BARC_2.0_Gm08_27620272 715601281 139.671 27620272 Gm08 BARC_1.01_Gm08_28027433_T_C BARC_2.0_Gm08_27885824 715601286 139.671 27885824 Gm08 BARC_1.01_Gm08_34506326_G_A BARC_2.0_Gm08_35113908 715601502 139.762 35113908 Gm08 BARC_1.01_Gm08_35102127_G_A BARC_2.0_Gm08_35718665 715601519 140.317 35718665 Gm08 BARC_1.01_Gm08_35467148_T_C BARC_2.0_Gm08_36075677 715601530 140.393 36075677 Gm08 BARC_1.01_Gm08_35664370_C_T BARC_2.0_Gm08_36272305 715601537 140.393 36272305 Gm08 BARC_1.01_Gm08_35856368_C_A BARC_2.0_Gm08_36466450 715601544 140.393 36466450 Gm08 BARC_1.01_Gm08_36324664_T_C BARC_2.0_Gm08_36939282 715601560 140.963 36939282

Gm08 Sat_232 142.914 22915759 Gm08 BARC_1.01_Gm08_39969061_C_T BARC_2.0_Gm08_40597410 715601733 147.251 40597410 Gm08 BARC_1.01_Gm08_40173645_T_C BARC_2.0_Gm08_40810156 715601759 148.237 40810156 Gm08 BARC_1.01_Gm08_40345085_C_A BARC_2.0_Gm08_40981382 715601792 148.856 40981382 Gm08 BARC_063663_18423 107929609 149.831 22547603 Gm09 BARC_1.01_Gm09_14923108_C_A BARC_2.0_Gm09_15487393 715603084 0 15487393 Gm09 BARC_1.01_Gm09_18598782_G_A BARC_2.0_Gm09_19208849 715603210 0.935 19208849 Gm09 BARC_1.01_Gm09_31217330_T_C BARC_2.0_Gm09_33843724 715603573 9.845 33843724 Gm09 BARC_1.01_Gm09_32096458_C_T BARC_2.0_Gm09_34705645 715603610 11.075 34705645 Gm09 BARC_1.01_Gm09_34830637_A_G BARC_2.0_Gm09_37391443 715603700 14.964 37391443 Gm09 BARC_1.01_Gm09_36666374_A_C BARC_2.0_Gm09_39239605 715603800 22.577 39239605 Gm09 BARC_1.01_Gm09_36784974_C_T BARC_2.0_Gm09_39358464 715603816 22.989 39358464 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm09 BARC_1.01_Gm09_39605825_C_T BARC_2.0_Gm09_42283105 715604233 50.652 42283105 Gm09 BARC_1.01_Gm09_41548661_T_C BARC_2.0_Gm09_44264423 715604498 59.447 44264423 Gm09 BARC_1.01_Gm09_41389071_G_A BARC_2.0_Gm09_44104810 715604482 59.882 44104810 Gm09 BARC_1.01_Gm09_41253226_T_C BARC_2.0_Gm09_43968962 715604469 60.465 43968962 Gm09 BARC_1.01_Gm09_41103872_T_C BARC_2.0_Gm09_43818290 715604453 60.766 43818290 Gm09 BARC_1.01_Gm09_40822345_T_G BARC_2.0_Gm09_43517260 715604411 61.914 43517260 Gm09 BARC_1.01_Gm09_40706793_A_C BARC_2.0_Gm09_43401680 715604395 62.099 43401680 Gm09 BARC_1.01_Gm09_40638454_A_G BARC_2.0_Gm09_43315338 715604374 62.545 43315338 Gm09 BARC_1.01_Gm09_40535562_T_C BARC_2.0_Gm09_43212679 715604355 62.701 43212679

Gm09 BARC_1.01_Gm09_40326613_T_C BARC_2.0_Gm09_43003730 715604330 63.416 43003730 Gm09 BARC_1.01_Gm09_43370976_T_C BARC_2.0_Gm09_46575741 715604689 81.861 46575741 Gm09 BARC_1.01_Gm09_44054693_A_G BARC_2.0_Gm09_47259302 715604788 89.038 47259302 Gm09 BARC_1.01_Gm09_44020265_C_T BARC_2.0_Gm09_47225154 715604781 89.065 47225154 Gm09 BARC_1.01_Gm09_44266451_T_G BARC_2.0_Gm09_47466734 715604805 89.446 47466734 Gm09 BARC_1.01_Gm09_44188059_T_C BARC_2.0_Gm09_47388342 715604800 89.446 47388342 Gm09 BARC_1.01_Gm09_44398393_C_A BARC_2.0_Gm09_47598386 715604816 89.671 47598386 Gm09 BARC_1.01_Gm09_44598626_G_A BARC_2.0_Gm09_47798573 715604827 90.532 47798573 Gm09 BARC_1.01_Gm09_44732111_G_A BARC_2.0_Gm09_47932059 715604839 91.809 47932059 Gm09 BARC_1.01_Gm09_44855340_C_T BARC_2.0_Gm09_48055288 715604850 92.359 48055288 Gm09 BARC_1.01_Gm09_44963125_G_T BARC_2.0_Gm09_48162901 715604857 92.438 48162901 Gm09 BARC_1.01_Gm09_45101803_G_A BARC_2.0_Gm09_48300022 715604870 92.59 48300022 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm09 BARC_1.01_Gm09_45482083_C_T BARC_2.0_Gm09_48680356 715604911 94.05 48680356 Gm09 BARC_1.01_Gm09_45548496_T_G BARC_2.0_Gm09_48746815 715604914 94.512 48746815 Gm11 BARC_1.01_Gm11_36124908_T_G BARC_2.0_Gm11_31649628 715610230 0 31649628 Gm11 BARC_1.01_Gm11_36174968_T_C BARC_2.0_Gm11_31699831 715610231 0.075 31699831 Gm11 BARC_1.01_Gm11_36293058_A_G BARC_2.0_Gm11_31817929 715610241 0.804 31817929 Gm11 BARC_1.01_Gm11_36404950_G_A BARC_2.0_Gm11_31929823 715610250 1.494 31929823 Gm11 BARC_1.01_Gm11_36469908_T_C BARC_2.0_Gm11_31994782 715610262 1.857 31994782 Gm11 BARC_1.01_Gm11_36581897_A_G BARC_2.0_Gm11_32115772 715610289 3.067 32115772 Gm11 BARC_1.01_Gm11_36778892_C_A BARC_2.0_Gm11_32321992 715610315 4 32321992

Gm11 BARC_1.01_Gm11_36733260_C_A BARC_2.0_Gm11_32276359 715610298 4 32276359 Gm11 BARC_1.01_Gm11_36890484_A_G BARC_2.0_Gm11_32433567 715610337 4.411 32433567 Gm11 BARC_1.01_Gm11_36931482_C_T BARC_2.0_Gm11_32474474 715610347 4.622 32474474 Gm11 BARC_1.01_Gm11_37179389_G_T BARC_2.0_Gm11_32727353 715610380 6.077 32727353 Gm11 BARC_1.01_Gm11_37626857_A_G BARC_2.0_Gm11_33177546 715610433 11.877 33177546 Gm11 BARC_1.01_Gm11_37710966_A_G BARC_2.0_Gm11_33261655 715610440 12.091 33261655 Gm11 BARC_1.01_Gm11_39108822_A_G BARC_2.0_Gm11_33424559 715610647 13.964 33424559 Gm11 BARC_1.01_Gm11_38892011_G_A BARC_2.0_Gm11_33641304 715610617 15.962 33641304 Gm11 BARC_1.01_Gm11_38496557_T_C BARC_2.0_Gm11_34037387 715610569 23.972 34037387 Gm11 BARC_1.01_Gm11_38299330_T_G BARC_2.0_Gm11_34234546 715610541 26.086 34234546 Gm11 BARC_1.01_Gm11_38261784_G_A BARC_2.0_Gm11_34272092 715610530 26.844 34272092 Gm11 BARC_1.01_Gm11_38183607_G_A BARC_2.0_Gm11_34350149 715610520 27.774 34350149 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm11 BARC_1.01_Gm11_38056078_C_T BARC_2.0_Gm11_34477652 715610505 29.502 34477652 Gm11 BARC_1.01_Gm11_37978746_G_T BARC_2.0_Gm11_34554985 715610496 30.445 34554985 Gm11 BARC_1.01_Gm11_37877507_G_A BARC_2.0_Gm11_34656421 715610473 30.601 34656421 Gm12 BARC_1.01_Gm12_1761905_G_T BARC_2.0_Gm12_1766819 715611672 0 1766819 Gm12 BARC_1.01_Gm12_1839277_A_G BARC_2.0_Gm12_1844191 715611710 0.202 1844191 Gm12 BARC_1.01_Gm12_1883937_G_A BARC_2.0_Gm12_1888851 715611720 0.332 1888851 Gm12 BARC_1.01_Gm12_2049842_G_A BARC_2.0_Gm12_2054699 715611757 1.262 2054699 Gm12 BARC_1.01_Gm12_2140417_A_G BARC_2.0_Gm12_2145273 715611781 1.32 2145273 Gm12 BARC_1.01_Gm12_2184391_A_G BARC_2.0_Gm12_2189248 715611786 1.492 2189248

Gm12 BARC_1.01_Gm12_2331255_T_C BARC_2.0_Gm12_2335685 715611833 3.625 2335685 Gm12 BARC_1.01_Gm12_2379195_C_A BARC_2.0_Gm12_2383625 715611845 4.223 2383625 Gm12 BARC_1.01_Gm12_2975576_T_C BARC_2.0_Gm12_2980968 715612043 6.726 2980968 Gm12 BARC_1.01_Gm12_3175818_A_G BARC_2.0_Gm12_3181216 715612118 7.617 3181216 Gm12 BARC_1.01_Gm12_3309895_G_A BARC_2.0_Gm12_3315546 715612248 7.698 3315546 Gm12 BARC_1.01_Gm12_3296301_T_G BARC_2.0_Gm12_3301952 715612235 7.698 3301952 Gm12 BARC_1.01_Gm12_4829922_C_T BARC_2.0_Gm12_4830371 715613114 21.207 4830371 Gm12 BARC_1.01_Gm12_6846625_G_T BARC_2.0_Gm12_6885126 715613333 40.073 6885126 Gm12 BARC_1.01_Gm12_8075838_G_A BARC_2.0_Gm12_8113476 715613528 47.877 8113476 Gm12 BARC_1.01_Gm12_8469462_T_C BARC_2.0_Gm12_8505012 715613586 49.222 8505012 Gm13a BARC_1.01_Gm13_9993080_C_T BARC_2.0_Gm13_11887842 715617303 0 11887842 Gm13a BARC_1.01_Gm13_10630165_T_C BARC_2.0_Gm13_11259402 715613733 0 11259402 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm13a BARC_1.01_Gm13_8308962_C_A BARC_2.0_Gm13_13550863 715617250 0.114 13550863 Gm13a BARC_1.01_Gm13_8720423_A_G BARC_2.0_Gm13_13136275 715617268 0.134 13136275 Gm13a BARC_1.01_Gm13_8529479_G_T BARC_2.0_Gm13_13331067 715617260 0.134 13331067 Gm13a BARC_1.01_Gm13_11463853_T_C BARC_2.0_Gm13_10423581 715613757 1.063 10423581 Gm13a BARC_1.01_Gm13_7285098_T_C BARC_2.0_Gm13_14567149 715617113 6.637 14567149 Gm13a BARC_1.01_Gm13_6342969_T_C BARC_2.0_Gm13_15543548 715616898 13.466 15543548 Gm13a BARC_1.01_Gm13_5769177_G_A BARC_2.0_Gm13_16051820 715616825 16.882 16051820 Gm13a Satt149 22.494 16855019 Gm13a Satt160 24.498 17875691

Gm13a Flowercolor 25.109 17312490 Gm13a BARC_1.01_Gm13_3316463_A_G BARC_2.0_Gm13_18552568 715615514 27.747 18552568 Gm13a BARC_1.01_Gm13_3489099_C_T BARC_2.0_Gm13_18379941 715615716 27.801 18379941 Gm13a BARC_1.01_Gm13_3719806_T_G BARC_2.0_Gm13_18149386 715616027 27.812 18149386 Gm13a BARC_1.01_Gm13_4204489_C_T BARC_2.0_Gm13_17664606 715616455 27.834 17664606 Gm13a BARC_1.01_Gm13_4187551_A_G BARC_2.0_Gm13_17681538 715616433 27.834 17681538 Gm13a BARC_1.01_Gm13_4319851_T_G BARC_2.0_Gm13_17550011 715616557 27.834 17550011 Gm13a BARC_1.01_Gm13_3822639_T_G BARC_2.0_Gm13_18046553 715616090 27.86 18046553 Gm13a BARC_1.01_Gm13_4520811_T_C BARC_2.0_Gm13_17349086 715616643 27.928 17349086 Gm13a BARC_1.01_Gm13_3620512_G_A BARC_2.0_Gm13_18248678 715615894 27.99 18248678 Gm13a BARC_1.01_Gm13_4817327_C_T BARC_2.0_Gm13_17047053 715616698 28.719 17047053 Gm13a BARC_1.01_Gm13_4905331_T_C BARC_2.0_Gm13_16926707 715616710 29.365 16926707 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm13a BARC_1.01_Gm13_5020064_C_T BARC_2.0_Gm13_16811968 715616733 29.895 16811968 Gm13a BARC_1.01_Gm13_5075945_G_A BARC_2.0_Gm13_16756004 715616745 30.343 16756004 Gm13a BARC_1.01_Gm13_1766981_T_C BARC_2.0_Gm13_20101231 715613953 34.792 20101231 Gm13a BARC_1.01_Gm13_1624949_C_A BARC_2.0_Gm13_20242637 715613885 34.99 20242637 Gm13a BARC_1.01_Gm13_1528565_A_G BARC_2.0_Gm13_20339017 715613867 35.763 20339017 Gm13a BARC_1.01_Gm13_1435626_C_T BARC_2.0_Gm13_20431993 715613845 35.958 20431993 Gm13a BARC_1.01_Gm13_1163621_T_C BARC_2.0_Gm13_20701079 715613764 37.403 20701079 Gm13a BARC_1.01_Gm13_898111_T_G BARC_2.0_Gm13_20966554 715617278 40.135 20966554 Gm13a BARC_1.01_Gm13_790808_A_G BARC_2.0_Gm13_21073871 715617200 40.288 21073871

Gm13a BARC_1.01_Gm13_850370_T_C BARC_2.0_Gm13_21014295 715617259 40.328 21014295 Gm13a BARC_1.01_Gm13_717318_C_T BARC_2.0_Gm13_21147361 715617090 41.055 21147361 Gm13a BARC_1.01_Gm13_50706_A_G BARC_2.0_Gm13_21810264 715616743 47.112 21810264 Gm13a BARC_1.01_Gm13_105760_T_G BARC_2.0_Gm13_21755210 715613730 47.196 21755210 Gm13b BARC_1.01_Gm13_26447438_T_C BARC_2.0_Gm13_27643859 715614474 0 27643859 Gm13b BARC_1.01_Gm13_26504428_C_T BARC_2.0_Gm13_27700711 715614477 0.947 27700711 Gm13b BARC_1.01_Gm13_26573887_G_T BARC_2.0_Gm13_27770170 715614489 1.204 27770170 Gm13b BARC_1.01_Gm13_26749514_T_C BARC_2.0_Gm13_27943258 715614527 2.135 27943258 Gm13b BARC_1.01_Gm13_26874636_G_A BARC_2.0_Gm13_28068421 715614558 3.283 28068421 Gm13b BARC_1.01_Gm13_27302662_C_T BARC_2.0_Gm13_28496350 715614642 4.904 28496350 Gm13b BARC_1.01_Gm13_27935177_A_G BARC_2.0_Gm13_29128801 715614755 6.324 29128801 Gm13b BARC_1.01_Gm13_27987641_C_T BARC_2.0_Gm13_29181004 715614764 6.324 29181004 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm13b BARC_1.01_Gm13_27846120_C_T BARC_2.0_Gm13_29040223 715614742 6.324 29040223 Gm13b BARC_1.01_Gm13_28141969_T_G BARC_2.0_Gm13_29335356 715614780 6.468 29335356 Gm13b BARC_1.01_Gm13_28206014_A_C BARC_2.0_Gm13_29399384 715614794 6.663 29399384 Gm13b BARC_1.01_Gm13_28437643_G_A BARC_2.0_Gm13_29630754 715614830 7.066 29630754 Gm13b BARC_1.01_Gm13_28826405_A_C BARC_2.0_Gm13_30026216 715614907 7.589 30026216 Gm13b BARC_1.01_Gm13_28918187_A_C BARC_2.0_Gm13_30117998 715614914 7.61 30117998 Gm13b BARC_1.01_Gm13_29042122_C_A BARC_2.0_Gm13_30241779 715614943 7.649 30241779 Gm13b BARC_1.01_Gm13_29418256_C_T BARC_2.0_Gm13_30618405 715615002 7.686 30618405 Gm13b BARC_1.01_Gm13_29265240_A_G BARC_2.0_Gm13_30465386 715614983 7.691 30465386

Gm13b BARC_1.01_Gm13_28957669_T_C BARC_2.0_Gm13_30157326 715614920 7.691 30157326 Gm13b BARC_1.01_Gm13_29123830_C_A BARC_2.0_Gm13_30323488 715614960 7.691 30323488 Gm13b BARC_1.01_Gm13_29524129_A_C BARC_2.0_Gm13_30724301 715615024 8.018 30724301 Gm13b BARC_1.01_Gm13_29677928_G_T BARC_2.0_Gm13_30875555 715615049 8.198 30875555 Gm13b BARC_1.01_Gm13_29739984_C_A BARC_2.0_Gm13_30937609 715615064 8.885 30937609 Gm13b BARC_1.01_Gm13_30268845_G_A BARC_2.0_Gm13_31449060 715615158 9.36 31449060 Gm13b BARC_1.01_Gm13_29941083_T_C BARC_2.0_Gm13_31122750 715615093 9.36 31122750 Gm13b BARC_1.01_Gm13_30078140_A_G BARC_2.0_Gm13_31259181 715615118 9.36 31259181 Gm13b BARC_1.01_Gm13_30310888_T_C BARC_2.0_Gm13_31514695 715615164 9.529 31514695 Gm13b BARC_1.01_Gm13_30351547_A_G BARC_2.0_Gm13_31555228 715615170 9.63 31555228 Gm13b BARC_1.01_Gm13_30479725_C_T BARC_2.0_Gm13_31691971 715615185 9.78 31691971 Gm13b BARC_1.01_Gm13_30578807_C_A BARC_2.0_Gm13_31791054 715615195 10.212 31791054 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm13b BARC_1.01_Gm13_30684298_C_T BARC_2.0_Gm13_31896687 715615217 10.542 31896687 Gm13b BARC_1.01_Gm13_30744043_A_G BARC_2.0_Gm13_31956416 715615228 10.666 31956416 Gm13b BARC_1.01_Gm13_30942034_A_G BARC_2.0_Gm13_32154461 715615257 12.128 32154461 Gm13b BARC_1.01_Gm13_31013252_A_G BARC_2.0_Gm13_32225680 715615266 12.33 32225680 Gm13b BARC_1.01_Gm13_31135256_T_C BARC_2.0_Gm13_32347696 715615281 13.14 32347696 Gm13b BARC_1.01_Gm13_31262161_G_A BARC_2.0_Gm13_32474603 715615301 13.338 32474603 Gm13b BARC_1.01_Gm13_31424193_T_G BARC_2.0_Gm13_32636682 715615320 14.367 32636682 Gm13b BARC_1.01_Gm13_31491632_C_T BARC_2.0_Gm13_32704120 715615328 14.766 32704120 Gm13b BARC_1.01_Gm13_31602992_A_G BARC_2.0_Gm13_32814804 715615344 14.766 32814804

Gm13b BARC_1.01_Gm13_31766939_T_G BARC_2.0_Gm13_32978732 715615363 15.1 32978732 Gm13b BARC_1.01_Gm13_31736878_G_A BARC_2.0_Gm13_32948671 715615361 15.108 32948671 Gm13b BARC_1.01_Gm13_31860090_G_A BARC_2.0_Gm13_33071883 715615381 15.167 33071883 Gm13b BARC_1.01_Gm13_31934756_G_A BARC_2.0_Gm13_33146571 715615392 15.773 33146571 Gm13b BARC_1.01_Gm13_32100739_A_G BARC_2.0_Gm13_33312556 715615409 16.05 33312556 Gm13b BARC_1.01_Gm13_32210915_T_C BARC_2.0_Gm13_33422715 715615420 16.916 33422715 Gm13b BARC_1.01_Gm13_32254260_T_C BARC_2.0_Gm13_33466062 715615423 17.326 33466062 Gm13b BARC_1.01_Gm13_32368683_G_A BARC_2.0_Gm13_33580485 715615438 17.53 33580485 Gm13b BARC_1.01_Gm13_32712123_C_A BARC_2.0_Gm13_33923772 715615458 18.628 33923772 Gm13b BARC_1.01_Gm13_32795953_T_G BARC_2.0_Gm13_34008029 715615465 18.628 34008029 Gm13b BARC_1.01_Gm13_32875289_C_A BARC_2.0_Gm13_34087365 715615474 19.007 34087365 Gm13b BARC_1.01_Gm13_33004100_T_G BARC_2.0_Gm13_34216199 715615486 19.772 34216199 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm13b BARC_1.01_Gm13_33027247_T_C BARC_2.0_Gm13_34239346 715615492 20.341 34239346 Gm13b BARC_1.01_Gm13_33124381_A_G BARC_2.0_Gm13_34336475 715615506 21.015 34336475 Gm13b BARC_1.01_Gm13_33113825_A_G BARC_2.0_Gm13_34325919 715615505 21.053 34325919 Gm13b BARC_1.01_Gm13_33306556_A_G BARC_2.0_Gm13_34518617 715615534 21.455 34518617 Gm13b BARC_1.01_Gm13_33302559_G_A BARC_2.0_Gm13_34514620 715615532 21.557 34514620 Gm13b BARC_1.01_Gm13_33471044_G_A BARC_2.0_Gm13_34683105 715615562 21.668 34683105 Gm13b BARC_1.01_Gm13_35032818_G_A BARC_2.0_Gm13_36241512 715615734 37.135 36241512 Gm13b BARC_1.01_Gm13_35909612_G_A BARC_2.0_Gm13_37050736 715615853 41.909 37050736 Gm13b BARC_1.01_Gm13_36031702_T_C BARC_2.0_Gm13_37172826 715615867 42.7 37172826

Gm13b BARC_1.01_Gm13_36224364_G_A BARC_2.0_Gm13_37365297 715615896 43.312 37365297 Gm13b BARC_1.01_Gm13_36316916_C_T BARC_2.0_Gm13_37457852 715615915 43.399 37457852 Gm13b BARC_1.01_Gm13_36261107_T_G BARC_2.0_Gm13_37402035 715615906 43.436 37402035 Gm13b BARC_1.01_Gm13_37339900_C_T BARC_2.0_Gm13_38501835 715616040 47.817 38501835 Gm13b BARC_1.01_Gm13_38133840_A_C BARC_2.0_Gm13_39311323 715616085 54.939 39311323 Gm13b BARC_1.01_Gm13_38492652_C_A BARC_2.0_Gm13_39670045 715616124 56.309 39670045 Gm13b BARC_1.01_Gm13_38412903_T_G BARC_2.0_Gm13_39590255 715616114 56.309 39590255 Gm13b BARC_1.01_Gm13_38840706_A_G BARC_2.0_Gm13_40017050 715616149 58.207 40017050 Gm14 BARC_1.01_Gm14_86112_G_A BARC_2.0_Gm14_92589 715620021 0 92589 Gm14 BARC_1.01_Gm14_587754_T_C BARC_2.0_Gm14_594215 715619712 2.966 594215 Gm14 BARC_1.01_Gm14_879705_C_A BARC_2.0_Gm14_881466 715620030 3.747 881466 Gm14 BARC_1.01_Gm14_923444_G_A BARC_2.0_Gm14_925196 715620077 3.747 925196 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm14 BARC_1.01_Gm14_837938_T_C BARC_2.0_Gm14_839702 715620008 3.778 839702 Gm14 BARC_1.01_Gm14_766413_G_A BARC_2.0_Gm14_772817 715619908 3.778 772817 Gm14 BARC_1.01_Gm14_1167509_A_G BARC_2.0_Gm14_1169042 715617539 4.357 1169042 Gm14 BARC_1.01_Gm14_1253814_C_T BARC_2.0_Gm14_1255379 715617579 5.371 1255379 Gm14 BARC_1.01_Gm14_1340473_G_T BARC_2.0_Gm14_1342110 715617676 6.135 1342110 Gm14 BARC_1.01_Gm14_1436509_G_A BARC_2.0_Gm14_1438206 715617776 8.109 1438206 Gm14 BARC_1.01_Gm14_1495353_T_C BARC_2.0_Gm14_1496980 715617793 8.193 1496980 Gm14 BARC_1.01_Gm14_1564632_C_T BARC_2.0_Gm14_1566268 715617814 9.249 1566268 Gm14 BARC_1.01_Gm14_1613564_T_G BARC_2.0_Gm14_1615206 715617826 9.923 1615206

Gm14 BARC_1.01_Gm14_2018487_G_T BARC_2.0_Gm14_2013931 715617975 14.325 2013931 Gm14 BARC_1.01_Gm14_2131407_C_T BARC_2.0_Gm14_2131853 715618003 14.753 2131853 Gm14 BARC_1.01_Gm14_2201279_A_G BARC_2.0_Gm14_2201645 715618025 15.354 2201645 Gm14 BARC_1.01_Gm14_2266236_A_G BARC_2.0_Gm14_2266551 715618048 15.744 2266551 Gm14 BARC_1.01_Gm14_2311158_G_A BARC_2.0_Gm14_2311478 715618057 15.744 2311478 Gm14 BARC_1.01_Gm14_2480875_A_C BARC_2.0_Gm14_2481174 715618096 16.294 2481174 Gm14 BARC_1.01_Gm14_2404878_A_G BARC_2.0_Gm14_2405177 715618082 16.294 2405177 Gm14 BARC_1.01_Gm14_2523580_A_G BARC_2.0_Gm14_2523881 715618110 16.488 2523881 Gm14 BARC_1.01_Gm14_2762103_T_C BARC_2.0_Gm14_2762413 715618161 18.433 2762413 Gm14 BARC_1.01_Gm14_2854797_C_A BARC_2.0_Gm14_2854417 715618194 18.533 2854417 Gm14 BARC_1.01_Gm14_3042771_T_C BARC_2.0_Gm14_3044904 715618256 18.627 3044904 Gm14 BARC_1.01_Gm14_3157865_C_A BARC_2.0_Gm14_3159986 715618305 19.352 3159986 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm14 BARC_1.01_Gm14_3750971_G_A BARC_2.0_Gm14_3763434 715618556 19.502 3763434 Gm14 BARC_1.01_Gm14_3779194_T_C BARC_2.0_Gm14_3791659 715618567 19.671 3791659 Gm14 BARC_1.01_Gm14_4056741_C_T BARC_2.0_Gm14_4069652 715618685 22.075 4069652 Gm14 BARC_1.01_Gm14_4087624_G_A BARC_2.0_Gm14_4100480 715618699 22.232 4100480 Gm14 BARC_1.01_Gm14_4184275_A_G BARC_2.0_Gm14_4198004 715618747 22.705 4198004 Gm14 BARC_1.01_Gm14_4264490_T_G BARC_2.0_Gm14_4281996 715618785 23.118 4281996 Gm14 BARC_1.01_Gm14_4430386_G_T BARC_2.0_Gm14_4514257 715618907 23.435 4514257 Gm14 BARC_1.01_Gm14_4770786_C_T BARC_2.0_Gm14_4856342 715619352 26.125 4856342 Gm14 BARC_1.01_Gm14_5908034_T_C BARC_2.0_Gm14_6019064 715619714 44.883 6019064

Gm14 BARC_1.01_Gm14_6448182_T_G BARC_2.0_Gm14_6551353 715619774 46.816 6551353 Gm14 BARC_1.01_Gm14_6514301_C_T BARC_2.0_Gm14_6617410 715619781 48.643 6617410 Gm14 BARC_1.01_Gm14_6554406_T_C BARC_2.0_Gm14_6660199 715619783 49.199 6660199 Gm14 BARC_1.01_Gm14_6770667_T_C BARC_2.0_Gm14_6877470 715619811 50.496 6877470 Gm14 BARC_1.01_Gm14_6969042_T_C BARC_2.0_Gm14_7075973 715619829 51.632 7075973 Gm14 BARC_1.01_Gm14_7151265_G_A BARC_2.0_Gm14_7259161 715619849 54.257 7259161 Gm14 BARC_1.01_Gm14_7195140_G_A BARC_2.0_Gm14_7302532 715619855 54.708 7302532 Gm14 BARC_1.01_Gm14_8027761_C_T BARC_2.0_Gm14_223576 715619947 65.172 223576 Gm14 BARC_1.01_Gm14_8096329_G_T BARC_2.0_Gm14_154615 715619964 65.776 154615 Gm14 BARC_1.01_Gm14_8186078_G_A BARC_2.0_Gm14_64866 715619979 66.168 64866 Gm14 BARC_1.01_Gm14_8128492_T_G BARC_2.0_Gm14_122452 715619968 66.198 122452 Gm14 BARC_1.01_Gm14_8288373_T_G BARC_2.0_Gm14_8080546 715619991 66.725 8080546 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm14 BARC_1.01_Gm14_9642828_T_C BARC_2.0_Gm14_9435464 715620123 74.444 9435464 Gm14 BARC_1.01_Gm14_9307586_A_G BARC_2.0_Gm14_9099832 715620089 74.472 9099832 Gm14 BARC_1.01_Gm14_9628707_A_G BARC_2.0_Gm14_9421343 715620121 74.472 9421343 Gm14 BARC_1.01_Gm14_9525103_T_C BARC_2.0_Gm14_9317739 715620109 74.472 9317739 Gm14 BARC_1.01_Gm14_9718302_T_G BARC_2.0_Gm14_9510938 715620130 74.663 9510938 Gm14 BARC_1.01_Gm14_9803364_T_G BARC_2.0_Gm14_9595999 715620138 74.854 9595999 Gm14 BARC_1.01_Gm14_10071491_C_T BARC_2.0_Gm14_9863990 715617324 75.194 9863990 Gm14 BARC_1.01_Gm14_10197799_A_G BARC_2.0_Gm14_9990544 715617358 75.891 9990544 Gm14 BARC_1.01_Gm14_10477535_C_T BARC_2.0_Gm14_10270279 715617397 76.566 10270279

Gm14 BARC_1.01_Gm14_10704639_A_G BARC_2.0_Gm14_10496865 715617463 76.569 10496865 Gm14 BARC_1.01_Gm14_10575538_G_A BARC_2.0_Gm14_10367765 715617422 76.569 10367765 Gm14 BARC_1.01_Gm14_10360733_C_T BARC_2.0_Gm14_10153478 715617382 76.569 10153478 Gm14 BARC_1.01_Gm14_13557173_C_A BARC_2.0_Gm14_13358759 715617697 76.908 13358759 Gm14 BARC_1.01_Gm14_13290049_C_T BARC_2.0_Gm14_13092389 715617664 76.911 13092389 Gm14 BARC_1.01_Gm14_13510414_A_G BARC_2.0_Gm14_13312001 715617684 76.911 13312001 Gm14 BARC_1.01_Gm14_19373649_A_G BARC_2.0_Gm14_23503557 715617948 79.416 23503557 Gm14 BARC_1.01_Gm14_28361034_A_G BARC_2.0_Gm14_32529543 715618189 81.307 32529543 Gm14 BARC_1.01_Gm14_34265654_T_C BARC_2.0_Gm14_17442487 715618424 81.936 17442487 Gm14 BARC_1.01_Gm14_30760829_T_C BARC_2.0_Gm14_34945350 715618272 82.09 34945350 Gm14 BARC_1.01_Gm14_44193109_G_A BARC_2.0_Gm14_43457807 715618894 88.248 43457807 Gm14 BARC_1.01_Gm14_44393026_T_C BARC_2.0_Gm14_43657351 715618926 89.423 43657351 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm14 BARC_1.01_Gm14_49680135_A_G BARC_2.0_Gm14_48089122 715619606 105.383 48089122 Gm14 BARC_1.01_Gm14_48656000_T_C BARC_2.0_Gm14_47974934 715619466 107.227 47974934 Gm14 BARC_1.01_Gm14_48535790_T_C BARC_2.0_Gm14_47854709 715619453 108.261 47854709 Gm14 BARC_1.01_Gm14_48425707_A_G BARC_2.0_Gm14_47744626 715619435 109.214 47744626 Gm14 BARC_1.01_Gm14_48129511_T_C BARC_2.0_Gm14_47447267 715619397 111.658 47447267 Gm14 BARC_1.01_Gm14_48089424_A_G BARC_2.0_Gm14_47407200 715619392 112.038 47407200 Gm14 BARC_1.01_Gm14_47895113_G_A BARC_2.0_Gm14_47215997 715619377 112.222 47215997 Gm14 BARC_1.01_Gm14_48026115_C_T BARC_2.0_Gm14_47343562 715619385 112.231 47343562 Gm14 BARC_1.01_Gm14_47991114_C_A BARC_2.0_Gm14_47308561 715619379 112.247 47308561

Gm14 BARC_1.01_Gm14_47744620_G_A BARC_2.0_Gm14_47065318 715619356 113.711 47065318 Gm14 BARC_1.01_Gm14_47643269_A_G BARC_2.0_Gm14_46963924 715619343 114.106 46963924 Gm14 BARC_1.01_Gm14_47636308_T_G BARC_2.0_Gm14_46956963 715619342 114.107 46956963 Gm14 BARC_1.01_Gm14_47418167_T_C BARC_2.0_Gm14_46738490 715619301 114.666 46738490 Gm14 BARC_1.01_Gm14_47299310_T_C BARC_2.0_Gm14_46588335 715619276 114.882 46588335 Gm14 BARC_1.01_Gm14_46968410_T_G BARC_2.0_Gm14_46266427 715619215 115.748 46266427 Gm15 BARC_1.01_Gm15_630331_G_A BARC_2.0_Gm15_629908 715622903 0 629908 Gm15 BARC_1.01_Gm15_741627_C_A BARC_2.0_Gm15_741109 715623019 0.406 741109 Gm15 BARC_1.01_Gm15_756303_T_C BARC_2.0_Gm15_755785 715623035 0.743 755785 Gm15 BARC_1.01_Gm15_872867_T_G BARC_2.0_Gm15_872351 715623163 1.787 872351 Gm15 BARC_1.01_Gm15_948412_T_C BARC_2.0_Gm15_947896 715623257 2.757 947896 Gm15 BARC_1.01_Gm15_1007132_A_C BARC_2.0_Gm15_1006618 715620179 2.985 1006618 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm15 BARC_1.01_Gm15_1491376_A_G BARC_2.0_Gm15_1490854 715620864 8.664 1490854 Gm15 BARC_1.01_Gm15_1842053_G_T BARC_2.0_Gm15_1842060 715621159 10.493 1842060 Gm15 BARC_1.01_Gm15_1969687_A_G BARC_2.0_Gm15_1969699 715621208 10.647 1969699 Gm15 BARC_1.01_Gm15_2021199_T_C BARC_2.0_Gm15_2021213 715621227 11.217 2021213 Gm15 BARC_1.01_Gm15_2072075_A_G BARC_2.0_Gm15_2072091 715621242 11.427 2072091 Gm15 BARC_1.01_Gm15_3050845_G_T BARC_2.0_Gm15_3050698 715621545 19.6 3050698 Gm15 BARC_1.01_Gm15_3160423_T_G BARC_2.0_Gm15_3169943 715621582 20.235 3169943 Gm15 BARC_1.01_Gm15_3334810_G_T BARC_2.0_Gm15_3344528 715621633 21.367 3344528 Gm15 BARC_1.01_Gm15_3468596_G_T BARC_2.0_Gm15_3488148 715621669 22.493 3488148

Gm15 BARC_1.01_Gm15_3621773_C_T BARC_2.0_Gm15_3639988 715621715 24.389 3639988 Gm15 BARC_1.01_Gm15_3573558_A_G BARC_2.0_Gm15_3591774 715621698 24.391 3591774 Gm15 BARC_1.01_Gm15_3727108_G_A BARC_2.0_Gm15_3745323 715621748 24.557 3745323 Gm15 BARC_1.01_Gm15_3845971_T_C BARC_2.0_Gm15_3863922 715621781 25.496 3863922 Gm15 BARC_1.01_Gm15_4264903_C_T BARC_2.0_Gm15_4283809 715621908 30.338 4283809 Gm15 BARC_1.01_Gm15_4315169_T_C BARC_2.0_Gm15_4334070 715621926 31.428 4334070 Gm15 BARC_1.01_Gm15_4406751_T_C BARC_2.0_Gm15_4425676 715621953 32.942 4425676 Gm15 BARC_1.01_Gm15_4522374_C_A BARC_2.0_Gm15_4541338 715622010 33.49 4541338 Gm15 BARC_1.01_Gm15_4456903_G_A BARC_2.0_Gm15_4475844 715621969 33.49 4475844 Gm15 BARC_1.01_Gm15_4613500_G_A BARC_2.0_Gm15_4632878 715622091 34.252 4632878 Gm15 BARC_1.01_Gm15_5638918_T_G BARC_2.0_Gm15_5657544 715622847 41.234 5657544 Gm15 BARC_1.01_Gm15_5897409_G_A BARC_2.0_Gm15_5916445 715622869 41.445 5916445 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm15 BARC_1.01_Gm15_6047557_T_C BARC_2.0_Gm15_6066642 715622880 42.815 6066642 Gm15 BARC_1.01_Gm15_6272006_T_C BARC_2.0_Gm15_6291081 715622900 43.439 6291081 Gm15 BARC_1.01_Gm15_6823009_G_T BARC_2.0_Gm15_6841404 715622951 45.098 6841404 Gm15 BARC_1.01_Gm15_7574118_T_C BARC_2.0_Gm15_7598331 715623039 49.014 7598331 Gm15 BARC_1.01_Gm15_7637174_A_C BARC_2.0_Gm15_7661406 715623050 49.251 7661406 Gm15 BARC_1.01_Gm15_7829610_A_G BARC_2.0_Gm15_7853665 715623081 50.497 7853665 Gm15 BARC_1.01_Gm15_8697425_C_A BARC_2.0_Gm15_8740226 715623159 60.703 8740226 Gm15 BARC_1.01_Gm15_8715603_A_G BARC_2.0_Gm15_8758404 715623162 60.736 8758404 Gm15 BARC_025663_04988 107917848 63.876 9504568

Gm15 BARC_1.01_Gm15_9058303_T_C BARC_2.0_Gm15_9100367 715623195 64.887 9100367 Gm15 BARC_1.01_Gm15_9164446_A_G BARC_2.0_Gm15_9205168 715623211 65.971 9205168 Gm15 BARC_1.01_Gm15_9413370_G_A BARC_2.0_Gm15_9557248 715623250 66.56 9557248 Gm15 BARC_1.01_Gm15_10416352_C_T BARC_2.0_Gm15_9383632 715620221 66.577 9383632 Gm15 BARC_1.01_Gm15_9594410_T_C BARC_2.0_Gm15_9748128 715623269 66.742 9748128 Gm15 BARC_1.01_Gm15_9520804_G_A BARC_2.0_Gm15_9665525 715623260 66.776 9665525 Gm15 BARC_1.01_Gm15_9733870_T_C BARC_2.0_Gm15_9887588 715623288 66.953 9887588 Gm15 BARC_1.01_Gm15_9829561_A_G BARC_2.0_Gm15_9983279 715623306 67.948 9983279 Gm15 BARC_1.01_Gm15_10008869_G_T BARC_2.0_Gm15_10162587 715620169 68.364 10162587 Gm15 BARC_1.01_Gm15_9948537_G_A BARC_2.0_Gm15_10102255 715623324 68.446 10102255 Gm15 BARC_1.01_Gm15_10059948_T_C BARC_2.0_Gm15_10213666 715620177 68.621 10213666 Gm15 BARC_1.01_Gm15_11496274_T_C BARC_2.0_Gm15_11517600 715620330 82.586 11517600 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm15 BARC_1.01_Gm15_27914877_T_C BARC_2.0_Gm15_30932029 715621469 85.032 30932029 Gm15 BARC_1.01_Gm15_28616409_T_C BARC_2.0_Gm15_28480017 715621492 85.055 28480017 Gm15 BARC_1.01_Gm15_33001719_T_C BARC_2.0_Gm15_35559345 715621617 85.613 35559345 Gm15 BARC_1.01_Gm15_40461287_A_G BARC_2.0_Gm15_41202590 715621837 85.613 41202590 Gm15 BARC_1.01_Gm15_40878937_G_A BARC_2.0_Gm15_41622105 715621846 85.774 41622105 Gm15 BARC_1.01_Gm15_42221723_T_G BARC_2.0_Gm15_42982853 715621890 85.774 42982853 Gm15 BARC_1.01_Gm15_34798953_C_T BARC_2.0_Gm15_37387010 715621673 85.774 37387010 Gm15 BARC_1.01_Gm15_43797502_G_T BARC_2.0_Gm15_44556639 715621943 88.047 44556639 Gm15 BARC_1.01_Gm15_46443671_T_C BARC_2.0_Gm15_47221063 715622110 88.393 47221063

Gm15 BARC_1.01_Gm15_47474634_A_G BARC_2.0_Gm15_48264207 715622328 90.025 48264207 Gm15 BARC_1.01_Gm15_47571188_T_C BARC_2.0_Gm15_48363862 715622336 90.344 48363862 Gm15 BARC_1.01_Gm15_47679988_T_C BARC_2.0_Gm15_48472662 715622346 90.677 48472662 Gm15 BARC_1.01_Gm15_47621393_G_A BARC_2.0_Gm15_48414067 715622340 90.893 48414067 Gm15 BARC_1.01_Gm15_12264838_A_G BARC_2.0_Gm15_12285420 715620424 92.299 12285420 Gm15 BARC_1.01_Gm15_12414192_C_T BARC_2.0_Gm15_12435063 715620441 94.379 12435063 Gm15 BARC_1.01_Gm15_12475289_T_C BARC_2.0_Gm15_12496431 715620449 94.561 12496431 Gm15 BARC_1.01_Gm15_12643435_T_C BARC_2.0_Gm15_12664579 715620463 95.772 12664579 Gm15 BARC_1.01_Gm15_13098003_A_G BARC_2.0_Gm15_13116982 715620540 99.086 13116982 Gm15 BARC_1.01_Gm15_13180039_C_T BARC_2.0_Gm15_13198878 715620550 99.851 13198878 Gm15 BARC_1.01_Gm15_13427310_G_T BARC_2.0_Gm15_13440994 715620598 101.504 13440994 Gm15 BARC_1.01_Gm15_14146264_T_C BARC_2.0_Gm15_14162257 715620709 104.734 14162257 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm15 BARC_1.01_Gm15_15001782_A_G BARC_2.0_Gm15_15026597 715620881 109.804 15026597 Gm15 BARC_1.01_Gm15_15178159_T_C BARC_2.0_Gm15_15203972 715620919 110.219 15203972 Gm15 BARC_1.01_Gm15_15896387_C_T BARC_2.0_Gm15_15923817 715621042 112.339 15923817 Gm15 BARC_1.01_Gm15_15952535_C_A BARC_2.0_Gm15_15979942 715621054 112.339 15979942 Gm15 BARC_1.01_Gm15_25411335_G_A BARC_2.0_Gm15_25503545 715621397 119.519 25503545 Gm15 BARC_1.01_Gm15_41526092_G_A BARC_2.0_Gm15_42284792 715621872 120.082 42284792 Gm15 BARC_1.01_Gm15_35867161_C_A BARC_2.0_Gm15_38447399 715621702 120.283 38447399 Gm15 BARC_1.01_Gm15_39888568_G_A BARC_2.0_Gm15_40633726 715621821 120.283 40633726 Gm15 BARC_1.01_Gm15_42869969_C_T BARC_2.0_Gm15_43631120 715621917 120.463 43631120

Gm15 BARC_1.01_Gm15_47871831_A_C BARC_2.0_Gm15_48664536 715622377 127.702 48664536 Gm15 BARC_1.01_Gm15_48117938_G_A BARC_2.0_Gm15_48911478 715622415 128.399 48911478 Gm16 BARC_1.01_Gm16_298188_C_A BARC_2.0_Gm16_298020 715624213 0 298020 Gm16 BARC_1.01_Gm16_486857_G_A BARC_2.0_Gm16_486741 715625156 0.597 486741 Gm16 BARC_1.01_Gm16_761034_G_T BARC_2.0_Gm16_759723 715625507 1.885 759723 Gm16 BARC_1.01_Gm16_808425_C_T BARC_2.0_Gm16_807114 715625603 1.995 807114 Gm16 BARC_1.01_Gm16_1251545_A_G BARC_2.0_Gm16_1260003 715623400 6.037 1260003 Gm16 BARC_1.01_Gm16_2299577_C_T BARC_2.0_Gm16_2321725 715623741 15.171 2321725 Gm16 BARC_1.01_Gm16_2405914_A_G BARC_2.0_Gm16_2428113 715623780 15.559 2428113 Gm16 BARC_1.01_Gm16_2513346_C_T BARC_2.0_Gm16_2537669 715623821 15.758 2537669 Gm16 BARC_1.01_Gm16_3099668_A_C BARC_2.0_Gm16_3124736 715624395 21.587 3124736 Gm16 BARC_1.01_Gm16_3246299_T_G BARC_2.0_Gm16_3271365 715624566 23.916 3271365 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm16 BARC_1.01_Gm16_3337301_A_G BARC_2.0_Gm16_3362395 715624634 25.252 3362395 Gm16 BARC_016775_02320 107915515 27.726 4272707 Gm16 BARC_1.01_Gm16_4034155_A_C BARC_2.0_BARC_4054598 715625060 31.164 4054598 Gm16 BARC_1.01_Gm16_4285389_A_G BARC_2.0_Gm16_4306664 715625087 31.979 4306664 Gm16 BARC_1.01_Gm16_4351139_A_C BARC_2.0_Gm16_4378162 715625101 32.66 4378162 Gm16 Satt693 42.733 6325509 Gm16 BARC_1.01_Gm16_5340777_C_T BARC_2.0_Gm16_5369094 715625201 45.297 5369094 Gm16 BARC_1.01_Gm16_5429551_T_C BARC_2.0_Gm16_5457849 715625208 45.854 5457849 Gm16 BARC_1.01_Gm16_5656680_T_C BARC_2.0_Gm16_5683202 715625231 46.075 5683202

Gm16 BARC_1.01_Gm16_5928303_A_G BARC_2.0_Gm16_5887013 715625250 46.244 5887013 Gm16 BARC_1.01_Gm16_5998589_A_G BARC_2.0_Gm16_6042142 715625254 46.45 6042142 Gm16 BARC_1.01_Gm16_6061510_C_T BARC_2.0_Gm16_6105250 715625261 47.496 6105250 Gm16 BARC_1.01_Gm16_6423098_G_A BARC_2.0_Gm16_6570336 715625307 48.434 6570336 Gm16 BARC_1.01_Gm16_6179363_T_G BARC_2.0_Gm16_6222257 715625278 48.59 6222257 Gm16 BARC_1.01_Gm16_6559259_C_A BARC_2.0_Gm16_6706066 715625333 50.601 6706066 Gm16 BARC_1.01_Gm16_6702694_C_T BARC_2.0_Gm16_6858504 715625343 50.926 6858504 Gm16 BARC_1.01_Gm16_7018526_T_C BARC_2.0_Gm16_7176290 715625394 52.091 7176290 Gm16 BARC_1.01_Gm16_7070805_G_A BARC_2.0_Gm16_7228568 715625402 52.803 7228568 Gm16 BARC_1.01_Gm16_7143783_A_G BARC_2.0_Gm16_7302240 715625414 53.008 7302240 Gm16 BARC_1.01_Gm16_7407374_G_A BARC_2.0_Gm16_7565829 715625464 54.48 7565829 Gm16 BARC_1.01_Gm16_7990029_T_C BARC_2.0_Gm16_8145827 715625587 56.732 8145827 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm16 BARC_1.01_Gm16_8540188_T_C BARC_2.0_Gm16_8704236 715625658 56.799 8704236 Gm16 BARC_1.01_Gm16_10243181_A_G BARC_2.0_Gm16_10412660 715623336 57.417 10412660 Gm16 BARC_1.01_Gm16_22474964_T_C BARC_2.0_Gm16_17825502 715623728 57.581 17825502 Gm16 BARC_1.01_Gm16_22148369_C_T BARC_2.0_Gm16_18154067 715623718 57.581 18154067 Gm16 BARC_1.01_Gm16_15145964_A_G BARC_2.0_Gm16_15280985 715623487 57.581 15280985 Gm16 BARC_1.01_Gm16_17089104_C_T BARC_2.0_Gm16_17268611 715623568 57.581 17268611 Gm16 BARC_1.01_Gm16_16713042_T_C BARC_2.0_Gm16_16883924 715623549 57.581 16883924 Gm16 BARC_1.01_Gm16_20054798_T_C BARC_2.0_Gm16_20258606 715623665 57.774 20258606 Gm16 BARC_1.01_Gm16_20344286_G_A BARC_2.0_Gm16_19969300 715623673 57.851 19969300

Gm16 BARC_1.01_Gm16_19031157_T_C BARC_2.0_Gm16_21281833 715623633 58.664 21281833 Gm16 BARC_1.01_Gm16_24793404_C_T BARC_2.0_Gm16_25143466 715623807 59.185 25143466 Gm16 BARC_1.01_Gm16_18732921_A_G BARC_2.0_Gm16_21580377 715623624 59.193 21580377 Gm16 BARC_1.01_Gm16_22937295_T_C BARC_2.0_Gm16_23245621 715623739 59.193 23245621 Gm16 BARC_1.01_Gm16_24612301_A_G BARC_2.0_Gm16_24962131 715623798 59.193 24962131 Gm16 BARC_1.01_Gm16_23995972_G_A BARC_2.0_Gm16_24346820 715623778 59.193 24346820 Gm16 BARC_1.01_Gm16_24389823_A_C BARC_2.0_Gm16_24739622 715623791 59.193 24739622 Gm16 BARC_1.01_Gm16_24329186_A_C BARC_2.0_Gm16_24680039 715623790 59.193 24680039 Gm16 BARC_1.01_Gm16_25127133_A_C BARC_2.0_Gm16_25480628 715623820 59.585 25480628 Gm16 BARC_1.01_Gm16_25378270_A_G BARC_2.0_Gm16_25731746 715623834 60.317 25731746 Gm16 BARC_1.01_Gm16_26324517_C_T BARC_2.0_Gm16_26670344 715623860 60.742 26670344 Gm16 BARC_1.01_Gm16_26824305_C_T BARC_2.0_Gm16_27169242 715623874 60.953 27169242 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm16 BARC_1.01_Gm16_27092931_A_G BARC_2.0_Gm16_27437538 715623882 61.918 27437538 Gm16 BARC_1.01_Gm16_27521057_G_T BARC_2.0_Gm16_27864182 715623895 62.727 27864182 Gm16 BARC_1.01_Gm16_28266706_T_C BARC_2.0_Gm16_28628441 715623946 64.357 28628441 Gm16 BARC_1.01_Gm16_27978857_A_C BARC_2.0_Gm16_28330994 715623912 64.357 28330994 Gm16 BARC_1.01_Gm16_28232079_A_G BARC_2.0_Gm16_28593405 715623936 64.376 28593405 Gm16 BARC_1.01_Gm16_28443553_T_C BARC_2.0_Gm16_28798761 715623979 64.56 28798761 Gm16 BARC_1.01_Gm16_28753577_A_G BARC_2.0_Gm16_29108774 715624037 65.699 29108774 Gm16 BARC_1.01_Gm16_28792833_T_C BARC_2.0_Gm16_29159876 715624042 65.699 29159876 Gm16 BARC_1.01_Gm16_28845819_A_G BARC_2.0_Gm16_29213667 715624055 66.092 29213667

Gm16 BARC_1.01_Gm16_28901653_G_A BARC_2.0_Gm16_29269501 715624073 66.112 29269501 Gm16 BARC_1.01_Gm16_28961127_T_G BARC_2.0_Gm16_29328591 715624087 66.318 29328591 Gm16 BARC_1.01_Gm16_29181015_G_T BARC_2.0_Gm16_29547943 715624140 68.089 29547943 Gm16 BARC_1.01_Gm16_29261393_C_A BARC_2.0_Gm16_29631736 715624165 68.303 29631736 Gm16 BARC_1.01_Gm16_29322493_T_C BARC_2.0_Gm16_29673580 715624177 68.365 29673580 Gm17 BARC_1.01_Gm17_4737388_T_G BARC_2.0_Gm17_4467354 715627931 0 4467354 Gm17 BARC_1.01_Gm17_4789679_C_A BARC_2.0_Gm17_4519644 715627942 0.386 4519644 Gm17 BARC_1.01_Gm17_4967175_G_A BARC_2.0_Gm17_4697224 715627958 1.36 4697224 Gm17 BARC_1.01_Gm17_5042611_T_G BARC_2.0_Gm17_4772652 715627969 1.767 4772652 Gm17 BARC_1.01_Gm17_5793411_T_C BARC_2.0_Gm17_5525889 715628043 5.192 5525889 Gm17 BARC_1.01_Gm17_6090553_C_T BARC_2.0_Gm17_5826097 715628065 5.739 5826097 Gm17 BARC_1.01_Gm17_6841753_C_T BARC_2.0_Gm17_6577190 715628106 10.53 6577190 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm17 BARC_1.01_Gm17_6778459_T_G BARC_2.0_Gm17_6514005 715628104 10.615 6514005 Gm17 BARC_1.01_Gm17_8194356_C_T BARC_2.0_Gm17_7924918 715628226 20.404 7924918 Gm17 BARC_1.01_Gm17_8270421_A_G BARC_2.0_Gm17_8000983 715628234 21.22 8000983 Gm17 BARC_1.01_Gm17_8352493_G_A BARC_2.0_Gm17_8080597 715628242 21.644 8080597 Gm17 BARC_1.01_Gm17_8449684_G_A BARC_2.0_Gm17_8178483 715628259 22.058 8178483 Gm17 BARC_1.01_Gm17_8595668_T_C BARC_2.0_Gm17_8324468 715628286 23.381 8324468 Gm17 BARC_1.01_Gm17_8563621_G_A BARC_2.0_Gm17_8292422 715628279 23.428 8292422 Gm17 BARC_1.01_Gm17_8891564_A_G BARC_2.0_Gm17_8621032 715628311 25.08 8621032 Gm17 BARC_1.01_Gm17_8956091_G_A BARC_2.0_Gm17_8685557 715628319 25.209 8685557

Gm17 BARC_1.01_Gm17_8939133_A_G BARC_2.0_Gm17_8668599 715628316 25.312 8668599 Gm17 BARC_1.01_Gm17_9114615_A_C BARC_2.0_Gm17_8843808 715628328 26.456 8843808 Gm17 BARC_1.01_Gm17_9191781_T_C BARC_2.0_Gm17_8920937 715628332 26.837 8920937 Gm17 BARC_1.01_Gm17_9590152_T_G BARC_2.0_Gm17_9319718 715628367 30.257 9319718 Gm17 BARC_1.01_Gm17_9684872_T_C BARC_2.0_Gm17_9399802 715628380 31.19 9399802 Gm17 BARC_1.01_Gm17_13487812_A_G BARC_2.0_Gm17_13225475 715626059 0 13225475 Gm17 BARC_1.01_Gm17_13660920_C_T BARC_2.0_Gm17_13398617 715626094 0.708 13398617 Gm17 BARC_1.01_Gm17_13722544_A_G BARC_2.0_Gm17_13460241 715626107 0.732 13460241 Gm17 BARC_1.01_Gm17_15493313_G_T BARC_2.0_Gm17_15258296 715626247 6.083 15258296 Gm17 BARC_1.01_Gm17_15872822_C_T BARC_2.0_Gm17_15637177 715626258 7.065 15637177 Gm17 BARC_1.01_Gm17_16158023_A_G BARC_2.0_Gm17_15940516 715626266 7.455 15940516 Gm17 BARC_1.01_Gm17_17726952_A_G BARC_2.0_Gm17_17360912 715626307 7.653 17360912 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm17 BARC_1.01_Gm17_18770148_A_G BARC_2.0_Gm17_18425185 715626336 8.826 18425185 Gm17 BARC_1.01_Gm17_20043070_T_C BARC_2.0_Gm17_19731255 715626369 8.941 19731255 Gm17 BARC_1.01_Gm17_23618170_C_T BARC_2.0_Gm17_23236006 715626464 8.966 23236006 Gm17 BARC_1.01_Gm17_24474211_A_G BARC_2.0_Gm17_24094514 715626501 9.144 24094514 Gm17 BARC_1.01_Gm17_26776447_T_C BARC_2.0_Gm17_26362187 715626572 9.279 26362187 Gm17 BARC_1.01_Gm17_25294261_G_A BARC_2.0_Gm17_24925330 715626528 9.279 24925330 Gm17 BARC_1.01_Gm17_28538552_C_T BARC_2.0_Gm17_28203907 715626623 9.413 28203907 Gm17 BARC_1.01_Gm17_27791091_G_A BARC_2.0_Gm17_27383311 715626604 9.416 27383311 Gm17 BARC_1.01_Gm17_31111789_G_A BARC_2.0_Gm17_30815457 715626697 9.416 30815457

Gm17 BARC_1.01_Gm17_32625352_A_G BARC_2.0_Gm17_32295875 715626744 9.609 32295875 Gm17 BARC_1.01_Gm17_32367167_G_A BARC_2.0_Gm17_32037371 715626733 9.611 32037371 Gm17 BARC_1.01_Gm17_31544109_C_T BARC_2.0_Gm17_31246808 715626711 9.611 31246808 Gm17 BARC_1.01_Gm17_32038975_T_G BARC_2.0_Gm17_31742522 715626724 9.611 31742522 Gm17 BARC_1.01_Gm17_33343495_A_G BARC_2.0_Gm17_33008592 715626767 9.753 33008592 Gm17 BARC_1.01_Gm17_17971540_A_G BARC_2.0_Gm17_17603614 715626313 10.232 17603614 Gm17 BARC_1.01_Gm17_36602853_A_G BARC_2.0_Gm17_36312506 715626999 12.064 36312506 Gm17 BARC_1.01_Gm17_36408425_C_T BARC_2.0_Gm17_36118829 715626922 12.074 36118829 Gm17 BARC_1.01_Gm17_36544388_G_A BARC_2.0_Gm17_36253917 715626982 12.092 36253917 Gm17 BARC_1.01_Gm17_35679376_C_A BARC_2.0_Gm17_35347020 715626842 12.111 35347020 Gm17 BARC_1.01_Gm17_36382955_A_G BARC_2.0_Gm17_36093358 715626915 12.115 36093358 Gm17 BARC_1.01_Gm17_36847420_A_G BARC_2.0_Gm17_36557081 715627072 12.443 36557081 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm17 BARC_1.01_Gm17_37204244_A_C BARC_2.0_Gm17_36913821 715627165 12.612 36913821 Gm17 BARC_1.01_Gm17_37335550_T_C BARC_2.0_Gm17_37046845 715627191 12.755 37046845 Gm17 BARC_1.01_Gm17_37391436_C_T BARC_2.0_Gm17_37102731 715627203 13.152 37102731 Gm17 BARC_1.01_Gm17_37843080_C_A BARC_2.0_Gm17_37553627 715627247 13.484 37553627 Gm17 BARC_1.01_Gm17_37769727_A_G BARC_2.0_Gm17_37480257 715627242 13.484 37480257 Gm17 BARC_1.01_Gm17_37989202_C_T BARC_2.0_Gm17_37697148 715627265 15.104 37697148 Gm17 BARC_1.01_Gm17_38051554_A_C BARC_2.0_Gm17_37759500 715627282 15.483 37759500 Gm17 BARC_1.01_Gm17_38170820_T_C BARC_2.0_Gm17_37879049 715627319 15.87 37879049 Gm17 BARC_1.01_Gm17_38282072_G_A BARC_2.0_Gm17_37990017 715627350 16.408 37990017

Gm17 BARC_1.01_Gm17_38361476_G_T BARC_2.0_Gm17_38069333 715627377 16.737 38069333 Gm17 BARC_1.01_Gm17_38465611_G_A BARC_2.0_Gm17_38173476 715627403 17.138 38173476 Gm17 BARC_1.01_Gm17_38540012_A_G BARC_2.0_Gm17_38247877 715627432 17.138 38247877 Gm17 BARC_1.01_Gm17_38461325_T_C BARC_2.0_Gm17_38169190 715627401 17.157 38169190 Gm17 BARC_1.01_Gm17_39167346_G_A BARC_2.0_Gm17_38882864 715627539 28.338 38882864 Gm17 BARC_1.01_Gm17_39295184_G_A BARC_2.0_Gm17_39019814 715627556 29.494 39019814 Gm17 BARC_1.01_Gm17_39388462_A_G BARC_2.0_Gm17_39113097 715627567 29.508 39113097 Gm17 BARC_1.01_Gm17_39479718_C_T BARC_2.0_Gm17_39204594 715627583 31.72 39204594 Gm18 BARC_1.01_Gm18_6636054_G_T BARC_2.0_Gm18_6661172 715632542 0 6661172 Gm18 BARC_1.01_Gm18_5305873_T_C BARC_2.0_Gm18_5323509 715631407 5.671 5323509 Gm18 BARC_1.01_Gm18_6032670_T_G BARC_2.0_Gm18_6069903 715632280 10.835 6069903 Gm18 BARC_1.01_Gm18_6370950_A_G BARC_2.0_Gm18_6393112 715632523 11.071 6393112 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm18 BARC_1.01_Gm18_5133882_G_A BARC_2.0_Gm18_5151897 715631188 18.158 5151897 Gm18 BARC_1.01_Gm18_4622873_G_A BARC_2.0_Gm18_4643663 715630660 19.044 4643663 Gm18 BARC_1.01_Gm18_5961229_G_A BARC_2.0_Gm18_5998461 715632179 25.954 5998461 Gm18 BARC_1.01_Gm18_7012291_T_C BARC_2.0_Gm18_7035552 715632589 30.659 7035552 Gm18 BARC_1.01_Gm18_7149340_A_G BARC_2.0_Gm18_7172561 715632610 31.011 7172561 Gm18 BARC_1.01_Gm18_7233159_C_A BARC_2.0_Gm18_7255708 715632624 31.864 7255708 Gm18 BARC_1.01_Gm18_7290439_G_A BARC_2.0_Gm18_7312517 715632633 32.34 7312517 Gm18 BARC_1.01_Gm18_7515726_T_C BARC_2.0_Gm18_7537875 715632657 32.712 7537875 Gm18 BARC_1.01_Gm18_7790416_C_T BARC_2.0_Gm18_7812457 715632686 33.577 7812457

Gm18 BARC_1.01_Gm18_13080290_C_T BARC_2.0_Gm18_13108531 715628821 44.08 13108531 Gm18 BARC_1.01_Gm18_13218800_A_G BARC_2.0_Gm18_13247187 715628843 44.464 13247187 Gm18 BARC_1.01_Gm18_13166954_A_G BARC_2.0_Gm18_13195341 715628836 44.682 13195341 Gm18 BARC_1.01_Gm18_13676905_G_A BARC_2.0_Gm18_13705653 715628903 45.154 13705653 Gm18 BARC_1.01_Gm18_14859936_G_T BARC_2.0_Gm18_14603631 715629047 45.453 14603631 Gm18 BARC_1.01_Gm18_14951019_T_C BARC_2.0_Gm18_14694627 715629058 45.63 14694627 Gm18 BARC_1.01_Gm18_15324039_A_G BARC_2.0_Gm18_15066204 715629107 45.803 15066204 Gm18 BARC_1.01_Gm18_15669089_G_A BARC_2.0_Gm18_15410992 715629155 45.923 15410992 Gm18 BARC_1.01_Gm18_15595633_A_G BARC_2.0_Gm18_15337852 715629143 45.925 15337852 Gm18 BARC_1.01_Gm18_16141327_G_A BARC_2.0_Gm18_15891405 715629212 46.091 15891405 Gm18 BARC_1.01_Gm18_21677373_C_T BARC_2.0_Gm18_21416584 715629917 48.868 21416584 Gm18 BARC_1.01_Gm18_22369640_C_T BARC_2.0_Gm18_22126449 715629939 49.208 22126449 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm18 BARC_1.01_Gm18_38257741_G_A BARC_2.0_Gm18_35244929 715630438 49.569 35244929 Gm18 BARC_1.01_Gm18_37934784_G_T BARC_2.0_Gm18_34928209 715630427 49.569 34928209 Gm18 BARC_1.01_Gm18_27607706_A_G BARC_2.0_Gm18_31398769 715630106 49.569 31398769 Gm18 BARC_1.01_Gm18_30521009_C_A BARC_2.0_Gm18_28452369 715630196 49.569 28452369 Gm18 BARC_1.01_Gm18_34931761_C_T BARC_2.0_Gm18_31842803 715630346 49.57 31842803 Gm18 BARC_1.01_Gm18_28659934_A_G BARC_2.0_Gm18_30359192 715630145 49.571 30359192 Gm18 BARC_1.01_Gm18_42005163_A_G BARC_2.0_Gm18_38752799 715630525 49.829 38752799 Gm18 BARC_1.01_Gm18_47380987_A_G BARC_2.0_Gm18_43090752 715630715 51.388 43090752 Gm18 BARC_1.01_Gm18_46416185_A_C BARC_2.0_Gm18_42299316 715630669 51.388 42299316

Gm18 BARC_1.01_Gm18_46081850_T_G BARC_2.0_Gm18_41965392 715630653 51.388 41965392 Gm18 BARC_1.01_Gm18_46298863_T_C BARC_2.0_Gm18_42182473 715630664 51.388 42182473 Gm18 BARC_1.01_Gm18_47671359_T_C BARC_2.0_Gm18_43396034 715630759 51.57 43396034 Gm18 BARC_1.01_Gm18_48070209_G_A BARC_2.0_Gm18_43794293 715630832 52.141 43794293 Gm18 BARC_1.01_Gm18_48100117_G_A BARC_2.0_Gm18_43824201 715630836 52.17 43824201 Gm18 BARC_1.01_Gm18_53810098_C_A BARC_2.0_Gm18_49536028 715631507 62.219 49536028 Gm18 BARC_1.01_Gm18_53762458_A_G BARC_2.0_Gm18_49489939 715631502 62.386 49489939 Gm18 BARC_1.01_Gm18_53627468_T_G BARC_2.0_Gm18_49354794 715631484 62.386 49354794 Gm18 BARC_1.01_Gm18_53574057_G_T BARC_2.0_Gm18_49301920 715631473 62.386 49301920 Gm18 BARC_1.01_Gm18_53457728_G_A BARC_2.0_Gm18_49185950 715631455 62.465 49185950 Gm18 BARC_1.01_Gm18_54021599_G_T BARC_2.0_Gm18_49747507 715631530 63.304 49747507 Gm18 BARC_1.01_Gm18_57289081_C_T BARC_2.0_Gm18_53019579 715631854 81.178 53019579 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm18 BARC_1.01_Gm18_57227205_C_A BARC_2.0_Gm18_52957703 715631847 81.419 52957703 Gm18 BARC_1.01_Gm18_57037107_C_T BARC_2.0_Gm18_52767605 715631822 81.577 52767605 Gm18 BARC_1.01_Gm18_56910277_C_A BARC_2.0_Gm18_52640773 715631810 82.173 52640773 Gm18 BARC_1.01_Gm18_56839033_A_C BARC_2.0_Gm18_52569529 715631805 82.173 52569529 Gm18 BARC_1.01_Gm18_56713153_C_T BARC_2.0_Gm18_52443633 715631794 82.35 52443633 Gm18 BARC_1.01_Gm18_56486524_T_C BARC_2.0_Gm18_52216926 715631773 82.987 52216926 Gm18 BARC_1.01_Gm18_58287938_C_T BARC_2.0_Gm18_54016344 715631972 96.011 54016344 Gm18 BARC_1.01_Gm18_58521532_G_T BARC_2.0_Gm18_54249904 715632014 96.045 54249904 Gm18 BARCSOYSSR_18_1741 96.954 54313980

Gm18 BARCSOYSSR_18_1710 97.138 53902882 Gm18 BARCSOYSSR_18_1707 97.593 53852971 Gm18 BARC_1.01_Gm18_59600111_C_A BARC_2.0_Gm18_55328225 715632175 103.478 55328225 Gm18 BARC_1.01_Gm18_59830615_A_C BARC_2.0_Gm18_55549922 715632217 103.615 55549922 Gm18 BARC_1.01_Gm18_59980727_T_C BARC_2.0_Gm18_55700093 715632231 104.067 55700093 Gm18 BARC_1.01_Gm18_60065308_C_A BARC_2.0_Gm18_55784646 715632241 104.415 55784646 Gm18 BARC_1.01_Gm18_60144414_A_G BARC_2.0_Gm18_55863741 715632251 104.544 55863741 Gm18 BARC_1.01_Gm18_61009028_C_A BARC_2.0_Gm18_56710850 715632379 110.685 56710850 Gm18 BARC_1.01_Gm18_61175038_G_A BARC_2.0_Gm18_56876857 715632400 110.808 56876857 Gm18 BARC_1.01_Gm18_61065114_G_A BARC_2.0_Gm18_56766936 715632385 111.005 56766936 Gm18 BARC_1.01_Gm18_61265863_C_T BARC_2.0_Gm18_56967695 715632408 111.297 56967695 Gm18 BARC_1.01_Gm18_61668426_G_A BARC_2.0_Gm18_57370289 715632455 112.516 57370289 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm18 BARC_1.01_Gm18_61587028_G_T BARC_2.0_Gm18_57288891 715632447 112.516 57288891 Gm18 BARC_1.01_Gm18_61723602_C_T BARC_2.0_Gm18_57425465 715632465 112.989 57425465 Gm18 BARCSOYSSR_18_1949 116.222 57972957 Gm19a BARC_1.01_Gm19_549103_T_G BARC_2.0_Gm19_52957 715636126 0 52957 Gm19a BARC_1.01_Gm19_427448_T_C BARC_2.0_Gm19_174608 715635239 1.686 174608 Gm19a BARC_1.01_Gm19_334751_A_G BARC_2.0_Gm19_267267 715634017 3.138 267267 Gm19a BARC_1.01_Gm19_159297_C_A BARC_2.0_Gm19_471094 715633225 4.281 471094 Gm19a BARC_1.01_Gm19_116338_A_G BARC_2.0_Gm19_514053 715633071 4.824 514053 Gm19a BARC_1.01_Gm19_1296583_T_C BARC_2.0_Gm19_1333269 715633118 20.405 1333269

Gm19a BARC_1.01_Gm19_1333661_A_G BARC_2.0_Gm19_1370347 715633135 20.566 1370347 Gm19a BARC_1.01_Gm19_1420943_T_C BARC_2.0_Gm19_1456217 715633164 20.567 1456217 Gm19a BARC_1.01_Gm19_1974292_A_G BARC_2.0_Gm19_2019409 715633340 24.112 2019409 Gm19a BARC_1.01_Gm19_1954907_T_C BARC_2.0_Gm19_2000024 715633330 24.12 2000024 Gm19a BARC_1.01_Gm19_2067992_A_G BARC_2.0_Gm19_2114304 715633380 24.32 2114304 Gm19b Sct_010 0 41380452 Gm19b BARC_1.01_Gm19_39261055_G_A BARC_2.0_Gm19_39462292 715634817 5.298 39462292 Gm19b BARC_1.01_Gm19_39298979_C_T BARC_2.0_Gm19_39500216 715634825 5.638 39500216 Gm19b BARC_1.01_Gm19_39686084_T_C BARC_2.0_Gm19_39887681 715634898 6.844 39887681 Gm19b BARC_1.01_Gm19_39723056_G_T BARC_2.0_Gm19_39924653 715634905 6.844 39924653 Gm19b BARC_1.01_Gm19_39863286_G_T BARC_2.0_Gm19_40078646 715634937 7.087 40078646 Gm19b BARC_1.01_Gm19_40088295_C_A BARC_2.0_Gm19_40281232 715634968 7.722 40281232 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm19b BARC_1.01_Gm19_40315072_G_A BARC_2.0_Gm19_40507980 715635005 7.9 40507980 Gm19b BARC_1.01_Gm19_40255847_C_T BARC_2.0_Gm19_40448736 715634997 7.938 40448736 Gm19b BARC_1.01_Gm19_40350365_A_G BARC_2.0_Gm19_40543275 715635008 8.12 40543275 Gm19b BARC_1.01_Gm19_40594861_T_C BARC_2.0_Gm19_40787533 715635036 9.263 40787533 Gm19b BARC_1.01_Gm19_40644937_G_A BARC_2.0_Gm19_40837608 715635040 9.617 40837608 Gm19b BARC_1.01_Gm19_40783256_T_C BARC_2.0_Gm19_40975911 715635070 10.35 40975911 Gm19b BARC_1.01_Gm19_41192542_G_T BARC_2.0_Gm19_41385244 715635111 12.014 41385244 Gm19b BARC_1.01_Gm19_41265238_A_C BARC_2.0_Gm19_41458437 715635117 12.058 41458437 Gm19b BARC_1.01_Gm19_41144271_A_G BARC_2.0_Gm19_41336973 715635104 12.058 41336973

Gm19b BARC_1.01_Gm19_41343324_G_A BARC_2.0_Gm19_41536524 715635124 12.255 41536524 Gm19b BARC_1.01_Gm19_41557773_A_C BARC_2.0_Gm19_41758037 715635129 12.47 41758037 Gm19b BARC_1.01_Gm19_41638742_G_T BARC_2.0_Gm19_41839807 715635135 12.611 41839807 Gm19b BARC_1.01_Gm19_42007555_C_T BARC_2.0_Gm19_42210569 715635166 13.8 42210569 Gm19b BARC_1.01_Gm19_42054264_C_T BARC_2.0_Gm19_42257278 715635175 13.93 42257278 Gm19b Satt448 16.401 42119600 Gm19b BARC_1.01_Gm19_42812863_T_C BARC_2.0_Gm19_43014594 715635250 20.175 43014594 Gm19b BARC_1.01_Gm19_42846269_T_C BARC_2.0_Gm19_43048677 715635253 20.358 43048677 Gm19b BARC_1.01_Gm19_43117852_A_C BARC_2.0_Gm19_43321502 715635276 20.673 43321502 Gm19b GML_OSU10 23.197 43231221 Gm19b BARCSOYSSR_19_1243 24.725 43023051 Gm19b BARC_047496_12943 107921208 28.262 43023051 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm19b BARCSOYSSR_19_1286 34.446 44370710 Gm19b BARC_1.01_Gm19_45999263_T_C BARC_2.0_Gm19_46116996 715635553 43.542 46116996 Gm19b BARCSOYSSR_19_1393 48.495 46388480 Gm19b BARC-064609-18739 107929955 54.193 47232949 Gm19b Glyma19g40940 56.475 47338816 Gm19b BARCSOYSSR_19_1452 58.959 47528159 Gm19b Glyma19g41210 59.989 47633059 Gm19b Glyma19g41390 62.005 47787869 Gm19b BARC_1.01_Gm19_47662191_T_C BARC_2.0_Gm19_47784141 715635727 63.518 47784141

Gm19b Glyma19g41870 65.73 48140101 Gm19b BARC_1.01_Gm19_48707459_C_T BARC_2.0_Gm19_48828805 715635875 71.313 48828805 Gm19b BARCSOYSSR_19_1532 73.67 49060024 Gm19b BARC_1.01_Gm19_49578689_G_A BARC_2.0_Gm19_49699850 715635964 81.544 49699850 Gm19b BARC_1.01_Gm19_49786000_A_G BARC_2.0_Gm19_49907162 715635983 82.631 49907162 Gm19b BARC_1.01_Gm19_49930354_A_C BARC_2.0_Gm19_50051516 715635992 82.693 50051516 Gm19b BARC_1.01_Gm19_49885090_G_A BARC_2.0_Gm19_50006252 715635988 82.709 50006252 Gm19b BARC_1.01_Gm19_49964637_T_C BARC_2.0_Gm19_50085799 715635996 83.036 50085799 Gm19b BARC_1.01_Gm19_50107667_C_T BARC_2.0_Gm19_50228894 715636004 83.84 50228894 Gm19b BARC_1.01_Gm19_50205252_A_G BARC_2.0_Gm19_50325877 715636018 84.177 50325877 Gm19b BARC_1.01_Gm19_50184509_A_G BARC_2.0_Gm19_50305134 715636013 84.177 50305134 Gm19b BARC-041915-08133 107913866 87.268 49966893 Continued

Table B.1. Continued Genetic position Wm82.a2.v1 Chra Marker name (Wm82.a1.v1.1) Marker name (Wm82.a2.v1) SNP IDs (cM) physical position (bp) Gm19b BARC-014385-01342 107912964 88.909 50343566 Gm20 BARC_1.01_Gm20_39582428_T_C BARC_2.0_Gm20_40704783 715638104 0 40704783 Gm20 BARC_1.01_Gm20_38391185_C_T BARC_2.0_Gm20_39503857 715638030 8.991 39503857 Gm20 BARC_1.01_Gm20_38306103_T_C BARC_2.0_Gm20_39418983 715638028 9.185 39418983 Gm20 BARC_1.01_Gm20_37466130_A_G BARC_2.0_Gm20_38571066 715637966 12.123 38571066 Gm20 BARC_1.01_Gm20_37551598_A_G BARC_2.0_Gm20_38656535 715637973 12.123 38656535 Gm20 BARC_1.01_Gm20_37273411_G_A BARC_2.0_Gm20_38369293 715637958 12.488 38369293 Gm20 BARC_1.01_Gm20_37211061_A_G BARC_2.0_Gm20_38306943 715637948 12.767 38306943 Gm20 BARC_1.01_Gm20_36478507_A_G BARC_2.0_Gm20_37573710 715637856 17.154 37573710

Gm20 BARC_1.01_Gm20_36542128_T_C BARC_2.0_Gm20_37637311 715637865 17.293 37637311 Gm20 BARC_1.01_Gm20_36153048_C_A BARC_2.0_Gm20_37248263 715637832 19.051 37248263 Gm20 BARC_1.01_Gm20_35625615_C_T BARC_2.0_Gm20_36720824 715637735 26.332 36720824 Gm20 BARC_1.01_Gm20_35232978_A_G BARC_2.0_Gm20_36332679 715637679 29.597 36332679 Gm20 BARC_1.01_Gm20_34881595_C_T BARC_2.0_Gm20_36021058 715637647 30.507 36021058 Gm20 BARC_1.01_Gm20_34942502_G_A BARC_2.0_Gm20_36081945 715637657 30.639 36081945 Gm20 BARC_1.01_Gm20_33099801_G_A BARC_2.0_Gm20_34239213 715637419 56.119 34239213 Gm20 BARC_1.01_Gm20_33049242_A_G BARC_2.0_Gm20_34188658 715637414 56.295 34188658 Gm20 BARC_1.01_Gm20_32784352_A_G BARC_2.0_Gm20_33925526 715637380 56.835 33925526 Gm20 BARC_1.01_Gm20_32603292_A_G BARC_2.0_Gm20_33744434 715637358 57.899 33744434 Gm20 BARC_1.01_Gm20_32550693_T_G BARC_2.0_Gm20_33692025 715637353 57.899 33692025

Appendix C. Loci of interest associated with resistance to Phytophthora sojae from chapter 2

219

QTL Left Right CIM PV LOD Genome Additive Chra Nearest markerb Isolate IMc Sourcef Name marker marker d %e thrg LODh effecti Phytophthora sojae BARC_2.0_ BARC_2.0_Gm0 9 Gm09_1548 1.S.1.1 2.31 1.63 1.8 Conrad 1.9 3.2 -0.681 9_15487393 7393 BARC_2.0 BARC_2.0_ BARC_2.0_Gm1 16 16-3 _BARC_40 Gm16_4378 OH25 3.82 1.75 5.5 Sloan 1.8 3.2 0.505 6_4306664 54598 162 Glyma19g4

220 Glyma19g41210 1390

(Wm82.a2.v1 BARCSOY (Wm82.a2.v 19 19-2 name SSR_19_1 1 name 1.S.1.1 0.95 0.95 1.4 Conrad 2.0 3.2 -0.441 Glyma.19G2242 452 Glyma.19g2 00) 26100)

a chromosome bName of SNP (“BARC”_Glyma.Wm82 assembly version_chromosome_physical position), SSR marker or PCR markers cInterval mapping value dComposite interval mapping value ePhenotypic variation explained by individual QTL as calculated in MapQTL (van Ooijen, 2004) fSource of resistance gThreshold of significance for LOD for each chromosome based on permutation tests of 1000 interations (Churchill and Doerge, 1994) hThreshold of significance for LOD across the entire genome iAdditive effects of nearest markers

Table C.1 Loci of interest for resistance at or near QTL for resistance to at least two isolates of Phytophthora sojae.

Appendix D. Comparison of QTL conferring resistance to P. sojae in three genearations of Conrad x Sloan RILs

221

Gen Chr QTL Isolate Right marker/second nearest PV Physical Method Left marker/nearest marker IMd CIMe a b Name c marker f locationg 48932991- F 1 1.S.1.1 tray BARC-060037-16311 BARC-054071-12319 3.1 3.7 5.0 6:8 50158408 BARC_2.0_Gm01_5016444 BARC_2.0_Gm01_5029563 50164447- F 1 1.S.1.1 tray 3.1 3.08 4.5 9:11 7 5 50295635 BARC_2.0_Gm01_5057217 BARC_2.0_Gm01_5079706 50572171- F 1 C2.S1 tray 5.42 5.43 7.6 9:11 1 1 50797061 BARC_2.0_Gm01_5020634 BARC_2.0_Gm01_5028727 50206347- F 1 OH25 tray 5.86 5.86 8.2 9:11 7 4 50287274 BARC_2.0_Gm04_4597776 BARC_2.0_Gm04_4620451 45977762-

222 F 4 1.S.1.1 tray 3.44 3.77 4.4 9:11 2 7 46204517

BARC_2.0_Gm04_4609622 BARC_2.0_Gm04_4653619 46096228- F 4 C2.S1 tray 3.12 3.28 3.2 9:11 8 6 46536196 BARC_2.0_Gm04_4597776 BARC_2.0_Gm04_4620451 45977762- F 4 OH25 tray 3.44 2.91 3.2 9:11 2 7 46204517 Continued a b c Gen.-Generation Chr.-chromosome. Data for F4:6 1.S.1.1 tray test from Wang et al., 2010. Data for F4:6 C2.S1 and OH25 tray test d e and 1.S.1.1 layer test from Wang et al., 2012a. Data for F6:8 from Wang et al., 2012b. Interval mapping value Composite interval f mapping value, genome-wide LOD threshold for F9:11 is 3.2 Phenotypic variation explained by individual QTL as calculated in MapQTL for CIM unless only IM value is given (van Ooijen, 2004) gPhysical location of region between the Left and Right markers or the nearest marker in assembly Wm82.a2.v1 (SoyBase)

Table D.1. Comparison of quantitative trait loci (QTL) conferring resistance to Phytophthora sojae in three generations of Conrad x Sloan recombinant inbred lines (RILs).

Table D.1. Continued Gen Ch QTL Isolate Right marker/second nearest CIM PV Physical Method Left marker/nearest marker IMd a rb Name c marker e f locationg F4:6 8 C2.S1 tray GMA2_OSU19 ̶ 2.1 ̶ 6.3 7690556 F9:11 9 1.S.1.1 tray ̶ BARC_2.0_Gm09_15487393 2.31 2.8 3.3 15487393 F9:11 9 C2.S1 tray ̶ BARC_2.0_Gm09_15487393 4.5 5.26 6 15487393 F9:11 9 OH25 tray ̶ BARC_2.0_Gm09_15487393 5.08 4.99 7.4 15487393 F4:6 12 1.S.1.1 tray GMH_OSU31 ̶ 1.9 2.3 4.8 5526515 F4:6 14 1.S.1.1 tray Satt304 ̶ 2.5 2.6 4.5 13086766 3639988- F 15 C2.S1 tray BARC_2.0_Gm15_3639988 BARC_2.0_Gm15_3591774 2.67 2.06 2 9:11 3591774 486741- F9:11 16 16-1 OH25 tray BARC_2.0_Gm16_486741 BARC_2.0_Gm16_807114 3.63 2.06 5.1

223 807114 3124736- F 16 16-2 1.S.1.1 tray BARC_2.0_Gm16_3124736 BARC_2.0_Gm16_3362395 3.68 4.05 4.9 9:11 3362395 3124736- F 16 16-2 C2.S1 tray BARC_2.0_Gm16_3124736 BARC_2.0_Gm16_3362395 3.15 3.25 3.5 9:11 3362395 not in F4:6 17 1.S.1.1 tray Satt574 ̶ 3.1 3.6 7 Wm82.2a. v1 F4:6 13 13-1 1.S.1.1 tray F424_294 ̶ 2.5 ̶ 5.9 ̶ F4:6 13 13-2 1.S.1.1 tray Sct_033 ̶ 2.9 3.2 4.7 31951960 F4:6 18 18-1 1.S.1.1 tray BARCSOYSSR_18_1707 ̶ 9.8 2.4 4.8 53852971 Continued

Table D.1. Continued Gen Chr QTL Isolate Right marker/second nearest CIM PV Physical Method Left marker/nearest marker IMd a b Name c marker e f locationg 16. 4.4/ 53852971/ F 18 18-1 C2.S1 tray BARCSOYSSR_18_1707 BARCSOYSSR_18_1793 ̶ 5/8 4:6 3.2 55001577 .9 12. F 18 18-1 OH25 tray BARCSOYSSR_18_1707 ̶ 4.4 ̶ 53852971 4:6 8 10. 56889960- F 18 18-2 1.S.1.1 tray BARC-039397-07314 ̶ 12.2 5.4 4:6 7 56889749 53852971- F 18 18-2 1.S.1.1 tray BARCSOYSSR_18_1707 BARCSOYSSR_18_1710 5.3 4.5 6.1 6:8 53902949

224 54744147- F6:8 18 18-2 1.S.1.1 tray BARCSOYSSR_18_1777 BARCSOYSSR_18_1949 10.5 8.4 9.3 57972986 56710850- F 18 1.S.1.1 tray BARC_2.0_Gm18_56710850 BARC_2.0_Gm18_56766936 7.35 6.89 8.3 9:11 56766936 14. 56889960- F 18 18-2 C2.S1 tray BARC-039397-07314 ̶ 5.7 5.9 4:6 8 56889749 56710850- F 18 C2.S1 tray BARC_2.0_Gm18_56710850 BARC_2.0_Gm18_56766936 6.03 5.76 6.6 9:11 56766936 16. 56889960- F 18 18-2 OH25 tray BARC-039397-07314 ̶ 6.5 7.3 4:6 1 56889749 10.0 13. 56710850- F 18 OH25 tray BARC_2.0_Gm18_56710850 BARC_2.0_Gm18_56876857 9.99 9:11 1 6 56876857 Continued

Table D.1. Continued Gen Chr QTL Isolate Right marker/second nearest CI Physical Method Left marker/nearest marker IMd PVf a b Name c marker Me locationg

F4:6 19 19-1 1.S.1.1 tray BARCSOYSSR_19_1243 ̶ 2 1.9 2.6 43533689 43023051- F 19 19-1 1.S.1.1 tray BARC-047496-12943 BARCSOYSSR_19_1243 6 3.5 4.8 6:8 43533689 2.6 43533689- F 19 19-1 1.S.1.1 tray BARCSOYSSR_19_1243 BARCSOYSSR_19_1286 2.69 4.3 9:11 4 44370771 F4:6 19 19-1 C2.S1 tray GML_OSU10 ̶ 4.6 4.3 10.2 43231221 2.8 43023051- F 19 19-1 C2.S1 tray BARC-047496-12943 BARC_2.0_Gm19_46116996 4.49 4.3 9:11 6 46116996 F4:6 19 19-1 OH25 tray GML_OSU42 ̶ 4.3 2 4.5 44019432

225 3.3 44370710- F 19 19-1 OH25 tray BARCSOYSSR_19_1286 BARC_2.0_Gm19_46116996 5.24 9.1 9:11 4 46116996

F4:6 19 19-2 1.S.1.1 tray BARC-039977-07624 ̶ 2.9 2.3 3.3 48732911 Glyma19g40800 47227073- F 19 19-2 1.S.1.1 tray (Wm82.a2.v1 name BARC-039977-07624 9.4 7.9 11.9 6:8 48732911 Glyma.19g220100)

F4:6 19 19-2 C2.S1 tray BARC-064609-18739 ̶ 2.5 ̶ 8 47232949 Glyma19g41390 2.8 47528116- F 19 19-2 C2.S1 tray BARCSOYSSR_19_1452 (Wm82.a2.v1 name 2.86 4.1 9:11 6 47790275 Glyma.19g226100)

F4:6 19 19-2 OH25 tray BARC-039977-07624 ̶ 4.6 3.1 6.3 48732911 Continued

Table D.1. Continued Gen Chr QTL Isolate Right marker/second CIM Physical Method Left marker/nearest marker IMd PVf a b Name c nearest marker e locationg Glyma19g41390 5.5 47528116- F 19 19-2 OH25 tray BARCSOYSSR_19_1452 (Wm82.a2.v1 name 4.87 7.8 9:11 3 47790275 Glyma.19g226100) BARC_2.0_Gm19_5030513 4.5 50305134- F 19 19-3 OH25 tray BARC-014385-01342 3.03 6.55 9:11 4 9 50222477 layer F4:6 18 18-1 1.S.1.1 (root BARCSOYSSR_18_1777 ̶ 2.4 ̶ 6.4 54744147 rot) layer F4:6 18 18-1 1.S.1.1 (root BARCSOYSSR_18_1777 ̶ 4.7 ̶ 12.6 54744147 226 weight)

layer (whole F 18 18-1 1.S.1.1 BARCSOYSSR_18_1777 ̶ 3.9 ̶ 10.4 54744147 4:6 plant weight) layer F4:6 18 18-1 1.S.1.1 (plant BACRSOYSSR_18_1793 ̶ 3.3 ̶ 8.2 55001577 height) layer 56889960- F 18 18-2 1.S.1.1 (root BARC-039397-07314 ̶ 5.2 5.9 12.4 4:6 56889749 rot) layer 56889960- F 18 18-2 1.S.1.1 (root BARC-039397-07314 ̶ 10 9.9 22.6 4:6 56889749 weight Continued

Table D.1. Continued Right QTL CIM Physical Gena Chrb Isolatec Method Left marker/nearest marker marker/second IMd PVf Name e locationg nearest marker layer (whole 20. 56889960- F 18 18-2 1.S.1.1 BARC-039397-07314 ̶ 9 8.8 4:6 plant weight) 1 56889749 layer (plant 18. 56889960- F 18 18-2 1.S.1.1 BARC-039397-07314 ̶ 7.2 7.3 4:6 height) 3 56889749 layer (percent 56889960- F 18 18-2 1.S.1.1 BARC-039397-07314 ̶ 2.9 3.4 7.4 4:6 damping off) 56889749

F4:6 19 19-1 1.S.1.1 layer (root rot) BARCSOYSSR_19_1243 ̶ 6.6 3.2 7.1 43533689

227 layer (root F 19 19-1 1.S.1.1 GML_OSU42 ̶ 3.1 3.2 6.7 44019432 4:6 weight)

layer (whole F 19 19-1 1.S.1.1 GML_OSU42 ̶ 3.7 3.7 8 44019432 4:6 plant weight) layer (percent F 19 19-1 1.S.1.1 BARCSOYSSR_19_1243 ̶ 5.5 3.9 8.8 43533689 4:6 damping off)

F4:6 19 19-2 1.S.1.1 layer (root rot) BARCSOYSSR_19_1473 ̶ 5.6 3.9 8.4 47923547 layer (percent F 19 19-2 1.S.1.1 BARCSOYSSR_19_1494 ̶ 4.5 4.1 9.2 48338071 4:6 damping off)

Appendix E. Comparison of QTL conferring resistance to F. graminearum in two generations of Conrad x Sloan RILs

228

Physical Gena Chrb Left marker/nearest marker Right marker/second nearest marker IMd CIMe PVf locationg F6:8 8 BARC_051847_11270 ̶ 3.1 3.1 5.0 36466059 F9:11 8 not detected F6:8 13 FLOWER_COLOR W1/w1 locus ̶ 1.9 2.8 4.4 17312490 16811968- F 13 BARC_2.0_Gm13_16811968 BARC_2.0_Gm13_17047053 2.4 2.7 3.9 9:11 17047053 F6:8 14 not detected 2405177- F 14 BARC_2.0_Gm14_2405177 BARC_2.0_Gm14_2762413 4.3 4.3 5.7 9:11 2762413 F6:8 15 BARC-025663-04988 ̶ 3.6 3.4 6.7 9504568 F9:11 15 not detected

229 F6:8 16 Satt693 ̶ 3.0 2.9 4.3 6325509

F9:11 16 not detected F6:8 19 BARCSOYSSR_19_1452 ̶ 1.8 2.2 3.3 47528116 Glyma19g41390 (Wm82.a2.v1 Glyma19g41870 (Wm82.a2.v1 name 47790275- F 19 6.1 6.3 8.5 9:11 name Glyma.19g226100) Glyma.19g230600) 48144083 a b c d e Generation Chromosome F6:8 data from Ellis et al., 2012. Interval mapping value Composite interval mapping value, genome- f wide LOD threshold for F9:11 generation is 3.2 Phenotypic variation explained by individual QTL as calculated in MapQTL for CIM (van Ooijen, 2004) gPhysical location of region between the Left and Right markers or the nearest marker in assembly Wm82.a2.v1 (SoyBase)

Table E.1. Comparison of quantitative trait loci (QTL) conferring resistance to F. graminearum in two generations of Conrad x Sloan recombinant inbred lines (RILs) using the rolled towel method.

Appendix F. Genes associated with QTL conferring resistance to P. sojae mapped in chapter 2

QTL Gene IDa Start:End Panther GO pfam LEUCINE-RICH REPEAT protein kinase activity, ATP 50572694: RECEPTOR-LIKE PROTEIN binding, protein 1 Glyma.01g168100 . 50576084 KINASE, SUBFAMILY phosphorylation, protein 230 NOT NAMED binding microtubule motor activity, 50582822: FAMILY NOT NAMED, ATP binding, microtubule 1 Glyma.01g168200 . 50590835 (description unavailable) binding, microtubule-based movement 50599907: 1 Glyma.01g168300 . . . 50603304 Continued aGene name, starting and ending physical location (bp), and panther, GO term, and pfam information from assembly Wm82.a2.v1 (SoyBase)

Table F.1. Genes between flanking markers of quantitative trait loci (QTL) conferring resistance to Phytophthora sojae in a Conrad x Sloan F9:11 recombinant inbred line (RIL) population.

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam Glyoxalase/Bleomycin LACTOYLGLUTATHIONE 50605679: resistance 1 Glyma.01g168400 LYASE (GLYOXALASE I), . 50608020 protein/Dioxygenase (description unavailable) superfamily 50609598: 1 Glyma.01g168500 . . B-box zinc finger 50613102 50620709: Uncharacterised protein 1 Glyma.01g168600 . . 50629264 family (UPF0183) 50622412: 1 Glyma.01g168700 . . . 50622757 231 transferase activity, transferring 50633986: 1 Glyma.01g168800 . acyl groups other than amino- Transferase family 50636589 acyl groups protein binding, DNA binding, Plus-3 domain, SWIB 50639788: (description unavailable), DNA-templated transcription 1 Glyma.01g168900 /MDM2 domain, GYF 50646581 (description unavailable) initiation, histone modification, domain nucleus 50650738: (description unavailable), 1 Glyma.01g169000 protein binding GYF domain 50654889 (description unavailable) 50656699: Protein of unknown 1 Glyma.01g169100 UNCHARACTERIZED . 50662990 function (DUF726) Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam iron ion binding, electron carrier activity, oxidoreductase activity, acting on paired 50665857: (description unavailable), 1 Glyma.01g169200 donors with incorporation or Cytochrome P450 50669296 FAMILY NOT NAMED reduction of molecular oxygen, heme binding, oxidation- reduction process 50689165: 1 Glyma.01g169300 . . . 50689427 sequence-specific DNA

232 TRANSCRIPTION FACTOR binding transcription factor 50689651: GATA (GATA BINDING activity, zinc ion binding, 1 Glyma.01g169400 GATA zinc finger 50691406 FACTOR), (description sequence-specific DNA unavailable) binding, regulation of transcription DNA-templated LEUCINE-RICH REPEAT 50701453: 1 Glyma.01g169500 RECEPTOR-LIKE PROTEIN protein binding Leucine Rich Repeat 50703401 KINASE Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam DNA binding, protein dimerization activity, SRF-type transcription sequence-specific DNA 50706222: (description unavailable), factor (DNA-binding 1 Glyma.01g169600 binding transcription factor 50708849 MADS BOX PROTEIN and dimerisation activity, regulation of domain), K-box region transcription, DNA-templated, nucleus

UBIQUITIN- 50715084: acid-amino acid ligase activity, Ubiquitin-conjugating 1 Glyma.01g169700 CONJUGATING ENZYME 233 50719427 protein binding enzyme E2, (description unavailable)

UDP-N-acetylmuramate CYTOKININ dehydrogenase activity, FAD binding domain, 50726088: DEHYDROGENASE 2- oxidoreductase activity, flavin 1 Glyma.01g169800 FAD linked oxidases, C- 50733347 RELATED, D-LACTATE adenine dinucleotide binding, terminal domain DEHYDROGENASE oxidation-reduction process, catalytic activity Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam iron ion binding, electron carrier activity, oxidoreductase activity, acting on paired 50743009: FAMILY NOT NAMED, 1 Glyma.01g170000 donors, with incorporation or Cytochrome P450 50750309 (description unavailable) reduction of molecular oxygen, heme binding, oxidation- reduction process rRNA (adenine-N6 CN6-)- dimethyltransferase activity, rRNA methyltransferase 50754028: DIMETHYLADENOSINE activity, rRNA modification, Ribosomal RNA 234 1 Glyma.01g170100 50755790 TRANSFERASE methyltransferase activity, adenine dimethylase protein methyltransferase activity, protein methylation, cytoplasm, metabolic process hydrolase activity, hydrolyzing O-glycosyl compounds, BETA-GALACTOSIDASE Galactose binding lectin 50763806: carbohydrate metabolic 1 Glyma.01g170200 RELATED, (description domain, Glycosyl 50769670 process, carbohydrate binding, unavailable) hydrolases family 35 beta-galactosidase activity, beta-galactosidase complex 50770157: 1 Glyma.01g170300 THIOREDOXIN cell redox homeostasis Thioredoxin 50773422 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam 50775756: Protein of unknown 1 Glyma.01g170400 UNCHARACTERIZED . 50777700 function (DUF778) 50779772: EamA-like transporter 1 Glyma.01g170500 . membrane 50781482 family 50782964: 1 Glyma.01g170600 . . . 50789836 50793927: Domain of unknown 1 Glyma.01g170700 . . 50800725 function (DUF702) Vacuolar protein, 50172929: 1 Glyma.01g164100 Vascular sorting protein . sorting associated 50182147 protein

235 GTP binding, small GTPase

50183409: 1 Glyma.01g164200 Rho Family GTPase mediated signal transduction, Ras family 50186003 intracellular oxidoreductase activity, metal ion binding, oxidation- AROM 50189239: reduction process, 3- 3-dehydroquinate 1 Glyma.01g164300 DEHYDROQUINATE 50192953 dehydroquinate synthase synthase SYNTHASE activity, aromatic amino acid family biosynthetic process 50194784: 1 Glyma.01g164400 . . . 50197544 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam Protein of unknown 50206480: function (DUF632), 1 Glyma.01g164500 . . 50210828 Protein of unknown function (DUF630) peroxidase activity, heme 50211708: binding, response to 1 Glyma.01g164600 . Peroxidase 50215545 oxidative stress, oxidation- reduction process 50323314: 1 Glyma.01g165800 . . Thaumatin family 50324161

236 BETA CATENIN-RELATED

50339264: ARMADILLO REPEAT- Armadillo/beta-catenin- 1 Glyma.01g165900 protein binding 50341908 CONTAINING, (description like repeat unavailable)

50355756: (description unavailable), 1 Glyma.01g166000 . DnaJ domain 50357120 FAMILY NOT NAMED protein kinase activity, ATP (description unavailable), 50366875: binding, protein 1 Glyma.01g166100 SERINE/THREONINE- Protein kinase domain 50372430 phosphorylation, calcium PROTEIN KINASE ion binding Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam oxidoreductase activity, oxidoreductase activity, acting on paired donors, with incorporation or OXIDOREDUCTASE, 2OG- reduction of molecular 50397487: FE(II) OXYGENASE FAMILY 2OG-Fe(II) oxygenase 1 Glyma.01g166200 oxygen, 2-oxoglutarate as 50400307 PROTEIN, (description superfamily one donor, and unavailable) incorporation of one atom each of oxygen into both donors, oxidation-reduction process

237

50402188: 1 Glyma.01g166300 . . . 50404181

ATAXIA TELANGIECTASIA MUTATED (ATM)-RELATED, phosphotransferase activity, FAT domain, 50404781: 1 Glyma.01g166400 TRANSFORMATION/TRANS alcohol group as acceptor, Phosphatidylinositol 3- 50436297 CRIPTION DOMAIN- protein binding and 4-kinase ASSOCIATED PROTEIN 50441351: 1 Glyma.01g166500 . . . 50442688 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam YEATS DOMAIN- 50443699: regulation of transcription, 1 Glyma.01g166600 CONTAINING PROTEIN 4, YEATS family 50446896 DNA-templated, nucleus YEATS DOMAIN 50447674: 1 Glyma.01g166700 . . . 50451570 46100177: Mediator complex 4 Glyma.04g190300 . . 46105567 subunit 28 serine-type peptidase 46131920: (description unavailable), Prolyl oligopeptidase 4 Glyma.04g190500 activity, proteolysis, 46135591 UNCHARACTERIZED family hydrolase activity

238 46132614: 4 Glyma.04g190600 . . . 46132935

Papain family cysteine (description unavailable), 46143583: cysteine-type peptidase protease, Cathepsin 4 Glyma.04g190700 CYSTEINE PROTEASE 46146881 activity, proteolysis propeptide inhibitor FAMILY C1-RELATED domain (I29) MITOCHONDRIAL PEPTIDE peptide-methionine (S)-S- 46143080: METHIONINE SULFOXIDE Peptide methionine 4 Glyma.04g190800 oxide reductase activity, 46147709 REDUCTASE, METHIONINE sulfoxide reductase oxidation-reduction process SULFOXIDE REDUCTASE Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam protein binding, transcription cofactor activity, histone 46152356: FAMILY NOT NAMED, TAZ zinc finger, BTB 4 Glyma.04g190900 acetyltransferase activity, 46155245 (description unavailable) FPOZ domain zinc ion binding, regulation of transcription, DNA- templated, nucleus nucleic acid binding, 3-5 exonuclease activity, 46159231: 4 Glyma.04g191000 3-5 EXONUCLEASE nucleobase-containing 3-5exonuclease 46159795 compound metabolic 239 process

46174420: 4 Glyma.04g191100 . . Pectate lyase 46176838 REPLICATION FACTOR, ATPase family 46203955: 4 Glyma.04g191200 DNA POLYMERASE III ATP binding associated with various 46209400 GAMMA-TAU SUBUNIT cellular activities (AAA) 46212718: 4 Glyma.04g191300 . . . 46218522 46220242: (description unavailable), 4 Glyma.04g191400 . Peptidase family C78 46235879 FAMILY NOT NAMED 46238647: PROGRAMMED CELL 4 Glyma.04g191500 . MA3 domain 46243068 DEATH 4 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam (description unavailable), 46244278: 4 Glyma.04g191600 TETRATRICOPEPTIDE protein binding Tetratricopeptide repeat 46250287 REPEAT PROTEIN, TPR 2-DEOXYGLUCOSE-6- 46254652: haloacid dehalogenase-like 4 Glyma.04g191700 PHOSPHATE PHOSPHATASE . 46259833 hydrolase 2 46261171: Endonuclease/Exonuclease/ 4 Glyma.04g191800 AP ENDONUCLEASE . 46268403 phosphatase family JUMONJI DOMAIN 46271697: CONTAINING PROTEIN, metal ion binding, JmjC domain, hydroxylase, 4 Glyma.04g191900

240 46281894 LYSINE-SPECIFIC protein binding jmjN domain DEMETHYLASE LID

JUMONJI DOMAIN 46279239: CONTAINING PROTEIN, jmjN domain, JmjC domain, 4 Glyma.04g192000 protein binding 46297477 LYSINE-SPECIFIC hydroxylase DEMETHYLASE LID PROTEIN PHOSPHATASE 46307459: Zinc finger C-x8-C-x5-C- 4 Glyma.04g192100 RELATED, (description metal ion binding 46313184 x3-H type (and similar) unavailable) Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam Retinoblastoma- associated protein A RETINOBLASTOMA- domain, Domain of 46324061: ASSOCIATED PROTEIN (RB)- regulation of cell cycle, unknown function 4 Glyma.04g192200 46333019 RELATED, (description nucleus (DUF3452), unavailable) Retinoblastoma- associated protein B domain LYST-INTERACTING 1 C3-beta-D-glucan PROTEIN LIP5 (DOPAMINE synthase activity, (1->3)-

241 46344683: RESPONSIVE PROTEIN DRG- beta-D-glucan biosynthetic 1 C3-beta-glucan 4 Glyma.04g192300

46403452 1), VACUOLAR PROTEIN process, 1 C3-beta-D-glucan synthase component SORTING-ASSOCIATED synthase complex, PROTEIN VTA1 HOMOLOG membrane 46416413: B3 DNA binding 4 Glyma.04g192400 . DNA binding 46421655 domain transporter activity, ADENINE/GUANINE transport, transmembrane PERMEASE AZG1, transport, membrane, sulfate 46422834: XANTHINE- 4 Glyma.04g192500 transmembrane transporter Permease family 46425458 URACIL/VITAMIN C activity, sulfate transport, PERMEASE FAMILY integral component of MEMBER membrane Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam 46433403: KELCH REPEAT DOMAIN, Kelch motif, Kelch 4 Glyma.04g192600 protein binding 46442042 (description unavailable) motif

46442743: 4 Glyma.04g192700 . . . 46443564

Radical SAM 46445789: COPROPORPHYRINIGEN III catalytic activity, iron-sulfur 4 Glyma.04g192800 superfamily, HemN C- 46448085 OXIDASE cluster binding terminal domain HISTONE N-acetyltransferase activity, Acetyltransferase 46449234: 242 4 Glyma.04g192900 ACETYLTRANSFERASE- catalytic activity, iron-sulfur (GNAT) family, Radical 46454444

RELATED cluster binding SAM superfamily

46455066: (description unavailable), Telomere length 4 Glyma.04g193000 . 46465626 FAMILY NOT NAMED regulation protein

THIOL PROTEASE ULP-4- Ulp1 protease family, C- 46466217: cysteine-type peptidase 4 Glyma.04g193100 RELATED, UBIQUITIN-LIKE terminal catalytic 46468787 activity, proteolysis PROTEASE PROTEIN 2 domain DNA binding, transposase 46483962: MULE transposase 4 Glyma.04g193200 . activity, transposition, 46486557 domain DNA-mediated 46487159: 4 Glyma.04g193300 . . . 46488590 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO pfam Glyceraldehyde 3- phosphate oxidoreductase activity, dehydrogenase, NAD GLYCERALDEHYDE 3- acting on the aldehyde or 46504406: binding domain, 4 Glyma.04g193400 PHOSPHATE oxo group of donors, NAD 46507455 Glyceraldehyde 3- DEHYDROGENASE or NADP as acceptor, phosphate oxidation-reduction process dehydrogenase, C- terminal domain Glyceraldehyde 3- phosphate oxidoreductase activity, dehydrogenase, C-

243 GLYCERALDEHYDE 3- acting on the aldehyde or 46511258: terminal domain, 4 Glyma.04g193500 PHOSPHATE oxo group of donors, NAD 46514211 Glyceraldehyde 3- DEHYDROGENASE or NADP as acceptor, phosphate oxidation-reduction process dehydrogenase, NAD binding domain 46520712: 4 Glyma.04g193600 . . . 46525863 46528402: 4 Glyma.04g193700 . . . 46536243 Plant protein of 45982982: 4 Glyma.04g188900 . . unknown function 45986148 (DUF868) 45988768: 4 Glyma.04g189000 . . . 45989908 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam (description unavailable), 46001963: nucleotidyltransferase Nucleotidyltransferase 4 Glyma.04g189100 TOPOISOMERASE-RELATED 46009715 activity domain PROTEIN tRNA intron tRNA-intron endonuclease endonuclease, catalytic TRNA-SPLICING 46020865: activity, tRNA splicing, via C-terminal domain, 4 Glyma.04g189200 ENDONUCLEASE SUBUNIT 46023009 endonucleolytic cleavage tRNA intron SEN2 and ligation endonuclease, N- terminal domain TRANSMEMBRANE

244 ANTERIOR POSTERIOR 46029363: Eukaryotic membrane 4 Glyma.04g189300 TRANSFORMATION . 46037024 protein family PROTEIN 1 HOMOLOG, UNCHARACTERIZED 46033660: 4 Glyma.04g189400 . . . 46034323 iron ion binding, electron carrier activity, oxidoreductase activity, 46039217: acting on paired donors, 4 Glyma.04g189500 . Cytochrome P450 46040087 with incorporation or reduction of molecular oxygen, heme binding, oxidation-reduction process Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam DUAL SPECIFICITY PROTEIN protein kinase activity, 46047721: 4 Glyma.04g189600 KINASE, (description ATP binding, protein Protein kinase domain 46051704 unavailable) phosphorylation iron ion binding, electron carrier activity, oxidoreductase activity, 46058598: (description unavailable), acting on paired donors, 4 Glyma.04g189700 Cytochrome P450 46060493 FAMILY NOT NAMED with incorporation or reduction of molecular

245 oxygen, heme binding, oxidation-reduction process

FAMILY NOT NAMED, THIOSULFATE 46061873: SULFURTRANSFERASE 4 Glyma.04g189800 . Rhodanese-like domain 46063795 FRHODANESE-LIKE DOMAIN-CONTAINING PROTEIN 3 46066906: 4 Glyma.04g189900 COPINE . Copine 46071217 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam Raffinose synthase or 46076888: 4 Glyma.04g190000 . . seed imbibition protein 46080907 Sip1 RNA recognition motif. 46083382: FAMILY NOT NAMED, 4 Glyma.04g190100 nucleic acid binding (a.k.a. RRM, RBD, or 46086444 (description unavailable) RNP domain) protein-L-isoaspartate (D- aspartate) O- methyltransferase activity, Protein-L- 46086785: PROTEIN-L-ISOASPARTATE cellular protein modification isoaspartate(D-aspartate) 4 Glyma.04g190200 46089618 O-METHYLTRANSFERASE process, protein O-methyltransferase

246 methyltransferase activity, (PCMT) protein methylation, cytoplasm LEUCINE-RICH REPEAT protein kinase activity, 46109702: RECEPTOR-LIKE PROTEIN ATP binding, protein Protein kinase domain, 4 Glyma.04g190400 46112064 KINASE, (description phosphorylation, protein Leucine Rich Repeat unavailable) binding 3593207: 15 Glyma.15g044900 . . . 3599650 3603477: 15 Glyma.15g045000 . . Nodulin 3604915 Contiuned

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam Carbamoyl-phosphate synthetase large chain, oligomerisation catalytic activity, (description unavailable), domain, MGS-like domain, 3609289: metabolic process, ATP 15 Glyma.15g045100 CARBAMOYLTRANSF Carbamoyl-phosphate synthase L 3614077 binding, D-alanine-D- ERASE RELATED chain, ATP binding domain, alanine ligase activity Carbamoyl-phosphate synthase L chain, N-terminal domain 3620311: Protein of unknown function 15 Glyma.15g045200 . . 3622470 DUF260

247 3630795: 15 Glyma.15g045300 . nutrient reservoir activity Cupin 3632030 3632569: 15 Glyma.15g045400 . . . 3633207 3634797: PROTEIN DISULFIDE 15 Glyma.15g045500 cell redox homeostasis Thioredoxin 3637279 ISOMERASE LEUCINE-RICH REPEAT RECEPTOR- protein kinase activity, 3639896: 15 Glyma.15g045600 LIKE PROTEIN ATP binding, protein Protein kinase domain 3642551 KINASE, (description phosphorylation unavailable) Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam methyltransferase activity, 3127716: N6-ADENOSINE- 16 Glyma.16g033100 nucleobase-containing MT-A70 3133331 METHYLTRANSFERASE compound metabolic process GLUCOSYL/GLUCURON transferase activity, 3135514: UDP-glucoronosyl and 16 Glyma.16g033200 OSYL TRANSFERASES, transferring hexosyl groups, 3136874 UDP-glucosyl transferase (description unavailable) metabolic process GLUCOSYL/GLUCURON transferase activity, 3138967: UDP-glucoronosyl and 16 Glyma.16g033300 OSYL TRANSFERASES, transferring hexosyl groups, 3143764 UDP-glucosyl transferase (description unavailable) metabolic process 248 3142251: transmembrane transport, Mechanosensitive ion 16 Glyma.16g033400 . 3149554 membrane channel BETA-1 C3- transferase activity, 3152014: Protein of unknown 16 Glyma.16g033500 GLUCOSYLTRANSFERAS transferring glycosyl groups, 3156923 function, DUF604 E, FRINGE-RELATED membrane transferase activity, 3157708: 16 Glyma.16g033600 . transferring acyl groups Transferase family 3159706 other than amino-acyl groups GLUCOSYL/GLUCURON transferase activity, 3162563: UDP-glucoronosyl and 16 Glyma.16g033700 OSYL TRANSFERASES, transferring hexosyl groups, 3164829 UDP-glucosyl transferase (description unavailable) metabolic process Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam Ferric reductase like transmembrane component, 3167697: (description unavailable), oxidoreductase activity, 16 Glyma.16g033800 FAD-binding domain, Ferric 3172780 NADPH OXIDASE oxidation-reduction process reductase NAD binding domain LEUCINE-RICH REPEAT- Leucine Rich Repeat, 3174939: CONTAINING PROTEIN, protein binding, ADP 16 Glyma.16g033900 Leucine Rich Repeat, NB- 3181746 DISEASE RESISTANCE binding, signal transduction ARC domain, TIR domain PROTEIN RPS4-RELATED 3181971: 249 16 Glyma.16g034000 . . . 3182144

metal ion binding, zinc ion (description unavailable), binding, ubiquitin-protein 3195056: Zinc finger, C3HC4 type 16 Glyma.16g034100 RING FINGER DOMAIN- ligase activity, anaphase- 3196022 (RING finger) CONTAINING promoting complex, protein binding 3214808: 16 Glyma.16g034200 . protein binding WRC 3216552 DIHYDRONEOPTERIN dihydroneopterin aldolase 3226621: 16 Glyma.16g034300 ALDOLASE, FOLATE activity, folic acid-containing Dihydroneopterin aldolase 3228817 SYNTHESIS PROTEINS compound metabolic process NOP SEVEN 3229276: 16 Glyma.16g034400 ASSOCIATED PROTEIN 1, . . 3235664 (description unavailable) Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam FIVE-SPAN TRANSMEMBRANE 3242522: Protein of unknown function 16 Glyma.16g034500 PROTEIN M83, . 3250501 (DUF3522) SUBFAMILY NOT NAMED (description unavailable), protein kinase activity, ATP 3254425: LEUCINE-RICH REPEAT PPR repeat, Protein tyrosine 16 Glyma.16g034600 binding, protein 3263715 RECEPTOR-LIKE kinase phosphorylation PROTEIN KINASE metal ion binding, zinc ion (description unavailable), binding, ubiquitin-protein 3266015: Zinc finger, C3HC4 type 250 16 Glyma.16g034700 RING FINGER ligase activity, anaphase- 3269666 (RING finger)

CONTAINING PROTEIN promoting complex, protein binding 3267377: 16 Glyma.16g034800 . . . 3268109 (description unavailable), protein kinase activity, ATP S-locus glycoprotein family, 3273872: LEUCINE-RICH REPEAT binding, protein 16 Glyma.16g034900 Protein kinase domain, D- 3276746 RECEPTOR-LIKE phosphorylation, recognition mannose binding lectin PROTEIN KINASE of pollen (description unavailable), 3311992: UBIQUITIN- acid-amino acid ligase 16 Glyma.16g035000 . 3314979 CONJUGATING ENZYME activity E2 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam (description unavailable), SWI/SNF-RELATED SNF2 family N-terminal MATRIX-ASSOCIATED DNA binding, ATP binding, 3320804: domain, Helicase conserved 16 Glyma.16g035100 ACTIN-DEPENDENT nucleic acid binding, helicase 3332208 C-terminal domain, QLQ, REGULATOR OF activity Bromodomain CHROMATIN SUBFAMILY-RELATED 3339459: 16 Glyma.16g035200 . . . 3340732 zinc ion binding, positive 3345543: Brf1-like TBP-binding 251 16 Glyma.16g035300 . regulation of transcription, 3347254 domain DNA-templated, nucleus

TRANSCRIPTION FACTOR IIIB 90 KDA TBP-class protein binding, Transcription factor TFIIB 3348514: SUBUNIT, zinc ion binding, positive 16 Glyma.16g035400 repeat, Brf1-like TBP- 3362406 TRANSCRIPTION regulation of transcription, binding domain INITIATION FACTOR IIB- DNA-templated, nucleus RELATED Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam TELOMERIC REPEAT BINDING PROTEIN,HOMEODOMAI 523399: 16 Glyma.16g006500 N-LIKE PROTEIN WITH . . 531647 RING FFYVE FPHD-TYPE ZINC FINGER DOMAIN- RELATED RING FINGER PROTEIN 499346: Zinc finger, C3HC4 type 16 Glyma.16g006200 24-RELATED, (description . 499889 (RING finger) unavailable) 502366: 16 Glyma.16g006300 . . . 252 503680

DISEASE RESISTANCE PROTEIN RPS4- Leucine Rich Repeat, NB- 515780: protein binding, ADP 16 Glyma.16g006400 RELATED, LEUCINE- ARC domain, TIR domain, 520765 binding, signal transduction RICH REPEAT- Leucine Rich Repeat CONTAINING PROTEIN DEVELOPMENTALLY- REGULATED GTP- GTP binding, ferrous iron BINDING PROTEIN 1, transmembrane transporter 533713: 50S ribosome-binding 16 Glyma.16g006600 DEVELOPMENTALLY activity, ferrous iron 540391 GTPase, TGS domain REGULATED GTP- transport, integral component BINDING PROTEIN- of membrane RELATED Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 542955: Protein of unknown function 16 Glyma.16g006700 . . 544859 (DUF1313) (description unavailable), 549293: 16 Glyma.16g006800 DNA2 FNAM7 HELICASE . . 557692 FAMILY 567830: 16 Glyma.16g006900 . . . 570909 SUBFAMILY NOT DNA-templated transcription 573026: Transcription initiation 16 Glyma.16g007000 NAMED, FAMILY NOT initiation, transcription factor

253 580402 factor TFIID subunit A NAMED TFIID complex

583765: MYB-LIKE DNA- Myb-like DNA-binding 16 Glyma.16g007100 chromatin binding 585815 BINDING PROTEIN MYB domain 594725: MYB-LIKE DNA- Myb-like DNA-binding 16 Glyma.16g007200 chromatin binding 596329 BINDING PROTEIN MYB domain 599220: AUTOPHAGY PROTEIN autophagic vacuole Ubiquitin-like autophagy 16 Glyma.16g007300 602627 12 assembly, cytoplasm protein Apg12 sequence-specific DNA binding transcription factor 605287: (description unavailable), 16 Glyma.16g007400 activity, regulation of AP2 domain 609287 UNCHARACTERIZED transcription, DNA- templated Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 626448: 16 Glyma.16g007500 . . . 628474 protein binding, ATP binding, hydrolase activity, acting on acid anhydrides, in 635959: 16 Glyma.16g007600 . phosphorus-containing WRC, QLQ 638549 anhydrides, regulation of transcription, DNA- templated, nucleus 651716: 16 Glyma.16g007700 . nutrient reservoir activity Cupin 254 652917

655504: 16 Glyma.16g007800 . nutrient reservoir activity Cupin 656129 659259: 16 Glyma.16g007900 . nutrient reservoir activity Cupin 659879 663800: 16 Glyma.16g008000 . . . 666924 COILED-COIL-HELIX- 666386: 16 Glyma.16g008100 COILED-COIL-HELIX . . 667402 DOMAIN CONTAINING 4

669746: 16 Glyma.16g008200 . . GRAS domain family 672318

Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam UNCHARACTERIZED ubiquitin-protein ligase 674033: 16 Glyma.16g008300 RING ZINC FINGER- activity, mitochondrion E3 Ubiquitin ligase 679140 CONTAINING PROTEIN organization GUANOSINE-3 7 C5 7- phosphoric diester hydrolase 684997: BIS(DIPHOSPHATE) 3 7- activity, metal ion binding, Region found in RelA/SpoT 16 Glyma.16g008400 689811 PYROPHOSPHOHYDROL guanosine tetraphosphate proteins, HD domain ASE metabolic process LEUCINE-RICH REPEAT RECEPTOR-LIKE protein kinase activity, ATP 712186: 16 Glyma.16g008500 PROTEIN KINASE, binding, protein Protein tyrosine kinase 714569

255 SUBFAMILY NOT phosphorylation NAMED

iron ion binding, electron carrier activity, oxidoreductase activity, 722534: (description unavailable), acting on paired donors, with 16 Glyma.16g008600 Cytochrome P450 725157 FAMILY NOT NAMED incorporation or reduction of molecular oxygen, heme binding, oxidation-reduction process Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam oxidoreductase activity, acting on single donors with incorporation of molecular 735622: (description unavailable), PLAT FLH2 domain, 16 Glyma.16g008700 oxygen, incorporation of two 742337 LIPOXYGENASE Lipoxygenase atoms of oxygen, metal ion binding, oxidation-reduction process, protein binding

761969: 16 Glyma.16g008800 . . . 762810

256 serine-type endopeptidase

activity, proteolysis, (description unavailable), Sodium/calcium exchanger transmembrane transport, 772817: PROPROTEIN protein, PA domain, 16 Glyma.16g008900 integral component of 779723 CONVERTASE Peptidase inhibitor I9, membrane, identical protein SUBTILISIN/KEXIN Subtilase family binding, negative regulation of catalytic activity 786709: Protein of unknown function 16 Glyma.16g009000 . . 788292 (DUF1677) Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam LIPASE CLASS 3 FAMILY triglyceride lipase activity, 798695: PROTEIN, CGI-141- lipid metabolic process, Lipase 3 N-terminal region, 16 Glyma.16g009100 804808 RELATED /LIPASE (description unavailable), Lipase (class 3) CONTAINING PROTEIN lipid catabolic process 523399: 16 Glyma.16g006500 . . . 531647 499346: 16 Glyma.16g006200 . . . 499889 502366: 16 Glyma.16g006300 . . . 503680 515780: 257 16 Glyma.16g006400 . . . 520765 533713: 16 Glyma.16g006600 . . . 540391 542955: 16 Glyma.16g006700 . . . 544859 549293: 16 Glyma.16g006800 . . . 557692 567830: 16 Glyma.16g006900 . . . 570909 573026: 16 Glyma.16g007000 . . . 580402 583765: 16 Glyma.16g007100 . . . 585815 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 594725: 16 Glyma.16g007200 . . . 596329 599220: 16 Glyma.16g007300 . . . 602627 605287: 16 Glyma.16g007400 . . . 609287 626448: 16 Glyma.16g007500 . . . 628474 635959: 16 Glyma.16g007600 . . . 638549 651716: 16 Glyma.16g007700 . . . 258 652917

655504: 16 Glyma.16g007800 . . . 656129 659259: 16 Glyma.16g007900 . . . 659879 663800: 16 Glyma.16g008000 . . . 666924 666386: 16 Glyma.16g008100 . . . 667402 669746: 16 Glyma.16g008200 . . . 672318 674033: 16 Glyma.16g008300 . . . 679140 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 684997: 16 Glyma.16g008400 . . . 689811 712186: 16 Glyma.16g008500 . . . 714569 722534: 16 Glyma.16g008600 . . . 725157 735622: 16 Glyma.16g008700 . . . 742337 761969: 16 Glyma.16g008800 . . . 762810 772817: 16 Glyma.16g008900 . . . 259 779723

786709: 16 Glyma.16g009000 . . . 788292 798695: 16 Glyma.16g009100 . . . 804808 SUBFAMILY NOT 56710302: NAMED, LEUCINE-RICH 18 Glyma.18g287100 ADP binding NB-ARC domain 56713686 REPEAT-CONTAINING PROTEIN 56724573: FAMILY NOT NAMED, 18 Glyma.18g287200 . . 56725612 (description unavailable) 56734297: 18 Glyma.18g287300 . . . 56739429 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam oxidoreductase activity, acting on the aldehyde or Dehydrogenase E1 56740754: 2-OXOGLUTARATE 18 Glyma.18g287400 oxo group of donors, component, Transketolase, 56748259 DEHYDROGENASE disulfide as acceptor, pyrimidine binding domain metabolic process 56749390: FAMILY NOT NAMED, 18 Glyma.18g287500 . PPR repeat 56753241 (description unavailable) GTPase activity, GTP binding, small GTPase 56754676: (description unavailable), 18 Glyma.18g287600 mediated signal transduction, Ras family 56759595 FAMILY NOT NAMED

260 nucleus, cytoplasm, intracellular HEAT SHOCK PROTEIN 56767722: 18 Glyma.18g287700 70KDA, (description . Hsp70 protein 56768049 unavailable) HEAT SHOCK PROTEIN 56769416: 18 Glyma.18g287800 70KDA, (description . Hsp70 protein 56773573 unavailable) HEAT SHOCK PROTEIN 56777135: 18 Glyma.18g287900 70KDA, (description . Hsp70 protein 56784200 unavailable) Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam sequence-specific DNA binding transcription factor PITUITARY HOMEOBOX 56787190: activity, sequence-specific 18 Glyma.18g288000 HOMOLOG PTX1, Homeobox domain 56790765 DNA binding, regulation of FAMILY NOT NAMED transcription, DNA- templated 56791325: 18 Glyma.18g288100 FAMILY NOT NAMED . PPR repeat 56794532 DNA REPAIR PROTEIN XRCC3, RECA FRAD51 56795210: 18 Glyma.18g288200 FRADA DNA STRAND- . Rad51 56796076 261 PAIRING FAMILY

MEMBER 56798511: 18 Glyma.18g288300 . . Putative zinc-finger domain 56811129 RNA AND EXPORT RNA recognition motif. 56812346: 18 Glyma.18g288400 FACTOR BINDING nucleic acid binding (a.k.a. RRM, RBD, or RNP 56817728 PROTEIN domain) 56817246: 18 Glyma.18g288500 . . . 56838281 PHOSPHOLIPASE D, Phospholipase D Active site 56840393: protein binding, catalytic 18 Glyma.18g288600 PHOSPHOLIPASE D BETA motif, C2 domain, 56849007 activity, metabolic process 1-RELATED Phospholipase D, terminal Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam serine-type endopeptidase (description unavailable), activity, proteolysis, identical Subtilase family, PA 56849790: PROPROTEIN 18 Glyma.18g288700 protein binding, negative domain, Peptidase inhibitor 56852099 CONVERTASE regulation of catalytic I9 SUBTILISIN/KEXIN activity serine-type endopeptidase (description unavailable), activity, proteolysis, identical Peptidase inhibitor I9, 56853815: PROPROTEIN 18 Glyma.18g288800 protein binding, negative Subtilase family, PA 56856371 CONVERTASE regulation of catalytic domain SUBTILISIN /KEXIN activity 56861459: ENOYL-COA catalytic activity, metabolic Enoyl-CoA

262 18 Glyma.18g288900 56862507 HYDRATASE-RELATED process hydratase/isomerase family

56863534: 18 Glyma.18g289000 . . . 56867736 56874667: HEAT SHOCK PROTEIN 18 Glyma.18g289100 Hsp70 protein 56877565 70KDA GASTRULATION 43024959: 19-1 Glyma.19g169500 DEFECTIVE PROTEIN 1- protein binding WD domain, G-beta repeat 43028740 RELATED RNA polymerase II transcription cofactor 43030982: activity, regulation of 19-1 Glyma.19g169600 . Mediator complex protein 43034448 transcription from RNA polymerase II promoter, mediator complex Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam phosphorelay response (description unavailable), regulator activity, 43049522: RESPONSE REGULATOR phosphorelay signal Response regulator receiver 19-1 Glyma.19g169700 43050155 OF TWO-COMPONENT transduction system, domain SYSTEM regulation of transcription, DNA-templated (description unavailable), 43050652: VHS DOMAIN 19-1 Glyma.19g169800 intracellular protein transport VHS domain 43055928 CONTAINING PROTEIN FAMILY 43063596: 263 19-1 Glyma.19g169900 . . . 43066868 SUPPRESSION OF 43070328: uDENN domain, DENN 19-1 Glyma.19g170000 TUMORIGENICITY 5 . 43080205 (AEX-3) domain (ST5) (description unavailable), zinc ion binding, Alcohol dehydrogenase 43081671: ALCOHOL 19-1 Glyma.19g170100 oxidoreductase activity, GroES-like domain, Zinc- 43084907 DEHYDROGENASE oxidation-reduction process binding dehydrogenase RELATED UNCHARACTERIZED, DNA binding, DNA- 43086883: RNA POLYMERASE- templated transcription, 19-1 Glyma.19g170200 Plus-3 domain 43089910 ASSOCIATED PROTEIN initiation, histone RTF1 HOMOLOG modification, nucleus

Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam FAMILY NOT NAMED, ACTIVATING 43100795: 19-1 Glyma.19g170300 MOLECULE IN BECN1- protein binding WD domain, G-beta repeat 43108509 REGULATED AUTOPHAGY PROTEIN 1 43111932: WD REPEAT PROTEIN 26- 19-1 Glyma.19g170400 protein binding WD domain, G-beta repeat 43119042 RELATED (description unavailable), protein kinase activity, ATP 43127931: LEUCINE-RICH REPEAT

264 19-1 Glyma.19g170500 binding, protein Protein tyrosine kinase 43134467 RECEPTOR-LIKE phosphorylation PROTEIN KINASE 43136042: (description unavailable), pfkB family carbohydrate 19-1 Glyma.19g170600 . 43139252 SUGAR KINASE kinase IQ calmodulin-binding motor activity, ATP binding, motif, DIL domain, Myosin 43141448: 19-1 Glyma.19g170700 MYOSIN myosin complex, protein head (motor domain), 43159900 binding Myosin N-terminal SH3- like domain Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam N,N-dimethylaniline monooxygenase activity, (description unavailable), 43188069: flavin adenine dinucleotide 19-1 Glyma.19g170800 DIMETHYLANILINE . 43190263 binding, NADP binding, MONOOXYGENASE oxidation-reduction process, oxidoreductase activity PHOSPHATIDYLINOSITO L N- ACETYLGLUCOSAMINY LTRANSFERASE 43217844: Protein of unknown function 19-1 Glyma.19g170900 SUBUNIT P (DOWN .

265 43223544 (DUF3741) SYNDROME CRITICAL

REGION PROTEIN 5)- RELATED, (description unavailable) ZINC FINGER FYVE hydrolase activity, acting on 43229301: DOMAIN CONTAINING GDSL-like 19-1 Glyma.19g171000 ester bonds, lipid metabolic 43230858 PROTEIN, (description Lipase/Acylhydrolase process unavailable)

43232554: 19-1 Glyma.19g171100 . . . 43239780

43246680: CLASP, (description CLASP N terminal, HEAT 19-1 Glyma.19g171200 protein binding 43260856 unavailable) repeat Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam phosphorelay response (description unavailable), regulator activity, 43263354: RESPONSE REGULATOR phosphorelay signal Response regulator receiver 19-1 Glyma.19g171300 43264634 OF TWO-COMPONENT transduction system, domain SYSTEM regulation of transcription, DNA-templated phosphorelay response (description unavailable), regulator activity, 43272232: RESPONSE REGULATOR phosphorelay signal Response regulator receiver 19-1 Glyma.19g171400 43273013 OF TWO-COMPONENT transduction system, domain SYSTEM regulation of transcription,

266 DNA-templated

(description unavailable), ANKYRIN REPEAT AND 43280769: 19-1 Glyma.19g171500 PROTEIN KINASE protein binding Ankyrin repeat 43283516 DOMAIN-CONTAINING PROTEIN 43284506: 19-1 Glyma.19g171600 . protein binding Ankyrin repeat 43286341 26S PROTEASE REGULATORY SUBUNIT, ATPase family associated 43286481: 19-1 Glyma.19g171700 26S PROTEASE ATP binding with various cellular 43291174 REGULATORY SUBUNIT activities (AAA) 4 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 43296469: 19-1 Glyma.19g171800 . . . 43297147 43299344: 19-1 Glyma.19g171900 . . . 43300062 43309323: 19-1 Glyma.19g172000 . . . 43310270 43314273: 19-1 Glyma.19g172100 . . . 43316701 43318945: HEAT SHOCK PROTEIN 19-1 Glyma.19g172200 . Hsp70 protein 43321873 70KDA 43325742:

267 19-1 Glyma.19g172300 . . . 43328166

43328388: 19-1 Glyma.19g172400 . . Oligosaccaryltransferase 43329644 43332082: Core histone 19-1 Glyma.19g172500 HISTONE H4 DNA binding 43333163 H2A/H2B/H3/H4 43333204: 19-1 Glyma.19g172600 . . . 43337622 ARF GTPase activator 43338318: CENTAURIN/ARF, activity, zinc ion binding, Putative GTPase activating 19-1 Glyma.19g172700 43342360 (description unavailable) regulation of ARF GTPase protein for Arf activity Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam oxidoreductase activity, 43351479: metabolic process, catalytic 19-1 Glyma.19g172800 FAMILY NOT NAMED short chain dehydrogenase 43355523 activity, coenzyme binding, cellular metabolic process 43356237: 19-1 Glyma.19g172900 . . . 43357302 43357447: UNC-93 RELATED, Ion channel regulatory 19-1 Glyma.19g173000 . 43361980 (description unavailable) protein UNC-93 EUKARYOTIC 43363045: TRANSLATION 19-1 Glyma.19g173100 protein binding PCI domain 268 43369495 INITIATION FACTOR 3, THETA SUBUNIT

RNA recognition motif. 43370394: (description unavailable), 19-1 Glyma.19g173200 nucleic acid binding (a.k.a. RRM, RBD, or RNP 43373186 FAMILY NOT NAMED domain) 43375469: 19-1 Glyma.19g173300 . . . 43380799 43383360: Core histone 19-1 Glyma.19g173400 HISTONE H2B DNA binding 43384249 H2A/H2B/H3/H4 43386491: 19-1 Glyma.19g173500 . . . 43388610 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam magnesium ion binding, inorganic diphosphatase 43396429: INORGANIC 19-1 Glyma.19g173600 activity, phosphate- Inorganic pyrophosphatase 43400503 PYROPHOSPHATASE containing compound metabolic process, cytoplasm 43415193: EamA-like transporter 19-1 Glyma.19g173800 . membrane 43418612 family (description unavailable), 43421409: Endonuclease/Exonuclease/ 19-1 Glyma.19g173900 INOSITOL 5- . 43432892 phosphatase family PHOSPHATASE 43452743: FAMILY NOT NAMED, 269 19-1 Glyma.19g174000 . . 43453600 (description unavailable) 43456080: 19-1 Glyma.19g174100 . metal ion binding . 43456340 43457932: FAMILY NOT NAMED, 19-1 Glyma.19g174200 . . 43458737 (description unavailable) diaminopimelate epimerase 43460887: 19-1 Glyma.19g174300 . activity, lysine biosynthetic Diaminopimelate epimerase 43465092 process via diaminopimelate 43467733: Protein of unknown function 19-1 Glyma.19g174400 . . 43469028 (DUF1635) DUAL SPECIFICITY protein kinase activity, ATP 43470384: 19-1 Glyma.19g174500 PROTEIN KINASE, binding, protein Protein kinase domain 43473867 (description unavailable) phosphorylation Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam Plant protein 1589 of 43483087: 19-1 Glyma.19g174600 . . unknown function 43484677 (A_thal_3526) 43488438: FAMILY NOT NAMED, 19-1 Glyma.19g174700 protein binding . 43492167 (description unavailable) (description unavailable), PHOSPHATIDYLINOSITO L N- ACETYLGLUCOSAMINY 43496630: 19-1 Glyma.19g174800 LTRANSFERASE . . 43498094 SUBUNIT P (DOWN

270 SYNDROME CRITICAL REGION PROTEIN 5)- RELATED 43499516: 19-1 Glyma.19g174900 . . . 43499728 43500299: 19-1 Glyma.19g175000 . . . 43500613 COPPER TRANSPORT 43500927: PROTEIN ATOX1- metal ion binding, metal ion Heavy-metal-associated 19-1 Glyma.19g175100 43503305 RELATED, (description transport domain unavailable) Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam EXOCYST COMPLEX 43524643: PROTEIN EXO70, Exo70 exocyst complex 19-1 Glyma.19g175200 exocytosis, exocyst 43526959 EXOCYST COMPLEX subunit COMPONENT 7 43532560: FAMILY NOT NAMED, 19-1 Glyma.19g175300 protein binding Ankyrin repeat 43536063 (description unavailable) 43538392: FAMILY NOT NAMED, 19-1 Glyma.19g175400 protein binding Ankyrin repeat 43542161 (description unavailable) 43549323: 19-1 Glyma.19g175500 . . . 43550402 LNS2 (Lipin /Ned1 /Smp2), 271 43561808: (description unavailable), 19-1 Glyma.19g175600 . lipin, N-terminal conserved

43569019 LIPIN region integral component of LUNG SEVEN membrane, G-protein 43569883: TRANSMEMBRANE Lung seven transmembrane 19-1 Glyma.19g175700 coupled receptor signaling 43572105 RECEPTOR, PROTEIN receptor pathway, response to C15H9.5 pheromone 43577204: 19-1 Glyma.19g175800 . . . 43578386 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam E1-E2 ATPase, Cation transporting ATPase, C- terminus, haloacid 43587364: FAMILY NOT NAMED, nucleotide binding, metal ion 19-1 Glyma.19g175900 dehalogenase-like 43593960 (description unavailable) binding hydrolase, Cation transporter FATPase, N- terminus ATP-BINDING CASSETTE 43596780: ATP binding, ATPase ABC-2 type transporter, 19-1 Glyma.19g176000 TRANSPORTER, 43600042 activity, membrane ABC transporter (description unavailable) Zinc knuckle, RNA 272 (description unavailable), 43606806: nucleic acid binding, zinc ion recognition motif. (a.k.a.

19-1 Glyma.19g176100 SPLICING FACTOR, 43609648 binding RRM, RBD, or RNP ARGININE/SERINE-RICH domain) Zinc knuckle, RNA (description unavailable), 43611009: nucleic acid binding, zinc ion recognition motif. (a.k.a. 19-1 Glyma.19g176200 SPLICING FACTOR, 43614558 binding RRM, RBD, or RNP ARGININE/SERINE-RICH domain) 43617216: 19-1 Glyma.19g176300 . . . 43621660 43628962: 19-1 Glyma.19g176400 . . . 43630817 43635433: 19-1 Glyma.19g176500 . . . 43637342 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 43642041: PROTEIN PHOSPHATASE 19-1 Glyma.19g176600 catalytic activity Protein phosphatase 2C 43645437 2C, (description unavailable) 43647633: 19-1 Glyma.19g176700 . . . 43650345 43650848: 19-1 Glyma.19g176800 . . . 43651971 43651712: 19-1 Glyma.19g176900 . . . 43652954 (description unavailable), GLUTATHIONE S-

27 43654763: 19-1 Glyma.19g177000 TRANSFERASE, GST, . .

3 43656193 SUPERFAMILY, GST DOMAIN CONTAINING ATP phosphoribosyltransferase ATP ATP 43656382: activity, histidine 19-1 Glyma.19g177100 PHOSPHORIBOSYLTRAN phosphoribosyltransferase, 43660685 biosynthetic process, SFERASE (ATP-PRTASE) HisG, C-terminal domain cytoplasm, magnesium ion binding (description unavailable), GLUTATHIONE S- 43661700: 19-1 Glyma.19g177200 TRANSFERASE, GST, protein binding . 43663265 SUPERFAMILY, GST DOMAIN CONTAINING Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam LEUCINE-RICH REPEAT protein kinase activity, ATP 43664877: RECEPTOR-LIKE 19-1 Glyma.19g177300 binding, protein Protein kinase domain 43668124 PROTEIN KINASE, phosphorylation (description unavailable) sequence-specific DNA binding transcription factor 43672865: activity, sequence-specific WRKY DNA -binding 19-1 Glyma.19g177400 . 43681647 DNA binding, regulation of domain transcription, DNA- templated ATP binding, nucleobase-

274 containing compound kinase

43689818: 19-1 Glyma.19g177500 NUCLEOTIDE KINASE activity, nucleobase- Adenylate kinase 43692728 containing compound metabolic process antioxidant activity, 43693879: 19-1 Glyma.19g177600 . oxidoreductase activity, AhpC FTSA family 43697609 oxidation-reduction process 43697819: 19-1 Glyma.19g177700 FAMILY NOT NAMED . PPR repeat 43705695 ZINC FINGER- 43708336: 19-1 Glyma.19g177800 CONTAINING PROTEIN . . 43711024 P48ZNF Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 43713259: 19-1 Glyma.19g177900 . . . 43715666 HISTONE H2A 43718461: DEUBIQUITINASE Myb-like DNA-binding 19-1 Glyma.19g178000 chromatin binding 43721894 MYSM1, SWI/SNF domain COMPLEX-RELATED structural constituent of 43724429: 60S RIBOSOMAL Ribosomal protein L4 FL1 19-1 Glyma.19g178100 ribosome, translation, 43726244 PROTEIN L4 family ribosome sequence-specific DNA binding transcription factor 275 43733667: (description unavailable), 19-1 Glyma.19g178200 activity, regulation of AP2 domain

43738337 UNCHARACTERIZED transcription, DNA- templated 43734084: 19-1 Glyma.19g178300 . . . 43734374 LEUCINE-RICH REPEAT protein kinase activity, ATP PROTEIN KINASE-LIKE 43763089: binding, protein Protein tyrosine kinase, 19-1 Glyma.19g178400 PROTEIN, LEUCINE-RICH 43770484 phosphorylation, protein Leucine Rich Repeat REPEAT RECEPTOR-LIKE binding PROTEIN KINASE Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam CCAAT-BINDING TRANSCRIPTION DNA binding, sequence- Histone-like transcription 43772568: 19-1 Glyma.19g178500 FACTOR-RELATED, specific DNA binding, factor (CBF FNF-Y) and 43773713 NUCLEAR FACTOR Y- intracellular archaeal histone BOX B DNA HELICASE MCM8, DNA binding, ATP binding, 43777882: 19-1 Glyma.19g178600 DNA REPLICATION DNA replication, ATPase MCM2 F3 F5 family 43787553 LICENSING FACTOR activity 43791376: 19-1 Glyma.19g178700 . . . 43795718 30S RIBOSOMAL structural constituent of 276 43797832: Ribosomal protein S12 19-1 Glyma.19g178800 PROTEIN S12 FAMILY ribosome, translation,

43799750 FS23 MEMBER intracellular, ribosome 43801633: 19-1 Glyma.19g178900 . . . 43806525 43814184: (description unavailable), IQ calmodulin-binding 19-1 Glyma.19g179000 protein binding 43818649 NEUROMODULIN motif 43829624: FAMILY NOT NAMED, 19-1 Glyma.19g179200 . PPR repeat 43833356 (description unavailable) nucleic acid binding, ATP Helicase conserved C- 43833754: (description unavailable), binding, ATP-dependent 19-1 Glyma.19g179300 terminal domain, 43838961 FAMILY NOT NAMED helicase activity, helicase DEAD/DEAH box helicase activity Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 43845456 19-1 Glyma.19g179400 . . . 43846767 43867049: Protein of unknown function 19-1 Glyma.19g179800 . . 43868663 (DUF1685) 43869578: defense response, integral 19-1 Glyma.19g179900 . Mlo family 43876035 component of membrane RING FINGER DOMAIN- 43883518: metal ion binding, zinc ion Zinc finger, C3HC4 type 19-1 Glyma.19g180000 CONTAINING, (description 43892232 binding, protein binding (RING finger) unavailable) 43889521: 19-1 Glyma.19g180100 . . 43889847

277 43897578: SYNTAXIN, (description

19-1 Glyma.19g180200 protein binding SNARE domain 43902160 unavailable) 43924558: SERINE/THREONINE- 19-1 Glyma.19g180400 metal ion binding . 43927342 PROTEIN KINASE RIO structural constituent of 43937527: RIBOSOMAL PROTEIN 19-1 Glyma.19g180500 ribosome, translation, Ribosomal protein L13 43941752 L13 ribosome SUBFAMILY NOT 43944097: NAMED, DNAJ Tetratricopeptide repeat, 19-1 Glyma.19g180600 protein binding 43949261 HOMOLOG SUBFAMILY, DnaJ domain MEMBER 43949931: (description unavailable), 19-1 Glyma.19g180700 . Fasciclin domain 43951646 PERIOSTIN-RELATED Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam

43958456: (description unavailable), 19-1 Glyma.19g180800 protein binding WD domain, G-beta repeat 43964733 WD REPEAT PROTEIN MEMBRANE 43965433: ASSOCIATED RING Zinc finger, C3HC4 type 19-1 Glyma.19g180900 zinc ion binding 43970801 FINGER, (description (RING finger) unavailable) 43982433: 19-1 Glyma.19g181000 . . . 43984465 43985460: 19-1 Glyma.19g181100 MAHOGUNIN . . 43989205

278 LEUCINE-RICH REPEAT protein kinase activity, ATP

43993469: 19-1 Glyma.19g181200 RECEPTOR-LIKE binding, protein Protein kinase domain 43995676 PROTEIN KINASE phosphorylation 44013405: 19-1 Glyma.19g181400 . . . 44013878 44017168: 19-1 Glyma.19g181500 . . . 44017752 44023940: 19-1 Glyma.19g181600 . . . 44024116 44024142: 19-1 Glyma.19g181700 . . . 44024535 44032853: 19-1 Glyma.19g181800 . . Senescence regulator 44033980 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam regulation of transcription, AUX/IAA family, B3 DNA 44046183: DNA-templated, nucleus, 19-1 Glyma.19g181900 . binding domain, Auxin 44050281 DNA binding, response to response factor hormone ARGININE/DIAMINOPIM Pyridoxal-dependent ELATE/ORNITHINE decarboxylase, C-terminal 44062237: 19-1 Glyma.19g182000 DECARBOXYLASE, catalytic activity sheet domain, Pyridoxal- 44067639 GROUP IV dependent decarboxylase, DECARBOXYLASE pyridoxal binding domain 44074293: Possible lysine 19-1 Glyma.19g182100 . . 44078620 decarboxylase

279 44132739: SUGAR KINASE, pfkB family carbohydrate

19-1 Glyma.19g182400 . 44137801 ADENOSINE KINASE kinase 44140634: 19-1 Glyma.19g182500 . . . 44143366 44149020: 19-1 Glyma.19g182600 . . Auxin responsive protein 44149397 44154735: 19-1 Glyma.19g182700 . . . 44155630 TRANSLIN AND 44156119: sequence-specific DNA 19-1 Glyma.19g182800 TRANSLIN ASSOCIATED Translin family 44159926 binding PROTEIN X, TRANSLIN 44162660: 19-1 Glyma.19g182900 . . . 44163769 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam LEUCINE-RICH REPEAT RECEPTOR-LIKE protein kinase activity, ATP 44165449: 19-1 Glyma.19g183000 PROTEIN KINASE, U-BOX binding, protein Protein kinase domain 44169882 DOMAIN-CONTAINING phosphorylation PROTEIN 34-RELATED DNA binding, sequence- specific DNA binding transcription factor activity, Sigma-70, region 4, Sigma- 44175360 sigma factor activity, DNA- 19-1 Glyma.19g183100 . 70 region 2, Sigma-70 44181626 templated transcription, region 3 initiation, regulation of

280 transcription, DNA-

templated 44184808 19-1 Glyma.19g183200 . . DVL family 44185562 44189061 19-1 Glyma.19g183300 . . . 44190778 ATPase family associated with various cellular ATP binding, four-way activities (AAA), Cell junction helicase activity, 44200337: AAA-FAMILY ATPASE, division protein 48 19-1 Glyma.19g183400 DNA repair, DNA 44205116 (description unavailable) (CDC48), N-terminal recombination, ATPase domain, Cell division activity protein 48 (CDC48), domain 2 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 44208750: FAMILY NOT NAMED, Membrane magnesium 19-1 Glyma.19g183500 . 44211353 (description unavailable) transporter 44211501: 19-1 Glyma.19g183600 . . . 44215068 44217743: 19-1 Glyma.19g183700 . . Auxin responsive protein 44225659 44227904: 19-1 Glyma.19g183800 . . Auxin responsive protein 44228402 44238670: 19-1 Glyma.19g183900 . . Auxin responsive protein 44239216

281 44246080: 60S RIBOSOMAL 19-1 Glyma.19g184000 . . 44246438 PROTEIN L4

F13E7.9 PROTEIN- 44253254: RELATED, COPPER metal ion binding, metal ion Heavy-metal-associated 19-1 Glyma.19g184100 44255368 TRANSPORT PROTEIN transport domain ATOX1-RELATED GLYCOSYL 44262631: TRANSFERASE- transferase activity, Glycosyl transferase family 19-1 Glyma.19g184200 44265800 RELATED, (description transferring glycosyl groups 2 unavailable) Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam ATP binding, ATPase activity, ATPase activity, coupled to transmembrane ABC transporter 44282172: 19-1 Glyma.19g184300 FAMILY NOT NAMED movement of substances, transmembrane region, ABC 44289331 transport, transmembrane transporter transport, integral component of membrane 44296907: 19-1 Glyma.19g184400 . . . 44297657

282

44313863: MYB-LIKE DNA- Myb-like DNA-binding 19-1 Glyma.19g184500 chromatin binding 44315939 BINDING PROTEIN MYB domain

44328063: THIOREDOXIN, 19-1 Glyma.19g184600 cell redox homeostasis Thioredoxin 44330015 (description unavailable) methionine S- S-adenosylmethionine 44328250: adenosyltransferase activity, 19-1 Glyma.19g184700 ADENOSYLMETHIONINE synthetase, C-terminal 44328453 S-adenosylmethionine SYNTHETASE domain biosynthetic process Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam Phosphoadenosine FAD SYNTHETASE- Mo-molybdopterin cofactor phosphosulfate reductase 44331344: RELATED (FMN biosynthetic process, 19-1 Glyma.19g184800 family, Probable 44340234 ADENYLYLTRANSFERAS catalytic activity, metabolic molybdopterin binding E) process domain hydrolase activity, hydrolyzing O-glycosyl compounds, carbohydrate Glycosyl hydrolases family 44362160: metabolic process, 16, Xyloglucan endo- 19-1 Glyma.19g184900 . 44364929 xyloglucan:xyloglucosyl transglycosylase (XET) C- transferase activity, cellular terminus 283 glucan metabolic process,

cell wall, apoplast 44366371: 19-1 Glyma.19g185000 RFWD3 PROTEIN . . 44368114 43399778 19-1 Glyma.19g173700 . . . 43400423 43852811: FAMILY NOT NAMED, 19-1 Glyma.19g179500 . PLAC8 family 43855799 (description unavailable) (description unavailable), nucleic acid binding, zinc 43857979: Transcription factor S-II 19-1 Glyma.19g179600 DNA-DIRECTED RNA ion binding, transcription, 43859580 (TFIIS) POLYMERASE DNA-templated Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam DNA binding, regulation of 43860567: 19-1 Glyma.19g179700 . transcription, DNA- DNA binding protein S1FA 43862275 templated, nucleus DNA binding, regulation of 43905106: No apical meristem (NAM) 19-1 Glyma.19g180300 . transcription, DNA- 43907015 protein templated 44103207: 19-1 Glyma.19g182200 . . . 44104404 (description unavailable), 44118211: ammonia-lyase activity, 19-1 Glyma.19g182300 HISTIDINE AMMONIA- Aromatic amino acid lyase 44122192 biosynthetic process LYASE 284 hydrolase activity,

47525151: hydrolyzing O-glycosyl Cellulase (glycosyl 19-2 Glyma.19g223000 . 47530202 compounds, carbohydrate hydrolase family 5) metabolic process SUGAR-1-PHOSPHATE GUANYL TRANSFERASE, GLUCOSE-1-PHOSPHATE 47534912: nucleotidyltransferase 19-2 Glyma.19g223100 ADENYLYLTRANSFERAS Nucleotidyl transferase 47540592 activity, biosynthetic process E LARGE SUBUNIT 2, CHLOROPLASTIC- RELATED 47543256: 19-2 Glyma.19g223200 . . . 47554489 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam cysteine-type peptidase CYSTEINE PROTEASE activity, proteolysis, Peptidase family C1 47559538: 19-2 Glyma.19g223300 FAMILY C1-RELATED, cysteine-type endopeptidase propeptide, Papain family 47565331 CATHEPSIN B activity, regulation of cysteine protease catalytic activity 47570204: 19-2 Glyma.19g223400 WD40 REPEAT PROTEIN . WD domain, G-beta repeat 47583463 47584408: 19-2 Glyma.19g223500 . 47586022 nucleic acid binding, zinc ion Helicase conserved C- binding, ATP binding, ATP-

285 FAMILY NOT NAMED, terminal domain, GUCT 47587939: dependent helicase activity, 19-2 Glyma.19g223600 SUBFAMILY NOT (NUC152) domain, 47593545 helicase activity, DNA NAMED DEAD/DEAH box helicase, binding, hydrolase activity, Zinc knuckle RNA binding, nucleus ORGANIC SOLUTE 47596730: TRANSPORTER- Organic solute transporter 19-2 Glyma.19g223700 . 47601570 RELATED, (description Ostalpha unavailable) 47604792: 19-2 Glyma.19g223800 . . . 47605616 47609720: 19-2 Glyma.19g223900 . . . 47610445 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam GTPase activity, GTP binding, ferrous iron transmembrane transporter activity, ferrous iron Elongation factor Tu GTP TRANSLATION FACTOR, 47620374: transport, integral component binding domain, 19-2 Glyma.19g224000 PROTEIN F46B6.6, 47625859 of membrane, small GTPase Translation-initiation factor ISOFORM A mediated signal transduction, 2 intracellular, ATP binding, cellular biogenic amine metabolic process 47626692:

286 19-2 Glyma.19g224100 . . . 47629861

regulation of transcription, DNA-templated, detection of His Kinase A (phospho- visible light, protein- acceptor) domain, Histidine TWO-COMPONENT chromophore linkage, kinase-, DNA gyrase B-, 47633059: SENSOR HISTIDINE 19-2 Glyma.19g224200 phosphorelay sensor kinase and HSP90-like ATPase, 47641958 KINASE, (description activity, signal transduction, GAF domain, PAS fold, unavailable) membrane, protein binding, PAS fold, Phytochrome ATP binding, signal region transducer activity 47645626: 19-2 Glyma.19g224300 . nutrient reservoir activity Cupin 47647217 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam NITRATE TRANSPORTER 47655610: 1.2, OLIGOPEPTIDE transporter activity, 19-2 Glyma.19g224400 POT family 47660246 TRANSPORTER- transport, membrane RELATED 47664635: (description unavailable), 19-2 Glyma.19g224500 . Pectinacetylesterase 47670007 NOTUM-RELATED MYB-LIKE DNA- 47679177: BINDING PROTEIN MYB, Myb-like DNA-binding 19-2 Glyma.19g224600 chromatin binding 47681818 MYB TRANSCRIPTION domain FACTOR (description unavailable),

287 BASIC HELIX-LOOP- 47691501: Helix-loop-helix DNA-

19-2 Glyma.19g224700 HELIX FLEUCINE ZIPPER protein dimerization activity 47696511 binding domain TRANSCRIPTION FACTOR 47700978: 19-2 Glyma.19g224800 . . . 47703010 47714557: 19-2 Glyma.19g224900 . . . 47715599 47716835: 19-2 Glyma.19g225000 . . . 47722268 47721119: VEFS-Box of polycomb 19-2 Glyma.19g225100 . . 47723376 protein 47728252: 19-2 Glyma.19g225200 . . . 47728800 Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 47732671: 19-2 Glyma.19g225300 . . . 47734730 ZINC FINGER- G-patch domain, Zinc-finger 47738977: 19-2 Glyma.19g225400 CONTAINING, (description nucleic acid binding double-stranded RNA- 47743292 unavailable) binding Saposin-like type B, region aspartic-type endopeptidase 47743727: (description unavailable), 2, Eukaryotic aspartyl 19-2 Glyma.19g225500 activity, proteolysis, lipid 47748610 ASPARTYL PROTEASES protease, Saposin-like type metabolic process B, region 1 (description unavailable), 47750947: 19-2 Glyma.19g225600 CYSTEINE metabolic process Aminotransferase class-V

288 47753958 DESULFURYLASE

PHOSPHOENOLPYRUVA pectinesterase activity, cell Pectinesterase, Plant 47756301: 19-2 Glyma.19g225700 TE DIKINASE-RELATED, wall modification, cell wall, invertase/pectin 47758811 (description unavailable) enzyme inhibitor activity methylesterase inhibitor LIMKAIN B (LKAP), 47760247: 19-2 Glyma.19g225800 MEIOSIS ARREST . NYN domain 47764888 FEMALE PROTEIN 1 47767305: (description unavailable), 19-2 Glyma.19g225900 . X8 domain 47770626 FAMILY NOT NAMED (description unavailable), 47773367: INTERLEUKIN-1 Domain of unknown 19-2 Glyma.19g226000 . 47780678 RECEPTOR-ASSOCIATED function (DUF3635) KINASE Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam 47787869: ATP-CITRATE 19-2 Glyma.19g226100 . . 47790275 SYNTHASE Cytochrome b5-like 50217887: 19-3 Glyma.19g258500 CYTOCHROME B5 heme binding Heme/Steroid binding 50222920 domain iron ion binding, electron carrier activity, oxidoreductase activity, 50232126: FAMILY NOT NAMED, acting on paired donors, 19-3 Glyma.19g258700 Cytochrome P450 50234284 (description unavailable) with incorporation or reduction of molecular

289 oxygen, heme binding,

oxidation-reduction process 50260963: 19-3 Glyma.19g258800 . . Auxin responsive protein 50261686 50269554: (description unavailable), RhoGAP domain, P21-Rho- 19-3 Glyma.19g258900 signal transduction 50273566 MKIAA1688 PROTEIN binding domain 50279552: 19-3 Glyma.19g259000 . . . 50280343 50285165: 19-3 Glyma.19g259100 . . . 50286526 RNA recognition motif. 50287876: FAMILY NOT NAMED, 19-3 Glyma.19g259200 nucleic acid binding (a.k.a. RRM, RBD, or RNP 50294885 ELAV-LIKE PROTEIN 2 domain) Continued

Table F.1. Continued QTL Gene IDa Start:End Panther GO Pfam UDP-N-acetylmuramate dehydrogenase activity, oxidoreductase activity, (description unavailable), FAD binding domain, D- 50296772: flavin adenine dinucleotide 19-3 Glyma.19g259300 GULONOLACTONE arabinono-1,4-lactone 50300441 binding, oxidation-reduction OXIDASE oxidase process, D-arabinono- 1%2C4-lactone oxidase activity, membrane

290

Appendix G. Genes associated with QTL conferring resistance to Pythium irregulare and/or Fusarium graminearum from chapter 2

291

QTL Gene IDa Start:End Panther GO pfam Pythium irregulare

1615784: 14 Glyma.14g022700 . . . 1617090 COMPLEMENT COMPONENT 1, COMPLEMENT 1619376: Mitochondrial 14 Glyma.14g022800 COMPONENT 1 Q mitochondrial matrix 1621423 glycoprotein SUBCOMPONENT- BINDING PROTEIN, MITOCHONDRIAL (description unavailable), F-

292 1622349: 14 Glyma.14g022900 BOX/LEUCINE RICH . . 1626842 REPEAT PROTEIN (description unavailable), 1630530: GERANYLGERANYL 14 Glyma.14g023000 . . 1631856 PYROPHOSPHATE SYNTHASE 1639233: 14 Glyma.14g023100 . . Senescence regulator 1640841 Continued aGene name, starting and ending physical location (bp), and panther, GO term, and pfam information from assembly Wm82.a2.v1 (SoyBase)

Table G.1. Genes between flanking markers of quantitative trait loci (QTL) conferring resistance to Pythium irregulare and Fusarium graminearum in a Conrad x Sloan F9:11 recombinant inbred line (RIL) population.

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 1650823: protein binding, Golgi vesicle SNARE domain, 14 Glyma.14g023200 SYNTAXIN 1654542 transport, membrane Syntaxin 6, N-terminal EUKARYOTIC 1656550: TRANSLATION translation initiation factor Translation initiation 14 Glyma.14g023300 1657752 INITIATION FACTOR activity, translational initiation factor SUI1 SUI1 1661351: Domain of unknown 14 Glyma.14g023400 . . 1661983 function (DUF313)

SERINE/THREONINE- calcium ion binding, protein 1669047: Protein kinase domain,

293 14 Glyma.14g023500 PROTEIN KINASE, kinase activity, ATP binding, 1673690 EF hand (description unavailable) protein phosphorylation

1691809: TRANSLATION Endoribonuclease L- 14 Glyma.14g023600 . 1693795 INITIATION INHIBITOR PSP 1698258: HIV-INDUCED PROTEIN- OTU-like cysteine 14 Glyma.14g023700 . 1703173 7-LIKE PROTEASE protease METHIONINE SULFOXIDE peptide-methionine (S)-S-oxide 1707404: REDUCTASE, Peptide methionine 14 Glyma.14g023900 reductase activity, oxidation- 1710941 MITOCHONDRIAL sulfoxide reductase reduction process PEPTIDE METHIONINE SULFOXIDE REDUCTASE Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 1708107: 14 Glyma.14g023800 . . . 1708262 1718621: 14 Glyma.14g024000 . . . 1723131 1724080: 14 Glyma.14g024100 . . . 1727463 HEAT SHOCK PROTEIN 1727864: 14 Glyma.14g024200 70KDA, (description . Hsp70 protein 1733875 unavailable) nucleic acid binding, ATP Helicase conserved C- 1740362: (description unavailable), 14 Glyma.14g024300 binding, ATP-dependent helicase terminal domain,

294 1745905 FAMILY NOT NAMED activity, helicase activity DEAD/DEAH box helicase

PH DOMAIN LEUCINE- RICH REPEAT- 1746860: CONTAINING PROTEIN protein binding, signal 14 Glyma.14g024400 TIR domain 1749862 PHOSPHATASE 1, transduction LEUCINE-RICH REPEAT- CONTAINING PROTEIN (description unavailable), 1751063: protein binding, signal 14 Glyma.14g024500 LEUCINE-RICH REPEAT- TIR domain 1753753 transduction CONTAINING PROTEIN U3 small nucleolar RNA- 1755937 14 Glyma.14g024600 BAP28 . associated protein 10, 1778895: BP28CT (NUC211) domain Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 1781035: ACID PHOSPHATASE Calcineurin-like 14 Glyma.14g024700 hydrolase activity 1783960 RELATED phosphoesterase 1785084: 14 Glyma.14g024800 UNCHARACTERIZED . DTW domain 1786355 1787388: TRANSMEMBRANE Transmembrane proteins 14 Glyma.14g024900 membrane 1790125 PROTEIN 14, 15 14C 1787953: 14 Glyma.14g025000 . . . 1788236 1791899: 14 Glyma.14g025100 . . . 1797356 295 LEUCINE-RICH REPEAT

RECEPTOR-LIKE PROTEIN KINASE, LRR RECEPTOR- 1802636: protein kinase activity, ATP 14 Glyma.14g025200 LIKE Protein kinase domain 1810623 binding, protein phosphorylation SERINE/THREONINE- PROTEIN KINASE RLK- RELATED DNA binding, DNA-directed DNA polymerase activity, DNA 1813641: replication, nucleic acid binding, 3'-5' exonuclease, DNA 14 Glyma.14g025300 DNA POLYMERASE I 1823920 3’-5’ exonuclease activity, polymerase family A nucleobase-containing compound metabolic process Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 1827049: 14 Glyma.14g025400 . . . 1830067 1828278: 14 Glyma.14g025500 . . . 1829575 1832540: CHLOROPLASTIC 14 Glyma.14g025600 . Lipocalin-like domain 1835527 LIPOCALIN, LIPOCALIN GTP binding, small GTPase 1842057: FAMILY NOT NAMED, 14 Glyma.14g025700 mediated signal transduction, Miro-like protein 1844953 (description unavailable) intracellular Triose-phosphate 1849711: SOLUTE CARRIER membrane, transmembrane 296 14 Glyma.14g025800 Transporter family, EamA- 1854842 FAMILY 35 transport

like transporter family SMALL NUCLEAR 1859249: RIBONUCLEOPROTEIN- 14 Glyma.14g025900 . LSM domain 1863710 ASSOCIATED PROTEIN B AND N KIN17 (KIN, ANTIGENIC KOW motif, Domain of 1865361: 14 Glyma.14g026000 DETERMINANT OF RECA . Kin17 curved DNA-binding 1867519 PROTEIN HOMOLOG) protein HEAT SHOCK PROTEIN 1869973: 22-RELATED, SMALL Hsp20/alpha crystallin 14 Glyma.14g026100 . 1873593 HEAT-SHOCK PROTEIN family (HSP20) FAMILY Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam GDSL/SGNH-like Acyl- 1876584: FAMILY NOT NAMED, Esterase family found in 14 Glyma.14g026200 . 1881789 (description unavailable) Pmr5 and Cas1p (original Pfam: PF03005) (description unavailable), Di-glucose binding within protein kinase activity, ATP 1887286: LEUCINE-RICH REPEAT endoplasmic reticulum, 14 Glyma.14g026300 binding, protein phosphorylation, 1898057 RECEPTOR-LIKE PROTEIN Leucine Rich Repeat, Protein protein binding KINASE kinase domain transferase activity, transferring acyl groups, acyl groups 1899269: 297 14 Glyma.14g026400 CITRATE SYNTHASE converted into alkyl on transfer, Citrate synthase 1904627

cellular carbohydrate metabolic process protein kinase activity, ATP binding, protein phosphorylation, oxidoreductase activity, oxidoreductase activity, acting LEUCINE-RICH REPEAT on paired donors, with 2OG-Fe(II) oxygenase 1906384: RECEPTOR-LIKE PROTEIN 14 Glyma.14g026500 incorporation or reduction of superfamily, Protein tyrosine 1909125 KINASE, SUBFAMILY NOT molecular oxygen, 2- kinase NAMED oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidation-reduction process Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam methyltransferase activity, lipid HEXAPRENYLDIHYDROX biosynthetic process, protein 1908407: 14 Glyma.14g026600 YBENZOATE methyltransferase activity, protein Methyltransferase domain 1912887 METHYLTRANSFERASE methylation, cytoplasm, metabolic process SERINE-THREONINE protein binding, protein kinase 1915319: Ankyrin repeat, Protein 14 Glyma.14g026700 PROTEIN KINASE, activity, ATP binding, protein 1921138 kinase domain (description unavailable) phosphorylation 1926782: hAT family C-terminal 14 Glyma.14g026800 . . 1929521 dimerisation region 1937125:

298 14 Glyma.14g026900 . . . 1945520

1946463: HVA22-LIKE PROTEINS, 14 Glyma.14g027000 . TB2/DP1, HVA22 family 1947909 (description unavailable) 50S/60S RIBOSOMAL 1949772: PROTEIN L14/L23, 54S structural constituent of ribosome, Ribosomal protein 14 Glyma.14g027100 1950078 RIBOSOMAL PROTEIN translation, ribosome L14p/L23e L38, MITOCHONDRIAL SRF-type transcription factor 1967656: (description unavailable), DNA binding, protein 14 Glyma.14g027200 (DNA-binding and 1971891 MADS BOX PROTEIN dimerization activity dimerisation domain) sequence-specific DNA binding 1975415: (description unavailable), transcription factor activity, 14 Glyma.14g027300 K-box region 1977737 MADS BOX PROTEIN regulation of transcription, DNA- templated, nucleus Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam GLYCOSYLTRANSFERAS E 8 DOMAIN- 1980146: CONTAINING PROTEIN 2, transferase activity, transferring 14 Glyma.14g027400 Glycosyl transferase family 8 1986546 GLYCOSYLTRANSFERAS glycosyl groups E 8 DOMAIN- CONTAINING PROTEIN 1994150: 14 Glyma.14g027500 . . . 1995960 iron ion binding, electron carrier activity, oxidoreductase activity, LANOSTEROL 14-ALPHA 2004420: acting on paired donors, with

299 14 Glyma.14g027600 DEMETHYLASE, FAMILY Cytochrome P450 2006136 incorporation or reduction of NOT NAMED molecular oxygen, heme binding, oxidation-reduction process hydrolase activity, hydrolyzing O-glycosyl compounds, Xyloglucan endo- GLYCOSYL HYDROLASE- carbohydrate metabolic process, 2010502: transglycosylase (XET) C- 14 Glyma.14g027700 RELATED, (description xyloglucan:xyloglucosyl 2012080 terminus, Glycosyl unavailable) transferase activity, cellular hydrolases family 16 glucan metabolic process, cell wall, apoplast 2013874: 14 Glyma.14g027800 . . . 2017378 2019174: 14 Glyma.14g027900 . . . 2021899 Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 2025377: 14 Glyma.14g028000 . . . 2027067 protein kinase activity, ATP binding, protein phosphorylation, MITOGEN-ACTIVATED 2031357: phosphotransferase activity, 14 Glyma.14g028100 PROTEIN KINASE, Protein kinase domain 2041238 alcohol group as acceptor, (description unavailable) lipopolysaccharide biosynthetic process, membrane DNA primase activity, DNA 2046878: DNA PRIMASE SMALL Eukaryotic and archaeal 14 Glyma.14g028200 replication, synthesis of RNA 2051456 SUBUNIT DNA primase small subunit primer 300 2056435: ANCIENT UBIQUITOUS transferase activity, transferring 14 Glyma.14g028300 Acyltransferase 2059029 PROTEIN acyl groups, metabolic process 2064330: (description unavailable), 14 Glyma.14g028400 . X8 domain 2068248 FAMILY NOT NAMED 2071718: SUBFAMILY NOT NAMED, 14 Glyma.14g028500 . PPR repeat 2075143 FAMILY NOT NAMED 2074152: Domain of unknown 14 Glyma.14g028600 . . 2074901 function (DUF296) (description unavailable), 2088047: 14 Glyma.14g028700 POTASSIUM CHANNEL, . Ion channel 2090527 SUBFAMILY K 2090742: 14 Glyma.14g028800 . . . 2094246 Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam sequence-specific DNA binding transcription factor activity, 2102301: WRKY DNA -binding 14 Glyma.14g028900 . sequence-specific DNA binding, 2105264 domain regulation of transcription, DNA- templated (description unavailable), 2118098: LEUCINE-RICH REPEAT protein kinase activity, ATP 14 Glyma.14g029000 Protein kinase domain 2123712 RECEPTOR-LIKE PROTEIN binding, protein phosphorylation KINASE Sucrose-6F-phosphate (description unavailable),

301 2126633: biosynthetic process, sucrose phosphohydrolase, Glycosyl 14 Glyma.14g029100 GLYCOSYLTRANSFERAS 2133000 metabolic process transferases group 1, Sucrose E synthase Fusarium graminearum

2405393: SUBFAMILY NOT NAMED, 14 Glyma.14g033200 . . 2413069 FAMILY NOT NAMED BADF TYPE ATPASE 2415369: BadF/BadG/BcrA/BcrD 14 Glyma.14g033300 DOMAIN-CONTAINING . 2421027 ATPase family PROTEIN nucleic acid binding, ATP Helicase conserved C- 2422873: SUBFAMILY NOT NAMED, 14 Glyma.14g033400 binding, ATP-dependent helicase terminal domain, 2427873 FAMILY NOT NAMED activity, helicase activity DEAD/DEAH box helicase Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam LEUCINE-RICH REPEAT Protein kinase domain, protein kinase activity, ATP 2436598: RECEPTOR-LIKE PROTEIN Leucine Rich Repeat, 14 Glyma.14g033500 binding, protein phosphorylation, 2441165 KINASE, (description Leucine rich repeat N- protein binding unavailable) terminal domain CHROMODOMAIN- HELICASE-DNA-BINDING SNF2 family N-terminal PROTEIN 1, SWI/SNF- DNA binding, ATP binding, domain, Helicase conserved 2445694: RELATED MATRIX- 14 Glyma.14g033600 nucleic acid binding, helicase C-terminal domain, Chromo 2466124 ASSOCIATED ACTIN- activity (CHRromatin Organisation DEPENDENT REGULATOR MOdifier) domain OF CHROMATIN 302 SUBFAMILY-RELATED

magnesium ion transmembrane 2472243: Magnesium transporter 14 Glyma.14g033700 UNCHARACTERIZED transporter activity, magnesium 2477533 NIPA ion transport, membrane 2474352: 14 Glyma.14g033800 . . . 2475051 TETRATRICOPEPTIDE 2478741: 14 Glyma.14g033900 REPEAT PROTEIN 11 (TPR . . 2480857 REPEAT PROTEIN 11) 2482399: 14 Glyma.14g034000 . . . 2484675 transferase activity C transferring 2485439: 14 Glyma.14g034100 . acyl groups other than amino-acyl Transferase family 2487656 groups Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam FYVE zinc finger, Regulator REGULATOR OF of chromosome condensation 2493571: CHROMOSOME 14 Glyma.14g034200 metal ion binding (RCC1) repeat, Transcription 2501952 CONDENSATION, factor regulating root and (description unavailable) shoot growth via Pin3 sequence-specific DNA binding transcription factor activity, 2513025: FAMILY NOT NAMED, 14 Glyma.14g034300 sequence-specific DNA binding, Homeobox domain 2521114 (description unavailable) regulation of transcription, DNA- templated, DNA binding 2523336:

303 14 Glyma.14g034400 FAMILY NOT NAMED . PPR repeat 2525277

2526887: 14 Glyma.14g034500 . . . 2527045 2534878: Domain of unknown 14 Glyma.14g034600 THAP4 PROTEIN . 2535711 function (DUF1794) 2539264: 14 Glyma.14g034700 . . . 2540225 2568463: Domain of unknown 14 Glyma.14g034800 . . 2571366 function (DUF702) 2586183: 14 Glyma.14g034900 . protein binding C2 domain 2588612 2598246: 14 Glyma.14g035000 . . . 2598473 Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 2610983: 14 Glyma.14g035100 . . . 2616082 SMG-7 (SUPPRESSOR 2619429: WITH MORPHOLOGICAL 14 Glyma.14g035200 . . 2623582 EFFECT ON GENITALIA PROTEIN 7) CGI-141-RELATED 2623312: FLIPASE CONTAINING 14 Glyma.14g035300 vesicle-mediated transport Got1/Sft2-like family 2627371 PROTEIN, (description unavailable) 2628946: RHO/RAC/CDC GTPASE- protein binding, phospholipid RhoGAP domain, PH 304 14 Glyma.14g035400 2641489 ACTIVATING PROTEIN binding, signal transduction domain

2652308: SNARE PROTEINS, vesicle-mediated transport, 14 Glyma.14g035500 Synaptobrevin 2655588 SUBFAMILY NOT NAMED integral component of membrane

2660613: 14 Glyma.14g035600 . . . 2665713 PEPTIDYL-PROLYL CIS- TRANS ISOMERASE 2667029: Rhodanese-like domain, 14 Glyma.14g035700 NIMA-INTERACTING 1, isomerase activity 2670588 PPIC-type PPIASE domain PEPTIDYL-PROLYL CIS- TRANS ISOMERASE Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam calcium ion binding, protein kinase activity, ATP binding, (description unavailable), protein phosphorylation, 2672381: EF hand, Protein kinase 14 Glyma.14g035800 SERINE/THREONINE- phosphotransferase activity, 2676894 domain PROTEIN KINASE alcohol group as acceptor, lipopolysaccharide biosynthetic process, membrane RNA recognition motif. 2677421: PRE-MRNA BRANCH SITE 14 Glyma.14g035900 nucleic acid binding (a.k.a. RRM, RBD, or RNP 2678295 PROTEIN domain) AMINOHYDROLASE,

305 2678945: 14 Glyma.14g036000 COLLAPSIN RESPONSE hydrolase activity Amidohydrolase family 2685696 MEDIATOR PROTEIN 2686475: 14 Glyma.14g036100 UNCHARACTERIZED . Las1-like 2694769 sequence-specific DNA binding HEAT SHOCK transcription factor activity, 2700412: TRANSCRIPTION 14 Glyma.14g036200 sequence-specific DNA binding, HSF-type DNA-binding 2701958 FACTOR, (description regulation of transcription, DNA- unavailable) templated, nucleus 2718560: 14 Glyma.14g036300 . protein binding F-box domain 2723283 2723599: Protein of unknown function 14 Glyma.14g036400 . . 2725248 (DUF1645) Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 2730030: 14 Glyma.14g036500 . . . 2731670 PROTEIN Y71G12B.10, 2738624: 14 Glyma.14g036600 HOMOCITRATE catalytic activity HMGL-like 2743169 SYNTHASE-RELATED 2747392: 14 Glyma.14g036700 . . . 2751118 (description unavailable), 2752036: TRANSLATIONAL 14 Glyma.14g036800 . . 2776640 ACTIVATOR GCN1- RELATED 306 Pythium irregulare and Fusarium graminearum

47787869: 19-2 Glyma.19g226100 ATP-CITRATE SYNTHASE . . 47790275 Sec23/Sec24 zinc finger, zinc ion binding, intracellular Sec23/Sec24 helical domain, 47794828: protein transport, ER to Golgi 19-2 Glyma.19g226200 SEC24-RELATED PROTEIN Sec23/Sec24 trunk domain, 47804528 vesicle-mediated transport, COPII Sec23/Sec24 beta-sandwich vesicle coat domain hydrolase activity, hydrolyzing 47809233: Cellulase (glycosyl 19-2 Glyma.19g226300 . O-glycosyl compounds, 47812801 hydrolase family 5) carbohydrate metabolic process 47817293: GLYCOGEN SYNTHASE protein kinase activity, ATP 19-2 Glyma.19g226400 Protein kinase domain 47821871 KINASE-3 ALPHA binding, protein phosphorylation Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 47823250: polygalacturonase activity, Glycosyl hydrolases family 19-2 Glyma.19g226500 . 47825956 carbohydrate metabolic process 28 PROTEASE FAMILY C15 47829848: 19-2 Glyma.19g226600 PYROGLUTAMYL- proteolysis Pyroglutamyl peptidase 47833331 PEPTIDASE I-RELATED glucose-6-phosphate Glucose-6-phosphate GLUCOSE-6-PHOSPHATE dehydrogenase activity, NADP dehydrogenase, NAD 47838450: 19-2 Glyma.19g226700 1-DEHYDROGENASE binding, glucose metabolic binding domain, Glucose-6- 47844119 (G6PD) process, oxidation-reduction phosphate dehydrogenase, C- process terminal domain 307 47848956: 19-2 Glyma.19g226800 . . . 47849926 ZINC FINGER FYVE 47852651: DOMAIN CONTAINING hydrolase activity, acting on ester GDSL-like 19-2 Glyma.19g226900 47856677 PROTEIN, (description bonds, lipid metabolic process Lipase/Acylhydrolase unavailable) 47858945: EamA-like transporter 19-2 Glyma.19g227000 . membrane 47863452 family protein binding, protein Armadillo/beta-catenin-like 47870228: transporter activity, protein 19-2 Glyma.19g227100 IMPORTIN ALPHA repeat, Importin beta binding 47873988 import into nucleus, nucleus, domain cytoplasm 47875846: Armadillo/beta-catenin-like 19-2 Glyma.19g227200 IMPORTIN ALPHA protein binding 47879326 repeat Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam Alkaline and neutral 47882570: glycopeptide alpha-N- 19-2 Glyma.19g227300 . invertase (original Pfam: 47886680 acetylgalactosaminidase activity PF04853) calcium ion binding, photosynthesis, photosystem II, 47886634: 19-2 Glyma.19g227400 . photosystem II oxygen evolving PsbP 47890427 complex, extrinsic component of membrane protein binding, intracellular CLATHRIN COAT 47891160: protein transport, vesicle- Adaptor complexes medium 19-2 Glyma.19g227500 ASSEMBLY PROTEIN, 47894363 mediated transport, clathrin subunit family

308 CARMINE adaptor complex

47896454: Eukaryotic protein of 19-2 Glyma.19g227600 UNCHARACTERIZED integral component of membrane 47899501 unknown function (DUF846) catalytic activity, coenzyme binding, cellular metabolic NAD DEPENDENT process, dTDP-4- NAD dependent 47899995: 19-2 Glyma.19g227700 EPIMERASE/DEHYDRATA dehydrorhamnose reductase epimerase/dehydratase 47904214 SE, (description unavailable) activity, extracellular family polysaccharide biosynthetic process 47911130: GLYCOGENIN, (description transferase activity, transferring 19-2 Glyma.19g227800 Glycosyl transferase family 8 47914214 unavailable) glycosyl groups 47916289: EamA-like transporter 19-2 Glyma.19g227900 . membrane 47919829 family Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 47930256: 19-2 Glyma.19g228000 . . . 47930804 antioxidant activity, Redoxin, NHL repeat, 47938072: (description unavailable), oxidoreductase activity, 19-2 Glyma.19g228100 haloacid dehalogenase-like 47953946 FAMILY NOT NAMED oxidation-reduction process, hydrolase protein binding 47963153: KELCH REPEAT DOMAIN, 19-2 Glyma.19g228200 protein binding Kelch motif, Kelch motif 47967577 (description unavailable) sequence-specific DNA binding (description unavailable), transcription factor activity, KNOX1 domain, Homeobox 47976989: HOMEOBOX PROTEIN

309 19-2 Glyma.19g228300 sequence-specific DNA binding, domain, ELK domain, 47982973 TRANSCRIPTION regulation of transcription, DNA- KNOX2 domain FACTORS templated, DNA binding, nucleus RNA-BINDING PROTEIN nicotianamine synthase activity, 47988378: Nicotianamine synthase 19-2 Glyma.19g228400 RELATED, (description nicotianamine biosynthetic 47989791 protein unavailable) process 47997925: 19-2 Glyma.19g228500 . . . 48000057 PEPTIDE CHAIN RELEASE translation release factor activity, 48000735: FACTOR, CLASS I translational termination, 19-2 Glyma.19g228600 PCRF domain, RF-1 domain 48004293 PEPTIDE CHAIN RELEASE translation release factor activity, FACTOR codon specific, cytoplasm 48006704: Universal stress protein 19-2 Glyma.19g228700 . response to stress 48008482 family Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam ADP RIBOSYLATION GTP binding, small GTPase 48009870: ADP-ribosylation factor 19-2 Glyma.19g228800 FACTOR-RELATED, mediated signal transduction, 48011866 family RE74312P intracellular ZINC FINGER MATRIN- TYPE PROTEIN 3, 48014375: Zinc-finger double-stranded 19-2 Glyma.19g228900 DOUBLE-STRANDED . 48017818 RNA-binding RNA-BINDING ZINC FINGER PROTEIN Endoplasmic reticulum 48020454: PROTEIN DISULFIDE cell redox homeostasis, 19-2 Glyma.19g229000 protein ERp29 C C-terminal 48024426 ISOMERASE endoplasmic reticulum domain, Thioredoxin 310 48027866: Protein of unknown function 19-2 Glyma.19g229100 . . 48030958 (DUF1645) PHOSPHATIDYLINOSITOL N- ACETYLGLUCOSAMINYL 48032567: TRANSFERASE SUBUNIT 19-2 Glyma.19g229200 . . 48037246 P (DOWN SYNDROME CRITICAL REGION PROTEIN 5)-RELATED, (description unavailable) 48040690: Domain of unknown 19-2 Glyma.19g229300 . . 48041028 function (DUF3511) 48048375: Calmodulin binding protein- 19-2 Glyma.19g229400 . . 48052530 like Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 48059444: Calmodulin binding protein- 19-2 Glyma.19g229500 . . 48063147 like GENERAL TRANSCRIPTION FACTOR 48064703: 19-2 Glyma.19g229600 2-RELATED ZINC FINGER . . 48067937 PROTEIN, (description unavailable) 48069220: FAMILY NOT NAMED, 19-2 Glyma.19g229700 . DnaJ domain 48070638 (description unavailable) protein binding, protein Armadillo/beta-catenin-like 48072274: transporter activity, protein

311 19-2 Glyma.19g229800 IMPORTIN ALPHA repeat, Importin beta binding 48078300 import into nucleus, nucleus, domain cytoplasm sequence-specific DNA binding TRANSCRIPTION FACTOR transcription factor activity, zinc 48081061: 19-2 Glyma.19g229900 GATA (GATA BINDING ion binding, sequence-specific GATA zinc finger 48081390 FACTOR) DNA binding, regulation of transcription, DNA-templated THREE PRIME REPAIR 48084644: 19-2 Glyma.19g230000 EXONUCLEASE 1, 2, . Exonuclease 48087743 (description unavailable) microtubule motor activity, ATP Calponin homology (CH) 48093731: (description unavailable), binding, microtubule binding, 19-2 Glyma.19g230100 domain, Kinesin motor 48099790 FAMILY NOT NAMED microtubule-based movement, domain protein binding Continued

Table G.1. Continued QTL Gene IDa Start:End Panther GO pfam 48103324: PROTEIN PHOSPHATASE 19-2 Glyma.19g230200 catalytic activity Protein phosphatase 2C 48106756 2C, (description unavailable) 48114507: 19-2 Glyma.19g230300 . polysaccharide binding . 48115561 hydrolase activity, hydrolyzing 48120978: Glycosyl hydrolases family 19-2 Glyma.19g230400 . O-glycosyl compounds, 48121737 16 carbohydrate metabolic process 48122051: (description unavailable), 19-2 Glyma.19g230500 protein binding WD domain, G-beta repeat 48131530 WD40 REPEAT PROTEIN 48140101: PROTEIN PHOSPHATASE 19-2 Glyma.19g230600 catalytic activity Protein phosphatase 2C

312 48144083 2C, (description unavailable)

Appendix H. Protocol for inoculating soybean with the tray assay

Preparation

1. Begin starter plate of Phytophthora isolate(s) 2. Weigh out seeds of soybean lines (If not in packets already) 3. Make lima bean agar plates (plastic plates with 12g agar), if using mycelia inoculation method. Make non-clarified V8 plates if using zoospore inoculation method.

Week One: Day one

1. Label cups (16 oz. Styrofoam) with soybean lines (it is not necessary to make stakes unless you are considering multiple treatments). This can be done earlier. 2. Be sure to include cups for necessary checks. Standard checks are OX-20 (susceptible), Sloan (mildly susceptible), and Conrad (resistant). 3. Fill cups with ⅓ coarse vermiculite, then with fine vermiculite up to the line near the top 4. Water cups with DI water until vermiculite appears saturated. Let cups sit overnight so vermiculite absorbs water (if time does not permit, this can be done the same day as planting). 5. Recommended: to prevent contamination and drying out, seal all plates with Parafilm and place them in a plastic bag.

313

Week One: Day two

1. Start inoculum plates. For Phytophthora mycelia inoculation use lima bean plates. You will need about 1 plate for every 5 trays (but it never hurts to make a few extra). Also make 1 starter plate to have on hand. Keep plates in incubator at 24- 25οC. It may be necessary to start culture sooner, depending on the isolate. 2. Plant 20 seeds per cup. 3. Cover seeds with coarse vermiculite and water with DI water. Finished cups should resemble figure one.

Figure H.1. Styrofoam cup set-up for tray test. Fill bottom ⅓ with coarse vermiculite (there is a line inside the cup that becomes visible near the bottom once some vermiculite has been added). Then add fine vermiculite to line near the top of the cup. Place 20 seeds on top of fine vermiculite. Cover seeds with coarse vermiculite.

Week One: Day three or four

1. Check plate for contamination. Start new plates if contamination occurs. 2. Check to make sure that seeds are still covered with coarse vermiculite. Re-cover seeds as needed.

Week Two: Day one (at least one day before inoculation)

1. Randomize lines for each rep. Checks can be included in randomization (recommended).

314

2. Label trays with soybean line and randomization number (Note: only include the line if the study is not blind, which will occur most of the time). 3. The night before inoculation, fill bottom third of buckets with water and add one capful of bleach. Let sit overnight.

Week Two: Day two (7 days after planting)-seedling prep

1. Remove seedlings from cups. Wash vermiculite off of roots with tap water. Wrap seedlings in a damp paper towel. 2. Dump remaining vermiculite out of cups into a large autoclave bag. Rinse cups if reusing them. 3. Place paper towel containing seedlings back inside cup for easy identification of soybean line (if stakes were not used). If stakes were used, wrap stake in paper towel with seedlings.

Week Two: Day two-inoculation

You will need:  2 tubs filled with DI water  1 large syringe and 2 small syringes per isolate  Labeled trays  Thick cotton pad (one per tray)  Thin cotton/polyester cloths (one per tray)  Inoculum plates  Washed soybean seedlings  Scalpel  Spreader/large spatula  Small plastic cup 1. Pour bleach water out of buckets. Rinse buckets and add 2 L of DI water to each one. 315

2. Lay out trays (Recommended: stack trays by line and place stacks in order by rep) 3. Wet thick cotton pad and cotton/polyester cloth with DI water. 4. Place the cotton pad lengthwise on the tray. Be sure to line up the end of the pad with the cut, flat edge of the tray. 5. Place the cotton cloth lengthwise on top of the pad. Line up one end of the cloth with the end of the pad and the cut, flat edge of the tray. Leave the bottom half of the cloth folded up at the opposite end of the tray. 6. Lay out eight to ten seedlings on top of the cloth. Seedlings should be about the same height. Line up seedlings so their crowns are level with each other. Cotyledons should hang over the cut, flat edge of the tray. 7. Lightly scratch each seedling about 2 cm below the crown with an ethanol sterilized scalpel. Scratches need to be long enough for proper inoculation and shallow enough that they do not expose the stele. Deep cuts can speed up the infection process. To maintain consistency, the same person should scratch all the seedlings. 8. Using the spreader, transfer lima bean agar with inoculum from plate to large syringe. Push mycelia through large syringe into smaller syringes. 9. Using a small syringe, place enough inoculum over the scratch to cover it. Once all seedlings’ scratches are covered with inoculum, fold the bottom half of the cotton cloth over the seedlings. Use the plastic cup to pour a little bit of DI water over the cloth-covered seedlings. Repeat for all trays in the rep. 10. Stack trays of inoculated seedlings according to the randomized order for each rep. Place an empty tray on the top of the stack to protect the seedlings in the first tray. If necessary, use a large rubber band to hold trays together. Note: for large amounts of trays (18 or more), do not use large rubber bands as this could crush the seedlings. If necessary, use empty trays to fill in the space in the bucket, so seedlings do not fall to the bottom of the trays.

316

11. Repeat for each rep. Several reps can fit in each bucket. At least one set of checks should be in each bucket. 12. Transfer buckets to the green house or the growth chamber at 25 οC, 20% RH, 14h light:10h dark (ideal). 13. Let cups dry. 14. During the week, add more DI water to buckets as needed (about every other day).

Week Three: Rating

1. One day before rating, set up data sheet in Excel. 2. Transfer buckets from greenhouse/growth chamber to 127. 3. Remove trays from bucket. It may be necessary to hold trays over the bucket to let excess water drain. 4. Unstack trays. Do this slowly, as the polyester cloth tends to stick to the tray above it. 5. Uncover soybeans. Using a scalpel, cut away the upper layers of tissue from the inoculation site to the margin of infection. 6. Measure the lesion length from the top of the inoculation site to the upper lesion margin (in mm). Record the length in the data sheet. 7. Hints: Rating is faster if there are at least two people, one to measure and one to record. Multiple trays can be cut before measuring to speeds things up as well. However, it is recommended to cut not more than five trays at a time, as it becomes difficult to distinguish the margin from surrounding plant tissue if the plant sits out too long.

Clean up

1. Place all seedlings in an autoclave bag. 2. Soak all cloths and pads in a bucket of DI water plus bleach overnight.

317

3. Soak trays in a bucket of DI water plus bleach. This can also be done overnight. 4. Wash cloths and pads in washer (in autoclave/dishwashing room). Do not use detergent. Simply place cloths in washer on whites cycle for 15-12 min. If a large number of cloths need to be washed, split them up into smaller loads as this makes it easier to remove any remaining plant residue. 5. Lay cloths and pads out on a clean surface or drying rack to dry. 6. Scrub trays and buckets with a scrub brush and rinse with tap water. Lay trays out on a clean surface to dry. (Scrubbing is optional).

References.

Wang, H., St. Martin S.K., and Dorrance, A.E. 2012a. Comparison of phenotypic methods and yield contributions of quantitative trait loci for partial resistance to Phytophthora sojae in soybean. Crop Sci. 52:609-622.

318

Appendix I. Production of zoospores from Phytophthora sojae

At least one week before inoculation

1. Prepare non-clarified V8 plates following lab recipe (use the one without cholesterol). 2. Place five-5 x 5 mm plugs of P. sojae from starter plate on each V8 plate. Repeat for desired number of plates. 3. Incubate plates in plastic bag at 25οC for three days. (If desired make a set of back-up plates one day after starting cultures on V8. Incubate these at the same temperature). 4. One to two days before inoculation, adjust the pH of distilled water to about 7.0 using KOH/NaOH and HCl (6.9 to 7.1 okay, do not go below pH of 6.0). Autoclave water (30 min sterilization) and store at room temperature. For 40 plates, 6 L of water is sufficient (including mock treatments). 5. Autoclave at least two-250mL or larger beakers or Mason jars. The total number required depends on the method used for inoculation and the number of inoculation concentrations used. If using a tray test method, three is the minimum number required (one for the concentrated zoospores, one for diluted zoospores-if needed, and one for mock treatment). If using a root dip method, the number of beakers is the number of treatments plus one (remember to include any mock treatments in this count).

319

Day before inoculation

1. Flood each plate with 15 mL of above prepared water. Plates must sit for 14-17 hours. Water can be measured using a sterile 50 mL centrifuge tube. Put plates back in plastic bags and incubate at 25οC overnight. 2. Decant water from plates into beaker for waste. Reflood each plate with 15mL of

sterile ddH2O pH ~7.0. Let sit for 30 min. Plates do not need to be covered with aluminum foil or otherwise protected from light. Hood should be turned off to prevent the plates from drying out. 3. Repeat step 2 for a total of three to seven 30 min washes. After the third wash, check plates under a compound light microscope (100x total magnification) for the formation of sporangia. If several sporangia are present, no further 30 min washes are needed. If only a few sporangia are present, continue 30 min washes. (OH25 usually takes about six washes).

4. Decant water into waste beaker. Reflood each plate with 15 mL of sterile ddH2O pH ~7.0. Let sit for 3h. 5. Decant water from plates into a 250 to 400 mL sterile beaker. This is the concentrated zoospore suspension. Note: zoospores will encyst if shaken too violently. Plates can be saved and reflooded overnight to produce more zoospores if desired. If flooding overnight, put the plates back in bags and incubate at 25οC. 6. Clean hemocytometer with de-ionized water. Obtain a new cover slip if necessary (the rectangular ones work well). 7. Pipet a small amount (about 15 μl) of concentrated zoospore suspension into the both sides of the hemocytometer. Observe under a compound microscope and count the number of zoospores in regions A, B, C, D, and E indicated in the grid below. Repeat for the other side. Add up the total number of zoospores in each side. Clean hemocytometer.

320

Figure I.1. Schematic layout of the hemacytometer. Zoospores should be counted in squares A, B, C, D, and E.

8. Repeat set 7. 9. Add up the total number of zoospores from each count and divide by four (for four counts) to get the average number of zoospores. Multiply this by 2000 to obtain the total number of zoospores per mL. Dilute suspension to 1 *104 to obtain the proper concentration for inoculation.

Clean up

1. Dispose of zoospore waste and remaining suspension down the drain (can add bleach or EtOH to waste before disposal if desired). Rinse out waste beaker. 2. Wash all beakers and glass bottles (for water storage) with non-phosphorous lab soap and let dry. Return to all borrowed materials to glassware room once dry.

References: Mideros, S. 2006. Study of incomplete resistance to Phytophthora sojae in soybean. M.Sc. Thesis. The Ohio State University.

321

Qutob, D., Hraber, P.T., Sobral, B.W.S., and Gijzen, M. 2000. Comparative analysis of expressed sequences in Phytophthora sojae. Plant Physiol. 123:243-254.

322

Appendix J. Protocol for soybean VMT NPA and 1-NAA experiments

Seed germination and VMT box set up

1. Check if a plastic vacuum desiccator will seal. To do this, place the lid on the

desiccator and turn on a UN86KTP Laboport® mini pump (KNF lab, Trenton,

NJ). If the desiccator can be lifted by the lid, a seal has formed. If it cannot, it

may be necessary to find a different mini pump or a change some of the

connecting tubes or valve.

2. Place soybean seeds in a single layer in the bottom of a plastic Petri plate. Place

the Petri plate inside the desiccator in a fume hood. Place a 250 mL glass beaker

filled with 100 mL of sodium hypochlorate in the desiccator. Add 1 mL of

concentrated HCl to the bleach. Immediately place the lid on the desiccator and

turn on the mini pump (which should also be inside the fume hood). After 2-5

min., close the valve to seal off the desiccator and turn off the mini pump. Close

the sash of the fume hood. Let seeds sit overnight. The next morning, remove

the lid from the desiccator, place the lid of the Petri plate over the seeds, and

seal the plate with either Parafilm or Micropore tape (Govindarajulu et al. 2008,

2009).

3. Place sterile 9 cm x 10 cm thick germination paper on the bottom of a sterile

glass Petri plate. Soak filter paper with sterile, deionized water. Gently press the 323

germination paper into the plate. Pour off excess water, but leave a little bit

standing in the bottom of the Petri plate to ensure good germination. Place ten

soybean seeds (previously sterilized as described above) on the germination

paper. Place plates in a plastic bag to maintain sterility and humidity. Incubate

at room temperature (approximately 24-26οC) in the dark for three-to-four days.

4. One day prior to setting up the VMT boxes, prepare Whatman chromatography

paper (cut to same size as glass plates, 28 cm x 28 cm), and filter paper strips

(1cm wide, 28-31 cm long). Also cut and sterilize thin germination paper into

12.5 (approx.) cm x 28 cm sections to cover the roots. Sterilize filter paper, an

empty 1000 μL tip box, a beaker (150 or 250 mL), two plastic test tube drying

racks (per box) wrapped in foil, a pencil, a glass 10 mL or 25 mL pipet, and 6 L

of distilled water (per box). If necessary, prepare 70% EtOH. Dry materials

(except water) in an oven at 70οC overnight.

5. Turn on UV light in hood for 15-30 min prior to box set up.

6. Clean glass plates, box lid, 100 mL beaker, a plastic ruler, and box with 70%

EtOH. Leave in hood with all other tools (filter paper, forceps, rack, beaker)

under UV light for 30 min. If setting up more than one box at a time, it may not

be possible to leave the box in the hood. It this case, leave the box outside the

hood with the box lid on (put at a slight angle to allow the EtOH to evaporate).

7. Pour 6 L of sterile deionized water into the box. Place plastic racks inside box.

Place glass lid on top of box. If necessary, move box out of hood to allow more

work space.

324

8. Once glass plates are dry, place plastic lid of box upside down in the hood.

Place empty tip box in center of the box lid. Place glass plate on the tip box,

making sure that the box is in the center of the plate. Place a piece of sterilized

filter paper on top of the glass plate, so the edges of the filter paper line up with

the edges of the glass. Label the filter paper with pencil. Also measure and mark

8.5 cm and 11.5 cm from the top of the plate to place the filter paper strip (8.5

cm) and thin germination paper (11.5 cm) in the proper place. Put the thin

germination paper on top of the filter paper. Pour some sterile water into the

beaker and then pour from the beaker onto the filter paper and thin germination

paper. Use the sterile glass pipet to roll the paper so it lies flat on the glass (air

bubbles will cause local changes in humidity).

9. Moisten a sterile filter paper strip with sterile water in the beaker. Place the strip

8.5 cm from the top of the glass plate. Place six to seven soybean seedlings on

top of the strip. Using forceps, place a moistened strip of sterile filter paper

over the roots of each seedling. Gently press the strip to the filter paper between

seedlings, so it sticks to the filter paper beneath it. Tear off pieces of strip that

overhang the edges of the glass plate if necessary. Place two strips at a 90ο angle

to the strip covering the seedlings at the edges of the plate (the strips should

form a giant “H” over the plate). Place plate into racks in box. Repeat as

needed.

10. To monitor the growing conditions of the plants (to see if the conditions

themselves contributed to the development of a region of necrosis well above

325

the inoculation site and separate from the P. sojae lesion), prepare a fifth plate

containing untreated, un-inoculated controls. For this plate, cut a piece of thick

germination paper to 25 cm x 28 cm, sterilize, and dry in an oven (for a couple

of hours at 90οC in Selby or overnight at 70οC in the Blakeslee lab). This

germination paper is in place of the filter paper on the glass plate (arranged so it

covered the plate from top to bottom with a gap on either side). Prepare the rest

of the plate with filter paper strips, thin germination paper, and seedlings as

described in step 7.

11. Keep plates containing plants in box at approximately 25οC, under constant

light.

12. One day after box set-up, start plates of P. sojae OH25 by transferring 3 plugs

to a plate of dilute lima bean agar (12 g of agar/L). Four plates of inoculum are

usually sufficient for two boxes (eight 28 cm x 28 cm plates of seedlings to be

inoculated total).

13. Two/three days later, a second piece of sterile, thin germination paper was

placed over the top of the roots. It was moistened with sterile, distilled water.

Plates were put back in the boxes, and boxes were resealed with Micropore tape

and placed back under the light.

NPA and 1-NAA solutions

1. Six days after setting up the boxes, prepare NPA and/or 1-NAA solutions. Thaw

stock solutions of NPA or 1-NAA (a 2.5 mM stock for 5 and 10 μM solutions

326

and a 250 μM stock for 1μM solution). For stock solutions, DMSO is the

solvent. Once melted, add NPA or 1-NAA stock solutions to a 2 mL tube (for

two boxes) using a micropipette.

2. Prepare a 50 mL solution of 2 mM MES, 2% DMSO, and 0.25% agarose. Add

30 mL of ultrapure (filtered) water to a 50 mL graduated cylinder. Add 12.5 mL

of 100 mM MES solution (pH 5.2) to the cylinder using a plastic volumetric

pipet. Pipet up and down to mix. Add 1 mL of DMSO to the cylinder using a

1000 μL micropipette. Pipet up and down to mix. Bring up to volume with

ultrapure water.

3. Add 0.125 g of agarose to a 125 mL Erlenmeyer flask. Add MES/DMSO

solution to the flask. Microwave the flask until all agarose is dissolved. (This

solution can be prepared ahead of time and stored at room temperature.)

4. Allow the agarose solution to become cool enough to touch the flask. Transfer

to the 2 mL tubes containing NPA or 1-NAA with a 1000 μL micropipette.

Pipet up and down to mix, then put immediately on ice. For the control, add

about 1-1.5 mL of agarose solution to a 2 mL tube and put on ice. Allow the

solutions to solidify.

NPA/1-NAA application

1. Once the agarose solutions have solidified, they can be applied to the soybeans.

Cut the end off of a 1000 μL micropipette tip, so the opening is about 2-3 mm

wide.

327

2. Remove the tape from around the lid of the VMT box. Carefully remove the plate

in the front. Set the plate on a flat, raised surface (such as a couple of plastic 50

mL tube racks). Using a thin scalpel, lift one of the vertical filter paper strips off.

Then lift off the strip lying directly across the seedlings.

3. Transfer 100 μL of the appropriate agarose solution onto the crown region of each

seedling.

4. Replace the filter paper strips. The seedlings are more likely to stay on the plate if

the strip lying across them is placed back in its original position. Use a plastic

Pasteur pipet to moisten the strips with ultrapure water. Place the plate back in the

box.

5. Repeat 17-19 for each plate and each box. Work from front to back, so treatments

do not cross-contaminate each other. The fifth plate for the untreated,

uninoculated control does not need to be removed from the box.

6. Reseal the box with micropore tape. Put the box back under constant light.

P. sojae inoculation and rating

1. Two days later, prepare a mycelial slurry of P. sojae. Cut the culture into strips

with a large metal spatula (aka frosting spreader) and transfer 2-3 plates of P.

sojae into a 60 mL syringe. Pass the agar through the 60 mL syringe into a 10 mL

syringe equipped with a 18G1/2 needle. Tap the 10 mL syringe on the side of the

lab bench (or carefully shake the syringe) to move the air to the top of the syringe.

328

Push the air out (recommended: do this into an empty Petri plate to prevent

mycelia from flying everywhere).

2. Remove a soybean seedling plate from the box as described in 17. Move one

vertical filter paper strip, but move the upper layer of thin germination paper

rather than the filter paper strip holding the seedlings. Make a small scratch 2cm

below the crown region. Cover the scratch with the mycelial slurry by passing it

through the 10mL syringe and needle.

3. Place the thin germination paper and the filter paper strip back into place. Add a

little ultrapure water to the thin germination paper using a Pasteur pipet.

4. Place the soybean plate back in the box. Repeat for all other plates to be

inoculated. Reseal the box and place it back under constant light.

5. Three days after inoculation with P. sojae, the soybean plate is removed from the

box as described above. Remove filter paper strips and the top layer of thin

germination paper. Starting just above the inoculation site, cut away the top layer

of tissue to expose the lesion. Measure the length of the lesion from the top of the

inoculation site to the upper edge of the lesion margin. Repeat for each plant on

each plate.

6. Make note of any unusual phenotypes, including on the untreated, uninoculated

control. It may be necessary to cut into the stem above the lesion to do this (plants

often developed an upper region of necrosis, likely due to stress).

329

7. Discard plants, filter paper, and germination paper into autoclave trash. Clean

glass plates, racks, and boxes with detergent and bleach. Triple rise them with tap

water and deionized water. Let dry overnight.

Suggestions for future experiments

This assay proved to be very sensitive to temperature. It was often too hot or too cold for good infection. Therefore, it is recommended that future experiments be done in a growth chamber to achieve better temperature control.

The roots of the plants were prone to drying out when exposed to constant light. It might be better to set the plants up in germination paper, rather than on the glass plates. This would eliminate the need to start seed in a separate location (and therefore, eliminate any potential confounding effects due to transferring the seedlings). It would also ensure that the plants were kept moist, and would eliminate the need to use the 28 cm x 28 cm filter paper.

The plants were also prone to developing necrosis in the stem/upper hypocotyl region.

This occurred even on the untreated, uninoculated control and could indicate that the growing conditions are not ideal for soybean. The exact cause of this necrosis is unclear.

Putting the plants in a more controlled environment (such as a growth chamber) might prevent this. However, changing other environmental conditions (such as the amount of time the plants are exposed to light) might help.

330

References

Govindarajulu, M., Elmore, J.M., Fester, T., and Taylor, C.G. 2008. Evaluation of constitutive viral promoters in transgenic soybean roots and nodules. Mol. Plant-Microbe Interact. 21:1027-1035. doi:10.1094/MPMI-21-8-1027

Govindarajulu, M., Kim, S.-Y., Libault, M., Berg, R.H., Tanaka, K., Stacey, G., and Taylor, C.G. 2009. GS52 ecto-apyrase plays a critical role during soybean nodulation. Plant Physiol. 149:944-1004. doi:10.1104/pp.108.128728

Murphy, A., Peer, W.A., and Taiz, L. 2000. Regulation of auxin transport by aminopeptidases and endogenous flavonoids. Planta 211:315-324. doi:10.1007/s004250000300

Murphy, A., and Taiz, L. 1995. A new vertical mesh transfer technique for metal- tolerance studies in Arabidopsis. Plant Physiol. 108:29-38. doi:10.1104/pp.108.1.29

331

Appendix K. Stock solutions for Hoagland’s solution

1 M Ca(NO3)2 ● 4 H2O

23.62g Ca(NO3)2 ● 4 H2O 100 mL distilled H2O (start with 70 mL distilled H2O, dissolve salt, then add remaining water to 100 mL final volume)

1 M KNO3

10.11 g KNO3 100 mL distilled H2O (start with 70 mL distilled H2O, dissolve salt, then add remaining water to 100 mL final volume)

1 M MgSO4 ● 7 H2O

24.65 g MgSO4 ● 7 H2O 50 mL distilled H2O (start with 40 mL distilled H2O, dissolve salt, then add remaining water to 100 mL final volume)

KH2PO4 (monobasic)

6.80 g KH2PO4 50 mL distilled H2O (start with 40 mL distilled H2O, dissolve salt, then add remaining water to 100 mL final volume)

Made micronutrients solution according to hand written lab recipe.

Modified from Hoagland, D.R., and Arnon, D.I. 1950. The water-culture method for growing plants without soil. California Agricultural Experimental Station, Circular-347.

332