A New Species of Micryletta (Amphibia: Microhylidae) from Southern Thailand
Total Page：16
File Type：pdf, Size：1020Kb
ZOOLOGICAL RESEARCH
A new species of Micryletta (Amphibia: Microhylidae) from southern Thailand
DEAR EDITOR, Peninsula to Sumatra in the south (Frost, 2020) (Figure 1A). We report on a new species, Micryletta dissimulans sp. nov., To date, six species are recognized within the genus: i.e., M. from the lowland forests of southern Thailand, which is aishani Das, Garg, Hamidy, Smith & Biju; M. erythropoda described based on molecular and morphological evidence. (Tarkhnishvili); M. nigromaculata Poyarkov, Nguyen, Duong, The new species is characterized by a combination of the Gorin & Yang; M. inornata (Boulenger), M. steinegeri following characters: small body size (20.3–22.4 mm in males, (Boulenger); and M. sumatrana Munir, Hamidy, Matsui, Kusrini 24.4–26.7 mm in females); slender body habitus; head longer & Nishikawa (Frost, 2020; Munir et al., 2020). The status of than wide; snout rounded in dorsal and lateral view; eye length the subspecies M. inornata lineata (Taylor) remains equal to snout length; tibiotarsal articulation reaching to controversial, with some studies regarding it as a full species tympanum; dorsal surface slightly granulated to shagreened; (i.e., M. lineata) (e.g., Zug & Mulcahy, 2020). In addition, supratympanic fold indistinct, ventrally edged in black with several preliminary phylogenies of Micryletta have revealed a large black spot behind eye; outer metatarsal tubercle absent; number of deep lineages (Alhadi et al., 2019; Das et al., 2019; dorsum reddish-brown with merging irregular-shaped brown Munir et al., 2020; Matsui et al., 2011; Poyarkov et al., 2018), blotches edged in beige, no black spots on dorsum; body suggesting that taxonomy of the genus is far from complete. flanks brown with large black spots edged in whitish mottling, In August 2018, during fieldwork in the lowland forests of two large black blotches in axillary and inguinal areas on each Songkhla Province in southern Thailand (Figure 1A, locality side; lateral sides of head black, with white patches on lips 16), we collected a series of specimens of an unusual absent, whitish mottling on tympanum and axillary region; microhylid species, which was tentatively identified as ventral surface pinkish to bluish-gray, translucent, laterally Micryletta sp. Consequent phylogenetic analysis of the 16S with dark-brown marbled pattern, medially immaculate; throat rRNA mtDNA gene confirmed the placement of this population in males dark-gray with sparse white mottling laterally; iris within Micryletta and the formation of a lineage deeply copper-orange. The new species is divergent from all other divergent from all other recognized species of the genus. congeners in 16S rRNA gene sequences (5.0%–7.4%). To Closer morphological examination showed that this species date, Micryletta dissimulans sp. nov. is only known from a could be clearly distinguished from all other congeners by a single locality in Saba Yoi District, Songkhla Province, combination of diagnostic morphological features. Thus, in the Thailand, at an elevation of 120 m a.s.l., but is also expected present paper, we describe the Micryletta population from to occur in neighboring parts of Malaysia. We suggest Songkhla Province as a new species. Micryletta dissimulans sp. nov. be considered as a Data Deficient (DD) species following the IUCN’s Red List Received: 09 June 2020; Accepted: 15 July 2020; Online: 04 August categories (IUCN Standards and Petitions Committee, 2019). 2020 Paddy frogs of the genus Micryletta Dubois, 1987 are a Foundation items: This study was supported by the Unit of Excellence little-known group of microhylid frogs found in southern China, 2020 on Biodiversity and Natural Resources Management, University including the Hainan and Taiwan islands in the north, through Indochina, the northeast portion of India and Myanmar to of Phayao (UoE63005); Thailand Research Fund (TRF: Nicobar and the Andaman Islands, and through the Malayan DBG6180001); and Plant Genetic Conservation Project under the Royal Initiative of Her Royal Highness Princess Maha Chakri Open Access Sirindhorn, University of Phayao (RD61017) to C.S.; partially This is an open-access article distributed under the terms of the supported by Chiang Mai University to S.C.; International Partnership Creative Commons Attribution Non-Commercial License (http:// Program of the Chinese Academy of Sciences (CAS) creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted (152453KYSB20170033), and Southeast Asia Biodiversity Research non-commercial use, distribution, and reproduction in any medium, Institute, CAS (Y4ZK111B01: 2017CASSEABRIQG002) to J.C.; and provided the original work is properly cited. Russian Science Foundation (19-14-00050; sampling, molecular, and Copyright ©2020 Editorial Office of Zoological Research, Kunming phylogenetic analyses) to N.A.P. Institute of Zoology, Chinese Academy of Sciences DOI: 10.24272/j.issn.2095-8137.2020.139
Science Press Zoological Research 41(5): 581−588, 2020 581
Figure 1 Phylogenetic relationships and distribution of the genus Micryletta and the holotype of Micryletta dissimulans sp. nov. (AUP01690) in life A: Distribution of the genus Micryletta (grey shading) and location of examined populations. For locality info see Supplementary Table S1. A dot in the center of icon denotes the type locality of a species; empty circle denotes locality not included in molecular analysis; star denotes the type locality of Micryletta dissimulans sp. nov. in Saba Yoi District, Songkhla Province, southern Thailand. B: Phylogenetic BI tree of Micryletta reconstructed on the base of 569 bp of partial 16S rRNA sequences. Values on the branches correspond to BI PP/ML BS, respectively; black and white circles correspond to well-supported and moderately supported nodes, respectively. C: Holotype of Micryletta dissimulans sp. nov. (AUP01690), adult male, in life in dorsolateral view. D: Same specimen in ventral view. Photos by N.A. Poyarkov, P. Pawangkhanant, J.H. Yang
and Eki Aprilia Resdiyanti Devung.
582 www.zoores.ac.cn A total of nine specimens were collected and photographed to all other species of Micryletta (1.0/67). The following in life before being euthanized using a 20% solution of subclades were recovered within the latter group: M. aishani benzocaine prior to fixation and storage in 75% ethanol. from northeast India; M. inornata from northern Sumatra, Tissue samples for genetic analysis were taken prior to Indonesia; M. erythropoda from southern Vietnam; M. cf. preservation and stored in 95% ethanol. Specimens and lineata from Peninsular Thailand; and populations from tissues were subsequently deposited in the herpetological northern Indochina and southern China, including the collections of the School of Agriculture and Natural mainland and Taiwan. The latter group included the M. Resources, University of Phayao (AUP, Phayao, Thailand) steinegeri sensu stricto lineage from Taiwan, China (lineage and the Zoological Museum of Lomonosov Moscow State D; Figure 1B), and mainland populations formerly referred to University (ZMMU, Moscow, Russia). Measurements were as “M. cf. inornata” (lineages A–C and E; Figure 1B) (Das et taken using a digital caliper under a light dissecting al., 2019; Munir et al., 2020; Poyarkov et al., 2018). However, microscope to the nearest 0.01 mm, subsequently rounded to as the true M. inornata sensu stricto from Sumatra is 0.1 mm. The morphometrics of adults and character phylogenetically distinct from the mainland populations of terminology followed Poyarkov et al. (2018) (see Micryletta (Alhadi et al., 2019; Das et al., 2019; Munir et al., Supplementary Methods). Comparative data on the 2020), we herein refer to the mainland lineages A–C and E of morphology and taxonomy of Micryletta were obtained from the M. steinegeri complex as M. cf. steinegeri (Figure 1A, B). previous publications on the genus (see Supplementary The genetic distance between the Micryletta sp. from Methods for details). Songkhla and other described species of the genus ranged Total genomic DNA was extracted, and a partial fragment of from P=5.0% (with M. nigromaculata) to P=7.4% (with M. the mitochondrial 16S rRNA gene was amplified and erythropoda) (Supplementary Table S2). These values of sequenced. DNA extraction, primers, and polymerase chain divergence in the 16S rRNA gene are notably higher than the reaction (PCR) protocols followed Poyarkov et al. (2018) and formal P=3% threshold widely applied as an indicator of are detailed in the Supplementary Methods. To assess the species-level differentiation in frogs (Vieites et al., 2009). genealogical relationships among Micryletta species, Thus, due to congruent morphological (see below) and Bayesian inference (BI) and maximum-likelihood (ML) molecular differences from all currently recognized congeners, phylogenetic trees were reconstructed based on analysis of the newly discovered Micryletta population from Songkhla the 16S rRNA gene fragment (for details of phylogenetic Province is described as a new species below. analyses see Supplementary Methods). Homologous sequences of all currently recognized Micryletta species and Taxonomic account representative outgroups (Mysticellus franki, Uperodon Micryletta dissimulans sp. nov. (Figure 1C, D; systoma, Kaloula pulchra) were downloaded from GenBank Supplementary Figures S1–4; Table 1) (see Supplementary Table S1). We also calculated pairwise Holotype: AUP01690, adult male from a secondary lowland sequence divergence using uncorrected P-distances bamboo forest in Saba Yoi District, Songkhla Province, implemented in MEGA v6.0.6 (Tamura et al., 2013). southern Thailand (coordinates N6.369°, E100.873°; 120 m The topologies recovered by both BI and ML analyses were a.s.l.), collected on 22 August 2018 at 2 200 h by P. essentially identical, with relatively robust support for most Pawangkhanant and N.A. Poyarkov. terminal nodes (Figure 1B). The new microhylid species from Paratypes: AUP01691–01694 and AUP01698 (five adult Songkhla Province nested in the genus Micryletta with strong males), AUP01696–01697 (two adult females), and ZMMU support (1.0/97; hereafter node support values are given for BI A7262 (adult male), collected at the same time and place as posterior probability/ML bootstrap support, respectively) and the holotype. formed a distinct lineage (Figure 1B) with notable genetic Diagnosis: The new species is assigned to the genus divergence (P-distance≥5.0%) from all other recognized Micryletta Dubois, 1987 based on the following morphological species within the genus (Supplementary Table S2). Our attributes: body size small; vomerine teeth absent; tympanum phylogenetic tree agreed with earlier topologies of Poyarkov et small, rounded, externally visible; subarticular tubercles on al. (2018) and Das et al. (2019) but differed significantly from fingers and toes very prominent; three well-developed the topology presented in Munir et al. (2020). The Songkhla metacarpal tubercles; distinct supernumerary palmar and Micryletta sp. formed a clade (1.0/100) that was clearly distinct metatarsal tubercles posterior to base of digits; first finger not from all other congeners, with a possible sister species reduced; and webbing on fingers and toes absent (Alhadi et relationship shown for the recently described species M. al., 2019; Das et al., 2019; Dubois, 1987; Munir et al., 2020; sumatrana from southern Sumatra, Indonesia, although this Poyarkov et al., 2018). Micryletta dissimulans sp. nov. is grouping received no BI support and only weak ML support distinguished from all congeners by a combination of the (0.66/75; Figure 1B). All remaining species of Micryletta following morphological characters: body size small formed a well-supported monophylum (0.97/79), with seven (20.3–22.4 mm in seven males, 24.4–26.7 mm in two major subclades recovered within it. Micryletta nigromaculata females); body habitus slender; head longer than wide; snout from northern Vietnam grouped with Micryletta sp. 1 from rounded in dorsal and lateral views; eye length equal to snout northern Laos (0.97/87) and formed a sister clade with respect length; tibiotarsal articulation reaching tympanum; dorsal
Zoological Research 41(5): 581−588, 2020 583 Table 1 Selected measurements (in mm) of Micryletta dissimulans sp. nov. type series
Specimen ID AUP01690 AUP01698 AUP01691 AUP01692 AUP01693 AUP01694 ZMMU A7262 AUP01696 AUP01697 Type status Holotype Paratype Paratype Paratype Paratype Paratype Paratype Paratype Paratype Sex M M M M M M M F F SVL 21.2 21.9 20.9 20.3 21.2 20.3 22.4 26.7 24.4 HL 7.8 7.6 7.2 6.9 6.9 7.1 7.4 7.4 7.3 SL 2.5 2.6 2.4 2.5 2.5 2.2 2.9 3.1 3.1 EL 2.6 2.4 2.5 2.4 2.6 2.4 2.8 3.4 3.3 N-EL 1.4 1.4 1.4 1.5 1.4 1.4 1.6 1.5 1.5 HW 7.3 7.2 7.2 6.8 7.5 7.1 8.5 10.3 8.1 IND 1.9 2.0 1.8 1.9 1.9 2.0 2.3 2.6 2.5 IOD 2.7 2.3 2.2 2.2 2.7 2.5 2.3 2.5 2.5 UEW 1.9 1.5 1.9 1.6 1.9 1.4 1.6 2.7 2.7 FLL 12.7 14.6 13.0 14.0 12.5 14.3 16.0 18.3 17.7 LAL 8.3 9.9 8.2 9.9 8.3 9.6 11.2 13.0 11.8 HAL 5.5 5.4 5.4 5.4 5.8 6.0 6.4 8.0 6.8 IPTL 0.6 0.5 0.5 0.5 0.6 0.6 0.6 0.6 0.5 OPTL 0.9 0.8 0.9 0.8 0.9 0.9 1.0 1.2 1.1 3FDD 0.4 0.5 0.4 0.4 0.3 0.4 0.5 0.9 0.8 HLL 34.4 33.0 33.4 34.6 32.8 33.7 36.9 43.9 41.3 TL 10.8 10.0 10.3 10.3 8.9 10.6 11.1 12.8 12.2 FL 13.8 13.5 13.9 14.3 14.4 13.6 15.4 18.5 17.4 IMTL 0.9 0.8 0.9 0.9 0.9 0.9 0.9 1.1 1.0 4TDD 0.7 0.7 0.7 0.6 0.6 0.6 0.7 0.8 0.8 TD 1.2 1.2 1.1 1.0 1.2 1.2 1.3 1.3 1.2 1FL 2.2 2.4 1.7 2.2 2.1 1.8 2.5 3.9 3.3 2FL 3.2 3.4 3.0 3.0 3.0 2.3 4.0 4.1 4.1 3FL 5.1 5.2 4.7 4.9 3.3 4.0 5.9 6.9 6.8 4FL 3.3 4.4 3.0 4.1 3.6 3.0 4.4 5.0 4.9 1TOEL 2.6 2.4 2.5 2.3 2.6 2.7 2.8 3.1 2.2 2TOEL 43 4.0 3.5 3.4 4.2 4.3 4.4 5.7 5.0 3TOEL 6.7 6.6 6.8 6.0 7.0 7.3 8.0 9.2 8.5 4TOEL 10.4 9.6 9.9 9.0 10.3 9.4 11.3 12.1 11.4 5TOEL 6.5 5.5 6.0 5.3 6.4 5.7 6.5 8.0 7.7
Holotype measurements are given in bold. For character abbreviations see Supplementary Methods section. M: Male; F: Female. surface slightly granulated to shagreened; supratympanic fold beyond lower jaw (Supplementary Figure S1C); eyes indistinct, ventrally edged in black; large black spot behind comparatively large (EL/SVL 0.12), slightly protuberant in eye; outer metatarsal tubercle absent; dorsum reddish-brown dorsal and lateral views, subequal to snout length (EL/SL with merging irregular-shaped brown blotches edged in beige, 1.02) and interorbital distance (EL/IOD 0.96). Top of head flat; no black spots on dorsum; body flanks brown with large black canthus rostralis distinct, rounded; loreal region almost spots edged in whitish mottling, two large black blotches in vertical, concave; nostril oval, lateral, located closer to tip of axillary and inguinal areas on each side; lateral sides of head snout than to eye (N-EL/SVL 0.07); interorbital distance black, with white patches on lips absent, whitish mottling on noticeably wider than internarial distance (IND/IOD 0.70), tympanum and axillary region; ventral surface pinkish to about 1.5 times wider than upper eyelid (UEW/IOD 0.70). bluish-gray, translucent, laterally with dark-brown marbled Pineal spot absent; tympanum small (TYD/SVL 0.06), round, pattern, medially immaculate; throat in males dark-gray with poorly distinct with tympanic rim not elevated above tympanal sparse white mottling laterally; and iris copper-orange. area; supratympanic fold thin and flat, gently curving from Description of holotype: Adult male, small-sized specimen in posterior corner of eye towards axilla. Choanae elongated and good state of preservation; body habitus slender, body oval-shaped, widely spaced; upper jaw edentate; vomerine elongated and oval-shaped (Figure 1C); head longer than teeth absent; tongue without papillae, roundly spatulate, wide (HL/HW 1.07); snout short (SL/SVL 0.12), rounded in lacking posterior notch and free behind for three-quarters of its dorsal view and bluntly rounded in profile, slightly projecting length.
584 www.zoores.ac.cn Forelimbs short and slender (FLL/SVL 0.60); lower arm long transverse bands; fingers and toes dorsally gray with brownish and slender (LAL/SVL 0.39), hand constituting less than half dusting; ventral surfaces pinkish to bluish-gray, translucent, length of forelimb (HAL/FLL 0.43). Fingers slender, free of laterally with dark-brown marbled pattern, medially immaculate webbing, round in cross-section, lacking lateral skin fringes; (Figure 1D); throat dark-gray with sparse white mottling first finger well-developed, slightly shorter than second finger laterally in lower jaw area; iris dark-brown with copper-orange (1FL/2FL 0.68); relative finger lengths: I
Zoological Research 41(5): 581−588, 2020 585 The new species differs from M. erythropoda from southern inguinal spots absent, dorsum with irregular dark blotches or Vietnam by a combination of the following characters: smaller speckles); head sides uniform brown, with white patches on body size in males (SVL 20.3–22.4 mm vs. up to 30 mm); upper lip absent (vs. gray-brown with white spots present); outer metatarsal tubercle absent (vs. present); dorsal surface body flanks brown with dark spots and white mottling (vs. slightly granulated to shagreened (vs. smooth); dorsum brown flanks gray brown with dark marbling); pinkish to bluish-gray to reddish-brown (vs. gray or beige to saturated ochre or brick- venter, laterally with dark-brown marbled pattern (vs. venter red); dorsum pattern of merging brown blotches edged in pinkish to orange); and webbing between toes absent (vs. beige (vs. extremely variable and formed by black spots on rudimentary webbing present). reddish background); flanks brown with dark spots edged in Micryletta dissimulans sp. nov. differs from its putative whitish mottling (vs. dark-brown to gray with white patches); sister species M. sumatrana from southern Sumatra, venter pinkish to bluish-gray, laterally with dark-brown marbled Indonesia, by: larger body size (20.3–22.4 mm in males, pattern (vs. dark brownish-violet); and webbing between toes 24.4–26.7 mm in females vs. 17.4 mm in males, 22.8 mm in absent (vs. rudimentary webbing present). females); relatively longer tibia length (TL/SVL 0.42–0.51 Micryletta dissimulans sp. nov. differs from M. inornata from (mean 0.49) in males, 0.48–0.50 (mean 0.49) in females vs. northern Sumatra, Indonesia, by: larger body size (20.3– 0.41 in males, 0.45 in females); dorsum reddish-brown (vs. 22.4 mm in males, 24.4–26.7 mm in females vs. 16.8–20.5 golden-brown); dorsum pattern of irregular-shaped merging mm in males, 19.5 mm in females); interorbital distance two brown blotches edged in beige (vs. no dark pattern on times wider than upper eyelid width (vs. interorbital distance dorsum); skin on dorsum slightly granular to shagreened (vs. slightly wider than upper eyelid); dorsum reddish-brown (vs. smooth); lateral sides of head dark-brown, with white patches dark-brown or brownish-gray with silver tinge); dorsal pattern on upper lip absent (vs. cream spots on lips, tympanum of merging brown blotches edged in beige (vs. irregular region, and axilla present); body flanks brown with dark spots blackish blotches); dorsum slightly granulated to shagreened edged in whitish mottling (vs. dark-brown with white patches); (vs. smooth, covered with small tubercles or warts); sides of venter pinkish to bluish-gray laterally with dark-brown marbled head dark-brown to black, with white patches along upper lip pattern (vs. venter with dark-brown background coloration with absent (vs. black with white spots along upper lip present); cream mottling); tibia and tarsus with indistinct dark spots not body flanks brown with dark spots and whitish mottling (vs. forming cross band (vs. with dark cross bands); tibiotarsal dark-brown with white patches); venter pinkish to bluish-gray articulation of adpressed limb reaching to tympanum (vs. laterally with brown marbled pattern (vs. light reddish-gray reaching to eye); supratympanic fold less distinct, flat, not without mottling); and tibiotarsal articulation of adpressed limb glandular, ventrally edged in black with large black spot reaching to tympanum (vs. reaching to eye). behind eye (vs. supratympanic fold distinct, thick, glandular, The new species differs from M. lineata from Peninsular and blackish); and iris copper-orange in upper and lower thirds Thailand by: dorsum reddish-brown with merging brown (vs. golden). blotches edged in beige (vs. grayish-brown with three straight Etymology: The specific epithet “ dissimulans” is a Latin continuous or broken lines); tibiotarsal articulation reaching to adjective in the nominative case, feminine gender, derived tympanum (vs. reaching to eye); sides of head dark-brown to from the Latin verb “ dissimulo” meaning “to hide” or “to black, with white patches along upper lip absent (vs. cream conceal”, and is given in reference to the iconic “Frog Skin” stripe of irregular width from snout to axilla); body flanks camouflage pattern, resembling the characteristic mottled and brown with dark spots and whitish mottling (vs. black stripe disruptive dorsal pattern of the new species. The name is also from axilla to groin with indistinct light stripe ventrally); and given in reference to the new species being concealed for a venter pinkish to bluish-gray laterally with brown marbled long time until its recent discovery. We recommend pattern (vs. immaculate). “Camouflaged Paddy Frog” as the common English name and Compared with M. nigromaculata from northern Vietnam, “Eung Jiew Lay Pang” (อึ่งจิ๋วลายพราง) as the common Thai Micryletta dissimulans sp. nov. can be distinguished by: name of the new species. tibiotarsal articulation reaching to tympanum (vs. reaching to Conservation status: To date, Micryletta dissimulans sp. eye); dorsal pattern consisting of merging brown blotches (vs. nov. is known only from a single location in southern Thailand; generally more prominent dark hourglass-shaped markings); the actual extent of distribution and population trends of the whitish spots present on head flanks from tympanum region to new species remain unknown. We suggest Micryletta axilla (vs. immaculate dark-brown without white spots); body dissimulans sp. nov. be considered as a Data Deficient (DD) flanks brown with dark spots and white mottling (vs. blackish species following the IUCN’s Red List categories (IUCN patches edged in white); pinkish to bluish-gray venter, laterally Standards and Petitions Committee, 2019). with dark-brown marbled pattern (vs. whitish with indistinct Distribution and biogeography: To date, the new species is light-gray marbling). known only from a single locality in the lowland areas of The new species differs from M. steinegeri by: smaller body Songkhla Province in southern Peninsular Thailand (Saba Yoi size in females (20.3–22.4 mm vs. 27.0–30.1 mm); dorsum District) (see Figure 1A, locality 16), approximately 6 km from brownish (vs. dark-gray to violet); dorsum pattern of merging the international border with Malaysia. Biogeographically, the brown blotches edged in beige with black inguinal spots (vs. Songkhla Province is located southwards from the Kangar-
586 www.zoores.ac.cn Pattani Line, a well-known biogeographic barrier that bisects separated geographically (see Figure 1A, B), each potentially the Thai-Malay Peninsula (Van Steenis, 1950), and thus the represents an undescribed species. Finally, our mtDNA-based occurrence of the new species to the south, in Peninsular genealogy could not provide full phylogenetic resolution for the Malaysia, is highly anticipated. Similar patterns have been genus Micryletta; the tendency for a basal position of the observed in other microhylids inhabiting this region (see Gorin Sundaic clade comprised of Micryletta dissimulans sp. et al., 2020). Munir et al. (2020) discussed that some nov.+M. sumatrana is only poorly supported. Further Micryletta populations reported from the Malay Peninsula and multilocus phylogenies along with integrative taxonomic Singapore superficially resemble M. sumatrana in coloration, analyses are needed to achieve a better understanding of but differ from the latter by fewer cream spots on the lips and Micryletta taxonomic diversity and evolutionary history. tympanum and by a different arrangement of black spots on the flanks. The population from Johor (see Figure 1A, locality NOMENCLATURAL ACTS REGISTRATION 19) reported by Wood et al. (2008) is indeed somewhat similar The electronic version of this article in portable document to Micryletta dissimulans sp. nov. in having irregular brownish spots on the dorsum and lacking white spots on the upper lip format represents a published work according to the International Commission on Zoological Nomenclature (ICZN), (Wood et al., 2008: Figure 3, LSUHC 7 626); however, further studies are required to clarify the taxonomic status of and hence the new names contained in the electronic version Micryletta from Peninsular Malaysia and Singapore. are effectively published under that Code from the electronic The present study further underlines our incomplete edition alone (see Articles 8.5–8.6 of the Code). This understanding of Micryletta diversity. In addition to the published work and the nomenclatural acts it contains have description of four new species of this genus in just the last been registered in ZooBank, the online registration system for two years, our study, in agreement with earlier research the ICZN. The ZooBank LSIDs (Life Science Identifiers) can (Alhadi et al., 2019; Das et al., 2019; Munir et al., 2020; be resolved and the associated information can be viewed Poyarkov et al., 2018), identified several lineages of Micryletta through any standard web browser by appending the LSID to that likely correspond to new species. The population of the prefixhttp://zoobank.org/. Micryletta sp. 1 from Laos (Figure 1A, locality 6), initially Publication LSID: identified as M. inornata (Blackburn et al., 2013), but later urn:lsid:zoobank.org:pub: F6ABA4F9-93E2-4BA7-8B1C- suggested as M. cf. nigromaculata by Das et al. (2019), is 4939756C74B4 geographically isolated and notably divergent from typical M. Micryletta dissimulans LSID: nigromaculata in 16S rRNA sequences (P=2.8%); thus, further urn:lsid:zoobank.org:act: 2C8AF677-4ED6-4 588-9 944- integrative studies are needed to clarify its taxonomic status. 298430AED17B Our study also confirms (Poyarkov et al., 2018) the close genealogical relationship between M. erythropoda from SCIENTIFIC FIELD SURVEY PERMISSION INFORMATION southern Vietnam and samples from peninsular Thailand and Specimen collection protocols were approved by the Myanmar (Figure 1A, localities 13–14), originally identified as Institutional Ethical Committee of Animal Experimentation of M. i. lineata by Matsui et al. (2011) and Munir et al. (2020), or the University of Phayao (certificate No. UP-AE61-01-04-0022 as M. lineata by Zug & Mulcahy (2020). However, these issued to Chatmongkon Suwannapoom) and Institute of samples do not originate from the type locality of M. lineata in Animals for Scientific Purpose Development (IAD), Bangkok, Nakhon Si Thammarat Province, Thailand (Figure 1A, locality Thailand (permit number U1-01205-2 558, issued to 15), and are regarded as M. cf. lineata in our study. The Chatmongkon Suwannapoom). geographical complexity of the Thai-Malay Peninsula compounds population estimations of M. cf. lineata and M. SUPPLEMENTARY DATA erythropoda, which can only be resolved using integrative taxonomic approaches and comparisons with type specimens Supplementary data to this article can be found online. and genetic analyses of topotypic materials. Our study further confirms that M. inornata sensu stricto is restricted to Sumatra COMPETING INTERESTS (Alhadi et al., 2019), and thus application of this name for The authors declare that they have no competing interests. populations in northern Indochina and southern China (as in Munir et al., 2020) is misleading. We provide further evidence AUTHORS' CONTRIBUTIONS that a large radiation of Micryletta in this region is comprised of at least five divergent mtDNA lineages, including M. C.S. and N.A.P. designed the study. P.P. and N.A.P. collected steinegeri sensu stricto from Taiwan in southern China specimens in the field. C.S., V.A.G., and N.A.P. performed (Figure 1B, lineage D). We herein suggest referring to this molecular experiments. C.S., T.V.N, V.A.G., and N.A.P. group as the M. steinegeri complex (Figure 1B, lineages A–E). performed data analyses. C.S., T.V.N., and N.A.P. wrote the Though the mainland lineages of this complex from Thailand manuscript. T.V.N, V.A.G., C.J., S.C., and N.A.P. revised the and Laos (lineage A), central Vietnam and Laos (lineage B), manuscript. All authors read and approved the final version of northern Vietnam (lineage C), and Laos (lineage E) are likely the manuscript.
Zoological Research 41(5): 581−588, 2020 587 ACKNOWLEDGEMENTS redescription, molecular identity, and taxonomic implications. Zootaxa,
4613 (1): 111−126. We would like to thank the Laboratory Animal Research Blackburn DC, Siler CD, Diesmos AC, McGuire JA, Cannatella DC, Brown Center (University of Phayao), Institute of Animal for Scientific RM. 2013. An adaptive radiation of frogs in a Southeast Asian island Purposes Development (IAD), and Department of National Parks, Wildlife and Plant Conservation (DNP), Thailand, for archipelago. Evolution, 67(9): 2631−2646. permission to do field work. The authors are grateful to Thai Das A, Garg S, Hamidy A, Smith EN, Biju SD. 2019. A new species of
Van Nguyen (SVW), Andrey N. Kuznetsov (JRVTTC), Micryletta frog (Microhylidae) from Northeast India. PeerJ, 7: e7012. Valentina F. Orlova and Roman A. Nazarov (ZMMU) for Dubois A. 1987. Miscellanea taxinomica batrachologica (II). Alytes, 6(1): supporting our study. We thank Watinee Juthong, Pattarawich 1−9. Dawwrueng, Kanokwan Yimyoo, Thiti Ruengsuwan, Kawin Frost DR. 2020(2018-08)[2020-05]. Amphibian species of the World 6.0, an Jiaranaisakul, and Akkrachai Aksornneam for help, support, online reference. New York: Darrel Frost and the American Museum of
and encouragement during fieldwork. We also thank Jian- Natural History. http://research.amnh.org/herpetology/amphibia/index.html. Huan Yang for providing photos of Micryletta inornata and to Gorin VA, Solovyeva EN, Hasan M, Okamiya H, Karunarathna DMSS, Eki Aprilia Resdiyanti Devung for providing photos of M. Pawangkhanant P, et al. 2020. A little frog leaps a long way: Compounded sumatrana. We are grateful to Mark D. Scherz, Peter Geissler, colonizations of the Indian Subcontinent discovered in the tiny Oriental frog and Jian-Huan Yang for useful comments and corrections of genus Microhyla (Amphibia: Microhylidae). PeerJ, 8: e9411. the earlier version of the manuscript. IUCN Standards and Petitions Committee. 2019(2020-05). Guidelines for using the IUCN red list categories and criteria. Version 14. Prepared by the Chatmongkon Suwannapoom1, Tan Van Nguyen2, Standards and Petitions. http://www.iucnredlist.org/documents/ Parinya Pawangkhanant1, Vladislav A. Gorin3, RedListGuidelines.pdf . 4,5 6,7 3,8,* Siriwadee Chomdej , Jing Che , Nikolay A. Poyarkov Matsui M, Hamidy A, Belabut DM, Ahmad N, Panha S, Sudin A, et al. 2011. 1 Division of Fishery, School of Agriculture and Natural Resources, Systematic relationships of oriental tiny frogs of the family Microhylidae University of Phayao, Phayao 56000, Thailand (Amphibia, Anura) as revealed by mtDNA genealogy. Molecular
2 Department of Species Conservation, Save Vietnam’s Wildlife Phylogenetics and Evolution, 61(1): 167−176. Center, Ninh Binh, Vietnam Munir M, Hamidy A, Matsui M, Kusrini MD, Nishikawa K. 2020. A new species of Micryletta (Amphibia: Anura) from Sumatra, Indonesia. 3 Faculty of Biology, Department of Vertebrate Zoology, Moscow
Zoological Science, 37(3): 295−301. State University, Moscow 119234, Russia Poyarkov NA, Nguyen TV, Duong TV, Gorin VA, Yang JH. 2018. A new 4 Department of Biology, Faculty of Science, Chiang Mai limestone-dwelling species of Micryletta (Amphibia: Anura: Microhylidae) University, Chiang Mai 50200, Thailand
from northern Vietnam. PeerJ, 6: e5771. 5 Research Center in Bioresources for Agriculture, Industry and Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Medicine, Chiang Mai University, Chiang Mai 50200, Thailand molecular evolutionary genetics analysis version 6.0. Molecular Biology and 6 State Key Laboratory of Genetic Resources and Evolution,
Evolution , 30(12): 2725−2729. Kunming Institute of Zoology, Chinese Academy of Sciences, Van Steenis CGGJ. 1950. The delimitation of Malesia and its main plant Kunming, Yunnan 650223, China
geographical divisions. Flora Malesiana Series, 1: 70−75. 7 Southeast Asia Biodiversity Research Institute, Chinese Vieites DR, Wollenberg KC, Andreone F, Köhler J, Glaw F, Vences M. Academy of Sciences, Yezin Nay Pyi Taw 05282, Myanmar 2009. Vast underestimation of Madagascar's biodiversity evidenced by an 8 Laboratory of Tropical Ecology, Joint Russian-Vietnamese integrative amphibian inventory. Proceedings of the National Academy of Tropical Research and Technological Center, Hanoi, Vietnam
Sciences of the United States of America, 106(20): 8267−8272. *Corresponding author, E-mail: [email protected] Wood PL Jr, Grismer LL, Youmans TM, Nasir NB, Ahmad N, Senwai J. 2008. Additions to the herpetofauna of Endau-Rompin, Johor, west REFERENCES
Malaysia. Herpetological Review, 39(1): 112−121. Alhadi F, Hamidy A, Farajallah A, Munir M, Atmaja VY, Garg S, et al. 2019. Zug GR, Mulcahy DG. 2020. The Amphibians and Reptiles of South Rediscovery of Micryletta inornata (Boulenger, 1890) from Sumatra: Tanintharyi. Cambridge, U. K.: Fauna & Flora International, 1−203.
588 www.zoores.ac.cn SUPPLEMENTARY MATERIALS
Supplementary Methods
Laboratory methods. For molecular phylogenetic analyses, we extracted total genomic DNA from ethanol-preserved femoral muscle tissue using standard phenol-chloroform-proteinase K extraction procedures with consequent isopropanol precipitation, to a final concentration of ~1 mg/mL (protocols followed Hillis et al., 1996 and Sambrook & Russell, 2001). We visualized the isolated total genomic DNA in agarose electrophoresis in the presence of ethidium bromide. We measured the concentration of total DNA in 1 μL using a NanoDrop 2000 (Thermo Scientific, USA), and consequently adjusted the concentration to ca. 100 ng DNA/μL. We amplified mtDNA fragments covering partial sequences of the 16S rRNA mtDNA gene to obtain a 569 bp length continuous fragment of mtDNA. The 16S rRNA gene is widely applied in biodiversity surveys in amphibians (Vences et al., 2005a, 2005b; Vieites et al., 2009), and has been used in most recent phylogenetic studies on Microhylinae (Matsui et al., 2011; Peloso et al., 2016; Tu et al., 2018). We performed DNA amplification in 20 μL reactions using ca. 50 ng genomic DNA, 10 nmol of each primer, 15 nMol of each dNTP, 50 nMol additional MgCl2, Taq PCR buffer (10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 1.1 mmol/L MgCl2, and 0.01% gelatin), and 1 unit of Taq DNA polymerase. Primers used in PCR and sequencing included 16sL1 (CTGACCGTGCAAAGGTAGCGTAATCACT) and 16H-1 (CTCCGGTCTGAACTCAGATCACGTAGG) (Hedges, 1994). The PCR conditions included an initial denaturation step of 5 min at 94 °C and 43 cycles of denaturation for 1 min at 94 °C, primer annealing for 1 min with the TouchDown program from 65 °C to 55 °C reducing 1 °C every cycle, extension for 1 min at 72 °C, and final extension step for 5 min at 72 °C.
The PCR products were loaded onto 1.5% agarose gels in the presence of ethidium bromide and visualized via agarose electrophoresis. When distinct bands were produced, we purified the PCR products using 2 μL of a 1:4 dilution of ExoSapIt (Amersham, USA) per 5 μL of PCR product prior to cycle sequencing. The 10 μL sequencing reaction included 2 μL of template, 2.5 μL of sequencing buffer, 0.8 μL of 10 pmol primer, 0.4 μL of BigDye Terminator v3.1 Sequencing Standard (Applied Biosystems, USA), and 4.2 μL of water. The cycle sequencing used 35 cycles of 10 s at 96 °C, 10 s at 50 °C, and 4 min at 60 °C. We purified the cycle sequencing products by ethanol precipitation. We carried out sequence data collection and visualization on an ABI 3730xl Automated Sequencer (Applied Biosystems, USA). The obtained sequences were deposited in GenBank under accession numbers MT573413–MT573416 (see Supplementary Table S1).
Phylogenetic analyses. To reconstruct the matrilineal genealogy, we used 16S rRNA sequences of the Micryletta sp. from Songkhla Province, as well as 16S rRNA sequences of all currently recognized Micryletta species and subspecies and several undescribed lineages reported in earlier phylogenetic studies of the genus (Alhadi et al., 2019; Das et al., 2019; Munir et al., 2020; Poyarkov et al., 2018). GenBank accession numbers, museum vouchers, and localities of origin for sequences used in this study are summarized in Supplementary Table S1. We also added a sequence of Mysticellus franki, the sister taxon of Micryletta, as an outgroup (Garg & Biju, 2019); sequences of Kaloula pulchra and Uperodon systoma were used to root the tree. In total, we obtained 16S rRNA data from 31 specimens, including four sequences of Micryletta sp. from Songkhla, 27 sequences of all other species of Micryletta from Thailand, Laos, Vietnam, India, China, and Indonesia, including type specimens of M. sumatrana (Sumatra, Indonesia), M. aishani (India), and M. nigromaculata (Vietnam), topotype specimens of M. inornata (Sumatra), M. erythropoda (Ma Da, Dong Nai, Vietnam), and M. steinegeri (China, Taiwan), and three outgroup sequences of other Microhylinae (Mysticellus franki, Uperodon systoma, Kaloula pulchra) (see Supplementary Table S1).
We initially aligned nucleotide sequences using ClustalX 1.81 (Thompson et al., 1997) with default parameters, and then optimized them manually in BioEdit 7.0.5.2 (Hall, 1999). We used MODELTEST v.3.06 (Posada & Crandall, 1998) to estimate the optimal evolutionary models to be used for dataset analysis. The best-fitting model for the 16S rRNA gene fragment was the GTR+I+G model of DNA evolution, as suggested by the Akaike Information Criterion (AIC). We determined mean uncorrected genetic distances (p-distances) between sequences with MEGA 6.0 (Tamura et al., 2013). We inferred matrilineal genealogy using Bayesian inference (BI) and maximum-likelihood (ML) approaches. We conducted BI in MrBayes 3.1.2 (Ronquist & Huelsenbeck, 2003); Metropolis-coupled Markov chain Monte Carlo (MCMCMC) analyses were run with one cold chain and three heated chains for one million generations, with sampling every 100 generations. We performed five independent MCMCMC runs and the initial 2 500 trees were discarded as burn-in. We assessed confidence in tree topology by the frequency of nodal resolution (posterior probability; BI PP) (Huelsenbeck & Ronquist, 2001). We conducted ML analyses with the RAxML web server (http://embnet.vital-it.ch/raxml-bb/, Stamatakis et al., 2008), which was used to search ML trees with the gamma model of rate heterogeneity option. We assessed nodal confidence by non-parametric bootstrapping (ML BS) with 1 000 pseudoreplicates (Felsenstein, 1985).
In both datasets, we regarded tree nodes with ML BS values of 75% or greater and BI PP values over 0.95 to be sufficiently resolved a priori. ML BS values between 75% and 50% and BI PP values between 0.95 and 0.90 were regarded as tendencies. Lower values were considered to indicate unresolved nodes (Huelsenbeck & Hillis, 1993).
Morphological description. The morphometrics of adults and character terminology followed Poyarkov et al. (2018): (1) snout-vent length (SVL; tip of snout to cloaca); (2) head length (HL; tip of snout to hind border of jaw angle); (3) snout length (SL; anterior corner of eye to tip of snout); (4) eye length (EL; distance between anterior and posterior corners of eye); (5) nostril-eye length (N-EL; distance between anterior corner of eye and nostril center); (6) head width (HW; maximum width of head on level of mouth angles in ventral view); (7) internarial distance (IND; distance between central points of nostrils); (8) interorbital distance (IOD; shortest distance between medial edges of eyeballs in dorsal view); (9) upper eyelid width (UEW; maximum distance between medial edge of eyeball and lateral edge of upper eyelid); (10) tympanum length (horizontal tympanum diameter (TMP); (11) forelimb length (FLL; length of straightened forelimb to tip of third finger); (12) lower arm and hand length (LAL; distance between elbow and tip of third finger); (13) hand length (HAL; distance between proximal end of outer palmar (metacarpal) tubercle and tip of third finger); (14) first finger length (1FL, distance between tip and distal end of inner palmar tubercle); (15) inner palmar tubercle length (IPTL; maximum distance between proximal and distal ends of inner palmar tubercle); (16) outer palmar tubercle length (OPTL; maximum diameter of outer palmar tubercle); (17) third finger disk diameter (3FDD); (18) hindlimb length (HLL; length of straightened hindlimb from groin to tip of fourth toe); (19) tibia length (TL; distance between knee and tibiotarsal articulation); (20) foot length (FL; distance between distal end of tibia and tip of fourth toe); (21) inner metatarsal tubercle length (IMTL; maximum length of inner metatarsal tubercle); (22) first toe length (1TOEL), distance between distal end of inner metatarsal tubercle and tip of first toe; (23) fourth toe disk diameter (4TDD). For holotype description, we took the following measurements: (24–26) second to fourth finger lengths (2–3FL-O, 4FL-I; for outer side (O) of second and third, inner side (I) of fourth, distance between tip and junction of neighboring finger); (27–30) second to fifth toe lengths (outer lengths for toes II–IV, inner length for toe V; 2–5TOEL); (31) nostril-snout length (N-SN), distance between middle of nostril and snout tip.
Terminology for describing eye coloration in living individuals was in accordance with Glaw & Vences (1997); subarticular tubercle formulas followed those of Savage (1975). All measurements were taken on the right side of the examined specimen. Sex was determined by gonadal inspection following dissection.
Comparative data on the morphology and taxonomy of Micryletta were obtained from previous publications on the genus: including M. aishani (Das et al., 2019); M. erythropoda (Tarkhnishvili, 1994; Vassilieva et al., 2016); M. inornata (Alhadi et al., 2019; Boulenger, 1890; Taylor, 1962), M. lineata (Taylor, 1962; Zug & Mulcahy, 2020); M. nigromaculata (Poyarkov et al., 2018); M. steinegeri (Boulenger, 1909; Das et al., 2019; Fei et al., 2009, 2012); and M. sumatrana (Munir et al., 2020).
REFERENCES
Alhadi F, Hamidy A, Farajallah A, Munir M, Atmaja VY, Garg S, et al. 2019. Rediscovery of Micryletta inornata (Boulenger, 1890) from Sumatra: redescription, molecular identity, and taxonomic implications. Zootaxa, 4613(1): 111–126. Blackburn DC, Siler CD, Diesmos AC, McGuire JA, Cannatella DC, Brown RM. 2013. An adaptive radiation of frogs in a Southeast Asian island archipelago. Evolution, 67(9): 2631–2646. Boulenger GA. 1890. List of the reptiles, batrachians, and freshwater fishes collected by Professor Moesch and Mr. Iversein in the district of Deli, Sumatra. Proceedings of the Zoological Society of London, 1890: 31–40. Boulenger GA. 1909. Descriptions of four new frogs and a new snake discovered by Mr. H. Sauter in Formosa. Annals and Magazine of Natural History, Series 8, 4: 492–495. Das A, Garg S, Hamidy A, Smith EN, Biju SD. 2019. A new species of Micryletta frog (Microhylidae) from Northeast India. PeerJ, 7: e7012. de Sá RO, Streicher JW, Sekonyela R, Forlani MC, Loader SP, Greenbaum E, et al. 2012. Molecular phylogeny of microhylid frogs (Anura: Microhylidae) with emphasis on relationships among New World genera. BMC Evolutionary Biology, 12(1): 241.
Fei L, Hu SQ, Ye CE, Huang YZ. 2009. Fauna Sinica Amphibia Anura, Volume 2. Beijing: Science Press.
Fei L, Ye CY, Jiang JP. 2012. Colored Atlas of Chinese Amphibians and Their Distributions. Sichuan: Sichuan Publishing House of Science & Technology.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39(4): 783−791.
Garg S, Biju SD. 2019. New microhylid frog genus from Peninsular India with Southeast Asian affinity suggests multiple Cenozoic biotic exchanges between India and Eurasia. Scientific Reports, 9(1): 1906. Garg S, Suyesh R, Das A, Jiang JP, Wijayathilaka N, Amarasinghe AAT, et al. 2019. Systematic revision of Microhyla (Microhylidae) frogs of South Asia: a molecular, morphological, and acoustic assessment. Vertebrate Zoology, 69(1): 1–71. Glaw F, Vences M. 1997. Anuran eye colouration: definitions, variation, taxonomic implications and possible functions. In: Böhme W, Bischoff W, Ziegler T. Herpetologia Bonnensis. Bonn: SEH Proceedings, 125–138.
Grosjean S, Ohler A, Chuaynkern Y, Cruaud C, Hassanin A. 2015. Improving biodiversity assessment of anuran amphibians using DNA barcoding of tadpoles. Case studies from Southeast Asia. Comptes Rendus Biologies, 338(5): 351–361.
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41: 95–98.
Hedges SB. 1994. Molecular evidence for the origin of birds. Proceedings of the National Academy of Sciences of the United States of America, 91(7): 2621–2624.
Hillis DM, Moritz C, Mable BK. 1996. Molecular Systematics. 2nd ed. Sunderland, Massachusetts, U. S. A: Sinauer Associates, 1–655.
Huelsenbeck JP, Hillis DM. 1993. Success of phylogenetic methods in the four-taxon case. Systematic Biology, 42(3): 247–264.
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17(8): 754–755.
Kurabayashi A, Matsui M, Belabut DM, Yong HS, Ahmad N, Sudin A, et al. 2011. From Antarctica or Asia? New colonization scenario for Australian-New Guinean narrow mouth toads suggested from the findings on a mysterious genus Gastrophrynoides. BMC Evolutionary Biology, 11(1): 175.
Matsui M, Hamidy A, Belabut DM, Ahmad N, Panha S, Sudin A, et al. 2011. Systematic relationships of Oriental tiny frogs of the family Microhylidae (Amphibia, Anura) as revealed by mtDNA genealogy. Molecular Phylogenetics and Evolution, 61(1): 167–176. Munir M, Hamidy A, Matsui M, Kusrini MD, Nishikawa K. 2020. A new species of Micryletta (Amphibia: Anura) from Sumatra, Indonesia. Zoological Science, 37(3): 295–301.
Peloso PLV, Frost DR, Richards SJ, Rodrigues MT, Donnellan S, Matsui M, et al. 2016. The impact of anchored phylogenomics and taxon sampling on phylogenetic inference in narrow-mouthed frogs (Anura, Microhylidae). Cladistics, 32(2): 113–140.
Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics, 14(9): 817–818.
Poyarkov NA, van Nguyen T, van Duong T, Gorin VA, Yang JH. 2018. A new limestone-dwelling species of Micryletta (Amphibia: Anura: Microhylidae) from northern Vietnam. PeerJ, 6: e5771.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19(12): 1572–1574.
Sambrook JF, Russell RW. 2001. Molecular Cloning: A Laboratory Manual. 3rd ed. New York: Cold Spring Harbor Laboratory Press, New York.
Savage JM. 1975. Systematics and distribution of the Mexican and Central American stream frogs related to Eleutherodactylus rugulosus. Copeia, 2: 254–306.
Stamatakis A, Hoover P, Rougemont J. 2008. A rapid bootstrap algorithm for the RAxML web servers. Systematic Biology, 57(5): 758−771.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30(12): 2725–2729.
Tarkhnishvili DN. 1994. Amphibian communities of the southern Viet Nam: preliminary data. Journal of the Bengal Natural History Society, New Series, 13(1): 3–62.
Taylor EH. 1962. The amphibian fauna of Thailand. University of Kansas Science Bulletin, 43: 265–599. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25(24): 4876–4882.
Tu N, Yang MH, Liang D, Zhang P. 2018. A large-scale phylogeny of Microhylidae inferred from a combined dataset of 121 genes and 427 taxa. Molecular Phylogenetics and Evolution, 126: 85–91.
Vassilieva AB, Galoyan EA, Poyarkov NA, Geissler P. 2016. A Photographic Field Guide to the Amphibians and Reptiles of the Lowland Monsoon Forests of Southern Vietnam. Frankfurt-am-Main: Chimaira, 1–319.
Vences M, Thomas M, Bonett RM, Vieites DR. 2005a. Deciphering amphibian diversity through DNA barcoding: chances and challenges. Philosophical Transactions of the Royal Society B: Biological Sciences, 360(1462): 1859−1868.
Vences M, Thomas M, van der Meijden A, Chiari Y, Vieites DR. 2005b. Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians. Frontiers in Zoology, 2(1): 5.
Vieites DR, Wollenberg KC, Andreone F, Köhler J, Glaw F, Vences M. 2009. Vast underestimation of Madagascar's biodiversity evidenced by an integrative amphibian inventory. Proceedings of the National Academy of Sciences of the United States of America, 106(20): 8267−8272.
Zug GR, Mulcahy DG. 2020. The Amphibians and Reptiles of South Tanintharyi. Cambridge, U. K.: Fauna & Flora International, 1−203.
Supplementary Table S1. Localities, voucher information, and GenBank accession numbers for all specimens used in molecular analyses in this study. Locality numbers correspond to those in Figure 1. For references see Supplementary Methods section.
Species Specimen ID Locality GenBank no. References
M. aishani SDBDU 3920 India: Assam, Cachar district, Subhong MK889218 Das et al. (2019)
M. dissimulans sp. nov. AUP01690 Thailand: Songkla Prov., Saba Yoi district MT573414 this study
M. dissimulans sp. nov. AUP01691 Thailand: Songkla Prov., Saba Yoi district MT573415 this study
M. dissimulans sp. nov. AUP01696 Thailand: Songkla Prov., Saba Yoi district MT573416 this study
M. dissimulans sp. nov. AUP01698 Thailand: Songkla Prov., Saba Yoi district MT573413 this study
M. erythropoda ZMMU A4721-1533 Vietnam: Dong Nai, Ma Da (Vinh Cuu) N.R. MH756146 Poyarkov et al. (2018)
M. erythropoda ZMMU A4721-1542 Vietnam: Dong Nai, Ma Da (Vinh Cuu) N.R. MH756147 Poyarkov et al. (2018)
M. inornata MZB Amph 23949 Indonesia: Sumatra, Deli Serdang LC208135 Alhadi et al. (2019)
M. inornata MZB Amph 23947 Indonesia: Sumatra, Deli Serdang LC208136 Alhadi et al. (2019)
M. inornata MZB Amph 23948 Indonesia: Sumatra, Deli Serdang LC208137 Alhadi et al. (2019)
M. inornata MZB Amph 27242 Indonesia: Sumatra, Aceh LC208138 Alhadi et al. (2019)
M. cf. lineata KUHE 23858 Thailand: Ranong AB634695 Matsui et al. (2011)
M. cf. lineata CAS 247206 Myanmar: Tanintharyi Div., Kawthaung dist. KM509167 Peloso et al. (2016)
M. nigromaculata ZMMU A5947 Vietnam: Hai Phong, Cat Ba N.P. MH756148 Poyarkov et al. (2018)
M. nigromaculata ZMMU A5937 Vietnam: Hai Phong, Cat Ba N.P. MH756149 Poyarkov et al. (2018)
M. nigromaculata ZMMU A5946 Vietnam: Hai Phong, Cat Ba N.P. MH756151 Poyarkov et al. (2018)
M. nigromaculata DTU 301 Vietnam: Ninh Binh, Cuc Phuong N.P. MH756154 Poyarkov et al. (2018)
M. steinegeri KUHE 35937 China: Taiwan: Yunlin AB634696 Matsui et al. (2011)
M. cf. steinegeri KUHE 20497 Thailand: Phrae, Mae Yom AB598341 Matsui et al. (2011)
M. cf. steinegeri K 3246 Laos: Luangprabang Prov., Ban Sop Chuna KC180027 de Sá et al. (2012)
M. cf. steinegeri TZ9892 Vietnam: Ha Tinh, Ke Go AF285206 unpublished M. cf. steinegeri ZMMU NAP-3580 Vietnam: Hai Phong, Cat Ba N.P. MH879845 Poyarkov et al. (2018)
M. cf. steinegeri K3068 Thailand: Chiang Mai, Doi Chiang Dao KR827953 Grosjean et al. (2015)
M. cf. steinegeri KUHE 35133 Laos AB611968 Kurabayashi et al. (2011)
M. cf. steinegeri FMNH 255121 Laos: Boualapha, Khammouan Prov. KC822494 Blackburn et al. (2013)
M. cf. steinegeri DTU 310 Vietnam: Ninh Binh, Cuc Phuong N.P. MH879840 Poyarkov et al. (2018)
M. sumatrana MZB Amph 30594 Indonesia, Sumatra Selatan, Musi Banyuasin MN727065 Munir et al. (2020)
Micryletta sp. 1 FMNH 255123 Laos: Thaphabat, Bolikhamxay KC822493 Blackburn et al. (2013)
Outgroup
Mysticellus franki ZSI/WGRC/V/A/967 India: Kerala, Wayand MK285340 Garg and Biju (2019)
Uperodon systoma SDBDU 2005.4723 India: Tamil Nadu: Kunnapattu MG557949 Garg et al. (2019)
Kaloula pulchra NMNS 3208 China KC822614 Blackburn et al. (2013)
Supplementary Table S2. Uncorrected p-distance (percentage) 16S rRNA sequences of Micryletta species included in phylogenetic analyses (below diagonal), average intraspecific genetic p-distances (on diagonal), and standard error estimates (above diagonal).
Species 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 M. cf. steinegeri A 0.3 0.6 0.7 0.7 0.6 0.9 0.9 0.7 1.1 1.0 1.2 1.1 0.9 1.3 2 M. cf. steinegeri B 2.4 1.8 0.8 0.8 0.7 1.0 1.0 0.8 1.2 1.1 1.4 1.2 1.0 1.4 3 M. cf. steinegeri C 2.9 4.1 0.4 0.7 0.6 0.9 0.9 0.7 1.0 1.1 1.4 1.1 1.0 1.3 4 M. steinegeri s. str. D 2.1 3.5 2.8 - 0.5 0.9 1.0 0.8 1.0 1.0 1.3 1.1 1.0 1.4 5 M. cf. steinegeri E 1.9 3.1 2.2 1.2 - 0.8 0.9 0.7 1.0 1.0 1.2 1.1 0.9 1.3 6 M. cf. lineata 4.4 5.3 4.6 4.2 3.4 0.0 0.7 0.8 1.1 1.0 1.4 1.1 1.0 1.3 7 M. erythropoda 5.6 6.5 5.8 5.6 4.8 2.6 0.0 0.9 1.0 1.2 1.6 1.2 1.1 1.3 8 M. aishani 3.4 4.5 3.2 3.6 3.0 3.4 4.8 - 0.9 0.9 1.1 1.0 0.9 1.4 9 M. inornata 5.9 6.9 5.0 5.0 4.8 6.1 7.1 4.7 0.6 1.1 1.5 1.2 1.1 1.3 10 M. nigromaculata 5.9 7.0 5.9 5.3 5.2 5.6 7.7 4.7 6.0 0.7 0.9 1.0 0.9 1.4 11 Micryletta sp. 1 5.7 6.5 7.0 6.3 4.9 5.5 7.4 4.3 6.5 2.8 - 1.8 1.3 2.0 12 M. sumatrana 6.5 8.0 7.5 6.0 6.5 7.5 9.3 6.0 7.9 5.9 9.1 - 1.0 1.4 13 M. dissimulans sp. nov. 5.1 6.6 5.8 4.8 4.8 6.0 7.4 4.4 5.5 5.0 5.5 5.2 0.0 1.3 14 Mysticellus franki 8.9 10.1 8.8 8.8 8.5 8.8 9.8 9.0 9.5 9.6 12.1 10.8 9.0 -
Supplementary Figure S1. Holotype of Micryletta dissimulans sp. nov. (AUP01690), adult male, in life. (A) General dorsolateral view; (B) ventral view; (C) lateral view of head; (D) volar view of left hand; (E) plantar view of right foot. Photos by P. Pawangkhanant.
Supplementary Figure S2. Holotype of Micryletta dissimulans sp. nov. (AUP01690), adult male in preservative. (A) Dorsal view; (B) ventral view. Scale bar equals 5 mm. Photos by C. Suwannapoom.
Supplementary Figure S3. Paratypes of Micryletta dissimulans sp. nov. in preservative (dorsal view). Scale bar equals 5 mm. Photos by C. Suwannapoom.
Supplementary Figure S4. Paratype of Micryletta dissimulans sp. nov. (AUP01696), gravid female, in life. (A) General dorsolateral view; (B) ventral view. Photos by P. Pawangkhanant.
Supplementary Figure S5. Habitat of Micryletta dissimulans sp. nov. at the type locality in Saba Yoi District, Songkhla Province, Southern Thailand. (A), (B) Secondary lowland bamboo forest showing microhabitat of the new species. Photos by P. Pawangkhanant.