Suppl Tabl.S4-Bimodal Genes TIVA-Tag
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Supplement 1 Overview of Dystonia Genes
Supplement 1 Overview of genes that may cause dystonia in children and adolescents Gene (OMIM) Disease name/phenotype Mode of inheritance 1: (Formerly called) Primary dystonias (DYTs): TOR1A (605204) DYT1: Early-onset generalized AD primary torsion dystonia (PTD) TUBB4A (602662) DYT4: Whispering dystonia AD GCH1 (600225) DYT5: GTP-cyclohydrolase 1 AD deficiency THAP1 (609520) DYT6: Adolescent onset torsion AD dystonia, mixed type PNKD/MR1 (609023) DYT8: Paroxysmal non- AD kinesigenic dyskinesia SLC2A1 (138140) DYT9/18: Paroxysmal choreoathetosis with episodic AD ataxia and spasticity/GLUT1 deficiency syndrome-1 PRRT2 (614386) DYT10: Paroxysmal kinesigenic AD dyskinesia SGCE (604149) DYT11: Myoclonus-dystonia AD ATP1A3 (182350) DYT12: Rapid-onset dystonia AD parkinsonism PRKRA (603424) DYT16: Young-onset dystonia AR parkinsonism ANO3 (610110) DYT24: Primary focal dystonia AD GNAL (139312) DYT25: Primary torsion dystonia AD 2: Inborn errors of metabolism: GCDH (608801) Glutaric aciduria type 1 AR PCCA (232000) Propionic aciduria AR PCCB (232050) Propionic aciduria AR MUT (609058) Methylmalonic aciduria AR MMAA (607481) Cobalamin A deficiency AR MMAB (607568) Cobalamin B deficiency AR MMACHC (609831) Cobalamin C deficiency AR C2orf25 (611935) Cobalamin D deficiency AR MTRR (602568) Cobalamin E deficiency AR LMBRD1 (612625) Cobalamin F deficiency AR MTR (156570) Cobalamin G deficiency AR CBS (613381) Homocysteinuria AR PCBD (126090) Hyperphelaninemia variant D AR TH (191290) Tyrosine hydroxylase deficiency AR SPR (182125) Sepiaterine reductase -
Edinburgh Research Explorer
Edinburgh Research Explorer International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list Citation for published version: Davenport, AP, Alexander, SPH, Sharman, JL, Pawson, AJ, Benson, HE, Monaghan, AE, Liew, WC, Mpamhanga, CP, Bonner, TI, Neubig, RR, Pin, JP, Spedding, M & Harmar, AJ 2013, 'International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list: recommendations for new pairings with cognate ligands', Pharmacological reviews, vol. 65, no. 3, pp. 967-86. https://doi.org/10.1124/pr.112.007179 Digital Object Identifier (DOI): 10.1124/pr.112.007179 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Pharmacological reviews Publisher Rights Statement: U.S. Government work not protected by U.S. copyright General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 1521-0081/65/3/967–986$25.00 http://dx.doi.org/10.1124/pr.112.007179 PHARMACOLOGICAL REVIEWS Pharmacol Rev 65:967–986, July 2013 U.S. -
Large XPF-Dependent Deletions Following Misrepair of a DNA Double Strand Break Are Prevented by the RNA:DNA Helicase Senataxin
www.nature.com/scientificreports OPEN Large XPF-dependent deletions following misrepair of a DNA double strand break are prevented Received: 26 October 2017 Accepted: 9 February 2018 by the RNA:DNA helicase Published: xx xx xxxx Senataxin Julien Brustel1, Zuzanna Kozik1, Natalia Gromak2, Velibor Savic3,4 & Steve M. M. Sweet1,5 Deletions and chromosome re-arrangements are common features of cancer cells. We have established a new two-component system reporting on epigenetic silencing or deletion of an actively transcribed gene adjacent to a double-strand break (DSB). Unexpectedly, we fnd that a targeted DSB results in a minority (<10%) misrepair event of kilobase deletions encompassing the DSB site and transcribed gene. Deletions are reduced upon RNaseH1 over-expression and increased after knockdown of the DNA:RNA helicase Senataxin, implicating a role for DNA:RNA hybrids. We further demonstrate that the majority of these large deletions are dependent on the 3′ fap endonuclease XPF. DNA:RNA hybrids were detected by DNA:RNA immunoprecipitation in our system after DSB generation. These hybrids were reduced by RNaseH1 over-expression and increased by Senataxin knock-down, consistent with a role in deletions. Overall, these data are consistent with DNA:RNA hybrid generation at the site of a DSB, mis-processing of which results in genome instability in the form of large deletions. DNA is the target of numerous genotoxic attacks that result in diferent types of damage. DNA double-strand breaks (DSBs) occur at low frequency, compared with single-strand breaks and other forms of DNA damage1, however DSBs pose the risk of translocations and deletions and their repair is therefore essential to cell integrity. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
G Protein-Coupled Receptors in Stem Cell Maintenance and Somatic Reprogramming to Pluripotent Or Cancer Stem Cells
BMB Reports - Manuscript Submission Manuscript Draft Manuscript Number: BMB-14-250 Title: G protein-coupled receptors in stem cell maintenance and somatic reprogramming to pluripotent or cancer stem cells Article Type: Mini Review Keywords: G protein-coupled receptors; stem cell maintenance; somatic reprogramming; cancer stem cells; pluripotent stem cell Corresponding Author: Ssang-Goo Cho Authors: Ssang-Goo Cho1,*, Hye Yeon Choi1, Subbroto Kumar Saha1, Kyeongseok Kim1, Sangsu Kim1, Gwang-Mo Yang1, BongWoo Kim1, Jin-hoi Kim1 Institution: 1Department of Animal Biotechnology, Animal Resources Research Center, and Incurable Disease Animal Model and Stem Cell Institute (IDASI), Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 143-701, Republic of Korea, UNCORRECTED PROOF 1 G protein-coupled receptors in stem cell maintenance and somatic reprogramming to 2 pluripotent or cancer stem cells 3 4 Hye Yeon Choi, Subbroto Kumar Saha, Kyeongseok Kim, Sangsu Kim, Gwang-Mo 5 Yang, BongWoo Kim, Jin-hoi Kim, and Ssang-Goo Cho 6 7 Department of Animal Biotechnology, Animal Resources Research Center, and 8 Incurable Disease Animal Model and Stem Cell Institute (IDASI), Konkuk University, 9 120 Neungdong-ro, Gwangjin-gu, Seoul 143-701, Republic of Korea 10 * 11 Address correspondence to Ssang-Goo Cho, Department of Animal Biotechnology and 12 Animal Resources Research Center. Konkuk University, 120 Neungdong-ro, Gwangjin- 13 gu, Seoul 143-701, Republic of Korea. Tel: 82-2-450-4207, Fax: 82-2-450-1044, E-mail: 14 [email protected] 15 16 17 18 19 1 UNCORRECTED PROOF 20 Abstract 21 The G protein-coupled receptors (GPCRs) compose the third largest gene family in the 22 human genome, representing more than 800 distinct genes and 3–5% of the human genome. -
Supp Material.Pdf
Simon et al. Supplementary information: Table of contents p.1 Supplementary material and methods p.2-4 • PoIy(I)-poly(C) Treatment • Flow Cytometry and Immunohistochemistry • Western Blotting • Quantitative RT-PCR • Fluorescence In Situ Hybridization • RNA-Seq • Exome capture • Sequencing Supplementary Figures and Tables Suppl. items Description pages Figure 1 Inactivation of Ezh2 affects normal thymocyte development 5 Figure 2 Ezh2 mouse leukemias express cell surface T cell receptor 6 Figure 3 Expression of EZH2 and Hox genes in T-ALL 7 Figure 4 Additional mutation et deletion of chromatin modifiers in T-ALL 8 Figure 5 PRC2 expression and activity in human lymphoproliferative disease 9 Figure 6 PRC2 regulatory network (String analysis) 10 Table 1 Primers and probes for detection of PRC2 genes 11 Table 2 Patient and T-ALL characteristics 12 Table 3 Statistics of RNA and DNA sequencing 13 Table 4 Mutations found in human T-ALLs (see Fig. 3D and Suppl. Fig. 4) 14 Table 5 SNP populations in analyzed human T-ALL samples 15 Table 6 List of altered genes in T-ALL for DAVID analysis 20 Table 7 List of David functional clusters 31 Table 8 List of acquired SNP tested in normal non leukemic DNA 32 1 Simon et al. Supplementary Material and Methods PoIy(I)-poly(C) Treatment. pIpC (GE Healthcare Lifesciences) was dissolved in endotoxin-free D-PBS (Gibco) at a concentration of 2 mg/ml. Mice received four consecutive injections of 150 μg pIpC every other day. The day of the last pIpC injection was designated as day 0 of experiment. -
Phenotypic Spectrum and Long-Term Outcome in Children with Genetic Causes of Early-Onset Epileptic Encephalopathy
Phenotypic Spectrum and Long-term Outcome in Children With Genetic Causes of Early-onset Epileptic Encephalopathy Chunhui Hu Department of Neurology, Children’s Hospital of Fudan University Deying Liu Wuhan Children’s hospital, Tongji Medical college, Huazhong University of Science & Technology Tian Luo Department of Neurology, Children’s Hospital of Fudan University Yi Wang ( [email protected] ) Department of Neurology, Children’s Hospital of Fudan University Zhisheng Liu Wuhan Children’s hospital, Tongji Medical college, Huazhong University of Science & Technology Research Article Keywords: Phenotypic spectrum, Long-term outcome, Genetic, EOEE, Therapy Posted Date: March 11th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-257334/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/23 Abstract Background To explore the clinical phenotype and long-term outcome in children with genetic causes of early-onset epileptic encephalopathies. Methods The clinical data of 118 children between 2010 and 2020 was obtained and analyzed. The whole exome sequencing and copy number variation studies in family were used to nd pathogenic mutations. The conrmed mutations were veried by Sanger sequencing. Results Among 118 patients, 39 patients were diagnosed with DS, 18 were WS, 3 were OS, 3 were EME, 2 were MMFSI, 1 was GLUT1 deciency syndrome, 1 was Pyridoxine dependent epilepsy and 51 were non-symptomatic EOEEs. The initial EEG showed frequent multiple and multifocal sharp waves, spike waves, sharp slow waves or spike slow waves. In the later period, some transformed into infrequent discharging or normal EEG. 112 patients (112/118, 94.9%) showed normal brain MRI, and the remaining 6 had widened extracerebral space. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A. -
Neurotransmission: Receptor Signaling
Neurotransmission - receptor and channel signaling GPCRs TYROSINE KINASES ION CHANNELS Neurotrophins BDNF NGF NT-3 Glutamate GABA ACh GDNF Neurturin Artemin Persepin NT-4/5 Glutamate Anandamide ATP Glycine γ 2 1 4 3 / α α α 2-AG α β / α A GFR GFR GFR GFR NTR mGLuR A/B/C X1, 2, 3 CB1/2 2 EphA/B* Ephrin RET Trk p75 AMPA/KainateNMDAR P GABA GlyR nAChR IP3 Lyn released Ephexin Fyn Rapsin Homer DAG Adenylate PI3K Grb4 Src PSD95 HAP1 Syntrophin i PD Shc Gephyrin Gi/q cyclase Gi K PLC GABARAP NcK 2RGS3 PI3 Shc + 2+ 2+ GRIF1 PI3K PLC γ Na Ca Ca P PI3K Grb2 PLCβ/γ PKC nNOS γ FAK PiP3/4 SOS MEK CaM Cl- Gephyrin Cl- ER NFkB PDEI PKA Rac RhoA RasGAP Src PTEN PKC Ras GTPase ERK CaMK Cl- 2+ PKK2 Calcineurin Ca ROCK ERK FRS2 AKT/PKB released Raf JNK nNOS SynGAP Grb2 actin MEK 1/2 P Ser133 Inhibition Excitation Src SOS Cell survival CREB of signaling of signaling RAS P CREB ERK 1/2 P P MAPK GSK3 ELK RSK NFκB CREB CREB gene Long term Cytoskeleton transcription synaptic dynamics, neurite ASK1 Bad CRE plasticity (LTP) P P extension CREB CREB Short term MKK3/6 Apoptosis plasticity Others Other GPCRs - ARA9 ACh (Muscarinic): M1, M2, M3, M4 CRE p38MAPK c-fos Potassium - ASICβ, ASIC3 Adrenalin: Alpha1b, 1c, 1d - KChIP2 - DDR 1, 2 ATP: P2Y MSK1 c-jun c-fos gene - KCNQ 3, 5 - ENSA Dopamine: D1, D4 transcription - Kv beta 2 - GJB1 GABA: GABAB receptor - Kv 1.2 - SLC31A1 μ δ κ P P Opioid: , , CREB CREB AP1 - Kv 1.3 - TRAR4 Neurotensin: 1, 2 Growth, - Kv 1.4 - TRPM7 Neurokinin: NKA, NKB, NK1, Calcitonin development & Sodium - Kv 2.2 - VR1 * forward/reverse signalling