1078-0432.CCR-18-0586.Full.Pdf

Author Manuscript Published OnlineFirst on November 5, 2018; DOI: 10.1158/1078-0432.CCR-18-0586 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Targeting an Autocrine Regulatory Loop in Cancer Stem-like

Cells Impairs the Progression and Chemotherapy

Resistance of Bladder Cancer

Kai-jian Wang1#, Chao Wang1#, Li-he Dai1#, Jun Yang1, Hai Huang1, Xiao-jing Ma2,

Zhe Zhou1, Ze-yu Yang1, Wei-dong Xu1, Mei-mian Hua1, Xin Lu1, Shu-xiong Zeng1,

Hui-qing Wang1, Zhen-sheng Zhang1, Yan-qiong Cheng1, Dan Liu1, Qin-qin Tian1,

Ying-hao Sun1* and Chuan-liang Xu1*.

Author affiliations

1. Department of Urology, Changhai Hospital, Second Military Medical University,

Shanghai, China.

2. Department of Microbiology and Immunology, Weill Cornell Medicine, New York,

New York.

#These authors contributed equally to the study.

*Corresponding author: Chuan-liang Xu. Address correspondence to: Department of

Urology, Changhai Hospital, Second Military Medical University, 168 Changhai

Road, Shanghai 200438, China. Tel.: +86 021 31161716; fax: +86 021 35030006.

E-mail: [email protected]

Ying-hao Sun. Address correspondence to: Department of Urology, Changhai

Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on November 5, 2018; DOI: 10.1158/1078-0432.CCR-18-0586 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200438,

China. Tel.: +86 021 35030006; fax: +86 021 35030006.

E-mail: [email protected]

Running title: Targeting CSCs Impairs the Progression of BCa.

Keywords: cancer stem-like cells, bladder cancer, YAP, PDGF-BB, PDGFR

Financial Support: This work was supported by Innovation Program of Shanghai

Municipal Education Commission (No. 2017-01-07-00-07-E00014); National Natural

Science Foundation of China (No. 81772720, 81773154, 81572509 and 81301861);

Shanghai Natural Science Foundation of China (No. 13ZR1450700); Special Fund for

Major Projects of Zhangjiang National Innovation Demonstration Zone; the national

new drug innovation program (2017ZX09304030); Shanghai clinical medical center

for urinary system diseases (2017ZZ01005); Shanghai Key Laboratory of Cell

Engineering (14DZ2272300).

Conflict of Interest: The authors declare no potential conflicts of interest.

Author contribution:

Conception and design: KJW, CW, YHS and CLX

Performing of the experiments: KJW, CW, LHD, JY, HH, ZZ and ZYY

Acquisition of data: KJW, CW, LHD, WDX, MMH and XL

Analysis and interpretation of data: KJW, CW, LHD and XJM

Drafting of the manuscript: KJW, CW and LHD

Animal experiments: KJW, CW, LHD, HH, SXZ, HQW, ZSZ, YQC, DL and QQT

Reviewing and editing of the manuscript: CW, XJM, YHS and CLX

Study supervision: YHS and CLX

Abbreviations:

BCa, bladder cancer; IHC, immunohistochemistry; ELISA, enzyme-linked immune

sorbent assay; ChIP, chromatin immunoprecipitation; CCK-8, cell counting kit-8;

Co-IP, co-immunoprecipitation; H&E, hematoxylin and eosin; FBS, fetal bovine

serum; STR, short tandem repeat; MACS, magnetic activated cell sorting; shRNA,

short hairpin RNA; GFP, green fluorescent protein; BSA, bovine serum albumin; IB,

immunoblotting; CSCs, cancer stem-like cells；YAP, yes-associated protein; TEAD,

TEA domain transcription factor; PDGFR, platelet-derived growth factor receptor;

PDGF-BB, platelet-derived growth factor-BB; MIBC, muscle-invasive bladder cancer;

NMIBC, non-muscle-invasive bladder cancer; MST1/2, mammalian Ste20-like

kinases 1/2; LATS1/2, large tumor suppressor 1/2; TEF-1, transcriptional enhancer

factor-1; HRP, horseradish peroxidase; PDGFB, platelet-derived growth factor subunit

B; PBS, phosphate buffer; DMSO, dimethylsulfoxide; NOD-SCID, non-obese,

diabetic, severe combined immunodeficient; ELDA, extreme limiting dilution

analysis; CTGF, connective tissue growth factor; CYR61, cysteine-rich angiogenic

inducer 61; ICAM-1, intercellular adhesion molecule-1; CM, conditioned medium;

MOI, multiplicity of infection; PCR, polymerase chain reaction; PI, propidium iodide;

ROC, receiver operating characteristic; IRS, immunoreactive score; AUC, area under

the receiver operating characteristic curve; Cis, cis-platinum; VP, verteporfin; CP,

CP-673451.

Translational relevance

Bladder cancer progression and chemotherapy resistance have been attributed to

the existence of cancer stem-like cells (CSCs). Thus, unveiling the molecular

mechanisms by which CSCs are regulated will aid in the development of new

therapies for bladder cancer patients. Our study demonstrates that OV6 is a good

indicator for disease progression and the prognosis of bladder cancer patients and that

the autocrine signaling loop YAP/TEAD1/PDGF-BB/PDGFR sustains the

self-renewal of OV6+ CSCs, which facilitates bladder cancer invasion and

chemotherapy resistance. Furthermore, targeting OV6+ CSCs by blocking this

autocrine signaling loop using a YAP or PDGFR inhibitor improves the efficacy of

cis-platinum in a treatment model of orthotopic bladder cancer. In conclusion, YAP or

PDGFR may be potential therapeutic targets for the control of OV6+ CSCs and the

inhibition of chemotherapy resistance in bladder cancer.

Abstract

Purpose: Cancer stem-like cells (CSCs) contribute to bladder cancer (BCa)

chemotherapy resistance and progression, but the associated mechanisms have not

been elucidated. This study determined whether blocking an autocrine signaling loop

in CSCs improves the therapeutic effects of cis-platinum on BCa.

Experimental Design: The expression of the epithelial marker OV6 and other

markers in human BCa specimens was examined by immunohistochemistry. The CSC

properties of magnetic-activated cell sorting (MACS)-isolated OV6+ and OV6- BCa

cells were examined. Molecular mechanisms were assessed through RNA-Seq,

cytokine antibody arrays, co-immunoprecipitation (co-IP), chromatin

immunoprecipitation (ChIP), and other assays. An orthotopic BCa mouse model was

established to evaluate the in vivo effects of a YAP inhibitor (verteporfin) and a

PDGFR inhibitor (CP-673451) on the cis-platinum resistance of OV6+ CSCs in BCa.

Results: Up-regulated OV6 expression positively associated with disease progression

and poor prognosis for BCa patients. Compared with OV6- cells, OV6+ BCa cells

exhibited strong CSC characteristics, including self-renewal, tumor initiation in

NOD/SCID mice and chemotherapy resistance. YAP, which maintains the stemness of

OV6+ CSCs, triggered PDGFB transcription by recruiting TEAD1. Autocrine

PDGF-BB signaling through its receptor PDGFR stabilized YAP and facilitated YAP

nuclear translocation. Furthermore, blocking the YAP/TEAD1/PDGF-BB/PDGFR

loop with verteporfin or CP-673451 inhibited the cis-platinum resistance of OV6+

BCa CSCs in an orthotopic BCa model.

Conclusions: OV6 could be a helpful indicator of disease progression and prognosis

for BCa patients, and targeting the autocrine YAP/TEAD1/PDGF-BB/PDGFR loop

might serve as a remedy for cis-platinum resistance in patients with advanced BCa.

Introduction

Bladder cancer (BCa) is one of the most frequently diagnosed and lethal cancers

worldwide, with an estimated 429,800 new cases and 165,100 deaths in 2012 (1).

Although surgical resection is the preferred treatment for patients with BCa, most

tumors recur and progress to muscle-invasive bladder cancers (MIBCs) and metastatic

BCa, which are prone to chemotherapy resistance after treatment and are associated

with poor prognosis (2, 3). Cancer stem-like cells (CSCs) are a small subpopulation of

tumor cells that are functionally defined by their strong stem-like properties, including

self-renewal, drug resistance, and tumor initiation capacity, upon serial passage, and

the heterogeneity, progression and chemotherapy resistance of many cancers,

including BCa, have been attributed to CSCs (4-6). Therefore, unveiling the

molecular mechanisms by which CSCs are regulated will likely facilitate the

development of novel and efficacious therapies for advanced and chemoresistant BCa.

Bladder CSCs can be isolated using several markers, such as CD44, SOX2,

CD133, and aldehyde dehydrogenase 1 A1 (ALDH1A1) (7, 8). Additionally, many

signaling pathways have been reported to regulate the self-renewal, chemotherapy

resistance and tumor initiation properties of bladder CSCs, including hedgehog

signaling, the Wnt/β-catenin pathway, and the KMT1A-GATA3-STAT3 and

E2F1-EZH2-SUZ12 cascades (9-12). A recent study reveals that variants of ARID1A,

GPRC5A and MLL2 drive the self-renewal of bladder CSCs, as indicated by

single-cell sequencing (13). However, the mechanisms underlying the maintenance of

the stem-like properties of bladder CSCs remain insufficiently understood. .

Hippo signaling was initially identified in Drosophila and has been more recently

examined for its regulatory role in mammalian cells; the Hippo pathway was found to

play crucial roles in mediating carcinogenesis and self-renewal in stem cells and

CSCs (14). The Hippo pathway effector Yes-associated protein (YAP) is negatively

regulated by the mammalian Ste20-like kinases 1/2 (MST1/2) and large tumor

suppressor 1/2 (LATS1/2), and this negative regulation results in retention of

phosphorylated YAP in the cytoplasm (15). Conversely, YAP that is not

phosphorylated enters the nucleus and functions as a transcription co-activator for

transcription factors of the TEA domain transcription factor (TEAD) family to induce

the expression of downstream genes that promote cell proliferation and differentiation

(15). Recent studies have demonstrated that YAP is required for CSC self-renewal and

expansion in various cancer types, such as breast cancer, prostate cancer, glioblastoma,

and lung cancer (16-18). However, the role of YAP in bladder CSCs and the related

mechanisms have yet to be established.

The epithelial marker OV6 serves as a putative marker for hepatic oval cells, bile

duct epithelial cells and also a CSC marker in epithelium-derived malignant tumors; it

is associated with patient prognosis as shown in many studies (19-24). In this study,

we found that high OV6 expression in specimens positively associated with disease

progression and poor prognosis of BCa patients. Moreover, OV6+ BCa cells harbored

strong stem-like properties, and the pattern of OV6 expression in bladder CSCs was

very similar to those of CD44 and CD133. In addition, we demonstrated that YAP

drives the self-renewal of OV6+ CSCs to facilitate the invasion, migration and drug

resistance of BCa. Furthermore, YAP triggers PDGFB transcription via TEAD1, and

reciprocally, PDGF-BB binds to its receptor PDGFR and stabilizes YAP by

preventing its phosphorylation by LATS1/2, thus forming an autocrine regulatory

loop in OV6+ CSCs. Finally, an orthotopic BCa mouse model was employed to show

that blocking the autocrine regulatory loop in OV6+ CSCs using a YAP or PDGFR

inhibitor overcame the resistance to cis-platinum in advanced BCa.

Materials and Methods

Patients and specimens

Two cohorts, cohort 1 (n=130, Jan-2009 to Dec-2013) and cohort 2 (n=95,

Jan-2004 to Dec-2008), of bladder cancer patients from Changhai Hospital (Shanghai,

China) were recruited in this study. The patients were merged and randomly divided

by 1:1 ratio into a training (n=113) and a validation set (n=112). In addition to the

cohorts above, this study also included a recurrent BCa patient (n=1), metastatic BCa

patients (n=6) and BCa patients treated with cis-platinum (n=5). Histological grade

and tumor stage were assessed according to the American Joint Committee on Cancer

(2010) and the World Health Organization classification (2004) (25).

Clinical follow-up data were available for all patients. The median follow-up

period was 59.17 months (mean 50.3 months) for cohort 1 and 122.1 months (mean

91.5 months) for cohort 2. All patients were investigated according to a uniform

method of the Department of Urology, Changhai Hospital based on the guideline (26,

27). Cystoscopy was applied for patients treated with TURBT at the first 3 months

after surgery. For patients with low-risk tumors, cystoscopy was performed 1 year

after surgery if the first cystoscopy was negative, and then yearly for 5 years. For

patients with high-risk tumors, cystoscopy was done every 3 months for 2 years, then

every 6 months for 2 years, and then yearly. Patients with intermediate-risk tumors

had an in-between follow-up scheme using cystoscopy, which is adapted according to

personal and subjective factors. For patients treated with radical cystectomy,

Return visits were generally performed postoperatively at least every 3 to 4 months

for the first year, semiannually for the second year, and annually thereafter. Follow-up

visits consisted of a physical examination, urine cytology, serum chemistry evaluation,

chest radiography, ultrasound examination (including liver, kidney and

retroperitoneum), computed tomography/magnetic resonance imaging of the abdomen

and pelvis.

The samples were obtained after written informed consent was provided by the

patients according to an established protocol approved by the Ethics Committee of

Changhai Hospital (Shanghai, China). The study was conducted in accordance with

the International Ethical Guidelines for Biomedical Research Involving Human

Subjects (CIOMS).

Immunohistochemistry (IHC)

Immunohistochemistry was performed as we previously described (28), and the

following primary antibodies were used: mouse anti-OV6 (MAB2020, R&D Systems,

Minneapolis, MN, USA), rabbit anti-YAP (ab52771), mouse anti-Vimentin (ab8978)

and rabbit anti-PDGF receptor beta (ab32570) (Abcam, Cambridge, MA, USA). The

percentage of positive cells (% of PPs) and the staining intensity (SI value) were

determined and multiplied to obtain the immunoreactive score (IRS value) (29),

which ranged from a minimum score of 0 to a maximum score of 12. Time-dependent

receiver operating characteristic (ROC) analysis was performed to determine the

cut-off value and AUC of OV6 expression in predicting 5-year cancer-specific

survival (30) using R software (4.3.3). Patients with BCa were divided into two

groups: a low-expression (IRS values of 0-3) group and a high-expression (IRS values

of 4-12) group.

Cell culture

The cell lines used in the present study were obtained from the Cell Bank of the

Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) in

June 2016. UMUC3 and J82 cells were cultured in Minimum Essential Medium

(1871544, Gibco, Waltham, MA, USA) supplemented with fetal bovine serum (FBS,

10%, 10099-141, Gibco). RT4 and T24 cells were maintained in McCoy’s 5A

medium (1849736, Gibco) modified with FBS (10%, 10099-141, Gibco). SW780

cells were cultured in Leibovitz’s L-15 medium (1828421, Gibco) containing 10%

FBS (Gibco). All cell lines were supplemented with 1% penicillin/streptomycin

(15140122, Gibco) and cultured at 37°C in 5% CO2.

The cell lines in this study were authenticated by short tandem repeat (STR)

profiling and tested for mycoplasma contamination with a Mycoplasma Detection Kit

(B39032, Selleck Chemicals). The most recent tests were performed in December

2017. The cell lines used in this study were within 40 passages.

Flow cytometry assay and magnetic cell sorting

Flow cytometric assays were performed with a Cyan ADP Sorter (Beckman, CA,

USA). BCa cell lines were magnetically labeled with APC-conjugated-OV6 antibody

(FAB2020A, R&D Systems, Minneapolis, MN, USA), FITC-conjugated-CD44

antibody (130-095-195, Miltenyi Biotec, Bergisch Gladbach, Germany) or

PE-conjugated-CD133 antibody (130•113•670, Miltenyi Biotec). The

magnetic-activated cell sorting (MACS) assay was performed with a MiniMACS™

Cell Sorter (Miltenyi Biotec). BCa cell lines were magnetically labeled with OV6

antibody (MAB2020, R&D Systems, Minneapolis, MN, USA), CD44 antibody

(130-110-082, Miltenyi Biotec, Bergisch Gladbach, Germany) or CD133 antibody

(130-090-423, Miltenyi Biotec, Bergisch Gladbach, Germany) and then subsequently

incubated with rat anti-mouse IgG1 microbeads and separated on a MACS MS

column (Miltenyi Biotec). All the procedures were carried out according to the

manufacturer’s instructions.

Spheroid formation assay

Briefly, after magnetic sorting, single-cell suspensions with 3000 cells were

seeded in 6-well ultra-low attachment culture plates (Corning, Corning, NY) and

cultured in serum-free DMEM/F12 (Gibco) supplemented with B27 (1:50, 17504-044,

Thermo Fisher, USA), N2 (1:100, 17502048, Thermo Fisher, USA), 20 ng/ml EGF

(Gibco), 10 ng/ml bFGF (Gibco), and ITS (1:100, 13146, Sigma, USA) for 5 days.

The number of spheroids formed was determined via microscopy, and representative

images were obtained.

The spheroid formation assay was carried out in semisolid medium. In brief,

single-cell suspensions with 3000 cells were resuspended in 1:1 Growth Factor

Reduced Matrigel (BD Biosciences, 356231)/serum-free DMEM/F12 (supplemented

with B27, N2, EGF, bFGF, and ITS) in a total volume of 200 μl. Samples were plated

around the rims of wells in a 12-well plate and allowed to solidify at 37°C for 10

minutes before 1 ml of serum-free DMEM/F12 (supplemented with B27, N2, EGF,

bFGF, and ITS) was added. Medium was replenished every 3 days. Ten days after

plating, spheres with a diameter over 50 μm were counted via microscopy, and

representative images were obtained.

For the single cell spheroid formation assay, bladder cancer cells were deposited

by FACS in wells from the ultra low-adhesion 96-well plates containing 200μl stem

cell medium (serum-free DMEM/F12 supplemented with B27, N2, EGF, bFGF, and

ITS) at a concentration of a single cell per well, which was confirmed visually by

microscope. Wells containing either none or more than one cell were excluded for

further analysis. The single cell wells were checked daily and a further 100 μl of stem

cell medium was added after 5 days. Ten days after plating, wells with sphere were

counted under a microscope, and representative images were obtained.

Cell proliferation, invasion and migration assays

The proliferation of BCa cells under the indicated conditions was evaluated using

a CCK-8 kit (CK-04, Dojindo, Kumamoto, Kyushu, Japan), which was described in

our previous study (31). The proliferation rates are presented as a proportion of the

control value, which was obtained from the treatment-free groups. Invasion and

migration assays were carried out in transwell chambers (Millipore, USA) with or

without Matrigel (BD Biosciences, USA) according to the manufacturer's instructions,

which was explained in our previous study (22).

Assessment of apoptosis

Apoptotic cells were evaluated with ANXA5 and PI staining (Invitrogen, A13201)

according to the manufacturer’s instructions and analyzed by flow cytometry with a

Cyan ADP Sorter (Beckman, CA, USA).

Gene knockdown and RNA interference

The short hairpin RNA (shRNA) interference vector pLKO.1-GFP, containing a

U6 promoter upstream of the shRNA, and the lentivirus packaging vectors pVSVG-I

and pCMV-GAG-POL were obtained from Shanghai Integrated Biotech Solutions Co.,

Ltd. (Shanghai, China). The UMUC3/J82 cell line was transduced with the

shRNA-expressing lentivirus (sh-YAP or sh-TEAD1) or control lentivirus. After 72 h

of transduction, the cells were observed and photographed under microscope. Stable

UMUC3/J82 knockdown of YAP and TEAD1 were also generated using lentiviral

constructs. The shRNA sequences are presented in Supplementary Table S18. Cell

transfection with YAP and TEAD1 plasmid was carried out using Lipofectamine 3000

reagent (L3000015, Invitrogen) according to the manufacturer's protocol, and the

sequence of the YAP and TEAD1 plasmid is shown in Supplementary Table S18.

Real-Time polymerase chain reaction

Total RNA was extracted with RNAiso Plus (9109, Takara, Kusatsu, Shiga

Prefecture, Japan), and cDNAs were synthesized using a PrimeScript One Step RT

reagent Kit (RR037B, Takara). Real-time PCR was performed with SYBR Green

Real-Time PCR Master Mix (QPK201, Toyobo, Osaka, Kansai, Japan) on an ABI

PRISM 7300HT Sequence Detection System. The results were normalized to the

expression of β-actin. Fold change relative to the mean value was determined by 2-△△Ct.

The primer sequences are presented in Supplementary Table S18.

Western blotting and co-IP analysis

The western blot analysis was performed as we previously reported (24). Nuclear

and cytoplasmic proteins from BCa cells were extracted using an NE-PER nuclear

and cytoplasmic extraction kit (#78899, Thermo Scientific, Waltham, MA, USA). The

following primary antibodies were used: rabbit anti-β-tubulin (#2128) and rabbit

anti-Histone H3 (#4499), rabbit anti-phospho-p44/42 MAPK (Erk1/2)

(Thr202/Tyr204) (#4370), rabbit anti-Phospho-MEK1/2 (Ser217/221)(#9154) from

Cell Signaling Technology (Danvers, MA, USA); rabbit anti-LATS1+LATS2

(ab70565), rabbit anti-LATS1+LATS2 (phospho-T1079+T1041; ab111344), rabbit

anti-PDGF receptor beta (ab32570), rabbit anti-YAP (ab52771), and rabbit anti-YAP

(phospho-S127; ab76252), rabbit anti-PDGF Receptor beta (phospho Y1021)

(ab134048), rabbit anti-ERK1 + ERK2 (ab17942) and rabbit anti-MEK1+MEK2

(ab178876) from Abcam (Cambridge, MA, USA); and mouse anti-TEF-1 (610922)

from BD Biosciences (Franklin Lakes, NJ, USA). The secondary antibodies were

horse anti-mouse IgG-HRP-linked antibody (#7076S) or goat anti-rabbit

IgG-HRP-linked antibody (#7074S) from Cell Signaling Technology (Danvers, MA,

USA). Co-immunoprecipitation experiments were performed according to previously

published protocols (24). The antibodies used are listed above.

Immunofluorescence analysis

The immunofluorescence analysis was performed as we previously reported (24).

The primary antibodies rabbit anti-YAP (ab52771, Abcam) and mouse anti-OV6

(MAB2020, R&D Systems, Minneapolis, MN, USA) were incubated with samples at

4°C overnight. Nuclei were stained with DAPI (E607303, Sangon, China).

Fluorescence images were observed and collected under a Leica DM5000B

fluorescence microscope (Leica, UK).

Antibody-microarray experiment and enzyme-linked immunosorbent assays

(ELISAs)

The antibody-microarray experiment was performed as we previously reported

(31). Cytokine profiles were examined by Quantibody Human Inflammatory Array 3

(QAH-INF-G3, RayBiotech, Norcross, GA, USA) containing 40

inflammation-associated cytokines. The PDGF-BB and ICAM-1 levels in cell culture

medium were measured using ELISA Kits for PDGF-BB (DBB00, R&D Systems,

Minneapolis, MN, USA) and ICAM-1 (DCD540, R&D Systems, Minneapolis, MN,

USA) according to the manufacturer’s instructions.

Chromatin immunoprecipitation (ChIP) and luciferase reporter assay 18

ChIP assays were performed according to our previously published study (31).

Primers complementary to the promoter region of PDGFB (forward: 5’-

TGGCAGAGCAGGTTCCCACATA; reverse:

5’-TGCTGAGACCACCGTGCTGT-3’) were used to detect PDGFB genomic DNA,

and primers specific to the human GAPDH promoter were used as the control (kit

supplied). Enrichment of the targets was calculated as follows: fold enrichment=2^(Ct

[PDGFB-ChIP] - Ct [IgG]).

The TEAD1-binding sites of the PDGFB promoter (NC_000022.11: -3000 to

+100 relative to the PDGFB transcription site) or its mutant sequence (-2732 to -2723,

CTCATTCCAT) were cloned into a pGL3-basic luciferase reporter vector (Promega,

USA). UMUC3 cells were co-transfected with 10 ng pTK-RL reporter control

plasmid and 200 ng pGL3-basic-PDGFB-WT or pGL3-basic-PDGFB-Mut using

Lipofectamine 3000 reagents (L3000015, Invitrogen, Waltham, MA, USA) according

to the manufacturer protocols. Cells were collected 48 h after transfection, and

PDGFB transcription activity was evaluated by measuring luminescence with a

Dual-Luciferase Assay Kit (E1910, Promega, Fitchburg, Wisconsin, USA). Fold

induction was derived relative to normalized reporter activity.

RNA-Seq and analysis

RNA was isolated from OV6- and OV6+ UMUC3 cells using TRIzol reagent

(Invitrogen, Grand Island, NY). The total RNA was purified with a Qiagen RNeasy

mini kit (Qiagen, Valencia, CA), and then, the purified RNA was checked to

determine the quantity. Single- and double-stranded cDNA was synthesized from

mRNA samples. The double-stranded cDNA was then purified for end repair, dA

tailing, adaptor ligation and DNA fragment enrichment. The libraries were quantified

using Qubit (Invitrogen, CA, USA) according to the Qubit user guide. The

constructed library was sequenced on an Illumina Hiseq 4000 sequencer. The paired

end raw reads were aligned using TopHat version 1.2.0, which allowed two

mismatches in the alignment. The aligned reads were assembled into transcripts using

cufflinks version 2.0.0. The alignment quality and distribution of the reads were

estimated using SAM tools. From the aligned reads, the gene and transcript

expression was assessed using cufflinks version 1.3.036. The differential transcripts

were analyzed via cuffdiff. Finally, GO and pathway functional analyses were

performed for the differentially expressed transcripts.

Animal experiments

All experimental animal procedures were approved by the Animal Care and Use

Committee of the Second Military Medical University (Shanghai, China). UMUC3

cells were transfected with the luciferase reporter gene. For the in vivo limiting

dilution assay, sorted tumor cells were diluted at an appropriate cell dose and injected

into NOD/SCID mice (Shanghai Laboratory Animal Center, SLAC, China); the

number of tumors formed from each cell dose injected was then scored. The

frequency of CSCs was calculated using the ELDA software

(http://bioinf.wehi.edu.au/software/elda/index.html) (the Walter and Eliza Hall

Institute). In the animal experiments, human recombinant PDFG-BB (10ng/ml),

PDGF-BB neutralizing antibody (100ng/ml) or CP-673451 (500nmol/ml) was added

to the culture medium of sorted cells for 4 days before subcutaneously injecting into

the mice.

For the in vivo metastasis assay, 5×105 cells in 200 µl of PBS were intravenously

injected through the tail vein of six-week-old male NOD-SCID mice. Mice were

sacrificed and examined five weeks after tumor cell injection. For mouse orthotopic

BCa, six-week-old female NOD-SCID mice were used in the present study. Briefly, 5

×105 UMUC3-Luc-OV6- cells or UMUC3-Luc-OV6+ cells in 50 µl of PBS were

respectively installed into the bladder via a 24-gauge catheter and maintained for 3 h

according to a previously described protocol (32). Tumor growth was monitored

weekly by live-animal bioluminescence optical imaging using an IVIS Lumina II

imaging system (PerkinElmer, Hopkinton, MA, USA) after intraperitoneal injection

of D-luciferin (150 mg/kg) (Gold Biotech, USA) in 100 μl of DPBS. Mice were

sacrificed 4 weeks after tumor implantation.

For the in vivo treatment model, orthotopic tumor-bearing mice, generated by

installation of 1×106 UMUC3-Luc-OV6+ cells or T24-Luc-OV6+ cells in 50 µl of

PBS, were divided into 4 groups on day 5 after tumor implantation. Cis-platinum

(S1166, Selleck Chemicals, Huston, TX, USA), verteporfin (5305, Tocris Bioscience,

Avonmouth, BS11, UK) and CP-673451 (HY-12050, MedChemExpress, Monmouth

Junction, NJ, USA) were stocked in DMSO and prepared in PBS. Mice were treated

by intraperitoneal injection of cis-platinum (3 mg/kg) alone or combined with

verteporfin (100 mg/kg) or CP-673451 (30 mg/kg) every 2 days. Necropsies were

performed after 6 weeks.

Statistical analysis

Numerical data are expressed as the mean ± S.D. Statistical differences between

variables were analyzed with a two-tailed Student`s t test, chi-square test or Fisher's

exact test for categorical/binary measures or ANOVA for continuous measures.

Correlation studies were analyzed by Pearson. Survival curves were plotted using the

Kaplan-Meier method and compared via log-rank analysis. Variables with p values <

0.1 on the univariate analysis were included in multivariate Cox proportional hazards

analysis. Differences were considered significant at p<0.05. Time-dependent receiver

operating characteristics (ROC) analysis was used to determine the cut-off value of

censored data with “survival ROC” package, R software 3.4.4. Time-dependent area

under the receiver operating characteristic curve (AUC) was computed with the “time

ROC” package. All the analyses were performed using the GraphPad Prism 5

(GraphPad Software, Inc.), SPSS 21.0 (IBM Corporation, Armonk, New York, USA)

software and R-project for statistical computing (version 3.4.4).

Results

OV6 is associated with disease progression and prognosis of patients with

bladder cancer

Based on the previous studies that OV6 closely associates with progression and

prognosis of patients with tumors (22-24), we also examined whether the epithelial

marker OV6 is associated with the clinicopathological characteristics and prognosis of

bladder cancer (BCa) patients. First, we analyzed OV6 expression in specimens via

immunohistochemistry (IHC). The positive and selective staining of OV6 in normal

bladder epithelial cells staining of OV6 in normal bladder epithelial cells (Fig. 1A)

suggested that it could serve as an epithelial marker. In addition, OV6 expression in

BCa specimens was determined by immunoreactive scores (IRS; ranging from a

minimum of 0 to a maximum of 12; the rules are described in the “Materials and

Methods”). Interestingly, the OV6 expression was higher in the muscle-invasive

bladder cancer (MIBC) than in the nonmuscle-invasive bladder cancer (NMIBC)

samples (Fig. 1A). Additionally, OV6 expression was higher in the muscular layer

than in the mucosa of the same specimen from MIBC patients (Supplementary Fig.

S1A). Of note, higher OV6 expression was observed in the invasive fronts of BCa

than in the core (Supplementary Fig. S1A). Metastatic lesions or postchemotherapy

samples exhibited higher OV6 expression than primary tumors or prechemotherapy

samples (Fig. 1B-C). These data indicate that OV6 is positively correlated with

progression of BCa.

Then, we determined whether OV6 expression in specimens was associated with

disease progression and the prognosis of BCa patients. First, the OV6 expression level

in specimens was assessed by IHC from BCa patients (Fig. 1D), and then, a

time-dependent receiver operating characteristics (ROC) curve analysis was

performed to determine the cut-off between low and high OV6 expression in cohort 1;

this analysis demonstrated that the best cut-off value was 4 (IRS score)

(Supplementary Fig. S1B). Thus, BCa patients from cohort 1 were divided into two

groups: a low OV6 expression group (IRS values of 0-3) or a high OV6 expression

(IRS values of 4-12) group, and OV6 expression in BCa samples was significantly

associated with multiple malignant clinicopathological features of BCa tumors, such

as tumor stage, tumor grade, lymph node status and TNM stage (Supplementary

Table S1). More importantly, Kaplan-Meier analysis revealed that patients with

higher OV6 expression exhibited markedly worse cancer-specific survival (CSS;

p<0.001), progression-free survival (PFS; p<0.001) and overall survival (OS; p<0.001)

than their counterparts (Supplementary Fig. S1C-E). Furthermore, univariable and

multivariable cox regression analyses indicated that OV6 was an independent risk

factor for prognosis of BCa patients (Supplementary Table S2). In addition, another

cohort (cohort 2) (Supplementary Table S3), comprising 95 consecutive BCa

patients, was employed as a validation set using the cut-off value (IRS=4) derived

from cohort 1. Kaplan-Meier analysis revealed that patients with higher OV6

expression exhibited markedly worse CSS (p=0.018), PFS (p=0.033) and OS

(p<0.001) than their counterparts (Supplementary Fig. S1F-H). Moreover,

incorporating OV6 expression to TNM stage improved accuracy in predicting CSS of

BCa patients as shown by time-dependent AUC analysis both in cohort 1 and cohort 2

(Supplementary Fig. S1I-J).

Furthermore, BCa patients in cohort 1 were merged with cohort 2, and all 225

BCa patients were randomly split into a training set (n=113) and a validation set

(n=112) at 1:1 ratio. A time-dependent ROC curve analysis was performed to

determine the cut-off between low and high OV6 expression. Consistent with the best

cut-off derived from cohort 1, the best cut-off value was also 4 (IRS score) (Fig. 1E).

Using the cut-off 4 for high and low OV6 expression, high OV6 expression in BCa

samples was also significantly associated with high tumor stage, tumor grade, positive

lymph node status and high TNM stage in both the training set and the validation set

(Supplementary Table S4). More importantly, Kaplan-Meier analysis revealed that

patients with higher OV6 expression exhibited markedly worse CSS (p<0.001,

training set; p=0.007, validation set), PFS (p<0.001, training set; p=0.043, validation

set) and OS (p<0.001, training set; p=0.003, validation set) than their counterparts

(Fig. 1F-K). In addition, univariate and multivariate cox regression analyses indicated

that OV6 was an independent risk factor for the CSS of BCa patients in both the

training and validation sets (Supplementary Table S5). Moreover, improved

accuracy in predicting CSS of BCa patients was also observed by combining OV6

expression with the TNM stage in both sets in time-dependent AUC analysis

(Supplementary Fig.S1K and S1L). These results demonstrate that OV6 could serve

as a helpful indicator of disease progression and prognosis for BCa patients.

OV6+ cancer cells possess stem-like properties and facilitate bladder cancer’s in

situ tumorigenicity, invasion, migration and metastasis

Given that OV6 is associated with disease progression and prognosis of BCa

patients and serves as a CSC maker for other tumors, we speculated that OV6 was a

putative CSC marker for BCa. First, we detected the percentage of OV6 in BCa cell

lines and determined whether the pattern of OV6 expression in BCa CSCs was similar

to other CSC markers. The flow cytometry analysis demonstrated that higher OV6

expression was observed in sphere-forming BCa cells (which were reported to possess

CSC properties) (33) than in adherent cells from various BCa cell lines (Fig. 2A).

Second, immunofluorescence confirmed co-localization of OV6 with other CSC

markers, such as CD44 or CD133, in BCa specimens or spheres from the BCa cell

line UMUC3 (Fig. 2B-C; Supplementary Fig. S2A-B). Third, multi-marker analyses

indicated that OV6+ UMUC3 or J82 cells also expressed CD44 or CD133 and that the

percentage of OV6+CD44+ or OV6+CD133+ cells was respectively increased in

spheres (Supplementary Fig. S2C-D). Fourth, flow cytometry showed that OV6 was

increased in CD133+ UMUC3 cells, which were sorted by magnetic-activated cell

sorting (MACS), and CD133 was also upregulated in OV6+ UMUC3 cells

(Supplementary Fig. S2E-F). These data suggest that the pattern of OV6 expression

in BCa CSCs may be similar to that of CD44 or CD133.

We then isolated OV6+ and OV6- UMUC3 or J82 cells via MACS to compare

their stem-like properties (Supplementary Fig. S2G). First, higher expression levels

of stem-associated genes were observed in OV6+ cells than in control OV6- cells via

real-time PCR (Fig. 2D). Second, a spheroid assay in serum-free medium or in

semisolid medium revealed that significantly more spheres were formed by OV6+

BCa cells than by OV6- cells (Fig. 2E; Supplementary Fig. S2H). In addition, single

cell spheroid formation assay revealed that OV6+ BCa cells had significantly stronger

capacity to generate spheroids than OV6- cells (Supplementary Fig. S2I), indicating

that OV6+ BCa cells harbored strong self-renewal. Third, a tumor limited dilution

assay to analyze OV6+ BCa cells stably labeled with luciferase that were

subcutaneously injected of into nonobese, diabetic, severe combined immunodeficient

(NOD/SCID) mice was employed to determine whether OV6+ BCa cells were more

tumorigenic than control OV6- cells in vivo. As expected, OV6+ BCa cells initiated

tumors with markedly higher frequency than OV6- cells in two serial generations.

(Fig. 2F; Supplementary Fig. S2J and S2K; Supplementary Table S6).

Furthermore, we showed that OV6+CD44+ UMUC3 cells exhibited higher tumor

initiation incidence and frequency than OV6-CD44+ cells in NOD/SCID mice, but

there was not a statistical difference in tumorigenicity between OV6+CD44+ and

OV6+CD44- cells (Supplementary Fig. S2L; Supplementary Table S7), indicating

that OV6 plays a stronger role than CD44 in the tumor initiation capacity of CSCs.

Moreover, given that CSCs were resistant to chemotherapeutic drugs, we also

examined whether OV6+ BCa cells were more chemo-resistant compared to OV6-

cells. Because chemotherapeutic drugs can enrich CSCs in tumors, a flow cytometric

analysis was performed to detect the percentage of OV6+ cells in BCa cells after

treatment with chemotherapeutic drugs. As expected, cis-platinum enriched the ratio

of OV6+ cells in UMUC3 or J82 cell populations (Fig. 2G). A Cell Counting Kit-8

(CCK-8) assay demonstrated that OV6+ CSCs exhibited higher cell survival during

cis-platinum treatment than OV6- cells (Fig. 2H). Additionally, annexin V/ propidium

iodide (PI) double staining revealed that cis-platinum treatment induced fewer

apoptotic events in OV6+ CSCs (UMUC3, 11.1±1.1%; J82, 12.89±2.1%) but

considerably more apoptotic events in OV6- cells (UMUC3, 47.5±5.1%; J82,

85.4±9.45%) (Fig. 2I). These results indicate that OV6+ BCa cells possess strong

stem-like properties.

Given that CSCs possess stronger tumorigenicity and facilitate tumor metastasis

(28), we assessed the in situ tumorigenicity and metastatic abilities of OV6+ CSCs in

BCa. First, OV6+ and OV6- cells obtained from UMUC3 cell populations stably

labeled with luciferase were perfused into murine bladders through a urethral catheter,

and the resulting bioluminescence was detected using an in vivo imaging system to

monitor tumor growth (Supplementary Fig. S2M). OV6+ CSCs exhibited a higher

rate of tumor formation in bladders than control OV6- cells (Supplementary Fig.

S2M-O). Thirdly, Matrigel invasion assays and transwell migration assays

respectively showed that OV6+ CSCs exhibited a higher rate of cell invasion and

migration than OV6- UMUC3 or J82 cells (Supplementary Fig. S2P-Q). In addition,

OV6+ and OV6- UMUC3 cells were injected into the caudal vein of mice, and the

injection of OV6+ cells yielded increases in the incidence, number and size of lung

metastases than OV6- cells (Supplementary Fig. S2R-T). Epithelial to mesenchymal

transition (EMT) is an essential step in tumor metastasis (34). We thus assessed the

expression of the EMT marker Vimentin in OV6+ UMUC3 cells-derived metastatic

lesion by IHC. As expected, higher Vimentin expression was observed in specimens

from OV6+ cells-generated lung metastasis (Supplementary Fig. S2R-T). These

results demonstrate that OV6+ CSCs can facilitate in situ tumorigenicity and

metastasis of BCa cells.

YAP is required for maintenance of stem-like properties of OV6+ CSCs in

bladder cancer

To identify strategies for targeting OV6+ CSCs and hereby reversing BCa

progression and chemotherapy resistance, we next explored the mechanisms that

promote the expansion and self-renewal of OV6+ CSCs. First, OV6+ CSCs and OV6-

UMUC3 cells were analyzed by RNA-Seq to search for the critical genes or pathways

involved in maintaining the stem-like properties of OV6+ CSCs. (Fig. 3A;

Supplementary Fig. S3A-D; Supplementary Table S8-10). The results revealed

that OV6+ CSCs exhibited differential expression of Hippo pathway-related genes,

such as the higher expression of YAP (Fig. 3A). Real-time PCR confirmed that YAP

mRNA was upregulated in OV6+ CSCs from UMUC3 and J82 cultures, and Western

blotting also corroborated the increased YAP protein level in the nucleus of OV6+

CSCs (Fig. 3B and C; Supplementary Fig. S3E), suggesting that YAP was activated

in OV6+ BCa CSCs. Additionally, the RNA-Seq results indicated that OV6+ CSCs

presented elevated expression of YAP target genes (Fig. 3D), which were validated

for connective tissue growth factor (CTGF) and cysteine-rich angiogenic inducer 61

(CYR61) (Fig. 3B). In addition, p-YAP phosphorylated by p-LATS1/2 is well known

to be retained in the cytoplasm, but only activated YAP (no phosphorylation) enters

the nucleus to exert its biological function. Accordingly, Western blotting

demonstrated that reduced YAP and LATS1/2 phosphorylation was observed in the

cytoplasm of OV6+ CSCs (Fig. 3C; Supplementary Fig. S3E). In addition, relative

to YAP expression in OV6- cells, Western blotting and immunofluorescence assays

both revealed that YAP was mainly located in the nucleus of OV6+ CSCs (Fig. 3C

and E; Supplementary Fig. S3E and S3F). Taken together, these data suggest that

YAP signaling is activated in OV6+ bladder CSCs.

We subsequently examined whether YAP was required for maintaining the

stem-like properties of OV6+ CSCs. After the successful knockdown of YAP in BCa

cells was confirmed by Western blot (Supplementary Fig. S3G), lower expression of

stem-associated genes and fewer spheres were found in YAP-silenced OV6+ CSCs

than in control OV6+ cells (Fig. 3F and G; Supplementary Fig. S3H and S3I).

Furthermore, compared with control OV6+ CSCs, YAP-silenced OV6+ CSCs showed

decreased tumor initiation in two serial generations, and enhanced apoptosis and

decreased cell survival were observed in OV6+ CSCs under cis-platinum treatment

(Fig. 3H and I; Supplementary Fig. S3J-L). In addition, to test whether

upregulation of YAP could rescue these inhibitory effects of YAP knockdown on the

stem-like properties of OV6+ CSCs, we re-expressed either wild-type (WT) or mutant

(MT) YAP in YAP-knockdown OV6+ CSCs from UMUC3 and J82 cells. Western

blotting demonstrated that BCa cells transfected with MT-YAP exhibited a better

overexpression effect (Supplementary Fig. S3M). Subsequently, exogenous

expression of MT-YAP enhanced the expression of stem-associated genes and the

sphere-forming capacity of YAP shRNA-transfected-OV6+ CSCs (Supplementary

Fig. S3N and S3O). Additionally, YAP overexpression increased the expression of

stem-associated genes, the number of spheres, and the tumorigenicity and

chemoresistance of OV6+ CSCs in BCa (Fig. 3J-M; Supplementary Fig. S3P-T;

Supplementary Table S11). Thus, YAP is crucial for maintaining the stem-like

properties of OV6+ CSCs.

Additionally, IHC analyses of specimens from BCa patients were performed

(Supplementary Fig. S3U), and the results revealed a positive correlation between

OV6 expression and nuclear YAP expression (Supplementary Table S12) (p<0.001).

Furthermore, all patients were classified into four groups according to OV6 and

nuclear YAP expression in specimens (Supplementary Table S13), and

concomitantly elevated expression of OV6 and nuclear YAP in BCa specimens was

found to be associated with the poorest cancer-specific survival (p<0.001),

progression-free survival (p<0.001) and overall survival (p<0.001) (Fig. 3N-P).

PDGF-BB/PDGFR-mediated signaling sustains persistent activation of YAP in

OV6+ CSCs

Given that autocrine signaling maintains the stem-like properties of CSCs (35), we

investigated the crucial inflammatory factors in mediating OV6+ BCa CSCs using a

RayBio Human Cytokine Antibody Array (Fig. 4A-C; Supplementary Fig. S4A-C;

Supplementary Table S14). As expected, the level of many cytokines was

significantly upregulated in the conditioned medium (CM) from OV6+ CSCs from

UMUC3 or J82 cell cultures relative to those in CM from OV6- cells (Fig. 4A and B;

Supplementary Fig. S4A-C; Supplementary Table S14). We then compared the

significantly differentially expressed cytokines using a Venn plot and found that

PDGF-BB and ICAM-1 were consistently increased in both cell types (Fig. 4C;

Supplementary Table S14). Based on validation through ELISA analysis, the

secretion of PDGF-BB but not ICAM-1 was significantly higher in the CM from

OV6+ bladder CSCs than in the CM from OV6- cells (Fig. 4D), which prompted us to

investigate whether PDGF-BB was responsible for maintaining the stemness of OV6+

CSCs. First, human recombinant PDGF-BB protein was added to OV6+ CSC cultures,

which resulted in higher expression of stem-related genes and higher sphere formation

than that detected in naïve OV6+ CSC cultures (Fig. 4E and F; Supplementary Fig.

S4D and S4E). Second, PDGF-BB-treated OV6+ CSCs presented a higher tumor

incidence than control OV6+ cells (Fig. 4G). Conversely, the addition of a

neutralizing antibody against PDGF-BB to the CM of OV6+ CSCs suppressed the

stem-like properties (Fig. 4E-G; Supplementary Fig. S4D-E). In addition,

PDGF-BB facilitated the stem-like properties of OV6- BCa cells (Supplementary Fig.

S4F-H; Supplementary Table S15). Thus, PDGF-BB is required for the stem-like

features of OV6+ bladder CSCs.

Given that PDGF-BB triggers the intrinsic signaling of tumor cells through its

receptor, PDGFR (36), we also found that recombinant PDGF-BB protein activated

the phosphorylation of PDGFR and its downstream kinases (MEK and ERK) (37) in

OV6+ CSCs (Supplementary Fig. S4I). We then determined whether the PDGFR

inhibitor CP-673451 (38) suppressed the stem-like characteristics of OV6+ CSCs. As

expected, CP-673451 inhibited the stem-like characteristics of OV6+ CSCs, including

stem-associated gene expression, self-renewal and tumorigenicity (Fig. 4E-G;

Supplementary Fig. S4D and S4E). Thus, autocrine PDGF-BB/PDGFR signaling is

required for maintenance of the stem-like characteristics of OV6+ CSCs in BCa.

Since YAP was required for the stem-like properties of OV6+ CSCs, we next

investigated whether autocrine PDGF-BB/PDGFR mediated YAP activity. First,

recombinant PDGF-BB protein inhibited YAP phosphorylation in the cytoplasm

while increasing YAP expression in the nucleus of OV6+ CSCs, whereas CP-673451

had the opposite effects (Fig. 4H; Supplementary Fig. S4K). Second, YAP

knockdown alleviated the promoting role of PDGF-BB in YAP stabilization and the

stem-like characteristics of OV6+ CSCs, including stem-associated gene expression,

self-renewal, and tumorigenicity (Fig. 4I-K; Supplementary Fig. S4L-M). Therefore,

PDGF-BB/PDGFR facilitated OV6+ CSCs through stabilizing YAP and promoting

YAP entry into the nucleus.

Moreover, we investigated how PDGF-BB/PDGFR mediated YAP activity in

OV6+ CSCs. First, we tested whether PDGFR could directly interact with YAP to

form a complex and prevent LATS1/2-dependent YAP phosphorylation. A co-IP

analysis demonstrated that endogenous PDGFR directly interacted with YAP in OV6+

UMUC3 CSCs (Fig. 4L). Second, PDGF-BB enhanced the interaction between

PDGFR and YAP, while CP-673451 abated the effects in OV6+ CSCs from UMUC3

or J82 cultures (Fig. 4M). In the same manner, PDGF-BB decreased the interaction

between p-LATS1/2 and YAP, while CP-673451 abrogated the promoting effects of

PDGF-BB (Fig. 4M). Third, PDGF-BB decreased the phosphorylation of YAP and

LATS1/2 in the cytoplasm of OV6+ CSCs (Fig. 4H). In addition, PDGF-BB-treated

OV6+ CSCs-derived xenografts presented activated PDGF-R and YAP, which were

inhibited in CP-673451-treated OV6+ CSCs-derived xenografts (Supplementary Fig.

S4N-Q). Therefore, PDGFR activated by PDGF-BB can directly interact with YAP,

which prevents p-LAST1/2 interaction with YAP and inhibits YAP phosphorylation

in OV6+ CSCs.

YAP/TEAD1/PDGF-BB/PDGFR forms an autocrine regulatory loop in OV6+

CSCs

Given that PDGF-BB/PDGFR upregulated and activated YAP in OV6+ bladder

CSCs, we next examined whether YAP could reciprocally promote PDGFB

expression and secretion. As shown in Fig. 5A, higher PDGFB expression was

observed in OV6+ than in OV6- CSCs from UMUC3 or J82 cells. However, YAP

knockdown decreased the PDGFB levels in OV6+ CSCs (Fig. 5A), while YAP

overexpression caused the opposite effects (Fig. 5B). Secondly, the concentration of

PDGF-BB in CM from OV6+ CSCs was higher than that in CM from OV6- cells (Fig.

5C). Silencing of YAP decreased the PDGF-BB concentration in CM from OV6+

CSCs (Fig. 5C), whereas YAP overexpression increased the PDGF-BB concentration

(Fig. 5D). Thirdly, we re-expressed YAP in YAP-knockdown OV6+ CSCs, which

reversed the inhibitory effects of YAP knockdown, especially the decreases in PDGFB

expression and PDGF-BB concentration (Supplementary Fig. S5A and S5B). The

data indicate that YAP promotes PDGFB expression in OV6+ bladder CSCs.

Then, we examined the mechanisms underlying YAP regulation of PDGFB in

OV6+ bladder CSCs. YAP triggers the transcription of downstream genes by

recruiting TEAD in tumors (39), which prompted us to determine whether YAP

upregulated PDGFB transcription via TEAD1 in OV6+ CSCs. We observed an

interaction between YAP and TEAD1 in OV6+ UMUC3 or J82 CSCs, which was

further enhanced by TEAD1 overexpression or recombinant human PDGF-BB

treatment (Fig. 5E). Verteporfin, an inhibitor that blocks the interaction between YAP

and TEAD (40), decreased PDGFB expression and PDGF-BB secretion by OV6+

CSCs (Fig. 5A and C). Third, TEAD1-knockdown attenuated the YAP-induced

increase in PDGFB mRNA expression and PDGF-BB concentration in CM of OV6+

CSCs (Fig. 5B and D; Supplementary Fig. S5C). Furthermore, TEAD1

overexpression increased the levels of stem-associated genes and the number of

spheres formed by OV6+ CSCs (Fig. 5F-G; Supplementary Fig. S5D-F), and

TEAD1 knockdown alleviated the promoting effects of YAP or PDGF-BB on the

stem-like properties of OV6+ CSCs from UMUC3 or J82 cells (Fig. 5F-G;

Supplementary Fig. S5E-F). Therefore, YAP facilitates PDGFB expression in a

TEAD1-dependent manner, contributing to the stem-like characteristics of OV6+

CSCs.

In addition, online JASPAR software (http://jaspar.genereg.net) was employed to

predict putative transcription factor-binding sites of TEAD1 on the PDGFB promoter

(Supplementary Fig. S5G). As expected, TEAD1 bound to the PDGFB promoter in

OV6+ CSCs, as demonstrated through a chromatin immunoprecipitation (ChIP) assay

(Fig. 5H). Additionally, though TEAD1 or YAP overexpression or PDGF-BB

treatment enhanced PDGFB transcriptional activity in OV6+ UMUC3 CSCs, mutated

variants of the TEAD1-binding sites on PDGFB abolished the effects, which was

validated by luciferase assays (Fig. 5I). Thus, PDGF-BB/PDGFR-induced YAP

upregulation reciprocally promotes the PDGFB transcription through TEAD1 in

OV6+ bladder CSCs.

Blocking the YAP/TEAD1/PDGF-BB/PDGFR autocrine regulatory loop impairs

chemotherapy resistance of OV6+ CSCs

As the autocrine regulatory loop YAP/TEAD1/PDGF-BB/PDGFR is required in

OV6+ CSCs, we further investigated whether blocking the loop using verteporfin or

CP-673451 could improve the therapeutic effect of cis-platinum in an orthotopic BCa

mouse model. OV6+ CSCs from UMUC3 or T24 cultures stably expressing a

luciferase reporter were perfused into murine bladders through a urethral catheter, and

tumor growth was monitored using an in vivo imaging system (Fig. 6A;

Supplementary Fig. S6A). After the perfusion, mice were treated with cis-platinum

or cis-platinum (Cis) combined with verteporfin (VP), or with CP-673451 (CP). As

shown in Fig. 6A-B and Supplementary Fig. S6A and S6B, there was no significant

difference in tumor growth between OV6+ CSC-derived xenografts treated with

cis-platinum and naïve xenografts, indicating that OV6+ CSCs were resistant to

cis-platinum in vivo, which is consistent with the in vitro experimental results.

However, cis-platinum combined with verteporfin or CP-673451 inhibited tumor

growth and reduced the expression levels of OV6 and YAP in tissues from OV6+

CSC-derived xenografts (Fig. 6A-D; Supplementary Fig. S6A-D). These results

indicate that blocking the YAP/TEAD1/PDGF-BB/PDGFR autocrine regulatory loop

in OV6+ CSCs with verteporfin or CP-673451 can reduce cis-platinum resistance in

BCa.

Furthermore, we examined the clinical significance of OV6 and PDGFR in BCa

patients. We found a positive correlation between OV6 and PDGFR expression in

BCa specimens (Supplementary Fig. S6E; Supplementary Table S16). Based on

intratumor OV6 and PDGFR expression, BCa patients were classified into four

groups (Supplementary Table S17), and concomitantly elevated OV6 and PDGFR

expression in BCa patients resulted in the poorest cancer-specific survival (p<0.001),

progression-free survival (p<0.001) and overall survival (p<0.001) (Supplementary

Fig. S6F-H).

Discussion

Approximately 75% of newly diagnosed patients are diagnosed with NMIBC, and

25% are diagnosed with MIBC or metastatic disease (41). Despite receiving radical

cystectomy and pelvic lymph node dissection for MIBC, more than half of patients

will eventually develop tumors at distant sites (42). BCa relapse and treatment failure

in most patients have been attributed to the existence of CSCs, which survive many

commonly employed therapeutics, including chemotherapy. Although many studies

have focused on bladder CSCs, the specific markers and underlying mechanisms of

chemotherapy resistance have not been elucidated. However, our study identified a

new subset of CSCs with OV6 expression that is closely associated with the

progression and prognosis of patients with BCa. Furthermore, the results showed that

targeting OV6+ CSCs inhibited chemotherapy resistance and improved the therapeutic

effects of cis-platinum on MIBC (Fig. 6E). These data suggest that OV6 can also

serve as a potential therapeutic target. However, since OV6 itself is a poorly

understood molecular entity, the practicality of using it to mark CSCs awaits further

delineation of its constituent complexity.

YAP is a transcription co-factor suppressed by the Hippo pathway, and this

co-factor exerts its pro-tumorigenic function and drives CSC self-renewal in various

malignant tumors. In BCa, YAP has been reported to be an independent biomarker for

poor prognosis of patients and to promote cell growth and migration (43, 44). A

recent study indicated that YAP activation is a pharmacological target for enhancing

the antitumor effects of DNA-damaging modalities in chemotherapy (45). However,

the role and mechanism of YAP in bladder CSCs have not been clearly elucidated. In

this study, the differentially expressed genes regulating bladder CSCs were screened

through transcriptome sequencing, and YAP was found to be a crucial factor. In

addition, we found that YAP is necessary for maintenance of the stem-like properties

of OV6+ bladder CSCs and that the combined expression of YAP and OV6 predicts

the prognosis of patients.

Many studies have demonstrated that autocrine signaling loops continuously

activate intratumor pathways and regulate tumor growth and CSCs (10, 46, 47). To

elucidate the mechanisms underlying the sustained activation of YAP and its role in

the self-renewal of OV6+ CSCs, we also identified a positive autocrine loop, namely,

the YAP/TEAD1/PDGF-BB/PDGFR loop. PDGF-BB has been reported to mediate

mesenchymal stem cells and chemotherapy-resistant cancer cells (48, 49), but the

biological function and mechanisms of PDGF-BB in CSCs are not fully understood.

In addition, although YAP is upregulated by stimulation with PDGF-BB in vascular

smooth muscle cells (50), the mechanisms underlying PDGF-BB regulation of YAP

have not been elucidated. In our study, we found that PDGF-BB facilitates the

stem-like characteristics of OV6+ CSCs by enhancing YAP stability in the cytoplasm

and promoting increased YAP entry into the nucleus. A recent study revealed that a

PDGFR-Src family kinase (SFK) cascade regulates YAP activation via tyrosine

phosphorylation in cholangiocarcinoma (51). However, whether PDGFR directly

mediates YAP stabilization in tumors has not been reported. Our study demonstrated

that PDGFR interacts with YAP to prevent YAP phosphorylation by LATS1/2, which

facilitates YAP activation in OV6+ CSCs.

Given that OV6 is associated with BCa progression and the prognosis of BCa

patients and the autocrine YAP/TEAD1/PDGF-BB/PDGFR signaling loop is required

in OV6+ CSCs, we established a treatment model of orthotopic BCa to examine

whether blocking the autocrine loop inhibited the resistance of MIBC and augmented

the therapeutic effect of cis-platinum. As expected, PDGFR or YAP suppression

alleviated the chemotherapy resistance of OV6+ CSCs to cis-platinum and achieved a

favorable therapeutic effect in vivo. We do, however, recognize that the YAP/TEAD1

inhibitor Verteporfin used in our study has been reported to exhibit YAP-independent

anti-proliferative and cytotoxic effects in endometrial cancer cells (52). Based on the

results of this study, our future studies will further elucidate the interaction between

CSCs and the microenvironment, which will aid in the discovery of more effective

therapeutic targets for drug resistance and recurrence in BCa patients.

Acknowledgements

This work was supported by Innovation Program of Shanghai Municipal

Education Commission (No. 2017-01-07-00-07-E00014); the National Natural

Science Foundation of China (No. 81772720, 81773154, 81572509 and 81301861);

Shanghai Natural Science Foundation of China (No. 13ZR1450700); Special Fund for

Major Projects of Zhangjiang National Innovation Demonstration Zone; the national

new drug innovation program (2017ZX09304030); Shanghai clinical medical center

for urinary system diseases (2017ZZ01005); Shanghai Key Laboratory of Cell

Engineering (14DZ2272300). We also thanks very much for contributions of Dr.

Zi-wei Wang and Yu-xin Tan (Department of Urology, Changhai Hospital, Second

Military Medical University, Shanghai, China), Jian Lu and Qi Chen (Department of

Health Statistics, Second Military Medical University, Shanghai, China) in this study.

References:

1. Torre Lindsey A., Bray Freddie, Siegel Rebecca L., Ferlay Jacques,

Lortet-Tieulent Joannie, Jemal Ahmedin. Global cancer statistics, 2012. CA: A

Cancer Journal for Clinicians 2015;65: 87-108.

2. Knowles Margaret A., Hurst Carolyn D. Molecular biology of bladder cancer:

new insights into pathogenesis and clinical diversity. NAT REV CANCER 2015;15:

25-41.

3. Zhang H., Prado K., Zhang K. X., Peek E. M., Lee J., Wang X., et al.. Biased

Expression of the FOXP3 3 Isoform in Aggressive Bladder Cancer Mediates

Differentiation and Cisplatin Chemotherapy Resistance. CLIN CANCER RES 2016;22:

5349-61.

4. Park Nicole I., Guilhamon Paul, Desai Kinjal, McAdam Rochelle F., Langille

Ellen, O Connor Madlen, et al.. ASCL1 Reorganizes Chromatin to Direct Neuronal

Fate and Suppress Tumorigenicity of Glioblastoma Stem Cells. CELL STEM CELL

2017;21: 209-24.

5. Garcia-Heredia Jose Manuel, Lucena-Cacace Antonio, Verdugo-Sivianes Eva M.,

Pérez Marco, Carnero Amancio. The Cargo Protein MAP17 (PDZK1IP1) Regulates

the Cancer Stem Cell Pool Activating the Notch Pathway by Abducting NUMB.

CLIN CANCER RES 2017;23: 3871-83.

6. Park S-J, Shim J. W., Park H. S., Eum D-Y, Park M-T, Mi Yi J., et al..

MacroH2A1 downregulation enhances the stem-like properties of bladder cancer cells

by transactivation of Lin28B. ONCOGENE 2016;35: 1292-301.

7. Chan K. S., Espinosa I., Chao M., Wong D., Ailles L., Diehn M., et al..

Identification, molecular characterization, clinical prognosis, and therapeutic targeting

of human bladder tumor-initiating cells. Proc Natl Acad Sci U S A 2009;106:

14016-21.

8. Zhu Fengyu, Qian Weiqing, Zhang Haojie, Liang Yu, Wu Mingqing, Zhang

Yingyin, et al.. SOX2 Is a Marker for Stem-like Tumor Cells in Bladder Cancer.

STEM CELL REP 2017;9: 429-37.

9. Li C., Du Y., Yang Z., He L., Wang Y., Hao L., et al.. GALNT1-Mediated

Glycosylation and Activation of Sonic Hedgehog Signaling Maintains the

Self-Renewal and Tumor-Initiating Capacity of Bladder Cancer Stem Cells. CANCER

RES 2016;76: 1273-83.

10. Jia Deyong, Li Li, Andrew Sulaiman, Allan David, Li Xuguang, Lee Jonathan, et

al.. An autocrine inflammatory forward-feedback loop after chemotherapy withdrawal

facilitates the repopulation of drug-resistant breast cancer cells. Cell Death and

Disease 2017;8: e2932.

11. Yang Zhao, He Luyun, Lin Kaisu, Zhang Yun, Deng Aihua, Liang Yong, et al..

The KMT1A-GATA3-STAT3 Circuit Is a Novel Self-Renewal Signaling of Human

Bladder Cancer Stem Cells. CLIN CANCER RES 2017;23: 6673-85.

12. Lee S. R., Roh Y. G., Kim S. K., Lee J. S., Seol S. Y., Lee H. H., et al..

Activation of EZH2 and SUZ12 Regulated by E2F1 Predicts the Disease Progression

and Aggressive Characteristics of Bladder Cancer. CLIN CANCER RES 2015;21:

5391-403.

13. Yang Zhao, Li Chong, Fan Zusen, Liu Hongjie, Zhang Xiaolong, Cai Zhiming, et

al.. Single-cell Sequencing Reveals Variants in ARID1A, GPRC5A and MLL2

Driving Self-renewal of Human Bladder Cancer Stem Cells. EUR UROL 2017;71:

8-12.

14. Zanconato Francesca, Cordenonsi Michelangelo, Piccolo Stefano. YAP/TAZ at

the Roots of Cancer. CANCER CELL 2016;29: 783-803.

15. Meng Z., Moroishi T., Guan K. L. Mechanisms of Hippo pathway regulation.

Genes Dev 2016;30: 1-17.

16. Escoll M., Gargini R., Cuadrado A., Anton I. M., Wandosell F. Mutant p53

oncogenic functions in cancer stem cells are regulated by WIP through YAP/TAZ.

ONCOGENE 2017;36: 3515-27.

17. Noto A., De Vitis C., Pisanu M. E., Roscilli G., Ricci G., Catizone A., et al..

Stearoyl-CoA-desaturase 1 regulates lung cancer stemness via stabilization and

nuclear localization of YAP/TAZ. ONCOGENE 2017;36: 4573-84.

18. Guo Y., Cui J., Ji Z., Cheng C., Zhang K., Zhang C., et al..

miR-302/367/LATS2/YAP pathway is essential for prostate tumor-propagating cells

and promotes the development of castration resistance. ONCOGENE 2017;36:

6336-47.

19. Crosby H. A., Hubscher S. G., Joplin R. E., Kelly D. A., Strain A. J.

Immunolocalization of OV-6, a putative progenitor cell marker in human fetal and

diseased pediatric liver. HEPATOLOGY 1998;28: 980-5.

20. Van Den Heuvel M. Expression of anti-OV6 antibody and anti-N-CAM antibody

along the biliary line of normal and diseased human livers. HEPATOLOGY 2001;33:

1387-93.

21. Wang C., Yang W., Yan H. X., Luo T., Zhang J., Tang L., et al.. Hepatitis B

virus X (HBx) induces tumorigenicity of hepatic progenitor cells in

3,5-diethoxycarbonyl-1,4-dihydrocollidine-treated HBx transgenic mice.

HEPATOLOGY 2012;55: 108-20.

22. Wang Chao, Yan Fei-hu, Zhang Jia-jun, Huang Hai, Cui Qin-shu, Dong Wei, et

al.. OV6 + cancer stem cells drive esophageal squamous cell carcinoma progression

through ATG7-dependent β-catenin stabilization. CANCER LETT 2017;391: 100-13.

23. Wang Chao, Wang Ming-da, Cheng Peng, Huang Hai, Dong Wei, Zhang

Wei-wei, et al.. Hepatitis B virus X protein promotes the stem-like properties of OV6+

cancer cells in hepatocellular carcinoma. CELL DEATH DIS 2017;8: e2560.

24. Yang W., Wang C., Lin Y., Liu Q., Yu L. X., Tang L., et al.. OV6(+)

tumor-initiating cells contribute to tumor progression and invasion in human

hepatocellular carcinoma. J HEPATOL 2012;57: 613-20.

25. Cheng L., Montironi R., Davidson D. D., Lopez-Beltran A. Staging and reporting

of urothelial carcinoma of the urinary bladder. Mod Pathol 2009;22 Suppl 2: S70-95.

26. Babjuk M., Bohle A., Burger M., Capoun O., Cohen D., Comperat E. M., et al..

EAU Guidelines on Non-Muscle-invasive Urothelial Carcinoma of the Bladder:

Update 2016. EUR UROL 2017;71: 447-61.

27. Alfred Witjes J., Lebret T., Comperat E. M., Cowan N. C., De Santis M., Bruins

H. M., et al.. Updated 2016 EAU Guidelines on Muscle-invasive and Metastatic

Bladder Cancer. EUR UROL 2017;71: 462-75.

28. Wang C., Fu S. Y., Wang M. D., Yu W. B., Cui Q. S., Wang H. R., et al.. Zinc

finger protein X-linked promotes expansion of EpCAM(+) cancer stem-like cells in

hepatocellular carcinoma. MOL ONCOL 2017;11: 455-69.

29. Tur Mehmet Kemal, Etschmann Benjamin, Benz Alexander, Leich Ellen, Waller

Christiane, Schuh Kai, et al.. The 140-kD Isoform of CD56 (NCAM1) Directs the

Molecular Pathogenesis of Ischemic Cardiomyopathy. The American Journal of

Pathology 2013;182: 1205-18.

30. Zheng Y., Katsaros D., Shan S. J. C., de la Longrais I. R., Porpiglia M., Scorilas

A., et al.. A Multiparametric Panel for Ovarian Cancer Diagnosis, Prognosis, and

Response to Chemotherapy. CLIN CANCER RES 2007;13: 6984-92.

31. Wang C., Peng G., Huang H., Liu F., Kong D. P., Dong K. Q., et al.. Blocking

the Feedback Loop between Neuroendocrine Differentiation and Macrophages

Improves the Therapeutic Effects of Enzalutamide (MDV3100) on Prostate Cancer.

CLIN CANCER RES 2018;24: 708-23.

32. Watanabe T., Shinohara N., Sazawa A., Harabayashi T., Ogiso Y., Koyanagi T.,

et al.. An improved intravesical model using human bladder cancer cell lines to

optimize gene and other therapies. CANCER GENE THER 2000;7: 1575-80.

33. Wang Yongfang, Zhou You, Tao Feng, Chai Shoujie, Xu Xia, Yang Ying, et al..

N-myc downstream regulated gene 1(NDRG1) promotes the stem-like properties of

lung cancer cells through stabilized c-Myc. CANCER LETT 2017;401: 53-62.

34. Hur K., Toiyama Y., Takahashi M., Balaguer F., Nagasaka T., Koike J., et al..

MicroRNA-200c modulates epithelial-to-mesenchymal transition (EMT) in human

colorectal cancer metastasis. GUT 2013;62: 1315-26.

35. Nomura Alice, Gupta Vineet K., Dauer Patricia, Sharma Nikita S., Dudeja Vikas,

Merchant Nipun, et al.. NFκB-Mediated Invasiveness in CD133+

Pancreatic TICs Is Regulated by Autocrine and Paracrine Activation of IL1 Signaling.

MOL CANCER RES 2018;16: 162-72.

36. Bauman J. E., Eaton K. D., Martins R. G. Antagonism of Platelet-Derived

Growth Factor Receptor in Non Small Cell Lung Cancer: Rationale and Investigations.

CLIN CANCER RES 2007;13: 4632s-4636s.

37. Yoshimura Hitoshi, Nariai Yuko, Terashima Masaharu, Mitani Toshifumi,

Tanigawa Yoshinori. Taurine suppresses platelet-derived growth factor (PDGF)

BB-induced PDGF-β receptor phosphorylation by protein tyrosine

phosphatase-mediated dephosphorylation in vascular smooth muscle cells. Biochimica

et Biophysica Acta (BBA) - Molecular Cell Research 2005;1745: 350-60.

38. Konotop G., Bausch E., Nagai T., Turchinovich A., Becker N., Benner A., et al..

Pharmacological Inhibition of Centrosome Clustering by Slingshot-Mediated Cofilin

Activation and Actin Cortex Destabilization. CANCER RES 2016;76: 6690-700.

39. Katschnig A. M., Kauer M. O., Schwentner R., Tomazou E. M., Mutz C. N.,

Linder M., et al.. EWS-FLI1 perturbs MRTFB/YAP-1/TEAD target gene regulation

inhibiting cytoskeletal autoregulatory feedback in Ewing sarcoma. ONCOGENE

2017;36: 5995-6005.

40. Liu-Chittenden Y., Huang B., Shim J. S., Chen Q., Lee S. J., Anders R. A., et al..

Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the

oncogenic activity of YAP. Genes Dev 2012;26: 1300-5.

41. Zlotta Alexandre R., Roumeguere Thierry, Kuk Cynthia, Alkhateeb Sultan,

Rorive Sandrine, Lemy Anne, et al.. Select Screening in a Specific High-Risk

Population of Patients Suggests a Stage Migration Toward Detection of

Non–Muscle-Invasive Bladder Cancer. EUR UROL 2011;59: 1026-31.

42. Birkenkamp-Demtröder Karin, Christensen Emil, Nordentoft Iver, Knudsen

Michael, Taber Ann, Høyer Søren, et al.. Monitoring Treatment Response and

Metastatic Relapse in Advanced Bladder Cancer by Liquid Biopsy Analysis. EUR

UROL 2017.

43. Liu J. Y., Li Y. H., Lin H. X., Liao Y. J., Mai S. J., Liu Z. W., et al..

Overexpression of YAP 1 contributes to progressive features and poor prognosis of

human urothelial carcinoma of the bladder. BMC CANCER 2013;13: 349.

44. Dong Liang, Lin Fan, Wu Wanjun, Huang Weiren, Cai Zhiming. Transcriptional

cofactor Mask2 is required for YAP-induced cell growth and migration in bladder

cancer cell. J CANCER 2016;7: 2132-8.

45. Ciamporcero E., Shen H., Ramakrishnan S., Yu Ku S., Chintala S., Shen L., et al..

YAP activation protects urothelial cell carcinoma from treatment-induced DNA

damage. ONCOGENE 2016;35: 1541-53.

46. Gautam Jaya, Ku Jin-Mo, Regmi Sushil Chandra, Jeong Hyunyoung, Wang Ying,

Banskota Suhrid, et al.. Dual Inhibition of NOX2 and Receptor Tyrosine Kinase by

BJ-1301 Enhances Anticancer Therapy Efficacy via Suppression of

Autocrine-Stimulatory Factors in Lung Cancer. MOL CANCER THER 2017;16:

2144-56.

47. Jia Deyong, Li Li, Andrew Sulaiman, Allan David, Li Xuguang, Lee Jonathan, et

al.. An autocrine inflammatory forward-feedback loop after chemotherapy withdrawal

facilitates the repopulation of drug-resistant breast cancer cells. Cell Death and

Disease 2017;8: e2932.

48. Hung Ben P., Hutton Daphne L., Kozielski Kristen L., Bishop Corey J., Naved

Bilal, Green Jordan J., et al.. Platelet-Derived Growth Factor BB Enhances

Osteogenesis of Adipose-Derived But Not Bone Marrow-Derived Mesenchymal

Stromal/Stem Cells. STEM CELLS 2015;33: 2773-84.

49. Lau C. K., Yang Z. F., Ho D. W., Ng M. N., Yeoh G. C. T., Poon R. T. P., et al..

An Akt/Hypoxia-Inducible Factor-1 /Platelet-Derived Growth Factor-BB Autocrine

Loop Mediates Hypoxia-Induced Chemoresistance in Liver Cancer Cells and

Tumorigenic Hepatic Progenitor Cells. CLIN CANCER RES 2009;15: 3462-71.

50. Xie Changqing, Guo Yanhong, Zhu Tianqing, Zhang Jifeng, Ma Peter X., Chen

Y. Eugene. Yap1 Protein Regulates Vascular Smooth Muscle Cell Phenotypic Switch

by Interaction with Myocardin. J BIOL CHEM 2012;287: 14598-605.

51. Smoot R. L., Werneburg N. W., Sugihara T., Hernandez M. C., Yang L., Mehner

C., et al.. Platelet-derived growth factor regulates YAP transcriptional activity via Src

family kinase dependent tyrosine phosphorylation. J CELL BIOCHEM 2018;119:

824-36.

52. Dasari V. R., Mazack V., Feng W., Nash J., Carey D. J., Gogoi R. Verteporfin

exhibits YAP-independent anti-proliferative and cytotoxic effects in endometrial

cancer cells. ONCOTARGET 2017;8: 28628-40.

Figure Legends

Figure 1

OV6 is associated with disease progression and the prognosis of patients with

bladder cancer. A, Representative hematoxylin and eosin (H&E) IHC staining images

and scores of OV6 expression in normal, nonmuscle-invasive bladder cancer (NMIBC)

and muscle-invasive bladder cancer (MIBC) specimens are presented (scale bar=20

µm; (M, muscle; T, tumor). The IHC scores for OV6 in the corresponding groups are

presented (right). B-C, Representative H&E staining and immunohistochemistry (IHC)

staining for OV6 in the following groups of tissues: primary bladder cancer (BCa)

tissues versus metastasis tissues (Case 1#) and pre-chemotherapy tissues versus

post-chemotherapy tissues (Case 2#) from the same patient with BCa (scale bar=20

µm). The IHC scores for OV6 in the corresponding groups are presented (right). D,

According to the expression level of OV6 (immunoreactive score; IRS was described

in the section “Materials and Methods”) in specimens, BCa patients were divided

into two groups: an OV6low group (IRS values of 0-3) and an OV6high group (IRS

values of 4-12). Representative H&E and IHC staining of OV6 in tissues from BCa

patients are shown (scale bar=20 µm). E, A time-dependent receiver operating

characteristics (ROC) analysis was performed to determine the optimum cut-off value

of the OV6 IRS score to predict 5-year cancer-specific survival in the training set

(n=113). F-H, Kaplan-Meier curves for cancer-specific survival (F), progression-free

survival (G) and overall survival (H) of BCa patients were analyzed according to

OV6 expression (training set, n=113). I-K, Kaplan-Meier curves for cancer-specific

survival (I), progression-free survival (J) and overall survival (K) of BCa patients

were analyzed according to OV6 expression (validation set, n=112).

Figure 2

OV6+ cancer cells possessed stem-like properties and facilitated bladder cancer in

situ tumorigenicity, invasion, migration and metastasis. A, Flow cytometric analysis

was performed to detect the percentage of OV6 (APC) in spheres and adherent cells

from BCa cell lines. B-C, Immunofluorescent staining of OV6 (red), CD44 (green)

and their co-localization (yellow) in tissues from BCa patients (B) or in spheres

formed by the BCa UMUC3 cell line (C) was performed (scale bar=10 µm). D, The

expression of stem-associated genes in OV6+ and OV6- cells sorted from UMUC3 or

J82 cultures was detected with real-time PCR. E, Single-cell suspensions with 3,000

cells were seeded in 6-well ultra-low attachment culture plates and cultured in

serum-free medium supplemented with other reagents for 5 days. The number of

spheroids formed was determined via microscopy, and representative pictures are

shown. Representative images and the numbers of OV6+ and OV6- cell-derived

spheres from three serial passages were compared (scale bar=75 µm). F, A total of

5,000, 10,000 or 20,000 OV6+ or OV6- UMUC3 or J82 cells were subcutaneously

injected into 6-week-old, male, nonobese, diabetic, severe combined immunodeficient

(NOD/SCID) mice (n=6/group). The tumor xenografts derived from OV6+ and OV6-

cells and the tumor incidence in two generations are shown. G, UMUC3 or J82 cells

were treated with cis-platinum (10 μM) for 3 days, and the percentage of OV6+ cells

in the total population was analyzed by flow cytometry. H, OV6+ and OV6- cells

sorted from UMUC3 or J82 cells were treated with cis-platinum for 3 days. The cell

viability was measured through a CCK-8 assay, and the data are presented as the fold

change relative to the treatment-free groups. I，OV6+ and OV6- cells sorted from

UMUC3 or J82 cells were treated with cis-platinum (10 μM) for 3 days, and the

annexin V/PI staining percentage was analyzed via flow cytometry. All the data

represent the means ± SD; *p<0.05, **p<0.01, and ***p<0.001.

Figure 3

YAP is required for maintenance of the stem-like properties of OV6+ CSCs in

bladder cancer. A, RNA-Seq was applied, and a heatmap depicting the significantly

expressed genes in OV6+ and OV6- UMUC3 cells from three independent

experiments is shown. B, The mRNA levels of YAP, CTGF and CYR61 in OV6+ and

OV6- cells from UMUC3 or J82 cultures were detected by real-time-PCR. C, Western

blot analysis of p-LATS1/2, LATS1/2, p-YAP and YAP in cytoplasmic (Cyt) and

nuclear (Nuc) fractions of OV6+ and OV6- cells from UMUC3 cultures. β-Tubulin and

Histone H3 served as internal controls for the cytoplasmic and nuclear fractions,

respectively. D, A heatmap depicting the significantly expressed LATS1, LATS2,

YAP and target genes of YAP in OV6+ and OV6- UMUC3 cells from three

independent experiments is shown. E, Immunofluorescent staining of OV6 and YAP

in OV6+ and OV6- cells from UMUC3 cultures was analyzed (scale bar=10 µm). F,

Expression of stem-associated genes in OV6+ UMUC3 cells transfected with YAP

shRNA (#1 and #2) or control shRNA. G, The numbers of OV6+ UMUC3 cells

transfected with YAP shRNA (#1 or #2) or control shRNA-derived spheres were

compared among serial passages. H, OV6+ UMUC3 cells with YAP shRNA#1 or

control shRNA were subcutaneously injected into NOD/SCID mice (n=6/group), and

images of xenografts derived from OV6+ UMUC3 cells with different treatments are

presented. I, OV6+ UMUC3 cells transfected with YAP shRNA (#1 and #2) or control

shRNA were treated with cis-platinum (10 μM) for 3 days. The annexin V/PI staining

percentage was analyzed by flow cytometry. J, Expression of stem-associated genes

in OV6+ UMUC3 cells transfected without or with YAP plasmid, examined via

real-time PCR. K, The number spheres derived from OV6+ UMUC3 cells treated

without or with YAP plasmid was compared among serial passages. L, OV6+ UMUC3

cells without or with YAP plasmid were subcutaneously injected into NOD/SCID

mice (n=6/group), and images of xenografts are presented. M, OV6+ UMUC3 cells

without or with YAP plasmid were treated with cis-platinum (10 μM) for 3 days. The

annexin V / PI staining percentage was analyzed via flow cytometry. N-P,

Kaplan-Meier curves for cancer-specific survival, progression-free survival and

overall survival of BCa patients were analyzed according to OV6 and YAP expression

(cohort1, n=130) (*p<0.05, **p<0.01, and ***p<0.001).

Figure 4

PDGF-BB/PDGFR sustains persistent activation of YAP in OV6+ CSCs. A-B,

Cytokine profiles were analyzed using a RayBio Human Cytokine Antibody Array.

Heatmaps of significantly expressed cytokines in conditioned medium (CM) from

OV6+ and OV6- J82 (A) or UMUC3 (B) cells. C, A Venn plot of significantly

upregulated cytokines in CM of OV6+ cells (relative to CM of OV6- cells) from

UMUC3 or J82 cultures is shown. D, An ELISA was performed to detect the

PDGF-BB or ICAM-1 concentration (pg/ml) in CM from OV6+ and OV6- BCa cells.

E, Expression of stem-associated genes in OV6+ UMUC3 cells without or with

recombinant PDGF-BB (10 ng/ml), a neutralizing antibody for PDGF-BB (100 ng/ml)

or the PDGFR inhibitor CP-673451 (500 nmol/ml) for 4 days. F, The numbers of

spheres derived from OV6+ UMUC3 cells without or with recombinant PDGF-BB (10

ng/ml), a neutralizing antibody for PDGF-BB (100 ng/ml) or CP-673451 (500

nmol/ml) for 4 days were compared among serial passages. G, OV6+ UMUC3 cells

without or with recombinant PDGF-BB (10 ng/ml), a neutralizing antibody for

PDGF-BB (100 ng/ml) or CP-673451 (500 nmol/ml) for 4 days were subcutaneously

injected into NOD/SCID mice (n=6/group). Images of xenografts derived from OV6+

UMUC3 cells with different treatments in two generations are presented. H, Western

blot analysis of p-LATS1/2, LATS1/2, p-YAP and YAP in cytoplasmic (Cyt) and

nuclear (Nuc) fractions of OV6+ UMUC3 or J82 cells without or with recombinant

PDGF-BB (10 ng/ml) or CP-673451 (500 nmol/ml) treatment for 4 days. β-Tubulin

and Histone H3 served as internal controls for the cytoplasmic and nuclear fractions,

respectively. I, Expression of stem-associated genes in OV6+ UMUC3 cells without

or with recombinant PDGF-BB (10 ng/ml, 4 days) or with PDGF-BB plus YAP

knockdown (shYAP1# and shYAP2#). J, The numbers of spheres derived from OV6+

UMUC3 cells without or with recombinant PDGF-BB (10 ng/ml, 4 days) or with

PDGF-BB plus YAP knockdown (shYAP1# and shYAP2#) were compared among

serial passages. K, OV6+ UMUC3 cells without or with recombinant PDGF-BB (10

ng/ml, 4 days) or with PDGF-BB plus YAP knockdown (shYAP1#) were

subcutaneously injected into NOD/SCID mice (n=6/group). Images of xenografts

derived from OV6+ UMUC3 cells with different treatments in two generations are

presented. L, A western blot analysis was performed to detect co-immunoprecipitation

(co-IP) of endogenous PDGFR with YAP from OV6+ UMUC3 cells. IgG served as the

IP control. M, Western blot analysis of co-IP of endogenous PDGFR or p-LATS1/2

with YAP from OV6+ UMUC3 or J82 cells without or with recombinant PDGF-BB

(10 ng/ml) or CP-673451 (500 nmol/ml) for 4 days. (*p<0.05, **p<0.01, and

***p<0.001).

Figure 5.

YAP/TEAD1/PDGF-BB/PDGFR forms an autocrine regulatory loop in OV6+

CSCs. A, mRNA expression of PDGFB in OV6- and OV6+ UMUC3 or J82 cells

treated without or with YAP shRNA#1, shRNA#2 or the YAP inhibitor verteporfin (500

nmol/ml, 3 days). B, PDGFB mRNA expression was analyzed in control OV6+ cells

and YAP-overexpressing OV6+ cells without or with TEAD1 shRNA#1 or TEAD1

shRNA#3. C, An ELISA was performed to detect the PDGF-BB concentration (pg/ml)

in CM from OV6- and OV6+ UMUC3 or J82 cells treated without or with YAP

shRNA#1, YAP shRNA#2, or verteporfin (500 nmol/ml, 3 days). D, An ELISA was

performed to detect the PDGF-BB concentration (pg/ml) in CM from control OV6+

cells and YAP-overexpressing OV6+ cells without or with TEAD1 shRNA#1 or

TEAD1 shRNA#3. E, Western blot analysis of the co-IP of endogenous YAP with

TEAD1 from OV6+ UMUC3 or J82 cells treated without or with TEAD1

overexpression or recombinant PDGF-BB treatment (10 ng/ml, 4 days). F, Expression

of stem-associated genes in control OV6+ cells, TEAD1-overexpressing OV6+ cells or

YAP-overexpressing OV6+ cells without or with TEAD1 shRNA#3. G, The numbers

of spheres derived from control OV6+ cells, TEAD1-overexpressing OV6+ cells or

YAP-overexpressing OV6+ cells without or with TEAD1 shRNA#3 were compared

among serial passages. H, ChIP-PCR analysis confirmed the binding of TEAD1 to the

PDGFB promoter in OV6- and OV6+ BCa cells. I, TEAD1-binding sites in OV6+

UMUC3 cells were blocked using reporter constructs harboring mutant TEAD1

variants. Luciferase assays were performed to detect PDGFB transcription activity in

OV6+ UMUC3 cells without or with TEAD1 overexpression, YAP overexpression

and PDGF-BB (10 ng/ml, 4 days) treatment. (*p<0.05, **p<0.01, and ***p<0.001).

Figure 6.

Blocking the autocrine regulatory loop using verteporfin or CP-673451 impedes

chemotherapy resistance of OV6+ CSCs. A, OV6+ cells with stable luciferase

expression were perfused into murine bladders using a urethral catheter, and then, the

mice were intraperitoneally injected with cis-platinum (3mg/kg) (Cis) alone or

cis-platinum combined with verteporfin (100mg/kg) (VP) or CP-673451 (30 mg/kg)

(CP) every 2 days. The tumor growth was monitored using an in vivo imaging system.

Bioluminescence images and tumor images of orthotopic xenografts derived from

OV6+ UMUC3 cells with different treatments are presented. H&E and IHC staining

of OV6 and YAP in orthotopic tumors from mice in different groups was performed

(scale bar=500 µm, 100 µm or 20 µm). B, At the third week postperfusion, photon

flux was examined in the different groups of mice. The results are presented as the

fold increase in tumor growth over time until the third week postinjection. C-D, IHC

staining scores for OV6 (C) and YAP (D) in orthotopic tumors from mice in different

groups are presented. E, Schematic diagram of the underlying mechanisms described

in our study and the clinical significance of our findings. (*p<0.05, **p<0.01 and

***p<0.001).

Targeting an Autocrine Regulatory Loop in Cancer Stem-Like Cells Impairs the Progression and Chemotherapy Resistance of Bladder Cancer

Kai-jian Wang, Chao Wang, Li-he Dai, et al.

Clin Cancer Res Published OnlineFirst November 5, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-18-0586

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2018/11/03/1078-0432.CCR-18-0586.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet Manuscript been edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2018/11/03/1078-0432.CCR-18-0586. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.