© 2012 Nature America, Inc. All rights reserved. should should be addressed to L.-H.T. ([email protected]). Medicine, Rutgers University, Newark, New Jersey, USA. (T.T.) and Department of Karolinska Neuroscience, Institutet, Stockholm, Sweden (K.M.). Correspondence 4 2 1 cells non-neuronal in cytoskeleton actin the modulates TAOK2 kinases (MEKs) protein mitogen-activated activates selectively TAOK2 phenotype. FMRP protein, X ile and schizophrenia shown to carry substantialbeen susceptibilityrecently has to that autism region spectrum di a 16p11.2, chromosome on located is TAOK2, a member of the MAP kinase kinase kinase encoding gene the In humans, (MAPKKK) of transcription. gene modulation family,the ways kinase p38 (JNK, or signal-regulated extracellular path (MAPK) kinase (MAP) protein mitogen-activated activate to dendrites. basal of formation the control that pathways molecular dendrites basal the on form neurons pyramidal by neocortical received of synapses majority The face, and basal dendrites, which emerge from the base of the cell body. sur pial toward the extends which dendrite, apical the domains: two In general, pyramidal neurons have a dendritic tree disorders that is divided intospectrum autism as such onset, delayed with disorders psychiatric and neurodevelopmental to contribute may arborization dendritic aberrant that suggest evidence of lines Several conditions. disease and normal in functions cognitive sophisticated underlying of neurons is of key these to phology the mechanisms the elucidation amygdala with and hippocampus the cortex, including associated functions, complex cognitive regions brain in abundant are neurons Pyramidal whereby Sema3A and Nrp1 transduce signals through TAOK2 and JNK to regulate basal dendrite development in cortical neurons.the formation of basal dendrites through the activation of the c-Jun N-terminal kinase (JNK). These results delineate a pathwayalso ameliorates the basal dendrite impairment resulting from Nrp1 downregulation cultured cortical neurons from protein that binds the secreted guidance cue Semaphorin 3A (Sema3A). TAOK2 overexpression restores dendrite formation in dendrite formation amino acid 2 kinase (TAOK2), also known as TAO2, is essential for dendrite morphogenesis. TAOK2 downregulationaffects impairs the basalformation of basal dendrites and axonal projections in cortical pyramidal neurons. We report that thousand-and-one-How neurons develop their morphology is an important question in neurobiology. Here we describe a new pathway that specifically Alex L Kolodkin Konstantinos Meletis Froylan Calderon de Anda affects basal dendrite formation in the neocortex Autism spectrum disorder susceptibility gene t r a 1022 Received 8 March; accepted 14 May; published online 10 June 2012; corrected after print 9 July 2012: Solomon Solomon H. Snyder Department of The Neuroscience, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA. Howard Hughes Medical Institute, Cambridge, USA. Massachusetts, Department of Brain and Cognitive Sciences, Picower Institute for Learning and Memory, Institute Massachusetts of Technology, Cambridge, USA. Massachusetts, TAOK1 and TAOK2 serine/threonine protein kinases are known known are kinases protein TAOK2serine/threonine TAOK1and

C I 1 . An understanding of the distinct physiology and mor and physiology distinct the of understanding An . e l 1 0 s and as serves a regulator of p38 MAPK. In 8 . . in vivo 2 9 TAOK2 , whose loss or dysfunction leads to an autistic autistic an to leads dysfunction or loss whose , , 4 & Li-Huei Tsai 1 without affecting apical dendrites. Moreover, TAOK2 interacts with Neuropilin 1 (Nrp1), a receptor – mRNA is also a direct target of frag the target a direct mRNA is also 3 4 , . However, little is known about the the about known is little However, . 5 , , Damien Rei Nrp1 1 , 2 , , Ana Lucia Rosario Sema− 1 – mice, which express Nrp1 receptors incapable of binding Sema3A. TAOK2 overexpression 3 1 , 2 , , Takahiro Soda 5 , 6 ), leading ), to leading 3

addition, addition, Stanley Stanley Center for Psychiatric Research, Broad Institute, Cambridge, USA. Massachusetts, 1 s , orders 2 , , Omer Durak 2 , 3 7 - - - - .

1 , guidance cue Sema3A that controls basal dendrite arborization dendrite basal controls that Sema3A cue guidance found that of TAOK2receptor the secreted the Nrp1, with interacted We elongation. axonal and dendrites basal of formation the impairs isoforms TAOK2 the produce to splicing JNK of activation the through is a region where actin, but not microtubules, accumulates ( accumulates microtubules, not but actin, where region a is to cones ( growth localized preferentially days 2 cultured and 17 (E) day embryonic at dissociated neurons cortical mouse in TAOK2immunoreactivity To examine the expression subcellular profile of TAOK2, we analyzed Expression profile of TAOK2 in neurons and cerebral cortex RESULTS cortex. developing the in Nrp1, TAOK2 and JNK1 in the regulation of Sema3A, basal dendrite formation involving axis signaling a of action the support data these neurons after TAOK2 in formation cortical Overall, downregulation. of a constitutively restored active JNK1 (MKK7-JNK1) dendrite basal Overexpression of neurons. cortical decrease cultured a in as phosphorylation JNK manifested that inactivation JNK to led also tion downregula TAOK2 overexpression. TAOK2 by restored be could activating or expressed was not capable of not binding dendrite basal formation Sema3A, deficits thereby either was Nrp1 which in phosphorylation, conditions In TAOK2. TAOK2 induced Sema3A 2 , , Ram Madabhushi Here we demonstrate that TAOK2 downregulation selectively selectively downregulation TAOK2 that demonstrate we Here VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME 1 1 2 – , of which only TAOK2 only which of , 3 , , Tracy Tran doi:10.1038/nn.314 in vivo . Finally, Sema3A and TAOK2 modulate 1 , 2 2 , , David D Ginty , 4 , 5 1 α , , Johannes Gräff 1 . . (140 kDa) and TAOK2and kDa) (140 α TAOK2 1 stimulates the JNK pathway JNK the stimulates 5 Present Present addresses: School of Fig. Fig. 1a is subjected to alternative alternative to subjected is nature nature in vitro in TAOK2 2 , , b 4 ). ). The cone growth ,

1 (DIV). TAOK2 (DIV). NEUR , 2 , β (120 kDa) kDa) (120 OSCI Fig. 1 Fig.

14– EN 1 3 . C 1 b 7 E - ) .

© 2012 Nature America, Inc. All rights reserved. being processed for immunocytochemistry using antibodies to to antibodies using TAOK2 immunocytochemistry and to acetylated tubulin ( for processed being before h 48 for cultured were Neurons (F-GFP). GFP brane-bound expressing by transfected been had that embryos from E17 at neurons cortical TAOK2 in neuronal endogenous downregulate to ability their to respect with constructs shRNA our of specificity the Weconfirmed TAOK2. of expression of sequences coding different ing RNAs For short hairpin (shRNAs) specific three target we this, designed differentiation. neuronal affects function of gain and function of TAOK2 loss whether asked we structures, actin-rich in centrated cells non-neuronal in cytoskeleton actin of the organization the TAOK2that modulates step latory in axon and formation dendrite The remodeling of cytoskeleton is the an actin-based important regu neurons cortical cultured in differentiation TAOK2 affects TAOK2 on studies subsequent our focused We therefore differentiation. neuronal for TAOK2 that of TAOK2 expression detected we neurons, cortical E17 DIV2 in addition, ( adult and in the perinatally observed only was kDa) 120 0) (P) day of TAOK2 (TAOK2 isoform short the In contrast, postnatal mice. adult and and (E19 perinatal in increased and opment devel embryonic cortical early throughout expressed was kDa) 140 of TAOK2 isoform long the (TAOK2that demonstrated ages natal post and embryonic different at mice of ventricu cortices the from the extracts in ( expression low is their zone the lar and of plate (E18), cortical cortex the and developing zone intermediate the in expressed dynamics microtubule and actin of coordinator TAOK2of that TAOK2 pattern This suggests may as a act expression ( accumulate also microtubules where shaft, neurite the to TAOK2 on (pTAOK2)by Ser181 activated phosphorylation localized dynamic most the is cytoskeleton actin the where and ( 10 bars, Scale control. a loading as used TAOK2 The points. time adult and P0) (E19, perinatal at considerably increases but development embryonic cortical early during constant is expression ( cortex. developing the of (CP) plate cortical and (IZ) zone intermediate the in present preferentially are pTAOK2 and ( neurons. cortical isolated of shaft neurite the to localizes ( cones. growth in (green) actin with ( neurons. cortical isolated of (arrowheads) cones ( cortex. cerebral developing the and 1 Figure nature nature and the number of intact (non-collapsed) growth cones per neuron, neuron, per cones growth (non-collapsed) intact of number the and ( neurons cortical cultured of cones growth the in content neurons. F-actin primary the TAOK2 decreased in of knockdown shRNA-mediated The morphology cone growth and cytoskeleton experiments. subsequent all for 2 and 1 shRNAs We used TAOK2 expression. downregulated that showed experiments shRNA 3). These ( line cell Ht22 ronal neu hippocampal mouse the in analysis blot western by constructs shRNA our of specificity the assessed We 3). also shRNA for shown d ); Hoechst stains nuclei. stains Hoechst ); We first examined the impact of TAOK2 knockdown on the the on knockdown TAOK2 of impact the examined first We preferentially are pTAOK2 and TAOK2 brain, mouse the In β isoform is absent before E19. Focal adhesion kinase (FAK) is kinase adhesion Focal E19. before absent is isoform

α NEUR Distribution of TAOK2 and activated TAOK2 in cultured neurons neurons TAOK2 cultured in activated TAOK2 of and Distribution but not TAOK2 not but Taok2 α OSCI is likely to be the TAOK2 isoform most important important most isoform TAOK2 the be to likely is Fig. 1 Fig. shRNA or control shRNA and expressing mem expressing and shRNA control or shRNA α EN 1 1 in utero in . and we found TAOK2 expression to be con be to expression TAOK2 found we and Supplementary Fig. 1e Fig. Supplementary C E d

). Western blot analysis using whole-cell whole-cell using analysis blot Western ). β VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME (data not shown). These results suggest suggest results These shown). not (data electroporation at E15 with constructs constructs with E15 at electroporation c a Supplementary Supplementary Fig. 1a ) Activated TAOK2 (pTAOK2; green) green) TAOK2 (pTAOK2; ) Activated Taok2 ) TAOK2 localizes to the growth growth the to ) TAOK2 localizes µ m m ( to acutely knock down the the down knock acutely to e 20– ) Western blotting. TAOK2 blotting. ) Western a Taok2 , c 2 b ), 5 ), 2 , ) TAOK2 (red) localizes localizes ) TAOK2 (red) f . . As it has shown been ; data not shown for for shown not data ; 1 9 µ shRNAs efficiently shRNAs efficiently . m m ( b d 1 ) and 200 200 ) and ) ) TAOK2 8 . In contrast, . In contrast, – Fig. 1 Fig. d Fig. 2a Fig. ; ; data not Fig. 1 Fig.

e µ ). ). In m , c α b α β ). ).

------) ; ;

morphological differentiation of cultured cortical neurons. Fig. 2a of cificity This molecular replacement experiment further demonstrated the spe TAOK2 Taok2 resulted specifically from the downregulation of TAOK2,( we coexpressed increasedid proportionthe ofneurons that elaborated multiple axons neurons( (axon-bearing)polarized of 2a Fig. ( formation axon impaired downregulation TAOK2 that found We neurons. cultured in polarization affects expression ( neurons in control those with compared neurites but primary, not secondary, of number the increased neurons cortical in cultured overexpression TAOK2 ( active phosphorylated, (refs. ( per neuron ( neurites of number the decreased TAOK2 downregulation addition, ( neurons control-transfected in those with compared Supplementary Fig. 2b Fig. Supplementary Fig. Fig. 2a d a Hoechst TAOK2 Acetylated tubulin IZ CP VZ In addition, we analyzed whether TAOK2whetheranalyzed addition,we In downregulationover or shRNA 1 with a shRNA-resistant version of 10 ). Together, these data demonstrate that TAOK2 is critical for the ). Of note, TAOK2 overexpression did not affect the number the affect not TAOK2overexpressiondid note, Of ). cDNA, , e , 1 ). ). TAOK2 autophosphorylation is known to activate TAOK2 Fig. 2 Fig. Taok2 Hoechst 105 kDa 120 kDa 140 kDa e 3 ); accordingly, the overexpression of TAOK2 increased increased TAOK2 of overexpression the accordingly, ); Fig. Fig. 2a TAOK2 a shRNA 1 treatment ( treatment 1 shRNA , d ). , d

) E10 and the number of branches secondary per cell ), which rescued the

, E11 c ). To determine whether these phenotypes these whether Todetermine ).

E12 TAOK2 b TAOK2 E13 Actin Supplementary Fig. 1g Fig. Supplementary E15 Supplementary Fig. 2a Fig.Supplementary

Fig. 2a Fig. E17

Taok2 E19

P0 pTAOK2 c – e TAOK2 shRNA 1 phenotypes. and Adult t r a FAK TAOK2 TAOK2 Supplementary Supplementary Supplementary cDNA (human Fig. 2a Fig. , β α h C I ). TAOK2 ). pTAOK2 Hoechst ), but it but ), TAOK2 Merge e l , c 1023 ). In ). s - ­ © 2012 Nature America, Inc. All rights reserved. ( neurons transfected of dendrites apical the affect not did expression that TAOK2 or TAOK2demonstrated downregulation analysis over to compared arbor neurons that ( in control-transfected dendritic the of complexity the increased sion 55 cantly fewer dendritic processes with intersections between 15 transfection. shRNA arbors than control dendritic less complex produced basal regulation arbors from shRNA-transfected neurons that revealed TAOK2 down ( dendrites primary of number ( trols con to compared as dendrites primary fewer significantly had rons the differentiation neuronal cortical disrupted TAOK2 of overexpression and knockdown the Both evaluated. rons neu of morphology dendritic the and P7 at killed were Mice struct. rat or rated post- E15 mouse embryos the on TAOK2 neurons of cortical of differentiation effect ­migratory the determine to sought then We elongation axon and formation dendrite basal TAOK2 affects n ANOVA, one-way by Taok2 ( 1, shRNA (control, cell per cones growth intact of number the decreased TAOK2 silencing cell. transfected per cones growth cultures; two cells, (control, cones growth in F-actin decreased silencing ( nuclei. stains Hoechst F-actin; stains Phalloidin neurites. primary more with complexity, human shRNA-resistant an of Expression cones. growth neurons. cortical of complexity the on effects opposite have 2 Figure t r a 1024 pyramidal of feature general more a was or neurons upper-layer to d b a Fig. 3 Fig. = 119 cells, three cultures; cultures; three cells, = 119 ,

To determine whether the basal dendrite phenotype was exclusive exclusive was phenotype dendrite basal the Towhether determine Normalized mean e µ ) TAOK2 downregulation decreased the number of primary (control, (control, primary of number the decreased ) TAOK2 downregulation in utero

m from the cell soma ( soma cell the from m F-actin signal in growth cones

0 1 2 3 4 shRNA 2, 2, shRNA Fig. 3a Fig. Taok2

d Control

Taok2 C I and and TAOK2 downregulation or overexpression affects the differentiation of isolated cortical neurons. ( neurons. cortical isolated of differentiation the affects overexpression or TAOK2 downregulation n

= 133 cells, three cultures; cultures; three cells, = 133 shRNA electroporated brains, the ** e l cDNA ( cDNA Supplementary Fig. 3a Fig. Supplementary

, Taok2 b **

). TAOK2 overexpression, by contrast, increased the the increased contrast, by TAOK2overexpression, ). 1 n s = 36 cells, two cultures; cultures; two cells, = 36 shRNA

Taok2 NS P post hoc post < 0.0001 by one-way ANOVA, ANOVA, one-way by < 0.0001 NS

rTaok2 shRNA 1 2 Taok2 Acetylated tubuli TAOK2

in utero + Dunnett test * test Dunnett shRNA–transfected neurons had signifi had neurons shRNA–transfected Fig. P ) plasmids together with an F-GFP con F-GFP an with together plasmids ) Phalloidin < 0.0001 by one-way ANOVA, ANOVA, one-way by < 0.0001 rTAOK2 Hoechst Control F-GFP Fig. 3a Fig.

3 c with ). In contrast, TAOK2 overexpres contrast, In ). n Fig. ). Taok2 Taok2 c , b Taok2 Average number of intact P ). Sholl analysis of dendritic dendritic of analysis Sholl ). P

3 < 0.05) per transfected cell. rTAOK2 overexpression increased the number of primary neurites (rTAOK2, (rTAOK2, neurites primary of number the increased overexpression rTAOK2 cell. transfected per < 0.05)

< 0.0001 by one-way ANOVA, ANOVA, one-way by < 0.0001 growth cones per cell c 0 1 2 3 shRNA 2, 2, shRNA

). ). Notably, however, Sholl Control shRNA–transfected neu

in vivo in Taok2 shRNA, control shRNA in vivo in shRNA post hoc post **

n Taok2 = 44 cells, three cultures; cultures; three cells, = 44 ** . In layer II-III of II-III layer In .

TAOK2 1 Taok2 shRNA n NS . We electropo . = 36 cells, two cultures; cultures; two cells, = 36 NS Taok2 shRNA 1 Dunnett test ** test Dunnett 2 Acetylated tubuli post hoc post cDNA counteracts TAOK2 downregulation. rTAOK2 overexpression increases neuronal neuronal increases overexpression rTAOK2 TAOK2 downregulation. counteracts cDNA

TAOK2 Taok2 shRNA–transfected neurons show fewer branched neurites and show collapsed collapsed show and neurites branched fewer show neurons shRNA–transfected

µ + m and Phalloidin rTAOK2 shRNA Hoechst F-GFP Dunnett test ** test Dunnett n = 168 cells, three cultures; cultures; three cells, = 168 ------

n 1 post hoc post P in in mouse the in elongation axon TAOK2 in of ( tract axons from to the axonal deviate some transfected caused expression axons were absent in the and midline ( elongation, axon impaired downregulation TAOK2 P7. at ined Callosal hemisphere. axons from neurons transfected crossing into the were midline exam contralateral the into constructs the shRNA mouse E15 into and Venus-expressing of introduction the by followed introduced cortex, were constructs shRNA control and tion as previously reported during brain development. We performed sequential neocortex. developing the in formation dendrite basal neuron pyramidal impairs function of gain or function of TAOK2loss that demonstrate findings These without affecting apical dendrite complexity ( dendrite basal the complexity of layer V neurons pyramidal ( impaired also 2 or 1 shRNA either using lation TAOK2 P4. downregu at V layer in neurons transfected of phology mor the dendritic evaluated then an with F-GFP construct, together porating E13 embryos with by V) (layer layer deeper a of neurons in TAOK2expression down knocked we layers, cortical different the in ­neurons < 0.01; NS, not significant). ( significant). not NS, < 0.01; d

We also examined the contribution of TAOK2 to axon elongation elongation TAOK2 axon of to contribution the Weexamined also Average number of primary Drosophila

Taok2 neurites per cell 0 1 2 3 4 5 6 P

Supplementary Fig. 3e Fig. Supplementary Control Dunnett test ** test Dunnett VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME Taok2 < 0.0001 by one-way ANOVA, ANOVA, one-way by < 0.0001 Taok2 P shRNA 1, 1, shRNA

< 0.01). Mean Mean < 0.01). shRNA b **

) Quantification of F-actin content in growth cones. TAOK2 cones. growth in content F-actin of ) Quantification Taok2 shRNA1+human 1 1 ** 9

. Taok2 shRNA NS

shRNA 1 ** n 2 Acetylated tubulin = 43 cells, three cultures; cultures; three cells, = 43 P

Taok2 TAOK2 < 0.01) and secondary neurites ( neurites secondary and < 0.01) + ± Phalloidin s.e.m. Scale bars, 10 10 bars, Scale s.e.m. 2 a rTAOK2 Hoechst 3 TAOK2 ) TAOK2 downregulation and overexpression overexpression and ) TAOK2 downregulation shRNA 1, 1, shRNA Taok2 F-GFP . mCherry fluorescent protein–expressing c ) Number of intact (non-collapsed) (non-collapsed) intact of ) Number ). These results strongly support action action support strongly results ). These Fig. 3e shRNA or control shRNA plasmids n = 160 cells, three cultures; cultures; three cells, = 160 post hoc post e

n Average number of secondary = 149 cells, three cultures; cultures; three cells, = 149

, neurites per cell f 0 1 2 3 ). By constrast, TAOK2 over Control Supplementary Fig. 3b Supplementary Taok2 Dunnett test ** test Dunnett Supplementary Fig. nature nature in vivo in shRNA Taok2 µ Taok2 * m.

1 * Taok2 shRNA NS shRNA 2, 2, shRNA , as was reported reported was as , in utero in utero in NEUR P shRNA 1 NS Acetylated tubulin

= 0.0102 = 0.0102 2 TAOK2 OSCI P + transfec < 0.01). < 0.01). Phalloidin electro Hoechst rTAOK2 n Taok2 rTAOK2

F-GFP = 36

Taok2 EN

3d

, c C

), ), ). E ­ - - - - -

© 2012 Nature America, Inc. All rights reserved. human embryonic kidney cells and found that TAOK2 interacted with and Nrp1. We coexpressed TAOK2 and in Nrp1-mCherry HEK-293T precipitation experiments to probe for an interaction between TAOK2 coimmuno To performed we differentiation. idea, neuronal this test hypothesized that TAOK2 may interact with this pathway to modulate in ones, and axons severe do defasciculate not which callosal cross the midline more to tract, axonal the from deviate axons some hippocampus also develop axonal in projection defects the and corpus callosum the ing cascade controls basal dendritic arborization Previous studies have shown that the Sema3A–Nrp1/PlexinA4 signal differentiation 1 to modulate TAOK2Neuropilin with interacts nature nature ( Nrp1-mCherry f e b a Horizontal section Taok2 Coronal section Taok2 Coronal section Control Number of primary dendrites 10

Control 0 1 2 3 4 5 6 7 8 9 F-GFP Control shRNA shRNA NEUR

shRNATaok2 ** 1 1 1 OSCI ** 4

. These defects vary from mild phenotypes, in which which in phenotypes, mild from vary defects These . 1 Fig. 4 Fig. shRNATaok2 ** EN 2 C rTAOK2 a E ). To investigate whether this complex also also complex this whether investigate To ).

VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME c Number of intersections 10 11 0 1 2 3 4 5 6 7 8 9 Taok2 F-GFP 0 Distance fromcellbody 10 shRNA ** * Taok2 Taok2 rTAOK2 Control ** 20 shRNA shRNA 1 30 14– 1 40 2 1 6 . . Nrp1 50 ( µ m) 60 Sema− Control Control Control d

1 mice 4 Number of intersections . . We F-GFP rTAOK2 0 1 2 3 4 0 Distance fromcellbody - - 25 Taok2 Taok2 rTAOK2 Control extracts from extracts mice homozygous for a mutationknock-in that renders P control; versus 1 increase ( 0.14-fold control, treatment control: Sema3A to after normalized induced also was phorylation phos TAOK2 endogenous that revealed treatment Sema3A of h 2 ( cells length 150 neurite and 40 axon, between putative (the analyzed neurite longest h the 6 in and 1 between significantly increased treatment Sema3A after (2 Sema3A with were for h treated 48 and cultured embryos mouse E17 lation in cultured primary neurons. Cortical neurons dissociated from = 0.0401 by by 0.0401 = µ 50 shRNA shRNA g ml g Fig. 4e Fig. 75 −1 2 1 ) for 30 min, 1 h, 2 h, or 6 h. pTAOK2 immunoreactivity pTAOK2immunoreactivity h. 6 or h, 2 h, 1 min, 30 for ) 100 , ( f µ ). Western blot analysis of lysates from neurons after after neurons from lysates of analysis blot Western ). m) t 125 test). Finally, we quantified pTAOK2 in cortical cortical in pTAOK2 quantified we Finally, test). µ m) as compared to that in untreated control untreated in that to compared as m) callosal axons traversing the midline ( midline the traversing axons callosal of number the diminished downregulation in cells ( hoc neurons. transfected layer cortical upper from arbor ** ANOVA, one-way by rTAOK2, brains; brains; three (control, rTAOK2 overexpression after increases and TAOK2 knockdown after ( development dendrite basal in effects opposite had upregulation and ( cortex. developing the in projection axon callosal and arborization dendrite basal affects overexpression 3 Figure TAOK2. Nrp1 associated with TAOK2 in in ( from lysates cortices P0 mouse TAOK2 with associated Nrp1 TAOK2. and Nrp1 to antibodies using precipitation coimmuno to subjected and homogenized forms ( inset. callosum corpus panel: Right midline. the crossed that axons callosal projected hemisphere) mCherry, right hemisphere; left (Venus, hemispheres both in neurons ( condition). per brains ligand Sema3A modulates TAOK2 phosphory drites to form den begin layer neurons elongate and deeper axons where plate, cortical lower and zone intermediate the in preferentially we found that pTAOK2 and Nrp1 colocalized wall, cerebral E19 mouse the In Nrp1. with first we TAOK2 active whether examined colocalizes TAOK2, activates Sema3A/Nrp1 kinase the of activation loop the in resides which Ser181, on 500 Mean left. at panels respective the in outlined callosum corpus the of inset panels: Right midline. the crossing from cells these from axons prevented d b f ) TAOK2 knockdown in Venus-positive neurons neurons Venus-positive in ) TAOK2 knockdown ) Sholl analysis of apical dendrites from from dendrites apical of analysis ) Sholl decreased dendrites primary of number ) The P Next, we examined whether the Nrp1 Nrp1 the whether examined we Next, phosphorylation by activated is TAOK2 Dunnett test ** test Dunnett < 0.01). ( < 0.01). µ m m ( 2 5 Taok2 n vivo in c (

. . ( n P TAOK2 downregulation or TAOK2 downregulation e Fig. 4c Fig. = 31 cells, three brains; brains; three = cells, 31 , < 0.0001 by one-way ANOVA, ANOVA, one-way by < 0.0001 ± e f n s.e.m. Scale bars, 10 10 bars, Scale s.e.m. ). , f Taok2 = 3 experiments per duplicate; duplicate; per experiments 3 = shRNA 2, 2, shRNA ) TAOK2 shRNA-mediated ) TAOK2 shRNA-mediated c ± , cortices from P0 mice were were mice P0 from cortices , ) Sholl analysis of the dendritic dendritic the of analysis ) Sholl 0.03-fold; Sema3A, 1.32 1.32 Sema3A, 0.03-fold; , d shRNA 1, 1, shRNA ). P post hoc post 2 < 0.01, * < 0.01, 4 . To determine whether whether Todetermine . e a ) Control transfected transfected ) Control n ) TAOK2 knockdown ) TAOK2 knockdown = 20 cells, two brains; brains; two = cells, 20 in vivo in t r a Dunnett test test Dunnett n P = 23 cells, three three = cells, 23 < 0.05. < 0.05. n = 19 cells, = cells, 19 . µ Fig. 4 Fig. P

m m ( C I < 0.0001 < 0.0001 n = 3 a Fig. ) and ) and

b

post post e l

). 1025

4 s g ± - - - ­ ;

© 2012 Nature America, Inc. All rights reserved. and is required for the maintenance of neuronal microtubules in in microtubules dendrites and neuronal axons of maintenance the for required is and neurons cultured in architecture dendritic and formation axon rons neu root ganglion dorsal pathway in cultured signaling JNK1–c-Jun (refs. Tyr185 and been shown to modulate the dual of phosphorylation JNK1 at Thr183 (ref. MEK6 and MEK3 of phorylation phos preferential the through cells in HEK-293T JNK1 endogenous lines cell in pathway ronal differentiation of for shown to have neu The many JNKs be important been aspects neurons. pyramidal cortical in pathway differentiation neuronal signaling modulates Sema3A-Nrp1 the with TAOK2 of interaction the which by effectors downstream the elucidate to sought Wenext neurons in cortical TAOK2JNK activity modulate and Sema3A activates TAOK2signaling Sema3A activity.kinase 0.56 ( Nrp1 pTAOK2 neurons of homozygous amounts cortical were lowerthe in our with ( Sema3A binding of incapable receptor Nrp1 endogenous the controls. Scale bars, 500 littermate. FAK and tubulin are used as loading immunoreactivity in the −/− mouse than in the +/− (−/−) P7 mice littermates showing less pTAOK2 heterozygous (+/−) and ( treatment increases pTAOK2 immunoreactivity. neuron lysates showing that the 2-h Sema3A significant). ( post hoc cultures; cultures; Sema3A 6 h, 2 h, Sema3A cultures; three 1 h, Sema3A cultures; two min, 30 Sema3A cultures; three (control, neurons cortical cultured Sema3A-treated and control of neurite longest the from immunoreactivity ( 2 h (bottom). for Sema3A with treated a neuron and (top) ( neurons. cortical cultured in (2 ( cortex. developing in box ( cortex. developing the of (CP) plate cortical and (IZ) zone intermediate the in expressed preferentially ( G. immunoglobulin IgG, immunoprecipitation; for used protein total the of 5% Input, cortex. developing the in ( immunoblot. IB, immunoprecipitation. for used protein total the of 5% Input, TAOK2. Myc- and Nrp1-mCherry with transfected were cells HEK-293T TAOK2. and Nrp1 of interaction the demonstrating mCherry ( TAOK2 phosphorylation. modulate 4 Figure t r a 1026 and axonal branching induces microtubules destabilizes treatment h b a Fig. 4 Fig. ) Immunoprecipitation (IP) with anti- with (IP) ) Immunoprecipitation ) Immunoblot of cortical lysates from ) TAOK2 coimmunoprecipitates with Nrp1 Nrp1 with ) TAOK2 coimmunoprecipitates µ g g ml 2 ± Sema−

8 0.09, c . Phosphorylated JNK1 and 2 can modulate neurite initiation, initiation, neurite modulate 2 can and JNK1 . Phosphorylated h : Nrp1 and pTAOK2 co-localize in the the in co-localize pTAOK2 and : Nrp1 Dunnett test **

C I −1 ; normalized to +/−: for +/−, 1 1 +/−, for +/−: to normalized ; P TAOK2 interacts with Nrp1 to Nrp1 with TAOK2 interacts in vitro in < 0.0001 by one-way ANOVA, ) increases pTAOK2 immunoreactivity immunoreactivity pTAOK2 ) increases (−/−) mice than in those of littermatesheterozygous in those (+/−) than mice (−/−) n g e l = 4 brains; ) Immunoblot of cultured cortical f ) Quantification of pTAOK2 of ) Quantification experiments, we found that found we experiments, s 5,27). Sema3A has also been shown to activate the the activate to shown been also has Sema3A 5,27). e d Nrp1 c – ) Magnification of white white of ) Magnification ) Nrp1 and pTAOK2 are are pTAOK2 and ) Nrp1 2 g n Nrp1 6 1 ) Sema3A treatment treatment ) Sema3A in vivo in P = 25 cells, three . . TAOK2 3 µ < 0.01 and NS, not . TAOK2 overexpression indirectly activates activates indirectly overexpression TAOK2 . n Sema− P m ( = 77 cells, cells, = 77 n = 0.0310 by Sema− = 32 cells, cells, = 32 n c e = 99 cells,= 99 three ) and 10 ) Control neuron neuron ) Control 3 ). In agreement agreement In ). 4 homozygous n . The deactivation of JNK1 by BDNF BDNF by JNK1 of deactivation The . α = 25 cells, cells, = 25

, , unlike TAOK2 Nrp1

µ

t m (

test). These results suggest that

Sema− ± 5). In addition, TAOK2 has has TAOK2 addition, In 5). d

0.10, 0.10,

, e ).

n β = 9 brains; for −/−, −/−, for brains; 9 = , , stimulates the JNK f c a Hoechst VZ IZ CP

Normalized mean pTAOK2 signal IP: mCherry 0 1 2 3 4 5

Control IB: TAOK2 Nrp1 TAOK2 Actin Sema3A Nrp1 NS 29– 30 min 3 3 ** 5 3 - - -

. TAOK2 + mCherry

Sema3A ** pTAOK2 dissociated from E17 mouse embryos and cultured for 48 h were were h 48 for cultured and embryos mouse E17 from dissociated could mask neurons that by induced Cortical our treatment. Sema3A which phosphorylation, JNK1 endogenous avoid to polarization of axons developed in enriched is phosphorylation JNK1 Since neurons. primary tured cul in phosphorylation JNK1 modulates Sema3A ligand Nrp1 the triplicate; per ments to control: control, 1 ( reduced significantly was kDa) 46 band, lower with transfected ( neurons control-transfected of that to compared neurons, shRNA-transfected of neurite longest JNK1. of the in form immunoreactivity pJNK1 active decreased the TAOK2downregulation represents (pJNK; which JNK1 Tyr185), and phosphorylated Thr183 to antibodies using cytochemistry immuno to subjected being before h 48 for cultured were neurons utero in via embryos mouse E15 into construct an F-GFP with together mids introduced we neurons, differentiation. neuronal on TAOK2 of Sema3A and effect the ate On the basis that of we JNK1 findings, hypothesized may these medi

1 ** TAOK2 + Nrp1

h

As TAOK2 interacts with Nrp1, we asked whether treatment with with treatment whether asked we Nrp1, with TAOK2 As interacts cortical in JNK1 modulates TAOK2 whether determine To Sema3A -mCherry Input 5% Input

VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME 2

electroporation and isolated cortical neurons at E17. These These E17. at neurons cortical isolated and electroporation h

Sema3A Merge

6 h 3 105 kDa 140 kDa 140 kDa g Taok2 1 , we used cultured neurons during the initiation initiation the during neurons cultured used we , d b e ± P Sema3A Control Hoechst pTAOK2 Hoechst pTAOK2 Acetylated tubulin Acetylated tubulin Nrp1 0.17; = 0.0233 by 0.0233 = shRNA 1, endogenous pJNK1 (top panel, panel, (top pJNK1 endogenous 1, shRNA Taok2 Control Taok2 Input 5% Fig. 5a Fig.

shRNA 1 construct or control plas control or construct 1 shRNA Sema3A shRNA 1, 0.76 FAK TAOK2 pTAOK2 t TAOK2 test). pTAOK2 , b ). Additionally, in Ht22 cells cells Ht22 in Additionally, ). IP antibody 140 kDa 140 kDa h

55 kDa Nrp1 nature nature pTAOK2 pTAOK2 Fig. 5 Fig. ± IgG +/– 0.09, Nrp1 Merge NEUR IB: Nrp1 IB: TAOK2 Sema c ; normalized normalized ; n –/– – = 4 experi OSCI Tubulin TAOK2 pTAOK2 EN C E - - - - ­

© 2012 Nature America, Inc. All rights reserved. binant lentivirus carrying control or or control carrying lentivirus binant recom with infected were neurons absence TAOK2. of Primary the presence or in treatment Sema3A after we activation JNK1 of possibilities, evaluated these means between by differentiate To JNK1 pathways. regulate distinct may they alternatively, mechanism; 0.54 ( Nrp1 homozygous of neurons cortical the in reduced were levels pJNK1 our with agreement In from mice. extracts cortical in pJNK1 of levels the examined 0.19; ( treatment Sema3A following induced also was kDa) 46 band, lower panel, top (pJNK, phosphorylation JNK1 endogenous that revealed treatment Sema3A of h 6 following neurons from harvested lysates ( cells control non-treated in that 40 axon, putative (the analyzed neurite longest the in treatment Sema3A following h 6 and h at 2 increased significantly was immunoreactivity pJNK1 analysis. pJNK1 were and measured western using blot immunocytochemistry (2 Sema3A with treated (GAPDH) dehydrogenase are used as the loading controls; panJNK1, antibody labeling total JNK1. Mean experiments per triplicate; (46 kDa) from immunoreactivity of Sema3A 6 h. ( failed to increase pJNK1 in the presence infected with showing that isolated cortical neurons than in the +/− littermate. ( (46 immunoreactivity kDa) in the −/− mouse −/− P7 littermate mice shows less pJNK1 cortex lysates from compared to control. ( increases pJNK1 (46 immunoreactivity kDa) lysates shows that Sema3A 6h treatment ( ** by one-way ANOVA, n 2 h, 30 min, (control, control and cortical Sema3A-treated neurons from immunoreactivity the longest neurite of (bottom). ( and a neuron treated with Sema3A for 2 h in cortical neurons. ( (2 (46 kDa) in Ht22 cells. ( decreases downregulation JNK1 phosphorylation *** Taok2 neurons (control, control and TAOK2-downregulated cortical pJNK1 in immunoreactivity the longest neurite of in transfected neurons. ( that in control neurons (left). Inset: pJNK1 signal (arrowheads) in cortical neurons co (right) decreases pJNK1 immunoreactivity activity of JNK1. ( Figure 5 nature nature of addition the after pJNK1 quantified we later, days Three plating. f Fig. 5 Fig. Fig. 5 Fig. = 64 cells, three cultures; ) ) Immunoblot of cultured cortical neuron P Sema3A and TAOK2 may modulate JNK1 by means of a common of a common by means JNK1 TAOK2and may modulate Sema3A µ P < 0.01 and NS, not significant). g g ml n < 0.0001 by ± Sema− shRNA 1, = 97 cells, three cultures; Sema3A 6 h, n 0.13, 0.13, f g = 3 experiments per duplicate; duplicate; per experiments 3 =

; normalized to control: control = 1 1 = control control: to normalized ; −1 n ; normalized to +/−: for +/−, 1 1 +/−, for +/−: to normalized ; n TAOK2 and Sema3A modulate the NEUR = 42 cells, two cultures; Sema3A = 71 cells, three cultures; Sema3A ) ) increases pJNK1 immunoreactivity e mice compared with those in heterozygous littermates littermates heterozygous in those with compared mice ) Quantification ) of Quantification pJNK1 n Taok2 = 4 brains; brains; 4 = OSCI n i n ) Quantification ) of Quantification pJNK1 a = 29 cells, two cultures; t = 72 cells, two cultures; ) ) TAOK2 downregulation Nrp1 test). ( shRNA 1 lentivirus post post hoc d EN ) ) Control neuron (top) g ) ) Immunoblot of Sema− C b d µ ) Quantification ) of Quantification – E µ c P f m < neurite length < 150 150 < length neurite < m

h ) ) Sema3A treatment P ) ) TAOK2 < 0.0001 by one-way ANOVA, g g ml P Dunnett test ) ) Western blotting = 0.0382 by 0.0382 = VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME +/− and < 0.0001 h −1 ( in vitro in m n ) ) for 2 30 min, h, or of 6 h. levels The = 2 pared pared to

Fig. 5d Fig.

experiments, we found that that found we experiments, P t

±

Taok2 test).

= 0.0014 by by 0.0014 = , 0.11, 0.11, e

). Western blot analysis of analysis Western blot ).

±

0.06, Sema3A = 1.59 1.59 = Sema3A 0.06, shRNA 1 soon after after soon 1 shRNA n = 9 brains; for −/−, −/−, for brains; 9 = h d a 140 kD F-GF pJNK1 35 kD 46 kD 54 kD 46 kD 54 kD

µ Sema3A Control pJNK1 Hoechst Acetylated tubulin pJNK1 Hoechst Acetylated tubulin m) compared to to compared m) t P post post hoc a a a a a a test). We also test). Contro Control Nrp1 Dunnett test ** l

Sema− shRNA Taok ± pJNK1 pJNK1 pJNK1 -

2 1 tion complexity to wild-type levels, confirming the inability of the the Nrp1 of inability the confirming levels, wild-type to complexity tion Nrp1 of cortex E13.5 the from dissociated TAOK2 neurons in overexpressed in situ neurons in V layer drites cortical den basal of growth and branching reduced markedly exhibit mice from neurons in observed arborization dendrite in defect the restore to sufficient is TAOK2overexpression tion downstream of Sema3A-Nrp1. To this end, we examined whether we TAOK2 to whether forma analyze Therefore, decided dendrite basal modulates neurons. pyramidal in the dendrites basal determine of that formation pathways molecular the about known is Little Sema3A-Nrp1 modulates basal dendrite formation through TAOK2 cortical in differentiation neurons. pyramidal neuronal mediate to phosphorylation JNK1 activates complex signaling of TAOK2 Sema3A-Nrp1 the with interaction the that suggest data these Together, pJNK1. induce to down knocked ( was TAOK2 when pJNK1 elevate not did Sema3A ( 30–40% about by neurons shRNA-treated trol (2 Sema3A exogenous Fig. Fig. 5h Control Nrp1 Taok2 P Sema− Sema− Sema3A < 0.01, * treated with complexity their increase dendritic Sema3A , Sema− shRNA i shRNA ). ). These results indicate that TAOK2 is required for Sema3A Taok neurons did not restore the reduced dendritic arboriza dendritic reduced the restore not did neurons receptor to bind Sema3A ( Sema3A bind to receptor e 2 and wild-type mice. At DIV7, Sema3A treatment of of treatment Sema3A DIV7, At mice. wild-type and Normalized mean 1 1 P pJNK1 signal F-GFP pJNK1 < 0.05). FAK and 3-phosphate glyceraldehyde 0 1 2 3 4 GAPDH TAOK2 panJNK1 pJNK1 Control

Sema3A 30 min b ± NS µ

s.e.m. Scale bars, 10 Normalized mean g ml g pJNK1 signal i ** Fold change of control 0 1 2 3 4

−1 Sema3A 2

(pJNK1) Control ** 2.0 0.5 1.0 1.5 ). Sema3A increased pJNK1 in con in pJNK1 increased Sema3A ). 0 14 *** ,

1 Control h shRNA 5

Sema3A 6 Taok . In contrast, wild-type neurons neurons . wild-type In contrast, Fig. 6a Fig. 2 1 Nrp1 ** h shRNATaok2 µ 105 kDa 105 kDa 140 kDa * m. 35 kDa 46 kDa 54 kDa 46 kDa 54 kDa 46 kDa 54 kDa 46 kDa 54 kDa g f c 35 kDa 46 kDa 54 kDa 46 kDa 54 kDa , Sema−

b 1 ). However, TAOK2 However, ). ** Fig. 5h Fig. Control t r a Sema3A mice

Taok2 Nrp1 + +/ Control Control –

shRNA 1 Sema– , i 14 –/– ). Notably, ). Taok2 C I Sema3A Sema3A , shRNA 1 5 GAPD panJNK1 pJNK1 FA TAOK GAPD panJNK pJNK1 + FA panJNK pJNK1 . These These . e l 1 K K 1 7 1027 . . We 2 H H 1 1 s - - - - © 2012 Nature America, Inc. All rights reserved. r bacig ws o rsoe t cnrl ees ( levels control to restored not was branching) ary (second branching dendritic basal the that found we analysis, Sholl nificantly dendrite basal not was sig number this primary knockdown; Nrp1 with in neurons number increased significantly a showed neurons Nrp1 in deficit arborization dendrite basal the ameliorated overexpression (II-III; layers in the the impaired of formation upper dendrites cortical basal and trol from con cortex of in neurons II-III layer the morphology dendritic and with together plasmid, shRNA control a or plasmid shRNA Fig. the expression of in Nrp1-mCherry HEK-293T cells ( cortex the in expression Nrp1 downregulate to reported previously was sequence by neurons cortical II-III TAOK2 in layer and overexpressed shRNA simultaneously construct vivo in the in levels Nrp1 wild-type to restored was arborization dendritic that 10 between located Nrp1 in arborization dendritic defective the ameliorated overexpression Nrp1 ANOVA, one-way by between differences significant showing arbors, dendritic rTAOK2, (control, neurons downregulated Nrp1 in dendrites primary of in deficit arborization dendritic basal the 10 between and neurons (WT) wild-type between differences statistical no showing arbors, ( 6 Figure t r a 1028 also analysis a c a F-GFP MAP2 ) rTAOK2 overexpression ameliorates the dendritic arborization deficit in primary cortical cortical primary in deficit arborization dendritic the ameliorates ) overexpression rTAOK2 To further confirm the functional interaction of TAOK2 interaction and Nrp1 Tothe functional confirm further

rTaok2 4a shRNA + rTAOK2 overexpression, and control conditions. Mean Mean conditions. control and + overexpression, rTAOK2 shRNA

Sema− Sema− shRNA-expressing neurons ( neurons shRNA-expressing , we acutely knocked down the expression of Nrp1 using an an using Nrp1 of expression the down knocked acutely we , , Fig. 6 Fig. Control (WT)

b C I n TAOK2 counteracts the dendritic arborization deficit in neurons expressing a deficient receptor for Nrp1 or with Nrp1 downregulation. downregulation. Nrp1 with or Nrp1 for receptor a deficient expressing neurons in deficit arborization dendritic the TAOK2 counteracts Nrp1 ). E15 embryos were were embryos E15 ). = 35 cells, three brains; brains; three cells, = 35 Control

TAOK2-overexpressing neurons ( neurons TAOK2-overexpressing ( neurons different from that of controls ( controls of that from different µ cDNA constructs, and studied at P7. We evaluated the the Weevaluated P7. at studied and constructs, cDNA e l

m and 100 100 m and 1 demonstrated that Nrp1 downregulation did not affect affect not did downregulation Nrp1 that demonstrated c 6 shRNA–expressing brains. The knockdown of Nrp1 Nrp1 of knockdown The brains. shRNA–expressing ), as has been previously reported previously been has as ), , and we confirmed that it efficiently knocked down down knocked efficiently it that confirmed we and , s post hoc post Fig. 6a Fig. µ m and 100 100 and m µ m from the cell soma ( soma cell the m from F-GFP MAP2 in utero in Dunnett test ** test Dunnett , b ). Sholl analysis of the dendritic arbors arbors dendritic the of analysis Sholl ). in utero in Nrp1 Nrp1 P electroporation. The The electroporation. < 0.0001, by one-way ANOVA, ANOVA, one-way by < 0.0001, shRNA Sema– µ Fig. 6 Fig. m from the cell soma showed showed soma cell the from m Nrp1 electroporated with the the with electroporated P c < 0.01). ( < 0.01). ). TAOK2 ). shRNA-transfected neurons from layer II-III cortex. ( cortex. II-III layer from neurons shRNA-transfected Fig. 6 Fig. Fig. 6 Fig. n = 20 cells per condition, two cultures, *** cultures, two condition, per cells = 20 F-GFP MAP2 1 d 6 Nrp1 . Notably,TAOK2 . ). However, using using However, ). Nrp1 b f ). - Supplementary Supplementary ) Sholl analysis of the apical dendrite, showing no differences between Nrp1 downregulation, downregulation, Nrp1 between differences no showing dendrite, apical the of analysis ) Sholl Nrp1 shRNA+rTAOK2 overexpressing overexpressing i. 6 Fig. Sema Nrp1 n – shRNA–expressing neurons and Nrp1 shRNA + rTAOK2–expressing neurons ( neurons + rTAOK2–expressing shRNA Nrp1 and neurons shRNA–expressing +rTAOK2 = 16 cells, two brains; brains; two cells, = 16 e shRNA ). Sholl Sholl ). F-GFP Nrp1 post hoc post ± s.e.m. Scale bars, 10 10 bars, Scale s.e.m. - - -

b Dunnett test ** test Dunnett elongation of basal versus apical dendrites. apical versus basal of elongation preferential the in function might pJNK1 of compartmentalization ( dendrite apical the in that vity,with compared immunoreacti MAP2 or tubulin to normalized immunoreactivity, basal dendrites showed a significant increase in the intensity of pJNK1 ( Weaxons in dendrites. that developed was pJNK1 enriched observed ‘basal’ thin several and ‘apical’ dendrite thick a bearing morphology at a Wepyramidal E17. that displayed cells rons dissociated analyzed in neu DIV7 mouse cortical localization we its examined subcellular dendrites. apical or basal in now, it has remained unclear whether pJNK1 modulates microtubules a progressive loss of microtubules in both axons and dendrites hippocampus and cortex both in dendrites, as well as axons, in dynamics microtubule of tion to in regula the be involved reported However,been has also pJNK1 est neurite, presumably the axon, of cultured hippocampal neurons to the long JNK1 has shown localize Activated to been preferentially JNK through formation dendrite basal TAOK2 modulates cortex. developing the of neurons pyramidal in development dendrite basal regulates that pathway a constitute TAOK2 and Nrp1 that evidence provide thus results Our neurons. Nrp1-deficient in expression TAOK2 fol lowing dendrites basal of formation the of restoration partial a reflect ( neurons transfected of dendrites apical the Nrp1 Fig. 7 Fig. Number of intersections d 0 1 2 3 4 5 6 7 To assess the localization of pJNK1 in cortical pyramidal neurons, neurons, pyramidal cortical in of pJNK1 To localization the assess Number of primary 0

Sema− dendrites 10 10 VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME 0 1 2 3 4 5 6 7 8 9 a Distance fromcellbody ) as previously reported previously as ) Nrp1 Control plus rTAOK2-overexpressing cultured neurons at a distance a distance at neurons cultured rTAOK2-overexpressing plus *** 30 Nrp1 shRNA, shRNA, ** µ P P shRNA m. 50 < 0.001 by by < 0.001 < 0.01 and NS, not significant). ( significant). not NS, and < 0.01 Nrp1 Sema− NS d 70 ) rTAOK2 overexpression restores the number number the restores ) overexpression rTAOK2 n shRNA neurons. ( neurons. rTAOK2 + rTAOK2 Nrp1 + Sema3A Nrp1 Nrp1 WT = 47 cells, three brains; brains; three cells, = 47 Nrp1 3 ( 4 µ 90 Sema– Sema– Sema– . . Furthermore, JNK1-deficient mice exhibit m) t + test). ( test). 110 b ) Sholl analysis of the dendritic dendritic the of analysis ) Sholl f 3 1

Number of intersections e . Of note, we also found that the the that found also we note, Of . c 0 1 2 3 4

) rTAOK2 overexpression reverses reverses ) overexpression rTAOK2 Number of intersections 0 1 2 3 4 5 6 7 8 9 0 0 Distance fromcellbody Nrp1 Nrp1 Control

25 Distance fromcellbody 10 Nrp1 Nrp1 Control nature nature

shRNA+rTAOK2 shRNA ** Nrp1 Fig. 6 Fig. 20 e shRNA+rTAOK2 shRNA 50 Fig. 7a Fig. ) Sholl analysis of the the of analysis ) Sholl shRNA plus plus shRNA 30 f NEUR ). These results results These ). 75 – c 40 ). Thus, the the Thus, ). P OSCI 100 ( < 0.0001 < 0.0001 µ ( m) µ 3

50 m) 4

. . Until EN 125 60 C 3 1 E - - - - ­ . © 2012 Nature America, Inc. All rights reserved. after the expression of MKK7-JNK1. Notably, MKK7-JNK1 overex Notably,MKK7-JNK1 MKK7-JNK1. of expression the after the branching of basal dendrites in transfected neurons ( shRNA– control from produced those as elaborated as not were that expressing between 15 distance a at MKK7-JNK1 expressing neurons and JNK1 ing express neurons between arborization dendritic the in differences Taok2 with or alone expressed was MKK7-JNK1 when increased markedly Notably, the number of of neurons dendrites primary was transfected the formation of in dendrites layer primary neurons II-III ( impaired TAOK2 downregulation P7. at them analyzed and structs, or control shRNA with together F-GFP and cDNA MKK7-JNK1 con embryos Wemouse E15 electroporated (refs. of pJNK1 activity the mimicking thus active, stitutively JNK1 con renders shown that MKK7 to fusing JNK1 (MKK7-JNK1) been previously had It function. of loss TAOK2 by caused notypes the whether determined den we arborization, basal dritic in JNK1 and TAOK2 between 10 3b Figure in as same the are cells 1–transfected shRNA in ( hoc post (*** neurons transfected layer cortical upper from arbor ( significant). hoc *** MKK7-JNK1, MKK7-JNK1, n n (control, overexpression MKK7-JNK1 after ( cells. control-transfected in that with compared dendrites basal of number the increases alone overexpression MKK7-JNK1 downregulation. following deficit dendrite basal the ameliorates overexpression MKK7-JNK1 neurons. control-transfected with TAOK2 of compared knockdown mediated shRNA- after dendrites basal underdeveloped showing neurons, transfected (II-III) layer * n (tubulin, dendrites apical of mean the to normalized are Values dendrites. apical in than dendrites basal in MAP2 to pJNK1 and tubulin to pJNK1 of ratios higher showing intensities, fluorescence ( in 3, 4) (2, outlined dendrites basal and ( (arrowheads). axon the in enriched is JNK1 Activated (red). pJNK1 and (green) tubulin for immunolabeled neuron ( downregulation. TAOK2 after formation dendrite basal deficient 7 Figure nature nature pression with or without TAOK2 downregulation did not affect apical c g e P = 23 cells, three brains; brains; three cells, = 23 brains; three cells, = 19 ** cultures; three cells, = 20 ) Ratio of pJNK1 and tubulin or MAP2 MAP2 or tubulin and pJNK1 of ) Ratio ) Sholl analysis of apical dendrites from cells cells from dendrites apical of analysis ) Sholl increases dendrites primary of number ) The To further investigate the relationship relationship the investigate further To = 0.0154 by by = 0.0154 f . Quantifications for control and and control for . Quantifications µ P µ

Dunnett test ** test Dunnett addition of pJNK1 was able to abrogate the basal dendrite phe dendrite basal the abrogate to able was pJNK1 of addition Taok2 m m ( < 0.0001 by one-way ANOVA, ANOVA, one-way by < 0.0001 m and 55 55 and m shRNA 1 ( 1 shRNA a

Dunnett test ** test Dunnett , n NEUR Activated JNK1 ameliorates ameliorates JNK1 Activated – d = 23 cells, three cultures; MAP2, MAP2, cultures; three cells, = 23 d shRNA 1, neurons expressing expressing neurons 1, shRNA ) and 5 ) and Taok2 . Mean . Mean P f n n < 0.0001 by one-way ANOVA, ANOVA, one-way by < 0.0001 ) Sholl analysis of the dendritic dendritic the of analysis ) Sholl = 42 cells, three brains; brains; three cells, = 42 brains; three cells, = 32 OSCI t µ Taok2 test). ( test). a m from the cell soma ( soma cell the from m ) Cultured cortical pyramidal pyramidal cortical ) Cultured shRNA and MKK7-JNK1 produced basal dendrites shRNA dendrites basal produced and MKK7-JNK1 Fig. 7d Fig. µ ± P b m m ( s.e.m. Scale bars, bars, Scale s.e.m. < 0.01 and NS, not not NS, and < 0.01 EN ) The apical dendrite (1) (1) dendrite apical ) The Fig. 7 shRNA–mediated shRNA–mediated b C P d ). E ) Upper cortical cortical ) Upper < 0.01, * < 0.01, Taok2 Taok2

, e f ). Sholl analysis demonstrated significant significant demonstrated analysis Sholl ). VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME ). This result reflects a partial restoration of P = 0.0051, = 0.0051, shRNA 1 + shRNA 1, shRNA Taok2 P post post Taok2 < 0.05). < 0.05).

a

.

in in utero

shRNA–transfected neurons Fig. 7 Fig. Taok2 - f with with ). However, neurons neurons However, ). shRNA 1 + MKK7- + 1 shRNA b d e a Tubulin pJNK1 Hoechst F-GFP Control pJNK1 Tubulin Merge

Number of primary dendrites 1 3 2 10 Apical dendrite Taok2 0 1 2 3 4 5 6 7 8 9 Taok2 Control 4

Taok2 shRNA 1 ** Fig. Fig. 7d shRNA 1 shRNA 1 MKK7-JNK1 NS 1 36,37). 36,37).

**

MKK7-JNK1+ , e ). ). 2 - - - - -

embryonic cortex. embryonic the in development neuron pyramidal during dendrites apical and to aimed work basal of delineation Our the for responsible tree. mechanisms the understand dendritic same the within differ of domains formation ent the direct may that differences molecular the dendrite in molecules ref. see several review, (for arborization of Extensive actions the projection. addressed axonal has in work functions also that pyramidal preferentially and cortical in neurons that dendrites pathway basal of formation molecular the new modulates a describe we Here DISCUSSION cortex. developing the in neurons pyramidal of genesis delineate a pathwaymolecular whereby TAOK2 governs the morpho results these collectively, and neurons, pyramidal cortical in tiation provide that evidence TAOK2 and JNK1 modulate neuronal differen active the TAOK2downregulation ( after that midline ­ the in found deficit axon callosal also the rescued We JNK1 pJNK. of compartmentalization ( neurons control-transfected of that with compared as morphology dendrite Taok2 F-GFP

Number of intersections f 10 11 Basal dendrites 0 1 2 3 4 5 6 7 8 9 shRNA 3 1 0 MKK7-JNK1 Control Tubulin Distance fromcellbody Fig. 7 Fig. 2 0

** ** 1 * 3 0 g 4 Supplementary Supplementary Fig. 5 ), further supporting a preferential basal dendrite dendrite basal preferential a supporting further ), 4 0 + MKK7-JNK1 Taok2 Taok2 5 0 MKK7-JNK Taok F-GFP shRNA shRNA ( µ 6 0 c 2 m)

shRNA Fold change of ratio pJNK1/tubulin 0 0 1 2 3 4 1 1 1 dendrites 38). However, little is known about about known is However,little 38). Apical + g Number of intersections 0 1 2 3 4 pJNK ** ). ). Together, these experiments 0 dendrites Basal Distance fromcellbody MKK7-JNK1 Control 1 25 F-GFP MKK7-JNK

50 Fold change of ratio

pJNK1/MAP2 t r a 10 0 1 2 3 4 5 6 7 8 9 dendrites 75 Apical + MKK7-JNK1 Taok2 Taok2 1 100 C I ( shRNA shRNA µ * m) dendrites Basal 125 e l 1029 1 1 s - - -

© 2012 Nature America, Inc. All rights reserved. dendrite formation and axonal projection ( projection axonal and formation dendrite basal in TAOK2 of action specific the part, in least at pJNK1 explain, may of compartmentalization subcellular the that plausible is it Therefore, TAOK2 after downregulation. projection axonal and tion forma dendrite basal in defects counteracted JNK1 active tutively consti the of Moreover, overexpression neurons. pyramidal of cortical axons the and dendrites basal the in enriched preferentially was branching arborization of cortical pyramidal neurons, as well as impaired axonal dendritic show JNK1, reduced 1 deactivates phatase (MKP-1), which of phos the loss of the MAP kinase function examining experiments in the different domains of the dendritic tree has not been clear. tubules in both axons and dendrites hippocampus and the cortex of dendrites and axons both in dynamics tubule that is pJNK1 involved reported in of been also the regulation micro has It neurons. cortical cultured DIV2 of axon, the presumably rite, also found that pJNK1 to was preferentially the localized longest neu that shown been in neurons in axons culture is of pJNK1 enriched hippocampal has It morphogenesis. dendrite basal modulates down TAOK2.of stream occur may formation dendrite basal sustain that of molecules compartmentalization subcellular the Alternatively, TAOK2. of distribution subcellular that differential a detect possible not could is Itmethods our neurites. axonal or dendritic for preference any without neurons, cortical in cones of developing the growth cultured by TAOK2 acted overexpression. counter be can downregulation Nrp1 following formation dendrite basal in deficit the that report we Importantly, dendrite. basal the of formation the impairs specifically downregulation Nrp1 acute that that TAOK2demonstrate analyses cal and Nrp1 form a and complex, Our biochemi formation. Nrp1 pathway dendrite that basal sustains These data strongly suggest that TAOK2 is a mediator of dendrites. the Sema3A– apical affecting without dendrites, basal of formation the of formation the controls dendrites. specifically basal dendritic receptor all ubiquitous on this distributed uniformly be processes to the likely controls is receptor PlexinA4 neurons cortical of through arborization dendritic basal signaling Sema3A–Nrp1 that Sema3A by polarization receptor neuronal Nrp1 regulate to the appeared of activation reports, previous In The Sema3A-Nrp1 signaling cascade is coupled to TAOK2-JNK1 dendrite or apical, principal, longest a single lack which arbors, dendritic symmetric with neurons produces polarity apical dendrites of pyramidal neurons and that the disruption of Golgi toward the is polarized trafficking membrane post-Golgi that shown was it Accordingly, pathways. molecular and cellular distinct upon rely may dendrites) apical versus basal example, (for subtypes dritic ized microtubule arrays CA1 and layer V cortical neurons pyramidal ubiquitously have polar However, it was recently found that apical dendrites from tree. dendritic the of homogeneity molecular the of concept the port polarity mixed of microtubules contain dendrites indicated that axons contain microtubules of uniform polarity, whereas t r a 1030 of activation Sema3A/Nrp1-mediated that demonstrate results Our This work implicates activated JNK1 as an effector of TAOK2 that an effector as JNK1 activated implicates work This Our data also show that TAOK2 appears to be uniformly distributed impairs specifically downregulation TAOK2 that show now We Over a decade ago, electron microscopy studies in cultured neurons

C I 1 3 3 5 4 5 , as well as the axon the as well as , and that JNK1 . In agreement with these findings, we that found pJNK1 findings, these . with In agreement e l s 4 0 , suggesting , that suggesting the −/− mice exhibit a progressive loss of micro 4 4 , one question that arises is how how is arises that question one , 3 4 . . However, the function of pJNK Supplementary Fig. 6 Fig. Supplementary 42

morphogenesis of morphogenesis den , 4 3 . It was also shown shown also was It . 4 14– 3 1 9 . . These data sup data These . 1 6 . As the Nrp1 Nrp1 the As .

hippocampal In vivo 3 1 . . We ). ). ------

susceptibility to autism and appears to account for approximately approximately for account to appears and autism to susceptibility substantial carries that identified been has 16p11.2 chromosome of microduplication reciprocal or microdeletion recurrent a Recently, phenotype autistic an synthe to protein leading pathway one synaptic represent may aberrant sis that proposed been has it and understood. poorly remains this model supports patients, autistic in hypoconnectivity cortical anatomical and functional shows which literature, Emerging associations. order higher- in involved are that regions brain of disconnection mental been recently suggested has ASD for model unifying remain a ASD cases, most of in elusive underpinnings genetic neurobiologi the clear Although a etiology. not cal is there which for syndrome neurodevel opmental heterogeneous a is (ASD) disorder spectrum Autism disorders spectrum autism TAOK2 and morphogenesis. dendrite regulating in JNK1 of preclude the importance of the TAOK2-mediatedobserved activation pathways could activate JNK, the existence of such pathways does not independent additional pathway.Although same the in act proteins ( TAOK2 requires pJNK1 reprints/index.htm at online available is information permissions and Reprints Published online at The authors declare no competing interests.financial F.C.d.A. and L.-H.T. and commented on by all authors. commented on the design of the experiments. The manuscript was written by D.D.G. and A.L.K. provided the T.S. generated the lentiviral shRNA construct and produced the particles. virus mice. O.D.,A.L.R., J.G. and contributedR.M. to experiments. the biochemistry T.T. performed and analyzed the data from the neuronal cultures of shRNA constructs. K.M., andA.L.R. D.R. contributed to the neuronal cultures. experiments. immunohistochemistry K.M. generated and the characterized and analyzed the data with andA.L.R. O.D. F.C.d.A. performed and analyzed the ofaspects the project. F.C.d.A. planned and performed the as the principal investigator, provided conceptual and technical guidance for all This study was designed, directed and coordinated by F.C.d.A. and L.-H.T. L.-H.T., A.L.K. and D.D.G. are investigators of the Howard Hughes Medical Institute. Health grant R01 MH59199 to A.L.K. and D.D.G. supported this work. L.-H.T., Brain, Social Massachusetts Institute of Technology). US National Institutes of by a fellowshippostdoctoral from the Simons Foundation (Simons Center for the Foundation Autism Research Initiative supported this work. F.C.d.A. is supported the manuscript, providing vectors, antibodies, and suggestions. The Simons Medical Center) and Y. Gotoh (University of Tokyo) for reading critical of We thank A. Mungenast, E.J. Kwon, M.H. Cobb (University of Texas Southwestern Note: Supplementary information is available in the the pape the of in version available are references associated any and Methods M brain of disconnection phenotype. underdeveloped autistic the the underlie may to that that regions contributes hypothesis morphology the neuron support downregulation axonal dendrite and basal immature ­development of findings our Therefore, TAOK2. for cases of 1% COM AU Acknowledgment ethods Several genes have been described as contributing to ASD to contributing as described been have genes Several T H P O ET VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME R R I CONT NG 4 45 5 . This model proposes that ASD results from a develop a from results ASD that proposes model This . 7 , FI 4 . One of the genes from the affected region encodes encodes region affected the from genes the of One . 6 . The cellular basis for dysfunctional circuits, however, . circuits, The for basis cellular dysfunctional N l RIBU . http://www.nature.com/doifinder/10.1038/nn.314 A NC r . T IA s I ON L I NTE S Fig. 5h Fig. Nrp1

rjcin dfct floig TAOK2 following deficits projections R Sema− E S T , i S mouse brains and suggested and ), which indicates that the three three the that indicates which ), online version of the pape nature nature in utero http://www.nature.com/ NEUR electroporations Nrp1 1 .

OSCI

Sema− online online r

. 47– EN

C 4 5 9 0 E - - - - . ,

© 2012 Nature America, Inc. All rights reserved. 25. 24. 23. 22. 21. 20. 19. 18. 17. 16. 15. 14. 13. 12. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. nature nature

oad S, ag Y, oeoRdiuz M & aka, . Morphological H. Markram, & M. Toledo-Rodriguez, Y., Wang, S., Romand, Zhou, T. to signals extracellular from polarity: de Anda, F.C., Meletis, Neuronal K., Ge, X., Rei, D. & Tsai, K. L.H. Centrosome motility Kaibuchi, is essential & N. Arimura, polarization. neuronal during cytoskeleton the of role The F. Bradke, & H. Witte, A.P.,Barnes, F.Polleux, & mechanisms D. molecular Solecki, the into insights New I. King, Bradke, F. & Dotti, C.G. The role length of local dendritic actin of Regulation instability R. Yuste, in & axon A. formation. Ghosh, Y., Chen, V.,Fenstermaker, G. Chen, Tran, T.S. C. Gu, C. Zihni, S. Yasuda, Moore, T.M. and TAO2 kinase protein the of Isolation M.H. Cobb, & M. Hutchison, Z., Chen, Darnell, J.C. McCarthy, S.E. L.A. Weiss, Chen, Z. protein mitogen-activated stress-responsive of Regulation M.H. Cobb, & Z. Chen, of cortex visual the of neurones pyramidal of morphology Dendritic A.U. Larkman, Golgi a autism: in Hippocampus T.L. Kemper, & M.L. Bauman, G.V., Raymond, of Depletion Perry,E. & Perry,R. integration. E., Jaros, H., Arnold, E.B., synaptic Mukaetova-Ladinska, and structure dendritic neurons: Pyramidal N. Spruston, Front. Neuroanat. Front. cortex. somatosensory rat the in cells pyramidal V layer thick-tufted of development MAP3K. Ste20p a of neocortex.initialformationtheaxonfor in mechanisms. intracellular Neurobiol. Opin. Curr. polarity neuronal specifying par-1. through behavior stimulated 1931–1934(1999). 3A. semaphorin by branching and development. CNS. postnatal the in development. cardiovascular and blebbing. membrane for requirement a is localization nuclear caspase-dependent and JNK- Neuron kinases. MAP p38 and TAO2beta via endocytosis N-cadherin triggering by number (2000). organization. cytoskeletal actin regulates and that activates the c-Jun N-terminal kinase mitogen-activated protein kinase pathway domain. binding kinase kinase signal-regulated kinase/extracellular protein mitogen-activated its of identification autism. and function Genet. Nat. autism. and 16p11.2 Chem. Biol. J. from carbachol to p38 mitogen-activated protein kinase and ternary complex factors. TAO2. by pathways kinase (MAP) distributions. Spine III. rat: the analysis. (2004). individuals. autistic adult in cortex prefrontal dorsolateral in changes cytoarchitectonic laminar and expression MAP2 Neurosci. Rev. Nat. NEUR

t al. et 56 et al. t al. et et al. Acta Neuropathol. Acta t al. et et al. et et al. J. Biol. Chem. Biol. J. , 456–471 (2007). 456–471 , et al. et

et al. 41 et al. erpln1 ovy smpoi ad EF inln drn neural during signaling VEGF and semaphorin conveys Neuropilin-1 t al. et Crystal structure of the TAO2 kinase domain: activation and specificity TAO (thousand-and-one amino acid) protein kinases mediate signaling OSCI

Nat. Neurosci. Nat.

et al. Secreted semaphorins control spine distribution and morphogenesis Drosophila rsaedrvd trl 2-ie iae -lh idcs apoptosis. induces 1-alpha kinase 20-like sterile Prostate-derived Semaphorin-3A guides radial migration of cortical neurons during neurons cortical of migration radial guides Semaphorin-3A , 1223–1227 (2009). 1223–1227 , 278 Activity-induced protocadherin arcadlin regulates dendritic spine dendritic regulates arcadlin protocadherin Activity-induced PSK,anovelSTE20-likekinasederivedfromprostaticcarcinoma

FMRP stalls ribosomal translocation on mRNAs linked to synaptic 5 soito bten irdlto ad irdpiain at microduplication and microdeletion between Association , 22278–22283 (2003). 22278–22283 ,

Microduplications of 16p11.2 are associated with schizophrenia. , 5 (2011). 5 , 9 EN , 206–221 (2008). 206–221 , Cell

Structure N. Engl. J. Med. J. Engl. N. Nature 18 C

282 a cnrl msro bd dvlpet n ethanol- and development body mushroom controls tao

, 479–487 (2008). 479–487 , E 146 Nat. Rev. Neurosci. Rev. Nat.

91 in vivo in

11 , 6484–6493 (2007). 6484–6493 , VOLUME 15 | NUMBER 7 | JULY 2012 JULY | 7 NUMBER | 15 VOLUME 462 , 247–261 (2011). 247–261 , , 117–119 (1996). 117–119 ,

J. Biol. Chem. Biol. J. 12 , 36–44 (2008). 36–44 , J. Comp. Neurol. Comp. J. Dev. Cell Dev. J. Biol. Chem. Biol. J. , 1065–1069 (2009). 1065–1069 , , 1891–1900 (2004). 1891–1900 , . J. Neurobiol. J. J. Neurosci. J. Curr. Opin. Neurobiol. Opin. Curr. erpto. pl Neurobiol. Appl. Neuropathol.

358 J. Neurosci.J.

5 , 667–675 (2008). 667–675 , , 45–57 (2003). 45–57 ,

274 8

. il Chem. Biol. J. , 194–205 (2007). 194–205 , 31

58

276 306 , 28803–28807 (1999). 28803–28807 , , 1139–1148 (2011). 1139–1148 , , 403–412 (2004). 403–412 , , 16070–16075 (2001). 16070–16075 ,

, 332–343 (1991). 332–343 , 30 , 10391–10406, (2010).

18 , 44–52 (2008). 44–52 ,

275

4311–4322 , 30 Science 615–623 ,

283 ,

38. 37. 36. 35. 34. 33. 32. 31. 30. 29. 28. 27. 26. 48. 47. 46. 45. 44. 43. 42. 41. 40. 39. 50. 49.

a, .. Jn LY Bacig u: ehnss f edii arborization. dendritic of mechanisms out: Branching L.Y. Jan, & Y.N. Jan, Yamasaki,T. K. Lei, MAP M.V.The Chao, & A.M. Bennett, G., Miyoshi, K., F.,Deinhardt, Jeanneteau, required is JNK1 M. Karin, & L.S. Goldstein, Y.,M.H., Jones, Ellisman, L., Chang, P.C.Wynshaw-Boris,Salinas, D., & Sussman, A. S.B., Rosso, through signaling Wnt Barnat, M. Oliva, A.A. Jr., Atkins, C.M., Copenagle, L. & Banker, G.A. Activated c-Jun N-terminal B. Bjorkblom, Tararuk, T. Ben-Zvi,A. Huangfu, W.C., Omori, E., Akira, S., Matsumoto, K. & Ninomiya-Tsuji, J. Osmotic stress F.Polleux, Snider,& W. axon. an growing and Initiating Weiss, L.A., Arking, D.E., Daly, M.J. & Chakravarti, A. A genome-wide linkage and linkage genome-wide A A. Chakravarti, & M.J. Daly, D.E., development. Arking, L.A., Weiss, brain and Autism J.L. Rubenstein, & E.M. Morrow, C.A., Walsh, developmental disorders: spectrum Functional N.J. Minshew, & Autism R.K. Kana, T.A.,Keller,V.L., Cherkassky, M.A., P.Just, Levitt, & D.H. Geschwind, F.,Polleux, Morrow, T. cortical for chemoattractant a is 3A Semaphorin A. Ghosh, & Nishiyama, M. Shelly,M. A.C. Horton, apical in arrays microtubule W.W.Polarized Webb, & D.A. Dombeck, A.C., Kwan, P.W.,Baas, orientation Banker,polarity & microtubule M.M. in Black, Changes G.A. Kelleher, R.J. III & Bear, M.F. The autistic neuron: troubled translation? troubled neuron: autistic M.F.Bear,The & III R.J. Kelleher, D. Pinto, Nat. Rev. Neurosci. Rev. Nat. cortex. cerebral developing the in (2002). NH c-Jun by transduction signal 13 of phosphorylation kinase phosphatase MKP-1 regulates BDNF-induced axon branching. controls and microtubules neuronal proteins. microtubule-associated of maintenance for development. dendritic (2005). 34–42 regulates JNK and Rac Dishevelled, regeneration.axonalduringelongation and formation.axon forrequired is kinase effector. an as 2 a dominant regulator of dendritic architecture: role of microtubule-associated protein length. axodendritic and survivalsignaling embryonicin neurons. DRG TAO2regulates TAK1pathways. TAK1-mediated NF- blocking while pathway TAK1-JNK the activates Biol. 401–406 (2008). 401–406 autism. for loci novel reveals scan association Cell (2007). 951–961 morphometry.callosum corpus and task function executive an of study FMRI an from evidence autism: in underconnectivity cortical anatomical and syndromes. disconnection dendrites. apical dendrites. to axons of growth. dendrite promoting and formation morphogenesis. and growth dendrite axons. and dendrites culture. in (1989). neurons 3085–3094 hippocampal of development the during spectrum disorders. spectrum , 1373–1379 (2010). 1373–1379 ,

135 2 , a001925 (2010). a001925 , et al. et , 396–400 (2008). 396–400 , et al. et et al. et et al. et al. etal. The Bax subfamily of Bcl2-related proteins is essential for apoptotic for essential is proteins Bcl2-related of subfamily Bax The et al. et t al. et et al. et et al. Functional impact of global rare copy number variation in autism in variation number copy rare global of impact Functional Distinct roles of c-Jun N-terminal kinase isoforms in neurite initiation Semaphorin3A regulates neuronal polarization by suppressing axon suppressing by polarization neuronal regulates Semaphorin3A JNK1 phosphorylation of SCG10 determines microtubule dynamics Semaphorin 3A and neurotrophins: abalance between apoptosis and Nature J. Neurosci. J. Stress-activated protein kinase MKK7 regulates axon elongation axon regulates MKK7 kinase protein Stress-activated

Polarized secretory trafficking directs cargo for asymmetric cargo directs trafficking secretory Polarized Constitutively active cytoplasmic c-Jun N-terminal kinase 1 is 1 kinase N-terminal c-Jun cytoplasmic active Constitutively Semaphorin 3A induces CaV2.3 channel-dependent conversion 11 Nature Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. Nat. Cell Biol. Cell Nat. , 316–328 (2010). 316–328 ,

404 J. Cell Biol. Cell J. Curr. Opin. Neurobiol. Opin. Curr.

466 , 567–573 (2000). 567–573 ,

25 J. Biol.Chem.J. , 368–372 (2010). 368–372 , 2 , 6350–6361 (2005). 6350–6361 , Dev. Cell Dev. -terminal kinase. -terminal J. Neurosci. J.

Neuron J. Neurosci.J. 173 13 , 676–685 (2011). 676–685 , , 265–277 (2006). 265–277 ,

Neuron J. Neurosci. J. 4 , 521–533 (2003). 521–533 ,

J. Neurochem.J. 48

281 Nature 31 , 757–771 (2005). 757–771 ,

17 105

, 16872–16883 (2011). 16872–16883 , 26 , 28802–28810, (2006). 71 Mol. Cell Biol. Cell Mol. , 103–111 (2007). 103–111 , , 9462–9470(2006). , , 433–446 (2011). 433–446 ,

, 11370–11375 (2008). 11370–11375 ,

461 Cold Spring Harb. Perspect. Harb. Spring Cold 30 , 7804–7816 (2010).7804–7816 ,

, 802–808 (2009). 802–808 , t r a 96 , 585–597,(2006). . el Biol. Cell J. a. Neurosci. Nat. Cereb. Cortex Cereb.

22 Nat. Neurosci. κ , 4929–4942 , C I activation: B Cell e l 1031

109 135

17 s 8 , , , ,

© 2012 Nature America, Inc. All rights reserved. C ImmunoResearch, 1:1,000) were applied for 1–2 h (Jackson at 25 °C. antibodies secondary Alexa-conjugated Probes). (Molecular loidin 1:500). Nuclei were visualized with Hoechst (Invitrogen) and F-actin with phal sc-32233, Biotechnology Cruz Santa (WBanti-GAPDH and 1:2,000) WB, 74, AC- clone A5316, (Sigma anti-actin 1:400); WB, ab62341, (Abcam, anti-RFP 1:1,000); WB, 632543, no. cat. (Clontech anti-mCherry 1:500); WB, AF566, Systems (R&D neuropilin-1 anti–rat goat 1:500); WB, sc-558, Biotechnology Cruz Santa C-20, (clone anti-FAK rabbit 1:500); WB, 610627; Laboratories V793B, immunocytochemistry, 1:200), mouse anti-pan-JNK (BD Transduction (Promegaanti-pJNK1/2rabbit 1:250); TechnologyWB Signaling 92555, (Cell Biotechnology; WB, 1:250; immunocytochemistry, 1:100), mouse anti-pJNK1/2 nocytochemistry,rabbit1:100), anti-pTAOK2 Santasc-135712; Cruz 181; (Ser anti-TAOK2 (K-16, goatSanta 1:1,000), Cruz Biotechnology,immunocytochemistry, T7451, (Sigma westerntubulin blotanti-acetylated (WB) 1:2,000; immu Antibodies. Infection was performed with MOI = 10. fields of view were counted per well, and three wells were inspected per dilution. fluorescentcells divided by totalthe number of cells by visualinspection. Four percentages of infected cells were determined by determining the percentage of supernatantapplication, viral of h 48titer. After viral determine to used were 1:20,000 and 1:2,000, 1:200, of dilutions serial and plates, six-well in well per Viral°C. −8010 titersplatedwere× cells HEK-293Tdeterminedonat 2 min. Viral pellets were resuspended in Dulbecco’sfilter (Corning PBS 431155) + and0.1% concentrated glucose by andultracentrifugation stored at at 25,000 later. Viral supernatant was filtered through a 0.45- DMEMafterh12 transfection and supernatantviral wascollected and48 h 96 and 5 DMEM and transfected at 95% confluency with 8 described titrationvirus. Productionandof CAGTGCAGGGGAAAGAATAGTAGAC. of the U6 promoter was confirmed using a sequencing primer with the sequence HpaIProperandXhoI. and insertionorientation sequencedownstreamtheof with XhoI, and ligated into the plentilox 3.7 vector that had been digested with AATTTCTTATTCAAGTCCTCTCGCA, respectively, were annealed, digested and TCGAGAAAAAACGAGAGGACTTGAATAAGAAATCTCTTGTTTTC GACTTGAATAAGAAATTCAAGAGATTTCTTATTCAAGTCCTCTCGTT FC_TAOK2TGCGAGAGFC_TAOK2sequencesand sh3pllfthe with sh3pllr described ously previ as 11795) plasmid (Addgene vector 3.7 plentilox the into cloned was L MKK7-JNK1 and 21934) (plasmid (plasmid 19726) are from Addgene (Cambridge, Nrp1-mCherry MA). The Center). Medical rat gift from A. Gartner (University of Leuven, Belgium). The Myc-TAOK2 (pCMV by Z. Xie (Boston University). The F-GFP (pCAGIG-GAP 43-GFP)The Venus construct (pCAGIG) and mCherry (pCAGIG)was plasmids were kindly provided taining a random-sequence hairpin insert was used as a control for the shRNAs. used in this study were inserted into a pSilencer vector. A pSilencer vector con Nrp1 IRATp970E03140D.Germany),clone (Berlin, imaGenes the forsequence The The primarily used We in this study are as follows: shR ONLINE METHODS nature nature grown under standard cell culture conditions and transfected with plasmids using entiviralproduction. ell transfection and western blot analysis.

Taok2 N shRNA is AGAGAAGCCAACCATTATA (ref. Taok2 A and fluorescent protein constructs. µ g pCMV-VSV-G per dish. The culture medium was switched to 30% FBS Taok2 Taok2 Taok2 ) was kindly provided by M. H. Cobb (University of Texas Southwestern 5 NEUR 1 hN 1rssat osrc (CV human (pCMV construct 1–resistant shRNA . Briefly,. HEK-293T cellswere plated on 10-cmdishes FBS-10%in The following antibodies were used in these studies: mouse mouse studies: these in used were antibodies following The shRNA 3 = GTTCCAGGAGACGTGTAAGATCC. shRNA 2 = GCATCCTAATACCATTCAGTA; shRNA 1 = CGAGAGGACTTGAATAAGAAA; 5 OSCI 1 . Briefly,complementary5 . Taok2 EN

Productionof plentilox3.7 Taok2 shRNA. C E shRNA 1 and 2 throughout the experiments. experiments. the throughout 2 and 1 shRNA Lentiviral particles were made as previously as made were particles Lentiviral HEK-293T and Ht22 cells (ATCC) were The ′ phosphorylated oligonucleotidesphosphorylated µ Taok2 g plenti 3.7, 6 µ 16). The shRNAs sequences m cellulose acetate vacuum shRNA sequences used TAOK2 µ

g pCMV-R8.9, Taok2 i from is ) shRNA g for 90 5 cells - - - -

homogenized in 350 Corticalbrain lysates. SDS-PAGE to separate the proteins, blots were incubated with anti-TAOK2. fivewithlysistimesbuffer before sample boilingLaemmli in buffer. Following washed with RIPA buffer twice to remove nonspecific proteins and then washed containing 0.5 mg of protein were Lysatesused for each °C. condition. 4 The beads at were overnightthen anti-mCherry to conjugated A–Sepharose protein For TAOK2 and Nrp1 immunoprecipitation assays, lysates were incubated with inhibitors. The Bio-Rad assay kit was used to determine protein concentration. washed once with ice-cold PBS and immediately lysed in expresslysisbeforeconstructsh forlysisandtheanalysis.24 Transfected bufferwerecells with protease 4.0 and 3.5 between DNAwas carrying plasmids overexpression of amounts equal with cotransfected were cells 293 Immunoprecipitation. signals were detected by enhanced chemiluminescence secondary(PerkinElmer). antibodies (GE) and then washedand forincubated 30 min for in 1 TBS-T.h at roomImmunoreactivity temperatureantibody withfor 2horseradish h to overnight peroxidase–conjugated at 4 °C. Membranes5% non-fat were dry milkwashed for 1for h at30 roommin temperaturein TBS-T andblocked then in TBS-Tincubated (50 mM Tris-HCl with primary pH 7.4, 150 mM NaCl, 0.1% Tween-20)and transferred with to Immobilon-P PVDF membranes (Millipore).from Membranescell lysates werewere separated on 8% or 12% SDS-polyacrylamide gels Lipofectamineat 60m V 2000 according to the manufacturer’s protocol (Invitrogen). Proteins and thereafter transferred to 30% sucrose/PBS (4 °C, overnight). Brains were Brains overnight). °C, (4 sucrose/PBS 30% to transferred thereafter and Cortical sections. the primary antibodies. at −20 °C. After blocking in goat serum (Zymed), neurons weremethanol incubated in with min 3 for fixation by followed min 2 for °C 37 at formaldehyde Immunofluorescence. tease inhibitors (Roche) for western blot analysis. studies or lysed with cold RIPA buffer supplemented with phosphatase and pro after 4 d in culture. Cells were either fixed as described for immunofluorescence lentiviral particles (infected 3 h after plating) were treated with Sema3A for 6 h was applied 48 h later at a final concentration of 2 Systems) (R&D Sema3A above. as cultured and E17 at harvested brains from dissected were Sema3A with treated Neurons analysis. immunofluorescence for fixed then and h, 48 for culture in maintained(Invitrogen), medium B27 plated on poly- Papain was inhibited by the addition of ovomucoid (Worthington).lated in HBSSNeurons (Invitrogen) were containing papain and DNase at 37and the transfected°C cortices were(Worthington). dissected 2 d later. Cortical neurons were iso C interval; 35–36 V) were delivered across the heads of the embryos. ms 950 pulse, ms (50 pulses F-GFP.current Venus,Fiveor mCherry, of that ventricles of embryos. The shRNA plasmid concentration was two to three times and plasmids mixed with Fast Green (Sigma) were microinjected into the lateral 1% / xylazine 2 mg/ml (0.01 ml/g body weight), the uterine horns were exposed, Swiss Webster mice were anesthetized by intraperitoneal injections of ketamine Massachusettsthe Institute Technologyof approved experiments.Pregnant all In utero for the immunoprecipitation. 95 °C, run on a 10% SDS gel and analyzed with at min the 5 forsame boiled NP-40.were Samples 0.5% NaCl, primary mM 120 antibodies7.4,Tris-Cl pH used mM 50 sterile-filteredNP-40;and 1% NaCl, mM 500 Tris-Cl,7.4, mM pH 50 then collected at 8000 r.p.m. for 3 min followedimmunecomplexesbound The were°C. 4 atmin bylysatesincubated45forand one wash each in sterile-filtered ing antibodies, 20 the supernatant. Following a 60-min incubation with 1–2 of collection and °C r.p.m.4 14,000at syringe, atcentrifugation 15-min a by followed 26G a using (Roche) inhibitors proteinase containing NP-40 0.5% ortical cultures. ortical electroporation. myc-Taok2 d -lysine and laminin pre-coated glass coverslips in Neurobasal / Brains were removed and fixed overnight in 4% formaldehyde µ Neurons were transfected by l of protein G–Sepharose (GE Healthcare) was added to the and µ Cortices from Cortices P0 Swiss Webster mice were dissected and l of sterile-filtered 50 mM Tris-Cl pH 7.4, 120 mM NaCl,

HEK-293T cell lysates. mCherry-Nrp1 iscae neurons. Dissociated The Institutional Animal Care and Use Committee of µ g per 35 mm plate. The cells were allowed to allowed were cells The plate. mm 35 per g cDNA. The total amount of transfected For transient transfection, HEK- Neurons were fixed with 4% 4% with fixed were Neurons inutero µ g/ml. Neurons infected with electroporation at E15 µ doi:10.1038/nn.3141 g of the correspond - - -

© 2012 Nature America, Inc. All rights reserved. 7 DIV after plating and then fixed as described (see Immunofluorescence). Immunofluorescence). (see described as fixed then and plating after DIV 7 neurons. cortical cultured of neurites Quantitative immunofluorescence of p cone area was measured using ImageJ. growth the in phalloidin of value intensitygray mean The phalloidin. labeled fluorescently of binding the by visualized was F-actin Immunofluorescence). (see above described as fixed then and plating after 2DIV for cultured were Quantitative phalloidin fluorescence determination in growth cones. were adjusted. z as GFP were used for analysis and for producing figures. 3D reconstructions and transfectedimagesstacksofofon cells,only z C sections were incubated overnight at 4 °C with the primary antibodies. embedded in OCT compound and sectioned in a cryostat. The 20–30 doi:10.1038/nn.3141 -seriesimages werecollected with1- -stackanalyseswereproduced using ImageJsoftware. Brightness contrastand onfocal imaging. Images were taken with a Zeiss LSM 510 confocal microscope. µ m steps.m To performreconstructions 3D Neurons were cultured for 2 DIV and DIV 2 for cultured Neurons were T A OK z sections in the same focal planefocalsamethe sections in 2, pJ NK , tubulin and M µ Neurons m cryo AP2 in - 51. specified otherwise. fortests,statisticalTheanalyses. two-tailed Student’s Statistical analysis. consecutive radii was 5 ing radius was 15 concentric circles centered on the cell soma usingisolated Adobe Illustratortransfected neuronsCS3. The instart the cortex. Shollplayed analysis relatively was performed low bytransfection drawing efficienciestaken as indescribed order (see Confocalto imaging).be able All Shollto analysesselect use andcorticesSholl analyze thatanalysis. dis using ImageJ.was measured immuno The mean intensity gray of value fluorescence. a drawn line along indirect neurites the by visualized were MAP2 and tubulin, pJNK, pTAOK2,

Mao, Y. via modulation of GSK3beta/beta-cateninofmodulation signaling.via et al. All GFP-positive image stacks from transfected cortical neurons were Disrupted in schizophrenia 1 regulates neuronal progenitor proliferation µ m and the ending radius was 55–100 Compiled data are expressed as mean t P test and one-way ANOVA, with < 0.05 was considered statistically significant. µ m. All analyses were performed in a blinded manner. P values in the Results areResultsfromthe in values nature nature Cell post hoc

µ 136 m; the interval between ± , 1017–1031 (2009).1017–1031 , s.e.m. We used the NEUR Tukey or Dunnett t tests unlesstests OSCI EN C E ­ - - CORRIGENDA

Corrigendum: Autism spectrum disorder susceptibility gene TAOK2 affects basal dendrite formation in the neocortex Froylan Calderon de Anda, Ana Lucia Rosario, Omer Durak, Tracy Tran, Johannes Gräff, Konstantinos Meletis, Damien Rei, Takahiro Soda, Ram Madabhushi, David D Ginty, Alex L Kolodkin & Li-Huei Tsai Nat. Neurosci. 15, 1022–1031 (2012); published online 10 June 2012; corrected after print 9 July 2012

In the version of this article initially published, the scale bar length for Figure 7d was not given. The bar represents 10 μm. The error has been corrected in the HTML and PDF versions of the article. © 2012 Nature America, Inc. All rights reserved. America, Inc. © 2012 Nature npg

nature neuroscience