DOCSLIB.ORG

Down-Regulation of Dendritic Spine and Glutamic Acid Decarboxylase 67 Expressions in the Reelin Haploinsufficient Heterozygous Reeler Mouse

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Down-Regulation of Dendritic Spine and Glutamic Acid Decarboxylase 67 Expressions in the Reelin Haploinsufficient Heterozygous Reeler Mouse Down-regulation of dendritic spine and glutamic acid decarboxylase 67 expressions in the reelin haploinsufficient heterozygous reeler mouse Wen Sheng Liu*, Christine Pesold*, Miguel A. Rodriguez*, Giovanni Carboni*, James Auta*, Pascal Lacor*, John Larson*, Brian G. Condie†, Alessandro Guidotti*, and Erminio Costa*‡ *Psychiatric Institute, Department of Psychiatry, College of Medicine, University of Illinois, Chicago, IL 60612; and †Institute of Molecular Medicine and Genetics, Departments of Medicine and Cellular Biology and Anatomy, Medical College of Georgia, Augusta, GA 30912 Contributed by Erminio Costa, December 22, 2000 Heterozygous reeler mice (HRM) haploinsufficient for reelin ex- heterozygote reeler mice (HRM) and in heterozygote GAD67 Ϸ press 50% of the brain reelin content of wild-type mice, but are knockout mice (HG67M) and compared them to their respective phenotypically different from both wild-type mice and homozy- wild-type background mice (WTM). In the present study, we gous reeler mice. They exhibit, (i) a down-regulation of glutamic have also quantified the number of neurons immunopositive for acid decarboxylase 67 (GAD67)-positive neurons in some but not reelin in the motor area of the frontoparietal cortex (FPC) of every cortical layer of frontoparietal cortex (FPC), (ii) an increase of HRM, as well as the total number of neurons immunopositive for neuronal packing density and a decrease of cortical thickness NeuN and the number of glial cells stained by Nissl (13) because of neuropil hypoplasia, (iii) a decrease of dendritic spine expressed in each of the six layers of this cortical area. In WTM, expression density on basal and apical dendritic branches of motor HRM, and HG67M, we have also quantified the laminar expres- FPC layer III pyramidal neurons, and (iv) a similar decrease in sion of GAD67-immunopositive neurons and the dendritic spine dendritic spines expressed on the basal dendrite branches of CA1 density expressed by pyramidal neurons of layer III FPC and of pyramidal neurons of the hippocampus. To establish whether the CA1 hippocampus. defect of GAD67 down-regulation observed in HRM is responsible for neuropil hypoplasia and decreased dendritic spine density, we Materials and Methods studied heterozygous GAD67 knockout mice (HG67M). These mice Colonies of HRM and HG67M. We have established an HRM exhibited a down-regulation of GAD67 mRNA expression in FPC breeding colony (obtained from The Jackson Laboratory) and (about 50%), but they expressed normal amounts of reelin and had more recently an HG67M colony (obtained from the Institute of no neuropil hypoplasia or down-regulation of dendritic spine Molecular Medicine and Genetics, Augusta, GA). HRM expression. These findings, coupled with electron-microscopic ob- (B6C3Fe strain) express a normal and a defective reelin allele servations that reelin colocalizes with integrin receptors on den- with a deletion of approximately 150 kb at the 3Ј end (Edinburg dritic spines, suggest that reelin may be a factor in the dynamic mutation) (14), and HG67M are heterozygous for a targeted NEUROBIOLOGY expression of cortical dendritic spines perhaps by promoting inte- allele of GAD67 (15). HG67M were originally on a mixed grin receptor clustering. These findings are interesting because the 129͞C57BL6J background and have been backcrossed for four brain neurochemical and neuroanatomical phenotypic traits exhib- to five generations with HRM background. ited by the HRM are in several ways similar to those found in The offspring of both heterozygous mice were genotyped by postmortem brains of psychotic patients. PCR as previously described for reelin (16) and GAD67 (17). The primer sequences (from 5Ј-3Ј) for reelin were, forward: taatct- rain postmortem studies from patients with schizophrenia gtcctcactctgcc; reverse: acagttgacataccttaatc; reverse mutated: Breveal a characteristic pattern of neuroanatomical and neu- tgcattaatgtgcagtgttgtc. The primer sequences for GAD67 were, rochemical abnormalities including: (i) enlarged cerebral ven- forward: tagaagctctcccggcacagctctc; reverse: gcgcaggttggtagtat- tricles (1, 2), (ii) altered cortical distribution of NADPH- taggatccg; reverse mutated: cgtgttcgaattcgccaatgacaagac. The diaphorase positive cells (3), (iii) decreased cortical thickness WTM, HRM, or HG67M used in the experiments were 60- to (4), (iv) increased cell-packing density associated with a neuropil 80-day-old males and were randomly sampled from several hypoplasia in absence of gliosis (5), (v) decreased expression of contemporaneous litters. dendritic spine in frontal, temporal, and subicular cortex (5–7), and (v) decreased expression of glutamic acid decarboxylase 67 Quantitative Reverse Transcription–PCR Analysis of Reelin, GAD67, and (GAD67) mRNA in prefrontal cortex neurons, particularly evi- GAD65 mRNAs. Primers and internal standards to quantify reelin dent in layers II and III (8–11). mRNA were previously described (17); the amplification primers Patients with schizophrenia or bipolar disorder with psychosis used were forward base pairs 9211–9231 and reverse base pairs express about 50% of the normal brain reelin mRNA levels in 9549–9569 (Gen Bank accession no. HSU79716). Primers for every cortical structure so far investigated, as well as in hip- GAD67 were: forward 1855–1878; reverse 2246–2269 base pairs pocampus, cerebellum, and caudate nucleus (9, 10). Although (Gen Bank accession no. M81883); the internal standard con- the number of GABAergic neurons that express reelin in tained a BglII restriction endonuclease, which on digestion prefrontal and temporal cortices (9, 10) and in the hippocampus generated fragments of 199 and 216 base pairs. Primers for (12) of these patients is reduced, the number of these interneu- rons is unchanged (8). Thus, it has been suggested that the decrease of reelin in neurons is probably because of the down- Abbreviations: GAD67, glutamic acid decarboxylase 67; HRM, heterozygous reeler mouse; WTM, wild-type mice; FPC, frontoparietal cortex; HG67M, heterozygous GAD67 knockout regulation in the expression of GAD67 mRNA and protein in mice. neurons rather than a reduction of the number of neurons per se ‡To whom reprint requests should be addressed at: 1601 West Taylor Street, M͞C 912, (9, 10, 12). To evaluate whether the down-regulation of GAD67 Psychiatric Institute, University of Illinois, Chicago, IL 60612. E-mail: [email protected]. mRNA expression is associated with a down-regulation of reelin The publication costs of this article were defrayed in part by page charge payment. This expression, we studied the expression of the mRNAs encoding article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. for reelin and GAD67 in the brain of reelin haploinsufficient §1734 solely to indicate this fact. www.pnas.org͞cgi͞doi͞10.1073͞pnas.051614698 PNAS ͉ March 13, 2001 ͉ vol. 98 ͉ no. 6 ͉ 3477–3482 Downloaded by guest on September 26, 2021 ␮ GAD65 were: forward 82–103; reverse 507–532 (Gen Bank Table 1. Reelin, GAD67 and GAD65 mRNA levels (attomol/ g total accession no. M72422); the internal standard contains an XbaI RNA) in FPC of WTM, HRM and HG67M restriction endonuclease, which on digestion generated frag- Type of mice Reelin GAD67 GAD65 ments of 215 and 235 base pairs. The assay was conducted as described by Grayson and Ikonomovic (18). WTM 190 Ϯ 9.0 7.0 Ϯ 0.80 48 Ϯ 14 HRM 99 Ϯ 16* 4.2 Ϯ 0.59* 40 Ϯ 12 Ϯ Ϯ Ϯ Immunohistochemistry. The brains used in these studies were ob- HG67M 145 24 3.2 0.38* 42 11 tained from mice anesthetized for about 1 min in a CO2 chamber Mean Ϯ SEM for WTM (n ϭ 6), HRM (n ϭ 6), and HG67M(n ϭ 4). Student’s and perfused intracardially with 10 ml of PBS followed by 10 ml of t test, two-tailed. *, P Ͻ 0.01. ice-cold fixative (for light microscopy: 4% paraformaldehyde in PBS; for Golgi impregnation: 4% paraformaldehyde ϩ 0.25% glutaraldehyde in PBS). Brains were removed and left in fresh studied under the Zeiss Axioskope microscope at ϫ40 objective fixative for 24 h at 4°C before storage in 30% sucrose at 4°C. with a video camera. Forty-micrometer sections were cut with a cryostat, and For the quantification of dendritic spine expression density. diaminobenzidine immunostaining was performed as previously Three-dimensional reconstruction of dendrites and their spines at described (17). The following antibodies were used: (i) mouse high magnification was obtained by using a Zeiss Axioskope monoclonal antibody G-10 (1:1,000), which was raised against connected to a live-image monitor. Only pyramidal neurons in layer the N-terminal region of Reelin (amino acid residue 40–189); a III of the motor cortex that satisfied the following criteria were generous gift from A. Goffinet (Department of Human Physi- included: (i) complete impregnation (including all dendrites), not ology, Faculte´s Universitaires Notre-Dame de la Paix School of obscured by other neurons or artifacts; (ii) clear image; and (iii) Medicine, Namur, Belgium): (ii) rabbit GAD67 (1:2,000, Chemi- visibility of at least three basal dendrites. For each neuron, the con); (iii) mouse anti-NeuN, a neuronal nuclei-specific marker apical and at least three basilar dendrites (and all of their branches) (1:500, Chemicon). were traced to their natural or artificial ends. Each branch was numbered with reference to its proximity to the cell body. For Stereological Cell-Counting Method. In different cortical layers of instance, the basal branch originating from the cell body is B1, motor FPC, cell density was quantified
Load more

Recommended publications
  • Do Thin Spines Learn to Be Mushroom Spines That Remember? Jennifer Bourne and Kristen M Harris
    CONEUR-488; NO OF PAGES 6 Do thin spines learn to be mushroom spines that remember? Jennifer Bourne and Kristen M Harris Dendritic spines are the primary site of excitatory input on most or whether they instead switch shapes depending on principal neurons. Long-lasting changes in synaptic activity are synaptic plasticity during learning. accompanied by alterations in spine shape, size and number. The responsiveness of thin spines to increases and decreases Maturation and stabilization of spines in synaptic activity has led to the suggestion that they are Spines tend to stabilize with maturation [5]; however, a ‘learning spines’, whereas the stability of mushroom spines small proportion continues to turnover in more mature suggests that they are ‘memory spines’. Synaptic brains [5–7]. The transient spines are thin spines that enhancement leads to an enlargement of thin spines into emerge and disappear over a few days, whereas mush- mushroom spines and the mobilization of subcellular resources room spines can persist for months [5,6]. Mushroom to potentiated synapses. Thin spines also concentrate spines have larger postsynaptic densities (PSDs) [1], biochemical signals such as Ca2+, providing the synaptic which anchor more AMPA glutamate receptors and make specificity required for learning. Determining the mechanisms these synapses functionally stronger [8–12]. Mushroom that regulate spine morphology is essential for understanding spines are more likely than thin spines to contain smooth the cellular changes that underlie learning and memory. endoplasmic reticulum, which can regulate Ca2+ locally [13], and spines that have larger synapses are also more Addresses Center for Learning and Memory, Department of Neurobiology, likely to contain polyribosomes for local protein synthesis University of Texas, Austin, TX 78712-0805, USA [14].
    [Show full text]
  • Biophysically Realistic Neuron Models for Simulation of Cortical Stimulation
    bioRxiv preprint doi: https://doi.org/10.1101/328534; this version posted August 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Biophysically Realistic Neuron Models for Simulation of Cortical Stimulation Authors: Aman S. Aberra1, Angel V. Peterchev1,2,3,4, Warren M. Grill1,3,4,5,* 1 Dept. of Biomedical Engineering, School of Engineering, Duke University, NC 2 Dept. of Psychiatry and Behavioral Sciences, School of Medicine, Duke University, NC 3 Dept. of Electrical and Computer Engineering, School of Engineering, Duke University, NC 4 Dept. of Neurosurgery, School of Medicine, Duke University, NC 5 Dept. of Neurobiology, School of Medicine, Duke University, NC * Corresponding Author: Warren M. Grill Keywords: neuron model, cortex, myelination, simulation, electric field, stimulation, axon bioRxiv preprint doi: https://doi.org/10.1101/328534; this version posted August 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 2 1. Abstract Objective. We implemented computational models of human and rat cortical neurons for simulating the neural response to cortical stimulation with electromagnetic fields. Approach. We adapted model neurons from the library of Blue Brain models to reflect biophysical and geometric properties of both adult rat and human cortical neurons and coupled the model neurons to exogenous electric fields (E-fields). The models included 3D reconstructed axonal and dendritic arbors, experimentally-validated electrophysiological behaviors, and multiple, morphological variants within cell types.
    [Show full text]
  • Cooperative Astrocyte and Dendritic Spine Dynamics at Hippocampal Excitatory Synapses
    The Journal of Neuroscience, August 30, 2006 • 26(35):8881–8891 • 8881 Development/Plasticity/Repair Cooperative Astrocyte and Dendritic Spine Dynamics at Hippocampal Excitatory Synapses Michael Haber, Lei Zhou, and Keith K. Murai Centre for Research in Neuroscience, Department of Neurology and Neurosurgery, The Research Institute of the McGill University Health Centre, Montreal General Hospital, Montreal, Quebec, H3G 1A4, Canada Accumulating evidence is redefining the importance of neuron–glial interactions at synapses in the CNS. Astrocytes form “tripartite” complexes with presynaptic and postsynaptic structures and regulate synaptic transmission and plasticity. Despite our understanding of the importance of neuron–glial relationships in physiological contexts, little is known about the structural interplay between astrocytes and synapses. In the past, this has been difficult to explore because studies have been hampered by the lack of a system that preserves complex neuron–glial relationships observed in the brain. Here we present a system that can be used to characterize the intricate relationshipbetweenastrocyticprocessesandsynapticstructuresinsituusingorganotypichippocampalslices,apreparationthatretains the three-dimensional architecture of astrocyte–synapse interactions. Using time-lapse confocal imaging, we demonstrate that astro- cytes can rapidly extend and retract fine processes to engage and disengage from motile postsynaptic dendritic spines. Surprisingly, astrocytic motility is, on average, higher than its dendritic spine
    [Show full text]
  • Contribution of Apical and Basal Dendrites of L2/3 Pyramidal Neurons to Orientation Encoding in Mouse V1 Jiyoung Park1,4*†, Athanasia Papoutsi3†, Ryan T
    bioRxiv preprint doi: https://doi.org/10.1101/566588; this version posted March 5, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Contribution of Apical and Basal Dendrites of L2/3 Pyramidal Neurons to Orientation Encoding in Mouse V1 Jiyoung Park1,4*†, Athanasia Papoutsi3†, Ryan T. Ash2,4, Miguel A. Marin2, Panayiota Poirazi3* & Stelios M. Smirnakis4* 1Program in Structural and Computational Biology and Molecular Biophysics, Baylor College of Medicine, Houston, Texas 2Department of Neuroscience, Baylor College of Medicine, Houston, Texas 3Institute of Molecular Biology and Biotechnology (IMBB), Foundation of Research and Technology Hellas (FORTH), Vassilika Vouton, Heraklion, Crete, Greece 4Brigham and Women’s Hospital and Jamaica Plain VA Hospital, Harvard Medical School, Boston, MA †Equal contribution. * Correspondence: [email protected], [email protected], [email protected] Abstract: Pyramidal neurons integrate synaptic inputs from basal and apical dendrites to generate stimulus-specific responses. It has been proposed that feed-forward inputs to basal dendrites drive a neuron’s stimulus preference, while feedback inputs to apical dendrites sharpen selectivity. However, how a neuron’s dendritic domains relate to its functional selectivity has not been demonstrated experimentally. We performed 2-photon dendritic micro-dissection on layer- 2/3 pyramidal neurons in mouse primary visual cortex. We found that removing the apical dendritic tuft did not alter orientation-tuning. Furthermore, orientation-tuning curves were remarkably robust to the removal of basal dendrites: ablation of 2-3 basal dendrites was needed to cause a small shift in orientation preference, without significantly altering tuning width.
    [Show full text]
  • Neuronal Organization of Olfactory Bulb Circuits
    REVIEW ARTICLE published: 03 September 2014 doi: 10.3389/fncir.2014.00098 Neuronal organization of olfactory bulb circuits Shin Nagayama 1*, Ryota Homma1 and Fumiaki Imamura 2 1 Department of Neurobiology and Anatomy, The University of Texas Medical School at Houston, Houston, TX, USA 2 Department of Pharmacology, Pennsylvania State University College of Medicine, Hershey, PA, USA Edited by: Olfactory sensory neurons extend their axons solely to the olfactory bulb, which is Benjamin R. Arenkiel, Baylor College dedicated to odor information processing.The olfactory bulb is divided into multiple layers, of Medicine, USA with different types of neurons found in each of the layers. Therefore, neurons in the Reviewed by: olfactory bulb have conventionally been categorized based on the layers in which their cell Kazushige Touhara, University of Tokyo, Japan bodies are found; namely, juxtaglomerular cells in the glomerular layer, tufted cells in the Veronica Egger, external plexiform layer, mitral cells in the mitral cell layer, and granule cells in the granule Ludwig-Maximilians-Universität, cell layer. More recently, numerous studies have revealed the heterogeneous nature of each Germany Kathleen Quast, Baylor College of of these cell types, allowing them to be further divided into subclasses based on differences Medicine, USA in morphological, molecular, and electrophysiological properties. In addition, technical *Correspondence: developments and advances have resulted in an increasing number of studies regarding Shin Nagayama, Department of cell types other than the conventionally categorized ones described above, including short- Neurobiology and Anatomy, The axon cells and adult-generated interneurons. Thus, the expanding diversity of cells in the University of Texas Medical School at Houston, 6431 Fannin Street, olfactory bulb is now being acknowledged.
    [Show full text]
  • Action Potentials in Basal and Oblique Dendrites of Rat Neocortical Pyramidal Neurons Srdjan D
    Physiology in Press; published online on May 9, 2003 as 10.1113/jphysiol.2002.033746 J Physiol (2003), xxx.x, pp. 000–000 DOI: 10.1113/jphysiol.2002.033746 © The Physiological Society 2003 www.jphysiol.org Action potentials in basal and oblique dendrites of rat neocortical pyramidal neurons Srdjan D. Antic Department of Cellular and Molecular Physiology, and Department of Neurobiology, Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06520, USA Basal and oblique dendrites comprise ~2/3 of the total excitable membrane in the mammalian cerebral cortex, yet they have never been probed with glass electrodes, and therefore their electrical properties and overall impact on synaptic processing are unknown. In the present study, fast multi- site voltage-sensitive dye imaging combined with somatic recording was used to provide a detailed description of the membrane potential transients in basal and oblique dendrites of pyramidal neurons during single and trains of action potentials (APs). The optical method allowed simultaneous measurements from several dendrites in the visual field up to 200 mm from the soma, thus providing a unique report on how an AP invades the entire dendritic tree. In contrast to apical dendrites, basal and oblique branches: (1) impose very little amplitude and time course modulation on backpropagating APs; (2) are strongly invaded by the somatic spike even when somatic firing rates reach 40 Hz (activity-independent backpropagation); and (3) do not exhibit signs of a ‘calcium shoulder’ on the falling phase of the AP. A compartmental model incorporating AP peak latencies and half-widths obtained from the apical, oblique and basal dendrites indicates that the specific intracellular resistance (Ri) is less than 100 V cm.
    [Show full text]
  • Coordinated Morphogenesis of Neurons and Glia
    Available online at www.sciencedirect.com ScienceDirect Coordinated morphogenesis of neurons and glia Elizabeth R Lamkin and Maxwell G Heiman Glia adopt remarkable shapes that are tightly coordinated with The scope of the problem: highly dynamic and the morphologies of their neuronal partners. To achieve these localized morphological changes precise shapes, glia and neurons exhibit coordinated The intimate associations between glia and synapses morphological changes on the time scale of minutes and on exhibit highly dynamic morphological changes on the size scales ranging from nanometers to hundreds of microns. order of minutes [7–11]. Landmark studies using time- Here, we review recent studies that reveal the highly dynamic, lapse confocal imaging of rodent brain slices revealed that localized morphological changes of mammalian neuron–glia post-synaptic dendritic spines and astrocytic processes do contacts. We then explore the power of Drosophila and C. not change shape in perfect register, yet generally grow elegans models to study coordinated changes at defined or shrink together over time [7,9]. Remarkably, this neuron–glia contacts, highlighting the use of innovative genetic coordinated growth is achieved even though glia–spine and imaging tools to uncover the molecular mechanisms interactions undergo rapid structural changes, astrocytic responsible for coordinated morphogenesis of neurons processes tend to exhibit even greater motility than their and glia. dendritic spine counterparts, and the extent of glial coverage of spines varies [7]. Two recent, complementary studies provided evidence for a mechanism that may help to explain the coordinated growth of astrocytic processes and dendritic spines. Address Perez-Alvarez et al. and Bernardinelli et al.
    [Show full text]
  • Transient Hypoxemia Chronically Disrupts Maturation of Preterm Fetal Ovine Subplate Neuron Arborization and Activity
    11912 • The Journal of Neuroscience, December 6, 2017 • 37(49):11912–11929 Development/Plasticity/Repair Transient Hypoxemia Chronically Disrupts Maturation of Preterm Fetal Ovine Subplate Neuron Arborization and Activity XEvelyn McClendon,1 Daniel C. Shaver,1 Kiera Degener-O’Brien,1 Xi Gong,1 Thuan Nguyen,2 Anna Hoerder-Suabedissen,3 Zolta´n Molna´r,3 Claudia Mohr,4 XBen D. Richardson,4 David J. Rossi,4 and Stephen A. Back1,5 1Department of Pediatrics and 2Public Health and Preventive Medicine, Oregon Health & Science University, Portland, Oregon 97239, 3Department of Physiology, Anatomy, and Genetics, University of Oxford, Oxford, United Kingdom OX1 3QX, 4Department of Integrative Physiology and Neuroscience, College of Veterinary Medicine, Washington State University, Pullman, Washington 99164, and 5Department of Neurology, Oregon Health & Science University, Portland, Oregon 97239 Preterm infants are at risk for a broad spectrum of neurobehavioral disabilities associated with diffuse disturbances in cortical growth and development. During brain development, subplate neurons (SPNs) are a largely transient population that serves a critical role to establish functional cortical circuits. By dynamically integrating into developing cortical circuits, they assist in consolidation of intra- cortical and extracortical circuits. Although SPNs reside in close proximity to cerebral white matter, which is particularly vulnerable to oxidative stress, the susceptibility of SPNs remains controversial. We determined SPN responses to two common insults to the preterm brain: hypoxia-ischemia and hypoxia. We used a preterm fetal sheep model using both sexes that reproduces the spectrum of human cerebral injury and abnormal cortical growth. Unlike oligodendrocyte progenitors, SPNs displayed pronounced resistance to early or delayed cell death from hypoxia or hypoxia-ischemia.
    [Show full text]
  • Autism Spectrum Disorder Susceptibility Gene TAOK2 Affects
    ART ic LE s Autism spectrum disorder susceptibility gene TAOK2 affects basal dendrite formation in the neocortex Froylan Calderon de Anda1,2, Ana Lucia Rosario1,2, Omer Durak1–3, Tracy Tran2,4,5, Johannes Gräff1,2, Konstantinos Meletis1–3,5, Damien Rei1,2, Takahiro Soda1,2, Ram Madabhushi1,2, David D Ginty2,4, Alex L Kolodkin2,4 & Li-Huei Tsai1–3 How neurons develop their morphology is an important question in neurobiology. Here we describe a new pathway that specifically affects the formation of basal dendrites and axonal projections in cortical pyramidal neurons. We report that thousand-and-one- amino acid 2 kinase (TAOK2), also known as TAO2, is essential for dendrite morphogenesis. TAOK2 downregulation impairs basal dendrite formation in vivo without affecting apical dendrites. Moreover, TAOK2 interacts with Neuropilin 1 (Nrp1), a receptor protein that binds the secreted guidance cue Semaphorin 3A (Sema3A). TAOK2 overexpression restores dendrite formation in cultured cortical neurons from Nrp1Sema− mice, which express Nrp1 receptors incapable of binding Sema3A. TAOK2 overexpression also ameliorates the basal dendrite impairment resulting from Nrp1 downregulation in vivo. Finally, Sema3A and TAOK2 modulate the formation of basal dendrites through the activation of the c-Jun N-terminal kinase (JNK). These results delineate a pathway whereby Sema3A and Nrp1 transduce signals through TAOK2 and JNK to regulate basal dendrite development in cortical neurons. Pyramidal neurons are abundant in brain regions associated with through the activation of JNK11. TAOK2 is subjected to alternative complex cognitive functions, including the cortex, hippocampus and splicing to produce the TAOK2α (140 kDa) and TAOK2β (120 kDa) amygdala1.
    [Show full text]
  • Contribution of Apical and Basal Dendrites to Orientation Encoding in Mouse V1 L2/3 Pyramidal Neurons
    ARTICLE https://doi.org/10.1038/s41467-019-13029-0 OPEN Contribution of apical and basal dendrites to orientation encoding in mouse V1 L2/3 pyramidal neurons Jiyoung Park1,2,7*, Athanasia Papoutsi3,7, Ryan T. Ash1,4,5, Miguel A. Marin4,6, Panayiota Poirazi 3,8*& Stelios M. Smirnakis1,8* 1234567890():,; Pyramidal neurons integrate synaptic inputs from basal and apical dendrites to generate stimulus-specific responses. It has been proposed that feed-forward inputs to basal dendrites drive a neuron’s stimulus preference, while feedback inputs to apical dendrites sharpen selectivity. However, how a neuron’s dendritic domains relate to its functional selectivity has not been demonstrated experimentally. We performed 2-photon dendritic micro-dissection on layer-2/3 pyramidal neurons in mouse primary visual cortex. We found that removing the apical dendritic tuft did not alter orientation-tuning. Furthermore, orientation-tuning curves were remarkably robust to the removal of basal dendrites: ablation of 2 basal dendrites was needed to cause a small shift in orientation preference, without significantly altering tuning width. Computational modeling corroborated our results and put limits on how orientation preferences among basal dendrites differ in order to reproduce the post-ablation data. In conclusion, neuronal orientation-tuning appears remarkably robust to loss of dendritic input. 1 Brigham and Women’s Hospital and Jamaica Plain VA Hospital, Harvard Medical School, Boston, MA, USA. 2 Program in Structural and Computational Biology and Molecular Biophysics, Baylor College of Medicine, Houston, TX, USA. 3 Institute of Molecular Biology and Biotechnology (IMBB), Foundation of Research and Technology Hellas (FORTH), Vassilika Vouton, HeraklionCrete, Greece.
    [Show full text]
  • Dendritic Size of Pyramidal Neurons Differs Among Mouse Cortical
    Cerebral Cortex July 2006;16:990--1001 doi:10.1093/cercor/bhj041 Advance Access publication September 29, 2005 Dendritic Size of Pyramidal Neurons Differs Ruth Benavides-Piccione1,2, Farid Hamzei-Sichani2, Inmaculada Ballesteros-Ya´n˜ez1, Javier DeFelipe1 and Rafael Yuste1,2 among Mouse Cortical Regions 1Instituto Cajal, Madrid, Spain and 2HHMI, Department of Biological Sciences, Columbia University, New York, USA Downloaded from https://academic.oup.com/cercor/article-abstract/16/7/990/425668 by University of Massachusetts Medical School user on 19 February 2019 Neocortical circuits share anatomical and physiological similarities a series of basic circuit diagrams based on anatomical and among different species and cortical areas. Because of this, electrophysiological data (Douglas et al., 1989, 1995; Douglas a ‘canonical’ cortical microcircuit could form the functional unit and Martin, 1991, 1998, 2004). According to their hypothesis, of the neocortex and perform the same basic computation on the common transfer function that the neocortex performs on different types of inputs. However, variations in pyramidal cell inputs could be related to the amplification of the signal structure between different primate cortical areas exist, indicating (Douglas et al., 1989) or a ‘soft’ winner-take-all algorithm that different cortical areas could be built out of different neuronal (Douglas and Martin, 2004). These ideas agree with the re- cell types. In the present study, we have investigated the dendritic current excitation present in cortical tissue which could then architecture of 90 layer II/III pyramidal neurons located in different exert a top-down amplification and selection on thalamic inputs cortical regions along a rostrocaudal axis in the mouse neocortex, (Douglas et al., 1995).
    [Show full text]
  • Sonic Hedgehog Signaling in Astrocytes Mediates Cell Type
    RESEARCH ARTICLE Sonic hedgehog signaling in astrocytes mediates cell type-specific synaptic organization Steven A Hill1†, Andrew S Blaeser1†, Austin A Coley2, Yajun Xie3, Katherine A Shepard1, Corey C Harwell3, Wen-Jun Gao2, A Denise R Garcia1,2* 1Department of Biology, Drexel University, Philadelphia, United States; 2Department of Neurobiology and Anatomy, Drexel University College of Medicine, Philadelphia, United States; 3Department of Neurobiology, Harvard Medical School, Boston, United States Abstract Astrocytes have emerged as integral partners with neurons in regulating synapse formation and function, but the mechanisms that mediate these interactions are not well understood. Here, we show that Sonic hedgehog (Shh) signaling in mature astrocytes is required for establishing structural organization and remodeling of cortical synapses in a cell type-specific manner. In the postnatal cortex, Shh signaling is active in a subpopulation of mature astrocytes localized primarily in deep cortical layers. Selective disruption of Shh signaling in astrocytes produces a dramatic increase in synapse number specifically on layer V apical dendrites that emerges during adolescence and persists into adulthood. Dynamic turnover of dendritic spines is impaired in mutant mice and is accompanied by an increase in neuronal excitability and a reduction of the glial-specific, inward-rectifying K+ channel Kir4.1. These data identify a critical role for Shh signaling in astrocyte-mediated modulation of neuronal activity required for sculpting synapses. *For correspondence: DOI: https://doi.org/10.7554/eLife.45545.001 [email protected] †These authors contributed equally to this work Introduction Competing interests: The The organization of synapses into the appropriate number and distribution occurs through a process authors declare that no of robust synapse addition followed by a period of refinement during which excess synapses are competing interests exist.
    [Show full text]