Down-Regulation of Dendritic Spine and Glutamic Acid Decarboxylase 67 Expressions in the Reelin Haploinsufficient Heterozygous Reeler Mouse

Home , Basal dendrite, Dendritic spine

Down-regulation of dendritic spine and glutamic acid decarboxylase 67 expressions in the reelin haploinsufficient heterozygous reeler mouse

Wen Sheng Liu*, Christine Pesold*, Miguel A. Rodriguez*, Giovanni Carboni*, James Auta*, Pascal Lacor*, John Larson*, Brian G. Condie†, Alessandro Guidotti*, and Erminio Costa*‡

*Psychiatric Institute, Department of Psychiatry, College of Medicine, University of Illinois, Chicago, IL 60612; and †Institute of Molecular Medicine and Genetics, Departments of Medicine and Cellular Biology and Anatomy, Medical College of Georgia, Augusta, GA 30912

Contributed by Erminio Costa, December 22, 2000

Heterozygous reeler mice (HRM) haploinsufﬁcient for reelin ex- heterozygote reeler mice (HRM) and in heterozygote GAD67 Ϸ press 50% of the brain reelin content of wild-type mice, but are knockout mice (HG67M) and compared them to their respective phenotypically different from both wild-type mice and homozy- wild-type background mice (WTM). In the present study, we gous reeler mice. They exhibit, (i) a down-regulation of glutamic have also quantified the number of neurons immunopositive for acid decarboxylase 67 (GAD67)-positive neurons in some but not reelin in the motor area of the frontoparietal cortex (FPC) of every cortical layer of frontoparietal cortex (FPC), (ii) an increase of HRM, as well as the total number of neurons immunopositive for neuronal packing density and a decrease of cortical thickness NeuN and the number of glial cells stained by Nissl (13) because of neuropil hypoplasia, (iii) a decrease of dendritic spine expressed in each of the six layers of this cortical area. In WTM, expression density on basal and apical dendritic branches of motor HRM, and HG67M, we have also quantified the laminar expres- FPC layer III pyramidal neurons, and (iv) a similar decrease in sion of GAD67-immunopositive neurons and the dendritic spine dendritic spines expressed on the basal dendrite branches of CA1 density expressed by pyramidal neurons of layer III FPC and of pyramidal neurons of the hippocampus. To establish whether the CA1 hippocampus. defect of GAD67 down-regulation observed in HRM is responsible for neuropil hypoplasia and decreased dendritic spine density, we Materials and Methods

studied heterozygous GAD67 knockout mice (HG67M). These mice Colonies of HRM and HG67M. We have established an HRM exhibited a down-regulation of GAD67 mRNA expression in FPC breeding colony (obtained from The Jackson Laboratory) and (about 50%), but they expressed normal amounts of reelin and had more recently an HG67M colony (obtained from the Institute of no neuropil hypoplasia or down-regulation of dendritic spine Molecular Medicine and Genetics, Augusta, GA). HRM expression. These ﬁndings, coupled with electron-microscopic ob- (B6C3Fe strain) express a normal and a defective reelin allele servations that reelin colocalizes with integrin receptors on den- with a deletion of approximately 150 kb at the 3Ј end (Edinburg

dritic spines, suggest that reelin may be a factor in the dynamic mutation) (14), and HG67M are heterozygous for a targeted NEUROBIOLOGY expression of cortical dendritic spines perhaps by promoting inte- allele of GAD67 (15). HG67M were originally on a mixed grin receptor clustering. These ﬁndings are interesting because the 129͞C57BL6J background and have been backcrossed for four brain neurochemical and neuroanatomical phenotypic traits exhib- to five generations with HRM background. ited by the HRM are in several ways similar to those found in The offspring of both heterozygous mice were genotyped by postmortem brains of psychotic patients. PCR as previously described for reelin (16) and GAD67 (17). The primer sequences (from 5Ј-3Ј) for reelin were, forward: taatct- rain postmortem studies from patients with schizophrenia gtcctcactctgcc; reverse: acagttgacataccttaatc; reverse mutated: Breveal a characteristic pattern of neuroanatomical and neu- tgcattaatgtgcagtgttgtc. The primer sequences for GAD67 were, rochemical abnormalities including: (i) enlarged cerebral ven- forward: tagaagctctcccggcacagctctc; reverse: gcgcaggttggtagtat- tricles (1, 2), (ii) altered cortical distribution of NADPH- taggatccg; reverse mutated: cgtgttcgaattcgccaatgacaagac. The diaphorase positive cells (3), (iii) decreased cortical thickness WTM, HRM, or HG67M used in the experiments were 60- to (4), (iv) increased cell-packing density associated with a neuropil 80-day-old males and were randomly sampled from several hypoplasia in absence of gliosis (5), (v) decreased expression of contemporaneous litters. dendritic spine in frontal, temporal, and subicular cortex (5–7), and (v) decreased expression of glutamic acid decarboxylase 67 Quantitative Reverse Transcription–PCR Analysis of Reelin, GAD67, and (GAD67) mRNA in prefrontal cortex neurons, particularly evi- GAD65 mRNAs. Primers and internal standards to quantify reelin dent in layers II and III (8–11). mRNA were previously described (17); the amplification primers Patients with schizophrenia or bipolar disorder with psychosis used were forward base pairs 9211–9231 and reverse base pairs express about 50% of the normal brain reelin mRNA levels in 9549–9569 (Gen Bank accession no. HSU79716). Primers for every cortical structure so far investigated, as well as in hip- GAD67 were: forward 1855–1878; reverse 2246–2269 base pairs pocampus, cerebellum, and caudate nucleus (9, 10). Although (Gen Bank accession no. M81883); the internal standard con- the number of GABAergic neurons that express reelin in tained a BglII restriction endonuclease, which on digestion prefrontal and temporal cortices (9, 10) and in the hippocampus generated fragments of 199 and 216 base pairs. Primers for (12) of these patients is reduced, the number of these interneurons is unchanged (8). Thus, it has been suggested that the decrease of reelin in neurons is probably because of the down- Abbreviations: GAD67, glutamic acid decarboxylase 67; HRM, heterozygous reeler mouse; WTM, wild-type mice; FPC, frontoparietal cortex; HG67M, heterozygous GAD67 knockout regulation in the expression of GAD67 mRNA and protein in mice. neurons rather than a reduction of the number of neurons per se ‡To whom reprint requests should be addressed at: 1601 West Taylor Street, M͞C 912, (9, 10, 12). To evaluate whether the down-regulation of GAD67 Psychiatric Institute, University of Illinois, Chicago, IL 60612. E-mail: [email protected]. mRNA expression is associated with a down-regulation of reelin The publication costs of this article were defrayed in part by page charge payment. This expression, we studied the expression of the mRNAs encoding article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. for reelin and GAD67 in the brain of reelin haploinsufficient §1734 solely to indicate this fact.

www.pnas.org͞cgi͞doi͞10.1073͞pnas.051614698 PNAS ͉ March 13, 2001 ͉ vol. 98 ͉ no. 6 ͉ 3477–3482 Downloaded by guest on September 26, 2021 ␮ GAD65 were: forward 82–103; reverse 507–532 (Gen Bank Table 1. Reelin, GAD67 and GAD65 mRNA levels (attomol/ g total accession no. M72422); the internal standard contains an XbaI RNA) in FPC of WTM, HRM and HG67M restriction endonuclease, which on digestion generated frag- Type of mice Reelin GAD67 GAD65 ments of 215 and 235 base pairs. The assay was conducted as described by Grayson and Ikonomovic (18). WTM 190 Ϯ 9.0 7.0 Ϯ 0.80 48 Ϯ 14 HRM 99 Ϯ 16* 4.2 Ϯ 0.59* 40 Ϯ 12 Ϯ Ϯ Ϯ Immunohistochemistry. The brains used in these studies were ob- HG67M 145 24 3.2 0.38* 42 11 tained from mice anesthetized for about 1 min in a CO2 chamber Mean Ϯ SEM for WTM (n ϭ 6), HRM (n ϭ 6), and HG67M(n ϭ 4). Student’s and perfused intracardially with 10 ml of PBS followed by 10 ml of t test, two-tailed. *, P Ͻ 0.01. ice-cold fixative (for light microscopy: 4% paraformaldehyde in PBS; for Golgi impregnation: 4% paraformaldehyde ϩ 0.25% glutaraldehyde in PBS). Brains were removed and left in fresh studied under the Zeiss Axioskope microscope at ϫ40 objective fixative for 24 h at 4°C before storage in 30% sucrose at 4°C. with a video camera. Forty-micrometer sections were cut with a cryostat, and For the quantiﬁcation of dendritic spine expression density. diaminobenzidine immunostaining was performed as previously Three-dimensional reconstruction of dendrites and their spines at described (17). The following antibodies were used: (i) mouse high magnification was obtained by using a Zeiss Axioskope monoclonal antibody G-10 (1:1,000), which was raised against connected to a live-image monitor. Only pyramidal neurons in layer the N-terminal region of Reelin (amino acid residue 40–189); a III of the motor cortex that satisfied the following criteria were generous gift from A. Goffinet (Department of Human Physi- included: (i) complete impregnation (including all dendrites), not ology, Faculte´s Universitaires Notre-Dame de la Paix School of obscured by other neurons or artifacts; (ii) clear image; and (iii) Medicine, Namur, Belgium): (ii) rabbit GAD67 (1:2,000, Chemi- visibility of at least three basal dendrites. For each neuron, the con); (iii) mouse anti-NeuN, a neuronal nuclei-specific marker apical and at least three basilar dendrites (and all of their branches) (1:500, Chemicon). were traced to their natural or artificial ends. Each branch was numbered with reference to its proximity to the cell body. For Stereological Cell-Counting Method. In different cortical layers of instance, the basal branch originating from the cell body is B1, motor FPC, cell density was quantified by a microscopist blind which will eventually branch off to form B2, and so on. For each with respect to the mouse genotype, by using variations of the mouse, five neurons from the FPC were selected. For each neuron, three-dimensional cell-counting method described by Selemon the number and length of dendrites were quantified. and Goldman-Rakic (4). Briefly, cells were counted with a ϫ40 Laser confocal microscope ﬂuorescence image technique. Layer Leica TCSNT laser confocal microscope by using the ‘‘optical III pyramidal motor neurons from Ϸ400 ␮m coronal sections of dissector’’ method in a cortical probe consisting of an uninter- FPC, serially sectioned 0.5 to 3 mm anterior to the Bregma (21), rupted series of three-dimensional counting boxes (100 ϫ 100 ϫ were stained by pressure injection of microdrops of 1,1Јdiocta- 40) that span from the pial surface to the underlying white decyl-3,3,3Ј,3Ј-tetramethylindocarbocyamine perchlorate dis- matter. For each box, the generated confocal image stacks solved in menhaden fish oil (22). A total of four to five slices were (approximately 16) allow counting of stained cells that come into used from each animal, and four to six motor neurons were view (or, alternatively, disappear) through a known depth (Z) of stained on each slide. Cells were visualized by a Leica confocal the tissue section by using the Stereo Investigator Confocal laser-scanning microscope by using a ϫ40 water-immersion Software (Microbright Field, Colchester, VT) and the Optical objective. Scans were made of each individual cell somata Fractionator Tool from the Stereo Investigation Program de- followed by four to eight serial zoomed optical sections of three scribed by Williams and Rakic (19). Cells located completely to four regions of secondary dendrites around each cell. Indi- inside the counting box and those crossing the top, right, or back vidual dendrites were traced three dimensionally from the sides were counted, whereas those crossing other planes were computer analyses of the optical serial sections, and the entire excluded. In each section, the number of reelin-immunopositive pyramidal neurons and their dendritic shafts and spines were neurons was counted in five to six cortical probes in a total of reconstructed. Quantification of spine density was determined as three sections (one of every five sections). Similarly, in serial described for the Golgi impregnation technique. sections NeuN-immunopositive cells and GAD67-immunopositive cells were quantified, as were Nissl-stained neurons and glial Results cells; glial cells were differentiated from neurons by using the Reelin, GAD67, and GAD65 mRNA Expression in the HRM and HG67M criteria described by Benes et al. (13). The number of reelin- Models. Table 1 shows that reelin mRNA expression is decreased positive cells, NeuN-positive cells, Nissl-stained neurons, and by about 50% in the FPC of HRM. This decrease is accompanied Ϯ glial cells are expressed as the mean SEM of the number of by a down-regulation in GAD67 mRNA, with no change in the cells per cubic millimeter, whereas the number of GAD67- expression of GAD65 mRNA. Table 1 also shows that in FPC of positive cells are expressed per area, as defined in Fig. 2. HG67M, the expression of GAD67 mRNA is down-regulated by about 50%, whereas the expression of GAD65 and reelin mRNAs Two Independent Methods to Measure Dendritic Spine Density. Golgi- is unchanged. However, despite the low content of GAD67 impregnation technique. Tissue blocks of desired cortex area mRNA, the down-regulation of GAD67 by 50% is associated with about 1–2 mm thick were cut with a razor blade. The blocks were a 20% decrease of FPC GABA content (unpublished data). rapid-Golgi stained, as previously described (20). Briefly, the blocks were immersed in a solution of 2% osmium tetroxide in Expression Density of Reelin-Positive Neurons in the FPC of the HRM buffer for 24 h, followed by 2-day immersion in a 4% solution of Model. In Table 2, we report that in motor FPC of HRM, potassium dichromate. Then the blocks were washed briefly in stereological counts of reelin-immunopositive neurons were dH2O and fresh solution of 0.75% silver nitrate and stored for significantly decreased in five of the six cortical layers; the 24 h in fresh solution of 0.75% silver nitrate. Finally, the blocks nonsignificant decrease in the expression of reelin-positive neu- were transferred to a graded series of increasing glycerol con- rons in layer VI reflects the extremely low density of reelin- centration and stored in pure glycerol at 4°C. These blocks were immunopositive neurons expressed by this cortical layer. Fig. 1 embedded in 7% agar and cut at 80 ␮m by using a vibratome. shows that in the WTM (Left), as previously described in rats (17, Sections were kept for 30 min under an illuminated device and 23), the neurons containing reelin are scattered throughout the

3478 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.051614698 Liu et al. Downloaded by guest on September 26, 2021 Table 2. Measurement of cell density and cortical thickness in motor FPC* of WTM and HRM Reelin positive neurons (no. neuron/␮m3 ϫ 10Ϫ3) Neurons (no. neuron/␮m3 ϫ 10Ϫ3) Glial cells (no. neuron/␮m3 ϫ 10Ϫ3) Cortical layer thickness, ␮m

WTM HRM WTM HRM WTM HRM WTM HRM

Layer I 5.8 Ϯ 0.6 2.0 Ϯ 0.5† 24.5 Ϯ 1.3 32.4 Ϯ 1.8† 50.7 Ϯ 5.6 50.0 Ϯ 4.8 106 Ϯ 8.5 92.0 Ϯ 7.8 Layer II 7.2 Ϯ 2.2 0.3 Ϯ 0.2† 55.1 Ϯ 5.1 63.5 Ϯ 4.6 47.7 Ϯ 6.2 45.9 Ϯ 4.4 75.0 Ϯ 0.9 72.7 Ϯ 1.4 Layer III 3.6 Ϯ 1.2 0 Ϯ 0† 45.4 Ϯ 1.7 81.5 Ϯ 4.4† 33.9 Ϯ 3.2 31.3 Ϯ 4.4 98.3 Ϯ 0.8 93.3 Ϯ 1.4† Layer IV 2.2 Ϯ 0.6 0.3 Ϯ 0.2† 40.2 Ϯ 1.4 78.5 Ϯ 3.7† 25.6 Ϯ 1.3 37.3 Ϯ 3.0† 130 Ϯ 1.1 113.7 Ϯ 2.4† Layer V 1.6 Ϯ 0.6 0 Ϯ 0† 41.9 Ϯ 2.5 87.8 Ϯ 3.7† 21.9 Ϯ 1.6 34.1 Ϯ 3.0† 346.7 Ϯ 2.3 316 Ϯ 3.7† Layer VI 0.5 Ϯ 0.3 0 Ϯ 0 45.1 Ϯ 3.2 86.4 Ϯ 5.2† 21.6 Ϯ 1.6 32.9 Ϯ 1.9† 433.8 Ϯ 3.1 406 Ϯ 4.0†

Each value is the mean Ϯ SEM of ﬁve animals. *Coronal sections between 0.5 and 1 mm anterior to Bregma. †Indicated there is a signiﬁcant different between WTM and HRM; Student’s t test, P Ͻ 0.05.

cortical mantle. In the HRM (Right), the reelin-expressing layer thickness in the motor FPC area of WTM and HRM are neurons are scattered throughout the cortex, but their density is reported in Table 2. The HRM model shows a significant significantly lower than that of WTM (Fig. 1 and Table 2). In increase in neuronal packing density, evidenced by an increase addition, the diffuse reelin immunostaining expressed in the in neuronal density and a concomitant decrease in cortical neuropil of HRM appears to be lower than that in WTM (Fig. 1). thickness, which is particularly striking in cortical layers III–VI. In addition, deeper cortical layers IV–VI also show a modest Expression Density of GAD67-Immunoreactive Neurons in the FPC Cortex of the HRM Model. The number of GAD67 immunoreactive neurons was quantified in various FPC regions (Fig. 2), which were labeled as M2, Cg1, and Cg2, following the nomenclature of Franklin and Paxinos (21). Fig. 2 Upper shows all counts of GAD67-immunopositive neurons in the HRM model as percentage of those of the WTM. The percentage of GAD67- immunopositive neurons in the HRM model is significantly decreased in the M2 and Cg1 regions of the FPC, and this decrease is more pronounced in the superficial layers (I–IV). GAD67 immunoreactivity in the neuropil of M2 and Cg1 regions in FPC sections of HRM is also lower than those of WTM. NEUROBIOLOGY

Neuronal Packing Density in the FPC of HRM Model. The stereological counts of neurons and glial cells and the estimation of cortical

Fig. 2. GAD67-immunoreactive neurons in FPC of HRM and WTM. (Upper Left) A schematic representation of a coronal section of FPC (0.74 mm anterior to Bregma) illustrating the subdivisions of superﬁcial layers (I–IV) and deep cortical layers (V–VI) of the M2, Cg1, and Cg2 regions of the FPC, and Right is the percentage of GAD67-immunoreactive cells in the HRM, as compared with the WTM. Student’s t test comparing HRM with WTM. *, P Ͻ 0.01;**, P Ͻ 0.001. (Lower) Photomicrographs of 40-␮m sections through the FPC of the WTM Fig. 1. Photomicrographs of reelin-immunostaining through the motor FPC (Left) and HRM (Right) immunolabeled for GAD67. Note that in the HRM there of WTM (Left) and HRM (Right)of20-␮m coronal sections taken 0.74 mm is a decreased number of GAD67-immunopositive cells in the Cg1 and M2 anterior to Bregma. Note that there is a decrease in the number of reelin- regions, as well as a decrease in the surrounding neuropil expression of GAD67. immunopositive neurons as well as an apparent decrease in the expression of Each value represents the mean of eight to nine animals. Standard error range reelin in the neuropil. (Bar ϭ 200 ␮m.) from 2–10% of the mean. (Bar ϭ 300 ␮m.)

Liu et al. PNAS ͉ March 13, 2001 ͉ vol. 98 ͉ no. 6 ͉ 3479 Downloaded by guest on September 26, 2021 Fig. 3. Photomicrographs showing a Golgi-impregnated FPC layer III pyra- Fig. 5. Laser confocal microscope fluorescent image of FPC pyramidal neu- midal cell from a WTM (A) and a HRM (B). C and D are higher magnifications rons stained with ⌬9 1,1Јdioctadecyl-3,3,3Ј,3Ј-tetramethylindocarbocyamine of the area boxed in A and B, respectively. Note the decreased number of perchlorate. (A and C) Pyramidal neuron of motor FPC area (1.0 mm anterior spines on the dendrites of the HRM. High magnification of B2 dendritic to Bregma) of WTM. (B and D) Pyramidal neuron from the homologous FPC branches shows that the spines of the HRM (F) appear to be smaller and have area of HRM. (Lower C and D) are the higher magnification of the area boxed ϭ ␮ a shorter neck than the spines of the WTM (E). (Bars in A and B 20 m; in C in A and B. (Bars: A and B ϭ 10 ␮m; C and D ϭ 5 ␮m.) and D ϭ 10 ␮m; in E and F ϭ 2.5 ␮m.)

HRM spines appear somewhat smaller and have shorter necks increase in glial cell density, present only in layers that have a than those of WTM. It is possible also to detect filopodia-like significantly reduced thickness. spines in WTM but not in HRM (Fig. 3 E and F). However, neither the length nor the thickness of dendritic branches differs Dendritic Spine Expression Density in the HRM Model. As seen in Fig. in these two groups of mice (data not shown). Although less 3, spine density on layer III pyramidal cells of the FPC of the dramatic, there is also a significant decrease in the expression HRM model (B and D) is significantly lower than in WTM (A density of dendritic spines on most basal branches, but not on the and C). Bar graphs in Fig. 4 show that the expression density of apical branches of CA1 hippocampal pyramidal neurons of the dendritic spines in various apical and basal branches of layer III HRM model (Fig. 4). Furthermore, there is a modest but pyramidal cells in FPC of HRM is significantly lower than in significant decrease in dendritic spine expression on the distal branches of Purkinje neurons in the cerebellum (WTM ϭ 15 Ϯ WTM. In addition, the morphology of the dendritic spines ϭ Ϯ ␮ ϭ expressed in layer III pyramidal neurons of HRM differs from 0. 3 and HRM 12 0.3 spines per 10 m dendritic length; n P Ͻ the spine morphology of homologous branches of WTM: the 5; 0.001). Note that in Purkinje neurons, only the spine expression on distal branches could be quantified because the dendritic arborization of the proximal branches was very intri- cate and too voluminous to allow a confident quantification of spine expression. Spine density was also determined on basilar or apical dendrites of layer III pyramidal neurons of the FPC of HG67M model. In this model, there were no significant differ- ences in expression density of spines in basal or apical dendrite branches when compared with the respective WTM. The average number of spines was 1.8 Ϯ 0.3 (basal) and 3.0 Ϯ 0.4 (apical) per 10 ␮m of dendrite in 3 WTM, and 1.5 Ϯ 0.2 (basal) and 2.2 Ϯ 0.5 (apical) in the homologous dendritic branches of 3 HG67M. Similar results were obtained by laser confocal microscope imaging of cortical pyramidal neurons stained with ⌬9 1,1Јdi- octadecyl-3,3,3Ј,3Ј-tetramethylindocarbocyamine perchlorate to visualize dendritic spines. Fig. 5 shows that the apical and basal dendrites branches of cortical pyramidal neurons of HRM have fewer spines than the WTM. The average number of spines in apical dendrite branches is: 6.1 Ϯ 0.6 per 10 ␮m of dendrite in the WTM and 2.9 Ϯ 0.2 in the HRM (n ϭ 5, P Ͻ 0.001). This result provides an independent confirmation of the results Fig. 4. Number of dendritic spines expressed on basal or apical branches of obtained by Golgi impregnation. motor FPC layer III pyramidal neurons (Left) and on basal or apical branches of hippocampal (HIP) CA1 pyramidal neurons (Right). Coronal FPC sections 0.5–1 Discussion mm anterior to the Bregma, Ⅺ, WTM; ■, HRM. Each value is the mean Ϯ SEM The present experiments have been conducted to establish of ﬁve animals. Student’s t test comparing HRM with WTM *, P Ͻ 0.02. whether the haploinsufficiency of reelin of the HRM, which is

3480 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.051614698 Liu et al. Downloaded by guest on September 26, 2021 similar in extent to that measured in the cortex of psychotic postmortem brains of schizophrenia or bipolar disorder patients (schizophrenia and bipolar depressed) patients (9, 10), is asso- with psychosis exhibit a similar loss of reelin immunolabeled cells ciated with a neuropil hypoplasia and a down-regulation of and reelin expression in the extracellular matrix, with no loss of GAD67 similar to that detected in the brains of these patients. neurons (9, 10). Because schizophrenics and bipolar disorder patients with psychosis consistently manifest a decrease of Decreased Dendritic Spine Density in the HRM Model. In this study, GAD67, without changes of GAD65 expression (8–11), we in- we showed that the HRM model exhibits a decreased dendritic vestigated whether a primary defect of GAD67 gene expression spine density. This characteristic is similar to what is seen in in GABAergic neurons is directly or indirectly responsible for postmortem brains of schizophrenic and bipolar disorder pa- the down-regulation of reelin expression we have consistently tients (5–7). Because dendritic spines are critical for mammalian detected in psychotic patients’ postmortem brains. Here we brain synaptic plasticity, a reduction of dendritic spine density report that reelin mRNA levels are normal in the HG67M (Table has important implications for brain function. 1), suggesting that the down-regulation of GAD67 is not likely A decreased dendritic spine density may also have important driving the down-regulation of reelin in brains of psychotic functional consequences, because about 80% of the excitatory patients. synaptic afferents to cortical pyramidal neurons impinge on dendritic spines (24). These cortical pyramidal cells also receive GAD67 Down-Regulation in the HRM Model. Similar to the postmor- local inhibitory GABAergic innervation from several subtypes tem brains of schizophrenia and bipolar disorder patients with of GABAergic interneurons (25), including horizontal, bitufted psychosis (10), the brains of HRM also exhibit a down-regulation and Martinotti cells, which are reelin-immunopositive (23). in the expression of GAD67 mRNA and in the number of FPC Conversely, basket and chandelier cells, which inhibit pyramidal neurons in which we detected GAD67 immunoreactivity. How- cells at the level of the aspiny cell body and axon initial segment, ever, because in the HRM, as in the brain of schizophrenic respectively, do not express reelin (23). Because reelin is syn- patients (9–11), there is no apparent loss of neurons (see Table thesized and secreted from the subpopulation of GABAergic 2), it is likely that GABAergic neurons are still present but do not interneurons that impinge directly on dendritic spines and shafts, express immunodetectable levels of GAD67. In addition, like in and because electron microscopy reveals that reelin is found to the brains of psychotic patients, there is a loss of GAD67 adhere to and presumably act on dendritic spines (26), it seems immunoreactivity in the surrounding neuropil. This likely re- possible that a decrease in reelin expression may be related to flects decreased GAD67 expression in the axon terminals of these the decrease in dendritic spine expression. Our finding that interneurons, presumably in response to the decreased number dendritic spines are not decreased in HG67M suggests that a of synaptic targets associated with the dendritic spine. Interest- down-regulation of GAD67 is not driving the decreased spine ingly, M2 and Cg1 areas of the PFC have also been implicated expression. in the pathophysiology of schizophrenia (28). In the HRM hippocampus, dendritic spine density is de- From these data, we cannot determine whether the GABAer- creased on basal dendrites of CA1 pyramidal cells, although not gic interneurons that are not expressing normal levels of GAD67 on apical dendrites. This fact is in keeping with our previous are reelin-containing cells. However, because reelin is expressed findings that in the rat hippocampal formation, the majority of primarily in horizontal, bitufted, and Martinotti cells (23), and GABAergic interneurons expressing reelin are located in the because the location of GABAergic interneurons that are down- NEUROBIOLOGY stratum oriens (17), around the basal dendrites of pyramidal regulated in M2 and Cg1 is mostly in the superficial layers where neurons. If reelin plays a role in neuropil plasticity regulation via these GABAergic neurons are located (17, 23), it is possible that a trophic action on dendritic spines, it is not surprising that a reelin-containing cells are among those that exhibit a down- down-regulation of reelin would have a greater impact on regulation of GAD67 expression. dendritic spine expression on nearby basal dendrites than on the It is unlikely that the decrease of GAD67 mRNA expression in apical dendrites of the reelin-scarce stratum radiatum. HRM is caused by a GAD67 genomic defect associated with the In the cerebellum, reelin is synthesized by glutamatergic reelin gene mutation, because in the HRM cerebellum, the granule cells and secreted by their axon parallel fibers onto expression of GAD67 is virtually identical to that in the cerebel- Purkinje cell dendritic trees (17). Dendritic spines are also lum of WTM (data not shown). decreased, albeit modestly, on the distal dendrites of cerebellar It does not appear that in the HRM model GAD65 is com- Purkinje cells in the HRM. Overall, dendritic spine density was pensating for the down-regulation of GAD67, because GAD65 decreased in several brain areas of the HRM in a manner that levels are virtually unchanged. Although GAD65 expression is may be related to the level of reelin that is normally released into also not up-regulated in the postmortem brains of schizophrenia the extracellular matrix surrounding their dendrites (26). In and bipolar disorder patients with psychosis (10), one should be contrast, dendritic spine expression does not appear to be prudent in making analogies between human and mouse brain reduced in HG67M, suggesting that the decrease of GAD67 models, because GAD65 is the most predominantly expressed present in HRM may not likely contribute significantly to the GABA synthesizing enzyme in the rat (29) and mouse brain (see decrease in dendritic spine expression observed in the HRM. Table 1), whereas GAD67 is the most predominantly expressed GABA synthesizing enzyme in the human brain (10). Reelin Expression. We have reported that reelin haploinsufficient HRM express about 50% of the normal amount of reelin in Reduction of Cortical Thickness in the HRM Model. As in the brains various brain structures, in peripheral organs, and in plasma (16, of schizophrenia patients (25), HRM have a decrease in cortical 27). Here we show that the HRM also express about half of the thickness that appears to be the result of a neuropil hypoplasia normal levels of reelin mRNA in FPC (Table 1) and have a rather than a consequence of a pathological neuronal necrosis. significant decrease in the number of cells expressing immuno- This finding is in line with the apparent absence of reactive detectable levels of reelin. Because there is no loss of cells in the gliosis, which would be expected if neuronal necrosis or apo- FPC of these animals, it appears that the decrease in the number ptosis has taken place. Although we found a modest increase in of reelin-positive cells is not because of a decrease of GABAer- glial cells in the deeper cortical layers, this appears to be the gic interneurons (see Fig. 1). Furthermore, by using electron result of an increased glial cell-packing density, because it is microscopy, we have shown that the amount of reelin expressed observed only in the layers where thickness is significantly around dendritic spines and their shafts is also decreased in the reduced. Furthermore, neuronal counts are significantly in- HRM FPC (G. Pappas, personal communication). Interestingly, creased in almost every cortical layer, which, given the reduction

Liu et al. PNAS ͉ March 13, 2001 ͉ vol. 98 ͉ no. 6 ͉ 3481 Downloaded by guest on September 26, 2021 in cortical thickness, likely reflects an increased cell-packing of this proposed model, see refs. 10 and 33). Phosphorylated density rather than an increase in the expression of neurons per Dab1 may then transfer specific proteins to the polyribosomes se. Because the neuropil consists mainly of axons, dendritic trees, and mRNAs resident at the confluence of spines and dendrites and spines, the decreased spine density reported here to occur and directly or indirectly activate the translation of these mR- in the FPC of HRM could potentially account for the diminished NAs, which often encode cytoskeletal proteins. The ability of neuropil. In fact spines express receptors, which are targets for spines to synthesize proteins suggests not only that the spine GABAergic, glutamatergic, and monaminergic axon terminals; protein composition, shape, and volume can change as a function reduction of spine-associated receptors triggers compensatory of this synthesis, but also that spines, via the synthesis of new pruning of these axon terminals. proteins, can send specific messages to the nucleus and thereby modify nuclear DNA transcription. Possible Role of Reelin on Dendritic Spines Expression. Although it appears that a reelin deficiency is associated with a decrease in Concluding Remarks. In the HRM, as in the brains of patients with dendritic spine density in both the HRM and in patients with schizophrenia, a reelin haploinsufficiency is associated with schizophrenia (5–7), one may speculate that in the adult brain, neuropil hypoplasia, which we suggest is an important factor in reelin may play a role in dendritic spine dynamics. In fact, the psychosis vulnerability. This hypoplasia may also underlie be- HRM model shows not abnormalities in dendritic length or havioral abnormalities, including the disruption of prepulse thickness but rather changes in the shape, size, and number of inhibition (16), increased anxiety in the elevated plus-maze test spines and filopodia (Fig. 5). Our electron microscopy studies in (16), cognitive impairments in an eight-arm radial maze task, monkeys show that reelin released into the extracellular matrix and abnormal responses to an intruder mouse (G.C., unpub- decorates dendritic spines and shafts of their presumed target ␣ lished work). The seemingly analogous neuroanatomical and cells (26). Reelin’s colocalization with 3 integrin receptor behavioral abnormalities of the HRM and the schizophrenia subunits on these dendritic spines and shafts suggests that patient, which at present do not appear to have other transmitter integrins, which function selectively to interconnect extracellular mechanism commonalties except for the decreased reelin and matrix proteins with intracellular cytoskeletal proteins, are the GAD67, suggest that reelin haploinsufficiency may provide a putative receptors for reelin (30). On the basis of converging model to study a new pharmacology of the psychosis vulnera- evidence from several laboratories, our current working hypoth- bility and perhaps of psychotic symptoms. esis postulates that in adult brain, reelin adheres to dendrites and spines presumably as a homopolymeric aggregate (31). The We thank Dr. Floyd E. Bloom, Department of Neuropharmacology, the reelin–integrin receptor signal transduction may trigger an in- Scripps Research Institute, La Jolla, CA, for constructive criticisms and tracellular transduction cascade involving the adaptor protein suggestions in the preparation of the manuscript. This work was in part mouse disabled 1 or mDab1 (32), which activates the phosphor- supported by National Institute of Mental Health Grants MH 49486 and ylation of Dab1 by a focal adhesion tyrosine kinase (for details MH 62188 (to A.G.)

1. Weinberger, D. R., Berman, K. F. & Zec, R. F. (1986) Arch. Gen. Psychol. 43, 18. Grayson, D. R. & Ikonomovic, S. (1998) in In-Vitro Neurochemical Techniques, 114–124. eds. Boulton, A. A., Baker, G. B. & Bateson, A. N. (Humana, Totowa, NJ), Vol. 2. Weinberger, D. R. & Lipska, B. K. (1995) Schizophr. Res. 16, 87–110. 34, pp. 127–151. 3. Akbarian, S., Kim, J. J., Potkin, S. G., Hetrick, W. P., Bunney, W. E., Jr. & 19. Williams, R. W. & Rakic, P. (1998) J. Comp. Neurol. 278, 233–352. Jones, E. G. (1996) Arch. Gen. Psychol. 53, 425–436. 20. Kisvarday, Z. F., Gulyas, A., Beroukas, D., North, J. B., Chubb, I. W. & 4. Selemon, L. D. & Goldman-Rakic, P. S. (1999) Biol. Psychol. 45, 17–25. Somogyi, P. (1990) Brain 113, 793–812. 5. Garey, L. J., Ong, W. Y., Patel, T. S., Kanani, M., Davis, A., Mortimer, A. M., 21. Franklin, K. B. J. & Paxinos, G. (1997) The Mouse Brain in Stereotaxic Barnes, T. R. & Hirsch, S. R. (1998) J. Neurol. Neurosurg. Psychol. 65, 446–453. Coordinates (Academic, San Diego, CA). 6. Glantz, L. A. & Lewis, D. A. (2000) Arch. Gen. Psychol. 57, 65–73. 22. Hosokawa, T., Bliss, T. V. & Fine, A. (1992) NeuroReport 3, 477–480. 7. Rosoklija, G., Toomayan, G., Ellis, S. P., Keilp, J., Mann, J. J., Latov, N., Hays, 23. Pesold, C., Liu, W. S., Guidotti, A., Costa, E. & Caruncho, H. J. (1999) Proc. A. P. & Dwork, A. J. (2000) Arch. Gen. Psychol. 57, 349–356. Natl. Acad. Sci. USA 96, 3217–3222. 8. Akbarian, S., Kim, J. J., Potkin, S. G., Hagman, J. O., Tafazzoli, A., Bunney, 24. Eberwine, J. H. (1999) in Dendrites, eds. Stuart, G., Spruston, N. & Ha¨usser, 552, W. E., Jr. & Jones, E. G. (1995) Arch. Gen. Psychol. 258–266. M. (Oxford Univ. Press, New York), pp. 35–67. 9. Impagnatiello, F., Guidotti, A. R., Pesold, C., Dwivedi, Y., Caruncho, H., Pisu, 25. Lewis, D. A. & Lieberman, J. A. (2000) Neuron 289, 325–334. M. G., Uzunov, D. P., Smalheiser, N. R., Davis, J. M., Pandey, G. N., et al. 26. Rodriguez, M. A., Pesold, C., Liu, W. S., Kriho, V., Guidotti, A., Pappas, G. D. (1998) Proc. Natl. Acad. Sci. USA 95, 15718–15723. & Costa, E. (2000) Proc. Natl. Acad. Sci. USA 97, 3550–3555. (First Published 10. Guidotti, A., Auta, J., Davis, J. M., DiGiorgi-Gerenini, V., Dwivedi, J., March 21, 2000; 10.1073͞pnas.050589797) Grayson, D. R., Impagnatiello, F., Pandey, G. N., Pesold, C., Sharma, R. F., et 27. Smalheiser, N. R., Costa, E., Guidotti, A., Impagnatiello, F., Auta, J., Lacor, al. (2000) Arch. Gen. Psychol. 57, 1061–1069. 97, 11. Volk, D. W., Austin, M. C., Pierri, J. N., Sampson, A. R. & Lewis, D. A. (2000) P., Kriho, V. & Pappas, G. (2000) Proc. Natl. Acad. Sci. USA 1281–1286. Arch. Gen. Psychol. 57, 237–245. 28. Benes, F. M., Vincent, S. L., Alsterberg, G., Bird, E. D. & San Giovanni, J. P. 12. Fatemi, S. H., Earle, J. A. & McMenomy, T. (2000) Mol. Psychol. 5, 654–663. (1992) J. Neurosci. 12, 924–929. 13. Benes, F. M., McSparren, J., Bird, E. D., Sangiovanni, J. P. & Vincent, S. L. 29. Izzo, E., Auta, J., Impagnatiello, F., Pesold, C., Guidotti, A. & Costa, E. (2001) (1991) Arch. Gen. Psychol. 48, 996–1001. Proc. Natl. Acad. Sci. USA 98, 3483–3488. 14. D’Arcangelo, G., Miao, G. G. & Curran, T. (1996) Mol. Brain Res. 39, 223–236. 30. Dulabon, L., Olson, E. C., Taglienti, M. G., Eisenhuth, S., McGrath, B., Walsh, 15. Condie, B. G., Bain, G., Gottlieb, D. I. & Capecchi, M. R. (1997) Proc. Natl. C. A., Kreidberg, J. A. & Anton, E. S. (2000) Neuron 27, 33–44. Acad. Sci. USA 94, 11451–11455. 31. Utsunomiya-Tate, N., Kubo, K., Tate, S., Kainosho, M., Katayama, E., Naka- 16. Tueting, P., Costa, E., Dwivedi, J., Guidotti, A., Impagnatiello, F., Manev, R. jima, K. & Mikoshiba, K. (2000) Proc. Natl. Acad. Sci. USA 97, 9729–9734. & Pesold, C. (1999) NeuroReport 10, 1329–1334. (First Published August 1, 2000; 10.1073͞pnas.160272497) 17. Pesold, C., Impagnatiello, F., Pisu, M. G., Uzunov, D. P., Costa, E., Guidotti, 32. Rice, D. S. & Curran, T. (1999) Gene Dev. 13, 2758–2773. A. & Caruncho, H. J. (1998) Proc. Natl. Acad. Sci. USA 95, 3221–3226. 33. Guidotti, A., Pesold, C. & Costa, E. (2000) Neurochem. Res. 25, 1207–1218.

3482 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.051614698 Liu et al. Downloaded by guest on September 26, 2021