Latent Developmental Potential to Form Limb-Like Structures in Fish Fins Revealed by Mutations in the Vav2/N-WASP Pathway

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citation Hawkins, Michael Brent. 2020. Latent Developmental Potential to Form Limb-Like Structures in Fish Fins Revealed by Mutations in the Vav2/N-WASP Pathway. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences.

Citable link https://nrs.harvard.edu/URN-3:HUL.INSTREPOS:37365806

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Latent Developmental Potential to Form Limb-Like Structures in Fish Fins Revealed by

Mutations in the Vav2/N-WASP Pathway

A dissertation presented

Michael Brent Hawkins

The Department of Organismic and Evolutionary Biology

in partial fulfillment of the requirements

for the degree of

Doctor of Philosophy

in the subject of

Biology

Harvard University

Cambridge, Massachusetts

March 2020

Dissertation Advisors: Matthew Harris, James Hanken Michael Brent Hawkins

Latent Developmental Potential to Form Limb-Like Structures in Fish Fins Revealed by

Mutations in the Vav2/N-WASP Pathway

Abstract

Despite descending from a common antecedent structure, fish fins and tetrapod limbs have evolved drastically divergent skeletal patterns. These changes have been instrumental to the success of vertebrate lineages both on land and in water. A key feature of limb evolution is the elaboration of the endoskeleton along the proximodistal axis. Teleost fins, on the other hand, have no such articulations in their diminutive endoskeleton.

I investigated the genetic basis of fin patterning using a forward genetic approach in the zebrafish (Danio rerio) and identified two mutants that develop novel long bones along the proximodistal axis of the pectoral fin. The new bones are well patterned, form joints, and connect with fin musculature. Formation of the new bones requires Hox11 paralogs. Loss of Hox13 paralogs results in an enhancement of the mutant phenotype, with additional new bones formed distally. These results suggest that the new bones are patterned with similar mechanisms used to specify the middle aspect of tetrapod limbs. Removal of Wasl, the mouse paralog of the affected gene in fish mutants, from limb mesenchyme results in a phenotype similar to Hoxa-11 mutants.

My data reveal that zebrafish have the developmental potential to form articulated fin endoskeletons using limb-like patterning cues. As this potential was likely present in the bony

iii fish ancestor, zebrafish retain this potential in a latent state, and it can be induced by a simple mutation.

Wasl was not known to have roles in patterning or skeletal development. By generating zebrafish mutants and mouse conditional mutants, I found that this gene is required for dermal and endochondral bone patterning in the axial and appendicular skeletons. The observed phenotypes are similar to Hox mutants, suggesting that Wasl interacts with Hox in skeletal patterning globally.

I then analyzed genetic regulation of fin development in a basally branching teleost relative, the bowfin (Amia calva), which retains ancestral proximodistal elaboration of the pectoral fin. Using RNAseq analysis, I identify developmental genetic features shared between fins and limbs, as well as Holostean-specific changes. These data act as a touchstone linking disparate appendages to identify common mechanisms and causes of morphological change.

iv Table of Contents

Page i Title Page

ii Copyright Page

iii Abstract

v Table of Contents

vi Acknowledgements

viii Dedication

1 Dissertation

1 Chapter 1

44 Chapter 2

72 Chapter 3

118 Chapter 4

136 Chapter 5

151 Appendix: Supplemental Material

152 Chapter 2 Supplemental Material

v Acknowledgements

This dissertation required a lot of work, which can be quantified in ways: hours in lab, number of animals genotyped, volume of formaldehyde used. But it also took a lot of luck, of which it is harder to take measure. Luck with resources, luck with genetic crosses, luck with mutations. But most of all it was my luck with coworkers and colleagues that was most important. Through their support, encouragement, and camaraderie, these people made my work possible, and I am extremely grateful for their help. It is my good fortune to have had the opportunity to work with and be trained by you. Thank you.

First, I must thank my co-advisor and director of the Museum of Comparative Zoology

James Hanken, who gave me a home base in Organismic and Evolutionary Biology at Harvard

University while also giving me the freedom to pursue projects across the river at Harvard

Medical School (HMS). He also gave me the great nickname “The Duke.”

This project would not have been possible without the tremendous resources created by other groups in the mouse and zebrafish communities. Other labs graciously shared lines that provided key insights into my study. Neil Shubin, Tetsuya Nakamura, and Andrew Gehrke of the

University of Chicago shared with me the Hox13 CRISPR mutant lines, and Marie-Andrée

Akimenko of the University of Ottawa shared the indispensable and beautiful Hox13 reporter lines. I am in debt to Matthew Warman at Boston Children's Hospital (BCH) Orthopedic

Research and HMS Genetics for enabling me to extend my dissertation research into mouse models. Joana Lopez trained me in many mouse techniques and saved me from feeling like a zebrafish out of water when working in the mouse house. I have also to thank Susan Mackem of

vi the National Institutes of Health, Olivier Pourquié and Jyoti Rao of HMS and Brigham and

Women’s Hospital, and Scott Snapper of BCH and HMS for their sharing of critical mouse lines.

The success of my bowfin work is due to the expertise and generosity of my collaborators. Emily Funk and Anne McCune at Cornell University hosted me and shared with me their expertise in collecting and rearing young bowfins. This project expanded to include

Andrew Thompson and Ingo Braasch at Michigan State University who made available their nascent genomic resources for Amia.

I am thankful for my fellow (at the time) graduate students, who discussed science and life with me and helped shaped my approach to my research. They include now-doctors Jacob

Daane, Seth Donoughe, Ezra Lencer, Rebecca Povilus, Kostadin Petrov, Zack Lewis, Elizabeth

Sefton, Kaitlin Samocha, Evan Kingsley, Thom Stewart, Peter Wilton, Mara Laslo, Kaitlyn

Webster, Ambika Kamath, Dan Rice, and Kara Feilich, as well as soon-to-be doctor Samantha

Royle. I also must include a special thank you to Maria Metzler, who suggested the mutant name rephaim. I am also thankful for the (at the time) postdoctoral fellows who guided me on my project decisions, Thom Sanger, Hillary Madden, Ricardo Mallarino, and Chunmei Li.

I owe many thanks to my co-advisor Matthew Harris of HMS Genetics and BCH

Orthopedic Research. Without his support this work would not have been possible. He gave me the tools, guidance, and latitude to investigate a wonderful piece of biology that I am proud to have played a role in exploring. I am fortunate to have been trained by Matt and lived and worked in the fun and collaborative lab he fostered.

Most of all, I must extend my thanks to Katrin Henke for sharing with me her beautiful mutants. That such amazing monsters could come out of a screen is a testament to the power of forward genetics and to Katrin's tenacity, organization, and painstaking work.

vii Dedication

This dissertation is dedicated to Alexander Cruz (1941-2018). Thank you for starting me on this wonderful path.

viii Chapter 1: Introduction

1 Chapter 1: Introduction

Animals comprise a vast and varied array of species with different shapes, sizes, physiologies, and behaviors. How was this diversity able to arise from a common ancestor? To address this question, scientists in the field of Evolutionary Developmental Biology (EDB) compare the process of development amongst different taxa to understand the commonalities and differences in the way organisms are formed. A central goal of EDB is to identify the mechanisms by which new body forms are produced in evolution. Beyond simply describing the details of development in various species, EDB seeks to identify unifying principles that underlie the generation of new structures and morphologies. Are there limits to the types of variation that development can produce? Can development potentiate or limit diversity? Does our understanding of developmental variation affect our ability to predict evolutionary change?

These are questions that EDB studies address using a range of approaches from descriptive comparative morphology to computational analysis of single-cell RNA sequencing. Together, these approaches can help us understand, at different evolutionary timescales and levels of biological organization, how the myriad forms of life arose on Earth.

In this dissertation, I demonstrate the ability of development to produce pronounced, complex changes to the body plan as a result of a simple, single base pair change to one gene.

Using vertebrate appendages as a study system, I find that simple mutations can induce dramatic morphological transformations that are coordinated across different tissues to produce integrated, adult viable phenotypes. The mutant phenotypes are reminiscent of natural transformations that took place in vertebrate evolution in the transition of fins into limbs. Given their nature, it is unlikely that the mutations themselves guide the formation of new bones directly. Rather, the

2 potential to produce extensive morphological change is latent within the developmental system, and mutations can induce the primed system to actualize this potential. My results, together with other recent findings in EDB, suggest that latent ancestral developmental potential may be an important mechanism for the emergence of morphological variation in evolution.

1.1. Development and root causes of phenotypic variation

Development is the process by which an individual organism transforms from a single cell into the complex adult body (Gilbert, 2006). It is during development that the body plan is established and the shape of an organism is determined. Thus, to understand how new body forms came to be in evolution, we must ask how the process of development has been changed to produce these forms (Raff, 1996). Development occurs over the entire lifespan of the individual, from fertilization, to early cell divisions, the formation of tissue layers, the movement and growth of primordia, morphogenesis, organogenesis, hatching, growth, sexual development, and senescence. Changes to the developmental process at any of these points can result in modifications to the body plan both large and small.

Certain periods of development are more flexible than others and are more likely to exhibit variation both within and between species. Early cell division and cell movements can occur through very different mechanisms even between closely related species, and later stages of development involve many lineage and species-specific developmental features (Gilbert,

2006; von Baer, 1828). However, at an intermediate point in embryogenesis, the so-called

‘phylotypic stage’ (Slack, 2003), different species belonging to the same phylum closely resemble one another. This observation gives rise to the ‘developmental hourglass’ model, wherein a wide range of possible morphologies early in ontogeny is narrowed by the phylotypic

3 stage, after which morphology can again diverge (Abzhanov, 2013; Irie and Kuratani, 2014).

One explanation for the phylotypic stage is that critical, conserved patterning mechanisms are deployed at this time, such as the Hox genes (Duboule, 1994).

Many factors, both internal and external to the individual, shape the process of development and its ultimate phenotypic outcome (Gilbert and Epel, 2009). Internal control of development is principally shaped by the genome, and development has been described as the process by which the genotype is interpreted to produce the phenotype. This genetic developmental programming interacts with the environment, which includes the epigenome and the trans-acting cellular environment, as well as the external natural environment. Depending on perturbations or environmental changes, one genome can be interpreted in different ways by development to produce different phenotypic outcomes, a phenomenon called developmental plasticity (Brakefield and Wijngaarden, 2003). The complete range of developmental outcomes that can be produced from a single genome is called the reaction norm (Schlichting and Pigliucci,

1998). In special cases, these plastic outcomes form discrete, categorically different body plans, such as the different castes of ants within a colony, a situation called polyphenism (Yang and

Pospisilik, 2019). Thus, a single genome is able to respond to a variety of environmental cues that effect phenotypic change even in the absence of any mutation or changes to the genome.

These plastic changes can be maintained reliably across generations if the environmental cue is constant. The environmental responsiveness of development can allow species to adapt to new or changing environments on short time scales while mutation and selection “catch up.”

While the environment can play important roles in the developmental process, the core of the process itself is governed by the programming in the genome (Carroll, Grenier, and

Weatherbee, 2006). Fish eggs develop into fish and frog eggs develop into frogs because of

4 differences in their DNA. For changes to development (and the resulting phenotype) to be long- term and robust, they must be heritable, and that means arising from changes in the DNA of the organism. Plasticity can change the phenotypic outcome in response to environmental change, but for such changes to remain even after the environmental cue is removed they must be preserved by mutation. While a selection regime is non-random, natural mutations occur randomly with respect to that regime, and variants that stabilize an advantageous phenotype may occur very slowly. When new mutations do arise, their effect on the phenotype is highly variable, as the effect of the mutation interacts with the rest of the genomic and cellular milieu. Over time, additional mutations may arise that buffer and modify the initial mutation and produce a more consistent phenotypic outcome. This process is referred to as canalization or genetic assimilation

(Waddington, 1942; Ehrenreich and Pfennig, 2016).

All animals share a common ancestor, and from this ancestor animals inherited not only their DNA but also the genetic instructions and developmental mechanisms that DNA encodes.

The same signaling pathways that pattern complex animals like lions and lobsters are also used in animals with simpler body plans like sponges and jellyfish (Nichols et al., 2006; Borisenko,

Podgornaya, and Ereskovsky, 2019). It is differential regulation of this set of common pathways that is able to produce such different life forms (Carroll, Grenier, and Weatherbee, 2006).

Understanding how changes in this regulation arise can help us understand how new and modified body plans are created. However, inheritance of this developmental toolkit does not only provide the ability to pattern a body, it also carries with it the constraints and limits of the toolkit.

A central theme in EDB is to investigate the relative importance of, and the interaction between, natural selection and developmental processes in the generation of morphology. Can

5 development produce any body configuration that selection favors, or do aspects of development and genetics limit what forms are possible? Historically, it was taken as given that development could produce whatever optimal phenotype was favored by selection, or put another way, that

“genetic variation is essentially a gas that can fill any selective phenotypic bottle (Hordijk and

Altenburg, 2019).” This view was grounded in ideas taken from population genetics and experimental evolution. In population genetics, models of variance were based on large numbers of genes each with a small effect on the phenotype, and early selection experiments suggested that the selected traits could evolve in a relatively small number of generations. However, developmental genetics has revealed that all genes are not equal in their effect on each phenotype. Instead, there are loci of large effect that control specific aspects of development.

Early selection experiments used phenotypes that were developmentally plastic in their response and were likely biased in using traits that could evolve rapidly and might not be representative of other aspects of the phenotype. Decades of work in EDB have made clear that development biases the type of morphological variation for selection to act upon.

Developmental constraint and loss in evolution

Historically, it was believed that features of development limit which phenotypes are possible and have a negative effect on the generation of variation (Maynard Smith et al., 1985).

The inborn limits inherent to the developmental system are called developmental constraints.

Constraint is the concept that development is unable to generate certain types of variation, even if that variation would have a selectable advantage. The biological basis of constraints is manifest at different levels, and may be based on physical constraint, genetic pleiotropy, genetic linkage, morphological modularity and integration, and contingency. Developmental constraints

6 limit the possible phenotypes that can arise in a lineage and prevent the evolution of optimal phenotypes.

Determining the existence of a developmental constraint is not always straightforward, and what is meant by ‘constraint’ may vary between investigators. If a certain type of variation is not observed in a wild population, is it because development cannot generate that variant or because selection has removed that variant from the population? Developmental constraint would be represented by the former but not the latter, but the distinction is not always clear. A helpful example is provided by variation in the number of cervical vertebrae in mammals. All mammals invariably have seven cervical vertebrae, with the exception of manatees and sloths.

Human variation in cervical vertebrae number is associated with embryonal cancers, both of which are associated with Hox genes. It has been proposed that this pleiotropic function of Hox genes is the basis for constraint on cervical vertebrae number (Galis, 1999). In this case, the developmental system is able to generate variable numbers of cervical vertebrae, but these variants are not compatible with life. Does this represent constraint on the developmental system, or selection against an unviable phenotype? Certainly sloths and manatees along with non- mammalian amniotes have found a way to vary cervical vertebrae number. This situation might represent a phylogenetically local constraint on development, but not an absolute constraint.

One of the most severe forms of developmental constraint is thought to be the loss of features in evolution. In other words, once structures and organs are lost in a lineage, it is nearly impossible for these features to reemerge in that lineage again, even if those features would be advantageous. Early thinking about the irreversible nature of loss was based on observations of patterns in vertebrate paleontology and on philosophical ideals about regression and decay in organic evolution (Dollo, 1893). More recent thinking about loss is informed by our knowledge

7 of developmental genetics and genetic drift. Gene regulatory networks (GRNs) guide the patterning of the body, and if certain tissues and organs do not provide a selectable advantage, the GRNs that pattern them may accumulate mutations, either by drift or negative selection, that break the network (Muller, 1939; Marshall et al., 1994; Zufall and Rauscher, 2004). Without the functional GRN the cognate organ cannot be made, and without selection to maintain the GRN it will continue to accumulate mutations. As the GRN drifts further into disrepair, it is increasingly unlikely that restorative mutations could resurrect the GRN and create the same organ anew. Due to the pleiotropic nature of developmental control genes, the core of GRNs are likely to be preserved, and the more peripheral and organ-specific components of the network are likely to be lost. In the case of tissue-specific structural genes and terminal differentiation markers, the genes themselves may be lost entirely (International Chicken Genome Sequencing Consortium, 2004).

One of the earliest and easily the most well-known conception of loss in evolution was advanced by Belgian paleontologist Louis Dollo in his “Law of Irreversibility.” In this law,

Dollo states that “an organism never returns exactly to a former state, even if it finds itself placed in conditions of existence identical to those in which it has previously lived (Dollo, 1893, translated in Gould, 1970).” Working some years after Dollo, British botanist Agnes Arber independently proposed her “Law of Loss” which states that “a structure or organ once lost in the course of phylogeny can never be regained; if the organism subsequently has occasion to replace it, it cannot be reproduced, but must be constructed afresh in some different mode

(Arber, 1918).” Arber was a pronounced skeptic of atavisms and reversions: rather than accept such examples as a true return to an ancestral condition, she considered them merely as numerical variation in a trait (Arber, 1919).

8 Although Dollo has received considerably more attention over the years, Arber’s conception of loss in evolution perhaps provides more utility in contemporary EDB thought.

Using the Law of Loss as a framework, we would expect re-evolved characters to utilize different cell types, tissue layers, or GRNs than those in the ancestral organ. Such regained organs grown using divergent developmental mechanisms would represent clear evolutionary convergence with the ancestral organ, and not a true reversion. A stunning example of reemergence is found in the tooth-like structures of the minnow Danionella dracula. Oral teeth were lost in the common ancestor of cypriniform fishes some 50 million years ago, and all 3700 extant members of this group retain teeth only in the pharyngeal region (Fink and Fink, 1981;

Nelson, 2006). Surprisingly, tooth-like structures have reappeared on the oral jaws of one member of this group, D. dracula (Britz, Conway, and Rüber, 2009). However, the new tooth- like structures are not teeth at all but instead simple projections of the underlying dentary and premaxillary bones, which lack specialized tooth cell types and mineralized matrices. Thus, tooth-like structures on the jaws have been regained in D. dracula, not by developing oral teeth, but by dramatically modifying the skeleton to recreate novel tooth-like projections. Especially intriguing about this case is that the species still retains true teeth on the pharyngeal jaws. While examination of the GRNs that underlie the novel projections has yet to be performed, it is likely that they will be different from the tooth GRN, given the differences in structure and origin of these organs.

In the time since Dollo and Arber, many violations of the Law of Loss have been described. Examples of the reemergence of once-lost structures include digits in lizards

(Kohlsdorf and Wagner, 2007), egg laying in boas (Lynch and Wagner, 2010), wings in stick insects (Whiting et al., 2003), mandibular teeth in frogs (Weins, 2011), molar teeth in felids

9 (Kurtén, 1963), and rotating sex combs in fruit flies (Seher et al., 2012). When traits seem to reemerge in evolution, their description and identity are often contentious (Galis et al., 2010). Is the re-evolved trait merely an example of meristic variation? Is the trait a true atavistic recapitulation of the lost feature, or is the trait a novel construction that merely resembles the original feature? While there might not be explicit answers to these questions, they still provide a framework for productive investigations. Deciding what level of similarity between the re- evolved feature and the original feature is sufficient to declare the feature an atavism, highlights important topics about evolution and development. Are the features composed of the same tissues, come from the same cellular lineage, or utilize the same GRNs? What if the cells come from different sources, but the same GRNs are redeployed in the new context? Maybe the ‘lost’ feature was maintained as a vestige or developmental rudiment and was expanded. It is possible that when a specific tissue or organ is lost, its patterning GRN is still used in other parts of the body, such that it is maintained by selection and able to be redeployed in the future.

Developmental bias and latent ancestral developmental potential

Recent thinking about the role of the developmental system in generating variation is more focused on the positive aspects of development that facilitate the generation of variation.

Authors have highlighted developmental features that enable tinkering in the developmental system. These variation-promoting features have been described using different terms by different authors, such as developmental drive (Arthur, 2001), flexible stem (Wund et al., 2008), facilitated variation (Gerhart and Kirschner, 2007), and ancestral developmental potential

(Rajakumar et al., 2012). While these concepts are similar in advocating a positive role for development in the generation of new forms, they are distinct in the particular mechanisms they

10 emphasize and the level of evolution to which they are applied. For example, in their theory of facilitated variation, Gerhart and Kirschner advocated that many features of metazoan development promote the generation of new phenotypes across animal life, such as weak regulatory linkage, exploratory behavior, compartmentation and modularity, adaptability, and robustness (Gerhart and Kirschner, 2007). These features are common across all multicellular life and can help explain the emergence of the dramatically different body plans observed within and between phyla. On the other hand, the flexible stem hypothesis focuses on ancestral plasticity in founding species that give rise to adaptive radiations (Wund et al., 2008). Such ancestral potential is particular to the lineage in which the radiation is taking place and might not be generalizable to other lineages.

Contemporary thinkers have sought to bring together both the variation-limiting and the diversity-promoting features of development together with the concept of developmental bias

(Arthur, 2002; Brigandt et al., 2020; Parsons et al., 2020; Moczek, 2020). While the concept of developmental constraint focuses on the prohibitive role of development on limiting phenotypic variation, developmental bias acknowledges this role while also recognizing that developmental features can facilitate the generation of variation. As a counterpoint to developmental constraint, these variation-facilitating features are referred to as ‘developmental drive’ (Arthur, 2001). The balance between drive and constraint determines which phenotypes a developmental system is likely to produce given genetic and/or environmental change. A pronounced example of developmental drive is latent ancestral developmental potential. In latent potential, the developmental system of a lineage is predisposed to respond to genetic or environmental signals/perturbations to generate coordinated, complex phenotypic changes, even in lineages that have not previously expressed the phenotype (Rajakumar, 2012).

11 A dramatic example of latent ancestral developmental potential is provided by Pheidole ants. In addition to a minor worker caste and soldier caste, two species in this genus are known to naturally produce a specialized caste of ‘supersoldiers’ (Rajakumar, 2012). Interestingly, these two supersoldier-making species are not sister taxa and are phylogenetically well separated by several non-supersoldier species. Rajakumar and colleagues found that they could artificially induce non-supersoldier species to make supersoldiers when exposed to exogenous Juvenile

Hormone (JH) during development (Figure 1.1). Based on phylogenetic analysis, the authors concluded that the ability to naturally form supersoldiers arose in the Pheidole ancestor, but that expression of this phenotype was subsequently suppressed. However, the ability to create supersoldiers was preserved in the clade, and this potential could be realized upon exposure to the JH signal.

Latent ancestral potential may also be incomplete in its ability to produce a complex phenotype. An example of partial developmental potential is found in the tooth-forming ability of birds. Class Aves lost true teeth ~75 million years ago, and the oral jaws of birds have been converted into beaks covered by the horny ramphotheca (Harris et al., 2006). Genomic analysis has revealed that extant birds are missing many of the structural genes required to make the dentin and enamel tooth layers (International Chicken Genome Sequencing Consortium et al.,

2004). The transformation of the jaws and loss of tooth genes would appear to represent strong constraints preventing the development of teeth in birds. Shockingly, however, chickens carrying the talpid2 mutation form tooth-like projections on the oral jaws (Harris et al., 2006). Analysis of these mutants revealed that the projections are patterned using the same mechanisms used to develop teeth, and induction of the tooth-like projections utilizes epithelial-mesenchymal interactions characteristic of true teeth. In the instance of bird teeth it is particularly surprising

Figure 1.1. Examples of morphological change produced by latent ancestral developmental potential. (A) In Pheidole ants, increased levels of juvenile hormone (JH) induce the formation of the super soldier caste. (B) In chickens, the talpid2 mutation induces tooth development programs on the oral jaw. (C) In zebrafish, heterotopic expression of ectodysplasin (eda) induces the formation of upper pharyngeal teeth.

that the tooth-forming ability was retained even without the action of selection to preserve the developmental program. One possibility is that the core tooth program shares common pathways with feathers and scales, which are retained in modern birds. Thus, these core processes would

13 be preserved and remain inducible, while tooth-specific features, such as dentin and enamel genes, were irreversibly lost.

In the two preceding examples, latent ancestral developmental potential preserved the ability to express a phenotype many generations after its complete loss from the organism. Latent ancestral developmental potential may also operate when a structure is lost from only a region of the body, or if the structure is still present in a much-reduced rudimentary or vestigial form. For an example of the former, we once again return to minnow teeth. The ancestral condition for teleost fishes was to express teeth on the oral jaws and throughout the mouth and pharyngeal regions (Stock, 2007). Lineages have reduced their dentition and lost teeth from various bones and regions. In Cypriniformes, the group containing carps, minnows, and the model zebrafish

Danio rerio, the oral teeth have been lost completely and most species only retain teeth on the fifth ceratobranchial bone. The fifth ceratobranchial is positioned ventrally and opposes a keratinized chewing pad on the roof of the pharynx. Even in cypriniform species where more teeth would appear advantageous, such as the piscivorous pike minnow, teeth have not returned to the oral jaws or dorsal pharynx. It would seem that the reemergence of teeth in these areas is prevented by developmental constraint. Surprisingly, experiments demonstrate that ectopic expression of a single gene, ectodysplasin (eda), in the zebrafish is sufficient to produce fully formed true teeth on the dorsal pharynx (Aigler, 2014). Wild type zebrafish express eda only in the ventral pharyngeal epithelium, while species that retain upper pharyngeal teeth express eda both dorsally and ventrally. Thus, by modifying the expression domain of a single signaling ligand to match the ancestral condition, the tooth developmental program could be redeployed in positions that have not formed teeth in over 50 million years. In this case, the tooth

14 developmental program was preserved as pharyngeal teeth were retained and expressed in the lineage and could be redeployed once an inducing signal was received in other regions.

Heterotopy is the expression of a gene in an abnormal place or time. As the previous example shows, heterotopy might provide a basis for latent ancestral developmental potential if the region retains its competence to respond to the signal. Here, the upper pharyngeal region retained its ability to respond to the eda signal. However, this is not always the case. While the transgenic zebrafish were able to make upper pharyngeal teeth, they failed to produce teeth in other regions that were tooth-bearing in the teleost ancestor, such as the oral jaws. The latent ancestral developmental potential to form teeth was thus preserved in the pharynx but not in the oral jaws.

Each of these examples of latent ancestral developmental potential involves the addition of a single factor to produce dramatic changes in the body plan, resurrecting structures not expressed for tens of millions of years. Individuals realizing such potential in the wild would represent abrupt changes in the phenotype and might rightly be considered ‘hopeful monsters’ sensu Goldschmidt (1940). Of course, such changes do not occur in a vacuum, but happen against a background of the standing genetic variation of the population. Different genetic backgrounds might modulate large-effect ‘hopeful’ mutations, and over time canalization could integrate these large changes into the developmental program.

1.2. Looking to the evolution of the paired appendages

Articulating skeletal structures of vertebrate paired appendages

The paired appendages of vertebrates are the fore- and hind limbs of tetrapods and the pectoral and pelvic fins of fishes. Paired appendages have been a pivotal study system in

15 biology, which has provided central ideas and insights into evolution, homology, development, biomechanics, and paleontology. The depth of our understanding of the developmental and evolutionary transitions underlying limb formation provides an important study system to ask about the developmental genetic basis of morphological variation (Shubin et al., 1997). Fins and limbs have been shaped through evolution into manifold and diverse forms that permit many types of movement and function. In tetrapods, this variation is based on modification to a basic ground plan that was established in early tetrapod ancestors, the ‘tripartite limb.’ The tripartite limb consists of three regions separated along the proximal distal axis of the appendage, beginning at the shoulder with the stylopod (upper arm, containing the humerus), followed distally by the zeugopod (forearm, containing the radius and ulna), and ending with the autopod

(the wrist and hand). While early tetrapods exhibited a range in digit number, refinement and canalization of the limb program led digit number to stabilize at five, and this pentadactyl limb has served as the template for extant tetrapod diversity (Coates and Clack, 1990). This basic structure can readily be observed across tetrapods, and this unity of form serves as one of the classic examples of homology as articulated by Richard Owen (1849). From this basic structure, tetrapod limbs have evolved into flying wings, swimming flippers, jumping legs, claws for digging, and hands capable of fine tool manipulation. These different forms arose variously through the loss of digits, the addition of new phalanges, fusions of once-independent bony elements, the transformation of wrist and ankle bones into long bones, and the outright loss of appendages altogether.

The origin of the paired appendages has been a central topic in EDB studies, with competing hypotheses both historical and contemporary, and many open questions. To summarize briefly, the ancestral condition for extant jawed vertebrates is to have two pairs of

16 paired appendages. That is, the ancestor of extant gnathostomes had a pair of pectoral fins and a pair of pelvic fins (Coates, 1994). Outside of this clade, the extant jawless vertebrates, the hagfish and lampreys, lack paired appendages and possess only midline fins. Various extinct groups of vertebrates are known from fossil forms, and their placement on the vertebrate tree varies between authors. These extinct groups bear various projections from the body wall that may or may not represent structures homologous to the paired appendages (Coates, 2003).

Depending on the placement of these extinct taxa, scenarios of fin loss or gain in subsequent lineages vary greatly: jawless fishes could have lost paired appendages or have diverged from other vertebrates before paired fins evolved.

One mechanistic hypothesis for the origin of paired appendages is that the fin developmental program first arose in the midline fins and that these programs were co-opted and redeployed to form the paired fins. Recent studies have found many similarities in the gene expression patterns between paired and median fins, and the same enhancers are required for their development (Freitas et al., 2006; Dahn et al., 2007; Letelier et al., 2018). Another hypothesis is that the paired appendages evolved from gill arch structures, as advocated by

Gegenbaur in his archepterygium model (Gegenbaur, 1878). Studies using modern molecular and developmental techniques have also supported similarities in the development of the gill arch skeleton and the pectoral fin (Gillis et al., 2009; Gillis and Hall, 2016). Finally, the lateral fin-fold hypothesis held that a continuous fin-fold, similar to the median fin-fold of larval fishes and amphibians, ran along the flanks of the body, and over time this fin-fold was separated into pectoral and pelvic appendage pairs (Wiedersheim and Parker, 1907; Tabin and Laufer, 1996).

17 Fin to limb transition as a model to address how development shapes evolution of key traits

The transition from fins in the bony fish common ancestor to limbs of tetrapods involved significant changes to the appendage endoskeleton (Tanaka, 2018). The common ancestor of bony fishes had a fin endoskeleton with three distinct regions across the anterior-posterior axis, consisting of the anterior propterygium, the middle mesopterygium, and the posterior metapterygium (Gegenbaur 1878; Zhu and Yu, 2009). While the propterygium is a single element, the mesopterygium can consist of one or several elements arranged side by side. The propterygium and mesopterygium consist of simple elements that do not segment along the proximal-distal axis. However, the metapterygium makes a single articulation with the shoulder girdle at its proximal base but forms additional elements that articulate distally (Jessen, 1972).

This general plan is seen in extant basally branching actinopterygian fishes as well as in stem sarcopterygian species, and is considered the plesiomorphic condition for gnathostomes

(Onimaru et al., 2015). However, in the fin-to-limb transition the two anterior regions of the fin, the propterygium and mesopterygium, were lost (Coates, 2003). The remaining region, the posterior metapterygium, was retained, elaborated, and refined to produce the large endoskeleton of the fleshy fin, with many elements articulating along the proximal-distal axis. In some lineages, such as lungfishes, the elements of the endoskeleton are not differentiated along the proximal-distal axis and are similar in morphology along the length of the fin (Jude et al., 2014).

However, in the lineage leading to tetrapods, the metapterygial endoskeleton was regionalized along the proximal-distal axis, ultimately producing the modern tetrapod limb (Cohn et al.,

2002).

The fin-to-fin transition that occurred from the bony fish ancestor to extant teleosts followed a pattern that is the near perfect inverse of the fin-to-limb transition. In the teleost

18 lineage, the posterior branched metapterygium was lost, and the ancestral teleost pectoral fin endoskeleton consisted of a reduced propterygium element followed by four proximal radial long bones of the mesopterygium arranged side by side along the anterior-posterior axis, with a row of small nodular distal radials in between the proximal radials and the fin ray exoskeleton

(Patterson, 1977; de Pinna, 1996; Arratia, 1999). This limited configuration is retained in most teleost lineages across a wide range of locomotor modes (Starks, 1930). The propterygium is often closely associated with the first fin ray, and sometimes is encased within the base of the first fin ray. In many cases, the reduced size of the propterygium causes the first fin ray to have close association with the shoulder girdle, in some cases articulating with the shoulder girdle directly. In this condition, the proximal radials increase in length from anterior to posterior.

While teleosts do not have any element that represents a metapterygium in morphological terms, they do have a most-posterior element in the fin endoskeleton. Whether the metapterygium was truly lost or if it was just dramatically simplified remains an open question (Coates, 1995; Laurin et al., 2000).

In contrast to the diverse limb skeletons observed across tetrapods, teleosts have an almost invariant pectoral fin endoskeleton. Most species exhibit the ancestral endoskeleton configuration. When there is variation in the teleost pectoral fin bauplan, it most frequently involves changes in the number of proximal radials along the anterior-posterior axis. For example, reduction in proximal radial number is seen in siluriform fishes and goosefishes

(Arratia, 1999). Anguilids such as the American eel have between 7 and 12 proximal radials along the anterior-posterior axis (Derjugin, 1910; Da Silva and Johnson, 2018). A similar expansion in proximal radial number is also seen independently in macrourids (Balushkin and

Prirodina, 2010). In some cases, the apparent increase in the number of proximal radials may

19 arise from expansion of the propterygium into a long bone. Midshipman pectoral fins have five elongated radial elements and a first fin ray that does not have a close association with the shoulder girdle (Starks, 1930). It is possible in this case that the propterygium has been transformed into a proximal radial.

The most dramatic reshaping of the teleost pectoral fin is seen in lophiiform fishes such as the goosefish and its relatives. These fishes have large, fleshy fins they use to walk along the substrate. In this configuration, the propterygium is absent and the proximal radials are dramatically expanded distally. The fin rays articulate with expanded distal ends of the proximal radials (Derjugin, 1910). However, even in this case with an expanded endoskeleton, only a single long bone element lies along the proximal-distal axis of the fin. No joints or segmentation are observed in the elongated radials. The remarkably constant pectoral fin pattern found across

~30,000 species of teleosts representing many different modes of locomotion suggests the existence of a developmental constraint that prevents teleosts from producing proximal-distal elaborations.

While the final structures of fins and limbs look very different, their initial stages of development are similar. Both fins and limbs first appear as a bud on the flank. The buds consist of lateral plate mesoderm encased in epithelium from ectoderm (Mercader, 2007). Signaling between the ectoderm and mesenchyme drives proliferation and outgrowth of the appendage buds (Gilbert, 2006). A special region of the ectoderm, the apical ectodermal ridge (AER), lies at the distal end of the bud and is an important signaling center (Saunders, 1948; Wood, 1982). In limb development, the AER is present throughout limb bud outgrowth but does not contribute to the adult skeleton, while the endoskeleton forms from condensations in the limb mesenchyme. In contrast, at a point in fin development the AER transforms into a flattened and expanded

20 structure called the apical ectodermal fold (AEF; Grandel and Schulte-Merker, 1998). The region of the AEF, including invading migratory mesenchymal cells, will give rise to the dermal portion of the adult fin skeleton, while the proximal mesenchyme will form the endoskeleton. In the limb, the skeletal elements arise from initially continuous prechondrogenic condensations that then segment to form individual elements separated by synovial joints (Decker et al., 2014).

After segmentation, mineralization begins and forms the bone collar along the limb long bones.

This is very different from fins, where the endoskeleton mesenchyme first forms as a single chondrified plate that persists for several weeks (Dewit et al., 2011). Later in development this cartilage plate separates into the four proximal radials, which then mineralize and form bone collars. This mode of development is seen across teleosts (Derjugin, 1910).

Despite their contrasting morphologies, fins and limbs share many patterning mechanisms and GRNs. These include common organizers, the AER mentioned above and the zone of polarizing activity (ZPA), which express common signaling ligands such as fgfs (AER) and shh (ZPA), which form a positive feedback loop that drives outgrowth (Krauss et al., 1993;

Riddle et al., 1993; Niswander et al., 1994; Neumann et al., 1999). In both fins and limbs, shh expression in the ZPA is inducible by retinoic acid treatment, and shh expression in the ZPA is driven by the same cis-regulatory regions (Riddle et al., 1993; Akimenko and Ekker, 1995;

Letelier et al., 2018). Other GRNs, including Wnt signaling, Meis-Cyp26b1 antagonism, Tbx field selector genes, and Sall and Sp transcription factors amongst others, also play common roles in fins and limbs (Mercader et al., 2007). Given that the core developmental machinery is responsible for the formation of fin and limbs, it is paradoxical that fins and limbs end up with such divergent morphology. However, one group of appendage patterning genes has emerged as a candidate cause of this variation: the Hox genes.

21 1.3. Hox genes in appendage patterning

Over the last 40 years, developmental genetics has identified many key mechanisms that pattern and specify the limb skeleton along the proximal-distal, anterior-posterior, and dorsal- ventral axes. Multiple pathways interact to pattern the developing limb across each axis by driving proliferation, migration, differentiation, and apoptosis. Hox genes are of particular importance in the patterning of the anterior-posterior and proximal-distal axes of appendages.

Members of the Hox family are defined as genes that (1) contain a particular DNA binding motif called the homeodomain, and (2) cause homeotic transformations when mutated.

Homeosis, or homeotic transformation, is a phenomenon in which one part of the body is transformed to resemble the identity of another (Bateson, 1894). When mutated, Hox genes cause dramatic changes to the body plan along the anterior-posterior axis. The founding mutant identifying this general nature of Hox genes was a spontaneous mutation in the fruit fly called bithorax, in which the posterior thorax was transformed into a second winged segment (Bridges and Morgan, 1923). Hox genes are arranged in a linear cluster along the chromosome, and their position along the 3’-to-5’ axis corresponds in registration to their expression boundaries along the anterior-posterior axis, such that the 3’-most member of the cluster is expressed in the anterior-most domain, and the 5’ member is expressed in the most posteriorly-restricted domain

(Lewis, 1978). This arrangement is called spatial colinearity. Such spatial colinearity is observed in the primary body axis of many bilaterian animals, including mammals and fishes, as well as in non-bilaterians such as anemones (Duboule and Dollé, 1989, Graham et al., 1989; Duboule,

2007; He et al., 2018). Hox cluster expression also exhibits temporal colinearity, whereby the more 3’ members of the cluster are expressed earlier in a structure than are the 5’ members

(Duboule, 1992; Durston, 2019). However, spatial and temporal Hox colinearity is not universal

22 across animals, and some groups have lost chromosomal linearity and cognate spatial colinear expression patterns (Schiemann et al., 2017).

Hox genes impart positional identity to regions of the body and can do so either individually or in combinatorial fashion (Lewis, 1978; Kessel and Gruss, 1991). Loss-of-function mutation and heterotopic expression of fruit fly and vertebrate Hox genes result in homeotic transformations in the primary body axis, causing segments to take on the morphological identity of other segments (Bridges and Morgan, 1923; Lewis, 1978; Mallo et al., 2010). The effects of these mutations reveal the general rule of posterior prevalence, whereby the posterior-most Hox gene that is expressed in a segment determines segment identity and morphology. For instance, the loss of Hoxa-11 in the mouse results in the transformation of rib-less lumbar vertebrate into rib-bearing thoracic vertebrae (Small and Potter, 1993). However, there are exceptions to the posterior prevalence rule (Durston, 2012).

Vertebrate appendages exhibit colinear Hox gene expression generally, but with particular exceptions. The 3’ members of the HoxA and HoxD clusters are expressed in proximal regions of fins and limbs, while more posterior members are restricted distally (Hérault et al.,

1999; Ahn and Ho, 2008). However, in contrast to the primary axis, limbs also exhibit reverse colinearity during the specification of the autopod, where the 5’-most HoxD gene is expressed in the broadest domain along the anterior-posterior axis and the more proximal Hox genes are restricted posteriorly (Nelson et al., 1996). Unlike the primary body axis, Hox genes do not strictly define element identity in the limb. Rather, it appears that the Hox genes in the limb provide a molecular address for different regions of the appendage based on colinearity and promote long bone growth and morphology. For example, formation of the most distal region of the limb, the autopod, requires activity of Hoxa-13 and Hoxd-13 (Fromental-Ramain et al.,

23 1996). When these genes are lost, the autopod fails to form. Similarly, Hoxa-11 and Hoxd-11 are required for normal development of the zeugopod (Davis et al., 1995). In Hoxa-11/Hoxd-11 double knock-out mice, the elements of the forearm, the radius and ulna, remain as small condensations of cartilage that lose their long bone morphology and fail to grow longitudinally.

However, none of these mutations causes one region of the appendage to be transformed into another identity like the homeotic transformations seen in the axial skeleton of Hox mutants.

The preponderance of functional genetic data on Hox gene function in appendages comes primarily from studies in chicken and mouse. However, advances in CRISPR-based genome editing have permitted functional analysis of Hox gene function in the zebrafish. Work by

Nakamura and colleagues demonstrated the first of these results by knocking out the Hox13 paralogs of the HoxAa, HoxAb, and HoxDa clusters (2016). Compound mutants of these paralogs failed to properly develop the fin rays, the distal-most structures in the fin. This result, that the dermal exoskeleton was also patterned by the distal Hox code, was very unexpected.

Direct historical homology between the digits of tetrapods and fin rays of fishes has been treated as dubious. However, these experiments demonstrate that the appendage patterning mechanism is common between fins and limbs and was present in the common ancestor of bony fishes, and that the distal-most region of fins and limbs share developmental homology.

1.4. Developmental genetic hypotheses regarding the fin-to-limb transition

Many authors have proposed developmental and genetic hypotheses about the mechanisms that underlie the fin-to-limb transition and the potential for teleosts to elaborate the fin endoskeleton.

24 Clock model of the fin fold

An early and highly influential hypothesis is the so-called ‘clock model’ proposed by

Peter Thorogood (1991). In this model, Thorogood proposed that the level of endoskeleton elaboration achieved in a fin or limb depended on how long the appendage bud maintained the

AER before this structure transformed into the AEF. The AEF gives rise to the exoskeletal dermal fin rays, while the subtending bud mesenchyme becomes the endoskeleton. Tetrapod limb buds possess an AER throughout limb bud outgrowth and patterning, and the resulting limb endoskeleton is highly elaborated. The AER never transforms into an AEF and there is no exoskeleton. At the other extreme, teleost fin buds bear an AER for only a portion of appendage outgrowth before the AER transforms into an AEF, and the final endoskeleton is very simple while the fin ray exoskeleton is greatly expanded. This model posits a hard developmental trade- off between endoskeleton formation and fin ray formation. Fishes with intermediate elaboration of the fin skeleton would be predicted to have an AER for a longer duration than teleosts but a shorter duration than tetrapods.

The clock model is prevalent in the literature and is used to interpret the findings of many studies (Sordino et al., 1995; Freitas et al., 2007; Yano et al., 2012; Masselink et al., 2016).

However, the clock model is not without its faults. While the overall trend between AEF formation and endoskeletal elaboration seems to hold true in broad comparisons between teleosts and tetrapods, it has only been experimentally tested in one study in zebrafish. Yano and colleagues found that after removal of the AEF, the distal fin passes through an AER-like stage while regenerating in which fgf10a and fgf24 are re-expressed (Yano et al., 2012). By performing recurrent resections of the distal embryonic fin, the authors caused perdurance of the AER, and found that this treatment resulted in a larger endoskeletal disc. When the manipulated animals

25 were raised to adulthood, they were found to have a modified fin skeleton in which proximal radial 4 was missing and proximal radials 2 and 3 were elongated. However, the elongated radials do not separate into discrete elements, and the overall morphology of the endoskeleton is difficult to interpret as the elements are dysmorphic.

Other studies have focused on the role structural proteins that comprise the larval fin fold have played in the fin-to-limb transition. This fin fold arises from the AEF and provides the template upon which bony lepidotrichia, the fin rays, will form (Wood, 1982). The larval fin fold is supported by elastinoidin fibrils called actinotrichia (Ferguson, 1912). These actinotrichia are composed of extracellular collagens (principally col1a1a and col2a1b in zebrafish), and actinodin proteins (Zhang et al., 2010; Durán et al., 2011). While Collagen I and Collagen II are found in both fishes and tetrapods, actinodin (and) paralogs are found in cartilaginous, ray- finned, and lobe-finned fishes but have been lost in tetrapods coincident with the loss of the fin fold and the appearance of limbs. To examine the consequences of fin fold loss on the patterning of the zebrafish fin, Zhang and colleagues used morpholino knock down to perturb the function of and1 and and2 (Zhang, 2010). Morphant animals were found to have reduced fin folds and exhibited changes in the expression of patterning genes, notably an anterior expansion of hoxd13a, suggesting that loss of and genes in evolution could have had effects on fin/limb patterning. Contrary to predictions based on the Thorogood clock model, the endoskeletal disc in morphants was delayed in its formation and reduced in size. Unfortunately, the effect on adult morphology could not be assessed as the morphant animals are not viable; thus, it remains unclear what effect these teleost-specific structural components have on skeletal pattern.

While many studies place their findings in the context of the clock model, the timing of

AER to AEF transition has not been rigorously examined in fishes with intermediate elaboration,

26 such as bowfins, sturgeons, and paddlefish. Moreover, the model does not account for teleosts which have pectoral fins that simultaneously possess large, fleshy endoskeletons and well- developed fin rays, such as midshipman fishes and goosefishes. Nor does the model account for extinct and extant sarcopterygians that possess highly elaborated endoskeletons along with an extensive fin ray exoskeleton (Stewart et al., 2019).

Hox gene regulation as key regulation underlying endoskeletal elaboration

Another set of hypotheses has focused on the differences in Hox gene regulation between fins and limbs. Sordino and colleagues first characterized the expression of posterior 5’ HoxA and HoxD genes in the zebrafish and noted key differences from limb bud patterning (Sordino et al., 1995). While in later stages of limb development Hoxa-11 expression is restricted from the distal autopodial plate in mouse limbs, hoxa11b was expressed throughout the middle and distal regions of the fin bud. Follow-up studies revealed this hoxa11b expression domain to overlap extensively with the hoxa13b domain (Sordino et al., 1996; Ahn and Ho, 2008), while in limbs

Hoxa-13 is restricted to the autopod, thus making mutually exclusive Hoxa-11 and Hoxa-13 limb domains (Haack and Gruss, 1993). The overlap between hoxa11 and hoxa13 expression domains seems to be a general feature of fins and has been observed in basally branching ray-finned fishes (Metscher et al., 2005; Davis et al., 2007) and cartilaginous fishes (Sakamoto et al., 2009;

Onimaru et al., 2015). Additionally, teleost fin buds do not exhibit the anterior expansion and reverse colinearity of posterior HoxD gene expression seen in developing limbs (Sordino et al.,

1995). However, this feature of HoxD expression has been found in non-teleost fishes with more elaborated pectoral fins that retain the metapterygium (Davis et al., 2007; Freitas et al., 2007).

27 Noting the less pronounced (or absent) reverse colinear phase of expression of 5’ Hoxd genes in teleost fins relative to tetrapod limbs, Freitas and colleagues hypothesized that increasing hoxd13a expression in the developing zebrafish fin could elaborate the fin endoskeleton in a limb-like manner (Freitas et al., 2012). These authors created various hoxd13a overexpression constructs and injected them into zebrafish embryos at the one-cell stage.

Embryos injected with the hoxd13a overexpression constructs were found to express chondrogenic markers in a wider domain and develop a larger endoskeletal disc while reducing the size of the fin fold. However, the effect of increased disc size on adult morphology could not be assessed due to lethality in the injected animals at early larval stages. Revisiting this approach with stable transgenic lines and more precise transgene control using recently identified enhancers could yield interesting adult-viable phenotypes.

1.5. Lessons learned from genetic mutant analysis in fishes

One way to probe the developmental potential latent in a species is using genetic screens.

Genetic screens allow investigators to discover what phenotypic changes are accessible to a species with one or several mutational steps from a wild-type genome. While genetic screens are a powerful approach to elucidate gene function and the phenotypic consequence of mutation, they are only feasible in a limited number of model species that are amenable to the experimental requirements, such as growth in captivity and large clutch sizes. This limits the types of characters and variation that can be assessed by a screen in a given species. Therefore, the failure to produce a particular phenotype does not prove the existence of a developmental constraint, as no screen will ever test every possible mutational step available to the genome. However, genetic

28 screens are able to show us some of the phenotypes available to wild-type genomes after one or several mutational steps allowing for clear association of genotype to phenotype.

In a forward genetic screen, individuals are assessed for a phenotype of interest, and after an interesting mutant is isolated the underlying causative mutation is identified. The earliest genetic screens used spontaneous mutations that appeared naturally in breeding populations

(Bridges and Morgan, 1923). To increase the rate of mutagenesis, modern forward screens use various mutagenic agents that have different effects on the genome (Nüsslein-Volhard and

Wieschaus, 1980; Patton and Zon, 2001). Chemical mutagens such as EMS and ENU produce small insertions and deletions, as well as single base-pair transversions. Mutations caused by these agents are likely to disrupt the coding regions of genes by creating either nonsense mutations that truncate the gene product or missense mutations that change the identity of amino acids at certain positions. Viral-based mutagenesis leverages the mutagenic action of insertion of viruses into the genome. The insertion of viral DNA can disrupt coding regions or separate coding regions from their regulatory neighborhood. Radiation mutagens such as X-rays cause double-stranded DNA breaks that result in large deletions, inversions, and translocations.

Radiation can delete genes, create gene fusions, and disrupt the regulation of a gene. Depending on the specific lesion, these mutagens can result in loss-of-function and gain-of-function alleles.

Whole-genome and whole-exome sequencing permits rapid mapping of the causative mutation underlying a mutant phenotype (Bowen et al., 2012; Henke et al., 2017). In reverse genetic screens, known gene targets are screened to see if they have a role in a phenotype of interest.

Reverse genetic screens are only possible in species where genetic tools are available to modify gene function. The advent of experimentally tractable genome editing tools have bolstered such reverse genetic approaches.

29 While both forward and reverse genetic screens can be used to assess latent ancestral developmental potential, the unbiased nature of forward screens, and in particular chemical mutagenesis screens, may make them advantageous over reverse approaches for discovery. Our understanding of latent ancestral developmental potential is in its infancy. It is not obvious what we expect the genetic basis of this potential to look like or what types of genetic changes will reveal latent potential. While high-throughput reverse genetic screens that target every locus are possible in cell culture, such screens are not feasible in an in vivo context. Another disadvantage of reverse screens is the types of genetic changes they can induce. Currently, reverse approaches can produce loss-of-function and hypomorphic effects, as well as gain-of-function by means of overexpression. However, it is unclear how sensitive cells and tissues are to overexpression at- large. The mutational effects of chemical mutagens used in forward genetic screens is more varied. By changing the identity of amino acids, chemical mutagens can create null and hypomorphic alleles, dominant negative alleles, and neomorphic alleles. These sorts of mutations have different effects on the developmental system. Forward genetic screens are powerful tools to identify novel loci that are involved in biological processes, and inform reverse screens in the future.

Key features of their life history make zebrafish an ideal vertebrate model in which to conduct forward genetic screens (Kimmel, 1989; Nüsslein-Volhard and Dahm, 2002; Nüsslein-

Volhard, 2012). Their high fecundity, short generation time, and external development make the zebrafish highly amenable to screening (Kimmel et al., 1995; Westerfield, 2007). A breeding pair of zebrafish can produce several hundred eggs in a single spawning event, and individual animals can be mated weekly. Zebrafish reach sexual maturity around two to three months of age. Their eggs are fertilized and develop externally, which allows the earliest stages of

30 development of the transparent embryo to be observed. External fertilization also allows for simplified in vitro fertilization. The zebrafish is also an excellent model in which to assess developmental bias in the teleost pectoral fin skeleton. Zebrafish retain the ancestral teleost pectoral fin configuration, development of the pectoral fin has been well studied and follows a process similar to other teleosts, and many genes involved in zebrafish fin development have been identified (Grandel and Schulte-Merker, 1998; Mercader, 2007). However, there has not been a systematic analysis of genes that shape the form of the adult fin, and our knowledge of the genetic factors that control patterning of the fin endoskeleton is limited to a few studies (Harris et al., 2008; Yano et al., 2012; Nakamura et al., 2016; Letelier et al., 2018). Previous work from the

Harris lab has made inroads into understanding the genetic basis of adult form by undertaking forward genetic screens to identify adult-viable mutants that affect the skeleton (Rohner et al.,

2009; Bowen et al., 2012; Perathoner et al., 2014; Henke et al., 2017; Daane et al., 2018). Here, I present the first analysis of mutants that enhance the zebrafish endoskeleton, and through these I identify a novel pathway in fin as well as limb patterning. Our results demonstrate the power of the forward screen to reveal unexpected properties of development in the zebrafish and underscore the continued importance of unbiased approaches in understanding the genetic regulation of form.

1.6. Overview

What phenotypic possibilities lie in developing systems only waiting to be induced? In this dissertation, I ask if the activation of latent ancestral developmental potential can produce coordinated changes to the animal body plan and how we can discover this hidden potential.

Using the vertebrate paired appendages as a study system, I find that unbiased forward genetic

31 screens are a powerful tool to uncover latent ancestral developmental potentials capable of producing dramatic morphological change in response to simple inducing factors.

In the second chapter, I describe novel zebrafish mutants isolated from forward genetic screens that demonstrate the unprecedented ability to develop an elaborated endoskeleton in a teleost fin. Using genetic mapping and CRISPR gene editing, I determine the causative mutations reside in wiskott-aldrich syndrome-like b (waslb) and vav2, two genes previously unknown to be involved in skeletal patterning. Using epistasis analysis, I show that waslb and vav2 form a genetic pathway and that this pathway interacts with Hox fin patterning mechanisms. Conditional inactivation of Wasl in the mouse reveals that this pathway is required for normal limb development. Astonishingly, I discover that appearance of the elaborated endoskeleton in zebrafish mutants required hoxa11b, suggesting that the novel elements share developmental homology. Altogether, these finds reveal an unexpected developmental potential latent in teleost fins to generate limb-like elaboration once thought unique to the lobe-finned fish and tetrapod lineage.

My unexpected finding that Wasl paralogs play a role in the skeletal patterning prompted the question of whether these genes play a role in other aspects of developmental patterning. In the third chapter, I sought to understand the role of Wasl paralogs in skeletal patterning more generally. I used a conditional knockout approach to inactivate Wasl in different tissues during mouse development. Using the Wnt1-Cre2 driver line to remove Wasl from neural crest cells, I discovered that Wasl is required for normal development of the calvaria, snout, hyoid, and cranial base. Removing Wasl from lateral plate mesoderm with the Hoxb6-Cre driver, I found that Wasl is required for normal limb and sternum patterning, confirming results from my first chapter using the Prrx1-Cre driver. These results demonstrate that Wasl paralogs play an

32 important, previously unidentified function in the patterning of both dermal and endochondral bones.

In the fourth chapter, I will detail my work on how the fin elaboration program induced in my zebrafish mutants compares to the developmental program in a closely related species that naturally forms an elaborated endoskeleton. To this end I investigated the bowfin Amia calva, the closest living relative to teleosts that retains the metapterygium and proximal-distal elaboration of the endoskeleton. As the bowfin is a non-model species without a reference genome and has not been studied with modern developmental techniques, I sought to generate resources to enable developmental genetic studies in the bowfin. First, I collected and reared bowfin embryos from the wild in collaboration with Amy McCune and Emily Funk at Cornell University. I then generated transcriptome data from developing bowfin fin buds and analyzed this data with genomic data in collaboration with Ingo Braasch and Andrew Thompson at Michigan State

University. My analysis of this data has revealed many similarities between fin and limb development as well as unexpected unique features of holostean fin development. With this groundwork in place, future studies will be able to compare bowfin fin development with my mutant zebrafish fin development and assess differences and similarities between these programs.

My dissertation concludes in the fifth chapter with a discussion of my findings and placing my results in the larger EDB context. I have found that development is primed to generate dramatic and coordinated changes in the body plan in a single generation in response to simple genetic perturbations. This potential may reside latent in a lineage for hundreds of millions of years, ready to be expressed in the presence of an inducing cue. My findings add to a growing body of work in EDB that suggests that large changes to the body plan can be achieved

33 rapidly through the reactivation of an ancestral developmental program. The role of latent ancestral developmental potential in the evolution of form is an exciting prospect that we are just beginning to understand. It is enticing to speculate on the prevalence of such potential relative to gradualistic change in the course of animal evolution.

1.7. References

Abzhanov, A. (2013). von Baer’s law for the ages: lost and found principles of developmental evolution. Trends in Genetics: TIG, 29(12), 712–722.

Ahn, D., & Ho, R. K. (2008). Tri-phasic expression of posterior Hox genes during development of pectoral fins in zebrafish: implications for the evolution of vertebrate paired appendages. Developmental Biology, 322(1), 220–233.

Aigler, S. R., Jandzik, D., Hatta, K., Uesugi, K., & Stock, D. W. (2014). Selection and constraint underlie irreversibility of tooth loss in cypriniform fishes. Proceedings of the National Academy of Sciences of the United States of America, 111(21), 7707–7712.

Akimenko, M. A., & Ekker, M. (1995). Anterior duplication of the Sonic hedgehog expression pattern in the pectoral fin buds of zebrafish treated with retinoic acid. Developmental Biology, 170(1), 243–247.

Arber, A. (1919a). On atavism and the law of irreversibility. American Journal of Science, Series 448(283), 27–32.

Arber, A. (1919b). The “Law of Loss” in Evolution. The Linnean: Newsletter and Proceedings of the Linnean Society of London. Linnean Society of London, 131(1), 1–21.

Arratia, G. (1999). The monophyly of Teleostei and stem-group teleosts. Mesozoic Fishes, 2, 265–334.

Arthur, W. (2001). Developmental drive: an important determinant of the direction of phenotypic evolution. Evolution & Development, 3(4), 271–278.

Arthur, W. (2002). The interaction between developmental bias and natural selection: from centipede segments to a general hypothesis. Heredity, 89(4), 239–246.

Balushkin, A. V., & Prirodina, V. P. (2010). A new species of Muraenolepididae (Gadiformes) Muraenolepis evseenkoi sp. nova from continental seas of Antarctica. Journal of Ichthyology, 50(7), 495–502.

34 Bateson, W. (1894). Materials for the Study of Variation: Treated with Especial Regard to Discontinuity in the Origin of Species. Macmillan.

Borisenko, I., Podgornaya, O. I., & Ereskovsky, A. V. (2019). From traveler to homebody: Which signaling mechanisms sponge larvae use to become adult sponges? Advances in Protein Chemistry and Structural Biology, 116, 421–449.

Bowen, M. E., Henke, K., Siegfried, K. R., Warman, M. L., & Harris, M. P. (2012). Efficient mapping and cloning of mutations in zebrafish by low-coverage whole-genome sequencing. Genetics, 190(3), 1017–1024.

Bridges, C. B., & Morgan, T. H. (1923). The Third-chromosome Group of Mutant Characters of Drosophila Melanogaster. Carnegie Institution of Washington.

Brigandt, I. (2020). Historical and philosophical perspectives on the study of developmental bias. Evolution & Development, 22(1-2), 7–19.

Britz, R., Conway, K. W., & Rüber, L. (2009). Spectacular morphological novelty in a miniature cyprinid fish, Danionella dracula n. sp. Proceedings of the Royal Society B: Biological Sciences, 276(1665), 2179–2186.

C B Da Silva, J. P., & Johnson, G. D. (2018). Reconsidering pectoral girdle and fin morphology in Anguillidae (Elopomorpha: Anguilliformes). Journal of Fish Biology, 93(2), 420–423.

Carroll, S. B., Grenier, J. K., & Weatherbee, S. D. (2013). From DNA to Diversity: Molecular Genetics and the Evolution of Animal Design. John Wiley & Sons.

Coates, M. I. (1994). The origin of vertebrate limbs. Development. Supplement, 169–180.

Coates, M. I. (1995). Limb evolution. Fish fins or tetrapod limbs--a simple twist of fate? Current Biology: CB, 5(8), 844–848.

Coates, M. I. (2003). The evolution of paired fins. Theory in Biosciences = Theorie in Den Biowissenschaften, 122(2), 266–287.

Coates, M. I., & Clack, J. A. (1990). Polydactyly in the earliest known tetrapod limbs. Nature, 347(6288), 66–69.

Cohn, M. J., Lovejoy, C. O., Wolpert, L., & Coates, M. I. (2002). Branching, segmentation and the metapterygial axis: pattern versus process in the vertebrate limb. BioEssays, 24(5), 460–465.

Daane, J. M., Lanni, J., Rothenberg, I., Seebohm, G., Higdon, C. W., Johnson, S. L., & Harris, M. P. (2018). Bioelectric-calcineurin signaling module regulates allometric growth and size of the zebrafish fin. Scientific Reports, 8(1), 10391.

Dahn, R. D., Davis, M. C., Pappano, W. N., & Shubin, N. H. (2007). Sonic hedgehog function in

35 chondrichthyan fins and the evolution of appendage patterning. Nature, 445(7125), 311–314.

Davis, A. P., Witte, D. P., Hsieh-Li, H. M., Potter, S. S., & Capecchi, M. R. (1995). Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11. Nature, 375(6534), 791–795.

Davis, M. C., Dahn, R. D., & Shubin, N. H. (2007). An autopodial-like pattern of Hox expression in the fins of a basal actinopterygian fish. Nature, 447(7143), 473–476.

De Pinna, M. C. C. (1996). Teleostean monophyly. Interrelationships of Fishes.

Decker, R. S., Koyama, E., & Pacifici, M. (2014). Genesis and morphogenesis of limb synovial joints and articular cartilage. Matrix Biology: Journal of the International Society for Matrix Biology, 39, 5–10.

Derjugin, K. (1910). Der Bau und die Entwicklung des Schultergrtels und der Brustflossen bei den Teleostiern. Zeitschrift Für Wissenschaftliche Zoologie, 96, 572–653.

Dewit, J., Witten, P. E., & Huysseune, A. (2011). The mechanism of cartilage subdivision in the reorganization of the zebrafish pectoral fin endoskeleton. Journal of Experimental Zoology. Part B, Molecular and Developmental Evolution, 316(8), 584–597.

Dollo, L. (1893). The laws of evolution. Bull. Soc. Bel. Geol. Paleontol, 7, 164–166.

Duboule, D. (1992). The vertebrate limb: a model system to study the Hox/HOM gene network during development and evolution. BioEssays: News and Reviews in Molecular, Cellular and Developmental Biology, 14(6), 375–384.

Duboule, D. (1994). Temporal colinearity and the phylotypic progression: a basis for the stability of a vertebrate Bauplan and the evolution of morphologies through heterochrony. Development. Supplement, 135–142.

Duboule, D. (2007). The rise and fall of Hox gene clusters. Development, 134(14), 2549–2560.

Duboule, D., & Dollé, P. (1989). The structural and functional organization of the murine HOX gene family resembles that of Drosophila homeotic genes. The EMBO Journal, 8(5), 1497–1505.

Durán, I., Marí-Beffa, M., Santamaría, J. A., Becerra, J., & Santos-Ruiz, L. (2011). Actinotrichia collagens and their role in fin formation. Developmental Biology, 354(1), 160–172.

Durston, A. J. (2012). Global posterior prevalence is unique to vertebrates: a dance to the music of time? Developmental Dynamics: An Official Publication of the American Association of Anatomists, 241(11), 1799–1807.

Durston, A. J. (2019). Vertebrate hox temporal collinearity: does it exist and what is it’s function? Cell Cycle, 18(5), 523–530.

36 Ehrenreich, I. M., & Pfennig, D. W. (2016). Genetic assimilation: a review of its potential proximate causes and evolutionary consequences. Annals of Botany, 117(5), 769–779.

Ferguson, J. S. (1912). THE BEHAVIOR AND RELATIONS OF LIVING CONNECTIVE TISSUE CELLS IN THE FINS OF FISH EMBRYOS WITH SPECIAL REFERENCE TO THE HISTOGENESIS OF THE COLLAGINOUS OR WHITE FIBERS. The American Journal of Anatomy, 13, 129.

Fink, S. V., & Fink, W. L. (1981). Interrelationships of the ostariophysan fishes (Teleostei). Zoological Journal of the Linnean Society, 72(4), 297–353.

Freitas, R., Gómez-Marín, C., Wilson, J. M., Casares, F., & Gómez-Skarmeta, J. L. (2012). Hoxd13 contribution to the evolution of vertebrate appendages. Developmental Cell, 23(6), 1219–1229.

Freitas, R., Zhang, G., & Cohn, M. J. (2006). Evidence that mechanisms of fin development evolved in the midline of early vertebrates. Nature, 442(7106), 1033–1037.

Freitas, R., Zhang, G., & Cohn, M. J. (2007). Biphasic Hoxd gene expression in shark paired fins reveals an ancient origin of the distal limb domain. PloS One, 2(8), e754.

Fromental-Ramain, C., Warot, X., Messadecq, N., LeMeur, M., Dollé, P., & Chambon, P. (1996). Hoxa-13 and Hoxd-13 play a crucial role in the patterning of the limb autopod. Development, 122(10), 2997–3011.

Galis, F. (1999). Why do almost all mammals have seven cervical vertebrae? Developmental constraints, Hox genes, and cancer. The Journal of Experimental Zoology, 285(1), 19–26.

Galis, F., Arntzen, J. W., & Lande, R. (2010). Dollo’s law and the irreversibility of digit loss in Bachia [Review of Dollo’s law and the irreversibility of digit loss in Bachia]. Evolution; International Journal of Organic Evolution, 64(8), 2466–2476; discussion 2477–2485.

Gegenbaur, & Bell. (1878). Elements of Comparative Anatomy / (Vol. 1878, p. 684). London.

Gerhart, J., & Kirschner, M. (2007). The theory of facilitated variation. Proceedings of the National Academy of Sciences of the United States of America, 104 Suppl 1, 8582–8589.

Gilbert, S. F. (2009). Developmental Biology. Sinauer Associates.

Gilbert, S. F., & Epel, D. (2009). Ecological Developmental Biology: Integrating Epigenetics, Medicine, and Evolution. Sinauer Associates.

Gillis, J. A., Dahn, R. D., & Shubin, N. H. (2009). Shared developmental mechanisms pattern the vertebrate gill arch and paired fin skeletons. Proceedings of the National Academy of Sciences of the United States of America, 106(14), 5720–5724.

37 Gillis, J. A., & Hall, B. K. (2016). A shared role for sonic hedgehog signalling in patterning chondrichthyan gill arch appendages and tetrapod limbs. Development, 143(8), 1313–1317.

Goldschmidt, R. (1940). The Material Basis of Evolution. Yale University Press.

Gould, S. J. (1970). Dollo on Dollo’s law: Irreversibility and the status of evolutionary laws. Journal of the History of Biology, 3(2), 189–212.

Graham, A., Papalopulu, N., & Krumlauf, R. (1989). The murine and Drosophila homeobox gene complexes have common features of organization and expression. Cell, 57(3), 367–378.

Grandel, H., & Schulte-Merker, S. (1998). The development of the paired fins in the zebrafish (Danio rerio). Mechanisms of Development, 79(1-2), 99–120.

Haack, H., & Gruss, P. (1993). The establishment of murine Hox-1 expression domains during patterning of the limb. Developmental Biology, 157(2), 410–422.

Harris, M. P., Hasso, S. M., Ferguson, M. W. J., & Fallon, J. F. (2006). The development of archosaurian first-generation teeth in a chicken mutant. Current Biology: CB, 16(4), 371–377.

Harris, M. P., Rohner, N., Schwarz, H., Perathoner, S., Konstantinidis, P., & Nüsslein-Volhard, C. (2008). Zebrafish eda and edar mutants reveal conserved and ancestral roles of ectodysplasin signaling in vertebrates. PLoS Genetics, 4(10), e1000206.

He, S., Del Viso, F., Chen, C.-Y., Ikmi, A., Kroesen, A. E., & Gibson, M. C. (2018). An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis. Science, 361(6409), 1377–1380.

Henke, K., Daane, J. M., Hawkins, M. B., Dooley, C. M., Busch-Nentwich, E. M., Stemple, D. L., & Harris, M. P. (2017). Genetic Screen for Postembryonic Development in the Zebrafish (Danio rerio): Dominant Mutations Affecting Adult Form. Genetics, 207(2), 609–623.

Hérault, Y., Beckers, J., Gérard, M., & Duboule, D. (1999). Hox gene expression in limbs: colinearity by opposite regulatory controls. Developmental Biology, 208(1), 157–165.

Hordijk, W., & Altenberg, L. (2020). Developmental structuring of phenotypic variation: A case study with a cellular automata model of ontogeny. Evolution & Development, 22(1-2), 20–34.

International Chicken Genome Sequencing Consortium. (2004). Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature, 432(7018), 695–716.

Irie, N., & Kuratani, S. (2014). The developmental hourglass model: a predictor of the basic body plan? Development, 141(24), 4649–4655.

J. Maynard Smith, R. Burian, S. Kauffman, P. Alberch, J. Campbell, B. Goodwin, R. Lande, D.

38 Raup and L. Wolpert. (1985). Developmental Constraints and Evolution: A Perspective from the Mountain Lake Conference on Development and Evolution. The Quarterly Review of Biology, 60(3), 265–287.

Jessen, H. L. (1972). Fossils and Strata, Schultergurtel und Pectoralflosse bei Actinopterygiern. Lethaia, 5(3), 344.

Jude, E., Johanson, Z., Kearsley, A., & Friedman, M. (2014). Early evolution of the lungfish pectoral-fin endoskeleton: evidence from the Middle Devonian (Givetian) Pentlandia macroptera. Frontiers of Earth Science in China, 2, 18.

Kessel, M., & Gruss, P. (1991). Homeotic transformations of murine vertebrae and concomitant alteration of Hox codes induced by retinoic acid. Cell, 67(1), 89–104.

Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., & Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Developmental Dynamics: An Official Publication of the American Association of Anatomists, 203(3), 253–310.

Kohlsdorf, T., & Wagner, G. P. (2006). Evidence for the reversibility of digit loss: a phylogenetic study of limb evolution in Bachia (Gymnophthalmidae: Squamata). Evolution; International Journal of Organic Evolution, 60(9), 1896–1912.

Krauss, S., Concordet, J. P., & Ingham, P. W. (1993). A functionally conserved homolog of the Drosophila segment polarity gene hh is expressed in tissues with polarizing activity in zebrafish embryos. Cell, 75(7), 1431–1444.

Kurtén, B. (1963). Return of a lost structure in the evolution of the felid dentition.

Laurin, I., I., Girondot, I., I., & de Ricqlès I. (2000). Early tetrapod evolution. Trends in Ecology & Evolution, 15(3), 118–123.

Letelier, J., de la Calle-Mustienes, E., Pieretti, J., Naranjo, S., Maeso, I., Nakamura, T., Pascual- Anaya, J., Shubin, N. H., Schneider, I., Martinez-Morales, J. R., & Gómez-Skarmeta, J. L. (2018). A conserved Shh cis-regulatory module highlights a common developmental origin of unpaired and paired fins. Nature Genetics, 50(4), 504–509.

Lewis, E. B. (1978). A gene complex controlling segmentation in Drosophila. Nature, 276(5688), 565–570.

Lynch, V. J., & Wagner, G. P. (2010). Did egg-laying boas break Dollo’s law? Phylogenetic evidence for reversal to oviparity in sand boas (Eryx: Boidae). Evolution; International Journal of Organic Evolution, 64(1), 207–216.

Mallo, M., Wellik, D. M., & Deschamps, J. (2010). Hox genes and regional patterning of the vertebrate body plan. Developmental Biology, 344(1), 7–15.

39 Marshall, C. R., Raff, E. C., & Raff, R. A. (1994). Dollo’s law and the death and resurrection of genes. Proceedings of the National Academy of Sciences of the United States of America, 91(25), 12283–12287.

Masselink, W., Cole, N. J., Fenyes, F., Berger, S., Sonntag, C., Wood, A., Nguyen, P. D., Cohen, N., Knopf, F., Weidinger, G., Hall, T. E., & Currie, P. D. (2016). A somitic contribution to the apical ectodermal ridge is essential for fin formation. Nature, 535(7613), 542–546.

Mercader, N. (2007). Early steps of paired fin development in zebrafish compared with tetrapod limb development. Development, Growth & Differentiation, 49(6), 421–437.

Metscher, B. D., Takahashi, K., Crow, K., Amemiya, C., Nonaka, D. F., & Wagner, G. P. (2005). Expression of Hoxa-11 and Hoxa-13 in the pectoral fin of a basal ray-finned fish, Polyodon spathula: implications for the origin of tetrapod limbs. Evolution & Development, 7(3), 186–195.

Moczek, A. P. (2020). Biases in the study of developmental bias. Evolution & Development, 22(1-2), 3–6.

Muller, H. J. (1939). REVERSIBILITY IN EVOLUTION CONSIDERED FROM THE STANDPOINT OF GENETICS. Biological Reviews of the Cambridge Philosophical Society, 14(3), 261–280.

Nakamura, T., Gehrke, A. R., Lemberg, J., Szymaszek, J., & Shubin, N. H. (2016). Digits and fin rays share common developmental histories. Nature, 537(7619), 225–228.

Nelson, C. E., Morgan, B. A., Burke, A. C., Laufer, E., DiMambro, E., Murtaugh, L. C., Gonzales, E., Tessarollo, L., Parada, L. F., & Tabin, C. (1996). Analysis of Hox gene expression in the chick limb bud. Development, 122(5), 1449–1466.

Neumann, C. J., Grandel, H., Gaffield, W., Schulte-Merker, S., & Nüsslein-Volhard, C. (1999). Transient establishment of anteroposterior polarity in the zebrafish pectoral fin bud in the absence of sonic hedgehog activity. Development, 126(21), 4817–4826.

Nichols, S. A., Dirks, W., Pearse, J. S., & King, N. (2006). Early evolution of animal cell signaling and adhesion genes. Proceedings of the National Academy of Sciences of the United States of America, 103(33), 12451–12456.

Niswander, L., Jeffrey, S., Martin, G. R., & Tickle, C. (1994). A positive feedback loop coordinates growth and patterning in the vertebrate limb. Nature, 371(6498), 609–612.

Nüsslein-Volhard, C. (2012). The zebrafish issue of Development. Development, 139(22), 4099– 4103.

Nüsslein-Volhard, C., & Dahm, R. (2002). Zebrafish: a practical approach. Oxford University

40 Nüsslein-Volhard, C., & Wieschaus, E. (1980). Mutations affecting segment number and polarity in Drosophila. Nature, 287(5785), 795–801.

Onimaru, K., Kuraku, S., Takagi, W., Hyodo, S., Sharpe, J., & Tanaka, M. (2015). A shift in anterior-posterior positional information underlies the fin-to-limb evolution. eLife, 4. https://doi.org/10.7554/eLife.07048

Owen, R. (1849). On the Nature of Limbs: A Discourse Delivered on Friday, February 9, at an Evening Meeting of the Royal Institution of Great Britain. J. Van Voorst.

Parsons, K. J., McWhinnie, K., Pilakouta, N., & Walker, L. (2020). Does phenotypic plasticity initiate developmental bias? Evolution & Development, 22(1-2), 56–70.

Patterson, C., & Rosen, D. E. (1977). Review of ichthyodectiform and other Mesozoic teleost fishes, and the theory and practice of classifying fossils. Bulletin of the AMNH; v. 158, article 2. http://digitallibrary.amnh.org/handle/2246/1224

Patton, E. E., & Zon, L. I. (2001). The art and design of genetic screens: zebrafish. Nature Reviews. Genetics, 2(12), 956–966.

Paul M Brakefield, P. J. W. (2003). Phenotypic Plasticity. In W. M. O. Brian K Hall (Ed.), Keywords & Concepts in Evolutionary Developmental Biology (pp. 288–297). Harvard University Press.

Perathoner, S., Daane, J. M., Henrion, U., Seebohm, G., Higdon, C. W., Johnson, S. L., Nüsslein-Volhard, C., & Harris, M. P. (2014). Bioelectric signaling regulates size in zebrafish fins. PLoS Genetics, 10(1), e1004080.

Raff, R. A. (1996, June). The Shape of Life. University of Chicago Press

Rajakumar, R., Mauro, D. S., Dijkstra, M. B., Huang, 1. Ming H., Wheeler, 2. Diana E., Hiou- Tim, F., Khila, A., Cournoyea, 1. Michael, & Abouheif, E. (2012). Ancestral Developmental Potential Facilitates Parallel Evolution in Ants. Science, 335.

Riddle, R. D., Johnson, R. L., Laufer, E., & Tabin, C. (1993). Sonic hedgehog mediates the polarizing activity of the ZPA. Cell, 75(7), 1401–1416.

Rohner, N., Bercsényi, M., Orbán, L., Kolanczyk, M. E., Linke, D., Brand, M., Nüsslein- Volhard, C., & Harris, M. P. (2009). Duplication of fgfr1 permits Fgf signaling to serve as a target for selection during domestication. Current Biology: CB, 19(19), 1642–1647.

Sakamoto, K., Onimaru, K., Munakata, K., Suda, N., Tamura, M., Ochi, H., & Tanaka, M. (2009). Heterochronic shift in Hox-mediated activation of sonic hedgehog leads to morphological changes during fin development. PloS One, 4(4), e5121.

Saunders, J. W., Jr. (1948). The proximo-distal sequence of origin of the parts of the chick wing

41 and the role of the ectoderm. The Journal of Experimental Zoology, 108(3), 363–403.

Schiemann, S. M., Martín-Durán, J. M., Børve, A., Vellutini, B. C., Passamaneck, Y. J., & Hejnol, A. (2017). Clustered brachiopod Hox genes are not expressed collinearly and are associated with lophotrochozoan novelties. Proceedings of the National Academy of Sciences of the United States of America, 114(10), E1913–E1922.

Schlichting, C., & Pigliucci, M. (1998). Phenotypic Evolution: A Reaction Norm Perspective.

Seher, T. D., Ng, C. S., Signor, S. A., Podlaha, O., Barmina, O., & Kopp, A. (2012). Genetic basis of a violation of Dollo’s Law: re-evolution of rotating sex combs in Drosophila bipectinata. Genetics, 192(4), 1465–1475.

Shubin, N., Tabin, C., & Carroll, S. (1997). Fossils, genes and the evolution of animal limbs. Nature, 388(6643), 639–648.

Slack, J. M. W. (2003). Phylotype and Zootype. In W. M. O. Brian K Hall (Ed.), Keywords & Concepts in Evolutionary Developmental Biology (pp. 309–317). Harvard University Press.

Small, K. M., & Potter, S. S. (1993). Homeotic transformations and limb defects in Hox A11 mutant mice. Genes & Development, 7(12A), 2318–2328.

Sordino, P., & Duboule, D. (1996). A molecular approach to the evolution of vertebrate paired appendages. Trends in Ecology & Evolution, 11(3), 114–119.

Sordino, P., van der Hoeven, F., & Duboule, D. (1995). Hox gene expression in teleost fins and the origin of vertebrate digits. Nature, 375(6533), 678–681.

Starks, E. C. (1930). The Primary Shoulder Girdle of the Bony Fishes. Stanford University Press.

Stewart, T. A., Lemberg, J. B., Taft, N. K., Yoo, I., Daeschler, E. B., & Shubin, N. H. (2019). Fin ray patterns at the fin-to-limb transition. Proceedings of the National Academy of Sciences of the United States of America. https://doi.org/10.1073/pnas.1915983117

Stock, D. W. (2007). Zebrafish dentition in comparative context. Journal of Experimental Zoology. Part B, Molecular and Developmental Evolution, 308(5), 523–549.

Tabin, C., & Laufer, E. (1993). Hox genes and serial homology. Nature, 361(6414), 692–693.

Tanaka, M. (2018). Alterations in anterior-posterior patterning and its accompanying changes along the proximal-distal axis during the fin-to-limb transition. Genesis, 56(1).

Thorogood, P. (1991). The Development of the Teleost Fin and Implications for Our Understanding of Tetrapod Limb Evolution. In J. R. Hinchliffe, J. M. Hurle, & D. Summerbell (Eds.), Developmental Patterning of the Vertebrate Limb (pp. 347–354). Springer US.

42 Waddington, C. H. (1942). CANALIZATION OF DEVELOPMENT AND THE INHERITANCE OF ACQUIRED CHARACTERS. Nature, 150(3811), 563–565.

Westerfield, M. (2007). The zebrafish book: a guide for the laboratory use of zebrafish (Danio rerio).

Whiting, M. F., Bradler, S., & Maxwell, T. (2003). Loss and recovery of wings in stick insects. Nature, 421(6920), 264–267.

Wiedersheim, & Parker. (1907). Comparative anatomy of vertebrates, (p. 598). London, Macmillan and co., limited.

Wiens, J. J. (2011). Re-evolution of lost mandibular teeth in frogs after more than 200 million years, and re-evaluating Dollo’s law. Evolution; International Journal of Organic Evolution, 65(5), 1283–1296.

Wood, A. (1982). Early pectoral fin development and morphogenesis of the apical ectodermal ridge in the killifish, Aphyosemion scheeli. The Anatomical Record, 204(4), 349–356.

Wund, M. A., Baker, J. A., Clancy, B., Golub, J. L., & Foster, S. A. (2008). A test of the “flexible stem” model of evolution: ancestral plasticity, genetic accommodation, and morphological divergence in the threespine stickleback radiation. The American Naturalist, 172(4), 449–462.

Yang, C.-H., & Andrew Pospisilik, J. (2019). Polyphenism - A Window Into Gene-Environment Interactions and Phenotypic Plasticity. Frontiers in Genetics, 10, 132.

Yano, T., Abe, G., Yokoyama, H., Kawakami, K., & Tamura, K. (2012). Mechanism of pectoral fin outgrowth in zebrafish development. Development, 139(16), 2916–2925.

Zhang, J., Wagh, P., Guay, D., Sanchez-Pulido, L., Padhi, B. K., Korzh, V., Andrade-Navarro, M. A., & Akimenko, M.-A. (2010). Loss of fish actinotrichia proteins and the fin-to-limb transition. Nature, 466(7303), 234–237.

Zhu, M., & Yu, X. (2009). Stem sarcopterygians have primitive polybasal fin articulation. Biology Letters, 5(3), 372–375.

Zufall, R. A., & Rausher, M. D. (2004). Genetic changes associated with floral adaptation restrict future evolutionary potential. Nature, 428(6985), 847–850.

43 Chapter 2: Latent developmental potential to form limb-like skeletal structures in zebrafish

This chapter was submitted to Cell for publication, and after positive peer reviews has invited for resubmission. The revisions are in progress and the manuscript will be resubmitted in Spring 2020.

Authors M. Brent Hawkins, Katrin Henke, and Matthew P. Harris

44 Chapter 2: Latent developmental potential to form limb-like skeletal structures in zebrafish

Changes in appendage structure underlie key transitions in vertebrate evolution. Addition of skeletal elements along the proximal-distal (PD) axis facilitated several critical transformations, including the fin-to-limb transition which permitted generation of diverse modes of locomotion. Despite their importance in evolution, genetic changes that result in the establishment of new skeletal elements along this axis are unknown. Here, we identify zebrafish mutants that form novel long bones along the PD axis of the pectoral fin. These new bones are integrated into musculature, form joints, and articulate with neighboring bones. This phenotype is caused by activating mutations in previously unrecognized regulators of appendage patterning, vav2 and waslb, that function in a common pathway. We find this pathway is required for normal appendage development across vertebrates, and loss of Wasl in developing mouse limbs results in patterning defects similar to those seen in Hoxa11 knockout mice. Concordantly, we show that formation of supernumerary fin long bones requires the function of hoxa11 paralogs, indicating developmental homology with the forearm and the existence of a latent but functional Hox code patterning the fin endoskeleton. Our findings reveal an inherent limb-like patterning ability in fins that can be activated by simple genetic perturbation, resulting in the elaboration of the endoskeleton.

2.1. Introduction

Vertebrates have evolved diverse appendages that exhibit a wide variety of forms and functions. Tetrapod limbs permit mobility via articulation of multiple endochondral long bones facilitated by specialized synovial joints. Based on this framework, limbs have evolved divergent

45 structures through digit reduction, phalangeal addition, transformation of wrist and ankle bones, alteration in element proportion, and outright limb-loss. In contrast, the skeletal pattern of the teleost pectoral appendage is almost invariant, showing a consistent arrangement across diverse lineages within this group of ~30,000 species. Teleost pectoral fins are composed of dermal fin rays supported at their base by a diminutive endoskeleton (Figure 2.1A). The endoskeleton typically consists of four long bones, called proximal radials, arranged side by side along the anterior-posterior (AP) axis, followed distally by small nodular distal radials (Arratia, 1999;

Jessen, 1972). No known teleost species exhibits more than a single long bone along the proximal-distal (PD) axis (Starks, 1930). The divergent architectures of teleost fins and tetrapod limbs have been maintained within each clade for over 250 (Betancur et al., 2017; Near et al.,

2012) and 350 million (Pardo et al., 2017) years, respectively.

Evidence from fossils suggests that, similar to extant ray-finned fishes, the common ancestor of teleosts and tetrapods had a series of long bones arranged side by side along the AP axis of the pectoral appendage (Zhu and Yu, 2009). The posterior-most element of this series was segmented along the PD axis, creating end-on-end articulation (Figure 2.1A). This structure, called the metapterygium, is not retained in teleost fishes, and is hypothesized to have been elaborated to form limbs through the progressive acquisition and regionalization of elements along the PD axis of the appendicular skeleton in stem and crown group lobe-finned fishes

(Gegenbaur, 1865; Supplemental Figure 2.1).

Due to their divergent skeletal patterns, identifying homologous structures between fins and limbs with one-to-one correspondence is difficult. However, despite the morphological disparity between fins and limbs, comparative approaches in developmental genetics have revealed shared pathways required for the normal patterning of these appendages. Hox genes, in

Figure 2.1. Gain-of-function mutations reveal capacity for limb-like development in fins (A) From a common ancestor, teleosts and tetrapods evolved divergent appendage patterns (see also Supplemental Figure 2.1). (B and C) Adult pectoral fin skeletons of wild-type and heterozygous rephaim mutants shown intact (left); fin rays and distal radials removed (center); schematized (right; see also Supplemental Figure 2.2). (D) waslb and vav2 alleles causing mutant phenotypes; Δ+ reph (mh130), and Δ+ wan (mh138; see also Supplemental Figures 2.3-2.5). (E) Epistasis analysis showing suppression of wan/vav2 phenotypes after loss of waslb function. (F) Genetic pathway of vav2, waslb, and fin elaboration. (G) Expression of waslb and vav2 in 48 hpf pectoral fin buds. Anterior to left, distal to top; scale bars (B, C, E) 500 μm, (G) 50 μm.

particular, are key players that specify and reinforce regional identity in appendages (Zakany and

Duboule, 2007). Overexpression of hoxd13a in embryonic zebrafish causes increased, but unpatterned, chondrogenic tissue formation in the larval pectoral fin (Freitas et al., 2012).

Furthermore, deletions of posterior group 13 HoxA and HoxD genes result in the loss of distal skeletal elements in mouse limbs (wrist/ankle and hand/foot) and zebrafish fins (dermal fin rays), suggesting that these genes provide a regional address for distal elements in the different appendages (Nakamura et al., 2016). While Hox genes that specify more proximal limb

47 components have been identified in tetrapods, it is unclear if similar mechanisms instruct the patterning of non-distal components of the fin.

Here, through unbiased forward genetic screens in the zebrafish (Haffter et al., 1996;

Henke et al., 2017), we identify mutants that break the long-standing teleost fin pattern by developing new skeletal elements along the PD axis of the pectoral fin in a limb-like manner.

These novel structures are fully differentiated long bones that integrate into the fin musculature and articulate with the fin skeleton. Mapping reveals modulation of vav2 and waslb signaling as causing the mutant phenotypes. We show through epistasis analysis that these genes function together in a common pathway not previously associated with limb development or embryonic patterning. Conditional knockout of Wasl in the mouse demonstrates that this pathway is required for normal limb patterning, and its absence results in a range of skeletal phenotypes that match those seen in Hoxa11 knockout mutants. Through generation of triple loss-of-function hox11 zebrafish mutants by CRISPR-Cas9 gene editing, we demonstrate that waslb requires hox11 function to form supernumerary elements, and more broadly interacts with hox genes to pattern the PD fin axis. Our results suggest that zebrafish retain the capacity to form structures with an intermediate regional address specified by hoxa11, similar to the limb zeugopod. This inherent capacity is activated by simple genetic changes, revealing a novel appendage-patterning pathway that may have played unrecognized roles in the fin to limb transition.

2.2. Materials and methods

Zebrafish husbandry, strains, and mutagenesis

All zebrafish lines were maintained and propagated as described by Nuesslein-Volhard &

Dahm (Nusslein-Volhard and Dahm, 2002). This study was conducted with ethical approval

48 from the Institutional Animal Care and Use Committee of Boston Children’s Hospital. A complete description of the husbandry and environmental conditions for the fish used in these experiments is available as a collection: protocols.io dx.doi.org/10.17504/protocols.io.mrjc54n. rephaim (dmh22) was isolated as part of a broad mutagenesis screen performed at Boston

Children’s Hospital (Henke et al., 2017). wanda (ty127) was initially isolated and described in the original Tuebingen screens (Haffter et al., 1996). wanda mutant stocks were obtained from the European Zebrafish Resource Center (http://www.ezrc.kit.edu/).

Mapping rephaim and wanda mutant zebrafish

Whole-exome sequencing was used to map the loci and mutations causing the reph and wan phenotypes through homozygosity-by-descent methods (Bowen et al., 2012). As both mutants exhibit dose-dependent phenotypes, homozygotes could be isolated and used for mapping. For each mutant, genomic DNA from 25 F2 homozygous mutants stemming from a

WIK outcross was extracted from whole larvae using the Qiagen DNeasy Blood & Tissue kit. 3

μg of pooled DNA was sheared to an average fragment size of 200 bp using a Covaris E220

Focused Ultrasonicator. Barcoded sequencing libraries were prepared from fragmented DNA using the KAPA Hyper Prep Kit following the manufacturer’s protocol. We used Agilent

SureSelect DNA target enrichment baits designed using the Zv9 genome assembly to enrich for coding regions of the zebrafish genome (Kettleborough et al., 2013). 50 bp single-end sequencing was performed on an Illumina HiSeq machine, resulting in average exome coverage of 7x for rephaim and 13x for wanda. Fine mapping of linked intervals was performed with polymerase chain reaction (PCR)-based analysis of recombinants using unique single nucleotide polymorphisms (SNP) and simple sequence length polymorphisms (SSLP).

49 Gene editing and isolation of frameshift mutations

CRISPR-Cas9 site-directed mutagenesis was used to generate null alleles for each target gene. Suitable target sites located early in the first exon of each gene were selected using

CHOPCHOP (http://chopchop.cbu.uib.no/). hoxa11a_1: 5'ACTGGCACATTGTTATCCGT 3'; hoxa11b_1: 5' CGTCTTCTTGCCCCATGACA 3'; hoxa11b_2: 5' TTTGATGAGCGGGTACCCGT 3'; hoxd11a_1: 5' CGCTTCGTACTATTCAACGG 3'; hoxd11a_2: 5' CTATTCTTCGAACATAGCGC 3'; vav2_1: 5' CTGAGGGCCAAACGACCCGG 3'; vav2_2: 5' TGGAGGAGTGGAGGCAGTGC 3'; waslb_1:

5' ATAGAGCCAACATTGAGCGC 3'; waslb_2: 5' AGAGCACTTCGTTTTCCTGA 3'; waslb_3: 5'

GCGGTCCACCTTCAAACAGG 3'. Guides were synthesized by IDT (Integrated DNA Technologies,

Coralville, IA) for use with their Alt-R CRISPR-Cas9 system. Gene-specific guides were multiplexed and injected at a concentration of 6.25 μM each crRNA guide and 500 ng/μL Cas9 mRNA into single-cell zebrafish embryos. Progeny of injected fish were screened for the presence of inherited lesions resulting in frameshifts and truncations, and animals carrying null alleles were used as founders.

Skeletal staining and histology

Adult fish were fixed overnight at room temperature with agitation in 3.7% formaldehyde in phosphate buffered saline (PBS) pH 7.4. After fixation, fish were rinsed briefly with PBS and stepped through one-hour ethanol/distilled water washes, with 30%, 50%, 70%, 95%, and finally

100% ethanol. Cartilage was then stained overnight at room temperature with 0.015% Alcian

Blue GX in 30% acetic acid in ethanol. One-hour ethanol/distilled water washes were then used to move the animals through 100%, 70%, 50%, 30% ethanol, and then washed twice in tap water. Fish were then macerated using 0.15% trypsin in 65% saturated sodium borax solution at

50 37°C. Typically fish were digested for 1 to 3 hours, stopping the process once the caudal peduncle and anal fin radials were visible when held up to light. Mineralized tissues were stained with 0.25% Alizarin Red S in 0.5% KOH (potassium hydroxide) overnight. If one night of staining was inadequate, a second overnight wash was performed with fresh staining solution.

For storage and imaging, stained fish were then moved through a glycerol/0.5% KOH series using overnight washes of 20%, 40%, 60%, 80% glycerol in 0.5% KOH, and finally 100% glycerol. Larval and juvenile fish were stained with the same protocol, with the exception that larval fish were left in the cartilage stain for only 4 hours. All wash volumes are 20 mL and all steps were performed in scintillation vials.

Calculations of endoskeletal disc area

Wild-type and mutant 7 dpf larvae were stained with Alcian blue. After staining, pectoral fins were removed and the endoskeletal disc was measured using integrated measurement tools in the Nikon Imaging Software. For each fin, the disc area was measured in triplicate and the average taken to be used in statistical analysis. Statistical comparison of average disc size was performed by Welch’s Two Sample t-test using the R statistical module software

(R_Core_Team, 2014).

Whole-mount actinotrichia collagen labeling

Whole-mount immunolabeling of actinodin collagen filaments and DAPI counter- labeling was carried out as previously described (Masselink et al., 2016; Lalonde and Akimenko,

2018).

51 Histology

Fish were fixed overnight in 3.7% formaldehyde in PBS at room temperature. After fixation, the pectoral girdle was removed and decalcified in 10% EDTA

(ethylenediaminetetraacetic acid) for several days, with daily solution changes. Fins were then embedded in paraffin, sectioned on a microtome, and stained with Hematoxylin and Eosin following standard protocols.

In situ hybridization

Whole mount in situ hybridization was performed following Jackman et al. (Jackman et al., 2004) with minor modifications. Embryos were pre-treated with 2.5 µg/mL proteinase K for

30 minutes at room temperature. In situ hybridization on sections was performed following

Smith et al. (Smith et al., 2008). Prior to embedding in OCT (Optimal Cutting Temperature,

Sakura), adult fins were decalcified overnight in 10% EDTA pH 7.6.

Cell localization constructs and assay

The gene fusion construct mEmerald-N-Wasp-C-18, consisting of an N-terminal GFP fused to the Mus musculus Wasl coding region driven by the CMV promoter, was a gift from

Michael Davidson (Addgene plasmid #54199). Site-directed mutagenesis via the QuikChange II

XL kit (Agilent) was used to introduce the S249P mutation with the primers

5’CCCAGCTTAAAGACAGAGAAACCTCAAAAGTTATTTATGACTTTATTG’3 and

5’CAATAAAGTCATAAATAACTTTTGGTGTTTCTCTGTCTTTAAGCTGGG’3. HeLa cells were seeded on 6-well plates in Dulbecco′s Modified Eagle′s medium (DMEM, Life

Technologies) supplemented with 10% fetal bovine serum (FBS, Life Technologies) and 1000 U

52 penicillin/streptomycin (Life Technologies). Cells were transfected using FuGENE transfection reagent (Promega) with either 1 μg wild-type or S249P construct. Two days after transfection, cells were given fresh media, stained with NucBlue™ Live Cell Stain (Molecular Probes), and photographed using a Zeiss EVOS imaging system.

Mouse husbandry and breeding

Mice were maintained in the animal resources facilities at Boston Children’s Hospital.

This work was conducted with the ethical approval of the Institutional Animal Care and Use

Committee at Boston Children’s Hospital. Adult mice homozygous for the conditional Wasl allele (WaslL2L) were a gift from Dr. Scott Snapper. These mice were crossed to the Prrx1-Cre driver line. All resulting progeny were phenotypically wild type, and those carrying the driver transgene were both in-crossed to one another and crossed to WaslL2L/L2L homozygotes. Offspring genotypes were observed in the expected ratios and were adult viable. Only WaslL2L/L2L; Prrx1-

Cre animals expressed an abnormal phenotype.

2.3. Results

Breaking the teleost fin ground plan

Wild-type zebrafish pectoral fins are representative of the ancestral teleost configuration, with four proximal radials arranged side-by-side followed by small nodular distal radials (Figure

2.1B). All four proximal radials are in direct contact with the shoulder early in development, but the two posterior radials shift distally in adulthood (Grandel and Schulte-Merker, 1998). To identify genes affecting the form and pattern of the adult skeleton in zebrafish, we conducted a forward mutagenesis screen focused on dominant mutations (Henke et al., 2017). In our screen,

53 we isolated a mutant that breaks from the teleost ground plan by forming supernumerary long bones along the PD axis of the pectoral fin endoskeleton (Figure 2.1C). We call these new bones

‘intermediate radials.’ They are found between the posterior proximal radials and distal radials, and they do not articulate directly with the shoulder. The overall pattern and size of the fin rays are not dramatically altered. We named this mutant rephaim (reph). The mutant phenotype exhibits varied expressivity and dose sensitivity, as homozygous fish are highly dysmorphic

(Supplemental Figure 2.2). Due to the severity of the homozygous condition, we have focused our analysis on heterozygous reph mutants.

Uncovering novel fin patterning genes

Using whole-exome sequencing, we mapped the reph mutation to chromosome 4 (Bowen et al., 2012; Supplemental Figure 2.3). Analysis of sequence data from the linked interval identified a missense mutation in the gene wiskott-aldrich syndrome-like b (waslb), changing a serine to a proline at amino acid position 265 (Figure 2.1D). Waslb is a member of the WAS protein family of actin cytoskeleton signaling regulators, which interact with Cdc42 and Arp2/3 to nucleate filamentous actin formation, and have roles in cell migration, cell signaling, and cell polarity (Snapper and Rosen, 1999). Additionally, nuclear-localized Wasl is required for the transcription of select genes through its interaction with nuclear actin, transcription factors, and

RNA polymerase (Ferrai et al., 2009; Wu et al., 2006).

To verify that the waslb mutation causes the reph phenotype, as well as to determine the genetic nature of the dominant reph allele, we used CRISPR-Cas9 to generate targeted frameshift mutations in wild-type waslb as well as in cis to the candidate reph S265P mutation, and assessed their effect on fin skeleton patterning (Figure 2.1D, Supplemental Figure 2.4). Loss-of-

54 function of wild-type waslb does not have any obvious effect on fin patterning (Supplemental

Figure 2.5). However, frameshift mutations generated upstream in cis to the missense mutation lead to reversion of the mutant phenotype, restoring the wild-type radial pattern. Small, in-frame deletions in cis to the mutation failed to rescue the wild-type phenotype. Together, these results demonstrate that the identified S265P mutation in waslb causes the reph phenotype, likely through a gain-of-function effect. The altered residue in reph is conserved across vertebrates and is positioned in a hinge region that is thought to regulate auto-inhibition and localization of the protein (Suetsugu and Takenawa, 2003). Consistent with this, introduction of the reph mutation into fluorescently tagged Wasl protein led to a marked reduction in nuclear localization of the fusion protein in cell culture (Supplemental Figure 2.5). Similar shifts in localization have been observed in Wasl constructs bearing phosphomimetic substitutions at a tyrosine residue adjacent to the residue mutated in reph (Suetsugu and Takenawa, 2003). This reduction in nuclear localization points towards a possible increase in cytoplasmic waslb function in the reph mutant.

Genetic interactors of Wasl signaling

As waslb is a novel factor in appendage development, we sought to identify additional loci that affect fin endoskeletal patterning in a similar manner. Although large dominant screens are not common in zebrafish, mutants having viable dominant phenotypes have been identified as a by-product of recessive genetic screens. We searched published screens and identified a mutant called wanda (wan) with a phenotype similar to reph (Supplemental Figure 2.2; Haffter et al., 1996; van Eeden et al., 1996). We obtained the wan mutant and found that it exhibited intermediate radials in a pattern similar to reph (Figure 2.1E), a phenotype that had not been

55 previously reported. Similar to reph, wan shows variable phenotypic expressivity and dose sensitivity (Supplemental Figure 2.2).

Unexpectedly, the wan mutant turned out to not be allelic to reph, but is instead due to a mutation in a different locus. We mapped wan and identified a missense mutation in a conserved residue of the vav2 gene on chromosome 21 (S67A; Figure 2.1D, Supplemental Figure 2.3). The

Vav family of protooncogenes consists of proteins that function as guanosine nucleotide exchange factors for Rho GTPases, and have roles in signal transduction, cytoskeletal regulation, cell motility, and receptor endocytosis (Bustelo, 2001, 2014; Hornstein et al., 2004). We created vav2 loss-of-function mutations using CRISPR-Cas9 and found that vav2 homozygous null zebrafish are viable and have no skeletal phenotypes (Supplemental Figures 2.4, 2.5), consistent with the phenotype reported for the Vav2 knockout mouse (Fujikawa et al., 2003). In addition, truncating mutations made in cis upstream of the S67A wan mutation cause reversion of the wan skeletal phenotype (Figure 2.1D, Supplemental Figure 2.5). Thus, similar to reph, wan causes fin patterning changes through a gain-of-function mutation.

Vav2 activates the small G-protein Cdc42 (Abe et al., 2000), and Cdc42 in turn regulates the activity of Wasl (Carlier et al., 1999). As such, it is likely that the similar phenotypes observed in reph and wan mutants are due to their effect on a common signaling pathway. To test this hypothesis, we crossed waslb loss-of-function alleles to the wan/vav2 mutant and found that waslb function is required for the expression of the wan phenotype (Figure 2.1E). Thus, waslb is epistatic to vav2, and these genes act together in a common pathway to pattern the fin endoskeleton (Figure 2.1F). Whole mount in situ hybridization reveals that both genes are expressed in fins during early patterning stages (Figure 2.1G), suggesting that these genes might

56 act in the developing fin mesenchyme. Interestingly, neither waslb nor vav2 have previously been associated with fin or limb development, skeletogenesis, or embryonic patterning at large.

Fin fold integrity is unchanged in rephaim

In the fin to limb transition, there was a reduction of the dermal skeletal fin rays concomitant with the elaboration of the endoskeleton, until fin rays were ultimately lost in crown tetrapods. Fin rays arise from the larval fin fold (Yano et al., 2012). Mechanistic hypotheses regarding the fin-to-limb transition posit a developmental trade-off between the fin endoskeleton and the fin fold, such that early formation of the fin fold in teleosts results in their diminutive endoskeleton (Thorogood, 1991). Previous studies have tested if reduction of the fin fold can result in limb-like characteristics in developing zebrafish fins. Experimental perturbation of the fin fold during early development leads to an enlargement of the endoskeletal disc in larval zebrafish, suggesting that the fin fold represses disc growth (Lalonde and Akimenko, 2018;

Masselink et al., 2016). However, similar to the effect of reducing hox13 paralog function

(Nakamura et al., 2016), subsequent elaboration of the adult fin endoskeleton is generally negligible, or has not been assessed, in the different manipulations.

To determine if changes in fin fold dynamics underlie intermediate radial development, we examined fin fold formation in reph+/- mutants (Figure 2.2). Immunolabeling of actinodin, the collagens that support the larval fin fold, revealed no differences between wild-type and reph+/- pectoral fins at 3 days post fertilization (dpf; Figure 2.2A, B). We also find no difference in endoskeletal disc size at 7 dpf (Figure 2.2C-E). The absence of changes in the endoskeletal disc and fin fold is consistent with a lack of patterning defects in 3-week-old mutant fins (Figure

2.2F, G). Thus, contrary to previous hypotheses, changes to fin fold development are not required for PD elaboration of the endoskeleton in reph+/- mutants.

Figure 2.2. Novel skeletal elements arise by segmentation of a common precursor (A and B) Immunolabeling of actinotrichia fibers (n=4). (C and D) Alcian-stained pectoral fins. e, Endoskeletal disc area is not significantly different between wild-type and reph+/- fins (7 dpf, wild-type (n=18), reph+/- (n=35), Welch’s Two Sample t-test, t = -1.7145, p > 0.098). Fin ontogeny in wild-type (F, H, J) and reph+/- (G, I, K) fish (n=5). (F and G) Initial separation of the endoskeletal disc. (H and I) Proximal mineralization of the radials. Posterior radial cartilages are elongated in reph+/- mutants (brackets). (J) wild-type proximal radials exhibit continuous zones of mineralization. (K) reph+/- mutants develop a secondary bone collar (asterisk) separated from the proximal ossification by cartilage (arrowhead). Anterior to left, distal to top; ED, endoskeletal disc; FF, fin fold; 1-4, proximal radials; scale bars (A-D) 50 μm, (F-K) 125 μm.

58 Formation of intermediate radials in rephaim

In teleost fishes, the fin endoskeleton first forms as a continuous endoskeletal disc of cartilage that is subsequently subdivided into the four proximal radial anlagen by localized involution and trans-differentiation, followed by perichondral ossification (Figure 2.2F, H; Dewit et al., 2011; Grandel and Schulte-Merker, 1998). This process occurs normally in reph+/- mutants

(Figure 2.2G). It is only after initial patterning and differentiation that differences are seen between wild-type and mutant fish endoskeletons, when reph+/- mutants show an elongation of the more posterior cartilage condensations compared to wild-type fish (Figure 2.2I). The extended condensations in reph+/- mutants form multiple sites of mineralization, with the nascent intermediate radial forming a distinct bone collar (Figure 2.2K), while wild-type siblings have a continuous zone of mineralization beginning proximally and growing distally (Figure 2.2J). The elongated condensation in mutants is subsequently segmented, resolving into two distinct bones separated by joint territories. This mode of ossification and cartilage segmentation in reph+/- mutants has not been reported in the pectoral fins of any other teleost, and is similar to tetrapod limb development, where an initially continuous condensation is segmented along the PD axis to produce independent elements separated by a joint (Hall, 2015).

Morphological integration of an expanded fin skeleton

Histological analysis of adult fins reveals that, while proximal radials possess epiphyses only at their distal ends, reph intermediate radials form both proximal and distal epiphyses

(Figure 2.3A, B). Both distal and proximal epiphyses exhibit normal differentiation of the cartilage in reph+/- mutants. Like the epiphyses of wild-type proximal radials and the long bones of tetrapod limbs, the newly formed epiphyses of intermediate radials express bone patterning

Figure 2.3. Intermediate radials are long bones morphologically integrated into the fin (A-F) Histology of adult fins. (A) Wild-type proximal radial with a single distal epiphysis (bracket). (B) reph+/- intermediate radial with dual epiphyses, a muscle insertion point (asterisk). (C) ihha expression in epiphyses of intermediate radial. (D) Blood vessel invading an intermediate radial (arrowhead). (E) Synovial joint between intermediate and proximal radials. (F) prg4b expression in the proximal-intermediate radial joint. (G) Diagram of muscle attachment in the tetrapod limb versus wild-type and reph+/- zebrafish pectoral fins. dr, distal radial; ir, intermediate radial; pr, proximal radial; anterior to left, distal to top; scale bars 50 μm.

genes such as indian hedgehog a (ihha; Figure 2.3C; Kronenberg, 2003). Intermediate radials also show evidence of vascular invasion (Figure 2.3D), suggesting the activation of endochondral ossification programs in reph+/- mutants similar to those found in tetrapod long bones and the bones of larger fishes (Haines, 1942). In limbs, synovial joints are formed between long bone elements (Hall, 2015). Similarly, in reph+/- mutants, proximal and intermediate radials form a distinct joint pocket between them with specialized differentiation of mesenchyme shaping the interface (Figure 2.3E). We find that the terminal joint marker prg4b (Askary et al.,

2016; Rhee et al., 2005) is expressed in the superficial chondrocytes of epiphyses, as well as in cells lining the joint space (Figure 2.3F). These findings suggest that the joint differentiation programs found in limbs are also activated in the reph intermediate radials.

60 In limbs, muscles originate from the shoulder as well as the limb bones and insert on more distal positions along the appendage (Figure 2.3G). Zebrafish, in contrast, have seven muscles that originate on elements of the shoulder girdle and insert directly on the dermal fin rays, bypassing the fin long bones entirely (Diogo et al., 2018). This configuration of the pectoral fin musculature is representative of most teleost fishes, and only in certain derived lineages does a muscle insert on pectoral fin radial bones (Winterbottom, 1973). Surprisingly, reph+/- intermediate radials have insertion points from muscles originating from the shoulder (Figure

2.3B). Thus, not only does the reph mutation reveal a capacity to make differentiated and patterned long bones, but these elements are morphologically integrated to form limb-like joints and muscle connections not seen in the fins of other teleosts.

Wasl is required for normal limb patterning and axial identity in tetrapods

Both wasl and vav2 have not previously been implicated in the regulation of developmental patterning. To assess if the patterning roles of vav2/waslb signaling are zebrafish specific, or if they are conserved across bony fishes, we asked if Wasl is required for normal tetrapod limb development. As homozygous somatic knockout of Wasl in mouse is embryonic lethal (Snapper et al., 2001), preventing analysis of adult limb patterning, we generated mice with conditional loss of Wasl function in developing limb progenitors by crossing the Prrx1-Cre driver (Logan et al., 2002) into a floxed WaslL2L background (Cotta-de-Almeida et al., 2007).

WaslL2L/+ and WaslL2L/L2L animals lacking the Cre driver are phenotypically wild type, as are

WaslL2L/+ heterozygotes with the driver (Figure 2.4A-D, Supplemental Table 2.1). However,

WaslL2L/L2L; Prrx1-Cre limb knockout (LKO) mice exhibit dramatic defects in limb and axial patterning. The long bones of LKO mouse limbs are shorter and wider than those of wild-type

61 siblings (Figure 2.4A, C). LKO mice also exhibit various coalitions of the carpal bones (Figure

2.4B), while the tibia and fibula fail to fuse (Figure 2.4C). Axial homeosis occurs in LKO mice, where the first sacral vertebra is transformed to exhibit partial or complete lumbar identity

(Figure 2.4D). This demonstrates that Wasl is necessary for proper patterning in limbs and the vertebral column. Intriguingly, this syndrome of axial and appendicular phenotypes closely matches those resulting from somatic loss of Hoxa11 function (Small and Potter, 1993), a gene thought to have played a key role in the fin to limb transition.

Waslb regulates appendage patterning through hoxa function

It is unclear if proximal radials and the mutant intermediate radials have a specific positional identity defined by hox gene expression, as is observed in the elements of tetrapod limbs. Limbs have a tripartite bauplan that has been canalized through their evolutionary history

(Figure 2.1), consisting of one long bone (humerus) in the upper arm (the stylopod), two side-by- side long bones (radius and ulna) in the forearm (the zeugopod), and many nodular and long bones in the wrist and hand (the autopod). Differential expression of Hox genes along the growing limb is essential for specification of positional identity and growth (Zakany and

Duboule, 2007). The A and D members of Hox paralogy group 13 are expressed in the autopod, while the A and D members of group 11 are expressed in the zeugopod (Haack and Gruss, 1993;

Nelson et al., 1996; Yokouchi et al., 1991). Loss of either group results in the reduced growth or even absence of the elements in which they are expressed (Davis et al., 1995; Fromental-Ramain et al., 1996). The pectoral fins of teleosts and other ray-finned fishes do not exhibit comparable hox regulation, as hox11 and hox13 paralogs are expressed in overlapping domains (Metscher et al., 2005; Sordino et al., 1995; Tulenko et al., 2017). This has been thought to be consistent with

62 the simple adult skeleton formed in teleost fins (Metscher et al., 2005). Interestingly, hox13 genes are however required for the development of the distal fin rays (Nakamura et al., 2016).

We asked if intermediate radials formed through activation of waslb signaling bear a positional identity specified by a Hox code similar to that found in limbs. Based on the Wasl

LKO mouse phenotype, we hypothesized that reph might interact with hoxa11 paralogs. To test this, we created null alleles of the hoxa11a, hoxa11b, and hoxd11a genes and examined how loss of these factors affects the expression of the reph phenotype. Homozygous null mutants for all three paralogs are viable and fertile, singularly and in combination, and do not show obvious phenotypes in the formation of the fin skeleton (Figure 2.4G, Supplemental Figure 2.6).

However, in reph+/- mutants, loss of hoxa11 paralog function resulted in the loss of intermediate radials, reverting the reph+/- pectoral skeleton to the wild-type pattern (Figure 2.4H). This result suggests that the intermediate radials formed in reph+/- mutants share a zeugopodial-type identity, and developmental homology, with the radius and ulna. Our findings demonstrate that, in contrast to the roles of hox13 paralogs in regulating formation of distal fin ray structures (Figure

2.4I; Nakamura et al., 2016), hox11 paralogs do not have essential roles in normal patterning of the zebrafish fin. Rather, the functional necessity of hoxa11 paralogs is revealed only in the context of intermediate radial formation in reph+/- mutants.

The Hox13 group genes can repress the activity of more proximal Hox genes in a process termed posterior prevalence (Duboule, 1991). In limbs, Hoxa13 suppresses Hoxa11 activity, and these genes form mutually exclusive expression domains at the stylopod/autopod boundary.

Ectopic expression of Hoxa11 in the autopod leads to broadening of the hand plate along the AP axis and polydactyly (Kherdjemil et al., 2016). Consistent with the broad retention of genomic architecture of the Hox complex across vertebrate evolution (Woltering et al., 2014) and the

Figure 2.4. Wasl is required for mouse limb patterning and interacts genetically with Hox genes to pattern fins. (A-D) Skeletal phenotype of Prrx1-Cre; WaslL2L/L2L (LKO) mice and wild-type littermates (see also Supplemental Table 2.1). (A) forearm; (B) wrist; (C) lower leg; (D) vertebrae. (E-J) Genetic interaction between waslb and hox genes in zebrafish fin patterning. (E) Wild-type. (F) waslbreph/+ mutants forming intermediate radials (arrowhead; n=8/9). (G) hoxa11a-/-; hoxa11b-/-; hoxd11a-/- mutants. (H) waslbreph/+; hoxa11a-/-; hoxa11b-/-; mutants fail to form intermediate radials (bracket; n=7/8). (I) hoxa13a-/-; hoxa13b-/- mutants. (J) waslbreph/+; hoxa13a-/-; hoxa13b-/-; hoxd13a+/- mutants show enhanced PD elaboration with multiple intermediate radials (arrowheads). (K) Model of region-specific requirements of Hox paralogs in PD patterning of fin and limb bones. Anterior to left, distal to top; c, central carpal; d2-4, distal carpals; py, pyramidal; L6, lumbar vertebrae 6; S1, sacral vertebrae 1; sl, scapholunate; scale bars (A, C, E) 1 mm, (B) 500 μm, (E-J) 250 μm.

64 requirement of hox11 function to form reph-mediated supernumerary elements, we found that loss of hox13 function resulted in the development of additional supernumerary long bones along the PD axis, but only in the context of waslb gain-of-function caused by the reph mutation

(Figure 2.4J). The necessity of hoxa11 paralogs for the expression of the reph+/- phenotype reveals the presence of a functional Hox code and regulatory network (Woltering et al., 2014) within developing teleost pectoral fins capable of specifying intermediate domains similar to that found in limbs. This suggests that the intermediate radials have a hox11 identity and share developmental homology with the zeugopodial structures of the tetrapod limb (Figure 2.4K).

However, the manifestation of this positional code is not normally expressed in teleost fishes, but is revealed by the action of the reph and wan mutations.

2.4. Discussion

The integration and differentiation of the novel long bones formed in reph and wan pectoral fins is unique amongst teleost fishes and harkens to the development and anatomy of long bones in the limbs of tetrapods. The common ancestor of all bony fishes, including humans, had a pectoral fin skeleton that consisted of multiple long bones arranged side by side, each articulating with the shoulder (Supplemental Figure 2.1; Gegenbaur, 1865; Zhu and Yu, 2009).

This polybasal condition of the endoskeleton consisted of unsegmented elements in the middle and anterior portions of the appendage, and the posterior metapterygium, which branched and was segmented along the PD axis. It is hypothesized that the tetrapod limb skeleton evolved via loss of the anterior components and elaboration of the metapterygium. Teleosts, on the other hand, are thought to have maintained the polybasal condition and lost the metapterygium

(Gegenbaur, 1878; Grandel, 2003; Tulenko et al., 2016). Interestingly, the skeletal elaboration

65 seen in reph and wan is restricted to the posterior region of the pectoral skeleton, resembling the morphology of basal actinopterygian and lobe-finned fishes (Coates, 1994; Jessen, 1972). Thus, it is possible that teleosts retain a cryptic ancestral axis of growth, corresponding to the metapterygial axis, whose potential for elaboration is revealed by these mutants.

The exact mutations we identify in wasl and vav2 are not observed in tetrapods.

However, these mutations reveal a previously unexplored pathway that has unappreciated roles in appendage patterning, and the evolution of which may have played a part in historical changes to appendage structure. Here, we have demonstrated genetic interaction between Hox genes and

Wasl. Further investigation of how vav2/wasl signaling interacts with the larger context of known limb patterning programs will likely reveal other unexpected connections.

It is unlikely that the mutations identified in this study are specifically instructive of limb- ness, but are instead permissive of endogenous limb-like developmental programs latent in fishes. A component of these mutation-activated programs is a functional Hox code, retained in teleost fishes, with specific intermediate (hoxa11) and distal (hoxa13) patterning cues. Our results reveal latent or emergent properties of development within vertebrate appendages to form elaborate, articulated skeletal structures. These patterning processes were present in the bony fish ancestor and potentially refined in the evolution of lobe-finned fishes during the transition to land.

2.5. References

Abe, K., Rossman, K. L., Liu, B., Ritola, K. D., Chiang, D., Campbell, S. L., Burridge, K., & Der, C. J. (2000). Vav2 is an activator of Cdc42, Rac1, and RhoA. The Journal of Biological Chemistry, 275(14), 10141–10149.

Arratia, G. (1999). The monophyly of Teleostei and stem-group teleosts. Mesozoic Fishes, 2, 265–334.

Askary, A., Smeeton, J., Paul, S., Schindler, S., Braasch, I., Ellis, N. A., Postlethwait, J., Miller, C. T., & Crump, J. G. (2016). Ancient origin of lubricated joints in bony vertebrates. eLife, 5. https://doi.org/10.7554/eLife.16415

Betancur-R, R., Wiley, E. O., Arratia, G., Acero, A., Bailly, N., Miya, M., Lecointre, G., & Ortí, G. (2017). Phylogenetic classification of bony fishes. BMC Evolutionary Biology, 17(1), 162.

Bustelo, X. R. (2001). Vav proteins, adaptors and cell signaling. Oncogene, 20(44), 6372–6381.

Bustelo, X. R. (2014). Vav family exchange factors: an integrated regulatory and functional view. Small GTPases, 5(2), 9.

Carlier, M. F., Ducruix, A., & Pantaloni, D. (1999). Signalling to actin: the Cdc42-N-WASP- Arp2/3 connection. Chemistry & Biology, 6(9), R235–R240.

Coates, M. I. (1994). The origin of vertebrate limbs. Development. Supplement, 169–180.

Cotta-de-Almeida, V., Westerberg, L., Maillard, M. H., Onaldi, D., Wachtel, H., Meelu, P., Chung, U.-I., Xavier, R., Alt, F. W., & Snapper, S. B. (2007). Wiskott Aldrich syndrome protein (WASP) and N-WASP are critical for T cell development. Proceedings of the National Academy of Sciences of the United States of America, 104(39), 15424–15429.

Davis, A. P., Witte, D. P., Hsieh-Li, H. M., Potter, S. S., & Capecchi, M. R. (1995). Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11. Nature, 375(6534), 791–795.

Diogo, R., Ziermann, J. M., Molnar, J., Siomava, N., & Abdala, V. (2018). Muscles of Chordates: Development, Homologies, and Evolution. CRC Press.

Duboule, D. (1991). Patterning in the vertebrate limb. Current Opinion in Genetics & Development, 1(2), 211–216.

Ferrai, C., Naum-Onganía, G., Longobardi, E., Palazzolo, M., Disanza, A., Diaz, V. M., Crippa, M. P., Scita, G., & Blasi, F. (2009). Induction of HoxB transcription by retinoic acid requires actin polymerization. Molecular Biology of the Cell, 20(15), 3543–3551.

Freitas, R., Gómez-Marín, C., Wilson, J. M., Casares, F., & Gómez-Skarmeta, J. L. (2012). Hoxd13 contribution to the evolution of vertebrate appendages. Developmental Cell, 23(6),

67 1219–1229.

Fujikawa, K., Miletic, A. V., Alt, F. W., Faccio, R., Brown, T., Hoog, J., Fredericks, J., Nishi, S., Mildiner, S., Moores, S. L., Brugge, J., Rosen, F. S., & Swat, W. (2003). Vav1/2/3-null mice define an essential role for Vav family proteins in lymphocyte development and activation but a differential requirement in MAPK signaling in T and B cells. The Journal of Experimental Medicine, 198(10), 1595–1608.

Gegenbaur. (n.d.). Untersuchungen zur vergleichenden anatomie der wirbelthiere, (p. 730). Leipzig, W. Engelmann.

Gegenbaur, & Bell. (1878). Elements of Comparative Anatomy / (Vol. 1878, p. 684). London.

Grandel, H. (2003). Approaches to a comparison of fin and limb structure and development. Theory in Biosciences = Theorie in Den Biowissenschaften, 122(2), 288–301.

Grandel, H., & Schulte-Merker, S. (1998). The development of the paired fins in the zebrafish (Danio rerio). Mechanisms of Development, 79(1-2), 99–120.

Haack, H., & Gruss, P. (1993). The establishment of murine Hox-1 expression domains during patterning of the limb. Developmental Biology, 157(2), 410–422.

Haffter, P., Odenthal, J., Mullins, M. C., Lin, S., Farrell, M. J., Vogelsang, E., Haas, F., Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J., Kane, D. A., Kelsh, R. N., Hopkins, N., & Nüsslein-Volhard, C. (1996). Mutations affecting pigmentation and shape of the adult zebrafish. Development Genes and Evolution, 206(4), 260–276.

Haines, R. W. (1942). THE EVOLUTION OF EPIPHYSES AND OF ENDOCHONDRAL BONE. Biological Reviews of the Cambridge Philosophical Society, 17(4), 267–292.

Hall, B. K. (2005). Bones and Cartilage: Developmental and Evolutionary Skeletal Biology. Elsevier.

Hornstein, I., Alcover, A., & Katzav, S. (2004). Vav proteins, masters of the world of cytoskeleton organization. Cellular Signalling, 16(1), 1–11.

Jackman, W. R., Draper, B. W., & Stock, D. W. (2004). Fgf signaling is required for zebrafish

68 tooth development. Developmental Biology, 274(1), 139–157.

Jessen, H. L. (1972). Fossils and Strata, Schultergurtel und Pectoralflosse bei Actinopterygiern. Lethaia, 5(3), 344.

Kettleborough, R. N. W., Busch-Nentwich, E. M., Harvey, S. A., Dooley, C. M., de Bruijn, E., van Eeden, F., Sealy, I., White, R. J., Herd, C., Nijman, I. J., Fényes, F., Mehroke, S., Scahill, C., Gibbons, R., Wali, N., Carruthers, S., Hall, A., Yen, J., Cuppen, E., & Stemple, D. L. (2013). A systematic genome-wide analysis of zebrafish protein-coding gene function. Nature, 496(7446), 494–497.

Kherdjemil, Y., Lalonde, R. L., Sheth, R., Dumouchel, A., de Martino, G., Pineault, K. M., Wellik, D. M., Stadler, H. S., Akimenko, M.-A., & Kmita, M. (2016). Evolution of Hoxa11 regulation in vertebrates is linked to the pentadactyl state. Nature, 539(7627), 89–92.

Kronenberg, H. M. (2003). Developmental regulation of the growth plate. Nature, 423(6937), 332–336.

Lalonde, R. L., & Akimenko, M.-A. (2018). Effects of fin fold mesenchyme ablation on fin development in zebrafish. PloS One, 13(2), e0192500.

Logan, M., Martin, J. F., Nagy, A., Lobe, C., Olson, E. N., & Tabin, C. J. (2002). Expression of Cre recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis, 33(2), 77–80.

Nakamura, T., Gehrke, A. R., Lemberg, J., Szymaszek, J., & Shubin, N. H. (2016). Digits and fin rays share common developmental histories. Nature, 537(7619), 225–228.

Near, T. J., Eytan, R. I., Dornburg, A., Kuhn, K. L., Moore, J. A., Davis, M. P., Wainwright, P. C., Friedman, M., & Smith, W. L. (2012). Resolution of ray-finned fish phylogeny and timing of diversification. Proceedings of the National Academy of Sciences of the United States of America, 109(34), 13698–13703.

69 Nüsslein-Volhard, C., & Dahm, R. (2002). Zebrafish: a practical approach. Oxford University Press.

Pardo, J. D., Szostakiwskyj, M., Ahlberg, P. E., & Anderson, J. S. (2017). Hidden morphological diversity among early tetrapods. Nature, 546(7660), 642–645.

R_Core_Team (2014). R: A language and environment for statistical computing. In R Foundation for Statistical Computing (Vienna, Austria).

Rhee, D. K., Marcelino, J., Baker, M., Gong, Y., Smits, P., Lefebvre, V., Jay, G. D., Stewart, M., Wang, H., Warman, M. L., & Carpten, J. D. (2005). The secreted glycoprotein lubricin protects cartilage surfaces and inhibits synovial cell overgrowth. The Journal of Clinical Investigation, 115(3), 622–631.

Small, K. M., & Potter, S. S. (1993). Homeotic transformations and limb defects in Hox A11 mutant mice. Genes & Development, 7(12A), 2318–2328.

Smith, A., Zhang, J., Guay, D., Quint, E., Johnson, A., & Akimenko, M. A. (2008). Gene expression analysis on sections of zebrafish regenerating fins reveals limitations in the wholemount in situ hybridization method. Developmental Dynamics: An Official Publication of the American Association of Anatomists, 237(2), 417–425.

Snapper, S. B., & Rosen, F. S. (1999). The Wiskott-Aldrich syndrome protein (WASP): roles in signaling and cytoskeletal organization. Annual Review of Immunology, 17, 905–929.

Snapper, S. B., Takeshima, F., Antón, I., Liu, C. H., Thomas, S. M., Nguyen, D., Dudley, D., Fraser, H., Purich, D., Lopez-Ilasaca, M., Klein, C., Davidson, L., Bronson, R., Mulligan, R. C., Southwick, F., Geha, R., Goldberg, M. B., Rosen, F. S., Hartwig, J. H., & Alt, F. W. (2001). N- WASP deficiency reveals distinct pathways for cell surface projections and microbial actin- based motility. Nature Cell Biology, 3(10), 897–904.

Sordino, P., van der Hoeven, F., & Duboule, D. (1995). Hox gene expression in teleost fins and the origin of vertebrate digits. Nature, 375(6533), 678–681.

Starks, E. C. (1930). The Primary Shoulder Girdle of the Bony Fishes. Stanford University Press.

Suetsugu, S., & Takenawa, T. (2003). Translocation of N-WASP by nuclear localization and export signals into the nucleus modulates expression of HSP90. The Journal of Biological Chemistry, 278(43), 42515–42523.

Tulenko, F. J., Augustus, G. J., Massey, J. L., Sims, S. E., Mazan, S., & Davis, M. C. (2016). HoxD expression in the fin-fold compartment of basal gnathostomes and implications for paired

70 appendage evolution. Scientific Reports, 6, 22720.

Tulenko, F. J., Massey, J. L., Holmquist, E., Kigundu, G., Thomas, S., Smith, S. M. E., Mazan, S., & Davis, M. C. (2017). Fin-fold development in paddlefish and catshark and implications for the evolution of the autopod. Proceedings of the Royal Society B: Biological Sciences, 284(1855), 20162780. van Eeden, F. J., Granato, M., Schach, U., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J., Kane, D. A., Kelsh, R. N., Mullins, M. C., Odenthal, J., Warga, R. M., & Nüsslein-Volhard, C. (1996). Genetic analysis of fin formation in the zebrafish, Danio rerio. Development, 123, 255–262.

Winterbottom, R. (1973). A Descriptive Synonymy of the Striated Muscles of the Teleostei. Proceedings of the Academy of Natural Sciences of Philadelphia, 125, 225–317.

Woltering, J. M., Noordermeer, D., Leleu, M., & Duboule, D. (2014). Conservation and divergence of regulatory strategies at Hox Loci and the origin of tetrapod digits. PLoS Biology, 12(1), e1001773.

Wu, X., Yoo, Y., Okuhama, N. N., Tucker, P. W., Liu, G., & Guan, J.-L. (2006). Regulation of RNA-polymerase-II-dependent transcription by N-WASP and its nuclear-binding partners. Nature Cell Biology, 8(7), 756–763.

Yano, T., Abe, G., Yokoyama, H., Kawakami, K., & Tamura, K. (2012). Mechanism of pectoral fin outgrowth in zebrafish development. Development, 139(16), 2916–2925.

Yokouchi, Y., Sasaki, H., & Kuroiwa, A. (1991). Homeobox gene expression correlated with the bifurcation process of limb cartilage development. Nature, 353(6343), 443–445.

Zakany, J., & Duboule, D. (2007). The role of Hox genes during vertebrate limb development. Current Opinion in Genetics & Development, 17(4), 359–366.

Zhu, M., & Yu, X. (2009). Stem sarcopterygians have primitive polybasal fin articulation. Biology Letters, 5(3), 372–375.

71 Chapter 3: N-WASP has specific roles in skeletal patterning in vertebrates

72 Chapter 3: N-WASP has specific roles in skeletal patterning in vertebrates

My recent discoveries suggest an important but unrecognized role for N-WASP in skeletal patterning of the vertebrate limb. This was surprising as there was no prior indication of a specific role of WASP family proteins in skeletal development. Here, I demonstrate the requirement of N-WASP for skeletal patterning during development using functional genetic approaches in the zebrafish Danio rerio and the mouse Mus musculus. Using CRISPR gene editing to knock out both wasla and waslb paralogs in the zebrafish I find that, as in mouse, Wasl function is essential for early development and viability. Using the conditional regulation of

Wasl function in the mouse, I show a broader role of Wasl for the normal patterning of the vertebrate skeleton in the developmental specification of calvaria, cranial base, hyoid, appendages, and rib cage. Generation of a conditional gain-of-function knock-in Wasl allele in the mouse suggests complex regulation of Wasl in skeletal development. Altogether, these results show that N-WASP has specific, critical, and heretofore unappreciated roles in skeletal patterning across vertebrates that extend beyond simple requirement for cell viability and proliferation. Through the comparison of sequence conservation among vertebrates, I identified tetrapod-specific regulatory changes, suggesting the evolution of lineage-specific mechanisms that correlate with the evolution of unique appendage morphologies.

3.1. Introduction

Prior to the findings described in Chapter 2, N-WASP was not known to play a role in the patterning of the skeleton, despite this protein being extensively studied in other contexts. Since

N-WASP is a regulator of actin cytoskeletal components, it was possible that general cellular

73 deficiencies of the protein would cause broad tissue defects, as suggested by the embryonic lethality of the loss of function mouse and zebrafish. However, N-WASP also interacts with various signaling pathways and could have specific effects on skeletal patterning. My discovery of a viable gain-of-function mutation in the N-WASP paralog waslb, which activates conserved developmental programs that cause specific patterning alterations in the skeleton, supports this hypothesis. I set out to investigate the role of N-WASP in skeletal development at large. Using functional genetics in zebrafish and mouse I find that N-WASP function is required for normal skeletal development across vertebrates, affecting specific patterning and morphogenic events during skeletal development. The shared requirement of N-WASP in the skeleton suggests that this protein plays a role in conserved skeletal patterning pathways and not just cell homeostasis and viability.

Overview of the WASP protein family

The WASP family of proteins are effectors of small GTPases, linking upstream signaling to actin nucleators and coordinating the cyto- and nucleoskeletal responses of the cell (Alekhina et al., 2017). WASP and N-WASP play direct roles in diverse cellular processes, including actin polymerization, membrane ruffling and protrusion, cell migration, receptor endocytosis, cell division, cell signaling, DNA damage repair, and gene transcription (Veltman and Insall, 2010).

Accordingly, these genes impact many different aspects of vertebrate development, such as muscle cell fusion (Gruenbaum et al., 2012), immune cell maturation and function (Liu et al.,

2013), hair follicle turnover (Lefever et al., 2010; Lyubimova et al., 2010), gamete maturation

(Wang et al., 2016), wound healing (Cvejic et al., 2008; Jain et al., 2016), and neural patterning

(You et al., 2010).

74 Discovery of the WASP gene family

The founding member of the Wiskott-Aldrich syndrome (WAS) gene family was first cloned from human patients with WAS, an X-linked recessive immunodeficiency disease that causes eczema, bloody diarrhea, low platelet count (thrombocytopenia), recurrent infections, and increased risk of malignancy (Ochs and Thrasher, 2006). Mapping the causative mutated locus identified loss-of-function mutations in unrelated WAS patients. This gene was named

WISKOTT-ALDRICH SYNDROME PROTEIN (WAS or WASp; Derry et al., 1994). Initial characterization of the encoded protein product revealed the presence of a nuclear localization sequence (NLS), proline-rich region, and acidic C-terminus (Derry et al., 1994). The second member of the WAS gene family was identified as a protein isolated from bovine brain tissue, and was accordingly named neural WASP or N-WASP (Miki et al., 1996). Sequence analysis revealed that WASP and N-WASP proteins share ~50% identity and have similar domain structure (Supplemental Figure 2.4). N-WASP orthologs were subsequently identified in human and rat (Fukuoka et al., 1997) and throughout metazoa, including cnidarians (Lehnert et al.,

2012). While the protein is called N-WASP, the genomic locus is called wiskott-aldrich syndrome protein-like (Wasl).

Following the discovery of WASP and N-WASP, additional members of the WASP family of proteins have been found across eukaryotes (Veltman and Insall, 2010). The vertebrate complement of this family includes WASP, N-WASP, WASH, WAVE1, WAVE2, WAVE3,

WAVE4, WHAMM1, WHAMM2, and WAWH (Kollmar et al., 2012). This protein family is united by a common domain structure in the middle and C-termini of the proteins, which include the Proline rich region, the WASP homology 2 (WH2) domain, the central region, and the acidic

75 region. The family is divided into WASP and WAVE subfamilies owing to differences in the N- termini of the proteins.

Domain structure and molecular interactions of WASP and N-WASP

Among vertebrates, WASP and N-WASP proteins are about 500 amino acids long and have a similar domain architecture (Alekhina et al., 2017). However, N-WASP is distinguished by the presence of an IQ motif (a putative Calmodulin binding site) and a second WH2 domain in tandem to the first (Miki et al., 1996; Mullins, 2000). Alone, both WASP and N-WASP reside in an autoinhibited state whereby the N-terminal binds and blocks the function of the C-terminal

(Kim et al., 2000). Binding and activation by other proteins releases this inhibition, and protein- protein interactions can recruit WASP and N-WASP to different regions of the cell membrane, cytoplasm, and nucleus (Alekhina et al., 2017). Activated WASP and N-WASP then recruit the actin nucleation machinery and promote polymerization of F-actin.

WASP and N-WASP participate in many protein-protein interactions through various domains, as well as intramolecular autoinhibitory interactions. Through the plekstrin homology

(PH) domain, WASP and N-WASP are bound by WASP-interacting protein (WIP), a protein that is involved in cortical actin cytoskeleton formation and stabilizes WASP and N-WASP (Ramesh et al., 1997; de la Fuente et al., 2007). The WH1 domain also binds phosphatidylinositol(4,5)bisphosphate (PIP2), a membrane-tethered signaling molecule involved in many signaling pathways, including epidermal growth factor (EGF) signaling (Miki et al.,

1996; Rohatgi et al., 1999; Czech, 2000). The GBD/CRIB domain is an important hub of WASP and N-WASP regulation that is bound by active Rho family small GTPases such as Cell division cycle (Cdc42) and Rac (Aspenström et al., 1996). Active GTP-bound Cdc42 binds the

76 GBD/CRIB and stabilizes the active open confirmation of WASP and N-WASP (Rohatgi et al.,

1999). Adaptor proteins Grb2 and Nck bind the polyproline region of WASP and N-WASP through their SH3 domains, and link these proteins to receptor signaling at the plasma membrane

(Quilliam et al., 1996; She et al., 1997; Carlier et al., 2000). The WH2/verprolin domain binds globular actin, and the acidic domain at the C-termini of WASP and N-WASP binds the actin microfilament nucleator actin-related proteins 2/3 (ARP2/3; Miki and Takenawa, 1998;

Machesky and Insall, 1998). Thus, WASP and N-WASP integrate many different pathways within the cell and are subject to various levels of regulation and integration.

Cellular localization and nuclear functions of WASP and N-WASP

WASP and N-WASP are found in both the nuclear and cytosolic fractions of the cell.

Both proteins have nuclear localization sequence (NLS) and nuclear export sequence (NES) signals, but they differ in how phosphorylation and activation affects their relative distributions in the nucleus and cytoplasm (Verboon et al., 2015). Phosphorylation of N-WASP by small

GTPases at a particular tyrosine residue (amino acid position 253) releases N-WASP from its autoinhibited conformation and activates the protein (Suetsugu et al., 2002). Using N-terminal

GFP fusion constructs, Suetsugu and Takenawa showed that wild type N-WASP is found in both the cytoplasm and nucleus at similar levels in COS-7 cells under serum-starvation conditions

(2003). However, the introduction of phosphomimetic mutations, replacing this phosphorylation target tyrosine residue with a positively charged glutamic acid, results in increased cytoplasmic, and decreased nuclear, localization. Replacement of tyrosine 253 with a phospho-‘null’ phenylalanine had the opposite effect, shifting more N-WASP to the nucleus (Suetsugu and

Takenawa, 2003). Modifications of other positions known to regulate N-WASP activity, such as

77 inactivating phosphorylation of threonine residue 259 by Dryk1A, have no effect on N-WASP localization (Park et al., 2012). Thus, activation of N-WASP promotes its cytoplasmic localization, while the inactive conformation is likely nuclear localized. Additional studies, however, have suggested that N-WASP in the nucleus can also exist in the open activated confirmation (Wu et al., 2004). In contrast to N-WASP, WASP is predominantly localized to the cytoplasm and moves into the nucleus upon activation (Taylor et al., 2010).

The functions of nuclear localized WASP and N-WASP have yet to be resolved. WASP and N-WASP are found in nuclear protein complexes that have roles in regulating gene expression and DNA repair (Miyamoto and Gurdon, 2013). N-WASP is found in complex with polypyrimidine-tract-binding-protein-associated splicing factor–non-Pou-domain octamer- binding protein/p54nrb (PSF-NonO), nuclear actin, and RNA polymerase II (Wu et al., 2006).

Transcriptional activity of this complex was found to require N-WASP-mediated actin polymerization. Notably, N-WASP is shown to form complexes with the PBX/Knotted 1

Homeobox 1 (Pknox1, also known as Prep1), actin, and RNA polymerase II (Ferrai et al., 2009).

This complex is required for the transcription of retinoic acid-inducible HoxB genes, and this function is also dependent on actin polymerization. While N-WASP has roles in the transcriptional machinery, nuclear WASP may also affect gene transcription at the level of epigenetic control and histone modification. WASP interacts with chromatin remodeling complexes to increase H3K4me3 histone methylation at the promoter of TBX21, enhancing transcription of the locus (Taylor et al., 2010). In contrast to N-WASP, the gene expression effects of WASP are independent of actin polymerization (Sadhukhan et al., 2014). Additionally,

WASP has been implicated in homology-directed repair of double-stranded DNA breaks caused by nucleases and ionizing radiation (Schrank et al., 2018; Hurst et al., 2019; Wen et al., 2019).

78 Thus, even though there is considerable conservation between N-WASP and WASP, they each seem to have broad and specialized functions. Given the pleiotropic functions of these WASP family members, a clear mechanism of how N-WASP may affect skeletal patterning during development is not clear.

Expression patterns of WASP and N-WASP

Spatial expression patterns during embryogenesis based on whole-mount in situ hybridization (WMISH) of Was and Wasl have not been reported for mouse, chick, or frog. The expression pattern of Was and Wasl was first assayed by Northern blotting of RNA extracted from cell lines as well as human and rat tissues. While the expression of WASP is restricted to the hematopoietic lineage, N-WASP is expressed ubiquitously, with highest expression in the nervous system (Derry et al., 1994; Miki et al., 1996; Snapper et al., 2001). Subsequently, Was and Wasl transcription was detected in the adult mouse spleen, liver, and brain by RT-PCR (Kim et al., 2006). WASP protein was also detected in the E9.5 mouse heart by immunohistochemistry

(Fritz et al., 2019).

Given the maintenance of the two WASP paralogs in zebrafish, wasa and wasb, their differential expression could alleviate early lethality and permit specific function. Previous

WMISH were limited to early development, and wasa and wasb were found to be expressed in the hematopoietic lineage of 3 days post fertilization (dpf) larvae (Cvejic et al., 2008).

Expression of the N-WASP paralog waslb was found not to be spatial restricted in the zebrafish embryo (Thisse and Thisse, 2004). The extent of these analyses are limited and do not resolve the question of potential subfunctionalization of wasl function underlying specific roles in skeletogenesis.

79 Conditional approaches to N-WASP genetics

Prior to my findings, genetic approaches to investigate N-WASP/Wasl function have been largely limited to studies in mouse. Wasl function is required for viability, and individuals homozygous for null Wasl alleles exhibit embryonic lethality by gestational age embryonic day

11 (E11; Snapper et al., 2001; Lommel et al., 2001). In order to examine the phenotypic effects of Wasl loss-of-function, conditional knockout approaches are required. The Cre-lox system of the mouse (Rossant and McMahon, 1999) is best suited for such tissue-specific modification, as many tissue specific driver lines are known and a “floxed” Wasl allele was available (see

Chapter 2). Three groups have independently generated floxed Wasl alleles for conditional knockout experiments, one removes exon 2 (Cotta-de-Almeida et al., 2007), another removes exons 6 through 9 (Lommel et al., 2001), and the third removes exons 3 and 4 (Jain et al., 2014).

Each floxed allele has been verified using Western blot analysis to produce no functional N-

WASP protein product following recombination. Using various Cre driver lines, studies have found roles for Wasl in many tissue types and processes, including T and B cell development

(Cotta-de-Almeida et al., 2007; Westerberg et al., 2012; Liu et al., 2013), wound closure (Jain et al., 2016), skin barrier formation (Kalailingam et al., 2017), Schwann cell-mediated nerve myelination (Jin et al., 2011; Novak et al., 2011), pancreatic β cell differentiation (Kesavan et al.,

2014), pancreatic tumor initiation (Lubeseder-Martellato et al., 2017), skin tumor formation (Li et al., 2019), muscle cell fusion (Gruenbaum-Cohen et al., 2012), kidney morphogenesis

(Reginensi et al., 2013), lung vasculature permeability (Wagener et al., 2016), intestinal tumorigenesis (Morris et al., 2018), and hair follicle cycling (Lefever et al., 2010; Lyubimova et al., 2010). These studies have revealed that Wasl interacts with known developmental genetic pathways, like TGF-β, epidermal growth factor (EGF), and Wnt/β-catenin. These myriad effects

80 highlight the novelty of the finding of specific N-WASP function in skeletal patterning after conditional inactivation in the lateral plate mesoderm (LPM; Chapter 2).

Here, I describe my efforts to further explore the role of N-WASP in regulation of skeletogenesis and patterning. I take advantage of specific, and well described, Cre-driver lines that primarily drive expression in the trunk and limbs, and one that is active in the neural crest:

• The Prrx1-Cre driver line expresses Cre recombinase in the LPM as well as a subset of

craniofacial mesenchyme (Logan et al., 2002). As a result, this driver allows for the

investigation of conditional knockout phenotypes in the limb bones, sternum, and caudal

aspects of the skull.

• To further address aspects of timing on N-WASP function within limb mesenchyme, I

utilized the HoxB6-Cre driver line, which expresses Cre earlier in the hindlimb LPM and the

Midbrain/Hindbrain boundary (Lowe et al., 2000). However, after limb induction, HoxB6-

Cre is expressed throughout the hind limb but is restricted in the forelimb bud to the posterior

mesenchyme (Li et al., 2005). Thus, the HoxB6-Cre enables phenotypic analysis in the

sternum, the hindlimb, and portions of the forelimb.

• The T-cre driver line drives expression in the early mesoderm lineage and thus results in

recombination in a wide range of tissues (Perantoni et al., 2005). This driver would permit

analysis of the phenotype in both the axial and appendicular skeleton. T-cre is the most

extensive Cre-driver in the trunk (Akiyama et al., 2015).

• The Wnt1-Cre line drives Cre expression in the premigratory neural crest in the neural tube

(Lewis et al., 2013). Neural crest gives rise to many cell types in the body, including head

mesenchyme. The Wnt1-Cre2 line enables analysis of the dermal skull, chondrocranium,

inner ear, and hyoid.

81 In this chapter, I extend the analysis I began in Chapter 2 to better characterize how changes in N-WASP function affect the skeleton in zebrafish and mouse. First, I examine in zebrafish how loss of both N-WASP paralogs, wasla and waslb, impacts skeletal patterning and viability. Second, I use conditional knockout approaches in the mouse to demonstrate the necessity of N-WASP for normal patterning of the skull, limbs, and sternum. Finally, I describe the generation of a conditional gain-of-function gene knock-in mouse that carries the reph mutation identified in Chapter 2. Altogether, these results demonstrate the critical importance of

N-WASP paralogs in skeletal development across vertebrates and suggest that conserved mechanisms of skeletal patterning are conserved between teleosts and tetrapods.

3.2. Materials and methods

Zebrafish lines and husbandry

Zebrafish were housed and maintained at the Animal Resources Children’s Hospital

(ARCH) Aquatic Resources Program (ARP) facility in the Enders building at Boston Children’s

Hospital (BCH). All lines and methods were approved by the Institute Animal Care and Use

Committee (IACUC) at BCH under protocol 19-07-3948 under Principal Investigator Matthew

Harris. The hoxa13a reporter lines Tg(m-Inta11-β-globin:mCherry) and

Tg(2Pand1Epi3mut:eGFP) were gifts from Marie-Andrée Akimenko (University of Ottawa).

Gene editing to produce null alleles of wasla was performed as described in Chapter 2 for other loci using the guide sequence 5’ AGTGGTCCAGGTTTACGGGG 3’ to target exon 2.

Genotyping of wasla alleles was performed by PCR using the primers wasla_L: 5’

TTCATGACACATTTATGATTCCG 3’ and wasla_R: 5’ AGGGTTGTCTTTCACCAAACAG

82 3’ followed by heteroduplexing and size discrimination by gel electrophoresis. Descriptions of mutant phenotypes are based on a minimum of ten individuals for each genotype.

Immunolabeling and F-actin labeling

Fish were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) pH 7.4 for 4 hours at room temperature. After fixation, fishes were washed with four, 30-minute washes in

PBS + 0.3% Triton X100 (PBSX). F-actin was then labeled with an overnight wash at 4°C with

Alexaflour-conjugated phalloidin at a dilution of 1:500 in PBSX. To counterlabel nuclei, DAPI was also added at 1:500. After labeling, fish were then washed with four, one-hour PBSX washes, followed by a one-hour wash in 1:1 glycerol:PBST. Fish were then moved to 4:1 glycerol:PBST for imaging and storage. All washes from the labeling step forward were carried out in a light-blocking container. Whole-mount immunolabeling of actinotrichia collagen filaments was carried out as previously described by Lalonde and Akimenko (2018).

Mouse lines and husbandry

Mice were housed and maintained at the ARCH facility in the Enders building at BCH.

All lines and methods were approved by IACUC at BCH under protocols 16-05-3165R and 19-

04-3910R under Principal Investigator Matthew Warman. The conditional Wasl line (Wasltm2Sbs) was a gift from Dr. Scott Snapper at BCH. The HoxB6-Cre driver line (Tg(Hoxb6-cre)#Mku) was a gift from Dr. Susan Mackem at the National Institutes of Health (NIH). The T-cre driver

(Tg(T-cre)1Lwd) was a gift from Dr. Jyoti Rao (Pourquié Lab) at Harvard Medical School

(HMS). The Prrx1-Cre (Tg(Prrx1-cre)1Cjt) and Wnt1-Cre2 (E2f1Tg(Wnt1-cre)2Sor) lines were purchased from The Jackson Laboratory. Descriptions of phenotypes are based on a minimum of

83 five wild type and five conditional knockout animals per age, per condition with a mix of sexes analyzed.

Generation of conditional N-WASP knock in mouse

WaslGt(LacZ-Ex8(t>c)) conditional knock-in mice were generated by the Gene Manipulation and Genome Editing Core at BCH. The targeting vector for the gene trap knock-in (pEM7-

NWASP-AdGTLacZ-mutEx8-TGV) was created by Dr. Patrick Smits at BCH. CRISPR guides targeted to the endogenous locus were used with Cas9 to created double-strand breaks in the genome and facilitate integration of the gene trap. Integration of the gene trap creates a null Wasl allele that expresses lacZ, and Cre-mediated recombination of the gene trap removes the targeting vector and creates a N-WASP protein with the S249P rephaim mutation.

Recombination was confirmed by PCR on cDNA made from mRNA extracted from the autopod of E13.5 embryos carrying the gene trap and the Prrx1-Cre driver.

3.3. Results

Loss-of-function analysis of Wasl signaling in the zebrafish

In Chapter 2, I identified waslb as having roles in skeletal patterning and developmental potential. Zebrafish possess two N-WASP paralogs, wasla and waslb, owing to the whole- genome duplication at the base of teleosts (Taylor et al., 2001). To more fully understand the role of N-WASP in zebrafish skeletal development, I sought to make mutant alleles of the other paralog to remove all N-WASP function. Using CRISPR-Cas9 gene editing, I generated two null alleles of wasla that are nonfunctional due to generation of frameshift mutations early in the

Figure 3.1. Generation of wasla null alleles in zebrafish and genetic interaction with rephaim and wanda. (A) Schematic of frameshift null alleles generated by CRISPR-Cas9 gene editing. Blue box indicates guide sequence, red text indicates inserted bases. (B) The adult pectoral fins of wasla mh151/151 homozygous mutants exhibit wild type patterning. (C) External adult phenotype wasla null mutants and compound mutants. Single homozygous mutants of wasla and waslb have a wild type phenotype. Loss of wasla from rephaim and wanda mutant backgrounds has no effect on these mutant phenotypes, while loss of waslb suppresses the wanda phenotype.

coding region (Figure 3.1A). Heterozygous and homozygous wasla mutants are viable, fertile, exhibit no obvious phenotypic abnormalities, and show normal fin endoskeleton patterning, similar to waslb mutants (Figure 3.1B and 3.1C). To determine if wasla interacts with waslb in the manifestation of the rephaim phenotype, I crossed null wasla alleles into the waslbreph background. Removal of wasla function did not modify the severity of the waslbreph phenotype

85 (Figure 3.1C), demonstrating that the effect of the waslbreph mutation is independent of wasla function. This suggests that wasla and waslb may have been subfunctionalized in teleost evolution, or that the reph mutation is neomorphic. In Chapter 2, I found an epistatic interaction between waslb and vav2, such that waslb function was required for expression of the vav2wan phenotype and suggesting that vav2 is upstream of waslb in a genetic pathway. While homozygous loss of waslb is able to suppress the wanda phenotype, homozygous loss of wasla had no effect on expression of the wan phenotype (Figure 3.1C). This result demonstrates that wasla and waslb do not necessarily play a role in the same genetic pathways and support subfunctionalization of the wasl paralogs in the zebrafish.

N-WASP function is required for early fin development and viability in zebrafish

Because wasla and waslb likely have redundant functions in development, I generated wasla/waslb double homozygous null (DKO) animals to observe the effect of complete loss of

N-WASP function in zebrafish. Unlike the single mutants, DKO mutants exhibited high mortality at 96 hours post fertilization (hpf), and none survived past 120 hpf. This early lethality is an expected outcome of loss of N-WASP, as N-WASP null mice exhibit embryonic lethality by E11 (Snapper et al., 2001). Zebrafish DKO mutants are indistinguishable from their wild-type siblings until 72 hpf, when DKO mutants have smaller heads, reduced fin folds, and a slight curvature to the body (Figure 3.2A). While the endoskeletal disc of DKO mutants appears normally formed in these mutants, the fin fold is highly dysmorphic, being of reduced size and curling back on the fin (Figure 3.2B). Antibody labeling of collagen II reveals that the DKO fin fold does not make mature actinotrichia.

Figure 3.2. wasla/waslb double mutants exhibit severe fin fold defects, and dysregulation of F-actin assembly. (A) Wild type and wasla/waslb double mutant larvae (DKO) at 3 dpf. Double mutants have a curved body and smaller fin folds. (B) Pectoral fin morphology in 3 dpf wild type and DKO mutant larvae shown with Alcian blue (AB) cartilage staining, DAPI nuclei labeling, and collagen II antibody labeling. DKO mutants have a reduced fin fold that does not contain actinotrichia (asterisk). (C) Phalloidin labeling of F-actin in wild type and mutant 3 dpf pectoral fins demonstrating reduced fin fold length (red line) in mutants. In developing wild-type fins, F- actin is found at cell boundaries, skeletal muscle, and in puncta in the fin fold mesenchyme. In contrast, wasla +/-; waslb -/- mutants have large aggregates of F-actin along cell boundaries in the fin fold (red arrowhead) and DKO mutants exhibit individual cells with intense F-actin labeling. Anterior to left, dorsal to top in A, anterior to left, distal to top in B and C; FF, fin fold; ED, endoskeletal disc; AT, actinotrichia.

Given the role of N-WASP in F-actin formation, I asked if DKO mutants had defects in

F-actin regulation during fin development. To visualize F-actin I used a fluorescent conjugate of phalloidin that binds and stabilizes F-actin (Cooper, 1987). In 3 dpf wild-type pectoral fins, F-

87 actin is found at cell boundaries (heightened staining found between the cells of the endoskeletal disc), the muscle fibers radiating across the disc, and in puncta spread throughout the mesenchyme of the fin fold (Figure 3.2C). Most mutant genotypes (wasla single homozygotes, waslb single homozygotes, and wasla/waslb trans-heterozygotes) were indistinguishable from the wild-type F-actin condition (Data not shown). However, wasla+/-;waslb-/- and DKO mutants exhibited F-actin defects in the fin fold. The pectoral fins of wasla+/-;waslb-/- mutants show large aggregates of F-actin at the cell boundaries of the fin fold, in addition to more phalloidin signal in the cells in general. DKO fins also have high phalloidin background and exhibit small cells with high F-actin signal. The number of F-actin puncta is reduced in wasla+/-;waslb-/- mutants and even more so in DKO mutants. Altogether, these results show that N-WASP function is critical for normal growth and patterning of the fin fold and homeostasis of the actin cytoskeleton.

N-WASP regulates lamellipodia formation in migrating fin fold cells

Within the developing fin fold resides a population of migratory mesenchymal cells that emerge around 48 hpf at the distal region of the presumptive endoskeletal disc and move into the fin fold as it expands (Lalonde et al., 2016). These cells pattern the actinotrichia and give rise to the bony lepidotrichia of the adult fin rays, and have long lamellipodia that project distally from the cell body (Nakamura et al., 2016; Lalonde and Akimenko, 2018; Phan et al., 2019). The cells express the distal Hox genes hoxa13a, hoxa13b, and hoxd13a, and are labeled by distal Hox reporter lines (Gehrke et al., 2015; Kherdjemil et al., 2016; Nakamura et al., 2016; Lalonde et al.,

2016). The transgene Tg(2Pand1Epi3mut:eGFP) is a Hox13-responsive sensor that uses the and1 regulatory region to drive expression of enhanced green fluorescent protein (eGFP;

88 Lalonde et al., 2016). The transgene Tg(m-Inta11-β-globin:mCherry) is another Hox13- responsive sensor that uses the mouse Hoxa-11 antisense promoter to drive mCherry expression

(Kherdjemil et al., 2016).

Given the interaction between rephaim and Hox genes shown in Chapter 2, and the effect on the actin cytoskeleton in DKO mutants, I asked if this migratory mesenchymal population was affected by changes in N-WASP function. Using the Tg(2Pand1Epi3mut:eGFP) and phalloidin labeling, I found that the F-actin puncta are located along the length of the lamellipodia of the Hox13+ migratory cells (Figure 3.3C). Seeing this association between actin cytoskeleton and the Hox13+ cells, I then asked if the behavior of the puncta would be changed in N-WASP mutants with defects in F-actin. To test this, I crossed the Tg(m-Inta11-β- globin:mCherry) reporter into the rephaim and wasla/waslb mutant backgrounds. This reporter marks the same population as the Tg(2Pand1Epi3mut:eGFP) line but has more consistent intensity across individuals. For analysis, I looked at the developing caudal fin, which is less dysmorphic in DKO mutants and more amenable to imaging and has a similar migratory population to the pectoral fin. In DKO animals, the Hox13+ migratory cells have fewer lamellipodia and decreased polarization toward the distal end of the fin (Figure 3.3D). In rephaim homozygotes, the Hox13+ cells retained polarity and had an increase in the number of lamellipodia. These data support a model in which wasla and waslb are required for the normal behavior of Hox13+ migratory cells, which pattern the fin fold and subsequent fin rays. Whether changes in the behavior of these cells is restricted to the dermal skeleton or if there are secondary effects on patterning of the proximal endoskeleton are interesting questions that merit further investigation.

Figure 3.3. Lamellipodia formation in migrating fin fold mesenchyme cells is modified by wasla and waslb. (A) Single confocal channels of a 3 dpf wild-type pectoral fin labeled for nuclei (DAPI), F-actin (phalloidin), and Hox13-responsive migratory fin fold mesenchyme cells (eGFP transgene). (B) Merge of the channels in A, showing localization of the GFP+ cells in the fin fold. (C) Blow-up of the region indicated in B, showing localization of F-actin puncta along the distal lamellipodia of the migratory fin fold mesenchyme cells (white arrowhead). (D) Migratory cell morphology in wild type, DKO, and rephaim mutants. DKO cells have fewer projections than wild type, while homozygous rephaim mutants make additional projections.

90 N-WASP is required for normal patterning of dermal and endochondral bones of the mouse skull

The vertebrate skull is an extremely complex structure, the proper patterning of which requires the coordinated interaction of the ectoderm, endoderm, mesoderm, and neural crest

(Hall, 2013). Elements of the head skeleton are derived from both the paraxial mesoderm and the neural crest, and both of these lineages give rise to both endochondral and dermal bones (Noden and Trainor, 2005; Piekarski et al., 2014). To examine the role of Wasl in the patterning of the neural crest-derived regions of the skull, I made conditional knockout mice using the Wnt1-Cre2 driver, which expresses Cre recombinase in the premigratory neural crest (Lewis et al., 2013). I crossed Wasl L2L/+; Wnt1-Cre2 males to Wasl L2L/L2L females and obtained Wasl L2L/L2L; Wnt1-

Cre2 (hereafter Wnt1 cKO) pups in the expected Mendelian frequency. Wnt1 cKO pups were born alive but lacked a milk spot, indicating their inability to feed. Examination of the phenotype revealed that Wnt1 cKO pups have severe cleft palate and are unable to suckle (Figure 3.4A).

The overall morphology of the Wnt1 cKO head appears blunted compared to wild type littermates, with a short, wide snout. Clearing and staining of skeletal tissues revealed that Wnt1 cKO neonates have severe defects in the calvaria preventing covering of the brain, and when viewing cleared Wnt1 cKO animals from the dorsal aspect the cranial base can be seen (Figure

3.4B). Analysis using µCT shows that the frontal bone of Wnt1 cKO animals is restricted to the lateral edge of the skull and does not extend medially to cover the head and meet along the midline as in wild type littermates (Figure 3.4C).

Removal of the ethmoid, nasal, maxillary, and premaxillary bones reveals a dramatically expanded nasal capsule in Wnt1 cKO pups that is wider and shorter compared to wild-type animals (Figure 3.4D). The nasal septum is also doubly wide in Wnt1 cKO pups, connecting with a widened basisphenoid. Since the basisphenoid is derived from mesoderm and not neural crest,

Figure 3.4. Loss of Wasl from the neural crest results in defects in the dermal and endochondral head skeleton. (A) Inferior view showing palate morphology in Wnt1 cKO animals and wild type littermates at P0. Wnt1 cKO animals have clefting of the palate (red line). (B) Dorsal view of P0 Wnt1 cKO and wild type littermate cleared and stained for skeletal elements. The frontal bones fail to cover the brain in Wnt1 cKO animals, and the cartilage of the cranial base is visible through the skull. (C) µCT rendering dorsal view of Wnt1 cKO and wild type littermate highlighting defects in frontal (orange) and parietal (blue) calvaria. (D) Inferior view of the rostrum with overlaying bones removes of Wnt1 cKO animals and wild type littermates. The nasal septum and capsule are expanded in Wnt1 cKO animals. Horizontal bar indicated width of the nasal septum at the anterior limit of the presphenoid. (E) Hyoid of wild type and Wnt1 cKO littermates. Wnt1 cKO animals exhibit fusion of the lesser horn to the hyoid body (black arrow). While wild type animals have a single center of ossification, Wnt1 cKO animals can exhibit two split centers (asterisks). (E) Wnt1 cKO animals exhibit an ectopic cartilaginous strut connecting the basisphenoid to the middle ear (black arrow) that is not seen in wild type littermates (asterisk). Rostral to top in A, B, C, and D; anterior to left, dorsal to top in F; Fr., frontal bone; Pr., parietal bone; PS, presphenoid; BS, basisphenoid; TC, thyroid cartilage; CC, cricoid cartilage; TR, tracheal cartilages; LH, lesser horn; GH, greater horn; MC, Meckel’s cartilage; ETM, ectotympanic.

92 it is likely that the modified shape in this structure is secondary to another defect caused by the loss of Wasl from the neural crest.

The patterning of the viscerocranium is also affected by the loss of Wasl. In wild type animals, the hyoid bone forms as an H-shaped structure, with a middle bar, the rostrally projecting lesser horns, and the caudally projecting greater horns (Figure 3.4E). The hyoid in

Wnt1 cKO animals takes on a V-shape, resulting from the fusion of the lesser horns to the middle bar, and an angle in the midpoint of the bar. While the middle bar normally forms a single continuous bone collar, Wnt1 cKO neonates sometimes have two distinct sites of ossification that fail to form a full collar around the circumference of the cartilage. Interestingly, Wnt1 cKO animals exhibit ectopic cartilaginous linkages from the cranial base to the ear. These cartilages run from the basitrabecular process of the basisphenoid to the region of the middle ear (Figure

3.4F).

Model of N-WASP skeletal regulation arising from calvarial development.

A similar calvaria phenotype observed in Wnt1 cKO mutants is observed in Prrx1 cKO animals. While Wnt1 cKO animals have defects in the frontal bones, Prrx1 cKO animals have a comparable phenotype in the parietal bones (Figure 3.5A) corresponding to the contributions of the targeted cell populations contributing to the different calvarial bones. The parietal bones in

Prrx1 cKO animals fail to extend fully and only meet in a small portion of the midline to form a reduced sagittal suture. The frontal bones in these animals extend caudally to fill the space left by the parietal bones. In severe cases, the parietal bones do not touch one another, the sagittal suture is absent, and the frontal bones almost make contact with the interparietal.

Figure 3.5. Mechanistic hypothesis for cellular basis of calvaria development phenotypes in N-WASP mutants. (A) Suture phenotype in Prrx1 cKO mutants and wild type littermate at P30. In wild type animals, the frontal suture (red line) lines in between the frontal bones, and extend caudally until it meets the sagittal suture (yellow line), which lies in between the parietal bones. In Prrx1 cKO mutants, the parietal bones are reduced in size, resulting in a limit sagittal suture at the midline, and the frontal bones expand caudally to fill the space. In severe cases there is no contact between the parietal bones, the sagittal suture is absent, and the frontal bones almost reach the interparietal. Lower schematic highlights shape of the frontal (orange), parietal (blue), and interparietal (purple). (B) Loss of Wasl from neural crest results in the failure of frontal bone expansion. (C) F-actin tipped lamellipodia in migrating mesenchyme of the zebrafish fin are affected by mutations in Wasl. (D) Dorsal view of 21 dpf zebrafish skull expressing the Sp7:mCherry transgene to label osteoblasts. Blow-up shows extensions of migratory mesenchyme. (E) Model of the role of N-WASP dependent cell migration in calvaria formation, using the frontal bone as an example (adapted from Cesario et al., 2018). At E12.5, bone progenitors reside laterally above the eye. Over development, cells from either side continue to proliferate and migrate until they meet on the midline on the dorsal aspect of the skull and form sutures. Defects in cell migration result in smaller calvaria and modified suture pattern.

In collaboration with Dr. Radhika Atit at Case Western Reserve University, we have developed a mechanistic hypothesis to explain the role of N-WASP in calvaria development.

Since the anlage of the calvaria arise on the lateral parts of the head and expand toward the midline (Figure 3.5E), the phenotype may be due to alterations in cell migration capability rather than proliferation or differentiation. As I find changes to lamellipodia in wasla and waslb

94 zebrafish mutants, the calvaria phenotypes might be due to defects in cell-matrix interactions.

Using the sp7:mCherry reporter line to label osteoblasts in the zebrafish, we observed cells with lamellipodia-like projections on the growing edges of the frontal and parietal bones of 21 dpf fish (Figure 3.5D). Dr. Atit’s work suggests that a fibronectin gradient exists as a gradient across the skull roof and may act to guide osteogenic precursors from the edge of the head toward the midline. Our model proposes that N-WASP is required for the migration of the precursors along the gradient, and loss of N-WASP results in dysmorphic frontal and parietal bones that fail to expand to cover the skull. My data has been used in support of an R01 application to the

National Institutes of Health from the Harris and Atit labs to test this model.

Loss of N-WASP from the mesoderm is not compatible with viability

My prior work with Prrx1 cKO mice suggested that these mutants exhibited homeotic transformations in the axial skeleton (Chapter 2). However, since the Prrx1-Cre driver is typically expressed in the LPM and is only expressed in cells that give rise to the vertebrae when leaky expression occurs stochastically in the maternal germ line, I sought to bolster this result with a Cre driver that has bona fide expression in the axial skeleton. The T-cre driver line has the most extensive domain of Cre recombinase expression of the drivers used in this study, and it removes conditional floxed alleles from the entire mesodermal lineage. This driver would allow for the analysis of phenotypes resulting from the loss of Wasl from the vertebral column as well as the appendages. Unfortunately, however, I found that loss of Wasl from the mesoderm resulted in embryonic lethality. After initially failing to recover Wasl L2L/L2L; T-cre pups from several litters of crosses between Wasl L2L/L2L females to Wasl L2L/+; T-cre males, I began collecting embryos from females earlier in term. I sacrificed four pregnant females and found

Figure 3.6. T-cre cKO is embryonic lethal. A T-cre cKO embryo with a wild type littermate. Embryos were collected at gestational age E13.5. Wild type littermates display normal morphology, while the most advanced T-cre cKO embryos have a morphology resembling E12.5 embryos. Ventral to anterior, rostral to top; FL, forelimb; HL, hindlimb.

several aborted embryos in various degrees of resorption, the most developed of which resembled an E12.5 embryo based on limb morphology (Figure 3.6). Genotyping of these aborted embryos revealed them to be the missing Wasl L2L/L2L; T-cre animals. The most advanced

Wasl L2L/L2L; T-cre animals did not appear to have blood flow, suggesting that lethality might be due to circulatory issues. I performed skeletal staining on these animals, but the result was unsatisfactory. Future investigations into the role of Wasl in the patterning of axial structures should use a Cre driver that expresses in a smaller subset of the mesoderm.

Conditional N-WASP knockout with the Hoxb6-cre driver reveals additional appendicular skeleton phenotypes

To confirm my results using the Prrx1-Cre driver to knock out Wasl in the LPM presented in Chapter 2, I generated animals that have conditional loss of Wasl in tissues

Figure 3.7. Hoxb6 cKO mice exhibit more severe hindlimb phenotypes and less severe forelimb phenotypes than Prrx1 cKO mice. (A) Carpal morphology in P30 Hoxb6 cKO mutants and wild type littermates. Hoxb6 cKO exhibit coalition of the distal carpals 2 and 3 with the central carpal. (B) Ankle morphology in P30 Hoxb6 cKO mutants and wild type littermates. Hoxb6 cKO mutants show fusion of the calcaneus and distal tarsal 5, as well as fusion of the centrale with distal tarsals 2 and 3. (C) Forelimb morphology in P30 Hoxb6 cKO mutants and wild type littermates. Prrx1 cKO mutants have shorter and thicker long bones, while Hoxb6 cKO mutants approximate wild type morphology. (D) The pelvic girdle is dysmorphic in Hoxb6 cKO mutants. Hoxb6 cKO mutants show fusion of the pubis with the ischium (arrow) while Prrx1 cKO animals have wild-type morphology at P0. (E) The pubis and ischium remain fused in P30 Hoxb6 cKO mutants (arrow), and the pubis and ischium are dysmorphic. Anterior to left, distal to top in A; anterior to right, distal to top in B and C; medial to left, rostral to top in E; 2, distal tarsal 2; 3, distal tarsal 3; 5DT, distal tarsal 5; AST, astragalus; CAL, calcaneus; CEN, centrale; C, central carpal; D#, distal carpal number; IL, ilium; IS, ischium; P, pubis; PY, pyramidal; SL, scapholunate.

expressing the Hoxb6-Cre driver. Like the Prrx1-Cre driver, the Hoxb6-Cre driver expresses

Cre recombinase in the LPM. However, there are important differences in the expression pattern of these drivers. The Hoxb6-Cre driver is expressed earlier in the posterior LPM than Prrx1-Cre, coming on at E8.5 instead of E9.5 (Lowe et al., 2000; Logan et al., 2002). However, Hoxb6-Cre comes on later in the forelimb than Prrx1-Cre (E10.5 versus E9.5), and the anterior regions of

97 the forelimb bud never express Cre. These differences in timing of Cre expression can allow for finer dissection of the spatial and temporal requirements of Wasl in limb patterning. I crossed

Wasl L2L/+; Hoxb6-Cre males to Wasl L2L/L2L females and obtained Wasl L2L/L2L; Hoxb6-Cre

(hereafter Hoxb6 cKO) pups in the expected Mendelian frequency.

Clearing and staining of Hoxb6 cKO animals revealed similar limb defects to those seen in Prrx1 cKO animals. Carpal coalition was observed in Hoxb6 cKO mutants, but at a lower frequency than Prrx1 cKO mutants (N = 2/7 versus 9/10, Figure 3.6A; Chapter 2 Fig. 3.4B).

Various fusions are also seen in the ankle of Hoxb6 cKO mice (Figure 3.7B). While Prrx1 cKO animals show fusion of distal tarsal 3 and the centrale (8/10), Hoxb6 cKO animals exhibit fusion of distal tarsals 2 and 3 with the central, and an additional fusion of distal tarsal 5 with the calcaneus (7/7). Hoxb6 cKO mutants exhibit dysmorphic tibia and fibula that fail to fuse at their distal ends, similar to that observed in Prrx1 cKO animals (10/10; Chapter 2 Fig. 3.4C). The long bones of Hoxb6 cKO mutant forelimbs appear similar to the wild-type phenotype and do not exhibit the stout morphology seen in Prrx1 cKO mutants (Figure 3.6C). In the pelvic girdle,

Hoxb6 cKO mutants show fusion of the pubis and the ischium (4/7), while Prrx1 cKO pelvises appear wild type in morphology (Figures 3.7D and 3.7E). Overall, Hoxb6 cKO mutants exhibit a milder forelimb phenotype and a more severe hind limb phenotype than Prrx1 cKO animals.

Posterior Hox gene expression in Prrx1 cKO embryos

One hypothesis for the observed middle limb patterning effects of reph zebrafish and

Wasl conditional mutant mice (Chapter 2) is that alteration in Wasl directly affects differential expression of Hox genes during development. To address this question, I asked if Hox gene expression in developing limbs is modified by loss of N-WASP. I performed WMISH on

Figure 3.8. Expression of posterior Hox genes in the developing limbs of Prrx1 cKO embryos. (A) Expression of Hoxa-11 and Hoxa-13 in the forelimb and hindlimb buds of Prrx1 cKO embryos and wild type littermates at E10.5. (B) Expression of Hoxa-11, Hoxa-13, Hoxd-11, and Hoxd-13 in the forelimb buds of Prrx1 cKO embryos and wild type littermates at E11.5. Anterior to left, distal to top; FL, forelimb; HL, hindlimb.

posterior HoxA and HoxD genes during limb patterning stages in Prrx1 cKO embryos and their wild-type littermates. I performed timed matings between Wasl L2L/+; Prrx1-cre males and Wasl

L2L/L2L females, and collected embryos at E10.5 and E11.5. The success rate of these timed matings was low, and to date I have been able to examine gene expression in a single Prrx1 cKO animal and a single wild type littermate per gene per stage. As such, the results presented here are preliminary, but they are an important addition to my overall findings concerning Wasl regulation of patterning. I found that the expression patterns of Hoxa-11, Hoxa-13, Hoxd-11, and

Hoxd-13 were similar between Prrx1 cKO embryos and wild type controls (Figure 3.8).

99 However, the domain of Hoxa-13 expression at E10.5 appears to be reduced in area somewhat in the Prrx1 cKO animal compared to the wild type control (Figure 3.8A). The Hoxd-13 expression domain and the distal expression domain of Hoxd-11 appear somewhat broader in Prrx1 cKO animal than in wild type (Figure 3.8B). While these results are intriguing, to have confidence that such subtle changes in expression domains are real biological signal would require a larger sample size. It would also be important to examine expression of these genes at later patterning stages to be able to make more conclusive statements.

Conditional knock-in of the rephaim gain of function mutation in mouse N-WASP

The reph mutation identified in zebrafish in Chapter 2 imparted gain-of-function effects to waslb function and resulted in unique, or revigorated, elaboration of the skeleton. As such, it is of interest to see if this mutant may have a similar gain of function effect on N-WASP in the mouse suggesting initiation of conserved appendage patterning pathways. I sought to introduce the reph mutation into mouse Wasl to determine its effects on skeletal development. Working with Dr. Patrick Smits along with the Gene Manipulation and Genome Editing Core at BCH, we created mice with a gene-trapped Wasl allele that will express a transcript with a mutation analogous to the reph mutation (S249P) in the presence of Cre recombinase (Figure 3.9A).

Without recombination activity, the insertion of the cassette at the locus (gene trap allele) is predicted to be disruptive to the Wasl locus. Homozygous mutant for the gene trap are embryonic lethal as expected. I used the Prrx1-Cre driver to activate the S249P gain-of-function mutation in the LPM. These animals were phenotypically wild type, with the exception of the sternum.

Animals carrying recombined gain-of-function allele exhibited fusions of the S3 and S4 sternebrae (Figure 3.9B). This phenotype was observed in animals that carried the gene trap over

100

Figure 3.9. Generation of a mouse line with conditional expression of a Wasl allele carrying the analogous S249P rephaim mutation. (A) Gene targeting strategy for knock-in of the gene trap construct. CRISPR guides direct endonuclease activity to the endogenous Wasl locus (scissors and red bars), these target sequences are not in the vector. The targeting vector is incorporated into the chromosome by homology directed repair. Without Cre recombinase activity, the gene trap allele acts as a Wasl null and expresses lacZ. Upon recombination, the lacZ cassette is excised, and the locus expresses a Wasl transcript with a mutated exon 8 that carries the S249P mutation. (B) Sternebrae fusion in occurs in Wasl conditional knockout as well as Wasl S249P knock in mice. Wild type animals have sternal elements separated by joints at the point where ribs meet the sternum. Wasl mutants exhibit sternebral fusion in the caudal region of the sternum. Rostral to top; Ma., manubrium; S#, sternebrae number; Xi., xiphisternum.

a wild type Wasl allele, as well as animals that carry the gene trap over the conditional L2L allele

(hemizygous). This phenotype is similar to that observed in conditional knockout animals generated with the Hoxb6-Cre and Prrx1-Cre drivers. Thus, the reph mutation in mouse may

101 have complex effects on the function of the protein, causing reduction in function of some aspects, at least in the functions that are relevant to sternum patterning.

The evolution of novel N-WASP regulation in tetrapods

Studies in mammalian cell culture have identified several residues in N-WASP that are modified by other proteins that regulate N-WASP activity and localization. One of these residues is a threonine in a conserved region in between the NES and proline rich region (Figure 3.10).

Phosphorylation of this threonine by Dyrk1a stabilizes the autoinhibited confirmation of N-

WASP (Park et al., 2012). This threonine is six residues away from a tyrosine which, when phosphorylated, stabilizes the open active form of N-WASP. While this tyrosine residue is conserved across vertebrates, the threonine is not. Interestingly, each tetrapod N-WASP ortholog that has been sequenced to date has a threonine at this position, while non-tetrapod vertebrates have other residues that are not typically phosphorylation targets in eukaryotes. This raises the interesting possibility of tetrapod-specific mechanisms of N-WASP regulation in tetrapods.

3.4. Discussion

The Wasl gene is a key regulatory gene with highly pleiotropic, diverse roles within the cell. It functions in different developmental processes, ranging from plasma membrane ruffling

(Wehland et al., 2005) to transcriptional activation in response to retinoic acid (Ferrai et al.,

2009). My work in Chapter 2 identified very specific function for wasl in regulating skeletal patterning. To delve into potential mechanisms underlying this role of Wasl function, I investigated loss-of-function alleles in developing zebrafish and mice, both globally and within specific tissues to understand its regulation of skeletal patterning. I found that Wasl is required

102

Figure 3.10. Multiple sequence alignment reveals tetrapod-specific residues that have roles in N-WASP regulation. Amino acid sequence alignment of N-WASP orthologs across vertebrates. Black boxes indicate non-consensus residues and the mutated reside in rephaim is indicated. Highlighted in yellow is a tyrosine residue conserved across vertebrates that is phosphorylated by small GTPases to regulate N-WASP activity and localization. Highlighted in orange is a tetrapod-specific threonine that is phosphorylated by Dyrk1a and promotes the autoinhibited confirmation of N-WASP. This reside is not conserved outside of tetrapods (grey box), suggesting that this mode of regulation might be unique to limbed vertebrates.

for the development of different skeletal structures of diverse origins and developmental modes.

After identifying commonalities in the formation of these different structures I have formulated a mechanistic hypothesis to explain the role of Wasl in the generation of the skeleton.

On wasl paralogs in the zebrafish

wasla and waslb appear to have distinct genetic interactions in the zebrafish. While waslb is required to express the Vav2/wanda mutant phenotype (Chapter 2), loss of wasla had no effect. One potential explanation is that wasla and waslb are expressed in different tissues or at different times during development, and that wasla is not expressed in the same time or place as vav2. However, results from a large WMISH screen suggest that at least waslb is not spatially restricted in its expression (Thisse and Thisse, 2004). A current direction in the Harris laboratory is a comprehensive analysis of vav2 and wasl paralog expression using endogenous knock-in reporter lines, which may provide better resolution that colorimetric WMISH.

103 Another possibility is that wasla and waslb have acquired divergent protein-protein interactions and wasla no longer interacts in the same pathway as vav2. Nothing is known about the functional consequences of sequence divergence between wasla and waslb, however these paralogs are functionally redundant as only the knockout of both genes results in embryonic lethality similar to that seen in the mouse, while single knockouts are compatible with viability.

This strongly supports subfunctionalization of the two paralogs in the zebrafish. This deduction is supported by a shared role between waslb and the single ortholog in mouse in the regulation of

Hox-dependent skeletal phenotypes in appendicular development, suggesting that the skeletal patterning function is not a neomorphic quality unique to zebrafish waslb.

The lethality of loss-of-function double mutants precludes examining the effect of Wasl loss on aspects of adult zebrafish skeletal pattern. The wasla/waslb double mutants do live long enough to assess the effects on one group of skeletal progenitors: the fin fold cells that give rise to the fin rays. DKO zebrafish developed a small fin fold lacking actinotrichia. This result is interesting considering the various hypotheses regarding the role of the fin fold in fin evolution and patterning. These hypotheses hold that reduction of the fin fold could enhance elaboration of the endoskeleton. However, in the case of waslb and reph, it is gain-of-function effects that enhance endoskeletal elaboration without affecting fin fold development (Chapter 2). It is then unexpected that loss-of-function of Wasl has a negative effect on fin fold development.

The effect of N-WASP on F-actin formation, lamellipodia, and skeletal pattern

Because N-WASP promotes and enhances F-actin nucleation and polymerization, it was surprising to find that loss of wasl paralogs in the zebrafish resulted in an increase in F-actin formation. Mutants are still able to form F-actin, but the distribution of the F-actin is grossly

104 abnormal and forms ectopic aggregates. This abnormal F-actin is in part due to changes in the lamellipodia of the migrating Hox13+ fin fold mesenchymal cells, which normally move into the fin fold and pattern the lepidotrichia. Unfortunately, DKO mutants are larval lethal, precluding the examination of the effect of modifying the lamellipodia on adult skeletal pattern. The development of tissue-specific tools to study wasl function in the zebrafish would be advantageous in this regard. It will be interesting to see how cell migration and lamellipodia behavior in the formation of mouse calvaria is impacted in by N-WASP. It is possible that perturbation of lamellipodia formation and cell migration is the general mechanism underlying the syndrome of N-WASPathies seen in the dermal skeleton of the fin rays and calvaria of conditional mutants.

While WASP is mutated in WAS, there are not congenital conditions associated with N-

WASP, and certainly not a syndrome of skeletal phenotypes. It is likely that mutation in N-

WASP is not compatible with viability, and as a result patients with germline N-WASP mutations are not seen in the population. This may be the result of the widespread expression of

N-WASP and roles in multiple tissues, while WASP is restricted in its expression and function.

Concordance and divergence between LPM Cre drivers

Conditional knockout of Wasl using two LPM Cre recombinase driver lines, Hoxb6-Cre and Prrx1-Cre, produced similar phenotypes in the appendicular skeleton. Both lines revealed that Wasl is required for normal limb patterning, and not only long bone proliferation per se.

However, differences in expression between these drivers yielded additional interesting findings.

The Hoxb6-Cre line turns on later in the forelimb and is limited to the posterior mesenchyme.

Accordingly, Hoxb6 cKO mutants had milder forelimb phenotypes than Prrx1 cKO mutants.

105 That a small difference in timing of Cre expression, E10.5 compared to E9.5, should result in different phenotypic outcomes suggests that Wasl function is important earlier in development.

Early removal of Wasl function by Prrx1-Cre during patterning stages also removes Wasl function from later differentiation and growth stages, and it cannot distinguish between which process Wasl is affecting. Since Hoxb6-Cre removes Wasl later and has a milder effect, it is likely that Wasl has a role in limb patterning rather than later cartilage growth.

In the hind limb, the Hoxb6-Cre driver turns on prior to Prrx1-Cre, resulting in a more severe phenotypic effect. Ankle fusions are frequent and extensive in Hoxb6 cKO mutants.

While the pelvis was unaffected in Prrx1 cKO animals, Hoxb6-Cre was able to reveal a pelvis phenotype following loss of Wasl. It would be interesting to know the vertebral phenotypes caused by lack of Wasl but, unfortunately, removing Wasl with the suitable T-cre driver line also causes embryonic lethality. Future studies should examine other potential Cre drivers to reveal more roles for Wasl in skeletal patterning.

Novel role of N-WASP in skeletal patterning: Wasl conditional knockouts recapitulate Dlx and

Hox mutant phenotypes

Insight into the presumptive mechanisms by which N-WASP regulates skeletal patterning comes from similarities between phenotypes seen in conditional ablation of Wasl and global Hox and Dlx knockout phenotypes. Loss of Wasl from the premigratory neural crest resulted in the formation of ectopic cartilage linkages that connect the basisphenoid to the middle ear. Ectopic cartilages in this same position are also found in Hox mutant and Dlx mutants. Based on their anatomical position, Rijli and colleagues identified these cartilages in Hoxa-2 null mice as

‘atavistic reptilian pterygoquadrate’ elements (Rijli et al., 1993). Similarly, Qiu and colleagues

106 found a structure in the same position in Dlx-2 null mice that they consider homologous to the pterygoquadrate (Qiu et al., 1995). Mutations in other Dlx paralogs also can cause the formation of these structures (Depew et al., 2005). It is tempting to speculate that Wasl is once again interacting with Hox genes to reveal the potential to express an ancestral skeletal configuration, except in this case it would be due to Wasl loss-of-function rather than gain-of-function.

However, the Wnt1 cKO mouse does not capitulate other aspects of the Hox and Dlx mutant phenotypes. Hoxa-2 mutants exhibit mirror-image duplications of the middle ear, and Dlx mutants have dramatic homeotic transformations in branchial arch derivatives, neither of which is observed in Wnt1 cKO animals.

Loss of Wasl and Dlx gene also have a similar patterning effect on the hyoid arch. Like

Wnt1 cKO animals, Dlx null mice exhibit V-shaped hyoid bodies with fused lesser horns and split ossification centers. Future studies should investigate the genetic interaction between Wasl and Dlx genes.

The similarity in phenotype between Hoxa-2 and Wasl mutants is intriguing, especially when taken into consideration with the other Wasl cKO phenotypes. Sternebrae fusion like that observed in Wasl cKO mice is also seen in mice with conditional inversions of the posterior

HoxD cluster (Tschopp et al., 2009), and loss of Wasl from the LPM results in phenotypic effects similar to Hoxa-11 and Hoxd-11 single mutant mice (Small and Potter, 1993; Davis and

Capecchi, 1994). Altogether, these results suggest that Wasl might interact with Hox globally to pattern the skeleton, either as an upstream regulator of Hox expression or as a downstream effector in multiple body regions.

107 Conditional gain-of-function mouse highlights the complexities of N-WASP function

After observing that Wasl was necessary for normal bone patterning using loss-of- function approaches, I investigated the phenotypic consequence of the reph mutation during mouse limb development. With the help of Dr. Smits, we successfully generated a gene-trapped mouse line, inserting a modified mutant exon containing the alteration found in rephaim mutant zebrafish, and have been able to assess the phenotype of conditionally recombined mutant animals in certain genotypes. In animals that carry the gene trap allele, either over a wild type allele or a floxed conditional null allele, I have only identified a phenotype in the sternum.

Interestingly, the same phenotype is also seen in the Wasl LPM cKO mutants. How can a gain- of-function mutation cause the same phenotype as a loss-of-function mutation? It could be that the gain-of-function mutation activates Wasl but also changes cellular localization, removing

Wasl function from one cell region while enhancing it in another. In cell culture, the S249P rephaim mutation causes a shift in localization from the nucleus to the cytoplasm (Supplemental

Figure 2.4). It could be that normal sternum patterning requires the nuclear function of Wasl, while the appendicular skeleton requires the cytoplasmic Wasl function.

Another possibility is that increased dosage of the gain-of-function allele is required to have a phenotypic effect. To this end, we are generating a mouse line with somatic recombination of the gene trap using the Wisp3-Cre driver, leading to two copies of the gain-of- function allele in every cell (Hann et al., 2013). These crosses are currently underway.

Tetrapod-specific control of N-WASP functions and limbs

Given my findings that activation of Wasl function causes changes to fin endoskeleton morphology, the existence of a tetrapod-specific coding change in Wasl that creates a new layer

108 of regulation is a tantalizing prospect that merits further investigation. As I have shown, there is specific gain of a phosphorylation site poised within an active region of the protein essential for regulating open conformation of the WASL protein and its active state. Currently, I do not have evidence beyond conservation within tetrapods for potential regulation of skeletal development.

With new CRISPR-Cas9 based gene editing, it is now possible to knock in constructs and coding regions into endogenous loci (Kimura et al., 2015). The waslb gene in zebrafish does not exhibit alternative splicing, and one could easily knock in different waslb cDNAs with different mutations, or the mouse Wasl cDNA, and see if they cause changes to the skeleton. If a cDNA with the tetrapod-specific threonine was able to produce a fin elaboration phenotype, it would suggest that this mutation could have played a role in the evolution of limbs. Conversely, the introduction of teleost-specific changes into mouse Wasl could reveal additional aspects of lineage-specific regulation of this protein that contributes to the distinctive morphologies of fin and limbs.

In this chapter, I have demonstrated that N-WASP is critical for the normal patterning and development of many different parts of the vertebrate skeleton. Given that both mouse and zebrafish require N-WASP function, it is likely that this function is a conserved feature of vertebrate development. The next step is to determine how N-WASP carries out these functions and which of its roles in the cytoplasm and nucleus are used in skeletal patterning. Finding that phenotypes in Wasl cKO animals throughout the skeleton are reminiscent of Hox and Dlx mutant phenotypes suggests that N-WASP might have a specific role in the patterning programs carried out by these classic developmental genes.

109 3.5. References

Akiyama, R., Kawakami, H., Wong, J., Oishi, I., Nishinakamura, R., & Kawakami, Y. (2015). Sall4-Gli3 system in early limb progenitors is essential for the development of limb skeletal elements. Proceedings of the National Academy of Sciences of the United States of America, 112(16), 5075–5080.

Alekhina, O., Burstein, E., & Billadeau, D. D. (2017). Cellular functions of WASP family proteins at a glance. Journal of Cell Science, 130(14), 2235–2241.

Aspenström, P., Lindberg, U., & Hall, A. (1996). Two GTPases, Cdc42 and Rac, bind directly to a protein implicated in the immunodeficiency disorder Wiskott-Aldrich syndrome. Current Biology: CB, 6(1), 70–75.

Benesch, S., Polo, S., Lai, F. P. L., Anderson, K. I., Stradal, T. E. B., Wehland, J., & Rottner, K. (2005). N-WASP deficiency impairs EGF internalization and actin assembly at clathrin-coated pits. Journal of Cell Science, 118(Pt 14), 3103–3115.

Carlier, M. F., Nioche, P., Broutin-L’Hermite, I., Boujemaa, R., Le Clainche, C., Egile, C., Garbay, C., Ducruix, A., Sansonetti, P., & Pantaloni, D. (2000). GRB2 links signaling to actin assembly by enhancing interaction of neural Wiskott-Aldrich syndrome protein (N-WASp) with actin-related protein (ARP2/3) complex. The Journal of Biological Chemistry, 275(29), 21946– 21952.

Cesario, J. M., Landin Malt, A., Chung, J. U., Khairallah, M. P., Dasgupta, K., Asam, K., Deacon, L. J., Choi, V., Almaidhan, A. A., Darwiche, N. A., Kim, J., Johnson, R. L., & Jeong, J. (2018). Anti-osteogenic function of a LIM-homeodomain transcription factor LMX1B is essential to early patterning of the calvaria. Developmental Biology, 443(2), 103–116.

Cooper, J. A. (1987). Effects of cytochalasin and phalloidin on actin. The Journal of Cell Biology, 105(4), 1473–1478.

Cvejic, A., Hall, C., Bak-Maier, M., Flores, M. V., Crosier, P., Redd, M. J., & Martin, P. (2008). Analysis of WASp function during the wound inflammatory response--live-imaging studies in zebrafish larvae. Journal of Cell Science, 121(Pt 19), 3196–3206.

Czech, M. P. (2000). PIP2 and PIP3: complex roles at the cell surface. Cell, 100(6), 603–606.

Davis, A. P., & Capecchi, M. R. (1994). Axial homeosis and appendicular skeleton defects in mice with a targeted disruption of hoxd-11. Development, 120(8), 2187–2198.

110 de la Fuente, M. A., Sasahara, Y., Calamito, M., Anton, I. M., Elkhal, A., Gallego, M. D., Suresh, K., Siminovitch, K., Ochs, H. D., Anderson, K. C., Rosen, F. S., Geha, R. S., & Ramesh, N. (2007). WIP is a chaperone for Wiskott–Aldrich syndrome protein (WASP). Proceedings of the National Academy of Sciences of the United States of America, 104(3), 926–931.

Depew, M. J., Simpson, C. A., Morasso, M., & Rubenstein, J. L. R. (2005). Reassessing the Dlx code: the genetic regulation of branchial arch skeletal pattern and development. Journal of Anatomy, 207(5), 501–561.

Derry, J. M., Ochs, H. D., & Francke, U. (1994). Isolation of a novel gene mutated in Wiskott- Aldrich syndrome. Cell, 79(5), following 922.

Fritz, K. R., Zhang, Y., & Ruest, L. B. (2019). Cdc42 activation by endothelin regulates neural crest cell migration in the cardiac outflow tract. Developmental Dynamics, 248(9), 795–812.

Fukuoka, M., Miki, H., & Takenawa, T. (1997). Identification of N-WASP homologs in human and rat brain. Gene, 196(1-2), 43–48.

Gehrke, A. R., Schneider, I., de la Calle-Mustienes, E., Tena, J. J., Gomez-Marin, C., Chandran, M., Nakamura, T., Braasch, I., Postlethwait, J. H., Gómez-Skarmeta, J. L., & Shubin, N. H. (2015). Deep conservation of wrist and digit enhancers in fish. Proceedings of the National Academy of Sciences of the United States of America, 112(3), 803–808.

Hall, B. K. (2013). The Neural Crest in Development and Evolution. Springer Science & Business Media.

Hann, S., Kvenvold, L., Newby, B. N., Hong, M., & Warman, M. L. (2013). A Wisp3 Cre- knockin allele produces efficient recombination in spermatocytes during early prophase of meiosis I. PloS One, 8(9), e75116.

Hurst, V., Shimada, K., & Gasser, S. M. (2019). Nuclear Actin and Actin-Binding Proteins in DNA Repair. Trends in Cell Biology, 29(6), 462–476.

Jain, N., Kalailingam, P., Tan, K. W., Tan, H. B., Sng, M. K., Chan, J. S. K., Tan, N. S., & Thanabalu, T. (2016). Conditional knockout of N-WASP in mouse fibroblast caused keratinocyte hyper proliferation and enhanced wound closure. Scientific Reports, 6, 38109.

Jain, N., Lim, L. W., Tan, W. T., George, B., Makeyev, E., & Thanabalu, T. (2014). Conditional N-WASP knockout in mouse brain implicates actin cytoskeleton regulation in hydrocephalus pathology. Experimental Neurology, 254, 29–40.

Jin, F., Dong, B., Georgiou, J., Jiang, Q., Zhang, J., Bharioke, A., Qiu, F., Lommel, S., Feltri, M.

111 L., Wrabetz, L., Roder, J. C., Eyer, J., Chen, X., Peterson, A. C., & Siminovitch, K. A. (2011). N-WASp is required for Schwann cell cytoskeletal dynamics, normal myelin gene expression and peripheral nerve myelination. Development, 138(7), 1329–1337.

Kalailingam, P., Tan, H. B., Jain, N., Sng, M. K., Chan, J. S. K., Tan, N. S., & Thanabalu, T. (2017). Conditional knock out of N-WASP in keratinocytes causes skin barrier defects and atopic dermatitis-like inflammation. Scientific Reports, 7(1), 7311.

Kesavan, G., Lieven, O., Mamidi, A., Öhlin, Z. L., Johansson, J. K., Li, W.-C., Lommel, S., Greiner, T. U., & Semb, H. (2014). Cdc42/N-WASP signaling links actin dynamics to pancreatic β cell delamination and differentiation. Development, 141(3), 685–696.

Kim, A. S., Kakalis, L. T., Abdul-Manan, N., Liu, G. A., & Rosen, M. K. (2000). Autoinhibition and activation mechanisms of the Wiskott-Aldrich syndrome protein. Nature, 404(6774), 151– 158.

Kim, H.-J., DiBernardo, A. B., Sloane, J. A., Rasband, M. N., Solomon, D., Kosaras, B., Kwak, S. P., & Vartanian, T. K. (2006). WAVE1 Is Required for Oligodendrocyte Morphogenesis and Normal CNS Myelination. The Journal of Neuroscience, 26(21), 5849–5859.

Kimura, Y., Hisano, Y., Kawahara, A., & Higashijima, S.-I. (2014). Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports, 4, 6545.

Kollmar, M., Lbik, D., & Enge, S. (2012). Evolution of the eukaryotic ARP2/3 activators of the WASP family: WASP, WAVE, WASH, and WHAMM, and the proposed new family members WAWH and WAML. BMC Research Notes, 5, 88.

Lalonde, R. L., & Akimenko, M.-A. (2018). Effects of fin fold mesenchyme ablation on fin development in zebrafish. PloS One, 13(2), e0192500.

Lalonde, R. L., Moses, D., Zhang, J., Cornell, N., Ekker, M., & Akimenko, M.-A. (2016). Differential actinodin1 regulation in zebrafish and mouse appendages. Developmental Biology, 417(1), 91–103.

Lefever, T., Pedersen, E., Basse, A., Paus, R., Quondamatteo, F., Stanley, A. C., Langbein, L., Wu, X., Wehland, J., Lommel, S., & Brakebusch, C. (2010). N-WASP is a novel regulator of hair-follicle cycling that controls antiproliferative TGFβ pathways. Journal of Cell Science, 123(Pt 1), 128–140.

Lehnert, E. M., Burriesci, M. S., & Pringle, J. R. (2012). Developing the anemone Aiptasia as a tractable model for cnidarian-dinoflagellate symbiosis: the transcriptome of aposymbiotic A.

112 pallida. BMC Genomics, 13, 271.

Lewis, A. E., Vasudevan, H. N., O’Neill, A. K., Soriano, P., & Bush, J. O. (2013). The widely used Wnt1-Cre transgene causes developmental phenotypes by ectopic activation of Wnt signaling. Developmental Biology, 379(2), 229–234.

Li, C., Xu, X., Nelson, D. K., Williams, T., Kuehn, M. R., & Deng, C.-X. (2005). FGFR1 function at the earliest stages of mouse limb development plays an indispensable role in subsequent autopod morphogenesis. Development, 132(21), 4755–4764.

Li, H., Petersen, S., Garcia Mariscal, A., & Brakebusch, C. (2019). Negative Regulation of p53- Induced Senescence by N-WASP Is Crucial for DMBA/TPA-Induced Skin Tumor Formation. Cancer Research, 79(9), 2167–2181.

Liu, C., Bai, X., Wu, J., Sharma, S., Upadhyaya, A., Dahlberg, C. I. M., Westerberg, L. S., Snapper, S. B., Zhao, X., & Song, W. (2013). N-wasp is essential for the negative regulation of B cell receptor signaling. PLoS Biology, 11(11), e1001704.

Logan, M., Martin, J. F., Nagy, A., Lobe, C., Olson, E. N., & Tabin, C. J. (2002). Expression of Cre recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis, 33(2), 77–80.

Lommel, S., Benesch, S., Rottner, K., Franz, T., Wehland, J., & Kühn, R. (2001). Actin pedestal formation by enteropathogenic Escherichia coli and intracellular motility of Shigella flexneri are abolished in N-WASP-defective cells. EMBO Reports, 2(9), 850–857.

Lowe, L. A., Yamada, S., & Kuehn, M. R. (2000). HoxB6-Cre transgenic mice express Cre recombinase in extra-embryonic mesoderm, in lateral plate and limb mesoderm and at the midbrain/hindbrain junction. Genesis, 26(2), 118–120.

Lubeseder-Martellato, C., Alexandrow, K., Hidalgo-Sastre, A., Heid, I., Boos, S. L., Briel, T., Schmid, R. M., & Siveke, J. T. (2017). Oncogenic KRas-induced Increase in Fluid-phase Endocytosis is Dependent on N-WASP and is Required for the Formation of Pancreatic Preneoplastic Lesions. EBioMedicine, 15, 90–99.

Lyubimova, A., Garber, J. J., Upadhyay, G., Sharov, A., Anastasoaie, F., Yajnik, V., Cotsarelis, G., Dotto, G. P., Botchkarev, V., & Snapper, S. B. (2010). Neural Wiskott-Aldrich syndrome protein modulates Wnt signaling and is required for hair follicle cycling in mice. The Journal of Clinical Investigation, 120(2), 446–456.

Machesky, L. M., & Insall, R. H. (1998). Scar1 and the related Wiskott-Aldrich syndrome protein, WASP, regulate the actin cytoskeleton through the Arp2/3 complex. Current Biology: CB, 8(25), 1347–1356.

Miki, H., Miura, K., & Takenawa, T. (1996). N-WASP, a novel actin-depolymerizing protein, regulates the cortical cytoskeletal rearrangement in a PIP2-dependent manner downstream of

113 tyrosine kinases. The EMBO Journal, 15(19), 5326–5335.

Miki, H., Sasaki, T., Takai, Y., & Takenawa, T. (1998). Induction of filopodium formation by a WASP-related actin-depolymerizing protein N-WASP. Nature, 391(6662), 93–96.

Miyamoto, K., & Gurdon, J. B. (2013). Transcriptional regulation and nuclear reprogramming: roles of nuclear actin and actin-binding proteins. Cellular and Molecular Life Sciences: CMLS, 70(18), 3289–3302.

Morris, H. T., Fort, L., Spence, H. J., Patel, R., Vincent, D. F., Park, J. H., Snapper, S. B., Carey, F. A., Sansom, O. J., & Machesky, L. M. (2018). Loss of N-WASP drives early progression in an Apc model of intestinal tumourigenesis. The Journal of Pathology, 245(3), 337–348.

Mullins, R. D. (2000). How WASP-family proteins and the Arp2/3 complex convert intracellular signals into cytoskeletal structures. Current Opinion in Cell Biology, 12(1), 91–96.

Nakamura, T., Gehrke, A. R., Lemberg, J., Szymaszek, J., & Shubin, N. H. (2016). Digits and fin rays share common developmental histories. Nature, 537(7619), 225–228.

Noden, D. M., & Trainor, P. A. (2005). Relations and interactions between cranial mesoderm and neural crest populations. Journal of Anatomy, 207(5), 575–601.

Novak, N., Bar, V., Sabanay, H., Frechter, S., Jaegle, M., Snapper, S. B., Meijer, D., & Peles, E. (2011). N-WASP is required for membrane wrapping and myelination by Schwann cells. The Journal of Cell Biology, 192(2), 243–250.

Ochs, H. D., & Thrasher, A. J. (2006). The Wiskott-Aldrich syndrome. The Journal of Allergy and Clinical Immunology, 117(4), 725–738; quiz 739.

Park, J., Sung, J. Y., Park, J., Song, W.-J., Chang, S., & Chung, K. C. (2012). Dyrk1A negatively regulates the actin cytoskeleton through threonine phosphorylation of N-WASP. Journal of Cell Science, 125(Pt 1), 67–80.

Perantoni, A. O., Timofeeva, O., Naillat, F., Richman, C., Pajni-Underwood, S., Wilson, C., Vainio, S., Dove, L. F., & Lewandoski, M. (2005). Inactivation of FGF8 in early mesoderm reveals an essential role in kidney development. Development, 132(17), 3859–3871.

Phan, H.-E., Northorp, M., Lalonde, R. L., Ngo, D., & Akimenko, M.-A. (2019). Differential actinodin1 regulation in embryonic development and adult fin regeneration in Danio rerio. PloS One, 14(5), e0216370.

Piekarski, N., Gross, J. B., & Hanken, J. (2014). Evolutionary innovation and conservation in the embryonic derivation of the vertebrate skull. Nature Communications, 5, 5661.

Qiu, M., Bulfone, A., Martinez, S., Meneses, J. J., Shimamura, K., Pedersen, R. A., & Rubenstein, J. L. (1995). Null mutation of Dlx-2 results in abnormal morphogenesis of proximal

114 first and second branchial arch derivatives and abnormal differentiation in the forebrain. Genes & Development, 9(20), 2523–2538.

Quilliam, L. A., Lambert, Q. T., Mickelson-Young, L. A., Westwick, J. K., Sparks, A. B., Kay, B. K., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., & Der, C. J. (1996). Isolation of a NCK- associated kinase, PRK2, an SH3-binding protein and potential effector of Rho protein signaling. The Journal of Biological Chemistry, 271(46), 28772–28776.

Ramesh, N., Antón, I. M., Hartwig, J. H., & Geha, R. S. (1997). WIP, a protein associated with wiskott-aldrich syndrome protein, induces actin polymerization and redistribution in lymphoid cells. Proceedings of the National Academy of Sciences of the United States of America, 94(26), 14671–14676.

Reginensi, A., Scott, R. P., Gregorieff, A., Bagherie-Lachidan, M., Chung, C., Lim, D.-S., Pawson, T., Wrana, J., & McNeill, H. (2013). Yap- and Cdc42-dependent nephrogenesis and morphogenesis during mouse kidney development. PLoS Genetics, 9(3), e1003380.

Rijli, F. M., Mark, M., Lakkaraju, S., Dierich, A., Dollé, P., & Chambon, P. (1993). A homeotic transformation is generated in the rostral branchial region of the head by disruption of Hoxa-2, which acts as a selector gene. Cell, 75(7), 1333–1349.

Rohatgi, R., Ma, L., Miki, H., Lopez, M., Kirchhausen, T., Takenawa, T., & Kirschner, M. W. (1999). The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell, 97(2), 221–231.

Rossant, J., & McMahon, A. (1999). “Cre”-ating mouse mutants-a meeting review on conditional mouse genetics. Genes & Development, 13(2), 142–145.

Sadhukhan, S., Sarkar, K., Taylor, M., Candotti, F., & Vyas, Y. M. (2014). Nuclear role of WASp in gene transcription is uncoupled from its ARP2/3-dependent cytoplasmic role in actin polymerization. Journal of Immunology, 193(1), 150–160.

Schilling, T., Wilson, S., Taylor, J. S., Van de Peer, Y., Braasch, I., & Meyer, A. (2001). Comparative genomics provides evidence for an ancient genome duplication event in fish. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 356(1414), 1661–1679.

Schrank, B. R., Aparicio, T., Li, Y., Chang, W., Chait, B. T., Gundersen, G. G., Gottesman, M. E., & Gautier, J. (2018). Nuclear ARP2/3 drives DNA break clustering for homology-directed repair. Nature, 559(7712), 61–66.

She, H. Y., Rockow, S., Tang, J., Nishimura, R., Skolnik, E. Y., Chen, M., Margolis, B., & Li, W. (1997). Wiskott-Aldrich syndrome protein is associated with the adapter protein Grb2 and the epidermal growth factor receptor in living cells. Molecular Biology of the Cell, 8(9), 1709–1721.

Small, K. M., & Potter, S. S. (1993). Homeotic transformations and limb defects in Hox A11

115 mutant mice. Genes & Development, 7(12A), 2318–2328.

Snapper, S. B., Rosen, F. S., Mizoguchi, E., Cohen, P., Khan, W., Liu, C. H., Hagemann, T. L., Kwan, S. P., Ferrini, R., Davidson, L., Bhan, A. K., & Alt, F. W. (1998). Wiskott-Aldrich syndrome protein-deficient mice reveal a role for WASP in T but not B cell activation. Immunity, 9(1), 81–91.

Suetsugu, S., Hattori, M., Miki, H., Tezuka, T., Yamamoto, T., Mikoshiba, K., & Takenawa, T. (2002). Sustained activation of N-WASP through phosphorylation is essential for neurite extension. Developmental Cell, 3(5), 645–658.

Taylor, M. D., Sadhukhan, S., Kottangada, P., Ramgopal, A., Sarkar, K., D’Silva, S., Selvakumar, A., Candotti, F., & Vyas, Y. M. (2010). Nuclear role of WASp in the pathogenesis of dysregulated TH1 immunity in human Wiskott-Aldrich syndrome. Science Translational Medicine, 2(37), 37ra44.

Thisse, B., Thisse, C. (2004) Fast Release Clones: A High Throughput Expression Analysis. ZFIN Direct Data Submission. (http://zfin.org).

Tschopp, P., Tarchini, B., Spitz, F., Zakany, J., & Duboule, D. (2009). Uncoupling time and space in the collinear regulation of Hox genes. PLoS Genetics, 5(3), e1000398.

Veltman, D. M., & Insall, R. H. (2010). WASP family proteins: their evolution and its physiological implications. Molecular Biology of the Cell, 21(16), 2880–2893.

Verboon, J. M., Sugumar, B., & Parkhurst, S. M. (2015). Wiskott-Aldrich syndrome proteins in the nucleus: aWASH with possibilities [Review of Wiskott-Aldrich syndrome proteins in the nucleus: aWASH with possibilities]. Nucleus, 6(5), 349–359.

Wagener, B. M., Hu, M., Zheng, A., Zhao, X., Che, P., Brandon, A., Anjum, N., Snapper, S., Creighton, J., Guan, J.-L., Han, Q., Cai, G.-Q., Han, X., Pittet, J.-F., & Ding, Q. (2016). Neuronal Wiskott-Aldrich syndrome protein regulates TGF-β1-mediated lung vascular permeability. FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology, 30(7), 2557–2569.

Wang, Z.-B., Ma, X.-S., Hu, M.-W., Jiang, Z.-Z., Meng, T.-G., Dong, M.-Z., Fan, L.-H.,

116 Ouyang, Y.-C., Snapper, S. B., Schatten, H., & Sun, Q.-Y. (2016). Oocyte-specific deletion of N-WASP does not affect oocyte polarity, but causes failure of meiosis II completion. Molecular Human Reproduction, 22(9), 613–621.

Wen, K.-K., Han, S.-S., & Vyas, Y. M. (2020). Wiskott-Aldrich syndrome protein senses irradiation-induced DNA damage to coordinate the cell-protective Golgi dispersal response in human T and B lymphocytes. The Journal of Allergy and Clinical Immunology, 145(1), 324– 334.

Westerberg, L. S., Dahlberg, C., Baptista, M., Moran, C. J., Detre, C., Keszei, M., Eston, M. A., Alt, F. W., Terhorst, C., Notarangelo, L. D., & Snapper, S. B. (2012). Wiskott-Aldrich syndrome protein (WASP) and N-WASP are critical for peripheral B-cell development and function. Blood, 119(17), 3966–3974.

Wu, X., Suetsugu, S., Cooper, L. A., Takenawa, T., & Guan, J.-L. (2004). Focal adhesion kinase regulation of N-WASP subcellular localization and function. The Journal of Biological Chemistry, 279(10), 9565–9576.

You, J.-J., & Lin-Chao, S. (2010). Gas7 functions with N-WASP to regulate the neurite outgrowth of hippocampal neurons. The Journal of Biological Chemistry, 285(15), 11652– 11666.

117 Chapter 4: Analysis of gene expression in developing pectoral fins of the bowfin (Amia calva)

This chapter is part of a collaborative project with Dr. Ingo Braasch at Michigan State University. The data presented here will be included in support of an Amia calva genome paper that is currently in preparation.

118 Chapter 4: Analysis of gene expression in developing pectoral fins of the bowfin (Amia calva)

Genomic resources for the bowfin are poised to provide key insights into fin and limb development and evolution. Teleost models, such as the zebrafish, Danio rerio, and the medaka,

Oryzias latipes, have long been used in developmental genetics as the main points of comparison between fins and limbs. However, the teleost pectoral fin endoskeleton has undergone severe reduction from the ancestral bony fish condition from which limbs arose, having lost the metapterygium and proximodistal long bone articulation (Figure 4.1A). This reduction limits how far results obtained in teleosts can be generalized to bony fishes at large, and it confounds the identification of developmental features that make fins different from limbs, which retain only the metapterygium and exhibit dramatic proximodistal elaboration. The bowfin is the closest living relative of the teleosts that retains the metapterygium as well as proximodistal elaboration of the fin endoskeleton. Incorporating data from this species can help us better understand appendage development and interpret the wealth of data from teleost studies. Here I present analysis of the bowfin pectoral fin bud transcriptome across early outgrowth and patterning. My findings reveal both conservation and divergence in limb and fin developmental programs and refines our understanding of what makes a fin different from a limb.

4.1. Background

Phylogenetic position and natural history of bowfin

The bowfin, Amia calva, together with seven gar species comprise the extant Holostei, the sister clade to the highly diverse teleost fishes. While living holosteans are largely restricted to freshwaters of eastern and central North America, extinct members of this group were found

119

Figure 4.1. The bowfin is the closest living relative of the teleosts that retains the metapterygium. (A) Evolution of the pectoral appendage endoskeleton in the bony fishes. Elements are colored based on which portion of the fin they comprise. From the tribasal ancestral condition, teleosts and gars independently lost the metapterygium, while tetrapods lost the propterygium and mesopterygium. (B) Bowfin pectoral fins at two different developmental stages cleared and stained with Alcian blue for cartilage and alizarin red for bone. Anterior to left, distal to top in all panels.

on almost every continent (Grande and Bemis, 1998; Grande, 2010). The extant holosteans capture just a small range of the extensive morphological diversity seen in fossil members of the lineage (Clarke et al., 2016).

Bowfin spawn in the spring, when they move from deeper water into shallow areas of lakes where there are reeds and stumps for concealment to build nests (Dean, 1898). Males are distinguished from females by the presence of an ‘eyespot’ or ocellus on the upper caudal peduncle, and during spawning season, the pectoral and pelvic fins of the males become bright green. Breeding groups consisting of one female and one-to-several males occupy a nest. Bowfin eggs are adhered to the substrate, and one nest can contain from hundreds to hundreds of thousands of eggs (Dean, 1895). After spawning, the male remains to defend the nest and aerate the eggs and leads the brood in foraging runs after the spawn hatch (Dean, 1898).

120 Fin development in non-teleost ray-finned fishes

Pectoral fin development in non-teleost ray-finned fishes has been well studied in chondrosteans and polypteriforms, while relatively little attention has been given to holosteans.

Ontogeny of the pectoral fin skeleton has been described from serial sections and cleared-and- stained wholemounts in paddlefish and sturgeons (Wiedersheim, 1892; Mollier, 1897;

Sewertzoff, 1926; Kryzanovsky, 1927; Davis et al., 2004; Mabee and Noordsy 2004), as well as bichirs (Budgett, 1902; Bartsch and Gemballa, 1992; Bartsch et al., 1997). In addition, several gene expression studies of pectoral fin patterning have been conducted in paddlefish (Metscher et al., 2005; Davis et al., 2007; Tulenko et al., 2016; Tulenko et al, 2017).

An early account of embryonic and larval bowfin pectoral fin development based on histology and wholemount skeletal staining was provided by Heronimus (1911). Later development of the fin skeleton in juveniles and adults has also been described using wholemount staining in bowfin (Grande and Bemis, 1998) as well as gars (Grande, 2010). While genomic resources are now available for the spotted gar (Braasch et al., 2016), modern imaging techniques and molecular approaches have yet to be applied to holostean fin development.

4.2. Materials and methods

Collection of bowfin embryos

Bowfin embryos were collected from nests in Oneida Lake, New York, in May 2016.

Eggs attached to nest material were collected in lake water with added methylene blue to abate fungal growth. Once in the lab, eggs were separated from nesting material by hand and placed in fresh lake water. Eggs and embryos were raised in static containers of lake water at 16°C and

121 moved to fresh lake water every other day. Embryos and larvae were staged according to Ballard

(1986).

Specimen collection and storage

For in situ hybridization and skeletal staining, animals were fixed overnight at 4°C in 4% paraformaldehyde in phosphate buffered saline (PBS), pH 7.4, washed twice for 5 minutes each in PBS + 0.1% Tween, washed once in 100% methanol for 5 minutes, and stored in 100% methanol at -20°C.

To isolate RNA for cDNA production, specimens were incubated overnight in RNAlater

(Ambion) on a rocker at 4°C. The next morning, whole embryos were moved to -20°C for two weeks, followed by long-term storage at -80°C.

For transcriptomic analysis of fin buds, 3 replicates of 6 to 7 animals each were collected at the desired stages in 2 mL of RNAlater. Whole animals were incubated overnight in RNAlater on a rocker at 4°C. The next day, the animals were placed in a dish of RNAlater at room temperature and the left and right fin buds dissected using tungsten needles. The isolated fin buds were then stored in RNAlater at -20°C for 2 weeks prior to RNA isolation.

RNA isolation and processing

RNA was isolated from both whole animals and dissected fin buds using the RNeasy Plus

Micro Kit (Qiagen). After removing excess RNAlater from stored samples, tissues were dissolved by incubation in RLT Plus buffer with mild vortexing at room temperature. Extracted

RNA was stored at -80°C.

122 For standard cloning, cDNA libraries were produced from RNA extracted from Stage 23 and Stage 25 single, whole embryos and from Stage 26 fin buds using the SuperScript IV

Reverse Transcriptase System (Invitrogen).

For transcriptome sequencing, extracted RNA was processed by the Bauer Center

Sequencing Core at Harvard University. Following poly-A selection, stranded mRNAseq libraries were produced using the PrepX RNA-Seq Library Kit for Illumina (IntegenX).

Next-generation transcriptome sequencing and RNAseq analysis

The Bauer Center Sequencing Core at Harvard University performed sequencing services. For each developmental stage, two replicate libraries were sequenced with 75 bp single- end reads, and a third was sequenced with 150 bp paired-end reads on an Illumina NextSeq machine. Reads were filtered using Trimmomatic 0.38 (Bolger et al., 2014) and ribosomal RNA reads were removed using SortMeRNA (Kopylova et al., 2012). Filtered and sorted reads were then aligned to the bowfin nuclear transcriptome using CLC Genomics Workbench (Qiagen).

The transcriptome toolkit in CLC Genomics Workbench was used to calculate RPKM values, fold-change, and analysis of differential gene expression. BAM files generated in CLC

Genomics Workbench were aligned to the bowfin genome using Integrative Genomics Viewer

(IGV; Robinson et al., 2011). Heatmaps to visualize gene expression dynamics were created using the Pretty Heatmaps package in R (R core team, 2017).

cDNA cloning and in situ hybridization

Nested PCR was used to amplify cDNAs of target genes. fgf8 and sp8 were amplified from a cDNA library pooled from whole-embryo Stage 23 and Stage 25 libraries. hoxd14 was

123 amplified from Stage 26 fin bud RNA. Wholemount in situ hybridization was performed as described for mouse by Lufkin (2007). Primers for bowfin (Ac) and gar (Lo) genes are as follows: AcFgf8_F1: 5’-ACCATTCAGTCCTCGCCTAA-3’, AcFgf8_R1: 5’-

GGGCAGACGCTTCATAAAAT-3’; LoFgf8_F1: 5’-ACCATTCAGTCCTCGCCTAA-3’,

LoFgf8_R1: 5’-TTGTTCAAAAGGTGAAATTCCT-3’, LoFgf8_R2: 5’-

GGCAATTCTCATGGACGTTT-3’; AcHoxD14_F1: 5’-CCTTCGTCTCTGACCTCTGG-3’,

AcHoxD14_R1: 5’-AAGAGGCAATTGGCACATTC-3’; AcSp8_F1: 5’-

GGAAGAGCCGAGGTTAGGAT-3’, AcSp8_R1: 5’-GCTGAGGAGGTGTGGAGAAG-3’,

AcSp8_R2: 5’-GAGTGACCCAAACCGGAGTA-3’

4.3. Results

Dynamic gene expression in developing bowfin pectoral fins

We performed transcriptome analysis across four stages of pectoral fin bud development in the bowfin (Figure 4.2A). These stages represent various stages of fin development, beginning from their first morphological appearance (Stage 23), to fin bud outgrowth (Stage 24), appearance of muscle buds (Stage 25), and finally to the transition of the fin bud apical ectodermal ridge (AER) into an expanding fin fold (Stage 26). These four stages encapsulate early patterning processes of the fin bud. To our knowledge, our data represent the first RNAseq analysis of gene expression dynamics across the early development of fin or limb buds. Many known limb patterning genes are expressed in the developing bowfin fin buds, and we find parallels between fin and limb patterning.

In the developing fin, the early fin fold is supported by elastinoid fibrils called actinotrichia (Wood, 1982). The most dramatic change in gene expression we observe is in the

124

Figure 4.2. RNAseq analysis of developing pectoral fins in bowfin. (A) The four stages used for transcriptome analysis. The fin bud is first visible at Stage 23 (black arrowhead, anterior to left). Isolated fin buds showing increasing size from Stage 24 to 25 to 26 (anterior to top, distal to right). (B) log2 fold-change in fin fold structural genes relative to Stage 23. (C) Actinotrichia fibrils (arrowhead) first appear at Stage 27. (D) heatmap depicting log2 fold-change in limb patterning genes relative to Stage 23 fin buds. Scale bars in A are 250 um, scale bar in C is 125 μm. Question marks (?) denote genes with uncertain paralog identification.

transcription of the structural components of the actinotrichia, the actinodins and collagens

(Fisher et al., 2003; Huang et al., 2008; Zhang et al., 2010). The expression of and1 and and3 spikes at Stage 26, as does expression of type III and type IX collagen components (Figure

4.2B). Type III collagens have not been previously implicated in actinotrichia development, as these collagens are absent in teleosts (Duran et al., 2015). Thus, type III collagens represent a

125 novel candidate to underlie differences in morphology between bowfin and teleost fins.

Interestingly col1a1, col1a2 and col2a1, the main components of actinotrichia in zebrafish

(Duran et al., 2011), exhibit relatively stable expression across the stages examined.

Hox genes play critical roles in the patterning of fin and limb skeletons. A key feature of

Hox gene regulation is the colinear expression of the cluster through time (Duboule, 1994). Our transcriptome data reveals temporal colinearity in gene expression levels across early fin bud outgrowth (Figure 4.2D). We found that the stage of peak expression of individual posterior Hox loci tracks with position within the hox cluster. The genes hoxa9, hoxa10, hoxd9, and hoxd10 peak at Stage 23, while hoxa11, hoxa13, hoxd11, hoxd12, and hoxd13 peak at Stage 25. The expression of hoxa13 was highest at Stage 26.

Other gene expression dynamics we observe are consistent with mechanisms described in limbs. Termination of limb bud outgrowth is caused in part by the onset of expression of twist2, which negatively regulates the expression of grem1 (Wade et al., 2012). In our transcriptome data, we find that twist2 increases in expression and peaks at stage 26, while grem1 peaks at stage 23 and is downregulated by ~3-fold by Stage 26. We see other expression profiles consistent with known antagonistic interactions, such as negative regulation of meis genes by cyp26b1 (Yashiro et al., 2004).

Retention and expression of the hoxd14 pseudogene

The evolution of the Hox14 paralog group exhibits interesting patterns of conservation, loss, and pseudogenation across vertebrates. As hoxd14 is a pseudogene in the gar (Braasch et al., 2016), we were surprised to observe a large number of reads aligning to an ~8 kb intergenic region between evx-2 and hoxd13. We designed primers to this region and amplified two hoxd14

126

Figure 4.3. A pseudogenized hoxd14 paralog is maintained and expressed in the bowfin. (A) relative position and orientation of Hox14 paralogs in the HOXD cluster between evx-2 and hoxd13 (Dr, Danio rerio; Ac, Amia calva; Hf, Heterodontus francisci). (B) Whole mount in situ hybridization of the hoxd14 pseudogene in the tail bud (tb) and vent at Stage 24 and in the posterior pectoral fin mesenchyme at Stage 26 (white arrowhead). (C) Multiple sequence alignment of the HoxD14 homeodomain across species. Black arrowhead indicates conserved intra-domain splicing position, and underline indicates conserved WFQNQR motif. Anterior to left in B. Scale bars in B are 125 μm.

transcripts from bowfin Stage 26 fin bud cDNA. Interestingly, one of the bowfin hoxd14 isoforms has a different exon structure from other hoxd14 paralogs, whereby two regions found in the first exon of other species form two different exons in the bowfin (Figure 4.3A).

Wholemount in situ hybridization revealed that hoxd14 is expressed in Stage 26 pectoral fin buds in a posterior mesenchymal domain similar to that seen in the paddlefish (Figure 4.3B;

Tulenko et al., 2016). Expression was also observed in the vent, as has been shown in shark and lamprey (Kuraku et al., 2008). Surprisingly, we also detected hoxd14 expression in the tailbud

(Figure 4.3B). Sequence analysis of the hoxd14 transcript shows that the locus is a pseudogene, with numerous stop codons and nonsynonymous changes throughout the coding region and homeodomain (Figure 4.3C). However, despite extensive sequence divergence and

127 pseudogenation, the hallmark Hox14 WFQNQR motif is preserved, as is the split homeodomain junction (Powers and Amemiya, 2004). Finally, as with other Hox genes, we observe temporal colinearity in hoxd14 fin bud expression, with the highest expression levels observed at stages 25 and 26 (Figure 4.2D).

Loss of fgf8 expression in the holostean pectoral fin

In my analysis of fin and limb patterning genes in the fin bud transcriptome, I noticed the lack of expression of a critical limb development gene, fgf8. This signaling ligand is expressed in the apical AER of fin and limb buds and is critical for the outgrowth and patterning of these appendages (Crossley et al., 1996; Lewandoski et al., 2000; Moon et al., 2000). Shockingly, fgf8 was not expressed in the bowfin fin bud transcriptome at any stage. Other AER markers, such as dlx5 (Robledo et al., 2002), are highly expressed in the transcriptomes, demonstrating that the

AER was not lost during dissection. We amplified fgf8 from whole-embryo cDNA and confirmed that the sequence of the gene predicted in our annotation is correct, precluding alignment error as the cause of the absence from the transcriptomes. Next, we performed wholemount in situ hybridization to analyze the expression of fgf8 and sp8, a transcription factor that directly positively regulates fgf8 expression in the AER (Haro et al., 2014). We found both genes to be expressed in their respective expected domains, such as the central nervous system and the tailbud (Figure 4.4). However, consistent with our transcriptome data, sp8 is highly expressed in the AER throughout early fin bud development while fgf8 is not. Similar to the bowfin, we found that gars also express sp8 in the AER but have no detectable fgf8 expression, suggesting that loss of fgf8 from the fin bud program occurred in the common ancestor of living holosteans.

128

Figure 4.4. Loss of fgf8 expression in the apical ectodermal ridge (AER) of Holostean fishes. The transcription factor sp8 is expressed in the AER of gar (Stage 26) and bowfin (Stage 23), while fgf8 is not detected in this domain. Dorsal view, anterior to top; left scale bar is 500 μm, right scale bar is 1 mm.

4.4. Discussion

By analyzing the bowfin pectoral fin transcriptome, I found several global features of gene expression dynamics that are shared between holostean fins and tetrapod limbs. Colinear

Hox expression is critical to the normal patterning of fins and limbs (Duboule, 1994), and colinearity has previously been demonstrated with in situ hybridization. While in situ hybridization can demonstrate the presence or absence of transcripts, the typical colorimetric approach is not quantitative. Data presented here provide a quantitative description of Hox colinearity in the developing appendage. These quantitative data allow for the analysis of

129 transcriptional levels over time and comparison among genes. Future analyses can explore these data further, confirming other correlations in gene expression as well as identifying novel transcription patterns.

The Hox14 paralogy group has undergone interesting patterns of conservation, loss, and pseudogenization across vertebrates. Members of this paralogy group are absent from tetrapods and teleosts but have been identified in cartilaginous fishes, lamprey, and, most recently, in paddlefish and gar (Powers and Amemiya, 2004; Kuraku et al., 2008; Tulenko et al., 2016;

Braasch et al., 2016). Initially, Hox14 genes were thought not to be subject to the ancestral regulation mechanisms that control the Hox1–13 members (Kuraku et al., 2008; Feiner et al.,

2011). However, it was recently discovered that paddlefish fin buds express hoxd14 in a posterior domain that is consistent with global collinear spatial Hox regulation (Tulenko et al.,

2016). Our findings expand the collinear nature of hoxd14 expression to a temporal dimension as well. We additionally find expression of hoxd14 in the tailbud, another domain that exhibits global colinear regulation. Even though the bowfin hoxd14 ortholog is pseudogenized, its transcript is still transcribed at high levels, spliced, and expressed in expected domains in the fins, vent, and tailbud. This discovery raises the possibility that, even though it no longer makes a functional protein product, transcription at the bowfin hoxd14 locus plays some function in regulation of Hox expression and fin patterning.

fgf8 is critical for the normal outgrowth and patterning of fins and limbs. fgf8 is expressed in a specialized signaling center called the apical ectodermal ridge. This expression is required for proper proximodistal patterning of the limb and is a positive regulator of sonic hedgehog

(shh) in the zone of polarizing activity, which is required for anteroposterior patterning. fgf8 is expressed in every fin and limb bud in which it has been assessed. Even in species that lack a

130 morphologically distinct AER, fgf8 is still expressed in either distal epithelium (Doroba and

Sears, 2010; Gross et al., 2011) or distal mesenchyme (Purushothaman et al., 2019). Thus, the lack of fgf8 from bowfin and gar fin buds is entirely unexpected. Given that sp8, the direct upstream transcriptional regulator of fgf8, is expressed in the AER at high levels, we hypothesize that changes have occurred in the cis-regulation of fgf8 that remove sp8 responsiveness in the fin.

These changes may be an ancestral holostean feature that occurred prior to the divergence of gars and bowfin. Fgf signaling at large still likely plays critical roles in fin patterning, and several fgf ligands and receptors are expressed in the developing bowfin fin buds (Figure 4.2). This result reveals unexpected drift in the fin/limb developmental system revealed by holostean genomics and serves as a warning against treating basally branching taxa as representative of an ancestral developmental condition.

Altogether, our findings lay the groundwork for modern investigations into holostean fin development. The bowfin occupies a key phylogenetic position as the closest living relative to teleosts that retains the metapterygium, the portion of the appendage skeleton from which limbs are derived. There are many differences between teleost pectoral fin development and tetrapod limb development. Investigations using the bowfin can help determine which of these differences are found in the fins of all actinopterygians, and which are additional derived features of teleosts.

This knowledge has the potential to inform our understanding of universal features of pectoral appendage patterning, the fin-to-limb transition in tetrapods, and the fin-to-fin transition in teleosts.

4.5. References

Ballard, W. W. (1986). Stages and rates of normal development in the holostean fish, Amia calva. The Journal of Experimental Zoology, 238(3), 337–354.

131

Bartsch, P., Gemballa, S., & Piotrowski, T. (1997). The Embryonic and Larval Development of Polypterus senegalus Cuvier, 1829: its Staging with Reference to External and Skeletal Features, Behaviour and Locomotory Habits. Acta Zoologica, 78(4), 309–328.

Bartsch, P., & Gemballa, S. (1992). On the anatomy and development of the vertebral column and pterygiophores in Polypterus senegalus Cuvier, 1829 (“Pisces”, Polypteriformes). Zoologische Jahrbucher. Abteilung Fur Anatomie Und Ontogenie Der Tiere, 122(497), 522.

Bolger, A. M., Lohse, M., & Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 30(15), 2114–2120.

Braasch, I., Gehrke, A. R., Smith, J. J., Kawasaki, K., Manousaki, T., Pasquier, J., Amores, A., Desvignes, T., Batzel, P., Catchen, J., Berlin, A. M., Campbell, M. S., Barrell, D., Martin, K. J., Mulley, J. F., Ravi, V., Lee, A. P., Nakamura, T., Chalopin, D., … Postlethwait, J. H. (2016). The spotted gar genome illuminates vertebrate evolution and facilitates human-teleost comparisons. Nature Genetics, 48(4), 427–437.

Budgett, J. S. (1902). On the structure of the larval Polypterus. The Transactions of the Zoological Society of London, 16(7), 315–346.

Clarke, J. T., Lloyd, G. T., & Friedman, M. (2016). Little evidence for enhanced phenotypic evolution in early teleosts relative to their living fossil sister group. Proceedings of the National Academy of Sciences of the United States of America, 113(41), 11531–11536.

Crossley, P. H., Minowada, G., MacArthur, C. A., & Martin, G. R. (1996). Roles for FGF8 in the induction, initiation, and maintenance of chick limb development. Cell, 84(1), 127–136.

Davis, M. C., Dahn, R. D., & Shubin, N. H. (2007). An autopodial-like pattern of Hox expression in the fins of a basal actinopterygian fish. Nature, 447(7143), 473–476.

Davis, M. C., Shubin, N. H., & Force, A. (2004). Pectoral fin and girdle development in the basal actinopterygians Polyodon spathula and Acipenser transmontanus. Journal of Morphology, 262(2), 608–628.

Dean, B. (1895). Memoirs: The Early Development of Amia. Journal of Cell Science, 2(152), 413–444.

Dean, B. (1898). On the Dogfish (Amia Calva), Its Habits and Breeding.

Doroba, C. K., & Sears, K. E. (2010). The divergent development of the apical ectodermal ridge in the marsupial Monodelphis domestica. Anatomical Record, 293(8), 1325–1332.

132

Duran, I., Csukasi, F., Taylor, S. P., Krakow, D., Becerra, J., Bombarely, A., & Marí-Beffa, M. (2015). Collagen duplicate genes of bone and cartilage participate during regeneration of zebrafish fin skeleton. Gene Expression Patterns: GEP, 19(1-2), 60–69.

Durán, I., Marí-Beffa, M., Santamaría, J. A., Becerra, J., & Santos-Ruiz, L. (2011). Actinotrichia collagens and their role in fin formation. Developmental Biology, 354(1), 160–172.

Feiner, N., Ericsson, R., Meyer, A., & Kuraku, S. (2011). Revisiting the origin of the vertebrate Hox14 by including its relict sarcopterygian members. Journal of Experimental Zoology. Part B, Molecular and Developmental Evolution, 316(7), 515–525.

Fisher, S., Jagadeeswaran, P., & Halpern, M. E. (2003). Radiographic analysis of zebrafish skeletal defects. Developmental Biology, 264(1), 64–76.

Grande, L. (2010). An Empirical Synthetic Pattern Study of Gars (Lepisosteiformes) and Closely Related Species, Based Mostly on Skeletal Anatomy: The Resurrection of Holostei. American Society of Ichthyologists and Herpetologists.

Grande, L., & Bemis, W. E. (1998). A Comprehensive Phylogenetic Study of Amiid Fishes (Amiidae) Based on Comparative Skeletal Anatomy. an Empirical Search for Interconnected Patterns of Natural History. Journal of Vertebrate Paleontology, 18(sup1), 1–696.

Gross, J. B., Kerney, R., Hanken, J., & Tabin, C. J. (2011). Molecular anatomy of the developing limb in the coquí frog, Eleutherodactylus coqui. Evolution & Development, 13(5), 415–426.

Haro, E., Delgado, I., Junco, M., Yamada, Y., Mansouri, A., Oberg, K. C., & Ros, M. A. (2014). Sp6 and Sp8 transcription factors control AER formation and dorsal-ventral patterning in limb development. PLoS Genetics, 10(8), e1004468.

Heronimus, C. (1911). Die Entwicklung des Brustflossenskelettes bei Amia calva. Anatomischer Anzeiger, 34, 193–203.

Huang, C.-C., Wang, T.-C., Lin, B.-H., Wang, Y.-W., Johnson, S. L., & Yu, J. (2009). Collagen IX is required for the integrity of collagen II fibrils and the regulation of vascular plexus formation in zebrafish caudal fins. Developmental Biology, 332(2), 360–370.

Kopylova, E., Noé, L., & Touzet, H. (2012). SortMeRNA: fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics, 28(24), 3211–3217.

KryŽanovsky, S. (1927). DIE ENTWICKLUNG DER PAARIGEN FLOSSEN BEI ACIPENSER, AMIA UND LEPIDOSTEUS. Acta Zoologica, 8(2-3), 277–352.

Kuraku, S., Takio, Y., Tamura, K., Aono, H., Meyer, A., & Kuratani, S. (2008). Noncanonical role of Hox14 revealed by its expression patterns in lamprey and shark. Proceedings of the National Academy of Sciences of the United States of America, 105(18), 6679–6683.

133

Lewandoski, M., Sun, X., & Martin, G. R. (2000). Fgf8 signalling from the AER is essential for normal limb development. Nature Genetics, 26(4), 460–463.

Lufkin, T. (2007). In situ hybridization of whole-mount mouse embryos with RNA probes: hybridization, washes, and histochemistry. CSH Protocols, 2007, db.prot4823.

Mabee, P. M., & Noordsy, M. (2004). Development of the paired fins in the paddlefish, Polyodon spathula. Journal of Morphology, 261(3), 334–344.

Mollier, S. (1897). Die Entwicklung der paarigen Flossen des Störs. Anatomische Hefte I. Abt, 24, 3–74.

Moon, A. M., & Capecchi, M. R. (2000). Fgf8 is required for outgrowth and patterning of the limbs. Nature Genetics, 26(4), 455–459.

Powers, T. P., & Amemiya, C. T. (2004). Evidence for a Hox14 paralog group in vertebrates. Current Biology: CB, 14(5), R183–R184.

Purushothaman, S., Elewa, A., & Seifert, A. W. (2019). Fgf-signaling is compartmentalized within the mesenchyme and controls proliferation during salamander limb development. eLife, 8. https://doi.org/10.7554/eLife.48507

R Core Team (2014). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL http://www.R-project.org/.

Robinson, J. T., Thorvaldsdóttir, H., Winckler, W., Guttman, M., Lander, E. S., Getz, G., & Mesirov, J. P. (2011). Integrative genomics viewer. Nature Biotechnology, 29(1), 24–26.

Robledo, R. F., Rajan, L., Li, X., & Lufkin, T. (2002). The Dlx5 and Dlx6 homeobox genes are essential for craniofacial, axial, and appendicular skeletal development. Genes & Development, 16(9), 1089–1101.

Sewertzoff, A. N. (1926). Die Morphologie der Brustflossen der Fische. Jenaische Zeitschrift Fur Medicin Und Naturwissenschaft, 62, 343–392.

Tulenko, F. J., Augustus, G. J., Massey, J. L., Sims, S. E., Mazan, S., & Davis, M. C. (2016). HoxD expression in the fin-fold compartment of basal gnathostomes and implications for paired appendage evolution. Scientific Reports, 6, 22720.

Tulenko, F. J., Massey, J. L., Holmquist, E., Kigundu, G., Thomas, S., Smith, S. M. E., Mazan,

134 S., & Davis, M. C. (2017). Fin-fold development in paddlefish and catshark and implications for the evolution of the autopod. Proceedings of the Royal Society B: Biological Sciences, 284(1855), 20162780.

Wade, C., Brinas, I., Welfare, M., Wicking, C., & Farlie, P. G. (2012). Twist2 contributes to termination of limb bud outgrowth and patterning through direct regulation of Grem1. Developmental Biology, 370(1), 145–153.

Wiedersheim, R. (1892). Das Gliedmassenskelet der Wirbelthiere: mit besonderer Berücksichtigung des Schultur- und Beckengürtels bei Fischen, Amphibien und Reptilien. G. Fischer.

Wood, A. (1982). Early pectoral fin development and morphogenesis of the apical ectodermal ridge in the killifish, Aphyosemion scheeli. The Anatomical Record, 204(4), 349–356.

Yashiro, K., Zhao, X., Uehara, M., Yamashita, K., Nishijima, M., Nishino, J., Saijoh, Y., Sakai, Y., & Hamada, H. (2004). Regulation of retinoic acid distribution is required for proximodistal patterning and outgrowth of the developing mouse limb. Developmental Cell, 6(3), 411–422.

135 Chapter 5: Discussion

136 Chapter 5: Discussion

In this dissertation, I explored the genetic basis of morphological diversity using a forward genetic approach integrated with comparative developmental anatomy of fin development. By artificial perturbation of development through creation of a random mutation, I asked what new phenotypes can be produced in a single mutational step from the wild type genome. Using the paired appendages as a study system and the zebrafish as a model, I found that dramatic yet coordinated changes to the body plan can be achieved by even such limited alteration. The identified mutant revealed the existence, or perdurance, of a developmental potential in the zebrafish to produce morphological changes that harken to phylogenetically distant characters. Further investigation revealed that this developmental potential utilizes preexisting mechanisms to produce these coordinated changes in morphology. Thus, while not expressed, the latent potential to generate these morphologies was present and has been inherited from an ancestor. Such latent ancestral developmental potential and the utilization of pre-existing developmental programs is increasingly recognized as a generative force of morphological variation and is the focus of recent and exciting studies in Evolutionary Developmental Biology.

While cutting edge approaches are used today to examine latent developmental potential, the seeds of the concept are at least as old as the theory of evolution by natural selection itself. In the fifth chapter of On the Origin of Species, Darwin writes:

When a character which has been lost in a breed, reappears after a great number of generations, the most probable hypothesis is, not that the offspring suddenly takes after an ancestor some hundred generations distant, but that in each successive generation there has been a tendency to reproduce the character in question, which at last, under unknown favorable conditions, gains an ascendancy. (Darwin, 1859)

137 Latent ancestral developmental potential was also a concept in some of the earliest formal genetic studies. In his work on the expression of an extra digit in guinea pigs, Harvard geneticist

W.E. Castle writes:

More probably the character is present, active or inactive, in every gamete, but the conditions under which it may become active are too complex for present analysis. On the other hand, it is possible that nothing in the germ of a normal guinea-pig stands for the character, extra-toe, and that when this character is formed, it is formed de novo. But if so, we must account for the appearance of a new digit in the precise position of a lost one, and with all the appropriate nervous and muscular connections. This it seems quite as hard to do as to suppose an antecedent state of latency or inactivity of the character throughout certain generations of ancestors. (Castle, 1906)

With the advent of developmental genetics, we are now in a position to understand

Darwin’s “unknown favorable conditions” at a molecular level, how this tendency is retained, and how latent potential is deployed. This understanding will allow us to place the role of retained developmental potential in the broader evolutionary context and inform our understanding of the generation of morphological variation.

In the case of the zebrafish pectoral fin, I found that the latent potential to express proximodistal elaborations of the appendage endoskeleton, a trait lost in teleosts, is induced by mutations in the vav2/waslb pathway. I argue that this phenotype is most probably the result of the rekindling of ancestral appendage patterning mechanism, as basally branching ray-finned fishes such as the bowfin, bichir, and chondrosteans exhibit proximo-distal branching of their metapterygial axis in their paired fins (Jessen, 1972). However, it remains possible that the rephaim and wanda mutations are activating emergent behaviors that occur, given particular developmental conditions, within the developing fin, rather than deploying an ancestral developmental program. Given the shared activity of Wasl and Hox in regulating the observed

138 phenotypes, the emergent behaviors hypothesis seems less likely than activation of a latent program.

Not only is such elaboration of the fin endoskeleton in a teleost an unexpected developmental potential, but also this potential is being activated by an unexpected gene – one that was not previously thought to have any role in limb development or patterning of the skeleton. Given the molecular functions of the vav2 and waslb proteins, it is unlikely that the amino acid substitutions identified in the reph and wan mutants are themselves instructive of an endoskeleton elaboration developmental program. Rather, it is more likely that reph and wan act as permissive mutations that allow the activation of latent aspects of the appendage-patterning machinery already in place in teleost fins. Altogether, my findings demonstrate the dramatic morphological changes that can be produced through the activation of latent developmental potential and highlight the possible role of this potential in morphological evolution.

Are intermediate radials atavisms?

The reph and wan mutants reveal the latent developmental potential present in fins to develop additional long bones along the proximodistal axis. How did this potential arise? Do the newly formed skeletal elements represent atavistic reversals to an ancestral skeletal pattern, or are they novel elements that are simply found in a similar position? The answer to this question depends on two criteria: (i) the distribution of the character of intermediate-like elements across the phylogeny, and (ii) the developmental programs that are used to pattern these elements in the mutant (Hall, 2010). For a structure to be an atavism, it must first be present in a lineage and then be lost before reappearing. The common ancestor of bony fishes – including lineages leading to tetrapods - had proximal radials and possessed a metapterygium with distally articulating radials

139 in a similar position to where I observe intermediate radials in reph and wan mutants (Zhu et al.,

2009). This configuration persisted from the bony fish ancestor through much of the actinopterygian lineage until their absence in teleosts (Jessen, 1972). The lineage leading to teleosts thus did have distally articulating long bones in the pectoral skeleton but these bones were lost. Therefore, the first criterion is met: intermediate radials are potentially atavistic.

The second criterion: Do zebrafish mutants use the same developmental mechanism to specify intermediate fin structures as natural species, or have the mutants found a novel way of segmenting the skeleton? Ideally, this comparison would involve species that are as closely related as possible. In this case, the two species would be the zebrafish and the bowfin, the closest living relative with a metapterygium and proximodistal elaboration of the fin endoskeleton. Unfortunately, the present account of fin development in the bowfin is inadequate for this purpose. The closest relative for which we have sufficient functional data concerning the specification and development of intermediate appendage regions is the mouse or chicken. Given the genetic tools present for our use, we focused on the mouse for comparison.

Do reph and wan mutants use the same mechanism to specify intermediate regions of the appendage as seen in mammalian limb development? My analysis of the reph phenotype in different Hox mutant backgrounds revealed a genetic interaction between waslb and the posterior

Hox genes. The loss of Hox11 paralogs resulted in a reduction of the reph phenotype, as would be expected of a structure with an intermediate/zeugopod type identity. In addition, removal of

Hox13 paralogs resulted in an enhancement of the reph phenotype. While loss of Hox13 paralogs in mouse does not result in more long bones along the proximodistal axis, Hoxa-13 is known to have a repressive effect on Hoxa-11 in the limb (Kherdjemil et al., 2016). The enhancement of the reph phenotype upon removal of Hox13 paralogs suggests that a similar antagonistic

140 relationship between Hox11 and Hox13 genes exists in zebrafish fins as well as mouse limbs.

Further, the conditional loss of Wasl function in the limb closely phenocopies Hoxa-11 knockouts, suggesting that these two pathways are acting in parallel or epistatically in the mouse as well. These data suggest that the mouse and the zebrafish are leveraging the same genetic tools to enable appendicular skeletal elaboration. As such, my results are consistent with intermediate radials being a true atavism (Hall, 1995).

Wasl as a novel player in skeletal patterning

Discovering that a teleost is capable of limb-like elaboration of the pectoral fin was shocking. Perhaps even more unexpected was that the mutated genes responsible for such a phenotype were revealed to be genes involved in core cell processes, vav2 and waslb, which act in a similar pathway to regulate actin cytoskeleton dynamics (Rohatgi, 1999; Abe et al, 2000).

These genes had no previous association with embryonic patterning or skeletal development. My finding that Wasl and Vav2 have specific patterning roles in the skeleton is especially unexpected considering the extent of knowledge concerning Wasl gene function in other contexts. The ability to discover new functions of a gene has been studied in hundreds of papers and highlights the importance and power of genetic screens in finding unique alleles and

‘pushing’ developmental systems in their regulation of phenotypes.

It remains an open question what limb developmental genetic mechanisms Wasl directly regulates. From my experiments in zebrafish, I know there is a genetic interaction between Wasl and the Hox genes. However, it is unclear what this interaction looks like at the level of the patterning pathway. I do not know if Wasl is a direct upstream regulator of HoxA and HoxD expression, as it is for HoxB (Ferrai et al., 2009), or if Wasl is a downstream target of Hox genes

141 or linked through some other relationship. I determined that the reph mutation affects Wasl localization in cell culture, causing an increase in the cytoplasmic fraction. It may be that the reph phenotype arises from enhancement of the cytoplasmic function of Wasl, or it could be removal of Wasl from the nucleus that drives the phenotype. The salient effects on Wasl function might depend on the aspect of skeletal development in question. Introduction of the reph mutation into mouse Wasl resulted in wild-type limb patterning when placed over a conditional null allele, suggesting that the mutant protein retains its normal function in limbs. However, expression of the reph Wasl allele, whether over a wild-type Wasl allele or a conditional null, caused a sternum phenotype similar to the Wasl LPM cKO loss-of-function phenotype. This result suggests that the regulation of pattern by Wasl is complex and might involve different functions of the protein in different parts of the skeleton.

While the specific role of Wasl in limb patterning remains obfuscated, progress was more forthcoming in understanding the role of the protein in the development of dermal bones.

Finding that Wasl modified the behavior of F-actin-bearing lamellipodia on the mesenchymal cells in the growing fin fold, my colleagues and I developed a mechanistic hypothesis regarding the role of Wasl in migrating osteoblast precursors. This model might be able to explain the role of Wasl in the fin fold but also the calvaria of the skull.

Atavism in evolution: a process or a by-product?

What is the significance of atavisms in evolution? Certainly as a concept, atavism was important in the development of evolutionary theory. Darwin himself used the existence of atavisms as evidence for common ancestry and decent (Darwin, 1859). Atavisms also provide examples in which to consider aspects of homology, development, teratology, and gene function.

142 But how important are atavisms in terms of the generation of morphological diversity (Hall,

1984)? This is hard to assess, especially because our ability to identify atavisms is underpowered

(Tomić and Meyer-Rochow, 2011). To recognize a trait or character as atavistic, we must have sufficient knowledge of the evolutionary history of the lineage and the condition of the ancestor

(Hall, 1995, 2010). Otherwise, we cannot know if a feature was once present and regained after loss, or if the feature arose de novo. For this reason, we are biased to identify atavisms in well- studied systems with extensive fossil records and for which we have a broad understanding of extant diversity and morphology. Lineages that are soft bodied or exist in habitats not conducive to fossilization are unlikely to reveal many atavistic reversals.

Beyond our limited ability to detect atavistic traits, authors have questioned whether atavism truly exists as a biological phenomenon. For instance, Agnes Arber held that what was offered as examples of atavism were simply variations in the number of meristic structures.

Since the ‘re-evolved’ structure in these cases still existed in the organism in reduced number or different locations, she considered it trivial for the developmental system to increase the number of these structures. In her conception, Agnes Arber held that only organs and structures that were lost completely and then reemerge could be taken under consideration as a true atavism. Such a strict test would remove many examples put forth as atavisms: increases in digit number in horses and guinea-pigs, reappearance of the second molar in lynx, changes in nipple number in mammals, reappearance of mandibular teeth in frogs, and the reacquisition of hindlimbs in dolphins and whales (Tomić and Meyer-Rochow, 2011). Perhaps the only examples that survive this stringent screen are atavistic teeth in birds (Harris et al., 2006), and the re-evolution of wings in stick insects (Whiting et al., 2003), where the structures were lost entirely. However, Agnes

Arber’s assumption about the relative ease with which meristic variation can arise, or organs can

143 be reformed in new places on the body is quite optimistic. While a genetic regulatory network might be present in an organism, not every region of the body may be competent to respond to inductive signals. This point is well made by Danionella dracula which, instead of redeploying the tooth gene regulatory network to the oral jaws, evolved tooth-like projections of the dermal jaw de novo (Britz, Conway, and Rüber, 2009).

Whether structures are lost completely or in part, the capacity of evolutionary reversal is predicated on retention and preservation of the developmental genetic mechanisms (Hall, 2010).

In the case of partial losses, the patterning mechanism persists in the remaining structures and can be maintained. When a structure is lost in its entirety - no rudiment, no vestige, no serial homolog - it is less obvious how the mechanism is preserved. In this case, the pleiotropic nature of developmental control genes is likely involved. There are a limited number of signaling pathways, and genes play similar roles in different gene regulatory networks (Davidson and

Erwin, 2006). The genetic kernels and circuits used to pattern a lost structure are likely preserved due to their role in other parts of the body. These circuits can be redeployed to generate the lost structure anew. However, recruiting all the gene regulatory mechanisms to recreate a completely lost organ is less frequent than the redeployment of an intact mechanism to an ancestral position.

For example, the restoration of teeth in a completely edentulous lineage is less likely than the redeployment of the tooth program in a lineage that retains teeth in another position. This might be an explanation for why examples of meristic atavism are more numerous than examples of reversal after complete organ loss.

In either case, atavisms require the redeployment of preexisting patterning programs.

However, atavisms are not the only instances in which genetic programs from one developmental context are deployed in a different context. In the next section, I discuss redeployment in other

144 contexts in an attempt to unify these various phenomena into a concept of latent ancestral developmental potential.

Co-option and atavism as special cases of latent ancestral developmental potential

A model can be devised in which atavisms are a component of a broader conceptual framework of development in evolution. Latent ancestral developmental potential involves the deployment of preexisting developmental genetic programs in response to an inducing signal to produce changes to the body plan. These genetic pathways/interactions were hard-wired prior to the new inductive event and remain latent in the lineage in which they are assembled but not expressed. In descendants of the ancestor, this developmental potential can be realized by inductive, but permissive, signals (Figure 5.1).

Depending on the context of the deployment of these programs, induction of latent ancestral developmental potential can result in the production of a morphological novelty or the reemergence of an atavistic structure. The deployment of a regulatory circuit in a new context is termed ‘co-option’ and is implicated in the evolution of morphological innovations (True and

Carroll, 2002; Shubin et al., 2009; Hu et al., 2018; Bowman et al., 2019; Fisher et al., 2020).

While the structure itself is novel, the underlying developmental program is not. An example of such co-option is provided by the horns of beetles. Beetles of the genus Onthophagus exhibit horns on different parts of the head and thorax (Moczek, 2005). As horns lack homologs in other groups of insects, these structures represent morphological novelties that arose uniquely within beetles. These novel structures, however, are not patterned by novel developmental mechanisms constructed de novo. Rather, horns arose through the co-option and redeployment of the appendage program to the horn-bearing regions (Moczek and Rose, 2009).

145

Figure 5.1. Atavism, co-option, and latent ancestral developmental potential. Expression of Latent ancestral developmental potential involves the deployment of preexisting developmental genetic mechanisms. Colored boxes denote expression of a character, and open boxes indicate its absence. (Left) A developmental potential can arise in the ancestor of a group before the potential is realized by an inducing signal. Decedents retain this potential and can express it upon induction (blue tips). (Center) In co-option, a gene regulatory network used to pattern Character A is redeployed (hooked arrow) in a new context to pattern a new character, B. In the example of beetle horns, Character A would symbolize legs, and Character B would be the novel beetle horns. (Right) Atavism is a special case of co-option, where the network that patterned the original structure is again redeployed at the original position where the structure was lost.

Thus, the ability to produce horns arises via the historical shaping of the appendage program that is within limbed insects, and this potential is realized in the new developmental context of the head leading to horn formation.

In an atavistic character, the structure itself is lost, but the developmental programs that produce the structure are sufficiently retained and can be reactivated (Hall, 2010). For gene regulatory networks to survive in the absence of the structure, they must be preserved in some other aspects of development that retain their functionality (Marshall et al., 1994). For a structure to reappear, its cognate developmental program must be redeployed/reactivated in the original position. In this way, the atavistic structure is co-opting the developmental program from the other developmental context in which it is used.

146 From this reasoning, latent developmental programs underly both the formation of some novelties as well as atavisms. Novelties can arise from the co-option of a developmental program from one tissue to a new location, and atavisms reappear from the co-option of a developmental program to a location from which it was lost. While atavism and novelty represent different patterns in phylogeny, they share a similar underlying generative process: the co-option of preexisting developmental programming.

Latent potential and the tempo of morphological evolution

Latent ancestral developmental potential, co-option, and atavism are able to generate dramatic changes to the body plan, in some cases in a single generation. These abrupt processes are a stark contrast to the slow changes in morphology over long time periods anticipated by gradualism (Pennell et al., 2013). Should we expect changes to the body to always occur so quickly? Clearly the fossil record says no, and many lineages exhibit stasis over long time periods. Latent ancestral developmental potential is likely a special case that occurs infrequently on a background of gradualistic change, kept in pace by natural selection and canalization of development.

While latent ancestral developmental potential can cause large changes in the body plan, it cannot explain the origin of such potential. The initial generative process of latent developmental programs occurred over evolutionary history. The signaling pathways, gene regulatory networks, and epigenetic interactions that make latent potential possible were themselves assembled and refined over many generations. An atavism in one generation reactivates a suite of genes, programs, and interactions that took millions of years to assemble.

For example, in the case of Pheidole ants and their latent ability to produce a supersoldier caste,

147 the potential to make a supersoldier is realized by the addition of a single factor, Juvenile

Hormone (JH; Rajakumar et al., 2012). However, the developmental genetic program that JH activates—the receptors, the transcription factors, the target genes, the entire coordinated response to the JH signal—evolved over many generations of the Insecta lineage. Similarly, the talpid2 mutation causes chickens in a single step to develop teeth after tens of millions of years of their absence (Harris et al., 2006). However, the origin and evolution of epithelial appendage programs that culminated in vertebrate teeth took place over hundreds of millions of years

(Fraser et al., 2010). In this sense, latent ancestral developmental potential is the abrupt “cashing out” of finely tuned developmental programs built by the investment of gradualistic evolution.

In closing, I have identified single mutations that cause the elaboration of the teleost fin skeleton by activating latent, limb-like patterning mechanisms. The success of using a forward genetic screen to detect resting developmental potential raises the question of what other potentials and phenotypes can be discovered with this approach. Not only did this method yield an unprecedented phenotype, it also identified a novel genetic pathway regulating the skeleton. In this dissertation, I have started the work to understand how this pathway is able to activate latent ancestral developmental potential, but much more remains to be discovered in this system.

Characterization of this system can help us understand how latent potential is maintained, and what role it plays in the evolution of morphology.

References

148 Britz, R., Conway, K. W., & Rüber, L. (2009). Spectacular morphological novelty in a miniature cyprinid fish, Danionella dracula n. sp. Proceedings of the Royal Society B: Biological Sciences, 276(1665), 2179–2186.

Bowman, J. L., Briginshaw, L. N., & Florent, S. N. (2019). Chapter Two - Evolution and co- option of developmental regulatory networks in early land plants. In U. Grossniklaus (Ed.), Current Topics in Developmental Biology (Vol. 131, pp. 35–53). Academic Press.

Castle, W.E. (1906). The origin of a polydactylous race of guinea-pigs /. 22.

Darwin, C. (1859). On the Origin of Species by Means of Natural Selection, Or, The Preservation of Favoured Races in the Struggle for Life. J. Murray.

Davidson, E. H., & Erwin, D. H. (2006). Gene regulatory networks and the evolution of animal body plans. Science, 311(5762), 796–800.

Fisher, C. R., Wegrzyn, J. L., & Jockusch, E. L. (2020). Co-option of wing-patterning genes underlies the evolution of the treehopper helmet. Nature Ecology & Evolution, 4(2), 250–260.

Fraser, G. J., Cerny, R., Soukup, V., Bronner-Fraser, M., & Streelman, J. T. (2010). The odontode explosion: the origin of tooth-like structures in vertebrates. BioEssays: News and Reviews in Molecular, Cellular and Developmental Biology, 32(9), 808–817.

Hall, B. K. (1995). Atavisms and atavistic mutations. Nature Genetics, 10(2), 126–127.

Hall, B. K. (2010). Atavisms. Current Biology: CB, 20(20), R871.

Harris, M. P., Hasso, S. M., Ferguson, M. W. J., & Fallon, J. F. (2006). The development of archosaurian first-generation teeth in a chicken mutant. Current Biology: CB, 16(4), 371–377.

Hu, Y., Schmitt-Engel, C., Schwirz, J., Stroehlein, N., Richter, T., Majumdar, U., & Bucher, G. (2018). A morphological novelty evolved by co-option of a reduced gene regulatory network and gene recruitment in a beetle. Proceedings. Biological Sciences / The Royal Society, 285(1885). https://doi.org/10.1098/rspb.2018.1373

Jessen, H. L. (1972). Fossils and Strata, Schultergurtel und Pectoralflosse bei Actinopterygiern. Lethaia, 5(3), 344.

149 Marshall, C. R., Raff, E. C., & Raff, R. A. (1994). Dollo’s law and the death and resurrection of genes. Proceedings of the National Academy of Sciences of the United States of America, 91(25), 12283–12287.

Moczek, A. P. (2005). The Evolution and Development of Novel Traits, or How Beetles Got Their Horns. Bioscience, 55(11), 937–951.

Moczek, A. P., & Rose, D. J. (2009). Differential recruitment of limb patterning genes during development and diversification of beetle horns. Proceedings of the National Academy of Sciences of the United States of America, 106(22), 8992–8997.

Pennell, M. W., Harmon, L. J., & Uyeda, J. C. (2014). Is there room for punctuated equilibrium in macroevolution? Trends in Ecology & Evolution, 29(1), 23–32.

Tomić, N., & Meyer-Rochow, V. B. (2011). Atavisms: medical, genetic, and evolutionary implications. Perspectives in Biology and Medicine, 54(3), 332–353.

True, J. R., & Carroll, S. B. (2002). Gene co-option in physiological and morphological evolution. Annual Review of Cell and Developmental Biology, 18, 53–80.

Whiting, M. F., Bradler, S., & Maxwell, T. (2003). Loss and recovery of wings in stick insects. Nature, 421(6920), 264–267.

Zhu, M., & Yu, X. (2009). Stem sarcopterygians have primitive polybasal fin articulation. Biology Letters, 5(3), 372–375.

150 Appendix: Supplemental Material

Page

151 Chapter 2 Supplemental Material

152 Supplemental Figures SF2.1 - SF2.8

160 Supplemental Table 2.1

151

Supplemental Figure 2.1. Phylogenetic model of pectoral appendage articulation in bony fishes

The last common ancestor of the bony fishes (the clade that encompasses the teleost and tetrapod lineages) had a polybasal condition in which the most proximal endochondral elements of the fin articulated with the shoulder girdle. The pectoral fin consisted of the anterior propterygium, the middle mesopterygium, and the posterior metapterygium. In the lineage leading to tetrapods, the propterygium and mesopterygium are postulated to have been lost along with the dermal fin rays, while new long bones that articulate end on end were added along the PD axis of the metapterygium, ultimately forming the limb. Conversely, in the teleost lineage, it is proposed that the metapterygium was lost while the propterygium and mesopterygium were retained, and no teleost exhibits end-on-end articulation of long bones in the pectoral fin. While rare, variation in the teleost pectoral fin endoskeleton is observed in proximal radial length as well as the number of radials along the AP axis of the fin in different clades. However, no teleost species showing PD long bone articulation comparable to that seen in tetrapods have been described.

152

Supplemental Figure 2.2. Additional adult phenotypes of reph and wan mutants

Adult pigmentation and skeletal patterning phenotypes of dorsal and pelvic fins in reph and wan mutants. (A-C) wild-type adult. (D-F) reph heterozygotes show increased number of radials in the dorsal fin (asterisk), however pelvic fins (F) are unaffected. (G-I) reph homozygous mutants show more severe effect on pigmentation (G) and defects in lepidotrichia growth and maintenance. (H and I) Dorsal fin endoskeleton in homozygous fish is uninterpretable. (J and L) wan heterozygotes show alteration in pigmentation and medial fin growth and patterning, pelvic fins are unaffected. (M-O) Similar to reph, wan homozygous fish show a more severe effect on pigmentation, and highly dysmorphic fin rays and endoskeletal elements in the dorsal and pelvic fins. Scale bars (B, E, H, K, N) 500 μm, (C, F, I, L, O) 1 mm.

153

Supplemental Figure 2.3. Mapping the causative mutations underlying the rephaim and wanda phenotypes

(A) Mapping score from homozygosity-by-descent analysis for reph and wan mutants based on whole-exome sequencing of homozygous populations. Asterisks highlight regions of putative linkage. (B) Fine mapping of the chromosome with the highest mapping score by recombination analysis in individual homozygous mutants. Shown are informative markers used, their position, and the number of recombinants identified per meiosis scored. Within the smaller linked interval, sequence data from the mutant pool was used to identify nonsynonymous SNPs as candidate mutations responsible for the altered skeletal phenotype of reph and wan.

154

Supplemental Figure 2.4. Gain-of-function mutations in waslb and vav2 cause the reph and wan phenotypes, respectively

(A) Waslb and (B) Vav2 protein schematics showing positions of missense mutations and CRISPR-generated lesions. Multiple sequence alignment reveals conservation of the mutated residues (pink bars) across vertebrates. Yellow bar indicated phosphorylated residue. Mutant alleles are listed with their consequence on amino acid sequence and their phenotypic effect. (C- D) HeLa cells transfected with constructs encoding N-terminal GFP fusions to mouse wild-type N-Wasp (C) and an N-Wasp version containing the orthologous reph mutation (S249P; D). (E) Qualitative scoring of transfected cells; white, predominantly cytoplasmic localization; black, predominantly nuclear localization; grey, no bias observed in localization.

155

Supplemental Figure 2.5. CRISPR-generated loss-of-function mutants of waslb and vav2

(A and B) Mutant lines of waslb and vav2 generated by CRISPR-Cas9 targeted gene editing. Shown is the targeted wild-type sequence as well as the sequence for the generated mutant alleles (blue indicates guide target sequence). Pictures show representative homozygous mutants. All mutants are homozygous viable and fertile. (C) Whole mount skeletal stained adult pectoral fins from homozygous mutants show no obvious defects in fin patterning (n=10 for each single mutant). Double mutants exhibit loss of proximal radial 4 (n=4 of 4, 100%).

156

Supplemental Figure 2.6. CRISPR-generated hox11 loss-of-function mutants

Mutant lines of hox11 paralogs. (A) hoxa11a (B) hoxa11b (C) hoxd11a generated by CRISPR- Cas9 targeted gene editing. Shown is the targeted wild-type sequence as well as the sequence for the generated mutant alleles (blue indicates guide target sequence). (D) Representative singular and compound mutants. All mutant combinations are viable and fertile. Scale bars 500 μm.

157

Supplemental Figure 2.7. Cartilage morphology in wild type and waslbreph/+ radials at 4 wpf

Pectoral fin radials cleared and stained for Alcian and alizarin imaged on a confocal microscope. Representative confocal sections demonstrating differences in chondrocyte morphology in wild and waslbreph/+ fourth radials. Wild-type radials have small chondrocytes in the distal growth zone subtended by larger hypertrophic chondrocytes. Mutants also exhibit growth zone and hypertrophic chondrocytes, and additionally show a region of high cell density that resembled a joint interzone.

158

Supplemental Figure 2.8. Leaky Cre activity in in maternal Prrx1-Cre driver

GFP signal is a readout Cre activity in embryonic mice carrying the mTmG transgene. When the Prrx1-Cre driver is transmitted through the male parent, signal in the mesoderm is restricted to the expected limb pattern. However, when the driver is received from the female parent, half of the animals exhibit recombination throughout the body, indicating off-target Cre expression.

159 Supplemental Table 2.1. Skeletal phenotypes in Wasl LKO mice

wild type Wasl LKO (n=5) (n=5) Vertebral pattern 6 Lumbar / 4 Sacral (wild type) 5 2 6 Lumbar / 1 Mixed Identity / 3 Sacral 0 2 7 Lumbar / 3 Sacral 0 1

Wrist pattern normal 5 0 d2 + c + d4 fusion 0 5 sl + py fusion 0 1 pi + T fusion 0 5

Tibia and Fibula: normal/unfused 5/0 0/5

Limb long bones: normal/shortened 5/0 0/5

Counts reported for limb and axial phenotypes observed in Wasl LKO mice and wild-type littermates cleared and stained at P30. c, central carpal; d2, distal carpal 2; d4, distal carpal 4; pi, pisiform; py, pyramidal; sl, scapholunate; T, triangular.

160