Please Find Below Over 500 Published Articles Reporting the Biochemical and Functional Validation of Protein Interactions Discov
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Open Dogan Phdthesis Final.Pdf
The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues. -
BTG2: a Rising Star of Tumor Suppressors (Review)
INTERNATIONAL JOURNAL OF ONCOLOGY 46: 459-464, 2015 BTG2: A rising star of tumor suppressors (Review) BIjING MAO1, ZHIMIN ZHANG1,2 and GE WANG1 1Cancer Center, Institute of Surgical Research, Daping Hospital, Third Military Medical University, Chongqing 400042; 2Department of Oncology, Wuhan General Hospital of Guangzhou Command, People's Liberation Army, Wuhan, Hubei 430070, P.R. China Received September 22, 2014; Accepted November 3, 2014 DOI: 10.3892/ijo.2014.2765 Abstract. B-cell translocation gene 2 (BTG2), the first 1. Discovery of BTG2 in TOB/BTG gene family gene identified in the BTG/TOB gene family, is involved in many biological activities in cancer cells acting as a tumor The TOB/BTG genes belong to the anti-proliferative gene suppressor. The BTG2 expression is downregulated in many family that includes six different genes in vertebrates: TOB1, human cancers. It is an instantaneous early response gene and TOB2, BTG1 BTG2/TIS21/PC3, BTG3 and BTG4 (Fig. 1). plays important roles in cell differentiation, proliferation, DNA The conserved domain of BTG N-terminal contains two damage repair, and apoptosis in cancer cells. Moreover, BTG2 regions, named box A and box B, which show a high level of is regulated by many factors involving different signal path- homology to the other domains (1-5). Box A has a major effect ways. However, the regulatory mechanism of BTG2 is largely on cell proliferation, while box B plays a role in combination unknown. Recently, the relationship between microRNAs and with many target molecules. Compared with other family BTG2 has attracted much attention. MicroRNA-21 (miR-21) members, BTG1 and BTG2 have an additional region named has been found to regulate BTG2 gene during carcinogenesis. -
Extrinsic Regulators of Mrna Translation in Developing Brain: Story of Wnts
cells Article Extrinsic Regulators of mRNA Translation in Developing Brain: Story of WNTs Yongkyu Park * , Midori Lofton , Diana Li and Mladen-Roko Rasin * Department of Neuroscience and Cell Biology, Robert Wood Johnson Medical School, Rutgers University, Piscataway, NJ 08854, USA; [email protected] (M.L.); [email protected] (D.L.) * Correspondence: [email protected] (Y.P.); [email protected] (M.-R.R.) Abstract: Extrinsic molecules such as morphogens can regulate timed mRNA translation events in developing neurons. In particular, Wingless-type MMTV integration site family, member 3 (Wnt3), was shown to regulate the translation of Foxp2 mRNA encoding a Forkhead transcription factor P2 in the neocortex. However, the Wnt receptor that possibly mediates these translation events remains unknown. Here, we report Frizzled member 7 (Fzd7) as the Wnt3 receptor that lays downstream in Wnt3-regulated mRNA translation. Fzd7 proteins co-localize with Wnt3 ligands in developing neo- cortices. In addition, the Fzd7 proteins overlap in layer-specific neuronal subpopulations expressing different transcription factors, Foxp1 and Foxp2. When Fzd7 was silenced, we found decreased Foxp2 protein expression and increased Foxp1 protein expression, respectively. The Fzd7 silencing also dis- rupted the migration of neocortical glutamatergic neurons. In contrast, Fzd7 overexpression reversed the pattern of migratory defects and Foxp protein expression that we found in the Fzd7 silencing. We further discovered that Fzd7 is required for Wnt3-induced Foxp2 mRNA translation. Surprisingly, we also determined that the Fzd7 suppression of Foxp1 protein expression is not Wnt3 dependent. In conclusion, it is exhibited that the interaction between Wnt3 and Fzd7 regulates neuronal identity and the Fzd7 receptor functions as a downstream factor in ligand Wnt3 signaling for mRNA translation. -
Genes in Eyecare Geneseyedoc 3 W.M
Genes in Eyecare geneseyedoc 3 W.M. Lyle and T.D. Williams 15 Mar 04 This information has been gathered from several sources; however, the principal source is V. A. McKusick’s Mendelian Inheritance in Man on CD-ROM. Baltimore, Johns Hopkins University Press, 1998. Other sources include McKusick’s, Mendelian Inheritance in Man. Catalogs of Human Genes and Genetic Disorders. Baltimore. Johns Hopkins University Press 1998 (12th edition). http://www.ncbi.nlm.nih.gov/Omim See also S.P.Daiger, L.S. Sullivan, and B.J.F. Rossiter Ret Net http://www.sph.uth.tmc.edu/Retnet disease.htm/. Also E.I. Traboulsi’s, Genetic Diseases of the Eye, New York, Oxford University Press, 1998. And Genetics in Primary Eyecare and Clinical Medicine by M.R. Seashore and R.S.Wappner, Appleton and Lange 1996. M. Ridley’s book Genome published in 2000 by Perennial provides additional information. Ridley estimates that we have 60,000 to 80,000 genes. See also R.M. Henig’s book The Monk in the Garden: The Lost and Found Genius of Gregor Mendel, published by Houghton Mifflin in 2001 which tells about the Father of Genetics. The 3rd edition of F. H. Roy’s book Ocular Syndromes and Systemic Diseases published by Lippincott Williams & Wilkins in 2002 facilitates differential diagnosis. Additional information is provided in D. Pavan-Langston’s Manual of Ocular Diagnosis and Therapy (5th edition) published by Lippincott Williams & Wilkins in 2002. M.A. Foote wrote Basic Human Genetics for Medical Writers in the AMWA Journal 2002;17:7-17. A compilation such as this might suggest that one gene = one disease. -
(Numbl) Downregulation Increases Tumorigenicity, Cancer Stem Cell-Like Properties and Resistance to Chemotherapy
www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 39 Research Paper Numb-like (NumbL) downregulation increases tumorigenicity, cancer stem cell-like properties and resistance to chemotherapy José M. García-Heredia1,2, Eva M. Verdugo Sivianes1, Antonio Lucena-Cacace1, Sonia Molina-Pinelo1,3, Amancio Carnero1 1Instituto de Biomedicina de Sevilla (IBIS), Hospital Universitario Virgen del Rocio, Universidad de Sevilla, Consejo Superior de Investigaciones Cientificas, Seville, Spain 2Department of Vegetal Biochemistry and Molecular Biology, University of Seville, Seville, Spain 3Present address: Instituto de Investigación Hospital 12 de Octubre, Madrid, Spain Correspondence to: Amancio Carnero, email: [email protected] Keywords: NumbL, Notch, cancer stem cells, tumor suppressor, tumorigenicity Received: April 22, 2016 Accepted: August 12, 2016 Published: August 23, 2016 ABSTRACT NumbL, or Numb-like, is a close homologue of Numb, and is part of an evolutionary conserved protein family implicated in some important cellular processes. Numb is a protein involved in cell development, in cell adhesion and migration, in asymmetric cell division, and in targeting proteins for endocytosis and ubiquitination. NumbL exhibits some overlapping functions with Numb, but its role in tumorigenesis is not fully known. Here we showed that the downregulation of NumbL alone is sufficient to increase NICD nuclear translocation and induce Notch pathway activation. Furthermore, NumbL downregulation increases epithelial-mesenchymal transition (EMT) and cancer stem cell (CSC)-related gene transcripts and CSC-like phenotypes, including an increase in the CSC-like pool. These data suggest that NumbL can act independently as a tumor suppressor gene. Furthermore, an absence of NumbL induces chemoresistance in tumor cells. An analysis of human tumors indicates that NumbL is downregulated in a variable percentage of human tumors, with lower levels of this gene correlated with worse prognosis in colon, breast and lung tumors. -
Differential Stromal Reprogramming in Benign and Malignant Naturally Occurring Canine Mammary Tumours Identifies Disease-Promoting Stromal Components
bioRxiv preprint doi: https://doi.org/10.1101/783621; this version posted September 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Differential stromal reprogramming in benign and malignant naturally occurring canine mammary tumours identifies disease-promoting stromal components Parisa Amini 1,a, Sina Nassiri 2,a, Alexandra Malbon 3,4 and Enni Markkanen 1,* 1 Institute of Veterinary Pharmacology and Toxicology, Vetsuisse Faculty, University of Zürich, Zürich, Switzerland 2 Bioinformatics Core Facility, SIB Swiss Institute of Bioinformatics, Lausanne, Switzerland 3 Institute of Veterinary Pathology, Vetsuisse Faculty, University of Zürich, Zürich, Switzerland 4 current address: The Royal (Dick) School of Veterinary Studies and The Roslin Institute Easter Bush Campus, Midlothian, EH25 9RG a these authors contributed equally to the manuscript * Correspondence: [email protected]; ORCID: 0000-0001-7780-8233 Keywords Laser-capture microdissection, canine mammary carcinoma, canine mammary adenoma, breast cancer, tumour stroma, tumour microenvironment Summary statement: RNasequencing-based analysis of stromal reprogramming between benign and malignant naturally occurring canine mammary tumours identifies potential molecular drivers in cancer-associated stroma that support tumour growth and malignancy. Abstract The importance of cancer-associated stroma (CaS) for initiation and progression of cancer is well accepted. However, as stromal changes in benign forms of naturally occurring tumours are poorly understood, it remains unclear how CaS from benign and malignant tumours compare. Spontaneous canine mammary tumours are viewed as excellent models of human mammary carcinomas (mCa). -
A Unique and Specific Interaction Between Αt-Catenin and Plakophilin
2126 Research Article A unique and specific interaction between ␣T-catenin and plakophilin-2 in the area composita, the mixed-type junctional structure of cardiac intercalated discs Steven Goossens1,2,*, Barbara Janssens1,2,*,‡, Stefan Bonné1,2,§, Riet De Rycke1,2, Filip Braet1,2,¶, Jolanda van Hengel1,2 and Frans van Roy1,2,** 1Department for Molecular Biomedical Research, VIB and 2Department of Molecular Biology, Ghent University, B-9052 Ghent, Belgium *These authors contributed equally to this work ‡Present address: Wiley-VCH, Boschstrasse 12, D-69469 Weinheim, Germany §Present address: Diabetes Research Center, Brussels Free University (VUB), Laarbeeklaan 103, B-1090 Brussels, Belgium ¶Present address: Australian Key Centre for Microscopy and Microanalysis, The University of Sydney, NSW 2006, Australia **Author for correspondence (e-mail: [email protected]) Accepted 24 April 2007 Journal of Cell Science 120, 2126-2136 Published by The Company of Biologists 2007 doi:10.1242/jcs.004713 Summary Alpha-catenins play key functional roles in cadherin- desmosomal proteins in the heart localize not only to the catenin cell-cell adhesion complexes. We previously desmosomes in the intercalated discs but also at adhering reported on ␣T-catenin, a novel member of the ␣-catenin junctions with hybrid composition. We found that in the protein family. ␣T-catenin is expressed predominantly in latter junctions, endogenous plakophilin-2 colocalizes with cardiomyocytes, where it colocalizes with ␣E-catenin at the ␣T-catenin. By providing an extra link between the intercalated discs. Whether ␣T- and ␣E-catenin have cadherin-catenin complex and intermediate filaments, the specific or synergistic functions remains unknown. In this binding of ␣T-catenin to plakophilin-2 is proposed to be a study we used the yeast two-hybrid approach to identify means of modulating and strengthening cell-cell adhesion specific functions of ␣T-catenin. -
A Genome-Wide Association Study of Calf Birth Weight in Holstein Cattle Using Single Nucleotide Polymorphisms and Phenotypes Predicted from Auxiliary Traits
J. Dairy Sci. 97 :3156–3172 http://dx.doi.org/ 10.3168/jds.2013-7409 © American Dairy Science Association®, 2014 . A genome-wide association study of calf birth weight in Holstein cattle using single nucleotide polymorphisms and phenotypes predicted from auxiliary traits J. B. Cole ,*1 B. Waurich ,† M. Wensch-Dorendorf ,† D. M. Bickhart ,* and H. H. Swalve † * Animal Improvement Programs Laboratory, Agricultural Research Service, USDA, Beltsville, MD 20705-2350 † Institute of Agricultural and Nutritional Sciences, Martin-Luther-University Halle-Wittenberg, Theodor-Lieser-Str. 11, D-06120 Halle / Saale, Germany ABSTRACT derived from one population are useful for identifying genes and gene networks associated with phenotypes Previous research has found that a quantitative trait that are not directly measured in a second population. locus exists affecting calving and conformation traits This approach will identify only genes associated with on Bos taurus autosome 18 that may be related to the traits used to construct the birth weight predictor, increased calf birth weights, which are not routinely and not loci that affect only birth weight. recorded in the United States. Birth weight data from Key words: birth weight , quantitative trait loci , se- large, intensively managed dairies in eastern Germany lection index , single nucleotide polymorphism with management systems similar to those commonly found in the United States were used to develop a selec- INTRODUCTION tion index predictor for predicted transmitting ability (PTA) of birth weight. The predictor included body Many studies have reported on QTL affecting calving depth, rump width, sire calving ease, sire gestation traits in several populations of Holstein cattle (Kühn et al., 2003; Schnabel et al., 2005; Holmberg and Ander- length, sire stillbirth, stature, and strength. -
Pan-Cancer Analysis of Homozygous Deletions in Primary Tumours Uncovers Rare Tumour Suppressors
Corrected: Author correction; Corrected: Author correction ARTICLE DOI: 10.1038/s41467-017-01355-0 OPEN Pan-cancer analysis of homozygous deletions in primary tumours uncovers rare tumour suppressors Jiqiu Cheng1,2, Jonas Demeulemeester 3,4, David C. Wedge5,6, Hans Kristian M. Vollan2,3, Jason J. Pitt7,8, Hege G. Russnes2,9, Bina P. Pandey1, Gro Nilsen10, Silje Nord2, Graham R. Bignell5, Kevin P. White7,11,12,13, Anne-Lise Børresen-Dale2, Peter J. Campbell5, Vessela N. Kristensen2, Michael R. Stratton5, Ole Christian Lingjærde 10, Yves Moreau1 & Peter Van Loo 3,4 1234567890 Homozygous deletions are rare in cancers and often target tumour suppressor genes. Here, we build a compendium of 2218 primary tumours across 12 human cancer types and sys- tematically screen for homozygous deletions, aiming to identify rare tumour suppressors. Our analysis defines 96 genomic regions recurrently targeted by homozygous deletions. These recurrent homozygous deletions occur either over tumour suppressors or over fragile sites, regions of increased genomic instability. We construct a statistical model that separates fragile sites from regions showing signatures of positive selection for homozygous deletions and identify candidate tumour suppressors within those regions. We find 16 established tumour suppressors and propose 27 candidate tumour suppressors. Several of these genes (including MGMT, RAD17, and USP44) show prior evidence of a tumour suppressive function. Other candidate tumour suppressors, such as MAFTRR, KIAA1551, and IGF2BP2, are novel. Our study demonstrates how rare tumour suppressors can be identified through copy number meta-analysis. 1 Department of Electrical Engineering (ESAT) and iMinds Future Health Department, University of Leuven, Kasteelpark Arenberg 10, B-3001 Leuven, Belgium. -
Genome-Wide DNA Methylation Analysis on C-Reactive Protein Among Ghanaians Suggests Molecular Links to the Emerging Risk of Cardiovascular Diseases ✉ Felix P
www.nature.com/npjgenmed ARTICLE OPEN Genome-wide DNA methylation analysis on C-reactive protein among Ghanaians suggests molecular links to the emerging risk of cardiovascular diseases ✉ Felix P. Chilunga 1 , Peter Henneman2, Andrea Venema2, Karlijn A. C. Meeks 3, Ana Requena-Méndez4,5, Erik Beune1, Frank P. Mockenhaupt6, Liam Smeeth7, Silver Bahendeka8, Ina Danquah9, Kerstin Klipstein-Grobusch10,11, Adebowale Adeyemo 3, Marcel M.A.M Mannens2 and Charles Agyemang1 Molecular mechanisms at the intersection of inflammation and cardiovascular diseases (CVD) among Africans are still unknown. We performed an epigenome-wide association study to identify loci associated with serum C-reactive protein (marker of inflammation) among Ghanaians and further assessed whether differentially methylated positions (DMPs) were linked to CVD in previous reports, or to estimated CVD risk in the same population. We used the Illumina Infinium® HumanMethylation450 BeadChip to obtain DNAm profiles of blood samples in 589 Ghanaians from the RODAM study (without acute infections, not taking anti-inflammatory medications, CRP levels < 40 mg/L). We then used linear models to identify DMPs associated with CRP concentrations. Post-hoc, we evaluated associations of identified DMPs with elevated CVD risk estimated via ASCVD risk score. We also performed subset analyses at CRP levels ≤10 mg/L and replication analyses on candidate probes. Finally, we assessed for biological relevance of our findings in public databases. We subsequently identified 14 novel DMPs associated with CRP. In post-hoc evaluations, we found 1234567890():,; that DMPs in PC, BTG4 and PADI1 showed trends of associations with estimated CVD risk, we identified a separate DMP in MORC2 that was associated with CRP levels ≤10 mg/L, and we successfully replicated 65 (24%) of previously reported DMPs. -
Hippo and Sonic Hedgehog Signalling Pathway Modulation of Human Urothelial Tissue Homeostasis
Hippo and Sonic Hedgehog signalling pathway modulation of human urothelial tissue homeostasis Thomas Crighton PhD University of York Department of Biology November 2020 Abstract The urinary tract is lined by a barrier-forming, mitotically-quiescent urothelium, which retains the ability to regenerate following injury. Regulation of tissue homeostasis by Hippo and Sonic Hedgehog signalling has previously been implicated in various mammalian epithelia, but limited evidence exists as to their role in adult human urothelial physiology. Focussing on the Hippo pathway, the aims of this thesis were to characterise expression of said pathways in urothelium, determine what role the pathways have in regulating urothelial phenotype, and investigate whether the pathways are implicated in muscle-invasive bladder cancer (MIBC). These aims were assessed using a cell culture paradigm of Normal Human Urothelial (NHU) cells that can be manipulated in vitro to represent different differentiated phenotypes, alongside MIBC cell lines and The Cancer Genome Atlas resource. Transcriptomic analysis of NHU cells identified a significant induction of VGLL1, a poorly understood regulator of Hippo signalling, in differentiated cells. Activation of upstream transcription factors PPARγ and GATA3 and/or blockade of active EGFR/RAS/RAF/MEK/ERK signalling were identified as mechanisms which induce VGLL1 expression in NHU cells. Ectopic overexpression of VGLL1 in undifferentiated NHU cells and MIBC cell line T24 resulted in significantly reduced proliferation. Conversely, knockdown of VGLL1 in differentiated NHU cells significantly reduced barrier tightness in an unwounded state, while inhibiting regeneration and increasing cell cycle activation in scratch-wounded cultures. A signalling pathway previously observed to be inhibited by VGLL1 function, YAP/TAZ, was unaffected by VGLL1 manipulation.