Wu Ina Thesis.Pdf (1.220Mb)

UNIVERSITY OF WISCONSIN-LA CROSSE

Graduate Studies

DETERMINING THE EFFECT OF THE LOSS OF SMALL RNAS OMRA AND

OMRB ON TYPE 1 PILI EXPRESSION IN ESCHERICHIA COLI

A Manuscript Style Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science in Biology

Ina Wu

College of Science and Health Clinical Microbiology

May, 2017

ABSTRACT

Wu, I. Determining the effect of the loss of small RNAs OmrA and OmrB on type 1 pili expression in Escherichia coli. MS in Biology, Clinical Microbiology Concentration, May 2017, 74pp. (W.R. Schwan)

Uropathogenic Escherichia coli (UPEC) cause up to 90% of the seven million annual cases of urinary tract infections in the United States. Expression of type 1 pili is necessary for pathogenicity and allows UPEC to attach to the host bladder epithelium. Under high osmolality, OmpR regulates type 1 pili expression through the recombinases FimB and FimE. OmpR also regulates transcription of the small RNAs OmrA and OmrB under the same environmental conditions. In this study, a ΔomrAB mutant strain was created to see its effects on type 1 pili expression in vitro under varying pH and osmolality and in vivo. Changes in fimB, fimE, and fimA transcription were determined by a β-galactosidase assay. The orientation of the reversible fimS element that contains the promoter for fimA was determined using a multiplex PCR, while surface expression of type 1 pili was estimated using hemagglutination. A low pH and high osmolality growth condition resulted in significantly less type 1 piliation in the mutant strain and reduced in vivo survival, suggesting regulation of type 1 pili by OmrA and OmrB. Additional experiments are needed to determine the exact mechanism by which OmrA and OmrB regulate type 1 pili expression.

iii

ACKNOWLEDGEMENTS

I would like to thank my thesis advisor Dr. William Schwan. I couldn’t have done this without your guidance. You encouraged me to apply for the RSEL grant and to go out and present my research at ASM-NCB. I really appreciate the opportunity you gave me to do research in your lab. Dr. Bernadette Taylor, Marisa Barbknecht, and Dr.

Marc Rott, thank you for your advice on how to improve my thesis, I really appreciate all the time and effort it took.

Thank you to Dr. Susan Gottesman from the National Institutes of Health for providing the Escherichia coli DJ480 and ΔomrA, ΔomrB, ΔomrAB, and Δhfq mutant strains used in this study, and to Craig Grosshuesch for making the Escherichia coli

NU149 ΔomrAB mutant and complemented strain and for his assistance with determining fimS orientations. Dr. Darby Oldenburg, Dr. Steve Lovrich, Dean Jobe, and Dr. Steve

Callister thank you for helping me troubleshoot the lab equipment.

Thank you Susan Betts, for organizing all the meetings.

Thank you to my parents for always encouraging my academic endeavors. I couldn’t have gotten this far without your support.

This project was made possible by funding from the University of Wisconsin – La

Crosse Graduate Student Research, Service, and Educational Leadership grant.

TABLE OF CONTENTS

PAGE

ABSTRACT ...... iii

ACKNOWLEDGEMENTS ...... iv

TABLE OF CONTENTS ...... v

LIST OF TABLES ...... vii

LIST OF FIGURES ...... viii

INTRODUCTION ...... 1

Significance and Epidemiology of Urinary Tract Infections ...... 1

Anatomy and Physiology of the Human Urinary Tract ...... 1

Urinary Tract Infection: Disease and Treatment ...... 2

Escherichia coli Virulence Factors ...... 2

Type 1 Pilus Operon, Structure, and Regulation ...... 3

Two-Component Regulatory Systems ...... 9

Non-Coding Regulatory RNAs ...... 11

Objectives ...... 16

MATERIALS AND METHODS ...... 17

Bacteria Strains, Plasmids, and Antibiotics ...... 17

Construction of K-12 and ΔomrA/B Mutant E. coli Strains with fim::lacZYA Plasmids ...... 17

Construction of fim::lacZYA Plasmids with Gentamicin Resistance ...... 20

Growth Curve ...... 21

β-galactosidase Activity Assay ...... 21

Construction of ΔomrAB Mutant in UPEC Strain NU149 ...... 21

Complementation of NU149 ΔomrAB Mutant ...... 25

Multiplex PCR for fimS Orientation ...... 26

Hemagglutination Assay ...... 26

Murine Urinary Tract Infection Model ...... 27

RESULTS ...... 28

Effects of omrA/B and hfq Gene Deletions on Growth Rate ...... 28

Both omrA/B and hfq Deletions Affect fim Transcription in Strains Grown under Different pH and Osmolality Conditions ...... 30

The Orientation of the fimS Element Switches to Favor the Phase-OFF Orientation in an omrAB Mutant Grown under High Osmolality Media ...... 35

High Osmolality Growth Conditions Diminish Type 1 Pili Expression in an omrAB mutant ...... 36

An omrAB Deletion Attenuates Survival of a UPEC Strain in Murine Urinary Tracts 37

DISCUSSION ...... 41

REFERENCES ...... 51

LIST OF TABLES

TABLE ...... PAGE

1. Strains and plasmids used in this study ...... 18

2. Primers used in this study ...... 23

3. Hemagglutination titers for UPEC strains NU149...... 37

vii

LIST OF FIGURES

FIGURE ...... PAGE

1. Schematic model of the fim operon ...... 4

2. Schematic diagram of type 1 pilus and accessory proteins ...... 5

3. Schematic model of the actions of 20 auxiliary proteins on the regulation of type 1 pili expression ...... 6

4. Nucleotide sequence from E. coli MG1655 showing the antisense strand ...... 14

5. Possible mechanisms of OmrA/B reduction of fimA transcription ...... 15

6. Growth curves of E. coli K-12 strains DJ480 (wild-type) ...... 29

7. β-galactosidase activity for fimA transcription in pH 5.5 or 7.0 LB ± 400 mM NaCl ...... 31

8. β-galactosidase activity for fimB transcription in pH 5.5 or 7.0 LB ± 400 mM NaCl ...... 33

9. β-galactosidase activity for fimE transcription in pH 5.5 or 7.0 LB ± 400 mM NaCl ...... 34

10. Orientation of the fimS element in E. coli NU149 ...... 36

11. Independent challenges of female Swiss Webster mice with E. coli strain NU149 (•) ...... 38

12. Proposed mechanism of OmrA and OmrB on type 1 pili expression in E. coli under high osmolality conditions ...... 42

viii

INTRODUCTION

Significance and Epidemiology of Urinary Tract Infections

There are 150 million cases of urinary tract infections (UTIs) worldwide annually, resulting in six billion dollars in healthcare costs (1). Seven million of those cases occur in the United States alone, costing two billion dollars annually. Urinary tract infections are the most common bacterial infections of humans and actual numbers may be even higher as many cases are not reported (2). Women are three times more likely to get

UTIs than males. Approximately 50-60% of all women will get one UTI in their lifetime

(2). Other factors that increase the risk of getting UTIs include catheter use, diabetes,

HIV infections, and other urological abnormalities. Infants, pregnant women, and the elderly are also at an increased risk (2).

Anatomy and Physiology of the Human Urinary Tract

The symptoms of UTIs are caused by bacterial colonization of the urinary tract.

The upper urinary tract includes the kidneys and ureters. Kidneys regulate electrolytes and acid-base balance, filter blood, and reabsorb water, glucose and amino acids (3). The bladder and urethra (and prostate in males) make up the lower urinary tract, which stores and expels urine (4). The unidirectional flow of urine and the secretion of glycosamines, which form a mucin layer, prevent bacterial attachment to the urinary tract epithelium.

The low pH and high osmolality of urine also inhibits the growth of bacteria (1). Despite

1 these innate immune defenses, urinary tract infections remain the most common bacterial infection.

Urinary Tract Infection: Disease and Treatment

Urinary tract infections can be subdivided into two categories: lower urinary tract infections (cystitis and/or urethritis) and upper urinary tract infections (pyelonephritis)

(5). A majority of UTIs are uncomplicated lower UTIs, which begin when fecal bacteria are introduced into the urinary tract (2, 5). This results in inflammation and produces the typical symptoms of dysuria (painful urination), frequent urination, and bacteriuria (6, 7).

Occasionally, the infection may ascend further up the ureters into the kidneys, leading to the more severe pyelonephritis that is responsible for kidney failure and possibly death.

UTIs also cause significant cases of bacteremia, some of which lead to septic shock (8).

Approximately 75% to 90% of UTIs are caused by uropathogenic Escherichia coli

(UPEC) (1, 9). Exact numbers are difficult to determine since UTIs are mostly treated empirically due to their prevalence and obvious symptoms. Common drugs used currently to treat UTIs in the United States include trimethoprim-sulfamethoxazole

(TMP-SXT), fluoroquinolones, fosfomycin, and nitrofurantoin (5, 7). The recurrent nature of UTIs promotes the development of drug resistance. Resistance to both TMP-

SXT and ciprofloxacin, a fluoroquinolone antibiotic, have increased over the past decade

(10-13).

Escherichia coli Virulence Factors

Several virulence factors produced by E. coli have been correlated with pathogenicity, including fimbrial and afimbrial adhesins, a siderophore (aerobactin), a polysaccharide capsule, and toxins such as cytotoxic-necrotizing factor and alpha

2 hemolysin (14-16). Fimbrial adhesins are key virulence factors that allow the bacteria to attach and subsequently colonize the urinary epithelium (17). The type 1 pilus/fimbria is the most common virulence factor found on UPEC isolates and is necessary for pathogenicity (16, 18, 19).

Type 1 Pilus Operon, Structure, and Regulation

The type 1 pilus is encoded by the fim operon, a cluster of genes located at 98 min in the E. coli chromosome (20-22). The fim operon contains nine genes plus an invertible

DNA element, labeled fimS (Fig. 1). The overall structure of type 1 pilus is described in

Figure 2. Fimbriae, flagella and other surface proteins specific to bacteria are highly immunogenic and energetically costly. Therefore, the expression of these proteins is tightly regulated. Expression of type 1 pili turns on when E. coli is in the bladder, allowing the bacterium to attach to D-mannose linked lipids present on the bladder epithelium (40-42).

Expression of type 1 pili switches between Phase-ON and Phase-OFF by the inversion of the 314-bp DNA segment fimS, which contains the promoter for fimA, and is flanked by a 9-bp inverted repeat sequence on both sides (43). Located upstream of fimS are fimB and fimE, which encode the site-specific recombinases, FimB and FimE, respectively (44, 45). One to three promoters have been identified for the fimB gene (Fig.

1). In UPEC clinical isolates, two promoters, P1 and P2, have been confirmed in separate studies, while P3 remains a putative promoter (46, 47). Another study using a K-12 strain identified a single promoter for fimB (48). Only one promoter has been identified for fimE (48). FimB binds and switches fimS to either the Phase-ON or Phase-OFF position, with a preference for the Phase-ON position, while FimE switches fimS from the

FIG 1 Schematic model of the fim operon (permission granted by William R Schwan).

FIG 2 Schematic diagram of type 1 pilus and accessory proteins. The fimA gene encodes a 158-159 amino acid protein, which polymerizes into a right-handed helical structure that forms the pilus shaft (23-25). Attached to the pilus shaft is the fibrillum, consisting of FimF, FimG and FimH proteins (26, 27). FimH, which is located on the distal end of the fibrillum, is the adhesin that binds D-mannose (28). FimF and FimG regulate the overall length of the pilus (29). The fimC and fimD genes code for a periplasmic chaperone and usher protein, respectively (30, 31). FimC binds other Fim proteins and catalyzes their folding (32-35). FimD is embedded in the outer membrane and binds FimC-Fim complexes, which are then translocated in a linear fashion to the bacterial cell surface (36-39).

Phase-ON to OFF orientation (45, 49). The function of FimI remains unknown, but it also appears to be necessary for type 1 pili expression (50, 51).

In addition to FimB and FimE, other site-specific recombinases that may affect the orientation of fimS have been identified: HbiF, IpbA, IpuA, IpuB, and FimX (Fig. 3)

(52). HbiF primarily mediates fimS switching from Phase-OFF to Phase-ON (53). The invertases, IpbA, IpuA, and IpuB were identified through their amino acid sequence

FIG 3 Schematic model of the actions of 20 auxiliary proteins on the regulation of type 1 pili expression. The inverted repeat left and right (IRL and IRR) are shown as open boxes. Binding sites for integration host factor (IHF I and II) and leucine-responsive protein (Lrp1, 2, and 3) are also represented as open boxes. Genes are displayed as black boxes and the promoters are shown as bent black arrows. The dark gray arrows correspond to FimB and the light gray arrows are for FimE. Black arrows signify an effect on the fimS element. Solid green arrows indicate confirmed binding associated with stimulatory effects, whereas dashed green arrows indicate presumed stimulatory effects. Solid red arrows indicate confirmed binding associated with repressing effects, whereas dashed red arrows indicate presumed repressing effects. (Permission granted by William R Schwan).

similarity to FimB (54). IpbA is identical to HbiF and performs a similar function, switching fimS from Phase-OFF to Phase-ON (54). IpuA switches fimS in both directions, much like what FimB does (54). IpuB has not been shown to invert fimS and may be a nonfunctional recombinase (50). FimX is another protein with significant amino acid similarity to FimB capable of switching fimS from Phase-OFF to Phase-ON

(55). FimX, in particular, has been predominately associated with UPEC strains (55, 56).

The fimX gene is located within a horizontally acquired genomic island termed a pathogenicity-associated island, which contains many genes for virulence factors (56).

E. coli expresses other pili besides type 1 pili. Two other pili commonly associated with UTIs are pyelonephritis (P) and sialic acid (S) pili (18, 57). The P pilus is the second most common virulence factor of UPEC involved in attachment, binding to glycosphingolipids with an α-D-galactopyranosyl-(1→4)-β-D-galactopyranoside

[Galα(1-4)Gal] linkage common in the kidney epithelium (16, 58, 59). The S pilus has been shown to bind to α-sialyl-(2→3)-β-galactosides, allowing for attachment to human kidney epithelium and endothelium (60-62). S-piliated E. coli serotypes have also been implicated in septicemia and meningitis, most likely through their ability to bind plasminogen and brain-specific glycolipids (63-67). Competition between the expression of these three fimbrial adhesins is controlled by regulatory cross-talk. PapB and SfaB, which regulate the expression of P and S pili, respectively, also inhibit type 1 pili expression by preventing Phase-OFF to Phase-ON switching (68). Genome sequence analyses have identified a number of putative genes encoding 17-kDa proteins (17-kDa genes) downstream of fimbrial operons (69). The 17-kDa genes are named after their adjacent fimbrial operons, although no functional relationship between the two has been

determined. A gene located downstream of the sfa operon encodes a 17-kDa protein,

SfaX. SfaX has no apparent effect on the sfa operon, but rather inhibits the expression of type 1 pili, allowing for the expression of flagella (69, 70).

Auxiliary proteins may also indirectly affect the expression of type 1 pili by regulating the expression of FimB and FimE. Histone-like nucleoid-structuring protein

(H-NS) binds and represses transcription from the fimB P1 and P2 promoters as well as the fimE promoter (47). H-NS also represses the expression of the leucine-responsive regulatory protein (Lrp) (71). Lrp responds to changes in amino acid metabolism and regulates the expression of many genes, including fimS (72-74). Both Lrp and IHF bind the fimS sequence and facilitate recombination by causing bends in the DNA structure

(74-78). LysR-type regulator (LrhA) binds to the promoter of fimE, causing an increase in FimE, which results in less type 1 pili expression (79). The regulatory alarmone, ppGpp and its cofactor DskA activate the expression of FimB at the second promoter through the binding of RNA polymerase (80, 81). SlyA also activates FimB expression at P2, by preventing H-NS binding (82).

There are several other proteins that may also regulate FimB and FimE expression, although binding to their respective promoters has yet to be shown. NanR and NagC activate the expression of fimB, mostly likely acting on the putative fimB P3 promoter (83-85). RfaH activates fimB expression indirectly, by suppressing the small

RNA, MicA, an inhibitor of fimB (86). The phosphate-specific transport system (Pst) also activates FimB, possibly through increasing the level of ppGpp (87). Under neutral pH and low salt conditions, RcsB activates fimB expression, whereas under neutral pH and high salt, RcsB inhibits the expression of fimE (88). E. coli in stationary phase

express less type 1 pili on their surface, which may be due to the suppression of fimB expression by the alternate sigma factor, RpoS (89). During logarithmic growth, expression of type 1 pili may be reduced under certain environmental signals, which alter the level of intracellular CRP-cAMP. CRP-cAMP inhibits FimB-mediated Phase-OFF to

Phase-ON recombination by repressing Lrp expression (90). CRP-cAMP also stimulates the fimA promoter, suggesting that CRP-cAMP plays a dual role in type 1 pili expression depending on environmental cues (90). UvrY is also needed for the transcription of both fimB and fimE (91). Two final proteins involved in regulating type 1 pili expression are part of the OmpR/EnvZ two-component regulatory system (TCS) (92, 93).

Two-Component Regulatory Systems

Two-component regulatory systems are key mediators of signal transduction in bacteria, allowing bacteria to sense and react to changes in the environment (94, 95). A

TCS consists of a histidine kinase (HK) and response regulator (RR). The HK is typically an integral membrane protein with the ability to autophosphorylate its histidine residue.

Under certain conditions, the phosphate from the HK is transferred to the aspartate residue(s) on the RR. Phosphorylated RRs bind DNA, RNA or other proteins, resulting in transcriptional or enzymatic changes within the cell (96). External signals that activate

TCSs include temperature, pH, osmolality, certain ions, and oxygen pressure. The TCSs can also be stimulated artificially. For example, the EnvZ HK can be activated by the anesthetic procaine, leading to subsequent phosphorylation of the OmpR RR (97).

E. coli has genes for 30 HKs and 34 RRs, which are conserved across different strains (94, 96). Some TCSs associated with virulence include CpxA/CpxR, RcsC/RcsB,

PhoQ/PhoP, QseC/QseB, and EnvZ/OmpR (listed as HK sensor/RR effector). Stresses

on the bacterial envelope are sensed by the CpxA/CpxR TCS (98). CpxA/CpxR regulates several surface structures, including type IV bundle-forming pili and the type III secretion system (99). Interplay between the response regulators CpxR and OmpR regulate the expression of curli, which are amyloid fibers involved in adhesion and associated with pathogenicity (100, 101). The CpxA/CpxR system has also been implicated in antibiotic resistance (102). Desiccation, osmotic shock, and growth on solid surfaces activate the RcsC/RcsB TCS and induce the production of a polysaccharide capsule and biofilm (103-106). PhoQ/PhoP senses divalent cations, such as Mg2+ and

Ca2+, and regulates the expression of LPS and Mg2+ uptake (107). Quorum sensing activates QseB/QseC, which regulates flagella, type 1 pili, and curli expression (108-

112). Changes in osmolality are sensed by EnvZ/OmpR, which regulates porin expression (113-116). Porin expression is also regulated by the CpxA/CpxR TCS (117).

Both OmpR and EnvZ are encoded within the ompB operon, located at 74 min on the E. coli chromosome (118-121). Changes in osmolality and pH are sensed by EnvZ, a histidine kinase located in the inner membrane (122, 123). Under high osmolality conditions, EnvZ autophosphorylates its His-243 residue more frequently, using the gamma phosphate from ATP (124). The phosphate is then transferred to the cytoplasmic response regulator OmpR at either Asp-55 or Asp-11 (125, 126). The phosphorylated

OmpR (OmpR-P) binds DNA and acts as a transcription regulator of a variety of genes

(127-129). Deletion of envZ/ompR in E. coli K-12 altered the expression of 125 genes,

71 of which were up-regulated and 54 were down-regulated (130). Some of the genes affected are involved in the synthesis of cysteine, isoleucine, enterochelin (enterobactin), and flagella (130). Loss of envZ/ompR severely down-regulated the expression of the

porin genes, ompC (at 47 min) and ompF (at 21 min) (130-133). High osmolality leads to higher levels of OmpR-P, which in turn stimulates the expression of ompC while down- regulating ompF (133-137). OmpC forms a smaller porin than OmpF, thus restricting the size of molecules that can pass through the bacterial membrane. The altered expression of many genes by envZ/ompR deletion may ultimately result from its control of ompC and ompF expression.

Deletion of envZ/ompR also resulted in a slight increase of fimB, fimE, and fimA expression (130). OmpR binds and represses transcription from the second promoter of fimB (93), and may repress fimE expression through another unidentified regulatory protein. In one study, UPEC grown in a low pH/high osmolality environment had significantly more OmpR protein present than in UPEC grown in a neutral pH/high osmolality environment, although no change in ompR transcription was seen. Growth of an ompR deletion mutant under high osmolality expressed higher fimB transcripts, Phase-

ON positioning of fimS, and subsequently more type 1 pili. This suggests that OmpR may regulate type 1 pili expression under low pH/high osmolality through post- transcriptional regulation of fimB (93).

Non-Coding Regulatory RNAs

Two-component regulatory systems, such as EnvZ/OmpR, are highly intertwined with regulatory, non-coding small RNAs (sRNAs) (138, 139). Small RNAs bind to complementary nucleic acid sequences and modify transcription, translation or protein activity (140). In E. coli, more than 80 different sRNAs have been found in genome- wide searches. Out of the 30 different TCSs found in E. coli, seven are known to incorporate sRNAs as part of their regulatory functions: ArcB/ArcA,

DpiB/DpiA(CitA/CitB), GlrK/GlrR(QseE/QseF), PhoQ/PhoP, RcsC/RcsB, BarA/UvrY, and EnvZ/OmpR (138). OmpR induces the transcription of the small RNA genes, omrA and omrB, whose gene products have been correlated with post-transcriptional regulation of genes (141). The exact functions of OmrA and OmrB sRNAs remain unknown, although the emerging picture indicates they respond to environmental stresses and regulate genes post-transcriptionally. Small RNAs fall under one of two classes depending on their mechanism of action. The first class consists of sRNAs that bind to proteins and modify their activity. The second and largest class of sRNAs, which accounts for more than 20 sRNAs found in E. coli, bind mRNA at the ribosome-binding site and modify translation by changing the stability of the bound mRNA. The latter class requires initial binding to the RNA chaperone, Hfq, which facilitates sRNA-mRNA interactions (142, 143).

Hfq is coded by a gene located at 94.8 min on the E. coli chromosome (144). The resulting protein is 102 amino acids long and forms a cyclical homohexamer. The hexamer has two RNA binding sites: a proximal site that binds sRNAs and mRNAs and a distal site that binds poly(A) tails (145). The proximal site contains a highly conserved binding pocket that recognizes a stretch of uridines. The distal site has three binding sites

(A, R, E/N). The A-site has a high affinity for adenosines, while the R-site binds purines

(146, 147). Hfq binds both sRNA and its target mRNA, forming a duplex. In some cases, Hfq also recruits proteins to the duplex for degradation or activation of the bound mRNA (148). Mutations in the hfq gene result in pleiotropic phenotypes, including reduced growth rate, increased cell size, and osmosensitivity (149). Deletion of hfq in

UPEC strains UTI189 and J96 showed reduced virulence and pathogenicity in murine

and C. elegans models, respectively (150, 151). Hfq has also been correlated with multidrug resistance, through the regulation of the efflux pump, AcrAB (152). The effects of Hfq on fim gene expression are inconclusive. A 2008 study by Kulesus et al. showed that a hfq deletion in UTI189 did not affect its ability to agglutinate yeast and red blood cells, which is dependent on the presence of type 1 pili (150). In contrast, a study by Pichon et al. showed the deletion of hfq in E. coli 536 resulted in visible loss of yeast agglutination and a four-fold average reduction in fim mRNAs, including fimB, fimE, and fimA (153). Both studies used E. coli grown in unbuffered Luria broth (LB), which may lead to changes in pH and subsequent variation in type 1 pili expression.

Two sRNAs in E. coli that require a functional Hfq are OmrA and OmrB

(previously known as RygA and RygB). The “genes” encoding OmrA/B are located in the intergenic region between aas and galR on the counterclockwise strand (Fig. 4).

OmrA is 88 nucleotides and OmrB is 82 nucleotides long (141, 154, 155). Transcription of omrA and omrB is activated by OmpR. OmrA and OmrB share significant sequence similarity, with the first 21 and last 35 nucleotides being identical, resulting in an overlap of functions and targets. A majority of mRNAs targeted by OmrA/B showed a decrease in abundance, consistent with the sRNAs’ mode of action. Most targets altered by

OmrA/B code for cell surface structures/functions, including flagella (flhD/C), curli

(csgD), and type 1 pili (fimA) (141, 156, 157). A preliminary microarray showed that a

10-fold overexpression of OmrA and OmrB reduced fimA transcripts by 2.6±0.1-fold and

1.6±0.2-fold, respectively (141). This experiment used a K-12 E. coli strain grown in unbuffered LB and the results were not verified by PCR.

AAGTAAGACA AAAAAAGAGA TTGCAAACCT TTGGTTACAC TTTGCGAAAC GCTGTTGCGA TTGACCGCTG GTGGCGTTTG GCTTCAGGTT GCTAAAGTGG TGATCCCAGA GGTATTGATA GGTGAAGTCA ACTTCGGGTT GAGCACATGA ATTACACCAG CCTGCGCAGA TGCGCAGGTT TTTTTTGCCG GTCATCAATC TGTAACAGTA ACCGACAATT TACACACCTC GTTGCATTTC CCTTCATTCC TTTGCGTTTT CTCGCTGGCG AAGAGTCGTC GTGCAGACCA CAATCAAGAT CCCAGAGGTA TTGATTGGTG AGATTATTCG GTACGCTCTT CGTACCCTGT CTCTTGCACC AACCTGCGCG GATGCGCAGG TTTTTTTTCG CACCTAATTT ACTGTCGCTC GCGTTCTTTA

FIG 4 Nucleotide sequence from E. coli MG1655 showing the antisense strand. The omrB sequence is highlighted in light gray and the omrA sequence is underlined.

The mechanism by which fimA transcription is reduced by OmrA/B is unknown.

OmrA/B may reduce fimA transcription by binding to its main regulators fimB and fimE.

Alternatively, OmrA/B can bind directly to fimA mRNA and flag it for degradation. And finally, the binding of OmrA/B to fimA, fimB and/or fimE may inhibit translation of the bound mRNA (Fig. 5). The fact that the expression of OmrA/B is controlled by OmpR may suggest this is another mechanism by which OmpR controls type 1 pili expression under high osmolality: by inducing the expression of OmrA/B, which in turn, suppresses the expression of fimA.

FIG 5 Possible mechanisms of OmrA/B reduction of fimA transcription. (A) OmrA/B binds and degrades fimB or fimE mRNA. Reduced FimB and FimE protein leads to phase OFF position, reduced fimA transcription and type 1 pili. Reduction of FimE not shown. (B) OmrA/B binds and degrades fimA mRNA. Reduced FimA protein and type 1 pili. (C) OmrA/B binds to fimB or fimE mRNA, inhibits translation. Reduced FimB and FimE protein leads to phase OFF position, reduced fimA transcription and type 1 pili. FimE not shown. (D) OmrA/B binds to fimA mRNA and inhibits translation. No reduction in fimA mRNA is seen but there is a reduction in FimA protein and subsequent type 1 pili expression.

Objectives

This study examined how Hfq and OmrA/OmrB regulate type 1 pili expression in

E. coli and how they affect colonization of a murine urinary tract. To do so, the following objectives were addressed:

Objective 1: Transcription of fimB::lacZYA, fimE::lacZYA, and fimA::lacZYA fusions in omrA, omrB, omrAB and hfq deletion mutations in E. coli K-12 strains was analyzed using a β-galactosidase assay

Objective 2: Type 1 pili expression was characterized in an omrAB deletion mutation in

UPEC strain NU149 in vitro. Effect of this mutation on survival in vivo was investigated.

The focus of this research was to examine the effects that omrA, omrB, and hfq mutations have on type 1 pili expression in E. coli. This study will contribute to an understanding of the control of type 1 pili expression in UPEC.

MATERIALS AND METHODS

Bacteria Strains, Plasmids, and Antibiotics

All bacterial strains and plasmids used are listed in Table 1. Several E. coli K-12 strains have been generously donated by Susan Gottesman’s laboratory (NIH), including

DJ480 (MG1655 Δlac X74 K-12 substrain), MG1001 (DJ480 ΔomrA::kan), MG1002

(DJ480 ΔomrB::kan), MG1398 (DJ480 ΔomrAB::kan), and MG1406 (DJ480 Δhfq::cm).

These strains were transformed with single copy number plasmids containing promoters for fimB, fimE, and fimA, each fused to the lacZ gene. All antibiotics were purchased from Sigma Aldrich Chemical Co. and used in the following concentrations: 12.5 µg/mL chloramphenicol (Cm12.5), 40 µg/mL kanamycin (Kan40), 8 or 10 µg/mL gentamicin

(Gm8 or Gm10, respectively), and 100 µg/mL ampicillin (Ap100).

Construction of K-12 and ΔomrA/B Mutant E. coli Strains with fim::lacZYA

Plasmids

To determine how the loss of omrA/B affects type 1 pili expression, single copy number plasmids, containing the promoters of fimA, fimB, and fimE connected to a promoter-less reporter gene, lacZ, were transformed into DJ480, MG1001, MG1002, and

MG1398. To make these cells competent, they were grown to mid-log phase

(OD600=0.4) and washed several times with cold CaCl2 solution (158-160). Strains

DJ480, MG1001, MG1002 and MG1398 were transformed with each of the three reporter constructs on a pPP2-6 plasmid background that contains a chloramphenicol resistance

TABLE 1 Strains and plasmids used in this study Strain or Plasmid Description Reference or Source Strains DJ480 MG1655 Δlac X74 (parent strain) D. Jin (NCI) MG1001 DJ480, ΔomrA::kan S. Gottesman MG1002 DJ480, ΔomrB::kan S. Gottesman MG1398 DJ480, ΔomrAB::kan S. Gottesman MG1406 DJ480, Δhfq::cm S. Gottesman NU149 Clinical isolate (161) NU149 ΔomrAB NU149, ΔomrAB This study DH5α F- Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) Life Technologies phoA supE44 λ-thi-1 gyrA96 relA1 Plasmids

18 pPP2-6 pPR274 + multiple cloning site (92)

pJB5A fimB::lacZYA on pPP2-6 (92) pJLE4-3 fimE::lacZYA on pPP2-6 (92) pWRS124-17 fimA::lacZYA locked-on on pPP2-6 (92) pUJ8 trp’-‘lacZ phoA Apr (162) pAON-1 fimA-lacZYA locked-on on pUJ8 (92) pP5-48 fimB-lacZYA on pUJ8 (92) pUT-Tc Mini-Tn5 on pUT Tcr (162) pUTE1 fimE-lacZYA on pUT-Tc (92) pPPBMR1 pPP2-6 + GmR B. Reuter pIWB1 fimB::lacZYA on pPPBMR1 This study pIWE1 fimE::lacZYA on pPPBMR1 This study pIWA1 fimA::lacZYA on pPPBMR1 This study pKD46 λ Red recombinase, Apr (163)

pKD4 FRT-flanked KanR cassette, Apr (163) pCP20 Flp recombinase, Apr (164) pHSS22 oriT KanR (165) pCG1-4 omrAB on pHSS22 This study

gene (166). The plasmids used included: pWRS124-17 (fimA::lacZYA), pJB5A

(fimB::lacZYA) and pJLE4-3 (fimE::lacZYA). Parent strain DJ480 transformants were selected by plating on Luria agar (LA)+Cm12.5+5-bromo-4-chloro-3-indolyl-β-d- galactopyranoside (X-Gal). MG1001, MG1002 and MG1398 transformants were selected for by plating on LA+Kan40+ Cm12.5+X-Gal. Presence of the fim::lacZYA fusion in each transformant was confirmed using a β-galactosidase (β-gal) assay.

Construction of fim::lacZYA Plasmids with Gentamicin Resistance

Since strain MG1406 (hfq mutant), contains a chloramphenicol resistance gene insertion, the fim::lacZYA fusion plasmids on pPP2-6 are incompatible because they are selected for on LA+Cm media. Instead, fimA::lacZYA, fimB::lacZYA, and fimE::lacZYA fusions were inserted into the single copy number plasmid pPPBMR1, which contains a gentamicin resistance gene. High copy number plasmids pAON-1, pP5-48, and pUTE1

(containing fimA::lacZYA, fimB::lacZYA, and fimE::lacZYA fusions, respectively) were extracted from AAEC189/pAON-1, DH5α/pP5-48, and S17.1/pUTE1 using a QIAprep

Spin Miniprep kit (Qiagen). The plasmids were then digested with NotI [New England

Biolabs (NEB)] and EcoRI (NEB) and the fim::lacZYA fusions were ligated to

NotI/EcoRI-digested pPPBMR1 using T4 DNA ligase (NEB). E. coli DH5α cells were transformed with the ligation mixture and plated on LA+Gm10+X-Gal to screen for the fusion construct. Blue colonies were patched on LA+Gm10 and LA+Ap100. Colonies that grew only on LA+Gm10 were retested for the fim::lacZYA fusion inserts using a β-gal assay. The fim::lacZYA fusions on pPPBMR1 were extracted from E. coli DH5α cells and used to transform MG1406 cells via electroporation (2.5 kV, 3-5 ms). MG1406

transformants were selected by plating on LA+Cm12.5+Gm8. The presence of a fim::lacZYA fusion was confirmed using a β-gal assay.

Growth Curve

A growth curve was generated for each strain grown in LB pH 5.5 and pH 7.0 with and without 400 mM NaCl by measuring the OD600 every 2 h over a 12 h period.

Growth differences between mutant and wild-type strains were taken into consideration when interpreting β-galactosidase activity for each strain.

β-galactosidase Activity Assay

Each strain containing a fim::lacZYA plasmid was serially passaged (48 h at 37°C, static; then 24 h at 37°C, static; and then 24 h at 37°C, static) in Luria broth (LB) plus the appropriate antibiotic (Cm12.5 for DJ480 strains, Kan40+Cm12.5 for MG1001, MG1002, and MG1398 strains and Gm8+Cm12.5 for MG1406 strains) to maximize type 1 pili expression (167). Cultures were then grown to log and stationary phase (OD600 = 0.4-

0.6) in neutral (pH 7) and acidic (pH 5.5) LB with or without 400 mM NaCl (92).

Transcription of fimA, fimB, and fimE under these four growth conditions was estimated by measuring the amount of β-galactosidase produced at OD420 using the β-galactosidase activity assays according to Miller and reported as Miller units (168). Assays were done at least three times per strain on separate days. The mean and standard deviations were calculated. Differences in β-galactosidase activity between mutant and wild-type strains were determined using the Student’s t-test. Significance was recorded as P ≤ 0.05.

Construction of ΔomrAB Mutant in UPEC Strain NU149

Since gene expression among E. coli strains can differ significantly, an omrAB deletion mutant was created in the UPEC strain NU149 using the λ Red recombinase

system (163). The λ Red plasmid pKD46 contains the genes for λ Red recombinase under an arabinose-inducible promoter. When a strain containing pKD46 is grown in media containing arabinose, expression of the λ Red recombinase protein occurs. The recombinase aligns and recombines complementary PCR-derived DNA sequences. The pKD46 plasmid also contains an ampicillin resistance gene and is temperature-sensitive

(will not replicate at 42°C). After recombination occurs, the strains can be cured of pKD46 by growing them at 42°C, preventing further recombination.

Primers were designed to have a 5’ overhang containing sequences that flank omrAB. The 3’ end of the primers were complementary to the kanamycin resistance gene flanked by Flp recognition targets (FRTs) on pKD4. All primers used in this study are listed in Table 2. PCR amplification (denaturation at 94°C for 5 min followed by 35 cycles of 94°C for 1 min, 57°C for 1 min, and 72°C for 3 min, and a final elongation step at 72°C for 7 min) with primers OmrAB3 and OmrAB4 and the pKD4 template produced a ~1.5 kb kanamycin resistance gene with sequences complementary to regions flanking the omrAB gene on each end. DNA from three PCR reactions was concentrated using a

Microcon-30 filter (Millipore). The concentrated PCR product was gel purified by excising the ~1.5 kb band and running the gel through fiberfill at 6200 x g for 10 min.

The gel purified DNA was precipitated by adding two volumes of 100% ethanol and 1/3 volume of 3 M sodium acetate and incubated overnight at -20°C. The DNA was pelleted by centrifugation at 17,000 x g for 10 min at 4°C. The DNA pellet was washed with 500

µL 70% ethanol and re-spun. The DNA was allowed to air dry at room temperature for

30 min before being resuspended in 20 µL ddH2O.

TABLE 2 Primers used in this study Primer Sequence 5’3’ Purpose OmrAB3 TTACACGAGATAAAGAACGCGAGCGACAGTAAATTAGGTGCGTGTGTAGGCTGGAGCTGCTTCG λ Red deletion of OmrAB4 ACCGCTGGTGGCGTTTGGCTTCAGGTTGCTAAAGTGGTGATCATATGAATATCCTCCTTAG omrAB gene

OmrA9 GGTGAGATTATTCGCTACGCT Detect loss of OmrA10 ACCCGTAACGCGAACGCGAT omrAB gene

EcFtsZ1 TAGCGGTATCACCAAAGGACT Detection of ftsZ EcFtsZ2 GTGATCAGAGAGTTCACATGC housekeeping gene

OmrAB7 GTACGAATTCCACCAGACGTACCAGATGTT Amplify omrAB OmrAB8 GTATGGATCCGGTGATAGCTAAGAGACTCC gene for complementation INV GAGGTGATGTGAAATTAATTTAC Detect fimS FIME GCAGGCGGTTTGTTACGGGG orientation FIMA GATGCGGTACGAACCTGTCC 23

Strain NU149/pKD46 was grown to mid-log phase (OD600 = 0.4) in LB + 10 mM arabinose to induce λ Red recombinase gene expression at 30°C, 200 rpm and then heat shocked at 42°C for 15 min for plasmid curing. Cells from approximately 40 mL of culture were pelleted by centrifugation at 5000 x g for 10 min at 4°C. The cells were resuspended in 10 mL cold ddH2O and pelleted at 5000 x g for 10 min at 4°C three times to remove all salts and resuspended in a final volume of 200 µL ddH2O. The cells were electroporated to introduce the PCR products into NU149/pKD46 using a Gene Pulser

(Bio-Rad) and allowed to recover in Super Optimal with Catabolite repression (SOC) broth for 1 to 2 h at 37°C, 250 rpm.

The λ Red recombinase aligned each PCR product with the corresponding gene in the chromosome and initiated crossing over, effectively replacing omrAB with a kanamycin resistance gene. Transformants were selected by plating on LA+Kan40 grown at 37ºC. As a control, other batches of NU149/pKD46 grown without 10 mM arabinose induction were given the same treatment and for which no growth on LA+Kan40 plates was observed. To confirm the loss of the pKD46 plasmid, all colonies recovered were patched onto LA+Kan40 plate and LA+Ap100 plate and incubated at 37°C. Transformants that represent homologous recombination events and loss of the pKD46 plasmid should grow on LA+Kan40, but not LA+Ap100. Transformants that grew on both Kan40 and

Ap100 were incubated at 42°C overnight to cure the plasmid and re-patched on LA+Kan40 and LA+Ap100. To confirm deletion of each target gene, colony PCRs (denaturation at

94°C for 5 min, followed by 30 cycles at 94°C for 1 min, 57°C for 1 min, and 72°C for 1 min) were performed using primers OmrA9 and OmrA10 and cell lysates from putative omrAB deletion mutants as templates. Chromosomal DNA from wild-type NU149 was

used as a positive control. Amplification of the ftsZ housekeeping gene from NU149

ΔomrAB chromosomal DNA ensured that the lack of amplification was due to the loss of omrAB and not the lack of chromosomal DNA.

The kanamycin resistance gene was removed from the NU149 ΔomrAB mutant by electroporating in the pCP20 plasmid, which contains the gene encoding the Flp recombinase as well as an ampicillin resistance gene (164). Flp recombinase catalyzes the recombination between FRT sequences, effectively removing the kanamycin resistance gene (169). The plasmid pCP20 was then cured from NU149 ΔomrAB by growing the cells at 42°C. To confirm the loss of the kanamycin resistance gene and the pCP20 plasmid, colonies were patched onto LA, LA+Kan40, and LA+Ap100 and incubated overnight at 42°C. The resulting NU149 ΔomrAB mutant grew on LA, but not

LA+Kan40 or LA+Ap100.

Complementation of NU149 ΔomrAB Mutant

To restore the omrAB gene back into NU149 ΔomrAB, a high copy number plasmid containing the full length omrAB gene was introduced into the ΔomrAB mutant strain. The omrAB gene was amplified (denaturation at 94°C for 5 min, and 35 cycles at

94°C for 1 min, 57°C for 1 min, and 72°C for 1.5 min) from NU149 chromosomal DNA using primers OmrAB7 and OmrAB8. OmrAB7 contains an EcoRI site at the 5’ end and

OmrAB8 contains a BamHI site at the 5’ end. The resulting ~1005 bp PCR product was cut with EcoRI (NEB) and BamHI (NEB) and ligated to EcoRI/BamHI-digested pHSS22 using T4 ligase (NEB). The plasmid pCG1-4 that resulted, containing the omrAB gene, was electroporated into NU149 ΔomrAB and transformants were selected by plating on

LA+Kan40.

Multiplex PCR for fimS Orientation

To see if the loss of omrAB affected fimS orientation, the positioning of fimS in

NU149, NU149 ΔomrAB, and NU149 ΔomrAB/pCG1-4 was determined using multiplex

PCR. The UPEC strains were passaged to maximize type 1 pili expression as described above. Chromosomal DNA was extracted from stationary phase cells grown in four conditions (pH 7.0 LB ± 400 mM NaCl and pH 5.5 LB ± 400 mM NaCl) using PurElute bacterial genomic kit (EdgeBio) and amplified with the primers INV (complementary to a region within the invertible element), FIMA (complementary to a region downstream), and FIME (complementary to a region upstream) as previously described (165). When fimS is in the phase-ON position, a 450 bp PCR product was amplified. When fimS is in the phase-OFF position, a 750 bp product was amplified. The intensity of the resulting phase-ON or phase-OFF bands were normalized to the housekeeping gene ftsZ, which was amplified by the primers EcFtsZ1 and EcFtsZ2, and quantified using ImageQuant software (Molecular Dynamics) (88).

Hemagglutination Assay

To see if the loss of omrAB affected type 1 pili production on the surface of E. coli cells, hemagglutination assays (HA) using guinea pig erythrocytes were done as previously described (170-172). E. coli cells cause agglutination of guinea pig erythrocytes proportional to the level of type 1 pili expression. NU149, NU149 ΔomrAB, and NU149 ΔomrAB/pCG1-4 strains were passaged to maximize type 1 pili expression and grown to stationary phase in pH 7.0 LB ± 400 mM NaCl and pH 5.5 LB ± 400 mM

NaCl. The cells were pelleted at 6,200 x g for 2 min, resuspended in 1/10 volume of phosphate buffered saline (PBS), and two-fold serially diluted in PBS in a microtiter

plate. An equal volume of 1% guinea pig red blood cells (GPRBCs) (Hardy Diagnostics) was added to each well and allowed to incubate overnight at 4°C. The HA titers were calculated as the reciprocal of the last dilution that still agglutinated the GPRBCs.

Murine Urinary Tract Infection Model

To see if the loss of omrAB in UPEC affected colonization and survival in the urinary tract, a murine urinary tract infection model was used (173). Wild-type, ΔomrAB, and complemented NU149 strains were passaged to maximize type 1 pili expression, pelleted by centrifugation at 6,200 x g for 2 min, and resuspended in 1/10 volume PBS.

Female Swiss Webster mice were then infected transurethrally with 200 µL of the bacterial suspensions. The mice were euthanized and the bladders and kidneys were harvested at 1, 3, and 5- days post-infection and homogenized in one milliliter PBS.

Each homogenate was 10-fold serially diluted in PBS, plated on LA, and incubated overnight at 37°C to enumerate the bacteria in each organ. The median values for each cohort (NU149, NU149 ΔomrAB, and NU149 ΔomrAB/pCG1-4) were determined and

ANOVA analyses were performed to determine significance. P values ≤ 0.05 were considered significant.

RESULTS

Effects of omrA/B and hfq Gene Deletions on Growth Rate

Several mutant strains were obtained from Susan Gottesman’s laboratory, representing mutations in omrA, omrB, omrAB, and hfq (Table 1). To determine if changes in the pH or osmolality affected growth of each mutant, growth curves were performed on the mutants compared to the wild-type E. coli K-12 strain in pH 5.5 and 7.0

LB with or without 400 mM NaCl. No significant growth differences were found for the single sRNA deletion mutants MG1001 and MG1002 (ΔomrA and ΔomrB, respectively) compared to the wild-type strain, DJ480 (Fig. 6A to D). However, the ΔomrAB mutant

MG1398 had a lower OD600 at 12 h compared to the wild-type strain when grown in pH

7.0 with and without added NaCl (Fig. 6B and D; P < 0.04). The Δhfq mutant MG1406 grew slower than the wild-type strain in all conditions tested, and had a significant difference in the OD600 readings at 6-8 h (Fig. 6A to D; P < 0.04). When the Δhfq mutant was grown in pH 7.0 with and without added NaCl, the OD600 reading was significantly lower when compared to wild-type at 12 h as well (Fig. 6B and D; P < 0.01).

A. 4 B. 4.5 3.5 4 3 3.5 3 2.5 2.5 2 2

1.5 O.D.600nm O.D.600nm 1.5 1 1 0.5 0.5 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 Time (h) Time (h)

DJ480 MG1001 MG1002 MG1398 MG1406 DJ480 MG1001 MG1002 MG1398 MG1406

29 C. 4.5 D. 4.5

4 4 3.5 3.5 3 3 2.5 2.5

2 2 O.D.600nm O.D.600nm 1.5 1.5 1 1 0.5 0.5 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 Time (h) Time (h)

DJ480 MG1001 MG1002 MG1398 MG1406 DJ480 MG1001 MG1002 MG1398 MG1406

FIG 6 Growth curves of E. coli K-12 strains DJ480 (wild-type, blue line), MG1001 (ΔomrA, orange line), MG1002 (ΔomrB, gray line), MG1398 (ΔomrAB, green line), and MG1406 (Δhfq, red line) in (A) pH 5.5 LB, (B) pH 7.0 LB, (C) pH 5.5 LB + 400 mM NaCl, and (D) pH 7.0 LB + 400 mM NaCl.

Both omrA/B and hfq Deletions Affect fim Transcription in Strains Grown under

Different pH and Osmolality Conditions

Microarray data from Guillier and Gottesman suggest that OmrA and OmrB may regulate fimA transcription (141). To determine if the loss of omrA, omrB, omrAB and hfq had an effect on type 1 pili expression; β-galactosidase activity assays were done to measure the transcription of fimA, fimB, and fimE, using lacZYA fusions on single copy number plasmids. Wild-type, ΔomrA, ΔomrB, ΔomrAB, and Δhfq E. coli K-12 strains containing a fimA, fimB, or fimE promoter fused to lacZYA on single copy number plasmids were grown to logarithmic (OD600 = 0.4-0.6) and stationary phase in pH 5.5 and

7.0 LB with or without added 400 mM NaCl and tested for β-galactosidase activity.

Growth of the omrA mutant in pH 5.5 LB led to a statistically significant increase in fimA transcription compared to the wild-type during logarithmic growth (P <

0.03), but not at stationary growth (P < 0.61) (Fig. 7). No increase in fimA transcription was detected between the omrA mutant and the wild-type strain for all other conditions tested. The increase in fimA transcription by the ΔomrA mutant at logarithmic growth in pH 5.5 LB is questionable as no significant difference in fimA transcription was observed between ΔomrB and ΔomrAB mutant strains versus wild-type in all growth conditions tested (Fig. 7). The lack of change in fimA transcription between the ΔomrAB mutant and the wild-type strain suggests that OmrA and OmrB does not directly affect fimA transcription. The Δhfq strain showed no significant difference in fimA transcription compared to the wild-type when grown in LB at pH 5.5, 7.0, and 7.0 + NaCl media (P <

0.11, P < 0.60, and P < 0.67 at logarithmic growth, respectively; P < 0.13, P < 0.22, and P

< 0.13 at stationary growth, respectively).

3500

3000

2500 * 2000 * 1500

1000 galactosidase galactosidase Activity (Miller)

- 500 β

0 LB pH 5.5 LB pH 7.0 LB pH 5.5 + NaCl LB pH 7.0 + NaCl Growth Condition

DJ480 MG1001 MG1002 MG1398 MG1406

1000 900 800 * 700 600 500 400 300

200

galactosidase galactosidase Activity (Miller) -

β 100 0 LB pH 5.5 LB pH 7.0 LB pH 5.5 + NaCl LB pH 7.0 + NaCl Growth Condition

DJ480 MG1001 MG1002 MG1398 MG1406

FIG 7 β-galactosidase activity for fimA transcription in pH 5.5 or 7.0 LB ± 400 mM NaCl. Effects of pH and osmolality on fimA expression in DJ480 (wild-type, white bar), MG1001 (ΔomrA, back-hatched bar), MG1002 (ΔomrB, forward-hatched bar), MG1398 (ΔomrAB, black bar), and MG1406 (Δhfq, gray bar) as determined with a lacZYA transcriptional fusion. The β-galactosidase activity (expressed in Miller units) was determined after 5 min; means ± standard deviations of at least three separate runs are indicated for (A) logarithmic phase and (B) stationary phase. Asterisks indicate statistically significant differences at P ≤ 0.05 (*).

Although OmrA and OmrB have no direct effect on fimA transcription, the loss of both sRNAs in strain MG1398 (ΔomrAB) significantly increased fimB transcription compared to wild-type when grown in pH 5.5 LB + NaCl medium (Fig. 8). Strains

MG1001 (ΔomrA) and MG1002 (ΔomrB) had no significant difference in fimB transcription compared to wild-type in all growth conditions tested (Fig. 8). Strain

MG1406 (hfq) grown to stationary phase demonstrated 1.4-to 1.5-fold higher fimB transcription compared to the wild-type strain under all growth conditions, but the differences were only significant for growth in pH 5.5 LB + NaCl and pH 7.0 LB media.

When the hfq mutant strain was examined at logarithmic phase, fimB transcription increased significantly when grown in pH 5.5, pH 7.0, and pH 7.0 + NaCl LB, but not in pH 5.5 LB + NaCl. No difference in fimE transcription was seen for the ΔomrA and

ΔomrB strains when compared to the wild-type strain in all of the media tested (Fig. 9).

The lack of changes in fim transcription for the ΔomrA and ΔomrB single mutants support the idea that OmrA and OmrB have functional redundancy. Although the single omrA and omrB mutants did not demonstrate differences in fim gene transcription, the ΔomrAB double mutant transcribed significantly more fimE than wild-type under all growth conditions tested except when grown in pH 7.0 LB. The difference in fimE transcription was greatest in pH 5.5 LB + NaCl medium. The Δhfq mutant displayed a significant increase in fimE transcription compared to wild-type in all growth conditions tested.

Under all growth conditions tested, the ΔomrAB and Δhfq mutants consistently had a higher fold change in fimE transcription than fimB transcription, changing the ratio of

FimB to FimE to favor FimE.

2500 **

2000 * 1500 *

1000 **

500

galactosidase galactosidase Activity (Miller)

- β

0 LB pH 5.5 LB pH 7.0 LB pH 5.5 + NaCl LB pH 7.0 + NaCl Growth Condition

DJ480 MG1001 MG1002 MG1398 MG1406

1000 900 800 700 ** 600 ** 500 ** 400 300

200

galactosidase galactosidase Activity (Miller) -

β 100 0 LB pH 5.5 LB pH 7.0 LB pH 5.5 + NaCl LB pH 7.0 + NaCl Growth Condition

DJ480 MG1001 MG1002 MG1398 MG1406

FIG 8 β-galactosidase activity for fimB transcription in pH 5.5 or 7.0 LB ± 400 mM NaCl. Effects of pH and osmolality on fimB expression in DJ480 (wild-type, white bar), MG1001 (ΔomrA, back-hatched bar), MG1002 (ΔomrB, forward-hatched bar), MG1398 (ΔomrAB, black bar), and MG1406 (Δhfq, gray bar) as determined with a lacZYA transcriptional fusion. The β-galactosidase activity (expressed in Miller units) was determined after 5 min; means ± standard deviations of at least three separate runs are indicated for (A) logarithmic phase and (B) stationary phase. Asterisks indicate statistically significant differences at P ≤ 0.05 (*) or P ≤ 0.01 (**).

2500 ** 2000 ** 1500

* 1000 ** ** 500

galactosidase galactosidase Activity (Miller) **

- β

0 LB pH 5.5 LB pH 7.0 LB pH 5.5 + NaCl LB pH 7.0 + NaCl Growth Condition

DJ480 MG1001 MG1002 MG1398 MG1406

1000 ** 900 800 ** 700 * 600 * 500 ** ** 400 ** 300

200

galactosidase galactosidase Activity (Miller) -

β 100 0 LB pH 5.5 LB pH 7.0 LB pH 5.5 + NaCl LB pH 7.0 + NaCl Growth Condition

DJ480 MG1001 MG1002 MG1398 MG1406

FIG 9 β-galactosidase activity for fimE transcription in pH 5.5 or 7.0 LB ± 400 mM NaCl. Effects of pH and osmolality on fimE expression in DJ480 (wild-type, white bar), MG1001 (ΔomrA, back-hatched bar), MG1002 (ΔomrB, forward-hatched bar), MG1398 (ΔomrAB, black bar), and MG1406 (Δhfq, gray bar) as determined with a lacZYA transcriptional fusion. The β-galactosidase activity (expressed in Miller units) was determined after 5 min; means ± standard deviations of at least three separate runs are indicated for (A) logarithmic phase and (B) stationary phase. Asterisks indicate statistically significant differences at P ≤ 0.05 (*) or P ≤ 0.01 (**).

The Orientation of the fimS Element Switches to Favor the Phase-OFF Orientation

in an omrAB Mutant Grown under High Osmolality Media

To see if the omrAB mutation affected fimS positioning, chromosomal DNA from

NU149, NU149 ΔomrAB, and NU149 ΔomrAB pCG1-4 grown in pH 5.5 or 7.0 LB with or without NaCl were used in a multiplex PCR. No differences in the orientation of the fimS element were detected between the NU149 ΔomrAB mutant (AB) and wild-type

(WT) when grown to stationary phase in pH 5.5 and pH 7.0 media (Fig. 10). In pH 7.0 +

NaCl, the fimS element was in the Phase-OFF position twice as much in the ΔomrAB mutant compared to wild-type, and half as much in the Phase-ON position. In pH 5.5 +

NaCl, the fimS element in the ΔomrAB mutant favored the Phase-OFF orientation four times as much and had four times less fimS in the Phase-ON position versus wild-type.

Complementation of the ΔomrAB mutant with pCG1-4 reverted orientation of the fimS element back to wild-type levels.

FIG 10 Orientation of the fimS element in E. coli NU149, NU149 omrAB, and NU149 omrAB/pCG1-4 strains when grown in LB pH 5.5 or 7.0 with or without added 400 mM NaCl. Multiplex PCRs were set up with INV and FIMA primers to amplify Phase-ON oriented DNA (ON, 450-bp product), FIME and INV to amplify Phase-OFF oriented DNA (OFF, 750-bp product), and EcFtsZ1 and EcFtsZ2 primers to amplify the ftsZ reference gene (302-bp product). Each multiplex was run at least three times. The PCR products of NU149 wild-type (WT), NU149 ΔomrAB (AB), and NU149 ΔomrAB/pCG1- 4 (C) were loaded onto a 1.5% agarose gel.

High Osmolality Growth Conditions Diminish Type 1 Pili Expression in an omrAB

Mutant

To ascertain if differences in fim gene transcription observed from the β- galactosidase assays and fimS orientation from the multiplex PCR corresponded to differences in type 1 pili surface expression, strains NU149, NU149 ΔomrAB, and NU149

ΔomrAB/pCG1-4 were grown in pH 5.5 or 7.0 LB with or without NaCl and tested for their ability to agglutinate GPRBCs. Wild-type NU149 grown in pH 7.0 medium had the highest level of type 1 pili expression (Table 3). Growth in low pH or high salt media reduced type 1 pili expression on NU149. The ΔomrAB double mutant grown under low salt conditions exhibited HA titers that were the same as wild-type. However, when the

ΔomrAB mutant was grown in pH 5.5 or pH 7.0 LB with added NaCl, the HA titers

dropped 4-fold and 2-fold compared to the wild-type, respectively. Complementation of the ΔomrAB mutant with pCG 1-4 restored HA titers to wild-type levels in all growth media tested.

TABLE 3 Hemagglutination titers for UPEC strains NU149, NU149 ΔomrAB, and NU149 ΔomrAB/pCG1-4. HA titer Strain pH 5.5 pH 5.5+b pH 7.0 pH 7.0+ NU149 256a 16 512 128 NU149 ΔomrAB 256 4 512 64 NU149 ΔomrAB/pCG1-4 256 16 512 128 a HA titers were reported as the average of at least three separate runs. b Addition of 400 mM NaCl

An omrAB Deletion Attenuates Survival of a UPEC Strain in Murine Urinary Tracts

Reduced type 1 pili expression by NU149 ΔomrAB under high salt conditions may impact its ability to attach to the bladder epithelium. To determine if the fitness of the omrAB mutant in the murine urinary tract was affected, strains NU149, NU149

ΔomrAB, and NU149 ΔomrAB/pCG1-4 were transurethrally injected into female Swiss

Webster mice and monitored over a five-day period. At 1 day post-inoculation, the

NU149 ΔomrAB strain in the murine bladders dropped to a median bacterial count that was nearly equal to the wild-type strain (P < 0.41) (Fig. 11A). The complemented

ΔomrAB strain had a bacterial count that was two logs lower than the wild-type strain, although the reduction in bacterial load was not significant (P < 0.20). In the infected murine kidneys at 1 day post-inoculation, the NU149 ΔomrAB mutant strain had a four log lower bacterial count compared to wild-type (Fig. 11B), but this marked difference was not significant (P < 0.13). The complemented ΔomrAB strain had a six log lower

FIG 11 Independent challenges of female Swiss Webster mice with E. coli strain NU149 (•), NU149 ΔomrAB (○), and a complemented mutant strain NU149 ΔomrAB/pCG1-4 (▲). Bacterial counts are shown for (A) the bladder 1 day post-inoculation; (B) the kidney, 1 day post-inoculation; (C) the bladder, 3 days post-inoculation; (D) the kidney, 3 days post-inoculation; (E) the bladder, 5 days post-inoculation; and (F) the kidney, 5 days post-inoculation. Each data point represents the CFU/ml for one mouse. The numbers in parentheses next to a data point indicate more than one data point with the same value. Horizontal bars represent the median values of the bacterial concentration of the population. Asterisks indicate statistically significant differences at P ≤ 0.05 (*) or P ≤ 0.01 (**). 38

bacterial count than wild-type, however, this reduction in bacterial numbers was also not significant (P < 0.08).

At 3 days post-inoculation, the NU149 ΔomrAB bacterial count in the murine bladders was three logs significantly lower than the wild-type (P < 0.02) (Fig. 11C). The

NU149 ΔomrAB complemented strain had a significant five log lower median bacterial count compared to wild-type (P < 0.001). In the murine kidneys, NU149 ΔomrAB had a two log lower median bacterial count than wild-type (P < 0.001) (Fig. 11D). The complemented omrAB strain had a four log reduction in the bacterial count versus the wild-type strain (P < 0.0001).

By 5 days post-inoculation, the bacterial counts in the murine bladders for wild- type increased back to 1 day post-inoculation levels. The omrAB mutant strains displayed results that were similar to those noted at 3 days post-infection, whereas the complemented omrAB strain bacterial number dropped even further. In the murine bladders, the mutant NU149 ΔomrAB had a four log lower median day 5 bacterial count than wild-type NU149 (Fig. 11E), but the lower bacterial number was not significant (P <

0.1). The complemented ΔomrAB strain displayed a significantly lower median bacterial count than the wild-type strain (P < 0.002). In the murine kidneys, the median bacterial count of NU149 ΔomrAB on day 5 post-inoculation was significantly three logs less than wild-type (P < 0.04) (Fig. 11F). The complemented omrAB strain had a median bacterial count of 0 CFU/ml, which was significantly less than wild-type count after 5 days post-inoculation (P < 0.002). No significant differences in wild-type bacterial counts were seen across the five day period in both the bladder and the kidneys (P < 0.62 and P < 0.1, respectively). In contrast, both the ΔomrAB mutant and the complemented

strain had significantly reduced bacterial counts in both tissues across the five day period

(in the bladder P < 0.01 and P < 0.02 and kidneys P < 0.001 and P < 0.02, respectively).

Our data suggest that OmrA and OmrB are needed by UPEC to survive over time in the murine urinary tract.

DISCUSSION

The main objective of this study was to determine the roles of OmrA and OmrB on type 1 pili expression and on in vivo survival of UPEC in a murine urinary tract. This study has demonstrated that the OmrA and OmrB sRNAs repressed fimB and fimE transcription under low pH and high osmolality conditions, altered the fimS element positioning, and affected the surface expression of type 1 pili on UPEC cells. Whether

OmrA and OmrB directly bind and repress fim transcription or regulate fim expression through the binding of other regulatory genes such as ompR has not been determined.

Taken together, it suggests that when UPEC enters the urinary tract, the low pH and high osmolality triggers ompR post-transcriptional changes that lead to more OmpR protein.

An elevated OmpR concentration may repress fimB transcription and activate omrA and omrB transcription (93, 141). The two-fold and three-fold increase in fimB and fimE transcription, respectively, in the ΔomrAB mutant suggest a greater repression of fimE transcription by OmrA and OmrB in the wild-type strain that favors FimB. FimB will also increase with reduction of OmpR and derepression of fimB transcription. Since the ratio of FimB to FimE favors FimB, the fimS element switches to the Phase-ON orientation, leading to greater type 1 pili expression and attachment to the bladder epithelium (Fig. 12). However, transcription of fimA is also being repressed by other

Hfq-dependent sRNA(s) and site-specific recombinases. Overexpression of OmrA and

OmrB in the complemented ΔomrAB mutant did not result in increased type 1 pili expression, as indicated by fimS orientation and HA titers.

FIG 12 Proposed mechanism of OmrA and OmrB on type 1 pili expression in E. coli under high osmolality conditions.

The type 1 pilus is an essential virulence factor needed for UPEC attachment to the bladder epithelium (16, 18, 19). Expression of type 1 pili undergoes phase variation, turning on (piliated) or off (non-piliated) through the switching of the fimS invertible

DNA element in response to changes in the environment (43). The orientation of fimS is largely regulated by the ratio of FimB (which switches fimS in both orientations) to FimE

(which switches fimS to the Phase-OFF position) (45, 49). Various proteins can regulate type 1 pili expression by directly changing the orientation of fimS, or by regulating expression of fimB and fimE. One of these proteins is OmpR, is known to bind to the second fimB promoter and repress fimB transcription, which may contribute to the loss of 42

type 1 pili expression in E. coli grown in a low pH/high osmolality environment (93).

This study detected no increase in ompR transcription, but did show an increase in OmpR protein under low pH/high osmolality conditions. OmpR activates transcription of the small regulatory RNA genes omrA and omrB whose gene products may regulate E. coli surface protein expression (141, 156, 157). In turn, OmrA and OmrB can suppress the transcription of ompR, which could explain the why ompR transcription under low osmolality does not increase (138, 141).

Initially, the effects of OmrA, OmrB, and their chaperone Hfq on fim gene transcription were assessed using ΔomrA, ΔomrB, ΔomrAB, and Δhfq mutants in an E. coli K-12 background. These strains were transformed with single copy number plasmids containing the promoter for fimA, fimB, or fimE fused to lacZYA. For fimA transcription, the hfq mutant was the only strain showing a significant difference compared to wild-type, and only when the bacteria were grown in a low pH/high osmolality environment. These results suggest that OmrA and OmrB have no direct regulatory effects on fimA transcription. Since the loss of Hfq did have a significant increase on fimA transcription in pH 5.5 + NaCl medium, it is likely that another sRNA regulates fimA under this condition. Hfq is required by more than 20 different sRNAs, including DsrA and RprA, which stimulates rpoS, a sigma factor that may suppress fimA transcription (143, 150).

For stationary phase cultures, the Δhfq mutant was the only mutant that had a significant effect on fimA transcription. Although fimA transcription increased slightly

(1.2- to 1.3-fold) in pH 5.5, 7.0, and 7.0 + NaCl LB growth media, it was insignificant and likely due to a lower OD600 reading (Fig. 6). A previous study has shown that

transcription of fimA was highest at pH 7.0 with low osmolality (92). In this study, the logarithmic phase pH 7.0 without NaCl culture also had the highest fimA transcription level. However, the stationary phase pH 7.0 without NaCl culture had the second lowest level of fimA transcription. There are several explanations for the difference in fimA transcription during logarithmic and stationary phase. Previous studies using β- galactosidase assays to measure fimA transcription have shown that β-galactosidase activity for fimA increases during logarithmic phase and decreases as E. coli enters stationary phase (80, 89), which is consistent with our findings. However, this does not explain why fimA transcription decreased more at pH 7.0 in comparison with the other three growth conditions. Several issues with performing β-galactosidase assays with stationary growth cultures may explain this decrease. First, the OD600 exceeded the recommended range (0.28-0.70) suggested by Miller (174). Excess growth leads to more

β-galactosidase production and β-galactosidase levels exceeding 10% of the available

ONPG would instantly convert most of the ONPG added to the reaction. Performing the

β-galactosidase assay on cultures at different stages of growth should generate more accurate readings of fim transcription. Second, an absorbance reading greater than 1.0 may be inaccurate in some spectrophotometers, and the OD420 readings for fimA transcription were similar for all growth conditions at stationary phase, ranging between

1.4 and 2.0. Bacterial growth and subsequently, the OD600 readings were highest at pH

7.0, resulting in a lower β-galactosidase activity when calculated. As such, the β- galactosidase activities at logarithmic phase may be more accurate than those calculated at stationary phase.

In every growth condition tested, the loss of both OmrA and OmrB increased fimE transcription more than fimB transcription, turning fimS to the Phase-OFF position and reducing type 1 pili expression. The loss of OmrA and OmrB had no significant effect on fimB transcription for the E. coli grown in pH 5.5, 7.0, and 7.0 + NaCl media.

Likewise, no difference in fimE transcription was seen in the ΔomrAB mutant grown in pH 7.0 medium. Transcription of omrA and omrB is activated by OmpR in response to high osmolality and as such, OmrA and OmrB may have limited activity under neutral pH/low osmolality growth conditions (141). In pH 5.5 and 7.0 LB with added NaCl, fimE transcription in the ΔomrAB mutant increased by 1.5- to 1.6-fold during logarithmic phase and 2.2- to 2.3-fold at stationary phase, indicating that OmrA and OmrB may regulate type 1 pili expression at the transcriptional level by repressing fimB and fimE transcription directly in response to changes in pH and osmolality. The highest increase in fimE transcription (3.2- to 3.8-fold) by the ΔomrAB mutant was seen in pH 5.5 LB +

NaCl. In low pH and high osmolality, the loss of omrAB also increased fimB transcription by 1.7-fold.

The loss of omrAB or ompR results in more fimB transcripts under low pH/high osmolality, suggesting multiple mechanisms within the EnvZ/OmpR pathway in regulating type 1 pili (93). Control of omrA and omrB by OmpR may be another mechanism by which OmpR suppresses type 1 pili expression under low pH/high osmolality. Alternatively, OmrA and OmrB may be acting indirectly by regulating ompR expression. Overexpression of OmrA and OmrB reduces ompR transcription (138, 141).

Therefore, the deletion of omrAB should increase the amount of OmpR, leading to a reduction in fimB transcription. Our β-galactosidase results did not show reduced fimB

transcription in the ΔomrAB mutant strain with respect to wild-type, but an increase in

OmpR could explain why fimB transcription did not increase as much as fimE with the loss of OmrA and OmrB. The effect of OmrA and OmrB on ompR expression requires further study, particularly under low pH/high osmolality conditions.

Under low pH and high osmolality conditions, the ΔomrAB mutant significantly increased fimE approximately three-fold and fimB transcription two-fold, orienting the fimS element to favor the Phase-OFF position. Likewise, the two-fold increase in fimE and no change in fimB transcription in the ΔomrAB mutant under neutral pH and high osmolality would also orient the fimS element to favor the Phase-OFF position.

Complementation of the ΔomrAB mutant with pCG1-4 restored the orientation of fimS to wild-type levels, indicating that the change in fimS orientation was due to the loss of

OmrA and OmrB. Although a significant increase in fimE transcription was detected in pH 5.5 LB, no difference in fimS orientation was detected in the ΔomrAB mutant under this condition. The fold increase in fimE transcription in pH 5.5 LB was half of that detected in pH 5.5 LB + NaCl and may not be sufficient to alter fimS positioning. Other recombinases: such as HbiF, IpbA, and FimX; which are known to switch fimS from

Phase-OFF to Phase-ON can minimize the effect of increased FimE on fimS orientation.

The β-galactosidase and fimS orientation results correlated with the HA results measuring type 1 pili surface expression. Wild-type strain NU149 had the highest HA titer, Phase-ON fimS element, and fimA transcription when grown in pH 7.0 medium, matching the results from a previous study (92). No differences in fim gene transcription and HA titers were observed between the ΔomrAB mutant and wild-type strain when grown in pH 7.0 medium. Growth of the ΔomrAB K-12 mutant in pH 5.5 medium had a

2.3-fold increase in fimE transcription at stationary phase compared to wild-type, but no difference in HA titers were seen in the UPEC counterparts. The 2.3-fold increase may not be enough to cause a significant change in type 1 pili expression because no differences in fimS orientation were seen either. There are also several recombinases that regulate fimA transcription independently of FimE and FimB that may minimize the impact of more FimE in the ΔomrAB strain. In pH 7.0 LB + NaCl, no differences in fimA or fimB transcription were detected between the ΔomrAB mutant and the wild-type strain.

However, NU149 ΔomrAB in pH 7.0 LB + NaCl had a two-fold reduction in the HA titers compared to wild-type NU149 and the orientation of fimS changed. The reduction in type 1 pili expression in pH 7.0 LB + NaCl may be attributed to an increase in FimE in the ΔomrAB mutant, as strain MG1398 (K-12 ΔomrAB) had a 2.2-fold increase in fimE transcription in pH 7.0 + NaCl at stationary phase. As no similar drop in HA titers and change in fimS orientation were seen in pH 5.5 LB despite similar increases in FimE, a mechanism independent of FimB and FimE, such as HbiF, IpuA, IpuB, IpbA, or FimX, may be responsible for switching the fimS element to the Phase-OFF orientation and reducing type 1 pili expression under high salt conditions. In pH 5.5 LB + NaCl, the

ΔomrAB K-12 mutant had a 3.2-fold increase in fimE transcription and a 1.7-fold increase in fimB transcription compared to wild-type. A four-fold change in the fimS element to the Phase-OFF position and reduction in HA titer in the NU149 ΔomrAB strain under the same growth conditions indicate a reduction in type 1 pili production, in part, because the ratio of FimB to FimE switches to favor FimE, as a result of the loss of OmrA and OmrB.

Complementation of the NU149 ΔomrAB strain restored type 1 pili expression to wild-

type levels, suggesting that the reductions in type 1 pili under high salt conditions were due to the loss of OmrA and OmrB alone.

The reduction in type 1 pili expression by the ΔomrAB mutant in pH 5.5 LB +

NaCl may impact the strains ability to colonize the urinary tract, which is an environment of both low pH and high osmolality. Swiss Webster mice transurethrally injected with

NU149, NU149 ΔomrAB, and NU149 ΔomrAB/pCG1-4 showed no difference in bladder colonization between wild-type NU149 and the ΔomrAB mutant at 1 day post- inoculation. Bladder colonization by NU149 wild-type remained approximately the same across the five day infection period, but the NU149 ΔomrAB mutant had a three log drop in the viable counts at 3 and 5 days post-inoculation.

The four log reduction in the median NU149 ΔomrAB viable count in the kidneys compared to the viable count for the wild-type strain at 1 day post-inoculation also suggests that OmrA and OmrB may affect initial colonization of the kidneys. By 3 and 5 days post-inoculation, the ΔomrAB viable counts were significantly lower than the wild- type strain, indicating that the loss of OmrA and OmrB reduces UPEC colonization and survival in both the murine bladder and kidneys. While the difference in viable counts could also be attributed to an overall lack of growth by the mutant strain, no difference in growth was detected between the ΔomrAB mutant and wild-type K-12 strain when grown in pH 5.5 LB with NaCl.

Complementation of the mutant strain should restore bacterial counts to wild-type levels and indicate that the difference seen was due to the loss of OmrA and OmrB alone.

However, the complemented ΔomrAB strain results from the infected murine bladders and kidneys were unexpected based on the growth curves, fim gene transcription, fimS

orientation, and HA titer analyses. Overexpression of OmrA and OmrB in the complemented strain appeared to have caused an even greater reduction in the colonization of the murine urinary tract than the loss of OmrA and OmrB. The complemented ΔomrAB strain displayed a two log lower median viable count than the

ΔomrAB mutant strain in both the murine bladder and kidney at one and three days post- inoculation. By 5 days post-inoculation, the complemented strain was almost completely cleared from the murine urinary tract. It is possible that excess production of OmrA and

OmrB sRNAs in UPEC greatly reduces its ability to survive in the murine urinary tract.

Overexpression of OmrA and OmrB, reduces other sRNAs from binding to Hfq, changing the gene regulation of not only those affected by OmrA and OmrB, but also those regulated by other sRNAs that require Hfq (175). Alternatively, the loss of OmrA and OmrB could increase the activity of other Hfq-dependent sRNAs and account for some of the changes seen in fim expression. Clearance of the complemented ΔomrAB strain in the murine kidneys suggest that OmrA and OmrB affect other genes in addition to type 1 pili. Overexpression of OmrA and OmrB would reduce ompR expression, derepress fimB transcription, and turn on type 1 pili expression (93, 138, 141). While type 1 pili are not necessary to bind to the kidney epithelium, failure to down-regulate type 1 pili would inhibit the expression of flagella, P pili, and S pili that are needed to ascend and infect the kidneys. Additionally, FimH, the adhesin of type 1 pili is highly immunogenic and recognized by TLR4 receptors on phagocytes (176, 177). Activation of the innate immune system could also explain the clearance of the complemented strain by day five. Further studies are needed to elucidate the virulence factors affected by

OmrA and OmrB and the mechanism by which they are regulated.

Type 1 pili expression in E. coli is regulated by many proteins in response to environmental changes. Fecal E. coli are likely non-piliated as the receptors for type 1 pili are not present in the colon and the solid surface of stool may signal E. coli to turn type 1 pili expression off (167, 173). When E. coli enters the urinary tract, it expresses type 1 pili in response to the pH, osmolality, and other environmental changes. While growth in low pH and high osmolality is not optimal, type 1 pili are necessary to bind to the bladder epithelium. However, in an environment that has few mannose receptors, the production of type 1 pili is unwarrented and the loss of type 1 pili through phase variation would allow the UPEC cells to avoid clearance by the host immune system.

Furthermore, repression of fim gene transcription would allow the expression of other virulence factors, such as P pili, that may facilitate attachment to kidney epithelial cells.

Altering the expression of type 1 pili in E. coli using small RNAs or other molecules can render it non-pathogenic. A drug that downregulates virulence factor genes, but does not kill the bacteria also has the advantage of preventing antibiotic resistance that has caused many conventional antibiotics to become ineffective.

REFERENCES

1. Kucheria R, Dasgupta P, Sacks SH, Khan MS, Sheerin NS. 2005. Urinary tract infections: new insights into a common problem. Postgrad Med J 81:83-86.

2. Foxman B. 2002. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Am J Med 113 Suppl 1A:5S-13S.

3. Wood D, Greenwell T. 2013. Surgical anatomy of the kidney and ureters. Surgery (Oxford) 31:326-328.

4. Patel AK, Chapple CR. 2008. Anatomy of the lower urinary tract. Surgery (Oxford) 26:127-132.

5. Wang A, Nizran P, Malone MA, Riley T. 2013. Urinary tract infections. Prim Care 40:687-706.

6. Giesen LG, Cousins G, Dimitrov BD, van de Laar FA, Fahey T. 2010. Predicting acute uncomplicated urinary tract infection in women: a systematic review of the diagnostic accuracy of symptoms and signs. BMC Fam Pract 11:78.

7. Shepherd AK, Pottinger PS. 2013. Management of urinary tract infections in the era of increasing antimicrobial resistance. Med Clin North Am 97:737-757, xii.

8. Nicolle LE. 2013. Urinary tract infection. Crit Care Clin 29:699-715.

9. Ronald A. 2002. The etiology of urinary tract infection: traditional and emerging pathogens. Am J Med 113 Suppl 1A:14S-19S.

10. Gupta K, Hooton TM, Stamm WE. 2001. Increasing antimicrobial resistance and the management of uncomplicated community-acquired urinary tract infections. Ann Intern Med 135:41-50.

11. Karlowsky JA, Kelly LJ, Thornsberry C, Jones ME, Sahm DF. 2002. Trends in antimicrobial resistance among urinary tract infection isolates of Escherichia coli from female outpatients in the United States. Antimicrob Agents Chemother 46:2540-2545.

12. Sanchez GV, Master RN, Karlowsky JA, Bordon JM. 2012. In vitro antimicrobial resistance of urinary Escherichia coli isolates among U.S. outpatients from 2000 to 2010. Antimicrob Agents Chemother 56:2181-2183.

13. Swami SK, Liesinger JT, Shah N, Baddour LM, Banerjee R. 2012. Incidence of antibiotic-resistant Escherichia coli bacteriuria according to age and location of onset: a population-based study from Olmsted County, Minnesota. Mayo Clin Proc 87:753-759.

14. Johnson JR. 1991. Virulence factors in Escherichia coli urinary tract infection. Clin Microbiol Rev 4:80-128.

15. Johnson JR. 2003. Microbial virulence determinants and the pathogenesis of urinary tract infection. Infect Dis Clin North Am 17:261-278, viii.

16. Tarchouna M, Ferjani A, Ben-Selma W, Boukadida J. 2013. Distribution of uropathogenic virulence genes in Escherichia coli isolated from patients with urinary tract infection. Int J Infect Dis 17:e450-453.

17. Brooks HJ, O'Grady F, McSherry MA, Cattell WR. 1980. Uropathogenic properties of Escherichia coli in recurrent urinary-tract infection. J Med Microbiol 13:57-68.

18. Mulvey MA. 2002. Adhesion and entry of uropathogenic Escherichia coli. Cell Microbiol 4:257-271.

19. Edén CS, Hansson HA. 1978. Escherichia coli pili as possible mediators of attachment to human urinary tract epithelial cells. Infect Immun 21:229-237.

20. Brinton Jr CC, Gemski Jr P, Falkow S, Baron LS. 1961. Location of the piliation factor on the chromosome of Escherichia coli. Biochem Biophys Res Commun 5:293-298.

21. Swaney LM, Liu YP, Ippen-Ihler K, Brinton CC. 1977. Genetic complementation analysis of Escherichia coli type 1 somatic pilus mutants. J Bacteriol 130:506-511.

22. Swaney LM, Liu YP, To CM, To CC, Ippen-Ihler K, Brinton CC. 1977. Isolation and characterization of Escherichia coli phase variants and mutants deficient in type 1 pilus production. J Bacteriol 130:495-505.

23. Klemm P. 1984. The fimA gene encoding the type-1 fimbrial subunit of Escherichia coli. Nucleotide sequence and primary structure of the protein. Eur J Biochem 143:395-399.

24. Orndorff PE, Falkow S. 1985. Nucleotide sequence of pilA, the gene encoding the structural component of type 1 pili in Escherichia coli. J Bacteriol 162:454- 457.

25. Hahn E, Wild P, Hermanns U, Sebbel P, Glockshuber R, Häner M, Taschner N, Burkhard P, Aebi U, Müller SA. 2002. Exploring the 3D molecular architecture of Escherichia coli type 1 pili. J Mol Biol 323:845-857.

26. Abraham SN, Goguen JD, Sun D, Klemm P, Beachey EH. 1987. Identification of two ancillary subunits of Escherichia coli type 1 fimbriae by using antibodies against synthetic oligopeptides of fim gene products. J Bacteriol 169:5530-5536.

27. Krogfelt KA, Klemm P. 1988. Investigation of minor components of Escherichia coli type 1 fimbriae: protein chemical and immunological aspects. Microb Pathog 4:231-238.

28. Jones CH, Pinkner JS, Roth R, Heuser J, Nicholes AV, Abraham SN, Hultgren SJ. 1995. FimH adhesin of type 1 pili is assembled into a fibrillar tip structure in the Enterobacteriaceae. Proc Natl Acad Sci U S A 92:2081-2085.

29. Russell PW, Orndorff PE. 1992. Lesions in two Escherichia coli type 1 pilus genes alter pilus number and length without affecting receptor binding. J Bacteriol 174:5923-5935.

30. Klemm P. 1992. FimC, a chaperone-like periplasmic protein of Escherichia coli involved in biogenesis of type 1 fimbriae. Res Microbiol 143:831-838.

31. Klemm P, Christiansen G. 1990. The fimD gene required for cell surface localization of Escherichia coli type 1 fimbriae. Mol Gen Genet 220:334-338.

32. Pellecchia M, Güntert P, Glockshuber R, Wüthrich K. 1998. NMR solution structure of the periplasmic chaperone FimC. Nat Struct Biol 5:885-890.

33. Choudhury D, Thompson A, Stojanoff V, Langermann S, Pinkner J, Hultgren SJ, Knight SD. 1999. X-ray structure of the FimC-FimH chaperone- adhesin complex from uropathogenic Escherichia coli. Science 285:1061-1066.

34. Vetsch M, Puorger C, Spirig T, Grauschopf U, Weber-Ban EU, Glockshuber R. 2004. Pilus chaperones represent a new type of protein-folding catalyst. Nature 431:329-333.

35. Bann JG, Pinkner JS, Frieden C, Hultgren SJ. 2004. Catalysis of protein folding by chaperones in pathogenic bacteria. Proc Natl Acad Sci U S A 101:17389-17393.

36. Saulino ET, Thanassi DG, Pinkner JS, Hultgren SJ. 1998. Ramifications of kinetic partitioning on usher-mediated pilus biogenesis. EMBO J 17:2177-2185.

37. Nishiyama M, Vetsch M, Puorger C, Jelesarov I, Glockshuber R. 2003. Identification and characterization of the chaperone-subunit complex-binding domain from the type 1 pilus assembly platform FimD. J Mol Biol 330:513-525.

38. Nishiyama M, Horst R, Eidam O, Herrmann T, Ignatov O, Vetsch M, Bettendorff P, Jelesarov I, Grütter MG, Wüthrich K, Glockshuber R, Capitani G. 2005. Structural basis of chaperone-subunit complex recognition by the type 1 pilus assembly platform FimD. EMBO J 24:2075-2086.

39. Saulino ET, Bullitt E, Hultgren SJ. 2000. Snapshots of usher-mediated protein secretion and ordered pilus assembly. Proc Natl Acad Sci U S A 97:9240-9245.

40. Ofek I, Beachey EH. 1978. Mannose binding and epithelial cell adherence of Escherichia coli. Infect Immun 22:247-254.

41. Korhonen TK, Leffler H, Svanborg Edén C. 1981. Binding specificity of piliated strains of Escherichia coli and Salmonella typhimurium to epithelial cells, saccharomyces cerevisiae cells, and erythrocytes. Infect Immun 32:796-804.

42. Klemm P. 1985. Fimbrial adhesions of Escherichia coli. Rev Infect Dis 7:321- 340.

43. Abraham JM, Freitag CS, Clements JR, Eisenstein BI. 1985. An invertible element of DNA controls phase variation of type 1 fimbriae of Escherichia coli. Proc Natl Acad Sci U S A 82:5724-5727.

44. Klemm P. 1986. Two regulatory fim genes, fimB and fimE, control the phase variation of type 1 fimbriae in Escherichia coli. EMBO J 5:1389-1393.

45. McClain MS, Blomfield IC, Eisenstein BI. 1991. Roles of fimB and fimE in site- specific DNA inversion associated with phase variation of type 1 fimbriae in Escherichia coli. J Bacteriol 173:5308-5314.

46. Schwan WR, Seifert HS, Duncan JL. 1994. Analysis of the fimB promoter region involved in type 1 pilus phase variation in Escherichia coli. Mol Gen Genet 242:623-630.

47. Donato GM, Lelivelt MJ, Kawula TH. 1997. Promoter-specific repression of fimB expression by the Escherichia coli nucleoid-associated protein H-NS. J Bacteriol 179:6618-6625.

48. Olsen PB, Klemm P. 1994. Localization of promoters in the fim gene cluster and the effect of H-NS on the transcription of fimB and fimE. FEMS Microbiol Lett 116:95-100.

49. Gally DL, Leathart J, Blomfield IC. 1996. Interaction of FimB and FimE with the fim switch that controls the phase variation of type 1 fimbriae in Escherichia coli K-12. Mol Microbiol 21:725-738.

50. Marc D, Dho-Moulin M. 1996. Analysis of the fim cluster of an avian O2 strain of Escherichia coli: serogroup-specific sites within fimA and nucleotide sequence of fimI. J Med Microbiol 44:444-452.

51. Valenski ML, Harris SL, Spears PA, Horton JR, Orndorff PE. 2003. The Product of the fimI gene is necessary for Escherichia coli type 1 pilus biosynthesis. J Bacteriol 185:5007-5011.

52. Schwan WR. 2011. Regulation of fim genes in uropathogenic Escherichia coli. World J Clin Infect Dis 1:17-25.

53. Xie Y, Yao Y, Kolisnychenko V, Teng CH, Kim KS. 2006. HbiF regulates type 1 fimbriation independently of FimB and FimE. Infect Immun 74:4039-4047.

54. Bryan A, Roesch P, Davis L, Moritz R, Pellett S, Welch RA. 2006. Regulation of type 1 fimbriae by unlinked FimB- and FimE-like recombinases in uropathogenic Escherichia coli strain CFT073. Infect Immun 74:1072-1083.

55. Hannan TJ, Mysorekar IU, Chen SL, Walker JN, Jones JM, Pinkner JS, Hultgren SJ, Seed PC. 2008. LeuX tRNA-dependent and -independent mechanisms of Escherichia coli pathogenesis in acute cystitis. Mol Microbiol 67:116-128.

56. Bateman SL, Stapleton AE, Stamm WE, Hooton TM, Seed PC. 2013. The type 1 pili regulator gene fimX and pathogenicity island PAI-X as molecular markers of uropathogenic Escherichia coli. Microbiology 159:1606-1617.

57. Anderson GG, Martin SM, Hultgren SJ. 2004. Host subversion by formation of intracellular bacterial communities in the urinary tract. Microbes Infect 6:1094- 1101.

58. Lund B, Lindberg F, Marklund BI, Normark S. 1987. The PapG protein is the alpha-D-galactopyranosyl-(1----4)-beta-D-galactopyranose-binding adhesin of uropathogenic Escherichia coli. Proc Natl Acad Sci U S A 84:5898-5902.

59. Leffler H, Svanborg-Edén C. 1981. Glycolipid receptors for uropathogenic Escherichia coli on human erythrocytes and uroepithelial cells. Infect Immun 34:920-929.

60. Korhonen TK, Väisänen-Rhen V, Rhen M, Pere A, Parkkinen J, Finne J. 1984. Escherichia coli fimbriae recognizing sialyl galactosides. J Bacteriol 159:762-766.

61. Hanisch FG, Hacker J, Schroten H. 1993. Specificity of S fimbriae on recombinant Escherichia coli: preferential binding to gangliosides expressing NeuGc alpha (2-3)Gal and NeuAc alpha (2-8)NeuAc. Infect Immun 61:2108- 2115.

62. Korhonen TK, Parkkinen J, Hacker J, Finne J, Pere A, Rhen M, Holthöfer H. 1986. Binding of Escherichia coli S fimbriae to human kidney epithelium. Infect Immun 54:322-327.

63. Ott M, Hacker J, Schmoll T, Jarchau T, Korhonen TK, Goebel W. 1986. Analysis of the genetic determinants coding for the S-fimbrial adhesin (sfa) in different Escherichia coli strains causing meningitis or urinary tract infections. Infect Immun 54:646-653.

64. Parkkinen J, Hacker J, Korhonen TK. 1991. Enhancement of tissue plasminogen activator-catalyzed plasminogen activation by Escherichia coli S fimbriae associated with neonatal septicaemia and meningitis. Thromb Haemost 65:483-486.

65. Parkkinen J, Korhonen TK, Pere A, Hacker J, Soinila S. 1988. Binding sites in the rat brain for Escherichia coli S fimbriae associated with neonatal meningitis. J Clin Invest 81:860-865.

66. Prasadarao NV, Wass CA, Hacker J, Jann K, Kim KS. 1993. Adhesion of S- fimbriated Escherichia coli to brain glycolipids mediated by sfaA gene-encoded protein of S-fimbriae. J Biol Chem 268:10356-10363.

67. Stins MF, Prasadarao NV, Ibric L, Wass CA, Luckett P, Kim KS. 1994. Binding characteristics of S fimbriated Escherichia coli to isolated brain microvascular endothelial cells. Am J Pathol 145:1228-1236.

68. Holden NJ, Uhlin BE, Gally DL. 2001. PapB paralogues and their effect on the phase variation of type 1 fimbriae in Escherichia coli. Mol Microbiol 42:319-330.

69. Sjöström AE, Sondén B, Müller C, Rydström A, Dobrindt U, Wai SN, Uhlin BE. 2009. Analysis of the sfaX(II) locus in the Escherichia coli meningitis isolate IHE3034 reveals two novel regulatory genes within the promoter-distal region of the main S fimbrial operon. Microb Pathog 46:150-158.

70. Sjöström AE, Balsalobre C, Emödy L, Westerlund-Wikström B, Hacker J, Uhlin BE. 2009. The SfaXII protein from newborn meningitis E. coli is involved in regulation of motility and type 1 fimbriae expression. Microb Pathog 46:243- 252.

71. Oshima T, Ito K, Kabayama H, Nakamura Y. 1995. Regulation of lrp gene expression by H-NS and Lrp proteins in Escherichia coli: dominant negative mutations in lrp. Mol Gen Genet 247:521-528.

72. Calvo JM, Matthews RG. 1994. The leucine-responsive regulatory protein, a global regulator of metabolism in Escherichia coli. Microbiol Rev 58:466-490.

73. Kelly A, Conway C, O Cróinín T, Smith SG, Dorman CJ. 2006. DNA supercoiling and the Lrp protein determine the directionality of fim switch DNA inversion in Escherichia coli K-12. J Bacteriol 188:5356-5363.

74. Corcoran CP, Dorman CJ. 2009. DNA relaxation-dependent phase biasing of the fim genetic switch in Escherichia coli depends on the interplay of H-NS, IHF and LRP. Mol Microbiol 74:1071-1082.

75. Eisenstein BI, Sweet DS, Vaughn V, Friedman DI. 1987. Integration host factor is required for the DNA inversion that controls phase variation in Escherichia coli. Proc Natl Acad Sci U S A 84:6506-6510.

76. Dorman CJ, Higgins CF. 1987. Fimbrial phase variation in Escherichia coli: dependence on integration host factor and homologies with other site-specific recombinases. J Bacteriol 169:3840-3843.

77. Blomfield IC, Kulasekara DH, Eisenstein BI. 1997. Integration host factor stimulates both FimB- and FimE-mediated site-specific DNA inversion that controls phase variation of type 1 fimbriae expression in Escherichia coli. Mol Microbiol 23:705-717.

78. Blomfield IC, Calie PJ, Eberhardt KJ, McClain MS, Eisenstein BI. 1993. Lrp stimulates phase variation of type 1 fimbriation in Escherichia coli K-12. J Bacteriol 175:27-36.

79. Blumer C, Kleefeld A, Lehnen D, Heintz M, Dobrindt U, Nagy G, Michaelis K, Emödy L, Polen T, Rachel R, Wendisch VF, Unden G. 2005. Regulation of type 1 fimbriae synthesis and biofilm formation by the transcriptional regulator LrhA of Escherichia coli. Microbiology 151:3287-3298.

80. Aberg A, Shingler V, Balsalobre C. 2006. (p)ppGpp regulates type 1 fimbriation of Escherichia coli by modulating the expression of the site-specific recombinase FimB. Mol Microbiol 60:1520-1533.

81. Aberg A, Shingler V, Balsalobre C. 2008. Regulation of the fimB promoter: a case of differential regulation by ppGpp and DksA in vivo. Mol Microbiol 67:1223-1241.

82. McVicker G, Sun L, Sohanpal BK, Gashi K, Williamson RA, Plumbridge J, Blomfield IC. 2011. SlyA protein activates fimB gene expression and type 1 fimbriation in Escherichia coli K-12. J Biol Chem 286:32026-32035.

83. El-Labany S, Sohanpal BK, Lahooti M, Akerman R, Blomfield IC. 2003. Distant cis-active sequences and sialic acid control the expression of fimB in Escherichia coli K-12. Mol Microbiol 49:1109-1118.

84. Sohanpal BK, El-Labany S, Lahooti M, Plumbridge JA, Blomfield IC. 2004. Integrated regulatory responses of fimB to N-acetylneuraminic (sialic) acid and GlcNAc in Escherichia coli K-12. Proc Natl Acad Sci U S A 101:16322-16327.

85. Sohanpal BK, Friar S, Roobol J, Plumbridge JA, Blomfield IC. 2007. Multiple co-regulatory elements and IHF are necessary for the control of fimB expression in response to sialic acid and N-acetylglucosamine in Escherichia coli K-12. Mol Microbiol 63:1223-1236.

86. Moores A, Chipper-Keating S, Sun L, McVicker G, Wales L, Gashi K, Blomfield IC. 2014. RfaH suppresses small RNA MicA inhibition of fimB expression in Escherichia coli K-12. J Bacteriol 196:148-156.

87. Crépin S, Houle S, Charbonneau M, Mourez M, Harel J, Dozois CM. 2012. Decreased expression of type 1 fimbriae by a pst mutant of uropathogenic Escherichia coli reduces urinary tract infection. Infect Immun 80:2802-2815.

88. Schwan WR, Shibata S, Aizawa S, Wolfe AJ. 2007. The two-component response regulator RcsB regulates type 1 piliation in Escherichia coli. J Bacteriol 189:7159-7163.

89. Dove SL, Smith SG, Dorman CJ. 1997. Control of Escherichia coli type 1 fimbrial gene expression in stationary phase: a negative role for RpoS. Mol Gen Genet 254:13-20.

90. Müller CM, Aberg A, Straseviçiene J, Emody L, Uhlin BE, Balsalobre C. 2009. Type 1 fimbriae, a colonization factor of uropathogenic Escherichia coli, are controlled by the metabolic sensor CRP-cAMP. PLoS Pathog 5:e1000303.

91. Mitra A, Palaniyandi S, Herren CD, Zhu X, Mukhopadhyay S. 2013. Pleiotropic roles of uvrY on biofilm formation, motility and virulence in uropathogenic Escherichia coli CFT073. PLoS One 8:e55492.

92. Schwan WR, Lee JL, Lenard FA, Matthews BT, Beck MT. 2002. Osmolarity and pH growth conditions regulate fim gene transcription and type 1 pilus expression in uropathogenic Escherichia coli. Infect Immun 70:1391-1402.

93. Rentschler AE, Lovrich SD, Fitton R, Enos-Berlage J, Schwan WR. 2013. OmpR regulation of the uropathogenic Escherichia coli fimB gene in an acidic/high osmolality environment. Microbiology 159:316-327.

94. Utsumi R. 2008. Bacterial signal transduction: networks and drug targets. Preface. Adv Exp Med Biol 631:v.

95. Mitrophanov AY, Groisman EA. 2008. Signal integration in bacterial two- component regulatory systems. Genes Dev 22:2601-2611.

96. Jung K, Fried L, Behr S, Heermann R. 2012. Histidine kinases and response regulators in networks. Curr Opin Microbiol 15:118-124.

97. Rampersaud A, Inouye M. 1991. Procaine, a local anesthetic, signals through the EnvZ receptor to change the DNA binding affinity of the transcriptional activator protein OmpR. J Bacteriol 173:6882-6888.

98. Raivio TL, Popkin DL, Silhavy TJ. 1999. The Cpx envelope stress response is controlled by amplification and feedback inhibition. J Bacteriol 181:5263-5272.

99. Debnath I, Norton JP, Barber AE, Ott EM, Dhakal BK, Kulesus RR, Mulvey MA. 2013. The Cpx stress response system potentiates the fitness and virulence of uropathogenic Escherichia coli. Infect Immun 81:1450-1459.

100. Jubelin G, Vianney A, Beloin C, Ghigo JM, Lazzaroni JC, Lejeune P, Dorel C. 2005. CpxR/OmpR interplay regulates curli gene expression in response to osmolarity in Escherichia coli. J Bacteriol 187:2038-2049.

101. Barnhart MM, Chapman MR. 2006. Curli biogenesis and function. Annu Rev Microbiol 60:131-147.

102. Mahoney TF, Silhavy TJ. 2013. The Cpx stress response confers resistance to some, but not all, bactericidal antibiotics. J Bacteriol 195:1869-1874.

103. Laubacher ME, Ades SE. 2008. The Rcs phosphorelay is a cell envelope stress response activated by peptidoglycan stress and contributes to intrinsic antibiotic resistance. J Bacteriol 190:2065-2074.

104. Ferrières L, Clarke DJ. 2003. The RcsC sensor kinase is required for normal biofilm formation in Escherichia coli K-12 and controls the expression of a regulon in response to growth on a solid surface. Mol Microbiol 50:1665-1682.

105. Jayaratne P, Keenleyside WJ, MacLachlan PR, Dodgson C, Whitfield C. 1993. Characterization of rcsB and rcsC from Escherichia coli O9:K30:H12 and examination of the role of the rcs regulatory system in expression of group I capsular polysaccharides. J Bacteriol 175:5384-5394.

106. Gottesman S, Trisler P, Torres-Cabassa A. 1985. Regulation of capsular polysaccharide synthesis in Escherichia coli K-12: characterization of three regulatory genes. J Bacteriol 162:1111-1119.

107. Lippa AM, Goulian M. 2012. Perturbation of the oxidizing environment of the periplasm stimulates the PhoQ/PhoP system in Escherichia coli. J Bacteriol 194:1457-1463.

108. Sperandio V, Torres AG, Kaper JB. 2002. Quorum sensing Escherichia coli regulators B and C (QseBC): a novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli. Mol Microbiol 43:809-821.

109. Clarke MB, Sperandio V. 2005. Transcriptional autoregulation by quorum sensing Escherichia coli regulators B and C (QseBC) in enterohaemorrhagic E. coli (EHEC). Mol Microbiol 58:441-455.

110. Clarke MB, Sperandio V. 2005. Transcriptional regulation of flhDC by QseBC and sigma (FliA) in enterohaemorrhagic Escherichia coli. Mol Microbiol 57:1734-1749.

111. Kostakioti M, Hadjifrangiskou M, Pinkner JS, Hultgren SJ. 2009. QseC- mediated dephosphorylation of QseB is required for expression of genes associated with virulence in uropathogenic Escherichia coli. Mol Microbiol 73:1020-1031.

112. Guckes KR, Kostakioti M, Breland EJ, Gu AP, Shaffer CL, Martinez CR, Hultgren SJ, Hadjifrangiskou M. 2013. Strong cross-system interactions drive the activation of the QseB response regulator in the absence of its cognate sensor. Proc Natl Acad Sci U S A 110:16592-16597.

113. Alphen WV, Lugtenberg B. 1977. Influence of osmolarity of the growth medium on the outer membrane protein pattern of Escherichia coli. J Bacteriol 131:623-630.

114. Taylor RK, Hall MN, Enquist L, Silhavy TJ. 1981. Identification of OmpR: a positive regulatory protein controlling expression of the major outer membrane matrix porin proteins of Escherichia coli K-12. J Bacteriol 147:255-258.

115. Garrett S, Taylor RK, Silhavy TJ. 1983. Isolation and characterization of chain- terminating nonsense mutations in a porin regulator gene, envZ. J Bacteriol 156:62-69.

116. Mizuno T, Mizushima S. 1987. Isolation and characterization of deletion mutants of ompR and envZ, regulatory genes for expression of the outer membrane proteins OmpC and OmpF in Escherichia coli. J Biochem 101:387- 396.

117. Batchelor E, Walthers D, Kenney LJ, Goulian M. 2005. The Escherichia coli CpxA-CpxR envelope stress response system regulates expression of the porins ompF and ompC. J Bacteriol 187:5723-5731.

118. Mizuno T, Wurtzel ET, Inouye M. 1982. Cloning of the regulatory genes (ompR and envZ) for the matrix proteins of the Escherichia coli outer membrane. J Bacteriol 150:1462-1466.

119. Wurtzel ET, Chou MY, Inouye M. 1982. Osmoregulation of gene expression. I. DNA sequence of the ompR gene of the ompB operon of Escherichia coli and characterization of its gene product. J Biol Chem 257:13685-13691.

120. Mizuno T, Wurtzel ET, Inouye M. 1982. Osmoregulation of gene expression. II. DNA sequence of the envZ gene of the ompB operon of Escherichia coli and characterization of its gene product. J Biol Chem 257:13692-13698.

121. Comeau DE, Ikenaka K, Tsung KL, Inouye M. 1985. Primary characterization of the protein products of the Escherichia coli ompB locus: structure and regulation of synthesis of the OmpR and EnvZ proteins. J Bacteriol 164:578-584.

122. Wang LC, Morgan LK, Godakumbura P, Kenney LJ, Anand GS. 2012. The inner membrane histidine kinase EnvZ senses osmolality via helix-coil transitions in the cytoplasm. EMBO J 31:2648-2659.

123. Forst S, Comeau D, Norioka S, Inouye M. 1987. Localization and membrane topology of EnvZ, a protein involved in osmoregulation of OmpF and OmpC in Escherichia coli. J Biol Chem 262:16433-16438.

124. Roberts DL, Bennett DW, Forst SA. 1994. Identification of the site of phosphorylation on the osmosensor, EnvZ, of Escherichia coli. J Biol Chem 269:8728-8733.

125. Forst S, Delgado J, Inouye M. 1989. Phosphorylation of OmpR by the osmosensor EnvZ modulates expression of the ompF and ompC genes in Escherichia coli. Proc Natl Acad Sci U S A 86:6052-6056.

126. Delgado J, Forst S, Harlocker S, Inouye M. 1993. Identification of a phosphorylation site and functional analysis of conserved aspartic acid residues of OmpR, a transcriptional activator for ompF and ompC in Escherichia coli. Mol Microbiol 10:1037-1047.

127. Mizuno T, Mizushima S. 1990. Signal transduction and gene regulation through the phosphorylation of two regulatory components: the molecular basis for the osmotic regulation of the porin genes. Mol Microbiol 4:1077-1082.

128. Forst SA, Roberts DL. 1994. Signal transduction by the EnvZ-OmpR phosphotransfer system in bacteria. Res Microbiol 145:363-373.

129. Itou H, Tanaka I. 2001. The OmpR-family of proteins: insight into the tertiary structure and functions of two-component regulator proteins. J Biochem 129:343- 350.

130. Oshima T, Aiba H, Masuda Y, Kanaya S, Sugiura M, Wanner BL, Mori H, Mizuno T. 2002. Transcriptome analysis of all two-component regulatory system mutants of Escherichia coli K-12. Mol Microbiol 46:281-291.

131. Mizuno T, Mizushima S. 1986. Characterization by deletion and localized mutagenesis in vitro of the promoter region of the Escherichia coli ompC gene and importance of the upstream DNA domain in positive regulation by the OmpR protein. J Bacteriol 168:86-95.

132. Norioka S, Ramakrishnan G, Ikenaka K, Inouye M. 1986. Interaction of a transcriptional activator, OmpR, with reciprocally osmoregulated genes, ompF and ompC, of Escherichia coli. J Biol Chem 261:17113-17119.

133. Ramakrishnan G, Ikenaka K, Inouye M. 1985. Uncoupling of osmoregulation of the Escherichia coli K-12 ompF gene from ompB-dependent transcription. J Bacteriol 163:82-87.

134. Ikenaka K, Ramakrishnan G, Inouye M, Tsung K. 1986. Regulation of the ompC gene of Escherichia coli. Involvement of three tandem promoters. J Biol Chem 261:9316-9320.

135. Bergstrom LC, Qin L, Harlocker SL, Egger LA, Inouye M. 1998. Hierarchical and co-operative binding of OmpR to a fusion construct containing the ompC and ompF upstream regulatory sequences of Escherichia coli. Genes Cells 3:777-788.

136. Yoshida T, Qin L, Egger LA, Inouye M. 2006. Transcription regulation of ompF and ompC by a single transcription factor, OmpR. J Biol Chem 281:17114- 17123.

137. Head CG, Tardy A, Kenney LJ. 1998. Relative binding affinities of OmpR and OmpR-phosphate at the ompF and ompC regulatory sites. J Mol Biol 281:857- 870.

138. Göpel Y, Görke B. 2012. Rewiring two-component signal transduction with small RNAs. Curr Opin Microbiol 15:132-139.

139. Valverde C, Haas D. 2008. Small RNAs controlled by two-component systems. Adv Exp Med Biol 631:54-79.

140. De Lay N, Schu DJ, Gottesman S. 2013. Bacterial small RNA-based negative regulation: Hfq and its accomplices. J Biol Chem 288:7996-8003.

141. Guillier M, Gottesman S. 2006. Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs. Mol Microbiol 59:231-247.

142. Brantl S. 2007. Regulatory mechanisms employed by cis-encoded antisense RNAs. Curr Opin Microbiol 10:102-109.

143. Gottesman S. 2004. The small RNA regulators of Escherichia coli: roles and mechanisms*. Annu Rev Microbiol 58:303-328.

144. Kajitani M, Ishihama A. 1991. Identification and sequence determination of the host factor gene for bacteriophage Q beta. Nucleic Acids Res 19:1063-1066.

145. Brennan RG, Link TM. 2007. Hfq structure, function and ligand binding. Curr Opin Microbiol 10:125-133.

146. Link TM, Valentin-Hansen P, Brennan RG. 2009. Structure of Escherichia coli Hfq bound to polyriboadenylate RNA. Proc Natl Acad Sci U S A 106:19292- 19297.

147. Murina V, Lekontseva N, Nikulin A. 2013. Hfq binds ribonucleotides in three different RNA-binding sites. Acta Crystallogr D Biol Crystallogr 69:1504-1513.

148. Valentin-Hansen P, Eriksen M, Udesen C. 2004. The bacterial Sm-like protein Hfq: a key player in RNA transactions. Mol Microbiol 51:1525-1533.

149. Tsui HC, Leung HC, Winkler ME. 1994. Characterization of broadly pleiotropic phenotypes caused by an hfq insertion mutation in Escherichia coli K- 12. Mol Microbiol 13:35-49.

150. Kulesus RR, Diaz-Perez K, Slechta ES, Eto DS, Mulvey MA. 2008. Impact of the RNA chaperone Hfq on the fitness and virulence potential of uropathogenic Escherichia coli. Infect Immun 76:3019-3026.

151. Bojer MS, Jakobsen H, Struve C, Krogfelt KA, Løbner-Olesen A. 2012. Lack of the RNA chaperone Hfq attenuates pathogenicity of several Escherichia coli pathotypes towards Caenorhabditis elegans. Microbes Infect 14:1034-1039.

152. Yamada J, Yamasaki S, Hirakawa H, Hayashi-Nishino M, Yamaguchi A, Nishino K. 2010. Impact of the RNA chaperone Hfq on multidrug resistance in Escherichia coli. J Antimicrob Chemother 65:853-858.

153. Pichon C, du Merle L, Caliot ME, Trieu-Cuot P, Le Bouguénec C. 2012. An in silico model for identification of small RNAs in whole bacterial genomes: characterization of antisense RNAs in pathogenic Escherichia coli and Streptococcus agalactiae strains. Nucleic Acids Res 40:2846-2861.

154. Argaman L, Hershberg R, Vogel J, Bejerano G, Wagner EG, Margalit H, Altuvia S. 2001. Novel small RNA-encoding genes in the intergenic regions of Escherichia coli. Curr Biol 11:941-950.

155. Wassarman KM, Repoila F, Rosenow C, Storz G, Gottesman S. 2001. Identification of novel small RNAs using comparative genomics and microarrays. Genes Dev 15:1637-1651.

156. De Lay N, Gottesman S. 2012. A complex network of small non-coding RNAs regulate motility in Escherichia coli. Mol Microbiol 86:524-538.

157. Holmqvist E, Reimegård J, Sterk M, Grantcharova N, Römling U, Wagner EG. 2010. Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis. EMBO J 29:1840-1850.

158. Cohen SN, Chang AC, Hsu L. 1972. Nonchromosomal antibiotic resistance in bacteria: genetic transformation of Escherichia coli by R-factor DNA. Proc Natl Acad Sci U S A 69:2110-2114.

159. Morrison DA. 1977. Transformation in Escherichia coli: cryogenic preservation of competent cells. J Bacteriol 132:349-351.

160. Dagert M, Ehrlich SD. 1979. Prolonged incubation in calcium chloride improves the competence of Escherichia coli cells. Gene 6:23-28.

161. Hultgren SJ, Porter TN, Schaeffer AJ, Duncan JL. 1985. Role of type 1 pili and effects of phase variation on lower urinary tract infections produced by Escherichia coli. Infect Immun 50:370-377.

162. de Lorenzo V, Herrero M, Jakubzik U, Timmis KN. 1990. Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria. J Bacteriol 172:6568-6572.

163. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640- 6645.

164. Cherepanov PP, Wackernagel W. 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158:9-14.

165. Schwan WR, Seifert HS, Duncan JL. 1992. Growth conditions mediate differential transcription of fim genes involved in phase variation of type 1 pili. J Bacteriol 174:2367-2375.

166. Tsutsui H, Matsubara K. 1981. Replication control and switch-off function as observed with a mini-F factor plasmid. J Bacteriol 147:509-516.

167. Hultgren SJ, Schwan WR, Schaeffer AJ, Duncan JL. 1986. Regulation of production of type 1 pili among urinary tract isolates of Escherichia coli. Infect Immun 54:613-620.

168. Miller JH. 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

169. Cox MM. 1983. The FLP protein of the yeast 2-microns plasmid: expression of a eukaryotic genetic recombination system in Escherichia coli. Proc Natl Acad Sci U S A 80:4223-4227.

170. Salit IE, Gotschlich EC. 1977. Hemagglutination by purified type I Escherichia coli pili. J Exp Med 146:1169-1181.

171. Vosti KL. 1979. Relationship of hemagglutination to other biological properties of serologically classified isolates of Escherichia coli. Infect Immun 25:507-512.

172. Hagberg L, Jodal U, Korhonen TK, Lidin-Janson G, Lindberg U, Svanborg Edén C. 1981. Adhesion, hemagglutination, and virulence of Escherichia coli causing urinary tract infections. Infect Immun 31:564-570.

173. Schaeffer AJ, Schwan WR, Hultgren SJ, Duncan JL. 1987. Relationship of type 1 pilus expression in Escherichia coli to ascending urinary tract infections in mice. Infect Immun 55:373-380.

174. Miller JH. 1992. A short course in bacterial genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

175. Moon K, Gottesman S. 2011. Competition among Hfq-binding small RNAs in Escherichia coli. Mol Microbiol 82:1545-1562.

176. Bar-Shavit Z, Goldman R, Ofek I, Sharon N, Mirelman D. 1980. Mannose- binding activity of Escherichia coli: a determinant of attachment and ingestion of bacteria by macrophages. Infect Immun 29:417-424.

177. Mossman KL, Mian MF, Lauzon NM, Gyles CL, Lichty B, Mackenzie R, Gill N, Ashkar AA. 2008. Cutting edge: FimH adhesin of type 1 fimbriae is a novel TLR4 ligand. J Immunol 181:6702-6706.