The role of Type VI Secretion System in the virulence of Klebsiella pneumoniae
Thesis Submitted for the degree of
Doctor of Philosophy
at the University of Leicester
By
David Mwin (B.Sc.)
Department of Infection, Immunity, and Inflammation
College of Medicine, Biological Sciences and Psychology
University of Leicester
October 2017
i
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK.
Statement of originality
The research work submitted in this thesis for the degree of Doctor of Philosophy PhD entitled “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae” is based on work conducted by the author in the Department of Infection, Immunity, and Inflammation (College of Medicine and Biological Science) of the University of Leicester. during the period between February 2012 and August 2015.
All the work recorded in this thesis is original unless otherwise acknowledged in the text or by references.
No part of this work is submitted elsewhere for another degree in this or any other University.
i
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Acknowledgement
To God Almighty, I say thank you for Your Wisdom, Protection, and the Gift of life upon me throughout my studies and beyond. I am highly indebted to my family for their support, patience, and care during my studies. Thanks to the Government of Ghana for their generous sponsorship and provision of funds for this research work.
I am very grateful to my Supervisors, Dr Yassine Amrani, Dr Shaun Heaphy, and Dr Kumar Rajakumar, for all their support and guidance during my studies. I am also very grateful for the support and constructive criticisms of Prof. Jose Bengoechea and Prof. Peter Andrew. To Dr Hasan Yelsilkaya and Dr Primerose Fresestone, I am immensely grateful for your mentorship.
The team from the Biotechnology Core was beneficial during confocal and Electron microscopy, and I am very thankful for their assistance. I am very grateful to Dr Codula Stover and Dr Simon Bath for the provision of J744 and Acanthamoeba castellani, respectively.
To my loving family whose undivided support and encouragement gave me the wings to saw higher during and beyond this journey, thank you for being such a pillar in my life. And finally, to all who in one way or the other supported me in completion of this work, I would like to say God bless you all.
ii
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Dedication
I dedicated this research work/ thesis to my; beautiful family (Mrs Ugomma Lauritta Mwin and our children), amazing mother (Marcelina Ngmenterebo) and late father, Godfred Ngmenterebo, whose support and memory inspire me for greater heights.
iii
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Abstract
The role of Type VI secretion system in the virulence of Klebsiella pneumoniae
David Mwin
The enterobacteria, especially the multidrug-resistant strains, pose a serious health threat with evolving virulence mechanisms against their host. The opportunistic pathogen, K. pneumoniae, is a leading cause of urinary tract infection, blood and pneumonia in patients at the hospital and remains a common isolate in community-acquired disease. Many bacteria, including K. pneumoniae, explore a range of factors /mechanisms such as secreted toxin and antibiotic resistance that may enhance their survival, virulence, and evasion of the host immune system. Type VI Secretion Systems (T6SSs) is a transmembrane “spring- loaded” toxin-translocating nanomolecular machinery recently characterized in over 25% of Proteobacteria. T6SS shares both structural and protein homology with phage tail and is considered to be reminiscent of the bacteriophage puncturing device. While available data suggest a diverse role of the toxin puncturing T6SS device in many Gram-negative bacteria, no experimental data have demonstrated the putative T6SS gene clusters’ role in the virulence of K. pneumoniae as at the time that this research work was conducted. In silico analysis, using a full range of bioinformatic tools were used to identify and map the T6SS gene cluster (T6SS1 and T6SS3) in K. pneumoniae. A library of molecular genetic tools was constructed via a novel strategy and used to disarm the resistance in MDR K. pneumoniae, which enhanced the safety and genetic manipulation of the strain for T6SS functional studies. Mainly, three T6SS mutants, ∆T1 (T6SS1 mutant), ∆T3 (T6SS3 mutant), and ∆T1∆T3 (T6SS1/T6SS3 mutant) generated via lambda red recombination allelic exchange and were examined for the role of the T6SS gene clusters in K. pneumoniae. The data obtained from the various assays and analysis suggest that K. pneumoniae via T6SS mediated antibacterial virulence against other competing bacteria and played a significant role T4SS-mediated conjugal transfer of mobile genetic elements. K. pneumoniae used T6SS to resist amoeba phagocytosis and enhance subsequent survival within the cell. Also, T6SS increased in vivo virulence in Galleria larvae, host cell invasion, survival, actin filament polymerisation and activation of host pro-inflammatory innate immunity. Thus, the putative T6SS gene clusters may be mediating a multipurpose virulence against host organism and other bacteria using pre-emptive contact-dependent strikes and toxin secretion.
iv
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Abbreviations ABC ATP-binding cassette Mpf Mating pair formation ATP Adenosine triphosphate MGE Mobile genetic element ApE A plasmid editor MCS Multiple Cloning Site Blast Basic Local Alignment Tool SOE-PCR Spliced overlap extension-PCR bp Base pair EDTA Ethylenediaminetetraacetic acid CFU Colony-forming unit NEB New England Bio lab OD Optical Density CRKP Carbapenem-resistant Klebsiella pneumoniae DNA Deoxyribose nucleic acid Pfam Protein families dNTP Deoxy-ribonucleotide triphosphate PAI Pathogenicity island dsDNA Double-stranded DNA PCR Polymerase Chain Reaction DF Downstream flank PBS Phosphate buffered saline ddH2O Deionised distilled water RF Right Flank ESBL extended-spectrum beta-lactamases RNA Ribose nucleic acid FRT Flippase Recognition Target ST Sequence type g Gram DR Direct repeat PO Phenoloxidase SOE Splice overlap extension GC Guanine and Cytosine T1SS Type I secretion system GI Genomic island T2SS Type II secretion system HGT Horizontal gene transfer T3SS Type III secretion system ICE Integrative and conjugative element T4SS Type IV secretion system int Integrase T5SS Type V secretion system IR Inverted repeat T6SS Type VI secretion system IPTG Isopropyl-β-D-thiogalactopyranoside tRNA Transfer RNA Kb Kilobase λ Lambda Kp Klebsiella pneumoniae ⁰ C Degree Celsius μl Microliter TATOXB Tannic acid-treated oxblood LA Luria Bertani agar μg Microgram LAS Luria Bertani agar + sucrose M Micro Molar LB Luria Bertani broth cDNA Complementary DNA LB Luria Bertani broth + sucrose CDS Coding domain Sequence Mpf Mating pair formation DF Conserved downstream flan GP-RBS Guinea pig red blood cells DMSO Dimethyl sulfoxide NCBI National Centre for Biotechnology SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel Information electrophoresis kDa Kilodalton TAE Tris-acetate-EDTA SOC Super-optimal broth with Catabolite qRT-PCR Quantitative real-time polymerase chain Repression reaction mM Millimolar pmol Picomole v/v Volume per volume ratio w/v Weight per volume ratio
v
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Table of Contents Statement of originality ...... i
Acknowledgement ...... ii
Dedication ...... iii
Abstract ...... iv
Abbreviations ...... v
List of Figures ...... xi
List of Tables ...... xiv
Publications ...... xv
Chapter 1: Introduction ...... 2
1.1 Klebsiella Species ...... 2
1.1.1 History and taxonomic structure ...... 2
1.1.2 Ecology and Host Range ...... 3
1.1.3 Isolation and Identification ...... 5
1.1.4 Epidemiology ...... 7
1.1.5 K. pneumoniae ...... 11
1.1.6 Virulence factors ...... 11
1.2 Antibiotic resistance and virulence association ...... 20
1.3 Secretion systems ...... 25
1.3.1 The Type I Secretion System (T1SS) ...... 27
1.3.2 The Type II Secretion System (T2SS) ...... 28
1.3.3 Type III secretion system (T3SS) ...... 29
1.3.4 Type IV secretion system (T4SS) ...... 30
1.3.5 Type V secretion system (T5SS) ...... 32
1.3.6 Type VI secretion system (T6SS) ...... 34
1.4 Research aims and objectives ...... 47
Chapter 2: Material and Methods...... 51
vi
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. 2.1 Bacterial strains, Eukaryotic cells and Plasmids ...... 51
2.1.1 Media, reagents and solutions ...... 57
2.2 DNA-related methods and technique ...... 59
2.2.1 Oligonucleotide design, In silico-PCR and synthesis ...... 59
2.2.2 Polymerase chain reaction (PCR) ...... 59
2.2.3 Colony PCR ...... 60
2.2.4 Splice Overlap Extension (SOE)-PCR: Mutant allele construction ...... 60
2.2.5 Genomic and plasmid extraction ...... 62
2.2.6 Gel electrophoresis, DNA purification and Sequencing ...... 63
2.2.7 Restriction digestion ...... 63
2.2.8 DNA dephosphorylation and ligation ...... 63
2.3 RNA-related techniques and methods ...... 63
2.3.1 RNA extraction and cDNA library preparation ...... 63
2.3.2 Transcriptional analysis of T6SS, T4SS and fimbrial gene clusters ...... 64
2.3.3 qRT-PCR analysis of T6SS, T4SS, fim and mrk fimbrial clusters...... 64
2.4 Construction of pDNTOOL plasmids ...... 64
2.4.1 Construction of suicide deletion vectors ...... 65
2.4.2 Variety of Lambda RED plasmids with different antibiotic resistance cassette ...... 68
2.4.3 FRT-based antibiotic cassettes/ GFP plasmids ...... 70
2.4.4 Flp recombinase- encoding plasmid construction ...... 74
2.4.5 Cloning and inducible expression plasmids/ GFP plasmid Construction ...... 76
2.5 Genetic manipulation ...... 80
2.5.1 Preparation of Competent bacterial cells ...... 80
2.5.2 Suicide vector-based allelic exchange ...... 81
2.5.3 Lambda RED recombination-based allelic exchange for KPHST6SS mutation ...... 82
2.5.4 Flp-mediated FRT recombination ...... 86
2.5.5 Sucrose counterselection ...... 87
vii
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. 2.6 Other methods ...... 87
2.6.1 Biofilm formation ...... 87
2.6.2 Growth and cell viability ...... 88
2.6.3 Antibiotic susceptibility testing ...... 89
2.6.4 Co-culture experiments ...... 90
2.6.5 Bacterial competition and plasmid mobilization ...... 90
2.6.6 Agglutination assay ...... 93
2.6.7 G. mellonella larvae In vivo virulence model ...... 94
2.6.8 Eukaryotic cell-based virulence assays and methods ...... 96
2.6.9 Transmission Electron Microscopy ...... 105
2.6.10 Data analysis and Statistical Analysis ...... 105
2.6.11 Bioinformatic Analysis ...... 105
Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae ...... 110
3.1 Constructed molecular tools and strategic genetic manipulation ...... 110
3.1.1 Novel DNA swapping strategy; constructing FRT-flanked antibiotic resistance marker ...... 110
3.1.2 Other constructed genetic tools ...... 116
3.2 K. pneumoniae HS11286 mobile genome analysis and disarmament antibiotic resistance ...... 118
3.2.1 The mobile genome of K. pneumoniae HS11286 and analysis ...... 118
3.2.2 Resistance genes and the broader contexts of the linked regions ...... 120
3.2.3 Genetic disarmament of the resistance of K. pneumoniae HS11286 ...... 121
3.3 Disarmament of antibiotic resistance in K. pneumoniae HS11286 enhanced in vitro fitness not in vivo virulence in G. mellonella...... 123
3.4 3.6 K. pneumoniae HSS11286 T6SS clusters are syntenic with similarity in flanking regions to other K. pneumoniae strains ...... 126
Chapter 4: K. pneumoniae T6SS enhance bacteria-bacteria interaction and biofilm-like formation ...... 142
4.1 Overview ...... 142
viii
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. 4.2 Deletion of T6SS gene clusters (T6SS1 and/ or T6SS3) did not affect the growth of the mutants relative to the parent strain ...... 144
4.3 T6SS hallmark genes hcp1, hcp2, vgrG1 and vgrG3 were expressed in the K. pneumoniae HS11286 strain...... 145
4.4 Deletion of the K. pneumoniae DN2 T6SS1 and/ or T6SS3 locus results in reduced 'intra-strain' fitness 146
4.5 K. pneumoniae DN2 inter-species fitness is dependent on which T6SS loci are being deleted 149
4.6 Absence of T6SS1 and T6SS3 enhanced plasmid DNA mobilization via conjugation ...... 152
4.7 T6SS deletion enhanced biofilm formation in K. pneumoniae...... 153
4.8 Deletion of T6SS1 and T6SS3 clusters enhanced type 1 and type 3 fimbriae expression respectively ...... 157
4.9 K. pneumoniae T6SSs mediate resistance to Acanthamoeba castellanii, complement-mediated killing and PMN internalisation ...... 161
Chapter 5: K. pneumoniae T6SSs Mediate Virulence and Activation Host Cell Innate Immune Response ...... 167
5.1 T6SSs in K. pneumoniae promote Galleria killing and in vivo survival of bacteria ...... 167
5.2 K. pneumoniae T6SSs enhance phagocytic uptake and survival in murine macrophage ...... 173
5.3 K. pneumoniae T6SSs promote attachment, invasion and actin polymerisation of host lungs epithelial cells ...... 176
5.4 T6SSs in K. pneumoniae trigger an inflammatory immune response in both macrophages and epithelial cell (J774 and A549) ...... 186
5.4.1 Expressed macrophage (J774) inflammatory mediators/ cytokines induced in response to K. pneumoniae infection ...... 187
5.4.2 Expressed epithelial (A549) inflammatory mediators/ cytokines stimulated in response to K. pneumoniae ...... 193
5.5 J774 inflammatory mediators induced by hyper mucoid K. pneumoniae NTUH-K2044 T6SS ..... 196
Chapter 6: General Discussion ...... 200
Chapter 7: Conclusion ...... 220
7.1 General conclusion ...... 223
ix
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. 7.2 Future work ...... 224
Appendix 1: Primer Table ...... 282
Appendix 2 ...... 289
Appendix 2-1: List of genes deleted from the 26 kb region ...... 289
Appendix 2-2 Antibiotic susceptibility of K. pneumoniae HS11286 and the antibiotic disarmed versions ...... 290
Appendix 2-3 Resistance genes identified in K. pneumoniae HS11286 that could confer resistance in Clinical cases ...... 291
Appendix 2-4- Distribution of mobile genetic elements in K. pneumoniae HS11286 ...... 292
Appendix 2-5 Replicons of the K. pneumoniae plasmids ...... 292
Appendix 2-6 Other GIs identified in K. pneumoniae HS11286 genome ...... 292
Appendix 2-7 T6SS gene cluster in K. pneumoniae HS11286 and NTUH-K2044 ...... 292
x
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK.
List of Figures Figure 1.1 Schematic of phylogeny within the Klebsiella genus ...... 3 Figure 1.2 Factors associated with nosocomial bacterial pneumonia...... 10 Figure 1.3 Virulence factors associated with K. pneumoniae...... 12 Figure 1.4 Protein secretion systems in Gram-Negative bacteria...... 27 Figure 1.5 T4SS Functional representation in most Gram-negative bacteria, including K. pneumoniae. 31 Figure 1.6 Core T6SS gene organisation and Structural resemblance to phage-tail...... 35 Figure 1.7 The assembled structural components of T6SS...... 37 Figure 1.8 Dynamic formations and dissociation T6SS in bacteria...... 38 Figure 1.9 T6SS genealogy reported in some commonly encountered bacteria...... 40 Figure 1.10 T6SS functional versatility...... 42 Figure 1.11 Identified T6SS gene clusters in some Klebsiella species...... 46 Figure 2.1 Schematic of SOE-PCR for mutant allele creation or joining DNA fragment...... 62 Figure 2.2 Construction of K. pneumoniae NUTH-K2044 T6SS1 deletion vector, pJTOOL-8...... 66 Figure 2.3 Construction of K. pneumoniae NUTH-K2044 T6SS3 deletion vector, pDNTOOL-9...... 67 Figure 2.4 Construction of pDNTOOL-13 and pDNTOOL-16...... 69 Figure 2.5 Construction of pDNTOOL-31 and pDNTOOL-1...... 72 Figure 2.6 Construction of pDNTOOL-19 and pDNTOOL-2...... 75 Figure 2.7 Construction of pDNTOOL-22 and pDNTOOL-3...... 77 Figure 2.8 Construction of pDNTOOL-29 and pDNTOOL-30...... 79 Figure 2.9 K. pneumoniae HS11286 T6SS1 mutant allele and knockout...... 83 Figure 2.10 K. pneumoniae HS11286 T6SS3 mutant allele creation and knockout...... 85 Figure 3.1 Schematic representation of novel in vivo plasmid manipulation...... 112 Figure 3.2 Construction and verification of pDNTOOL-31...... 113 Figure 3.3 Colony PCR to confirm the presences or absence of a target gene, lambda Red and constructed plasmids...... 114 Figure 3.4 Confirmation of constructed plasmid carrying FRT-Antibiotic resistance marker-FRT...... 115 Figure 3.5 The contexts of resistance genes in K. pneumoniae HS11286 (a) pKPHS2 and (b) pKPHS3 plasmids...... 121 Figure 3.6 Deletion of blaKPC-2 on pKPHS2 and 26 kb MDR region on pKPHS3 in K. pneumoniae HS11286 background...... 122
xi
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Figure 3.7 Deletion of the K. pneumoniae HS11286 antibiotic resistance arsenal enhances competitive fitness but not virulence in Galleria larvae...... 125 Figure 3.8 T6SS gene clusters identified in K. pneumoniae HS21186...... 129 Figure 3.9 Arrangement of T6SS1, T6SS2 and T6SS3 gene clusters using genome viewer...... 134 Figure 3.10 Schematic procedure for K. pneumoniae HS11286 T6SS1 deletion...... 136 Figure 3.11 Schematic procedure for K. pneumoniae HS11286 T6SS3 deletion...... 137 Figure 3.12 T6SS mutant generation in DN2 (resistance disarmed K. pneumoniae HS11286) background and T6SS mutant PCR confirmation...... 139 Figure 4.1 Growth bacteria strains after T6SS gene cluster knockout...... 145 Figure 4.2 T6SS core genes, hcp1, hcp2, vgrG1 and vgrG3 are expressed in K. pneumoniae...... 146 Figure 4.3 K. pneumoniae intra-strain in vitro competition...... 148 Figure 4.4 Inter-species in vitro competition...... 149 Figure 4.5 E. coli DH5α colony reduction due to K. pneumoniae T6SS activity...... 151 Figure 4.6 K. pneumoniae NTUH-K2044 T6SS1-dependent inhibition of E. coli DH5α...... 152 Figure 4.7 Plasmid mobilization and expression T4SS –related genes...... 155 Figure 4.8 Biofilm formation and visualisation...... 156 Figure 4.9 Expression of mrkD and fimH of K. pneumoniae surface fimbriae...... 158 Figure 4.10 Transmission electron microscopic (TEM) visualization of K. pneumoniae surface fimbriae...... 160 Figure 4.11 T6SS enhances K. pneumoniae against Acanthamoeba castellanii...... 162 Figure 4.12 K. pneumoniae T6SS-enhanced resistance to Serum mediated Killing, C3b deposition and opsonisation...... 164 Figure 5.1 K. pneumoniae T6SS dependent killing of Galleria larvae...... 168 Figure 5.2 In vivo competition: DN2 vs T6SS mutants in Galleria larvae...... 169 Figure 5.3 Hypermucoid K. pneumoniae T6SS enhanced killing of Galleria larvae...... 170 Figure 5.4 Phenoloxidase activity (PO) in infected Galleria larvae...... 171 Figure 5.5 Parentage viability cell count in larvae...... 172 Figure 5.6 J7774.A1 phagocytosis uptake and visualization of K. pneumoniae...... 175 Figure 5.7 K. pneumoniae phagocytic survival in murine macrophage (J774.A1) is T6SS enhanced. ... 176 Figure 5.8 K. pneumoniae T6SS-enhanced attachment and survival in lungs epithelial cells...... 177 Figure 5.9 Visualization K. pneumoniae attachment to H292 cells...... 180 Figure 5.10 K. pneumoniae T6SS toxicity in H292 cells ...... 182 Figure 5.11 K. pneumoniae T6SSs mediated A549 invasion and actin polymerisation after 3hrs...... 184 Figure 5.12 K. pneumoniae A549 invasion and actin polymerisation after 6hrs...... 185
xii
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Figure 5.13 A preliminary detection of cytokines array/ proteome profiler of K. pneumoniae-infected J774 cell supernatant at 3h post-infection...... 188 Figure 5.14 ELISA quantification of K. pneumoniae T6SS-dependent induction of inflammatory mediators in infected J774 supernatant...... 192 Figure 5.15 K. pneumoniae T6SS induced secretion of lungs epithelial A549 inflammatory mediators in the supernatant at 3 post-infection...... 195 Figure 5.16 Inflammatory mediators induced by hyper mucoid K. pneumoniae NTUH-K2044...... 197 Figure 6.1 Schematic representation of K. pneumoniae T6SS used for bacteria competition involved in DN2 interaction...... 208 Figure 6.2 K. pneumoniae T6SS induces type 1 and 3 fimbria-associated biofilm form...... 211 Figure 6.3 Multipurpose K. pneumoniae T6SS directly interact with target cells in a contact-dependent manner...... 217
xiii
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK.
List of Tables Table 1.1 Phenotypic characteristics of the Klebsiella species and K. pneumoniae subspecies ______6 Table 1.2 Features of bacterial secretion system ______26 Table 1.3.0 T6SS nomenclatural components and functions ______39 Table 1.4.0 Functional diversity of T6SS toward the eukaryotic host. ______43 Table 2.1 List of plasmids used in this study ______52 Table 2.2 List of bacterial strains and Eukaryotic lines used in this study______55 Table 2.3 Typical PCR cycling conditions ______60 Table 2.4 Bioinformatic resources used in this study ______105 Table 3.1 K. pneumoniae HS11286 T6SS1 gene cluster: context and content ______127 Table 3.2 K. pneumoniae HS11286 T6SS3 gene cluster: context and content ______130 Table 4.1 Agglutination Assay ______157
xiv
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK.
Publications
1. BI, D., JIANG, X., SHENG, Z.K., NGMENTEREBO, D., TAI, C., WANG, M., DENG, Z., RAJAKUMAR, K. and OU, H.Y., 2015. Mapping the resistance-associated mobilome of a carbapenem-resistant Klebsiella pneumoniae strain reveals insights into factors shaping these regions and facilitates the generation of a 'resistance-disarmed' model organism. The Journal of antimicrobial chemotherapy
xv
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK.
xvi
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction
CHAPTER ONE
INTRODUCTION
1
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction Chapter 1: Introduction
1.1 Klebsiella Species
In 1882, Austrian microbiologist called Anton von Frisch made the first account of Klebsiella as an encapsulated bacillus isolated from a chronic rhinoscleroma patient with chronic granulomatous infection of the upper airway. This bacillus was named in honour of a German Microbiologist, Edwin Klebs, in 1887 for discovering Corynebacterium diphtheria (RW.ERROR - Unable to find reference:758, RW.ERROR - Unable to find reference:912). Modern microbiology defines Klebsiella as a Gram-negative bacillus that forms mucoid colonies and non-motile (RW.ERROR - Unable to find reference:873). In the following sections, the history, taxonomy, ecology and host range, isolation and identification, and epidemiology of Klebsiella species are described. The next discussion will be the virulence factors of Klebsiella pneumoniae, including Type 6 secretion systems, which are the focus of this research. Also included in this chapter is the host immune response to K. pneumoniae, and more importantly, the overall aims and objective of this research. The Klebsiella species described in the most detail is a clinical isolate K. pneumoniae.
1.1.1 History and taxonomic structure
The genus Klebsiella consists of Gram-negative, non-motile, encapsulated, lactose-fermenting, facultatively anaerobic, rod-shaped bacteria. The genus Klebsiella belongs to the Enterobacteriaceae family, named by Trevisan (1885) in honour of Edwin Kleb (RW.ERROR - Unable to find reference:763). K. pneumoniae subspecies pneumoniae strain C122 is the strain-type for Klebsiella genus and was first isolated from urinary tract infection (RW.ERROR - Unable to find reference:751, RW.ERROR - Unable to find reference:749, RW.ERROR - Unable to find reference:757). The capsulated K. rhinoschleromatis, named by Trevisan (1887) was the first Klebsiella species to be isolated from a rhinoscleroma patient (RW.ERROR - Unable to find reference:758). Abel (1893) isolated K. ozaenae formally called “Bacillus mucosus” from the nasal secretion of a patient with ozaena (RW.ERROR - Unable to find reference:761). In 1982 Friedlander isolated from a pneumonia patient an organism he called “Hyalococcus pneumoniae” (RW.ERROR - Unable to find reference:762) and K. pneumoniae (RW.ERROR - Unable to find reference:764). There was considerable confusion about this genus (Klebsiella) for several years as the organism at the time could not be objectively distinguished from Escherichia (described as “Bacterium lactis aerogenes” by Escherich, in 1885). However, it was renamed as “Bacillus aerogenes” by Kruse in 1896, to “Aerobacter aerogenes” by Kruse in 1896, and later to Enterobacter aerogenes by Hormaeche and Edwards in 1960 (RW.ERROR - Unable to find reference:766, RW.ERROR - Unable to find reference:767, RW.ERROR - Unable to find reference:765).
2
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction The widely accepted taxonomic structure of Klebsiella includes K. pneumoniae (K. pneumoniae subsp. pneumoniae, K. pneumoniae subsp. ozaenae and K. pneumoniae subsp. rhinoscleromatis); K. oxytoca; K. planticola, K. ornithinolytica, K. terrigena, and K. variicola, as indicated in Figure 1.1. Error! Reference source not found. (RW.ERROR - Unable to find reference:757, RW.ERROR - Unable to find reference:768). These Klebsiella species are categorized into three broad clusters; the K. pneumoniae cluster one (K. pneumoniae subsp. pneumoniae, K. pneumoniae subsp. ozaenae and K. pneumoniae subsp. rhinoscleramtis), K. oxytoca as cluster three while the other species (K. planticola, K. ornithinolytica, K. terrigena, and K. variicola) utilize L-sorbose as carbon source and can grow at 10⁰C, classified as cluster two. K. pneumoniae, K. ozaenae, K. rhinoscleromatis and K. oxytoca are currently the most relevant clinical species (RW.ERROR - Unable to find reference:757).
Figure 1.1 Schematic of phylogeny within the Klebsiella genus A phylogenic tree depicting Klebsiella classification Adapted from (RW.ERROR - Unable to find reference:915, RW.ERROR - Unable to find reference:824, RW.ERROR - Unable to find reference:826, RW.ERROR - Unable to find reference:757, van Aartsen, 2012)
1.1.2 Ecology and Host Range
Klebsiella is ubiquitously found in diverse environmental habitats such as soil, water and vegetation (RW.ERROR - Unable to find reference:769, RW.ERROR - Unable to find reference:770, RW.ERROR -
3
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction Unable to find reference:771, RW.ERROR - Unable to find reference:772). It contributes to the biochemical and geochemical processes of the ecosystem and acting as microflora in nonclinical settings (RW.ERROR - Unable to find reference:773, RW.ERROR - Unable to find reference:774, RW.ERROR - Unable to find reference:775, RW.ERROR - Unable to find reference:777, RW.ERROR - Unable to find reference:778). These bacteria play an essential role in the nitrogen fixation as several Klebsiella species such as K. pneumoniae, K. oxytoca or K. planticola have been isolated from the plant root surface and nodules (RW.ERROR - Unable to find reference:779, RW.ERROR - Unable to find reference:780, RW.ERROR - Unable to find reference:782, RW.ERROR - Unable to find reference:783). The interaction of human and animals with their immediate environment enhances bacteria colonization to certain parts of the body (gut, nasopharynx and mucosal membranes) as microflora. Though few environmental Klebsiella strains occasionally appear in clinical settings, most of them are mostly not as virulent as clinical Klebsiella (RW.ERROR - Unable to find reference:784, RW.ERROR - Unable to find reference:785).
Klebsiella can exist in a wide range of mammal and insect host. K. oxytica is frequently isolated from insects, such as cockroaches among others which may act as vectors for the spread of Klebsiella in hospital settings. The bacteria play a role in the synthesis of pheromone aggregation in insects (RW.ERROR - Unable to find reference:795, RW.ERROR - Unable to find reference:796, RW.ERROR - Unable to find reference:797). Klebsiella has been either isolated or implicated in the several animal host diseases, such metritis, infertility and pyothorax pus accumulation in horses, cattle (bovine mastitis and osteomyelitis originating from pulmonary lesions), snakes, crocodiles, dogs, Rhesus monkey, guinea pigs, birds, muskrats and squirrel (RW.ERROR - Unable to find reference:1299). In humans, carriage in the gastrointestinal tract is a major K. pneumoniae reservoir albeit less frequently isolated from the nasopharynx (RW.ERROR - Unable to find reference:1361). Human host interactions with Klebsiella ranges from the asymptomatic carriage in healthy individuals to opportunistic infection in immune-compromised individuals and more recently in community-acquired diseases (RW.ERROR - Unable to find reference:805, RW.ERROR - Unable to find reference:806, RW.ERROR - Unable to find reference:812, RW.ERROR - Unable to find reference:810, RW.ERROR - Unable to find reference:813, RW.ERROR - Unable to find reference:808, RW.ERROR - Unable to find reference:1361). More recently, Klebsiella is frequently isolated as the etiologic agent of community-acquired pneumonia (RW.ERROR - Unable to find reference:813, RW.ERROR - Unable to find reference:814, RW.ERROR - Unable to find reference:815, RW.ERROR - Unable to find reference:816, RW.ERROR - Unable to find reference:817, RW.ERROR - Unable to find reference:818).
4
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction 1.1.3 Isolation and Identification
Klebsiella belongs to the Enterobacteriaceae family and can be further subdivided into a range of species, including K. granulomatis, K. mobilis, K. ornithinolytica, K. oxytoca, K. planticola, K. pneumoniae, K. singaporensis, K. terrigena, K. trevisanii and K. variicola. The bacterium K. pneumoniae can be further subdivided into K. pneumoniae subsp. pneumoniae, K. pneumoniae subsp. ozaenae and K. pneumoniae subsp. Rhinoscleromatis. K. pneumoniae is closely related to several other genera within the Enterobacteriaceae family, such as Citrobacter, Escherichia, Enterobacter and Salmonella (RW.ERROR - Unable to find reference:941, RW.ERROR - Unable to find reference:784, RW.ERROR - Unable to find reference:942). Being ubiquitous organisms, Klebsiella species grow well on varieties of media such nutrient agar, tryptic casein soy agar, bro-mocresol purple lactose agar, blood agar, as well as more differential plating media for Enterobacteriaceae, such as Drigalski agar, MacConkey agar, eosin- methylene blue agar (EMB), and bromothymol blue agar. K. pneumoniae and K. oxytoca are both lactose positive with dome-shaped colonies (3-4mm) when grown overnight at 30°C or 37°C and can be mucoid. K. planticola and K. terrigena are equally lactose positive and dome-shaped colonies but with 1.5- 2.5mm diameter and weakly mucoid. Almost all Klebsiella strains grow well in minimal medium with ammonium ions or nitrate as sole nitrogen source and a carbon source without growth factor requirement. Klebsiella strains can be conserved at room temperature in meat extract semisolid agar, or at –80°C in a broth medium with 10–50% (v/v) glycerol, or freeze-dried (RW.ERROR - Unable to find reference:821, RW.ERROR - Unable to find reference:820). Before the use invention of molecular methods, Klebsiella detection was based on a combination of biochemical tests and microphysical features.
Klebsiella species can be identified based on their differential carbon source utilization alongside other biochemical tests (RW.ERROR - Unable to find reference:823, RW.ERROR - Unable to find reference:820, RW.ERROR - Unable to find reference:832, RW.ERROR - Unable to find reference:833). Generally, eight carbon sources may be sufficient to for the Klebsiella species identification, and about 18 biochemical tests are often enough for the identification of all Klebsiella species but not K. variicola (RW.ERROR - Unable to find reference:834, RW.ERROR - Unable to find reference:835). K. pneumoniae is urease and citrate positive, ferments glucose and lactose, unable to produce indole and lacks ornithine decarboxylase and motility (RW.ERROR - Unable to find reference:757, RW.ERROR - Unable to find reference:822). Apart from the inability of the K. pneumoniae subspecies to grow at 10°C or utilise L-sorbose as the sole carbon source in combination with other biochemical methods (Table 1.1), carbon assimilation, 16S rDNA and β- subunit of RNA polymerase B (rpoB) sequencing was earlier reported for the taxonomic confirmation of the genus Klebsiella (RW.ERROR - Unable to find reference:824). In the sequence analysis of 16s rDNA and rpoB, 98.2% to 99.7% and 99.4% to 100% similarity, respectively, between the three K. pneumoniae
5
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction subspecies and K. granulomatis (RW.ERROR - Unable to find reference:725, RW.ERROR - Unable to find reference:943). Molecular typing of Klebsiella is used in the identification of the clonal complexity and the possible source of Klebsiella outbreaks. Several methods, such as biotyping, serotyping, bacteriocin typing and molecular typing, are now available for the characterization of Klebsiella species other than the usual biochemical method described Table 1.1 in below. More recently, Klebsiella species can now be reliably differentiated using molecular sequencing of housing genes such as gyrA, rpoB and parC (RW.ERROR - Unable to find reference:827, RW.ERROR - Unable to find reference:824). Brisse and colleagues in 2001 and 2004, described a simple PCR method and sequencing strategy for differentiating Klebsiella species based on gyrA PCR-RFLP and 16S RNA sequencing though it can be a bit problematic in distinguishing between phylogenetic groups within K. pneumoniae and K. oxytoca (RW.ERROR - Unable to find reference:837, RW.ERROR - Unable to find reference:726, RW.ERROR - Unable to find reference:827). Ribotyping and specific polymerase chain reaction (PCR) assay targeting the pehX (involved pectin degradation) have been developed for the identification of Klebsiella species (RW.ERROR - Unable to find reference:838, RW.ERROR - Unable to find reference:827).
Table 1.1 Phenotypic characteristics of the Klebsiella species and K. pneumoniae subspecies K. pneumoniae subsp. K. oxytoca K. terrigena K. planticola K. ornithinolytica
pneumoniae ozaenae rhinoscleromatis Growth at 10 oC - - - + + + + Growth at 44.5 oC - ND ND v - - ND Motility ------Urea hydrolyzed + v - + + + + Indole - - - + - v + Ornithine decarboxylase ------+ Lysine decarboxylase + v - + + + + Voges-Proskauer + - - + + + + Malonate + - + + + + + Methyl Red - + + - + v + Urea Hydrolysed + v - + + + + Pectate hydrolysed - - - + - - - Acid from D-Melezitose - - - v + - - Acid from L-Sorbose v ND ND + + + ND Utilization of m- - - - + + - - Hydroxybenzoate
6
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction Utilization of m- v ND ND v v + ND Hydroxy-L-proline Glucose dehydrogenase + - - - - - ND without added PQQ Glucose dehydrogenase + - - + + + ND without added PQQ ONPG test + + - + + + +
Symbols and abbreviations: +, 95–100% strains positive; -, 95–100%; v, variable reactions; ND, no data; ONPG, 2-nitrophenyl-β-d- galactopyranoside and PQQ, pyrroloquinoline quinone. Adopted from (RW.ERROR - Unable to find reference:823, RW.ERROR - Unable to find reference:792, RW.ERROR - Unable to find reference:757, RW.ERROR - Unable to find reference:840).
1.1.4 Epidemiology
Klebsiella poses a complex epidemiological case as a result of its ecological persistence as well as a carriage in animal and human populations (RW.ERROR - Unable to find reference:949, RW.ERROR - Unable to find reference:806). Carriage in the human population is often associated with upper respiratory tract, urinary tract or gastrointestinal tract with a high incidence of antibiotic-resistant strains due to antibiotic therapies (RW.ERROR - Unable to find reference:950). As an opportunistic pathogen, it often infects a variety of mucosal surfaces, including lower respiratory and urinary tracts (RW.ERROR - Unable to find reference:744). Klebsiella species account for 7-14% nosocomial pneumonia, 4-15% of septicaemia, 6- 17% urinary tract infection (UTI), 2-4% wound infections, 3-20% neonatal septicaemia, 4-17% intensive care unit (ICU) infections (RW.ERROR - Unable to find reference:921, RW.ERROR - Unable to find reference:912). K. pneumoniae is widely known to cause about 56% of all Klebsiella-related nosocomial infections as well as community-acquired infections. Asymptomatic individuals and infected patients at hospitals are often the primary reservoirs for K. pneumoniae transmission (RW.ERROR - Unable to find reference:826, RW.ERROR - Unable to find reference:806, RW.ERROR - Unable to find reference:921, RW.ERROR - Unable to find reference:768). K. pneumoniae carriage in healthy individuals is considered a major reservoir for transmission and infection (RW.ERROR - Unable to find reference:870, RW.ERROR - Unable to find reference:871, RW.ERROR - Unable to find reference:806, RW.ERROR - Unable to find reference:873, RW.ERROR - Unable to find reference:875, RW.ERROR - Unable to find reference:1361). Features predisposing to K. pneumoniae or K. oxytoca nosocomial infection include extremes of age, chronic alcoholism, diabetes mellitus, chronic cardiac, renal, and pulmonary and neoplastic disease (RW.ERROR - Unable to find reference:876, RW.ERROR - Unable to find reference:877). K. pneumoniae causes both community-acquired and hospital-acquired pneumonia, urinary tract infections and septicaemia (RW.ERROR - Unable to find reference:878, RW.ERROR - Unable to find reference:912, RW.ERROR - Unable to find reference:1361). In recent times, global reports indicate a rise in community-acquired pyogenic liver abscesses (PLA) caused by K. pneumoniae with an increased burden of metastatic meningitis
7
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction and endophthalmitis (RW.ERROR - Unable to find reference:879, RW.ERROR - Unable to find reference:880, RW.ERROR - Unable to find reference:857, RW.ERROR - Unable to find reference:882, RW.ERROR - Unable to find reference:813, RW.ERROR - Unable to find reference:883, RW.ERROR - Unable to find reference:856).
In the United States, urinary tract infections (UTIs) comprise 30% of nosocomial infections, followed by pneumonia at 27%, and bloodstream infections at 19%. K. pneumoniae is responsible for about 4-8% of these cases and continually ranked in the top 5 causative agents in nosocomial and community-acquired diseases (RW.ERROR - Unable to find reference:884). In Taiwan and USA, K. pneumoniae is one of the critical emerging pathogen responsible for about 78% and 41% community-acquired liver abscess, respectively. It remains a problem in most Intensive Care Unit (ICU) acquired infections worldwide (RW.ERROR - Unable to find reference:907, RW.ERROR - Unable to find reference:906, RW.ERROR - Unable to find reference:905, RW.ERROR - Unable to find reference:883, RW.ERROR - Unable to find reference:904, RW.ERROR - Unable to find reference:903). K. pneumoniae related infection have mainly been problematic in the many Asia nations with an incidence of 1 to 21 per 1000 hospital admissions. Global point-prevalence studies reported, 6.1% to 15% nosocomial infection rates, though nosocomial infection in Asian countries range from 4% to 43% of which 45% to 65% are lower respiratory tract infection (RW.ERROR - Unable to find reference:925). Mortality rate ranged from 25% to 54% has been reported in the region (RW.ERROR - Unable to find reference:944, RW.ERROR - Unable to find reference:945, RW.ERROR - Unable to find reference:946). The United States observed more cases of nosocomial K. pneumoniae-related pneumonia than community pneumonia which accounts for only 1% of the disease (RW.ERROR - Unable to find reference:806, RW.ERROR - Unable to find reference:951, RW.ERROR - Unable to find reference:954, RW.ERROR - Unable to find reference:953). The bacteria is the fifth most prevalent nosocomial bacterial pathogen in the United States, accounting for up to 6% of all nosocomial bacterial disease (RW.ERROR - Unable to find reference:956).
Understanding nosocomial infection and the associated factors and mechanisms that contribute to the persistence of K. pneumoniae in hospitals is very paramount in the fight against K. pneumoniae related pneumonia. A matrix of environmental, bacterial and host-related factors (Figure 1.2) play a huge role the incidence of K. pneumoniae associated infections (RW.ERROR - Unable to find reference:892, RW.ERROR - Unable to find reference:923). Many patients, including ICU patients, tend to have low immunity against most opportunistic pathogens such as K. pneumoniae, Pseudomonas aeruginosa, Escherichia coli, and other bacteria, thereby making them vulnerable to disease-causing bacteria. These poor host immune factors in combination to environmental factors predispose patients to K. pneumoniae found on contaminated hospital floors, surgical tools, invasive devices, hands/gloves of staff, and
8
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction contaminated respiratory therapies (RW.ERROR - Unable to find reference:1364). Typical cases are observed in patients under antibiotic therapies that often get infected with a deadly multi-drug resistant (MDR) K. pneumoniae. Treatment of K. pneumoniae respiratory and urinary tract infections with extensive use of broad-spectrum antibiotics in hospitals sometimes results in the emergence of drugs resistant strains such as extended-spectrum β-lactamase (ESBL) and carbapenem-resistant strains (RW.ERROR - Unable to find reference:935, RW.ERROR - Unable to find reference:947). This rapid and easy acquisition of antimicrobial resistance along with the unmatched development of novel antimicrobials is posing a threat to the last lines of antimicrobial therapies (RW.ERROR - Unable to find reference:931, RW.ERROR - Unable to find reference:932, RW.ERROR - Unable to find reference:933, RW.ERROR - Unable to find reference:934). Thus, the emergence of MDR K. pneumoniae strains is limiting therapeutic options and contributing to the overall high mortality rates caused by K. pneumoniae (RW.ERROR - Unable to find reference:928, RW.ERROR - Unable to find reference:938, Bi et al, 2015, RW.ERROR - Unable to find reference:733, RW.ERROR - Unable to find reference:736). The growth and colonization of the bacterium are enhanced by a matrix of environmental factors leading to the overwhelming population of the bacteria in the defenceless host-lungs, mostly through aspiration (oropharynx and gut) or inhalation of contaminated aerosols. Homogeneous dissemination of the bacteria may also play a role in bacteraemia or the translocation bacteria from other infected organs to the lungs. The increased imbalance of the bacteria population in the host lungs overwhelms the compromised host-lung immune systems, hence leading to pneumonia caused by K. pneumoniae. Though other unknown factors may play a role pneumonia infection, the below Error! Reference source not found. attempted to summarise the widely reported factors involved in Klebsiella-related pneumonia.
9
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction
Figure 1.2 Factors associated with nosocomial bacterial pneumonia. Factors contributing to the persistence of bacteria nosocomial pneumonia in hospitals (RW.ERROR - Unable to find reference:892)
10
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction 1.1.5 K. pneumoniae
For this research, K. pneumoniae is the organism of interest among the Klebsiella species. K. pneumoniae has K and O-antigens that are of epidemiological and clinical importance (RW.ERROR - Unable to find reference:858, RW.ERROR - Unable to find reference:918, RW.ERROR - Unable to find reference:919). The bacterium has 78 serotypes for capsular polysaccharide (CPS) K-antigen types and 9 serotypes for lipopolysaccharide (LPS) O-antigen types (RW.ERROR - Unable to find reference:806).
Classification of K. pneumoniae:
Bacteria
Proteobacteria
Gammaproteobacteria
Enterobaceriales
Enterobacteriaceae
K. pneumoniae
K. pneumoniae subsp. pneumoniae
The ubiquitous K. pneumoniae (named after the 19th-century German microbiologist, Edwin Kleb) belongs to the family Enterobacteriaceae and currently remains the most frequent causative agent of both human nosocomial and community-acquired infections. It is rod-shaped and measures 2 µm by 0.5 µm. In 1882, Friedlander C. Uber first discovered Klebsiella to be a pathogen that caused pneumonia (RW.ERROR - Unable to find reference:841). The bacterium is often found as a commensal resident of the human gastrointestinal tract (RW.ERROR - Unable to find reference:843).
1.1.6 Virulence factors
In 1890, Robert Koch postulated guidelines for identifying disease-causing organisms. A century later, Stanley Falkow established the molecular version of Koch’s postulate, thereby allowing the identification of microbial genes involved in virulence. As part of investigating functional molecular mechanisms, microbial genes are inactivated, and the appropriate virulence models are then used to determine the measure of the virulence (RW.ERROR - Unable to find reference:948). K. pneumoniae, as an opportunistic pathogen has evolved several mechanisms to evade and colonize the host or environment. In the human host, one or more virulence factors associated with K. pneumoniae may play an essential role in the pathogenicity of the bacterium. A broad genetic variability of K. pneumoniae plays a role in the dramatic
11
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction differences in the virulence factors and pathogenicity of the bacterium (RW.ERROR - Unable to find reference:1017). These virulence factors include capsular polysaccharide (CPS), lipopolysaccharide (LPS) and O-antigen side chains, antibiotic resistance, siderophores and receptors, adhesins/ fimbriae, and secretion systems (RW.ERROR - Unable to find reference:744, RW.ERROR - Unable to find reference:951, RW.ERROR - Unable to find reference:730, RW.ERROR - Unable to find reference:731, RW.ERROR - Unable to find reference:738, RW.ERROR - Unable to find reference:737). indicates some of the most commonly studied virulence factors (Capsule, Lipopolysaccharide LPS and O-antigens side chain, siderophore and receptors, adhesins/ fimbriae/ pili, and Secretion system) in K. pneumoniae.
Figure 1.3 Virulence factors associated with K. pneumoniae. The above figure is a schematic depiction of reported factors (Siderophores, LPS, CPS, secretion systems, fimbriae and antibiotic resistance) known to mediate virulence in pathogenic K. pneumoniae (adapted from (RW.ERROR - Unable to find reference:806)
1.1.6.1 capsular polysaccharide Capsules from a range of pathogenic bacteria are key virulence determinants, so is the capsule of K. pneumoniae that has been implicated in the virulence of the bacteria (RW.ERROR - Unable to find reference:958, RW.ERROR - Unable to find reference:960, RW.ERROR - Unable to find reference:965). As a widely reported virulence factor, K. pneumoniae capsular polysaccharide (CPS) is an acidic polysaccharide (consisting of 3-6 repeating sugar units) that promote resistance to phagocytosis, serum killing and in some cases contribute to biofilm through multi-path interaction with surface virulence factors(RW.ERROR - Unable to find reference:962, RW.ERROR - Unable to find reference:961, RW.ERROR - Unable to find reference:964). The CPS is synthesized by the Wzy-dependent
12
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction polymerization pathway, consisting of 21-30 kb containing 16-25 gene cluster which encodes the proteins for the polymerization and assembly of CPS subunits. The 5´ terminal regions of most CPS-expressing gene clusters are conserved, and consist of galF, orf2, wzi, wza, wzb and wzc while the 3´ end regions contain a conserved gnd and mostly terminated at the ugd gene (RW.ERROR - Unable to find reference:974, RW.ERROR - Unable to find reference:975).
CPS synthesis initiates the assembly of individual sugar-repeat units and catalysed by different glycosyltransferases resulting in long chains of nascent sugar units that are transferred across the membrane by flippase Wzx for polymerization by Wzy polymerase within the periplasmic space. Subsequent polymerization and export of the CPS result in the deposition of the CPS on the bacterial surface as a result of combined action of Wza (an inner membrane tyrosine autokinase), Wzb (a protein tyrosine phosphatase) and Wzc (an integral outer membrane lipoprotein) (RW.ERROR - Unable to find reference:976, RW.ERROR - Unable to find reference:977, Li et al, 2014). Capsular magA is a crucial virulent determinant in K. pneumoniae K1-induced metastatic infections associated with capsular K1-specific Wzy polymerase but has no role in the synthesis of lipopolysaccharide (LPS) (RW.ERROR - Unable to find reference:978, RW.ERROR - Unable to find reference:979, RW.ERROR - Unable to find reference:980). Based structural variability of capsular polysaccharide, Klebsiella characteristically produces 78 capsular (K-antigens) serotypes covering the bacterial surface though they widely differ in their pathogenicity (RW.ERROR - Unable to find reference:966, RW.ERROR - Unable to find reference:967, RW.ERROR - Unable to find reference:968, Li et al, 2014). Epidemiological reports indicate that about 70% of all cases of Klebsiella bacteremia are caused by 25 different serotypes (RW.ERROR - Unable to find reference:973). Among these serotypes, K1 and K2 are mostly the predominant serotypes associated pathogenic K. pneumoniae. Several K-antigen serotypes (including predominantly K1 and K2) have a unique hypermucoviscous (hypervirulent) phenotype as a result of high production of capsule polysaccharide (CPS), grown hypermucoviscous colonies of K. pneumoniae are easily identifiable on agar plates (RW.ERROR - Unable to find reference:969, RW.ERROR - Unable to find reference:970, Li et al, 2014).
CPS is by far the most important virulence factor of K. pneumoniae that plays essential roles in resistance to phagocytosis and serum killing, suppression of early inflammatory signals, resistance to antimicrobial peptides and other environmental chemicals, inhibition of dendritic cell maturation and enhancement of biofilm formation (RW.ERROR - Unable to find reference:964, RW.ERROR - Unable to find reference:808, Sahly et al, 2004, Li et al, 2014, RW.ERROR - Unable to find reference:981, RW.ERROR - Unable to find reference:982). The primary contribution of CPS to the virulence of Klebsiella appears to serve as a protective surface layer enhancing the bacteria to evade host immune systems (RW.ERROR - Unable to find reference:964, Li et al, 2014). K. pneumoniae capsule is an important virulence factor in the
13
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction UTIs and is reported to inhibit binding to epithelial cells (RW.ERROR - Unable to find reference:1016). K1 serotype, unlike avirulent counterparts, has a unique capsular nature (extensive pyruvation of glucuronic acid and acetylation of C2-OH or C3-OH of fucose) helps the bacterium to resist macrophages or escape neutrophil-mediated intracellular killing while disseminating the bacteria to other host organs during infection (RW.ERROR - Unable to find reference:985, RW.ERROR - Unable to find reference:984, RW.ERROR - Unable to find reference:983). K. pneumoniae is considered an extracellular pathogen though other reports showed that the bacterium could be internalised by epithelial cells (RW.ERROR - Unable to find reference:992, RW.ERROR - Unable to find reference:993).
It has been demonstrated that K. pneumoniae CPS plays a role in the suppression of inflammatory signals by inhibiting of IL-8 expression through the inhibition of Toll-Like Receptor 2 (TLR2) and TLR4, and NOD1-dependent pathways (Li et al, 2014). CPS acts as a surface protective shield against the access of host-derived antimicrobial peptides, environmental chemical agents, and free release forms of CPS can trap antimicrobial polypeptides to reduce antimicrobial polypeptides reaching the bacterial surface (RW.ERROR - Unable to find reference:986, RW.ERROR - Unable to find reference:987). Also, the sub- lethal concentration of host antimicrobial peptides in airway induces the bacteria CPS production in the bacterium to protect itself against host airway antimicrobial polypeptides (RW.ERROR - Unable to find reference:987). K. pneumoniae CPS can impair dendritic cell maturation resulting in the reduction in dendritic-mediated production of pro-Th1 cytokines (IL-12 and TNF-α). Thus, leading to the functional abortion of dendritic maturation and reduction in the translocation of dendritic-mediated natural killer cells during K. pneumoniae antigen presentation (RW.ERROR - Unable to find reference:989). Some K. pneumoniae strains express a repeated sequence of dimannose or dirhamnose and are recognised by macrophage receptors for binding, ingestion and digestion (RW.ERROR - Unable to find reference:990). CPS also affects the expression of K. pneumoniae adhesins which mediate non-phagocytic cell-binding as well as surface attachment structures (e.g. fimbriae/pili for biofilm formation and exchange of genetic content) (RW.ERROR - Unable to find reference:964). The above overwhelming data demonstrate the relevance of CPS in the pathogenicity of K. pneumoniae.
1.1.6.2 Lipopolysaccharide Lipopolysaccharide (LPS) is one of the significant structural and immunodominant molecules of the outer membrane (see Figure 1.3) and contains three parts: a highly variable O-antigen as the external part of LPS; a highly conserved hydrophobic lipid A anchored in the outer membrane; and a core polysaccharide linking O-antigen with lipid A (Li et al, 2014, RW.ERROR - Unable to find reference:964). At least nine type K. pneumoniae O-antigens have been reported (O1, O2, O2ac, O3, O4, O5, O7, O8 and O12). Enzymes encoded by six members wb gene cluster (wzm, wzt, wbbM, glf, wbbN and wbbO) are responsible for the
14
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction biosynthesis of O-antigen. The most prevalent O-antigen often isolated in clinical specimens is O1, which are usually hypermucoviscous (invasive) strains, unlike the non-tissue invasive strain (Li et al, 2014).
The O-antigen of K. pneumoniae prevents complement components from reaching activators such, porins and rough LPS, thereby enhancing bacterial resistance to complement-mediated killing (RW.ERROR - Unable to find reference:994). In clinical settings, there is frequent isolation O1-serotype (known for their serum resistance) than non-O1-serotype isolates (RW.ERROR - Unable to find reference:918). A strong virulent role is reported for the O1 antigen of hypermucoviscous K. pneumoniae serotype O1:K1 through host serum resistance and enhancement of bacterial dissemination and colonization in host organs (RW.ERROR - Unable to find reference:918). A study has reported that CPS and LPS O- antigens of hypermucoviscous K. pneumoniae O1: K2 in a murine pneumonia model enhanced bacteria passage in the blood and sepsis development. CPS but not LPS O-antigen triggered the deposition of C3 on the bacterium to protects it against human macrophage- phagocytosis in the alveolar (RW.ERROR - Unable to find reference:995). The core polysaccharide of K. pneumoniae contains type 1 and type 2 core polysaccharides which are synthesized by two different 13-gene wa gene cluster (RW.ERROR - Unable to find reference:996, RW.ERROR - Unable to find reference:998, Li et al, 2014). Both wa gene clusters have similar gene sets (hldD, waaF, waaC, waaL, waaQ, wabG, wabH, orf10, waaA, waaE and coaD). While type 1 has additional wabI and wabJ which encode 3-deoxy-d-manno-octulosonic acid (Kdo) transferase and heptosyltransferase, type 2 has wabK and wabM that are involved in the of transfer of the last two outer core Glc residues (RW.ERROR - Unable to find reference:998).
Mutation of a gene within the K. pneumoniae LPS synthesis gene cluster (waaC, waaF, wabG and wabG) results in a dramatic attenuation of virulence and urinary tract colonization (RW.ERROR - Unable to find reference:999). Lipid A is synthesised by a set of constitutive enzymes through ABC transporter MsbA and hanging onto the outer membrane. K. pneumoniae lipid A modifications are enzymatically catalysed upon receiving environmental stimuli, resulting in virulence modulation in the pathogen, such change in K. pneumoniae has attenuated virulence in animal models (RW.ERROR - Unable to find reference:1013, RW.ERROR - Unable to find reference:1015). Lipid A and core polysaccharide independent of O-antigen have been reported to be involved in phagocytic resistance against alveolar macrophage and to antibacterial peptides, resulting in evasion of host immune defence (RW.ERROR - Unable to find reference:1014). Pathogenic strains of K. pneumoniae serotypes O1:K1 and O1:K2 release an aggregate of an extracellular toxic complex made of CPS, LPS, and protein that has significant tissue damages as a result of active K. pneumoniae lobar pneumonia (RW.ERROR - Unable to find reference:999, Li et al, 2014).
15
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction 1.1.6.3 Adhesins/Fimbriae K. pneumoniae encodes a vast arsenal of fimbrial and afimbrial adhesins. Fmbrial adhesin was first described in E. coli in 1950. Pili and fimbriae are interchangeably used to describe nonflagellar proteinaceous surface appendages on bacteria (RW.ERROR - Unable to find reference:1040, RW.ERROR - Unable to find reference:1038, RW.ERROR - Unable to find reference:1039). The first study on K. pneumoniae fimbriae was reported by Duguid in the late 1950s who also used haemagglutination properties to distinguish between type 1 and type 3 fimbriae (RW.ERROR - Unable to find reference:1008, RW.ERROR - Unable to find reference:1038). Type 1 fimbriae mediate mannose-sensitive hemagglutination of guinea pig red blood cells, while type 3 fimbriae mediate mannose-resistant agglutination of tannic acid-treated ox erythrocytes (RW.ERROR - Unable to find reference:1008, RW.ERROR - Unable to find reference:1038). However, the advent of whole-genome sequencing has advanced the distinction among large numbers of phenotypically uncharacterised putative fimbrial gene clusters (RW.ERROR - Unable to find reference:1041). Four classes of fimbriae have been reported; conjugative fertility (F) fimbriae, type IV fimbriae, fimbriae assembled by extracellular nucleation/precipitation pathway and fimbriae assembled by the chaperone/usher (CU) pathway (e.g. Type 1 and type 3 fimbriae) (RW.ERROR - Unable to find reference:1041).
Type 1 fimbriae agglutinate the erythrocytes of fowl or guinea pig in the absence of a-D-mannose (RW.ERROR - Unable to find reference:1019). Type 1 fimbriae have been characterized in several other Enterobacteriaceae, including K. pneumoniae (RW.ERROR - Unable to find reference:1023, RW.ERROR - Unable to find reference:1022, RW.ERROR - Unable to find reference:1021, RW.ERROR - Unable to find reference:1020). Fimbriae are principal surface appendages on K. pneumoniae that have been well described to possess a wide range of virulence role in the pathogenicity of Enterobacteriaceae. K. pneumoniae fimbriae or pili play a massive role in the attachment to abiotic and biotic surfaces. The capacity to adhere to surfaces is an essential interactive stage for the pathogen to attach, invader and cause infection in host organisms. At least four types of fimbriae are widely described experimentally; type 1 fimbriae, type 3 fimbriae, Kpc fimbriae and KPF-28 adhesin (RW.ERROR - Unable to find reference:1025, RW.ERROR - Unable to find reference:1024). Type 1 fimbriae, type 3 fimbriae and Kpc fimbriae but not KPF-28 have been reported in hypermucoviscous O1:K1 strain, K. pneumoniae NUTH-K2044 with other uncharacterized fimbrial gene loci (kpa, kpb, kpd, kpe, kpf and kpe) (RW.ERROR - Unable to find reference:1025). The fimbriae are often encoded by an operonic cluster of genes with fimbrial-related genes with other putative genes captured within the fimbrial gene cluster.
K. pneumoniae type 1 fimbriae are thin and rigid adhesive thread-like bacterial surface appendages encoded by fimBEAICDFGHK (RW.ERROR - Unable to find reference:1024). K. pneumoniae, unlike E. coli, has
16
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction a unique transcriptional regulator with an N-terminally located putative DNA-bind region that is involved in fimA transcription (RW.ERROR - Unable to find reference:1029). FimA is the major fimbria structural protein at the base of the fimbria, while FimH is the sticky adhesins at the tip of the fimbria (RW.ERROR - Unable to find reference:1028). A region of inverted repeat called fim switch (fimS) is located upstream of fimA and is responsible for K. pneumoniae type 1 fimbriae phase-variation (RW.ERROR - Unable to find reference:1024). Type 1 fimbriae fimH mediates bacterial adherence to mannose-containing structures on host cell or environment (RW.ERROR - Unable to find reference:1031), hence attachment to surfaces. Type 1 fimbria of K. pneumoniae has been implicated in the establishment of urinary tract infection but reported to play less role in intestinal or lung colonization (RW.ERROR - Unable to find reference:1024).
K. pneumoniae type 3 fimbriae encoded by mrkABCDF operon is relatively longer (0.5–2-μm) and thicker (2–4-nm wide) appendages than type 1 fimbriae. Similar to type 1 fimbriae, MrkA is the main helical fimbrial shaft. Also, MrkD is at the tip of this fimbriae and forms the adhesive subunit that binds to collagen molecules. The chaperone, usher and scaffolding proteins responsible for fimbrial assemblage and stabilization are encoded by mrkB, mrkC and mrkF, respectively (RW.ERROR - Unable to find reference:1032). Type 3 fimbriae in a mannose resistant fashion are reported to enhance in vitro attachment to epithelial cells, kidney and lungs tissues (RW.ERROR - Unable to find reference:1033). The primary function of type 3 fimbria is for biofilm formation, but with little to no role in intestinal and pulmonary infections (RW.ERROR - Unable to find reference:1024). However, most K. pneumoniae urinary tract infection is associated with K. pneumoniae biofilm formation on indwelling urinary catheters and other contaminated medical devices. In a compensative manner, both type 1 and 3 fimbriae enhance biofilm formation on a urinary catheter. Additionally, type 3 is involved in colonisation role for K. pneumoniae biofilm-associated urinary infections due to the indwelling of urinary catheters (Stahlhut et al, 2012, RW.ERROR - Unable to find reference:1035).
Other hyper mucoid K. pneumoniae strains carry Kpc fimbriae encoded by kpcABCD operon (RW.ERROR - Unable to find reference:1025). Upstream of the gene (kpcA) expressing the primary Kpc fimbria subunit is a site-specific recombinase encoded by kpcI with a kpcS promoter region, and these two genes together mediate Kpc fimbria phase variation. The Kpc fimbria in E. coli further confer higher biofilm-forming activity and believe in playing a similar role of contributing to the enhancement of K. pneumoniae biofilm (RW.ERROR - Unable to find reference:1025, Li et al, 2014). Apart from the three types of fimbriae described above, KPF-28 adhesin (a 28-kDa) is expressed by K. pneumoniae. KPF-28 adhesin is a thin and long flexible major fimbrial subunit encoded by a gene on transferable CAZ-5/SHV-4 β-lactamase encoding R plasmid (RW.ERROR - Unable to find reference:1025). A previous study indicated that K. pneumoniae expressing both CAZ-5/SHV-4 β-lactamase and KPF-28 fimbriae were often detected in hospitals in
17
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction Clermont-Ferrand of France (RW.ERROR - Unable to find reference:1037). Adherence to human Caco-2 cell lines was reported for KPF-28 fimbriae expression K. pneumoniae. Thus, these plasmid-mediated expressed fimbriae play a role in mammalian intestinal colonisation (RW.ERROR - Unable to find reference:1036, Li et al, 2014). Hence, the K. pneumoniae surface adhesins are vastly involved in biofilm formation and adherence to host cells, thereby enhancing the pathogenicity of the bacterium cannot be overemphasised.
1.1.6.4 Iron Acquisition / Siderophores Bacteria require an iron supply for both in vitro and in vivo growth; hence the growth of bacteria in host organism is not only limited by host defence system but also the availability of iron to the bacteria (RW.ERROR - Unable to find reference:1043). Living organisms, including host organisms, require an iron supply for proper growth (RW.ERROR - Unable to find reference:806). Thus, free iron supply is rarely available for bacteria in the host, because the irons are bounded to host carrier proteins (haemoglobin, ferritin, hemosiderin, myoglobin, lactoferrin and transferrin). The iron acts as a redox catalyst in oxygen and electron transport processes (RW.ERROR - Unable to find reference:1044, RW.ERROR - Unable to find reference:1045), thus limiting the availability of irons for bacteria. Availability of free irons for bacteria in the host during specific human pathologies (physiology post-chemotherapy and haemochromatosis) means many pathogens can take advantage of the iron availability to cause significant morbidity and mortality on top of the underlying disorder (RW.ERROR - Unable to find reference:1048, RW.ERROR - Unable to find reference:1047). However, K. pneumoniae, including other bacteria secrete high-affinity, low-molecular-weight iron chelators called siderophores used in the competitive sequestration of iron from host molecules (RW.ERROR - Unable to find reference:806, RW.ERROR - Unable to find reference:1050).
Under iron-limiting conditions, K. pneumoniae is reported to produce between four and six outer membrane proteins, which to play a role in iron acquisition (RW.ERROR - Unable to find reference:1053). K. pneumoniae secrete siderophores that are specific for ferric iron uptake in bacteria (RW.ERROR - Unable to find reference:1051). Aerobactin, enterobactin (also known as enterochelin) and yersiniabactin are common iron chelators secreted by many K. pneumoniae strains that sequester iron from host carrier molecules due to their high affinity (RW.ERROR - Unable to find reference:1055, RW.ERROR - Unable to find reference:1054). Cell-specific receptors recognise iron-siderophore complexes and transport them through TonB- dependent receptors for iron dissociation to be made available for bacteria usage (RW.ERROR - Unable to find reference:1056). Iron-siderophore complexes are recognised by cell-specific receptors and are transported into the cell via TonB dependent receptors, where the iron dissociates and is made available for use by the bacterium (RW.ERROR - Unable to find reference:1056, van Aartsen, 2012). In addition to yersiniabactin and aerobactin, at least twelve other putative iron uptake systems have been
18
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction described in K. pneumoniae NTUH-K2044 classified into four groups; Fe2+ transporter Feo, ABC transporter, hemophore-based uptake systems and siderophore-based uptake systems (Li et al, 2014). Of these twelve, seven are TonB-dependent and shown to be required for the full virulence of K. pneumoniae; two are ABC transporters (Kfu and Sit), three are siderophore-based systems (Yersinia high-pathogenicity island), Iuc and IroA. (RW.ERROR - Unable to find reference:1058, RW.ERROR - Unable to find reference:1052, RW.ERROR - Unable to find reference:1061, RW.ERROR - Unable to find reference:1060, RW.ERROR - Unable to find reference:1059, Li et al, 2014).
A study demonstrated that when siderophore gene from a K. pneumoniae strain was cloned into a plasmid and expressed in an avirulent non-siderophore producing K. pneumoniae (strain), it further enhanced the growth of the bacterium in the host tissues (RW.ERROR - Unable to find reference:1051, RW.ERROR - Unable to find reference:1052), suggesting the role siderophores play in the growth and survival of K. pneumoniae in the iron-deficient environment. K. pneumoniae propensity to cause infection was significantly increased when the guinea pig was supplemented with iron parenterally (RW.ERROR - Unable to find reference:806). Another study demonstrated the virulent role of hydroxamate-type aerobactin in K. pneumoniae (RW.ERROR - Unable to find reference:1052). K. pneumoniae NTUH-K2044 tonB mutant reported to have shown attenuated virulence relative to the wild-type, hence reiterating the importance of siderophores in K. pneumoniae pathogenesis (RW.ERROR - Unable to find reference:1058). Enterobactin is produced more often by many K. pneumoniae strains and reported to have an additional advantage of higher affinity for iron than aerobactin. Hence a better candidate for sequestering iron from host carrier molecules such as transferrin unlike aerobactin iron source sequestered from is host cells (RW.ERROR - Unable to find reference:806, RW.ERROR - Unable to find reference:1057). However, it speculated that the production both siderophores, enterobactin and aerobactin, will provide a dual iron source for K. pneumoniae, thereby enhancing the virulence of the bacterium.
1.1.6.5 Other Virulence factors In addition to the above-discussed virulence factors, other factors associated with the virulence of K. pneumoniae include nitrogen source utilization (urease and allantoin metabolism), outer membrane protein (OmpA, outer membrane porins and efflux), and antibiotic resistance (to beta-lactam, quinolones, aminoglycosides) are reported to play a considerable role in bacterial virulence (RW.ERROR - Unable to find reference:1062, RW.ERROR - Unable to find reference:1063, Li et al, 2014). Many gut pathogens, including K. pneumoniae, can hydrolyze urea to ammonia and carbon dioxide as a nitrogen source for growth by using cytoplasmic urease encoded by ureDABCEFG operon (RW.ERROR - Unable to find reference:1065). Allantoin metabolism is noted in hypervirulent K. pneumoniae and is reported to induce K. pneumoniae associated liver infection such as primary liver abscesses in diabetic patients with increase
19
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction allantoin concentration (RW.ERROR - Unable to find reference:1017). The allantoin utilization phenotype described in hypervirulent K. pneumoniae elevates its capability to compete for allantoin as a nitrogen source in mammalian hosts (RW.ERROR - Unable to find reference:1067). However, K. pneumoniae have a symbiotic association with plant roots where the bacterium can fix nitrogen into the soil for plant use. The colonization of plant roots is aided by a combination of factor including fimbriae for attachment and secretion systems for delivery of toxins.
Outer membrane proteins (e,g OmpA) is conserved in Enterobacteriaceae and reported to play a role in the virulence of K. pneumoniae. A study said that lack of K. pneumoniae CPS is not enough to attenuate airway epithelial cell-mediated inflammatory response. Rather, K. pneumoniae OmpA is known to be involved in the inhibition of airways epithelial cell activation by acting on NF-κB-, p38- and p44/42-dependent pathways, and contributes to resistance to alveolar macrophage phagocytosis (RW.ERROR - Unable to find reference:1069, RW.ERROR - Unable to find reference:1071, RW.ERROR - Unable to find reference:1070). The absence of OmpA renders K. pneumoniae susceptible to antimicrobial peptides but has no effect on the CPS production (RW.ERROR - Unable to find reference:1075). OmpK35 and OmpK36 are two main outer membrane porins of K. pneumoniae through which hydrophilic molecules enter the bacterium (RW.ERROR - Unable to find reference:1072) even though alternative porins such as KpnO and OmpK26 are alternative in the absence of OmpK35/36 (RW.ERROR - Unable to find reference:1073, RW.ERROR - Unable to find reference:1074). Increased resistance to cephalosporins/carbapenems and attenuated virulence in the mouse model was observed in the absence of OmpK36, KpnO or OmpK26 while lack of OmpK35 showed no effect on antibiotic resistance and virulence (RW.ERROR - Unable to find reference:1069, Li et al, 2014, RW.ERROR - Unable to find reference:1072, RW.ERROR - Unable to find reference:1073, RW.ERROR - Unable to find reference:1074). Absence of OmpK36 affects K. pneumoniae surface structure altering the bacterium binding ability to phagocytic cells resulting in enhancing susceptibility to phagocytosis and attenuated virulence (RW.ERROR - Unable to find reference:1069). Also, efflux pumps (AcrAB) expressed in K. pneumoniae contribute to the export of antimicrobials agents, hence determinant of K. pneumoniae resistance to host (Li et al, 2014).
1.2 Antibiotic resistance and virulence association
Antibiotic resistance is one of the major problems encountered by most medical facilities globally. Development of antibiotic resistance by pathogenic bacteria since the discovery of antibiotics has now out- run the discovery of new antibiotics and antibacterial therapies for solving the problem posed by these resistant pathogenic bacteria. With a range of antimicrobial resistance and virulence factors in K. pneumoniae strains with different phylogenetic background, the relationship between resistance and 20
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction virulence is a complex issue than often reported, hence require elucidation. The main aim of this section of the chapter is to discuss how the association between antimicrobial resistance and virulence in K. pneumoniae strains play a crucial role in pathogenicity. Despite the different evolutionary timescale, pathogenic bacteria have competitively evolved through the combination of virulence and antibiotic resistance with the sole aim of survival and persistence in the host/ environment. Hypervirulent bacteria pose a significant health problem globally. More so, this is compounded by the emergence of antibiotic resistance, which is threatening the treatments of many pathogens in many hospitals. Virulence and antibiotic resistance may play independent or dependent roles during infection. However, these two determinants share some characteristics; (i) both are necessary for bacteria survival under adverse conditions, (ii) horizontal gene transfer (HGT) is essential in the transmission of both determinants, but compensatory/ adaptive mutations may also be involved, (iii) antibiotic resistance is related to virulence since the earlier is often associated with infection, (iv) both processes often have direct involvement of efflux pumps, porins, cell wall alterations, and two-component systems that activate or repress the expression of various resistance and virulence-related genes (RW.ERROR - Unable to find reference:1076, RW.ERROR - Unable to find reference:1077, RW.ERROR - Unable to find reference:1072, RW.ERROR - Unable to find reference:1084, RW.ERROR - Unable to find reference:1085).
K. pneumoniae is part of the ESKAPE group (Enterococcus faecium, Staphylococcus aureus, K. pneumoniae, A. baumannii, P. aeruginosa, and Enterobacter species) that are responsible for most nosocomial and community-acquired infections (RW.ERROR - Unable to find reference:1080). K. pneumoniae has a highly plastic genome with ease in losing or gaining genomic segments by lateral gene transfer (RW.ERROR - Unable to find reference:1077, RW.ERROR - Unable to find reference:1081). Hypervirulent K. pneumoniae (hvKP) isolates belonging to K1, and K2 serotypes are the two major strains often involved in infection (RW.ERROR - Unable to find reference:742). The increasing association of virulence and antibiotic resistance is becoming more beneficial to a lot of pathogenic bacteria, including K. pneumoniae. Also, antibiotic resistance may come with a fitness cost to K. pneumoniae; this is reported to reduce the competitive ability of the bacterium in the absence of antibiotics. Deletion or mutations in chromosomic genes involved in antimicrobial resistance (e.g., porins) lead to a fitness cost. However, this fitness cost is lower for the deletion of plasmid acquired antibiotic resistance (RW.ERROR - Unable to find reference:1082, RW.ERROR - Unable to find reference:1081, RW.ERROR - Unable to find reference:742). In Bejing over a period a decade and a half, multidrug-resistant (MDR), extensively drug- resistant(XDR), and pan-drug-resistant (PDR) K. pneumoniae isolate have risen to 61.4 %, 22 %, and 1.8 % respectively (RW.ERROR - Unable to find reference:742, RW.ERROR - Unable to find reference:1079). As discussed above, CPS, LPS, fimbriae, and siderophores and efflux are the main virulence factors of K. pneumoniae. They seem to be at the centre of classical pathogenesis (RW.ERROR - Unable to find 21
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction reference:806), though other factors such as secretion system as discussed in subsequent sections of this thesis participate in bacterial virulence as well. K. pneumoniae rapidly acquire resistance to traditional and new antimicrobial drugs, including resistance to beta-lactams, quinolones and aminoglycosides.
Resistance to beta-lactams: β-Lactam antibiotics are the largest class of antibiotics and are the most widely used antibiotics. These class of antibiotics usually have a β-lactam ring in their molecular structure (penicillins, cephalosporins, monobactams, carbapenems, and β-lactamase inhibitors). Expression of β- lactamases, alteration of permeability and efflux pump are the primary mechanism used by K. pneumoniae to escape β-lactam antibiotics. At the end of 1980s plasmid encoding, extended-spectrum β lactamases (ESBL) was noted to hydrolyze oxyimino-cephalosporins (RW.ERROR - Unable to find reference:1087). But CTX-M changed the game by remaining dominant in ESBLs with CTX-M-15 as observed in hypervirulent and resistant K. pneumoniae strains. Thus, conferring resistance against penicillins, first-, second-, and third generation cephalosporins, and aztreonam. ESBLs are inhibited by β-lactamase inhibitors and remain inactive against cefoxitin and carbapenems (RW.ERROR - Unable to find reference:742).
It has been reported that K. pneumoniae sometime acquire adhesins or potential virulence regulators during ESBL acquisition (e.g. adhesin CF29K, aerobactin, and mucoid phenotype, now associated with RmpA) thereby correlating with increased pathogenicity of the bacterium (Bi et al, 2015, RW.ERROR - Unable to find reference:1086, RW.ERROR - Unable to find reference:742). Recent studies have indicated that R-plasmids encoding a non-fimbrial protein (CF29K) and 28-kDa fimbrial protein (KPF- 28) (RW.ERROR - Unable to find reference:1036) aided the adherence of the Caco-2 cells to siderophores and ESBL expressing K. pneumoniae strains (RW.ERROR - Unable to find reference:1088, RW.ERROR - Unable to find reference:1089). Another study observed an increase in localized adhesion pattern, upregulation of type 3 fimbriae expression and invasion process in ESBL-producing (SHV-4 and SHV-12 β-lactamases) K. pneumoniae, suggesting the interplay of these factors as markers of pathogenicity (RW.ERROR - Unable to find reference:1091, RW.ERROR - Unable to find reference:1092). Hypermucoviscosity is more commonly associated with SHV- and TEM-type than with CTX-M-type ESBLs-producing K. pneumoniae strains but in most cases harmful for RmpA or RmpA2 (RW.ERROR - Unable to find reference:1086, RW.ERROR - Unable to find reference:1094). Plasmids encoding CTX-M-15 have been demonstrated to end up in strains with different genetic backgrounds, posing variable virulence though both could cause outbreaks without any fitness cost (RW.ERROR - Unable to find reference:1095). Strains carrying plasmids encoding CTX-M-15 belong to clonal complex 23 and therefore present worrying concerns as the clone are associated with hypervirulent traits and multidrug resistance (RW.ERROR - Unable to find reference:742).
22
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction Carbapenemases hydrolyze all cephalosporins and aztreonam, OXA-type carbapenemases in K. pneumoniae are only active against first-generation cephalosporins, cefotaxime, ceftriaxone, and cefepime, but not ceftazidime and aztreonam (RW.ERROR - Unable to find reference:1101). While plasmid encoding KPC-2 is the most common, KPC variants (KPC-2 to KPC-12) differ by a few amino acids changes (RW.ERROR - Unable to find reference:1098). They have rapidly spread due to their broad-host-range conjugative plasmids. Delhi metallo-beta-lactamase-1 (blaNMD) and blaOXA48 (OXA-48) have been reported in hypervirulent K. pneumoniae. The explanation for the epidemiological success of KPC strains remains unclear (RW.ERROR - Unable to find reference:1103, RW.ERROR - Unable to find reference:1102, RW.ERROR - Unable to find reference:1101). Few studies have examined the fitness cost of carbapenemase-producing K. pneumoniae strains when the kpc gene is inactivated. A study of OXA-48 producing K. pneumoniae strains demonstrated no particular trait of virulence (RW.ERROR - Unable to find reference:1096) while NDM-1-producing strain was virulent and possessed several virulence factors such as capsular serotype K2, enhanced biofilm formation, and human and murine serum resistance (RW.ERROR - Unable to find reference:743). Other studies using Caenorhabditis elegans and Galleria mellonella models demonstrated that KPC isolates showed decreased virulence compared to non-producing carbapenemase strain (RW.ERROR - Unable to find reference:1098, RW.ERROR - Unable to find reference:1099). In light of these observations, the success of these strains does not seem to be linked to their particular virulence.
Apart from K. pneumoniae outer membrane proteins (OmpA, OmpK35, OmpK36) contributing to phagocytic resistance, Ompk36, unlike OmpA, does not play a role in antimicrobial peptides resistance. In contrast to OmpK36, OmpA does not play any role in antibiotic resistance (RW.ERROR - Unable to find reference:1069). In K. pneumoniae strains producing ESBLs, OmpK35 and OmpK36 but the absence of OmpK36 often result in the strain virulence impairment (RW.ERROR - Unable to find reference:1072, RW.ERROR - Unable to find reference:1104). Bacteria usually sacrifice one or more protein to survive in an antibiotic environment resulting in the biological cost of acquiring antibiotic resistance via mutations (RW.ERROR - Unable to find reference:742). The expression of efflux pumps has been demonstrated to correlate with virulence. The expression AcrAB multidrug efflux system enhances resistance against lungs antimicrobial peptides and antibiotics (quinolones, cefoxitin, chloramphenicol, erythromycin, tigecycline) (RW.ERROR - Unable to find reference:1106, RW.ERROR - Unable to find reference:1107) and OqxAB, for resistance to nalidixic acid, ciprofloxacin, chloramphenicol, and cefoxitin (RW.ERROR - Unable to find reference:1108, RW.ERROR - Unable to find reference:1109). K. pneumoniae resistance nodulation– cell division (RND)-type efflux pump contributes to multidrug resistance still under study (RW.ERROR - Unable to find reference:1111).
23
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction Several mechanisms are available for the resistance of fluoroquinolones, such as plasmid induced resistance, inhibition of quinolone uptake due to overexpressed efflux, altered permeability due to porin loss, and mutations in quinolone resistance-determining regions of gyrase and topoisomerase (gyrA and parC respectively) (RW.ERROR - Unable to find reference:1118). A study reported 3.9% prevalence of qnr genes in K. pneumoniae isolates from blood specimens in Taiwan (RW.ERROR - Unable to find reference:1113) while another reported a strong link between fluoroquinolone resistance and fitness (RW.ERROR - Unable to find reference:1114). Another study suggests that this may be due to efflux activity rather than amino acid substitutional mutations in quinolones resistance regions (RW.ERROR - Unable to find reference:742).
Colistin interacts with lipid A resulting in the outer membrane disruption (RW.ERROR - Unable to find reference:1115) by modifying the LPS following the addition of 4-amino-4-deoxy-L-arabinose to lipid A associated with pbgPE operon modification (RW.ERROR - Unable to find reference:1116). A study showed that a hypervirulent K. pneumoniae ST23 resistant to colistin resulted in in vitro fitness defect and defect in hypermucoviscous, CPS production and serum resistance (RW.ERROR - Unable to find reference:1117).
In summary, the most commons mechanism of resistance in K. pneumoniae is through enzyme synthesis, especially β-lactamases (ESBLs), cephalosporinases, and carbapenemases. Resistance against β-lactams is plasmid-mediated though they often carry some other gene associated with virulence. Consequently, the acquisition of these plasmids by K. pneumoniae increased its virulence potential. In recent times, plasmid- mediated CTX-M-type ESBLs and carbapenemases (KPC) have become a primary concern. However, the plasmid-expressing enzymes do not seem to have any fitness cost, and these K. pneumoniae strains are usually less virulent. In light of the ongoing discussion, neither antibiotic resistance or virulence in K. pneumoniae is better over the other. It is, however, very important to state that their existence is of importance either way and contributes to the survival of the opportunistic pathogen in the human host. In a nutshell, antibiotic resistance tends to go hand-in-hand with the virulence of K. pneumoniae, and this ultimately raises the threat level of the bacterium in infections.
As reported in this thesis, the role of the recently discovered bacterial T6SS as a putative virulence factor in clinical hypervirulent K. pneumoniae HS11286 and NTUH-K2044 was examined to understand better how T6SS contributed to the overall virulence of K. pneumoniae. But as means to an end, an antibiotic resistance “disarmed” version of K. pneumoniae HS11286 was first created for safe laboratory use and to serve as the parent strain for the T6SS virulence role study. Also, reported is the fitness cost of the antibiotic resistance on the MDR K. pneumoniae HS11286 after deleting the antibiotic resistance genes. Thus, this research throws more lights on antibiotic resistance and virulence and how the acquisition of these factors
24
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction shape the genome of MDR K. pneumoniae while specifically elucidating the virulent role of putative K. pneumoniae T6SS gene clusters.
1.3 Secretion systems
Bacterial pathogens utilize diverse ways to survive in abiotic environments competitively or to thwart the host immune system and to cause damage to host tissue during infection. One of the essential mechanisms is via bacteria secretion systems used for the secretion of protein and other molecules across phospholipid membranes. Bacterial secretion systems are dedicated protein secretion systems widely reported to secret virulence factor from the cytosol of the bacteria into the extracellular milieu (RW.ERROR - Unable to find reference:1145, RW.ERROR - Unable to find reference:1123). The secreted proteins through these systems play many roles in promoting bacterial virulence ranging from attachment to abiotic and host cell surfaces to releasing of toxins into target cells, to functional disruption hosts immune system, to environmental resource scavenging, promotion of horizontal gene transfer of genetic content known for antibiotic resistance and virulence (RW.ERROR - Unable to find reference:1123). Bacteria secretion apparatuses differ types based on their structures, functions, and specificity. Based on the type of protein secretion system (see Table 1.2 and Figure 1.4), the secreted protein is translocated across a single phospholipid membrane, two membranes, or even three membranes including the target cell. Understanding of bacterial protein secretion system creates a huge potential of developing antimicrobials in this era of bacterial multidrug resistance. Not until 2006, the Gram-negative bacteria secretion systems were characterized into five types; Type I secretion system (T1SS), Type II secretion system (T2SS), Type III secretion system (T3SS), Type IV secretion system (T4SS) and Type V secretion system (T5SS). The importance of these dedicated secretion systems is discussed with regards to the promotion of virulence or survival in the bacteria niche. Therefore, elucidating protein secretion systems has a significant bearing on the field of bacterial pathogenesis, especially Enterobacteriaceae.
25
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction Table 1.2 Features of bacterial secretion system Secretion Signal Steps-in Folded Membranes Gram K. pneumoniae secretion Substrate (-) / (+) Sec N-terminal 1 No 1 Both yes
Tat N-terminal 1 Yes 1 Both yes
T1SS C-terminal 1 No 2 (-) yes
T2SS N-terminal 2 Yes 1 (-) yes
T3SS N-terminal 1 to 2 No 2-3 (-) Unknown
T4SS C-terminal 1 No 2-3 (-) yes
T5SS N-terminal 2 No 1 (-) Unknown
T6SS Unknown 1 Unknown 2-3 (-) yes
A summary of bacterial protein secretion system (T1SS, T2SS, T3SS, T4SS, T5SS, T6SS)
Apart from secretion systems, bacteria, archaea, and eukaryote also use a more conserved general secretion (Sec) and twin-arginine pathways to exported substrates into the periplasm and across the cytoplasmic membrane (RW.ERROR - Unable to find reference:1119, RW.ERROR - Unable to find reference:1120, RW.ERROR - Unable to find reference:1121). The Sec pathway has three parts (a protein targeting component, a motor protein, and a membrane-integrated conducting channel, called the SecYEG translocase) and primarily transport unfolded proteins (RW.ERROR - Unable to find reference:1120). K. pneumoniae, among other pathogens, are Sec-dependent in the transportation of several secreted proteins (with hydrophobic N-terminal signal sequence) that are involved in the promotion of virulence (RW.ERROR - Unable to find reference:1122). While proteins destined for the periplasm or outside of the cell by the Sec pathway contain SecB-specific signal sequences, proteins meant to remain in the inner membrane contain a signal recognition particle (SRP)-specific signal sequence (RW.ERROR - Unable to find reference:1123). The Tat secretion pathway N-terminal motif rich in basic amino acid residues (S-R- R-x-F-L-K) of large co-factor containing proteins and uses proton gradient energy to translocates the unfolded proteins (RW.ERROR - Unable to find reference:1124). The Tat pathway consists of TatA, TatB, and TatC where Gram-negative bacteria such as E. coli TatB and TatC bind to Tat-secreted proteins signal peptide to recruit TatA, thereby forming the membrane-spanning channel (RW.ERROR - Unable to find reference:1124, RW.ERROR - Unable to find reference:1125). Tat-secreted proteins in Gram-negative bacteria either remain in the periplasm or are TSS2-exported. Several Gram-negative bacteria (including P. aeruginosa, Yersinia pseudotuberculosis, and E. coli O157: H7) require a functional Tat secretion system for virulence in animal models (RW.ERROR - Unable to find reference:1126, RW.ERROR - Unable to find reference:1127, RW.ERROR - Unable to find reference:1128). A substrate such as phospholipase C is
26
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction one of such virulence proteolytic enzyme secreted by the Tat-pathway of P. aeruginosa (RW.ERROR - Unable to find reference:1126), Legionella pneumophila (RW.ERROR - Unable to find reference:1129) and Mycobacterium tuberculosis (RW.ERROR - Unable to find reference:1130) that can lead to the suppression of immune cell activity and promotion of intracellular survival during infection (RW.ERROR - Unable to find reference:1131).
Figure 1.4 Protein secretion systems in Gram-Negative bacteria. Various type of protein secretion systems in Gram-Negative bacteria (T1SS, T2SS, T3SS, T4SS, T5SS and T6SS).
1.3.1 The Type I Secretion System (T1SS)
T1SSs is a transmembrane Sec-independent system described in many Gram-negative bacteria of plant and animal origins where exportation of substrates into the external milieu of the cell is achieved in a single step (Figure 1.4) (RW.ERROR - Unable to find reference:1132). T1SS resemble ATP-binding cassette transporter and exports unfolded small molecules (such as antibiotics, digestive enzymes and toxins) and proteins with repeats-in-toxins (RTX) motifs. These substrates play a crucial role in the virulence and survival of the bacteria (RW.ERROR - Unable to find reference:1133, RW.ERROR - Unable to find reference:1134). Most of these substrates are without a C-terminal sequence and remain uncleaved even after being exported (RW.ERROR - Unable to find reference:1123). The three essential structural units of T1SS include ABC transporter protein in the inner membrane, a membrane fusion protein (MFP) that crosses the inner membrane and linking the third part, the outer membrane factor (OMF) in the outer membrane (RW.ERROR - Unable to find reference:1132). ABC transporters generate energy for the system, MFP links ABC to the OMF across the periplasm as well select substrate using its cytoplasmic- located N-terminus (RW.ERROR - Unable to find reference:1123) while the OMF forms an outer membrane pore for substrate release (RW.ERROR - Unable to find reference:1135). T1SS ABC
27
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction transporters may contain C39- peptidase (C39 peptidase domain is Colicin V of E. coli) (RW.ERROR - Unable to find reference:1136) for recognition and cleavage of N-termini, non-proteolytic C39-like peptidase domains (CLD) (RW.ERROR - Unable to find reference:1138) and non-N-terminal ABC transporters with C-terminal that may or may not have Rtx domain (RW.ERROR - Unable to find reference:1134).
T1SS has been reported in the secreting of V. cholera MARTX toxin (RW.ERROR - Unable to find reference:1139) and Serratia marcescens hemophore HasA (RW.ERROR - Unable to find reference:1140), and uropathogenic E. coli HlyA hemolysin protein (RW.ERROR - Unable to find reference:1123). These secreted toxins rapture host erythrocytes, nucleated eukaryotic cells, and damaging mucosal barriers and effector immune cells (RW.ERROR - Unable to find reference:1123). Recent studies showed that T1SS is involved in plant-bacteria association, (RW.ERROR - Unable to find reference:1134) as observed in rice pathogen Xanthomonas oryzae pv. oryzae that use T1SS complex to express AvrXa21 which is sensed by plant host (RW.ERROR - Unable to find reference:1141) while other studies reported metalloproteases, adhesions and glycanases secreted by the T1SS in Agrobacterium tumefaciens, P. syringae pv tomato, Ralstonia solanacearum, Xanthomonas axonopodis pv. citri and Xylella fastidiosa are avirulent to plants (RW.ERROR - Unable to find reference:1134, RW.ERROR - Unable to find reference:1142). Putative T1SS has been identified in K. pneumoniae though its role in the bacterium is unclear (RW.ERROR - Unable to find reference:1143).
1.3.2 The Type II Secretion System (T2SS)
Type II secretion systems are conserved in most Gram-negative bacteria, where they transport folded proteins from the periplasm into the extracellular environment. As shown in Figure 1.4, T2SS forms channel only in the outer membrane, where Sec or Tat-dependent proteins in the periplasm are export across the outer membrane (RW.ERROR - Unable to find reference:1122, RW.ERROR - Unable to find reference:1146). T2SS destined substrates must first have cleavable N-terminal signal sequence to enable it through Sec-Tat transporters before reaching T2SS (RW.ERROR - Unable to find reference:1122). T2SS folds and export the periplasmic unfolded proteins brought in by the Sec-transporters (RW.ERROR - Unable to find reference:1147). In some bacteria, T2SS secrete and export single protein or a wide range of substrates (proteases, lipases, and phosphatases and several carbohydrates-processing proteins) which contribute to the virulence of pathogens (RW.ERROR - Unable to find reference:1122, RW.ERROR - Unable to find reference:1148). T2SS apparatus has at least 15 different proteins that are grouped into four subassemblies; the outer-membrane complex, the inner-membrane platform, the secretion ATPase, and the
28
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction pseudopilus. The outer membrane complex has a multimeric protein called secretin that usually have a long N-terminus extend across the periplasm to touch the inner membrane (RW.ERROR - Unable to find reference:1147). The inner membrane platform is made of multiple copies of at least four proteins, is embedded in the inner membrane and extending across the periplasm to connect with the secretin, thereby communicating with the secretin, pseudopilus, and the cytoplasmic ATPase to coordinate the export of substrates (RW.ERROR - Unable to find reference:1122). T2SS inner membrane component is not involved in substrate transport into the periplasm. Instead, it serves as the anchoring platform for the rest of the system. T2SS pseudopilus is structurally like T4SS on bacterial cell surfaces suggesting evolutional relatedness (RW.ERROR - Unable to find reference:1149). Protein substrates interact with periplasmic secretin domain to stimulate ATPase dependent retraction of T2SS pseudopilus to expel proteins substrates through the outer membrane secretin channel (RW.ERROR - Unable to find reference:1122, RW.ERROR - Unable to find reference:1151, RW.ERROR - Unable to find reference:1150). T2SS is deployed by a large number of pathogens in transporting virulence factors outside the cell as observed in cholera toxin of Vibrio cholerae (RW.ERROR - Unable to find reference:1153), exotoxin A of P. aeruginosa (RW.ERROR - Unable to find reference:1160), ADP-ribosylating toxins of enterotoxigenic and enterohemorrhagic E. coli (RW.ERROR - Unable to find reference:1154, RW.ERROR - Unable to find reference:1155, RW.ERROR - Unable to find reference:1156), L. pneumophila (RW.ERROR - Unable to find reference:1157), K. pneumoniae (RW.ERROR - Unable to find reference:1162, RW.ERROR - Unable to find reference:1161), Aeromonas hydrophila (RW.ERROR - Unable to find reference:1158), and Dickeya dadantii (RW.ERROR - Unable to find reference:1159).
1.3.3 Type III secretion system (T3SS)
T3SSs are needle-like injectisome/ syringe secreting a wide variety of effector proteins across the cytoplasmic membranes into target cells in a single step (Figure 1.4) and appears to have a common evolutionary origin with the flagellum (RW.ERROR - Unable to find reference:1166). The primary function of the system is to release effector proteins across the bacterial and host membranes into the cytosol of host cells, modulating a wide range of cell functions (immune and defence responses) (reviewed in (Grant et al., 2006; Mota and Cornelis, 2005; Lindeberg et al., 2009). The effector proteins carry an embedded N- terminal secretion signal though they are not usually cleaved. T3SS has nine conserved core proteins and 10 to 20 accessory proteins for the secretion of unfolded effectors that are chaperone-guided to the T3SS base in an ATP-dependent manner (Abrusci et al., 2014; Burkinshaw and Strynadka, 2014). They share 8 of these proteins with the flagellar apparatus found in many bacteria and are evolutionarily related to flagellin (Troisfontaines and Cornelis, 2005). Pathogenicity islands in bacterial chromosome or plasmid may also carry few operons of T3SS encoding structural components. While the T3SS needle forms an
29
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction inner hollow core enough for unfolded effector to traverse (Deane et al., 2006; Demers et al., 2014), the outer residing T3SS needle tip complex is critical for sensing contact with target cells to insert into the target cell membrane for the release of secreted effectors (Price et al., 1991; Picking et al., 2005; Holmström et al., 2001). The translocon does not secrete effectors into the external milieu of the bacterium, instead provides passage for effectors by forming a pore through the target cell membrane (Price et al., 1991; Hakansson et al., 1993; Hakansson et al., 1996).
T3SS are acquired typically by horizontal transfer, and evolutionarily distant groups may have similar T3SSs. Although the genomes similarity between of Shigella and E. coli, the Shigella T3SS is more similar to the Salmonella T3SS than it is to T3SSs found in the E. coli pathogens EHEC and EPEC (Troisfontaines and Cornelis, 2005). Most T3SSs are comprised of at least 15 proteins (Abrusci et al., 2014; Burkinshaw and Strynadka, 2014) grouped into three main components: a base complex or basal body (transmembrane and cytoplasmic components), the needle component, and the translocon (Abrusci et al., 2014). The basal complex forms socket-like rings with a central needle rod-like filament extending through the secretin and into the extracellular space (Kubori et al., 1998). Yersinia, Salmonella, and Shigella T3SSs translocate effectors into host cells with virulence consequences (Buttner, 2012) such as remodelling of regular host cellular functions to enable survival in the host cell (Green and Mecsas, 2016). Though the earlier report of T3SS was in pathogenic bacteria, T3SS is known to be present in rhizobial nitrogen-fixing mutualists of plants, in the tsetse fly mutualist, Sodalis glossinidius, in the nematode mutualist, Photorhabdus luminescens and the human commensal Pantoea agglomerans (Tseng, Tyler and Setubal, 2009; Cornelis, 2006). Plant pathogenic bacterial T3SS has two family proteins (Hrp1 and Hrp2). In contrast, the rhizobial bacteria T3SS possess a third family though other bacteria may harbour multiple T3SS in the same genome (e.g. SPI-1 and SPI-2 of Salmonella typhimurium) (reviewed in (Tseng, Tyler and Setubal, 2009).
1.3.4 Type IV secretion system (T4SS)
T4SSs are transmembrane secretion system and unique in a sense that, they translocate nucleic acid (DNA) by conjugation in addition to protein effectors (Figure 1.5) across the cytoplasmic membrane of the target cell (bacteria, or eukaryotic cell and some archaea) (Christie and Cascales, 2005; Alvarez-Martinez and Christie, 2009). Found in both Gram-negative and positive bacteria, T4SSs are used to mediate plasmid conjugation thereby promoting the spread of antibiotic resistance and virulence among bacteria, this leads to enhance bacterial pathogenicity (Costa et al., 2015; Voth, Broederdorf and Graham, 2012). Agrobacterium tumefaciens Ti plasmid, and E. coli pKM101 and R388 conjugative plasmids-encoded T4SSs are some of the well-characterised T4SS (Alvarez-Martinez and Christie, 2009; Fronzes, Christie and Waksman, 2009). The T4SS consists of 12 proteins (VirB1 to VirB11, and VirD4) (Alvarez-Martinez and Christie, 2009; Fronzes, Christie and Waksman, 2009). The T4SS scaffold is formed by VirB3, VirB6,
30
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction VirB7, VirB8, VirB9 and VirB10 while VirB2 and VirB5 form the extracellular extending pilus (Trokter et al., 2014; Christie, Whitaker and González-Rivera, 2014). VirB1 is for lytic transglycosylase-dependent peptidoglycan degradation and pilus biogenesis while VirB2-VirB11 and VirD4 form the major components of A. tumefaciens C58 T4SS. Most VirB proteins form the T4SS structure complex of the secretory machinery under ATP energy hydrolysis (Fronzes, Christie and Waksman, 2009; Costa et al., 2015).
Figure 1.5 T4SS Functional representation in most Gram-negative bacteria, including K. pneumoniae. T4SS plays a crucial role in uptake and release of genetic material including antibiotic and virulence factors; conjugation enables spread of virulence and antibiotic resistance; and the translocation of effector protein/ toxins and T-DNA complexes into the host cell (inhibiting host cell functions) (Fronzes, Christie and Waksman, 2009; Souza et al., 2012).
T4SS operates via two modes; one is the pilus biogenesis in which VirB11 and VirB4 bind together, and the other mode is substrate-translocation, where VirB11 associates with VirD469 (Costa et al., 2015). Switching between these two modes is believed to occur when the pilus tip binds to an unknown recipient
31
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction cell receptor thereby triggering the release of VirB11 associated with virB4 to initiate binding with VirD4 (for function substrate translocation)(Costa et al., 2015). T4SS components can be found in both non- pathogenic bacteria such as Mesorhizobium loti (VirB) (Hubber, Sullivan and Ronson, 2007) and pathogenic bacteria such as A. tumefaciens C58 (CAG), Helicobacter pylori (ComB), P. aeruginosa (TraS/TraB), Bordetella pertussis (Ptl), E. coli (Tra) and L. pneumophila (Dot) (Christie and Cascales, 2005). Not all T4SSs contain the same sets of genes (Saier Jr, 2006). T4SS of A. tumefaciens C58 (model T4SS) export T-DNA complex from Ti plasmid (Christie and Cascales, 2005; Souza et al., 2012). T4SS injected T-DNA cause cancerous growth or crown gall tumours which results in carbon and energy source discourse for the pathogen (Tseng, Tyler and Setubal, 2009; Voth, Broederdorf and Graham, 2012; Fronzes, Christie and Waksman, 2009; Wallden, Rivera-Calzada and Waksman, 2010; Souza et al., 2012).
T4SS plays a role in the virulence of H. pylori, Bordetella pertussis and L. pneumophila by secreting transforming proteins and effectors that support the intracellular survival of the bacteria (Alvarez-Martinez and Christie, 2009). The L. pneumophila Dot/Icm T4SS mediate phagosome-lysosome fusion inhibitory activities and host cell rough ER recruitment to favour the bacterial replication. This enhances the intracellular survival of the bacterium within the phagosomes (Ensminger and Isberg, 2009). No pilus structure is associated with B. pertussis T4SS and depend on a VirB2 pilin homologue to release their substrates into the extracellular milieu rather than injecting them into the target host cell (Craig-Mylius and Weiss, 1999). The presence of several putative T4SS encoding loci in K. pneumoniae such as MDR K. pneumoniae HS11286 (Bi et al., 2015) and hyper mucoid K. pneumoniae NUTH-K2044 (Lery et al., 2014; Bistué et al., 2008) have been demonstrated using genomic analysis. These two strains were mainly used for the T6SS work presented in the subsequent chapter of this thesis. Pathogenic bacteria T4SSs have evolved with a variety of functions ranging from the translocation of 50 different effector proteins into host cells, to horizontal gene transfer-mediated spread of virulence factors and antibiotic resistance among bacteria (conjugation, uptake and release) (Fronzes, Christie and Waksman, 2009; Voth, Broederdorf and Graham, 2012; Alvarez-Martinez and Christie, 2009; Wallden, Rivera-Calzada and Waksman, 2010).
1.3.5 Type V secretion system (T5SS)
T5SS is a unique type of secretion systems that depend on Sec-pathway to translocate substrates into periplasm across the inner and outer membranes of the bacteria, hence exporting the substrates in two steps. T5SS destined proteins form β-barrel allowing the free passage of the passenger protein domain across the outer membrane onto the surface of the bacteria. T5SS proteins are grouped into three based on the number of proteins involved in the mechanistic secretion process; T5aSS (autotransporters, Va), T5bSS (two- partner system, Vb) and T5cSS (the chaperone-usher system, Vc) (reviewed in (Green and Mecsas, 2016; Tseng, Tyler and Setubal, 2009)). Autotransporters (T5Ass) are archetypal T5SS proteins that are able to
32
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction secrete themselves with at least three domains; a Sec-cleavable N-terminal passenger domain, effector domain (linker domain) and the C-terminal β-barrel domain forming the outer membrane channel (Leyton, Rossiter and Henderson, 2012; van Ulsen et al., 2014; Henderson et al., 2004; Jacob-Dubuisson, Fernandez and Coutte, 2004). They are called autotransporters because the C-terminal domains form a pore-forming β-barrel for N-terminal domain delivery(Henderson et al., 2004; Jacob-Dubuisson, Fernandez and Coutte, 2004) even though a recent study suggests otherwise (Bernstein, 2007). The translocator domain forms a β barrel with the help of accessory components such as chaperone Skp and the Bam complex (Wagner et al, 2009; Ruiz-Perez et al, 2009) while the flexible linker domain leads the passenger domain through the channel, which remains attached or released by protease cleavage (Leyton, Rossiter and Henderson, 2012). The Basic structure and biogenesis of T5SS proteins are the same. However, T5aSS are the most common in Proteobacteria genomes. The periplasmic substrates are usually unfolded, preceded by single N-terminal signal peptide (for Sec -dependant transport) and followed by effector domain and the C-terminal outer membrane translocation domain (Leyton, Rossiter and Henderson, 2012b; Pohlner et al., 1987; Dalbey and Kuhn, 2012).
Few T5SS substrates depend on T5bSS where protein pairs (β-barrel and secreted protein) (Henderson et al., 2004) are involved in the secretion of virulence proteins such as the filamentous haemagglutinin of B. pertussis and the high-molecular-weight adhesins HWM1 and HWM2 of Haemophilus influenzae (McCann and Geme III, Joseph W St, 2014; Lambert‐Buisine et al., 1998). The chaperone-usher secretion of T5SS recruits the help of β-barrel forming usher protein and chaperone to facilitate the folding of the secreted proteins before delivery into T5SS the channel (Waksman and Hultgren, 2009). An example of this system is observed in uropathogenic E. coli for pillin (P-pilus) formation (Waksman and Hultgren, 2009).
Neisseria meningitidis T5SS secretes a multidomain autotransporter protein called NalP as precursor proteins across the inner membrane into the periplasm via Sec-pathway. The translocator domain of the protein inserts into the outer membrane for free external localisation of the passenger domain (N-terminal and effector domain of the protein) (Henderson et al., 2004). IgA proteases are one of the virulence proteins secreted by N. gonorrhoea and N. meningitidis T4SS for the degradation of host IgA antibodies (Pohlner et al., 1987). Different translocator protein (TpsB) aid in the secretion of the effector protein (TpsA) through the outer membrane (ref for this). Most of the T5SS secreted proteins are well characterized as toxin and adhesins/ receptor-binding protein that significantly contribute to the virulence of pathogens to their host (Jacob-Dubuisson, Fernandez and Coutte, 2004; Bernstein, 2007; Henderson et al., 2004). The S. flexneri IcsA protein is for adhesion and actin-based intracellular motility) while Y. enterocolitica YadA promotes the resistance to host complement system and translocation of T3SS substrates into the host cell (Wagner et al., 2009; Pohlner, Halter and Meyer, 1988; Mikula, Kolodziejczyk and Goldman, 2014; Brandon et al.,
33
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction 2003). Also, many T5SS bacterial adhesins and toxins have reportedly been secreted via T5SS in H. pylori, Serratia marcescens, Rickettsia sp., Dickeya dadantii (Erwinia chrysanthemii), Proteus mirabilis and Edwardsiellla tarda (reviewed in (Green and Mecsas, 2016; Tseng, Tyler and Setubal, 2009; Henderson et al., 2004)). Interestingly, no account of T5SS in K. pneumoniae has been reported despite the presence of T5SSa in closely related species within the Proteobacteria family.
1.3.6 Type VI secretion system (T6SS)
T6SS is a recently identified Gram-negative bacterial injectisome (Mougous et al., 2006). The role of T6SS in bacteria is still under exploration for better insights. The focus of this research is on T6SS and is discussed in great details to lay a fundamental framework for the research work that was conducted. T6SS is a versatile envelope-spanning spring-loaded nano-machine that resembles an inverted phage-tail spike injectisome (Figure 1.6B). Many Gram-negative bacteria use T6SS to directly introduce its effector proteins into prokaryotic and eukaryotic target cells (Mougous et al., 2006; Zoued et al., 2014; Ho, Dong and Mekalanos, 2014; Russell, Peterson and Mougous, 2014; Tseng, Tyler and Setubal, 2009). Although recently characterised as a functional protein secretion system in 2006 (Pukatzki et al., 2006a), clues to the presence of T6SSs date back a decade earlier where hemolysin co-regulated protein, (Hcp now a hallmark protein of T6SS) was reported to be secreted by V. cholera without any signal peptide cleavage as mostly in the case of all the effector proteins in the other secretion systems (T1SS-T5SS) discussed earlier(Tseng, Tyler and Setubal, 2009; Green and Mecsas, 2016; Beeckman and Vanrompay, 2010). Similar clues were observed in R. leguminosarum, P. aeruginosa and L. pneumophila. Hence it was then named IcmF-associated homologous proteins (IAHP) because this gene cluster encoded a homolog of the IcmF protein associated with Type IVB secretion in L. pneumophila (Das and Chaudhuri, 2003). In 2006, John Mekalanos of Harvard Medical School functionally defined The T6SS to be present in V. cholerae (Pukatzki et al., 2006a) and now reportedly present in a broad range of Proteobacteria (Boyer et al., 2009a). Since then, T6SS is noted to be conserved among the Proteobacteria and analogous to the T3SS and T4SS machinery even though a majority of the T6SS proteins are unique (Bingle, Bailey and Pallen, 2008).
1.3.6.1 T6SS components, structure, and mechanism Different organization of T6SS gene clusters are widely reported to encode T6SSs as indicated in Fig. 1.5, however, these gene clusters are identifiable by the presence of 13 core components are shown in Figure 1.6 (Boyer et al., 2009a; Zheng and Leung, 2007). These T6SS genes within the clusters have been assigned TssA to TssM nomenclature (Shalom, Shaw and Thomas, 2007). However, other forms of names have also widely been used to refer to the T6SS components, such as Hcp, VgrG, ClpV, IcmF (refer to Tab. 1.3) just to mention a few (Bhatty, Gomez and Christie, 2013; Bingle, Bailey and Pallen, 2008). However, the use
34
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction of Tss or in combination with other specific names is now widely accepted. Apart from the core Tss genes, other accessory components associated with the T6SS gene clusters, such as fha, ppkA, tagF and sigma-54 dependent transcriptional activator vasH are associated with T6SS (Boyer et al., 2009a). Quite often, there are other genes that are unique to a specific T6SS cluster or strain-specific (these may be a system-specific substrate, chaperone or regulatory components). T6SS have been identified in over a quarter of analyzed sequenced bacterial genomes (especially Proteobacteria but not Epsilon Proteobacteria), and even up to six T6SS clusters in Burkholderia pseudomallei and Yersinia pestis. Based on the genome analysis, four families or phylogenetic groups of T6SS, A, B, C and D as shown in Figure 1.9 (Bingle, Bailey and Pallen, 2008; Boyer et al., 2009a; Blondel et al., 2010). The presence of most T6SS clusters on pathogenicity island together with the lack of correlation of phylogeny of T6SS cluster and bacterial taxonomy points to the possible acquisition of the T6SS gene via horizontal transfer to fit into the bacterial environment (Boyer et al, 2009a). Among the core components, Hcp and VgrG are considered hallmark protein and could exist in multiples within the same clusters or genome (Barret et al., 2011).
Figure 1.6 Core T6SS gene organisation and Structural resemblance to phage-tail. A. T6SS structure is encoded by at least 13 core/ conserved genes with a cluster or multiple clusters. The T6SS nanotube is encoded by hcp/tssD, needle-like puncturing device by vgrG/tssI, the baseplate complex by tssE, tssF, tssG and the sheath complex by tssB, tssB and tssA while tssJ, tssK, tssL and tssM encode the membrane complex. B. Structural similarity between phage and T6SS. T6SS is often regarded as remnant phage-tail injectisome. (Zoued et al., 2014a; Basler et al., 2012a; Leiman et al., 2009a; Brunet et al., 2014)
Despite the recent discovery of T6SS, considerable progress has already been made towards understanding T6SS (Bönemann, Pietrosiuk and Mogk, 2010; Cascales and Cambillau, 2012a; Silverman et al., 2012a).
35
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction The structure and function of the T6SS are enabled by 13 core components (TssA-TssM) and are responsible for the molecular nano-machine that span across the cell envelope of the bacteria to reach the target cells (see Fig 1.6B and Fig 1.7). Based on comparative genomics, protein remodelling and structural homology, T6SS is often regarded as a remnant of T4 phage injectisome (Figure 1.6B) with sequence similarities to some components of T4SS and powered by ATPase activity to contract and release substrates into their target cell in a single step through a needle-puncturing tip protein (Shrivastava and Mande, 2008; Leiman et al., 2009b). So far, all the effectors reported have no T6SS substrate-defining signal/ motif and are translocated in a single step independent of Sec- or Tat pathways. The hexameric Hcp and trimeric VgrG form the phage-tail like injecting device (with similarity to gp5 tube protein) (Mougous et al., 2006b; Ballister et al., 2008; Pell et al., 2009). Some core proteins of the T6SS apparatus serve a dual purpose, both as effector proteins, though other T6SS effector proteins may be secreted alongside such core proteins. The trimeric Valine-glycine-repeat protein, VgrG (needle-like T6SS protein), forms a spike in the central baseplate complex (Leiman et al., 2009b; Basler et al., 2012b) and often act both as a structural and effector protein (Schneider et al., 2013b; Bhatty, Gomez and Christie, 2013). VgrG spikes are nucleation platform for the T6SS tail tube assemblage, and the tail-tube is made of polymerised Hemolysin-Co-regulated protein Hcp (a structural homolog of phage tail tube protein) (Brunet et al., 2014; Leiman et al., 2009b). Hcp, just like the VgrG, served as structural protein as well as a secreted protein of T6SS. In vitro hexameric Hcp assemble spontaneously assemble into rings with an internal aperture of ~40Å in diameter (Schneider et al., 2013a; Mougous et al., 2006) unlike in vivo studies, where the Hcp hexamers in a head-to-tail fashion assemble into a contractile transmembrane tubular structure via which T6SS substrates are translocated (Pukatzki et al., 2007; Brunet et al., 2014).
36
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction
Figure 1.7 The assembled structural components of T6SS. Functional T6SS is made of at least 13 conserved components (TssA-TssM) (Zoued et al., 2014a; Cascales and Cambillau, 2012a).
The trimeric VgrG (similar gp5-gp27) sits on the Hcp tube and forms the spike-like puncturing device with other effector domains (Figure 1.7), while the TssB and TssC form the cytoplasmic contractile tail sheath (Leiman et al., 2009b; Basler and Mekalanos, 2012). TssE share similarity with gp25 of T4 phage, and forms part of a cytoplasmic baseplate-like structure (Lossi et al., 2011), and TssA, TssF, TssG, TssK are predicted to be cytoplasmic and involved in the complex basal formation. The T6SS injectisome is anchored to the cell envelope by complex, long tabular tail sheath structure perpendicular to the membrane, and extends deep into the bacterial cytoplasm (Basler et al., 2012b). The TssJ (OM protein), TssL (IM protein) and TssM (lipoprotein) make up the T6SS membrane complex. TssK is a T6SS cytoplasmic baseplate subunit thought to connect the membrane complex (TssJ–TssL–TssM) to the T6SS tail (Zoued et al., 2014a; Ma, Lin and Lai, 2009; Felisberto-Rodrigues et al., 2011; Zoued et al., 2013). Aschtgen and colleagues reported that TssM to be an anchoring protein to the T6SS apparatus via a peptidoglycan-binding domain or through interaction with an accessory protein, SciZ (Aschtgen, Thomas and Cascales, 2010). Outer membrane pore protein (analogous to T2SSand T3SS) or shared outer membrane pore protein (analogous TolC and used by T1SS and other transmembrane systems) has been reported.
37
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction
Figure 1.8 Dynamic formations and dissociation T6SS in bacteria. Diagrammatic representation of a mechanistic assemblage of T6SS (from left to right). TssA (red) recruited at the membrane complex to recruit the baseplate for initiation of Hcp (black rectangles) polymerization to build Hcp-TssBC (blue rectangles) during the assemblage of the nanotube. But TssA always at the distal end is release after sheath contraction (Zoued et al., 2016).
During the growing assemblage of the Hcp tube, the heterodimers of TssB–TssC polymerise around the tube to form the tail sheath (Basler et al., 2012b; Brunet et al., 2014) for the firm stability of Hcp tube (Figure 1.8). Dynamic formation and disassociation of both constricted and extended Hcp tubular structures and a tail sheath around the Hcp tube in V. cholera are believed to be ATPase energised by ClpV dimerization (Basler et al., 2012b; Cascales, 2008). Given the diverse parts, it seems T6SS has functionally assimilated a wide range of components, (the presence of eukaryotic post-translational regulation systems (based around PpkA, PppA and Fha proteins).
38
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction Table 1.3.0 T6SS nomenclatural components and functions T6SS Homologues COG ID# Localisation and putative function proteins TssI VgrG COG3501 Effector/ needle-like puncturing structure TssD Hcp COG3157 Soluble hexameric effector/ nano-tube structure TssC ImpC, VipB COG3517 Soluble OM protein to forming contractile sheath protein TssB ImpB, VipA COG3516 Soluble OM protein to forming contractile sheath protein TssH ClpV, VasG COG0542 Cytosolic AAA+ ATPase and also for TssBC recycling TssM IcmF, VasK COG3523 IM protein anchoring T6SS to cell wall TssL OmpA/DotU COG3455 IM protein anchoring T6SS to cell wall TssJ SciN/VasD COG3521 OM lipoprotein anchoring T6SS to cell wall TssE ImpF/VasS COG3518 Putative soluble baseplate protein TssG ImpH, VasB COG3520 Putative soluble protein TssF ImpG/ VasA COG3519 Putative soluble protein TssA ImpA/VasJ COG3515 Putative cytosolic protein TssK ImpJ, VasE COG3522 Cytosolic protein TagB BB0796 COG1357 Has pentapeptie_4 domain but function unknown TagAB BB0795 COG1357 Has pentapeptie_4 domain but function unknown TagE PknA/PpkA COG0515 Serine/threonine kinases, post-translational regulation TagF ImpM, SciT COG3913 Unknown function TagG PpA COG0631 Serine/threonine kinases, post-translational regulation TagH ImpI COG3456 Has FHA domain, post-translational regulation TagJ ImpE COG4455 Unknown function TagL C3389 COG2885/ OmpA_C-like domain but function unknown COG1360 - VCA0105 - Has PAAR_motif associated VgrG piercing structure - - COG3409 Peptidoglycan-binding domain, putative effector - L376_02862 - Peptidase M_23 domain, putative endopeptidase effector - Ebc_4130 - Has esterase_lipase domain but function unknown
Adapted from (Shyntum et al., 2014; Cascales and Cambillau, 2012a)
Based on the in silico analysis of genome data, T6SS gene clusters are relatively conserved in Proteobacteria but also within the planctomycetes and acidobacteria as they have been identified in over a quarter of sequenced bacterial genomes. T6SSs have been found in many Gram-negative bacteria including Pseudomonas spp, Escherichia spp, Acinetobacter spp, Edwardsiella spp. Francisella tularensis, A.
39
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction tumefaciens, Pectobacterium atrosepticum, Xanthomonas oryzae Myxococcus xanthus, Dechloromonas aromatica and Rhodopirellula baltica (Tseng, Tyler and Setubal, 2009; Leo, Grin and Linke, 2012). Based on T6SSs cluster analysis, T6SS can, therefore, be grouped into four families or phylogenetic groups A, B, C, D (Figure 1.9). However, complete structures are yet to be provided for the different T6SS groups (reviewed in (Parizad et al., 2016)). Though the overall identification and functional characterisation of T6SS effectors poorly understood, some progress has so far been made. VgrG or TssI often carry a variety of target specific-extensions such as actin-crosslinking domain (ACD), Proline-Alinine-Alinne-arginine repeat proteins (PAAR), Toxin-like (RtxA), ADP-ribosyl transferase (Vip), peptidases, chitinases, lipases and adhesins on the C-terminals and as such are collectively called “evolved VgrG’s” (Pukatzki et al., 2007) For example, VgrG-1 from V. cholera has an actin-cross-linking domain (ACD) at the C-terminal that can polymerize G-actins monomers (Bhatty, Gomez and Christie, 2013; Parizad et al., 2016). Many of the effectors secreted by T6SS are of wide forms and function especially against the bacterial cell wall and membranes further credence for supporting the T6SS interspecies bacterial competition theory (Russell, Peterson and Mougous, 2014; Russell et al., 2011c). Bacteria carrying T6SSs often have T6SS immune proteins to protect bacteria from self-intoxication or similar T6SS effectors from other bacteria (Russell, Peterson and Mougous, 2014).
Figure 1.9 T6SS genealogy reported in some commonly encountered bacteria. Gene arrangement in different families of T6SS identified in several Gram-negative bacteria (Coulthurst, 2013)
40
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction T6SS contraction and re-assembly cycle is energy-dependent, hence it not surprising that the expression and assembly of the system are tightly regulated in some kind of transcriptional control, quorum sensing, iron-depletion, thermoregulation or other environmental stress (reviewed in (Coulthurst, 2013)). In V. cholera T6SS, VasH is an essential activator of the transcription initiator σ54 (RpoN) though these two are only noted in control the transcription of two hcp operon but not the primary cluster (Pukatzki et al, 2006a; Zheng, Ho and Mekalanos, 2011a). Despite the range of T6SS mechanisms and tight control, transcriptional regulation of T6SS has many limitations as these regulations tend to be strain specific.
1.3.6.2 Role of T6SS; a multipurpose injectisome The bacterial T6SS was initially reported to translocate substrates directly into the eukaryotic host cells via needle-like appendages. However, subsequent reports indicate that T6SS is involved in mediating interbacterial interactions. Although T6SS can, in rare instances, directly influence interactions with higher organisms, the broader physiological significance of the system is likely to provide defence against simple eukaryotic cells and other bacteria in the environment. The crucial role of T6SS in bacterial interactions, along with its presence in many organisms relevant to disease, suggests that it might be a key determinant in the progression and outcome of certain human polymicrobial infections. T6SS effectors come in two flavours; one set with a C-terminal extension of VgrG puncturing device for mediating virulence towards eukaryotic cells and the other set is the free toxins involved in bacterial competition and killing. A recent study, however, suggested that V. cholerae VgrG-3 C-terminal extension is involved in peptidoglycan degradation (Brooks et al., 2013). Interestingly, through an unclear mechanism, few emerging data suggest that T6SS may instead be contributing to a more symbiotic or antivirulence of certain bacteria and maintaining balance with host microflora. Hence the role of T6SS can broadly be grouped into three (see Figure 1.10), virulence (mostly towards eukaryotic hosts such as animals and plants), Antivirulence by inducing a more protective or symbiotic interaction with other host organisms and finally competition (demonstration of fitness/cooperation/protection against threats of different bacteria, mostly between two more bacteria in the same ecological niche).
Many in vitro studies have demonstrated T6SS virulence role to host cells (see Table 1.4) range from cytotoxicity and resistance to epithelial, intracellular growth in macrophage, resistance and activation, cytoskeletal rearrangement, inflammasome activation; Dictyostelium resistance, adhesion and invasion of human brain microvascular endothelial cells, and to growth suppression of yeast cells (reviewed in (Coulthurst, 2013)). Recent studies suggest T6SS functional versatility in the mediation of not just virulence towards the eukaryotic host. It also functions to enhance commensal or mutualistic relationships between bacteria and eukaryotes or to mediate cooperative or competitive interactions between bacteria. Pukartzi
41
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction and colleagues demonstrated that VgrG-1 carry actin crosslinking domain (ACD) of RtxA together with other T6SS components in Vibrio necessary for actin polymerisation in host cells (Pukatzki et al., 2007). V. cholerae T6SS may mediate an immediate inflammation and in a longer-term contribute to the bacterial growth within the host and subsequent transmission. T6SS gene clusters in Burkholderia mediate virulence in acute mouse pneumonia based on a hamster model (Aubert, Flannagan and Valvano, 2008a; Gavrilin et al., 2012; Schell et al., 2007; French et al., 2011; Burtnick et al., 2010; Burtnick et al., 2011).
Figure 1.10 T6SS functional versatility. T6SS is a versatile system involved a wide range of function but can be broadly grouped into competition, antivirulence and virulence. (Hachani, Wood and Filloux, 2016)
Other bacteria mediating T6SS virulence towards the eukaryotic host cell or experimentally demonstrated using an in vitro and in vivo model includes uropathogenic E. coli, Francisella species, Salmonella species, Aeromonas hydrophila, Pectobacterium atrosepticum, E. carotovora subsp. atroseptica, just to mention a few (reviewed in (Coulthurst, 2013)) (reviewed in (Coulthurst, 2013)).
More emerging data are suggesting the involvement of T6SS in bacterial competition other just virulence towards the eukaryotic host. Also, several bacterial genomes harbour several T6SS-encoding gene clusters suggesting the possibility of functional diversity of T6SS. Konovalova and colleagues alluded the role of Myxococcus xanthus T6SS in intraspecies microbial cooperation (Konovalova, Petters and Sogaard-
42
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction Andersen, 2010). Hood and colleagues also showed that P. aeruginosa used T6SS to mediate antagonistic interaction with other competing bacteria in the same niche (Hood et al., 2010a).
Table 1.4.0 Functional diversity of T6SS toward the eukaryotic host. Bacteria T6SS Phenotype Reference Aeromonas hydrophila vas Resistance and cytotoxicity to Macrophages and epithelial (Suarez et al., 2008) cells Virulence in a septicaemic mouse model E. coli Evf Epithelial cells actin rearrangement and virulence in chick (De Pace et al., 2010; Zhou E. coli K1 Adhesion and invasion of brain microvascular endothelial et al., 2012) cells Burkholderia mallei, Bcs Virulence in Syrian hamster and mouse pneumonia model (Aubert, Flannagan and B. pseudomallei, T6SS- Intracellular growth, actin polymerisation Valvano, 2008a; Gavrilin et B. thailandensis, 1a Macrophage mononuclear giant cell formation and spread al., 2012; Schell et al., 2007; B. cenocepacia T6SS- Inhibition of Dictyostelium uptake; inflammasome activation French et al., 2011; Burtnick 5a Intercellular spread in cultured cells et al., 2010; Burtnick et al., 2011) Campylobacter jejuni Mouse colonisation; adhesion and invasion epithelial cell (Lertpiriyapong et al., 2012) Edwardsiella tarda Evp Virulence in the fish model; invasion of cultured carp (Wang et al., 2009; Zheng epithelial cells and Leung, 2007b) Francisella tularensis Iglb Growth, phagosomal escape and cytopathogenicity in cultured (Bröms et al., 2012a; De F.ovicidal macrophages; virulence in a mouse model Bruin, Ludu and Nano, Murine macrophages 2007; de Bruin et al., 2011) Helicobacter hepaticus Anti-inflammatory response and limitation of intestinal (Chow and Mazmanian, colonisation in mice (promotion of tolerance and balanced) 2010) Pseudomonas aeruginosa H1T6SS Full virulence in mouse lung and acute burn model (Potvin et al., 2003; Sana et P. syringae H2T6SS Killing in Caenorhabditis elegans model and Yeast growth al., 2012a; Lesic et al., H3T6SS suppression and enhancing of non-phagocytic cell bacterial 2009; Haapalainen et al., uptake 2012) Rhizobium leguminosarum Imp Host-specific inhibition of infection of pea plants (Bladergroen, Badelt and Spaink, 2003) Salmonella enterica sv. SPI-19 Colonization of chicken ileum, caeca, liver and spleen (Mulder, Cooper and Gallinarum T6SS Contribution to pathogenesis and systemic dissemination in a Coombes, 2012a; Blondel et S. enterica sv. Sci mouse model of typhoid, intracellular replication in al., 2010) Typhimurium macrophages V. cholera Vas Cytotoxicity towards Dictyostelium and macrophages; (Ma et al., 2009a; Ma and V. parahaemolyticus Inflammatory response, adhesion and actin cross-linking Mekalanos, 2010a; Pukatzki et al., 2006a; Yu et al., 2012) Pectobacterium Virulence in potato (stem and tuber infection models) (Liu et al., 2008) atrosepticum (Erwinia carotovora subsp. atroseptica)
Adapted from (Coulthurst, 2013)
43
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction
T6SS is essential in the ecological fitness of bacteria living in mixed bacterial communities such as mixed biofilms (Miyata, Bachmann and Pukatzki, 2013). Some of these bacteria also carry T6SS immunity to avoid self-killing or resistance the strike of other competing bacteria in the same niche. Many bacteria secreting effectors often carry cognate protection against the toxins self-intoxication or toxins of other closely related T6SS clusters of competing bacteria while using their effectors to target the cell wall, cell membrane and nucleic acid of the competing bacteria (Alcoforado Diniz, Liu and Coulthurst, 2015; Russell, Peterson and Mougous, 2014). Many T6SS-harbouring bacteria such as P. aeruginosa and B. pseudomallei possess multiple T6SS clusters. They may persist in both patients and the environment under polymicrobial setting for many years, suggesting the possibility of functional diversity of these T6SS gene clusters to enable the bacteria to survive in the stressful ecological niches. P. aeruginosa employs its powerful T6SS to strike or neutralise the threats from other bacteria and ready to operate on the “tit for tat” principle in other to survive in the mixed bacterial population (Ho, Basler and Mekalanos, 2013). In addition to targeting eukaryotic cells, V. cholera uses T6SS to confer toxicity towards other competing bacteria. Thus, T6SS activity may enhance the survival of the V. cholera in the aquatic ecosystem during and between the outbreak of cholera (MacIntyre et al., 2010c). Schwarz and colleague (2010) extensively demonstrated the involvement of Burkholderia T6SS in bacterial ecological fitness, suggesting that T6SS may be the decisive factor in determining the survival of bacterial species in polymicrobial communities (Schwarz et al., 2010c). The firing T6SS together with the exuding effectors may indiscriminately kill all susceptible bacteria in the complex microbial community (Kolenbrander et al., 2010; Peters et al., 2012). A study showed that S. marcescens T6SS does not contribute to virulence in a non-mammalian model. They instead enhance strain- specific killing with more effective killing in S. marcescens with a very similar and active T6SS, hence implicating the role of S. marcescens T6SS in competitiveness (Murdoch et al., 2011a). Similarly, Repizo and colleagues indicate that A. baumannii used T6SS to prey on E. coli in a contact-dependent manner (Repizo et al., 2015b). Thus, there are overwhelming data to support the idea that T6SS substrates are secreted to target other bacterial competitors in a polymicrobial environment to survive and colonize their niche.
The functional versatility of T6SS does not just end with only virulence and competition towards the eukaryotic host and bacteria competitor respectively, but controversial antivirulence in the eukaryotic host. T6SS has been reported to play to the advantage of the host by inducing antivirulence in host models. Few studies suggest T6SS may be present to limit bacterial replication or virulence in the host and encouraging a commensal or mutualistic interaction between the two (Jani and Cotter, 2010). For example, imp mutation in R. leguminosarum promotes mutualistic cooperation by forming functional nitrogen-fixing nodules on
44
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction pea plants (Bladergroen, Badelt and Spaink, 2003) (Bladergroen et al. (2003) Thus, suggesting that T6SS was involved in secretion of proteins that block infection of pea plants by R. leguminosarum, thus determining host specificity of the Rhizobium-plant interaction (Jani and Cotter, 2010). Parsons and Heffron (2005) also reported that a mutant of sciS in S. Typhimurium showed enhanced replication macrophages and increased virulence in a mouse model suggesting that T6SS via a poorly understood mechanism is upregulating virulence of S. Typhimurium sciS mutant (Parsons and Heffron, 2005). Also, Chow and Mazmanian (2010) presented a compelling argument by demonstrating that mutation of T6SS related genes in the symbiont H. hepaticus can function to limit within-host growth and virulence. The T6SS mutant had increased intestinal colonization as well as inducing a more robust inflammatory response in a dysbiosis model (Chow and Mazmanian, 2010). In a nutshell, compelling antivirulence evidence present here suggest that the role of T6SS maybe be strain-specific and the consideration T6SS as a virulence factor towards other bacteria and the host should be used with caution. The idea that multiple T6SS clusters within individual bacterial species could mediate various types of interactions with diverse hosts, predators, cooperators, or competitors is an enticing piece that demands attention. Also, there is the need to explore further the role of T6SS alongside other virulence mediating factor such as antibiotic resistance to further our understanding about how the two may contribute to the pathogenicity of the bacteria.
1.3.6.3 Putative T6SS gene clusters identified in hyper mucoid and MDR K. pneumoniae Multidrug-resistant (MDR) K. pneumoniae strains are very problematic and commonly isolated from both nosocomial and community-acquired infections, thus, stressing the limits therapeutic options for physicians. The discovery of new antibiotics to counter the evolving antibiotic resistance in bacteria remains a puzzle and compounded when other virulence factors such as capsular polysaccharides, lipopolysaccharides, iron acquisition systems (Nassif and Sansonetti, 1986; Cortes et al., 2002b; Shankar- Sinha et al., 2004a), and protein secretion systems (possibly T6SS) are present in such strains. Based on comparative in silico mining, Saris and colleagues reported the presence of three syntenic putative T6SS clusters in four K. pneumoniae strain (three full and one partially sequenced) as well as K. variicola (Figure 1.11) (Sarris et al., 2011b). Little to no experimental data exist for K. pneumoniae T6SS since the description of these putative T6SS gene clusters in Klebsiella. With all the accumulating literature on T6SS and the role T6SSs play in bacteria, the role of T6SS in K. pneumoniae is missing and poorly understood. Here this research examined to confirm the presence of T6SS gene clusters in K. pneumoniae and demonstrate the what T6SS clusters may be doing in K. pneumoniae.
45
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction
Figure 1.11 Identified T6SS gene clusters in some Klebsiella species. Putative T6SS clusters identified in Klebsiella species. Three different T6SS clusters or syntenies were noticed in the strains analysed. Diagram adapted from (Sarris et al., 2011)
46
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction
MDR K. pneumoniae HS11286 is a clinical isolate from Shanghai patient sputum in China. It has a highly plastic genome with one chromosome and six plasmids and carries two novel integrative and conjugative elements (ICEKpnHS11286-1 and CEKpnHS11286-2)(Liu et al., 2012a). These plasmids (pKPHS1, pKPHS2, pKPHS3, pKPHS4, pKPHS5 and pKPHS6) range from 122.8 Kb, 111.2 Kb, 106 Kb, 3.8 Kb, 3.4 Kb to 1.3 Kb respectively. The pKPHS6 is the smallest known K. pneumoniae plasmid. The pKPHS1 encode CTX-M-14 extended-spectrum beta-lactamase while pKPHS2 carries blaTEM-1 and carbapenemase gene(blaKPC-2). Also, pKPHS3 carry about 13 resistant determinants (such as tetG, cat, sul1, dfra12, aac(3)- Ia, aph, among others). Other plasmids such as pKPHS4, pKPHS5 and pKPHS6 encode some unknown protein. At the same time, pKPHS2 and pKPHS3 carry a conjugative transfer gene (tra) that may lead to the widespread of multidrug resistance antibiotic resistance among different genera (Liu et al., 2012a). K. pneumoniae NTUH-K2044 is a clinical isolate from a patient with liver abscess and meningitis and generally susceptible to a lot of antibiotics but very mucoid (high production for capsular polysaccharide) with demonstrated high virulence in mice (Wu et al., 2009). The T6SS gene clusters in K. pneumoniae NTUH-K2044 (especially T6SS1) were considered for mutation, but T6SS3 deletion failed. The microviscosity of the strain and possible presence of some essential genes on T6SS3 posed a huge challenge in the creation of T6SS3 mutant for functional studies in K. pneumoniae NTUH-K2044. Hence only T6SS1 mutant in K. pneumoniae NTUH-K2044 was analysed in this research. Understanding the antibiotic resistance and virulence factors (T6SS in this case) associated with K. pneumoniae HS1186 and K. pneumoniae NTUH-K2044 will not only add to the growing knowledge of antibiotic resistance and virulence puzzle but also elucidate the role of T6SS in K. pneumoniae pathogenicity.
1.4 Research aims and objectives
Before this research work reported in this thesis, no previous work defining the role of these putative T6SS gene clusters had been published for K. pneumoniae and more importantly in hyper mucoid or MDR K. pneumoniae strain such as K. pneumoniae HS11286 and K. pneumoniae NTUH-K2044. However, to allow multiple uses of various antibiotic cassettes for easy genetic manipulation, safe usage as well as understanding the resistance repertoire of K. pneumoniae HS11286 (Liu et al., 2012a), the K. pneumoniae HS11286 multidrug resistance arsenal was disarmed for safe laboratory usage (Bi et al., 2015). The disarming of this strain provided an antibiotic-susceptible K. pneumoniae model strain for the studies of putative T6SS and other future works. In a different strain, an attempt was made to study the role of T6SS1 in hyper mucoid K. pneumoniae NTUH-K2044 where T6SS1 was inactivated and examined. The presence
47
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction of T6SS in K. pneumoniae raises concern about how T6SS gene clusters may be shaping the pathogenicity of hypervirulent K. pneumoniae and other bacteria. Hence with growing data suggesting the functional versatility of T6SS in bacteria together with the presence of putative T6SS gene clusters in K. pneumoniae, this research work attempted to elucidate the role T6SS in K. pneumoniae, a common agent for nosocomial and community-acquired infections,
1. Bioinformatic analysis of K. pneumoniae resistance-mobilome, identification putative K. pneumoniae T6SS gene clusters and the generation of molecular genetic tools and T6SS mutants in a resistance-disarmed K. pneumoniae model strain: a. To in silico analyzes the resistance-mobilome of MDR K. pneumoniae HS11286. b. To perform T6SS in silico analysis and annotate putative K. pneumoniae T6SS gene clusters. c. To generate a library of molecular genetic tool for use in a wide range of Gram-negative bacteria d. To create a resistance-disarmed K. pneumoniae HS11286 as a safer model for future functional studies in K. pneumoniae e. To generate various K. pneumoniae T6SS gene cluster mutants for T6SS functional studies.
Resistance mobilome and two putative T6SS gene clusters were identified and mapped in K. pneumoniae based on bioinformatic analysis and subsequently disarmed for functional studies. The creation of a less resistant version of MDR resistant K. pneumoniae HS11286 did not only provide safely disarmed model strain with minimized potential health risk but also enhanced the understanding of antibiotic resistance and acquisition in MDR K. pneumoniae strains. Also, the disarmed K. pneumoniae HS11286 model strains facilitated easy genetic manipulation for the successful deletion of the identified putative T6SS gene clusters for functional studies.
2. Investigating the role of the putative K. pneumoniae T6SS in gene clusters in environmental survival during bacteria-bacteria and bacteria-amoeba interactions: a. To determine K. pneumoniae T6SS role in antibacterial virulence during bacterial competition b. To determine the role T6SS induced expression of other virulent mechanisms such as fimbria-mediated biofilm formation and T4SS-mediated acquisition of mobile genetic elements such as plasmids. c. To determine K. pneumoniae T6SS-mediate resistance to amoeba during environmental survival 48
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Introduction After the generation of K. pneumoniae T6SS mutants, the role of T6SS in mediating antibacterial virulence/ competition was examined. It was realised that K. pneumoniae uses T6SS to for survival in complex microbial communities by unleashing antibacterial toxins in a contact-dependent manner. Similarly, K. pneumoniae T6SS mediated antiphagocytic virulence against amoeba or survival within the amoeba. Also, T6SS played a role in making MDR K. pneumoniae as antibiotic resistance sink by enhancing the acquisition of foreign DNA such as plasmid and other mobile genetic elements carrying virulence/ resistance genes. This is the first of such experimental data that demonstrated that T6SS plays a significant role in the environmental survival of K. pneumoniae during bacteria-bacteria and bacteria-amoeba interactions.
3. Assessing the role of K. pneumoniae T6SSs in mediating virulence against host and immuno- stimulation of host innate immune system: a. To measure the role of T6SS in mediating attachment, invasion and survival within host cells such as macrophage and epithelial cells b. To determine the role of T6SS in K. pneumoniae in host cytoskeletal rearrangement and cell toxicity c. To measure the K. pneumoniae T6SS innate immuno-stimulation of pro-inflammatory response based on the induced expression of cytokines/chemokines in host cells. d. To measure K. pneumoniae T6SS mediated in vivo virulence using Galleria larvae model
The role of K. pneumoniae in mediating anti-phagocytic resistance and survival in the host cell was examined, and the corresponding pro-inflammatory cytokines and chemokine were measured. As a survival mechanism within host cells, T6SS enhanced actin filament polymerization and host cell toxicity. Finally, the T6SS was noted to improved in vivo competition of K. pneumoniae and increased larval mortality via stimulated phenoloxidase-based melanisation.
49
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Chapter Two
Materials and Methods
50
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods Chapter 2: Material and Methods
2.1 Bacterial strains, Eukaryotic cells and Plasmids
All the bacterial isolates used in this study were obtained from Lab 212 bacterial archives stored at -20℃/- 80℃ in Brain Heart Infusion (BHI) with 30% glycerol. While the E. coli and P. aeruginosa used in this study were obtained from Lab 212 laboratory bacterial strain collections, the K. pneumoniae strains are clinical isolates from Shanghai Jia Tong Hospital in China and National Taiwan University Hospital in Taiwan. Prior to experimental use, these bacterial strains were routinely grown at 37 ℃ overnight using lysogeny agar (LA) or broth (LB) with shaking at 200 rpm unless otherwise specified. When required, E. coli growth medium was supplemented with the appropriate antibiotics (100 µg/ml ampicillin, 50 µg/ml kanamycin, 30 µg/ml apramycin, 25 µg/ml gentamicin, 30 µg/ml chloramphenicol, 50 µg/ml hygromycin or 50 µg/ml streptomycin). Unless otherwise stated, K. pneumoniae strains were routinely grown in LA or LB medium and supplemented with antibiotics when required (50 µg/ml apramycin 100 µg/ml ampicillin, 25 µg/ml tetracycline, 50 µg/ml kanamycin, 25 µg/ml gentamicin, 30 µg/ml chloramphenicol, 50 µg/ml, hygromycin or 50 µg/ml streptomycin).
A. castellanii ATCC 30234 was a gift from Dr Simon Bath’s lab but originally purchased from American Type Culture Collections. Details of the bacterial strains or plasmids used for this study are listed in Table 2.1 and Table 2.2, respectively. All growth media used for this work were sterilized by autoclaving at 121 ℃, 15 psi, for 15 minutes or filtered with 0.45 µm-Merck Millipore filtration system.
51
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods Table 2.1 List of plasmids used in this study Plasmids Alternative designation Relevant Description Reference
pJTOOL-3 Lambda pir dependent suicide vector with sacB negative and cat markers (van Aartsen, 2012) pKD46 Lambda RED plasmid with ampicillin resistance marker (Datsenko and Wanner, 2000) pFLP2 Flipase-FRT excising suicide plasmid with ampicillin marker (Hoang et al., 1998) pUC18R6K-mini-tn7t-Gm Source of FRT-aacC1-FRT as a gentamicin marker (Choi et al., 2005) pBluescript II KS (+) With lacZa and Ampicillin resistance gene (Short et al., 1988) pJTOOL-8 Source FRT-aph-FRT with kanamycin resistance marker Lab 212 pWSK29 Cloning plasmid with ampicillin resistance marker (Wang and Kushner, 1991) pKOBEG-Apra Lambda RED plasmid with apramycin resistance marker (Chaveroche, Ghigo and d’Enfert, 2000) pMQ300 Sources of the hygromycin resistance marker (Kalivoda et al., 2011) pACYC186-OriT Cloning plasmid with ICE1 oriT and chloramphenicol resistance marker Lab 212 pIM438 Source of green fluorescent protein (GFP) marker (Murin et al., 2012) pKPHS6 K. pneumoniae HS11286 plasmid (1.3 kb) backbone with the origin of (Liu et al., replication 2012a) pDNTOOL-1 pUC18R6K-mini-Tn7t-aac(3)-IV For FRT-aac(3)-IV-FRT with apramycin resistance marker This study
52
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods pDNTOOL-2 pFLP2-aac(3)-IV Flipase-FRT excising suicide plasmid with expressing apramycin marker This study pDNTOOL-3 pWSK29-aac(3)-IV pWSK29 cloning plasmid with an apramycin resistance This study pDNTOOL-4 pWSK29-hph pWSK29 cloning plasmid with a hygromycin resistance This study pDNTOOL-5 pKD46-hph Temperature-dependent lambda RED plasmid with hygromycin marker This study pDNTOOL-6 pJTOOL-3-aac(3)-IV cat gene was replaced with aac(3’)-IV in the pJTOOL-3 backbone This study pDNTOOL-7 pJTOOL-3-hph cat gene was replaced with hph in the pJTOOL-3 backbone This study pDNTOOL-8 pJTOOL-3: T6SS1 mutant allele K. pneumoniae NTUH-K2044 T6SS1 deletion vector with pJTOOL-3 This study backbone pDNTOOL-9 pJTOOL-3: T6SS3 mutant allele K. pneumoniae NTUH-K2044 T6SS3 deletion vector with pJTOOL-3 This study backbone pDNTOOL-10 pKD46-aac(3)-IV Lambda RED plasmid with apramycin resistance marker This study pDNTOOL-11 pKD46- aacC1 Lambda RED plasmid with gentamicin resistance marker This study pDNTOOL-12 pKD46-aph Lambda RED plasmid with kanamycin resistance marker This study pDNTOOL-13 pKD46-sacB-cat Lambda RED plasmid with Chloramphenicol and levansucrase negative This study marker pDNTOOL-14 pKOBEG-hph Lambda RED plasmid with hygromycin resistance marker This study pDNTOOL-15 pKOBEG-aph Lambda RED plasmid with kanamycin resistance marker This study pDNTOOL-16 pKOBEG-sacB-cat Lambda RED plasmid with Chloramphenicol and levansucrase negative This study markers pDNTOOL-17 pKOBEG-aacC1 Lambda RED plasmid with hygromycin resistance marker This study pDNTOOL-18 pFLP2-hph Flipase-FRT recombination-based plasmid with a hygromycin resistance This study pDNTOOL-19 pFLP2-cat Flipase-FRT recombination-based plasmid with Chloramphenicol resistance This study pDNTOOL-20 pFLP2- aacC1 Flipase-FRT recombination-based plasmid with Gentamicin resistance This study pDNTOOL-21 pFLP2-aph Flipase-FRT recombination-based plasmid with Kanamycin resistance This study pDNTOOL-22 pWSK29-sacB-cat pWSK29 with sacB and chloramphenicol resistance makers This study pDNTOOL-23 pWSK29-aacC1 pWSK29 cloning plasmid with gentamicin resistance This study
53
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods pDNTOOL-24 pWSK29-aph pWSK29 cloning plasmid with a kanamycin resistance This study pDNTOOL-25 pWSK29- aac(3)-IV:gfp pWSK29 cloning plasmid with apramycin resistance and GFP This study pDNTOOL-26 pWSK29-hph-gfp pWSK29 cloning plasmid with hygromycin resistance and GFP This study pDNTOOL-27 pWSK29-aacC1-gfp pWSK29 cloning plasmid with gentamicin resistance and GFP This study pDNTOOL-28 pWSK29-aph-gfp pWSK29 cloning plasmid with kanamycin resistance and GFP This study pDNTOOL-29 pKPHS6repA:araC:aacC1 Inducible protein expressing vector with hygromycin and gentamicin This study resistance pDNTOOL-30 pKPHS6repA:araC:gfp:aacC1 Inducible protein-gfp expressing vector with hygromycin and gentamicin This study pDNTOOL-31 pUC18R6K-mini-tn7t-sacB-cat For FRT-sacB-cat-FRT with chloramphenicol and sucrose negative marker This study pDNTOOL-32 pUC18R6K-mini-tn7t-cat For FRT-cat-FRT with chloramphenicol resistance marker This study pDNTOOL-33 pUC18R6K-mini-tn7t-hph For FRT-hph-FRT with hygromycin resistance marker This study pDNTOOL-34 pUC18R6K-mini-tn7t-hph-gfp For FRT-hph-gfp-FRT with hygromycin resistance and GFP markers This study pDNTOOL-35 pUC18R6K-mini-tn7t- aac(3)-IV - For FRT-aac(3’)-IV-gfp-FRT apramycin resistance and GFP markers This study gfp pDNTOOL-36 pUC18R6K-mini-tn7t-sacB-aacC1 For FRT-sacB-aacC1-FRT with gentamicin and sucrose negative marker This study pDNTOOL-37 pUC18R6K-mini-tn7t-sacB-hph For FRT-sacB-hph-FRT with hygromycin and sucrose negative markers This study pDNTOOL-38 pUC18R6K-mini-tn7t-sacB-aac(3)- For FRT-sacB-aac(3’)-IV-FRT with apramycin and sucrose negative markers This study IV pDNTOOL-39 pBluescript II KS (+)-aac(3)-IV aac(3)-IV was used to replace the ampicillin resistance gene This study
54
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods Table 2.2 List of bacterial strains and Eukaryotic lines used in this study Bacterial strains/ Eukaryotic lines Alternative name Description Reference Bacterial strains E. coli DH5α DH5α F- φ80dlacZ∆M15 ∆(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rK- (Herrero, de mK+) phoA supE44 λ- thi-1 gyrA96 relA1 Lorenzo and Timmis, 1990) E. coli HB101 HB101 Recipient plasmid mobilization strain (F- mcrB mrr hsdS20(rB-mB-) recA13 leuB6 (Boyer and ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ-) Roullard Dessoix, 1969)
E. coli CC118λpir CC118λpir Lambda pair cloning strain (Δ(are-leu) araD ΔlacX74 galE galK phoA20 the-1 rpsE (Hanahan, rpoB argE(Am) recA1 λpir) 1983)
E. coli S17-λpir S17-λpir Conjugative lambda pir strain (F’ thi pro hsdR- recA::RP4-2-Tc::Mu Km::Tn7 λpir) (de Lorenzo et al., 1993) P. aeruginosa PA14 PA14 Clinical isolate (Lee et al, 2006) K. pneumoniae KR161 KR161 Bloodstream infection isolates with proper biofilm formation Lab212 K. pneumoniae KR162 KR162 Bloodstream infection isolate with poor biofilm formation Lab212 K. pneumoniae NTUH-K2044 KR1730 Full sequenced clinical isolate (causing liver abscess and meningitis) from Taipa, (Wu et al., Taiwan 2009) K. pneumoniae HS11286 KR3317 Fully sequenced multi-drug resistant human sputum isolates from Shanghai, China (Liu et al., 2012b) K. pneumoniae NTUH-K2044 ΔT6SS1:aaC(3)-iv NTUH ΔT6SS1: aaC(3)- Deletion of T6SS1 from K. pneumoniae NTUH-K2044 with gentamicin marker This study iv K. pneumoniae NTUH-K2044 ΔT6SS1 NTUH ΔT6SS1 Gentamicin marker flipped from K. pneumoniae NTUH-K2044 ∆T1:aaC(3)-iv This study
K. pneumoniae HS11286 ΔKPC:hph ΔKPC:hph Deletion of bla-kpc (KPC) in K. pneumoniae HS11286 with hygromycin marker This study K. pneumoniae HS11286 ΔKPC ΔKPC Hygromycin marker flipped from K. pneumoniae HS11286 ∆KPC;hph This study
55
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods K. pneumoniae HS11286 ΔKPCΔMDR:hph DN2T or Deletion of KPC and MDR in K. pneumoniae HS11286 with hygromycin marker This study ΔKPCΔMDR:hph K. pneumoniae HS11286 ΔKPCΔMDR DN2 or ΔKPCΔMDR Hygromycin marker flipped from K. pneumoniae HS11286 ∆KPC∆MDR;hph This study K. pneumoniae HS11286 ΔT1:hph Deletion of KPC, MDR and T6SS1 in K. pneumoniae HS11286 with hygromycin This study ΔKPCΔMDRΔT6SS1:hph marker K. pneumoniae HS11286 ΔKPCΔMDRΔT6SS1 ΔT1 Hygromycin marker flipped from K. pneumoniae HS11286 ∆KPC∆MDR∆T1;hph This study K. pneumoniae HS11286 ΔT3:hph Deletion of KPC, MDR and T6SS3 in K. pneumoniae HS11286 with hygromycin This study ΔKPCΔMDRΔT6SS3:hph marker K. pneumoniae HS11286 ΔKPCΔMDRΔT6SS3 ΔT3 Hygromycin marker flipped from K. pneumoniae HS11286 ∆KPC∆MDR∆T3;hph This study K. pneumoniae HS11286 ΔT1ΔT3:hph Deletion of KPC, MDR, T6SS1 and T6SS3 in K. pneumoniae HS11286 with This study ΔKPCΔMDRΔT6SS1ΔT6SS3:hph hygromycin marker K. pneumoniae HS11286 ΔT1ΔT3 Hygromycin marker flipped from K. pneumoniae HS11286 ∆KPC∆MDR This study ΔKPCΔMDRΔT6SS1ΔT6SS3 ∆T1∆T3;hph Eukaryotic cells Human neutrophils PMNs Pooled HPNC from consented blood donors who are not on antibiotics This study J774A.1 ATCC TIB-67 Adherent mouse BALB/c macrophages ATCC TIB-67 H292 ATCC CRL-1848 Adherent human lungs epithelial cells ATCC CRL-1848 A549 ATCC CCL-185 Adherent human lung epithelial cell ATCC CCL-185 A. castellanii ATCC 30234 Amoeba For amoeba-bacterial interaction ATCC 30234 G. mellonella larva Galleria larvae For bacterial-Galleria killing assay Livefoods.co.uk
56
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods 2.1.1 Media, reagents and solutions
Brain Heart Infusion (BHI) broth plus 30 % v/v glycerol: This was prepared by mixing 47 g of brain heart infusion broth powder (Oxoid) and 30% (v/v) of glycerol in a final volume of 1L and autoclaved before use.
Lysogeny Broth (LB) and Agar (LA): is also commonly called Luria-Bertani broth or agar. LB or LA was prepared by mixing 10 g of tryptone, 5 g of yeast extract and 5 g of sodium chloride in distilled water to a final volume of 1 litre for LB or dissolving 15g of agar base, 10 g of tryptone, 5 g of yeast extract and 5 g of sodium chloride and in distilled water to a final volume of 1 litre for LA.
LA + 5 % sucrose (LAS) or LA + 5 % sucrose + Antibiotics (LASA): LAS and LASA were used for sucrose-counterselection media during for allelic exchange or plasmid negative selection pressure. LA media as described above, was supplemented with 5 % sucrose to make LAS or supplemented with 5 % sucrose and the required antibiotics to make LASA.
MacConkey agar: This was prepared by mixing 52 g of MacConkey agar powder (Oxoid) with 0.5 L of dH2O stirred with a magnetic stirrer and top-up to 1L with distilled water and autoclaved. MacConkey agar contains bile salts which inhibit most Gram-positive bacterial growth.
Super Optimal Broth (SOB) or Supper Optimal broth with Catabolite repression (SOC): These media were generally used for the preparation of competent bacterial cells (SOB) or for immediate bacterial recovery right after plasmid transformation. An SOB media was prepared by adding 20 g of tryptone, 5 g of yeast extract and 0.5 g of sodium chloride, 0.2 g of potassium chloride, 1 g of anhydrous magnesium chloride and 1.2 g of anhydrous magnesium sulphate into 1 litre of distilled water (pH adjusted to 7 when needed) and autoclave. SOC was similarly prepared just like SOB but with the addition of 3.6 g of sterile glucose after autoclaving.
M9 minimal salt: This was prepared by adding Na2HPO4 (6.9 g/liter), KH2PO4 (3 g/liter), NaCl (0.5 g/liter), NH4Cl (1 g/liter), CaCl2 (0.1 mM), MgSO4 (2 mM), and 0.5% w/v glycerol as the sole carbon source in the media. Usually, 1ml of the trace metal mixture solution is added to 1000 ml M9 medium. Agar base is routinely added when required for M9 minimal plates.
1000X Trace metal mix: This was prepared by adding 49 mg of Co(NO3)2.6H2O, 2860 mg of H3BO3, 222 mg of ZnSO4.7H2O, 1810 mg of MnCl.4H2O, 390 mg of Na2MoO4.2H2O2 and 79 mg of CuSO4.5H2O into 1 litre.
57
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods PYG broth: The broth was prepared by mixing 0.75% w/v Difco Proteose peptone, 0.75% w/v Oxoid yeast extract and 1.5% w/v glucose
Page’s modified Neff’s amoeba saline (PAS): PAS was prepared by mixing 1 Liter of distilled water, 120 mg of NaCl, 4 mg of MgSO4.7H2O, 4 mg of CaCl2.2H2O, 142 mg of Na2HPO4 and 36 mg of KH2PO4
Tris-EDTA (TE) buffer: The buffer was prepared by mixing equal volumes of 10 mM of Tris-HCl (pH 8.0) and 1 mM of EDTA (pH 8.0).
Tris-acetate-EDTA (TAE) buffer: This buffer was prepared by mixing of 2 M Tris-HCl, 2 M Acetic acid. 50 mM EDTA
1 M MgSO4: This was made by dissolving 24.6 g MgSO4·7H2O in 100 ml of distilled water.
0.9% Sodium Chloride (saline): The saline was prepared by dissolving 9 g NaCl (154 mM final concentration, 0.9% w/v) in 1 litre distilled water and filter-sterilized.
Paraformaldehyde fixation buffer (4%): For a 1l of 4 % paraformaldehyde, 800 ml of 1X PBS and 40 g of paraformaldehyde powder were mixed in a glass beaker on the heating plate at 60 ℃ under a ventilated fume hood. The solution was gradually stirred while adding drops of 1 M NaOH to raise the pH until the solution is clear and completely dissolved. The cooled solution was filtered before adjusting the pH to 6.9 using dilute HCl.
4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) Crystallized DAPI power was dissolved in dH2O to a final concentration of 3 mg/ml as a stock solution (Store at -20). For the working solution, the stock solution was diluted in methanol to a final concentration of 1 µg/ml (store at +2 to +8 ℃ for six months).
Rhodamine-Phalloidin working solution from cytoskeleton Inc: The staining reagent was received as pink solid (MW 1306). The tube containing the reagent was centrifuged briefly and reconstituted with 500 µl of 100 % methanol to create a 14 µM solution stock. Aliquots were stored at -20℃ until needed.
Phosphate buffered saline (PBS): The following items were mixed for 1x PBS and adjusted to pH 7.4 in
500 ml dH2O and sterilised by autoclaving; 8 g NaCl, 0.2 g KCl, 1.15 g Na2HPO4.7H2O, 0.20 g KH2PO4.
58
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods 2.2 DNA-related methods and technique
2.2.1 Oligonucleotide design, In silico-PCR and synthesis
Oligonucleotides (primers) listed in Appendix 1: Primer Table for this study were all designed using a combination of NCBI primer blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) and primer3/ primer3plus (http://insilico.ehu.es/primer3/ or http://www.bioinformatics.nl/cgi- bin/primer3plus/primer3plus.cgi) by the setting all the primer design parameters to the highest quality to increase primer specificity. The primers were then verified with In silco-PCR tool (http://insilico.ehu.es/PCR/) when required. All primers were synthesized by Sigma Aldrich (https://www.sigmaaldrich.com/united-kingdom.html) and received as lyophilized in tubes and then subsequently dissolved in nH2O at 10 pmol/ul and stored at -20℃.
2.2.2 Polymerase chain reaction (PCR)
GoTaq DNA polymerase (Promega)and KOD host start polymerase (Novagen) PCR kits, were used for all the PCR amplification of various DNA fragments in this work. GoTaq DNA polymerase was used for regular verification of PCR amplicons sizes in plasmids, mutant alleles and bacterial strains. However, all high-fidelity amplification of both short and long-range PCR products for cloning, mutant creation or sequencing was done using KOD Hot Start DNA polymerase. Manufacturer’s instructions were strictly followed in the used of these DNA enzymes for PCR amplification. Cycling conditions (see Table 2.3) were set per the primer melting temperature (lowest Tm-2℃) and predicted PCR amplicon size. Representative PCR cycling conditions for each enzyme are indicated in Table 2.3 below.
59
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Table 2.3 Typical PCR cycling conditions GoTaq DNA polymerase KOD Hot Start DNA polymerase Temperature Time Cycles Temp. ℃ Time Cycles
Standard Standard
Initial Denaturation 95℃ 2 min 1 95℃ 10 s 1
Cycle Denaturation 95℃ 30 s 95 20 s
Annealing (Lowest Tm-2)℃ 30 s 25 -30 (Lowest Tm-2)℃ 10 s 30
Cycle Extension 72℃ 1 min/ kb 72℃ 20 s/ kb
Final Extension 72℃ 5 min 1 72℃ 5 min 1 Sample Hold 4℃ Until use 4℃ Until use Touch down Touch down
Initial Denaturation 95℃ 2 min 1 95℃ 10 s 1
Cycle Denaturation 95℃ 30 s 95℃ 20 s Annealing Lowest (Tm-2)℃ +10℃, Lowest (Tm-2)℃ +10℃, 30 s 10 10 s 10 decrease by1 each cycle decrease by1℃ each cycle Cycle Extension 72℃ 1 min/ kb 68℃ 20 s/ kb
Cycle Denaturation 95℃ 30 s 95℃ 20 s
Annealing (Lowest Tm-2)℃ 30 s 20 (Lowest Tm-2)℃ 10 s 20-25
Cycle Extension 72℃ 1 min/ kb 68℃ 20 s/ kb
Final Extension 72℃ 5 min 1 72℃ 5 min 1
Sample Hold 4℃ Until use Until use
Representative standard and touchdown PCR conditions for GoTaq DNA polymerase and KOD Hot Start DNA polymerase.
2.2.3 Colony PCR
A representative colony was resuspended in 100µ l of nH20 and boiled at 100℃ for 10 minutes and gently vortexed. The cell debris was then pelleted at 12000 ×g for 2 minutes, and 1µl of the clear supernatant used as the DNA template for that colony.
2.2.4 Splice Overlap Extension (SOE)-PCR: Mutant allele construction
SOE-PCR technique was used to join DNA fragments together for plasmid and mutant allele creation in this study. A typical mutant allele consisted of a relevant antibiotic marker with or without GFP, and two homologous flanking arms/fragments all joined together as a single piece of DNA fragment that can be
60
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods cloned into a specified plasmid when required. The size of each homologue flanks (Left flank, LF and Right Flank, RF) for the target gene to be deleted ranged varied from 300 bp to 1 kb. The LF and RF of the SOE- PCR product are homologues to the upstream and downstream regions of the target gene. When required (for cloning into suicide vector), unique restriction sites were added to the extreme ends of mutant alleles (restrictions sites matching the sites on the multiple cloning site on the suicide vector). The mutant alleles that were used in the generation of most of the bacterial mutants (derivatives of K. pneumoniae H11286) for this study via lambda RED recombination did not carry any restriction sites unlike those used in creating suicide vector-based allelic exchange.
Another unique method of mutant allele creation was used in this study by using two primers (P1 and P2 as shown in Figure 2.1a) where 30 bp – 60 bp sequence of LF and RF were incorporated into both primers and used to amplify the antibiotic cassette/DNA fragment, resulting in an amplicon with 30- 60 bp LF and RF. Such unique mutant alleles or SOE-PCR product were less successfully in bacterial mutant creation, rather the creation of various molecular genetic tools (pDNTOOL plasmids) as described subsequent sections of this work. Occasionally, two more DNA fragments were joined together by simply design the primers (P4 and P5 as shown in Figure 2.1b) of both fragments to overlap with complementary sequences.
A typical multi-step SOE-PCR mutant allele creation method (shown in Figure 2.1c) was employed mainly in the creation of the bacterial mutants. Three amplicons were amplified using primer pair P7/P8 (LF), P9/P10 (RF) and Ab-F/Ab-R (antibiotic tic cassette with two flanking FRT sites). Note that, P8 /Ab-F primer pair and P9/Ab-R carry reverse complementary sequence at their 5’ ends. Mutant alleles were cloned into a suicide vector with the help of restriction-ligation enzymes or used directly as in the case of lambda RED recombination. During the SOE-PCR process (Figure 2.1a and Figure 2.1b), regular PCR was run using the variety of overlapping DNA fragments but without primers for 10-15 cycles. The PCR machine then paused at the extension phase for the addition of the external primers (P3 and P6 in Figure 2.1b and P10 and P11 in Figure 2.1c) and the PCR process was then allowed to continue for another 25-30 cycles.
61
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.1 Schematic of SOE-PCR for mutant allele creation or joining DNA fragment. A; a single step generation of mutant allele/ SOE-PCR product (with 30-60 bp complementary overlap on P1 and P2) used for bacterial mutant or genetic tool creation. P1and P2 were used to PCR-amplify the antibiotic cassette to create a mutant allele with 30-60 bp homologous flanks B; joining two DNA fragments by SOE-PCR (with 20- 30 bp complementary overlap on P4 and P5) for molecular tool construction. C; Multi-step SOE-PCR used in creating mutant alleles for the creation of bacterial mutants. Left flank (LF), Right flank (RF) and antibiotic cassette were amplified with primer-pair P7/P8, P9/P10 and Ab-F/Ab-R. Please note that P11 and P12 are not required for mutant allele creation, instead were used in the verification of successful bacterial mutants.
2.2.5 Genomic and plasmid extraction
Genomic DNA (gDNA), when needed from various bacterial strains, were routinely extracted from 500 µl of overnight bacterial culture using the 5prime ArchivePure DNA purification kit (VWR). All plasmid DNA (pDNA) were obtained from 5-15 ml overnight bacterial cultures with appropriate antibiotics using the Sigma Aldrich plasmid mini-prep kit (Sigma Aldrich). Kits were used according to manufacturer’s instructions.
62
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods 2.2.6 Gel electrophoresis, DNA purification and Sequencing
Gel electrophoresis for visualization of DNA fragments was routinely performed in 0.8 % to 1.5 % agarose gels (depending on the DNA fragments) made with agarose powder, 1× TAE buffer and 0.5 µg/ml ethidium bromide. Quick-Load 2-log DNA Ladder, λ-HindIII, or GeneRulerTM (Thermo Fisher) were used as DNA standards. DNA fragments were either visualized in the gel using gel documenting system (Bio-Rad) or excised and subsequently purified from the gel using YORBIO Gel/PCR DNA purification kit (Geneflow) following manufacturer’s instructions Quantification of purified DNA was done using Nanodrop DNA quantification system (Thermo Fisher) before being used in any downstream works or sequencing. PCR amplicons and plasmid inserts were routinely Sanger-sequenced by GATC Biotech.
2.2.7 Restriction digestion
All restriction enzymes were obtained from New England Biolabs, Promega and Roche and sored at -20℃ before usage. 25-50 µl reaction volume was routinely performed according to the manufacturer’s protocol, chosen enzymes and DNA amount. For complete digestion reaction, the required restriction enzymes were set up in a compatible buffer at 37℃ for 30 – 60 minutes and then ran on 0.8 -1 % agarose gel. All restriction digestions meant for downstream application were first heat-inactivated per manufacturer’s protocol.
2.2.8 DNA dephosphorylation and ligation
During ligation, to prevent linearized plasmids from self-ligation after restriction digestion, thermosensitive alkaline phosphatase (TSAP, Promega) was added to plasmid restriction digestion at 1 U/µg DNA. Once the reaction was completed, TSAP was inactivated at 74℃ for 15 minutes.
The ligation reaction was performed in a final volume of 10-30 µl containing 3-5 U of T4 DNA ligase (Promega) and 1-3 µl of 10× ligation buffer incubated at room temperature for one hour followed by 4℃ overnight incubation. The ligation mixture was then transformed into competent E. coli and subsequently selected with the appropriate antibiotic medium and temperature.
2.3 RNA-related techniques and methods
2.3.1 RNA extraction and cDNA library preparation
Norgen Total RNA purification kit (following manufacturer’s instructions) was used to extract total RNA from K. pneumoniae grown in LB for 16 h at 37℃ and 200 rpm) unless otherwise mentioned in specific experiments. Ambion TURBO DNA-free kit was used to remove residual DNA from RNA preparations,
63
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods and cDNA library was synthesized using QuantiTect Reverse Transcription Kit (Qiagen) per Manufacturer’s instructions Also, an identical reaction without reverse transcriptase was performed as a control to check for DNA contamination.
2.3.2 Transcriptional analysis of T6SS, T4SS and fimbrial gene clusters
Each cDNA library and its reverse transcriptase negative controls were analyzed for transcripts corresponding to hcp1 and vgrG1 (T6SS1), hcp2 and vgrG3 (T6SS3), virB4 and mob (T4SS3), fimH (Type 1 fimbriae), and mrkD (Type 3 fimbriae). The regions corresponding to hcp1, vgrG1, hcp2, vgrG3, virB4, mobB, fimH and mrkD were then PCR-amplified from the cDNA. Hcp and VgrG proteins (Hcp1, VgrG1 Hcp2 and VgrG3) are both structural and secreted proteins of T6SS. VirB4 and MobB are T4SS conjugal transfer ATPase and T4SS relaxosome-DNA coupling protein for T4SS conjugative machine while FimH and MrkD are fimbrial adhesins for type 1 and type 3 fimbriae respectively. Primer pair DN135/DN136 (136 bp) were used for hcp1, DN137/DN138 (167 bp) were used for vgrG1, DN139/DN140 (148 bp) were used for hcp2, DN141/DN142 (173 bp) were used for vgrG3, DN147/DN148 (189 bp) were used for virB4, DN149/DN150 (165 bp) were used for mobB, DN143/DN144 (187 bp) were used for fimH, DN145/DN146 (198 bp) were used for mrkD.
2.3.3 qRT-PCR analysis of T6SS, T4SS, fim and mrk fimbrial clusters.
For in vitro samples, 2 µl of 10-1 dilutions of cDNA library and its reverse transcriptase negative controls for each set of experiments were used for quantitative real-time PCR (qRT-PCR). qRT-PCR reactions (20 µl) were set up using SensiMix Plus SYBR (Bioline) according to the manufacturer’s instructions. Also, a reaction for internal control, rpoD, was set-up using DN151/DN152 primer-pair (164 bp). For hcp1(DN135/DN136), vgrG1 (DN137/DN138), hcp2 (DN139/DN140), vgrG3 (DN141/DN142), virB4 (DN147/DN148), mob (DN149/DN150), fimH (DN143/DN144), and mrkD (DN145/DN146), 10 pmol of each primer was added to the reaction mixture. Cycling conditions consisted of 40 cycles of 95ºC for 15 seconds, 60ºC for 15 seconds and 72ºC for 20 seconds. Each qRT-PCR reaction was performed in triplicate using the Qiagen Rotor Gene 6000. The relative quantification of hcp1, vgrG1, hcp2, vgrG3, virB4, mobB, fimH, and mrkD transcripts versus rpoD was determined according to the Pfaffl equation (Pfaffl, 2001).
2.4 Construction of pDNTOOL plasmids
Most clinical K. pneumoniae strains are resistant to a broad range of antibiotics (as is the case of K. pneumoniae HS11286), hence finding the right genetic tools to embark on a successful study of the bacterium can be problematic. This section describes all the useful plasmid-based tool (pDNTOOLs) that
64
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods were carefully constructed to make available and aid in the genetic manipulation of most Gram-negative bacteria, including K. pneumoniae and E. coli. The constructed plasmids, pDNTOOLs, were of significant use in this work and beyond, as was the case with colleague lab members and collaborators. The pDNTOOLs are categorized into suicide deletion vectors, lambda RED recombination-based plasmids, necessary antibiotic resistance cassettes with or without GFP flanked by FRTs, flippase-FRT recombination-based plasmids and expression vectors.
2.4.1 Construction of suicide deletion vectors
Unlike K. pneumoniae HS11286, K. pneumoniae NTUH-K2044 is a hyper-mucoid strain and transformation with mutant alleles were unsuccessful for mutant creation, as such, a suicide plasmid-based allelic exchange was employed for the production of T6SS mutants. A lambda pir dependent plasmid, pJTOOL-3, encoding chloramphenicol resistance (cat gene) to was used as the backbone for the constructions of K. pneumoniae NTUH-K2044 T6SS1 and T6SS3 deletion vectors (See Figure 2.2 and Figure 2.3). First, T6SS1 mutant allele (2595 bp) was SOE-PCR constructed using the primer pairs DN1/DN2 (LF,733 bp), DN3/DN4 (RF, 852 bp) and Gm-F/ Gm-R (gentamicin resistance cassette 1052 bp), while DN7/DN8 (910 bp), DN9/DN10 (845 bp) and Gm-F/ Gm-R were used for T6SS3 mutant allele (2760 bp). The T6SS mutant alleles were then separately cloned into the spel/ xhol sites of pJTOOL-3 and transformed into E. coli cc18λpir resulting in pDNTOOL-8 (for T6SS1) and pDNTOOL-9 (for T6SS3). Plasmids were verified phenotypically for both gentamicin and chloramphenicol resistance and genotypically by restriction digestion, PCR and sequencing. The plasmids transformed into E. coli cc18λpir were purified and later transformed into E. coli s17λpir for conjugation with K. pneumoniae NTUH-K2044.
65
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.2 Construction of K. pneumoniae NUTH-K2044 T6SS1 deletion vector, pJTOOL-8. T6SS1 LF (733 bp) and RF (852 bp) were amplified from K. pneumoniae NTUH-K2044 using DN1/DN2 and DN3/DN4 primer-pairs respectively while aacC1 (1052 bp) was amplified from pUC18R6K-mini-Tn7t-Gm using GmF/GmR primer-pair. The three amplicons, LF, RF and aacC1, were SOE-PCR joined and amplified using DN1/DN4 to produce K. pneumoniae NUTH-K2044 T6SS1 allele which was SpeI/XhoI-cloned into pJTOOL-3 to yield pDNTOOL-8
66
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.3 Construction of K. pneumoniae NUTH-K2044 T6SS3 deletion vector, pDNTOOL-9. T6SS3 LF (910 bp) and RF (845 bp) were amplified from K. pneumoniae NTUH-K2044 using DN7/DN8 and DN9/DN10 primer-pairs respectively while aacC1 (1052 bp) was amplified from pUC18R6K-mini-Tn7t-Gm using GmF/GmR primer-pair. The three amplicons, LF, RF and aacC1, were SOE-PCR joined and amplified using DN7/DN10 to produce K. pneumoniae NUTH-K2044 T6SS3 allele which was SpeI/XhoI-cloned into pJTOOL-3 to yield pDNTOOL-9
A successful attempt was made to create a different antibiotic resistance version of pJTOOL-3 by replacing the chloramphenicol resistance-encoding gene (cat) with different antibiotic cassettes. These constructed plasmids were used to increase the pool of the genetic tools for the that can be used the manipulation of MDR strains such as K. pneumoniae HS11286. To this end, apramycin (pDNTOOL-6) and hygromycin
67
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods resistance (pDNTOOL-6) version of pJTOOL-3 were created by using lambda RED recombination-based allelic exchange.
To create pDNTOOL-6, PCR products of DN13/DN14 (LF, 503 bp) and DN15/DN16 (RF, 520 bp) both amplified from pJTOOL-3 and DN17/DN17 (apramycin cassette from PKOBEG-apra, 839bp) were joined by SOE-PCR to produce 1809 bp PCR product that was used as mutant allele in the replacement of cat in pJTOOL-3. The 1809 bp SOE-PCR product (2-5 µg) was transformed into an 0.2 % arabinose-induced competent E. coli cc18λpir carrying both the target (pJTOOL-3) and the lambda RED-recombination-based (pKD46) plasmids and recovered in apramycin plate at 37℃. The grown colonies were then parallel patched on chloramphenicol apramycin and ampicillin LB agar plates for loss of chloramphenicol and ampicillin.
Similarly, hygromycin version of pJTOOL-3 (pDNTOOL-7) was constructed by using PCR products of DN13/DN14, DN15/DN16 and DN19/DN20 (hph, 1058 bp) to produce SOE-PCR product of 2022 bp. The hygromycin SOE-PCR products (2-5 µg) was transformed into 0.2 % arabinose induced competent E. coli cc18λpir (with pJTOOL-3 and pKD46) and recovered in hygromycin plate at 37℃. Colonies were then parallel patched on chloramphenicol hygromycin and ampicillin LB agar plates for the loss of chloramphenicol and ampicillin resistance but not hygromycin.
As usual, all the constructed lambda-pir dependent suicide plasmids (pDNTOOL-6, pDNTOOL-7, pDNTOOL-8 and pDNTOOL-9) were verified by PCR, restriction digestion and sequencing (when needed) relative to the parent plasmid, pJTOOOL-3.
2.4.2 Variety of Lambda RED plasmids with different antibiotic resistance cassette
To further enhance the use of lambda RED recombination tools for easy access and usage in a variety of genetic manipulations in Gram-negative MDR bacteria, pDNTOOOL-10 to pDNTOOL-16, which are different antibiotic resistance versions of pKD46 and pKOBEG-Apra were constructed.
First, a PCR product of primer-pair DN21/DN22 (sacB-cat, 2199 bp) from pJTOOL-3 was cloned separately cloned into the inverse-PCR products of DN23/DN24 (10 kb from pKD46) or DN24/DN25 (6 kb from pKOBEG-apra) using PacI and ApaI sites, this gave rise to pDNTOOL-13 (see Figure 2.4a) or pDNTOOL-16 (see Figure 2.4b) respectively. The individual ligation mixtures were then transformed into E. coli DH5α and recovered in LA chloramphenicol plate at 30℃. Apramycin and ampicillin resistance- encoding genes in PKOBEG-apra and PKD46 were successfully replaced with sacB-cat genes encoding levansucrase for negative selection (only in the presence of sucrose) and chloramphenicol resistance. Subsequently, these plasmids (pDNTOOL-13 and pDNTOOL-16) were PCR and restriction digest verified.
68
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.4 Construction of pDNTOOL-13 and pDNTOOL-16. A. sacB-cat amplicon (DN21/DN22, 2199 bp) from pJTOOL-3 was cloned into pKD46-backbone (DN23/DN24, 5488 bp) to replace the ampicillin resistance-encoding gene; thus pDNTOOL-13 encoding SacB and chloramphenicol resistance. B. The plasmid pDNTOOL-16 was constructed by amplifying sacB-cat amplicon (DN21/DN22, 2199 bp) from pJTOOL-3 was cloned into pKOBEG-Apra-backbone (DN25/DN26, 6137 bp) to replace the apramycin resistance-encoding gene. For the transformation of ligation mixtures and recovery of E. coli carrying pDNTOOL-13 or pDNTOOL-16, incubation was done at 30℃ in LA supplement with chloramphenicol.
To construct plasmids pDNTOOL-10, pDNTOOL-11 and pDNTOOL-12, which are all pKD46 variants (apramycin, gentamicin and kanamycin respectively), the 1-2 µg PCR products of DN27/DN28 (aac(3)-IV = 853 bp) from PKOBEG-Apra, DN29/DN30 (aacC1 = 598 bp) from pUC18R6K-mini-tn7t-Gm and DN31/DN32 (aph = 859 bp) from pJTOOL-8 were individually transformed into 0.2 % arabinose-induced competent E. coli DH5α carrying only pDNTOOL-13. The transformants were recovered in LA apramycin, LA gentamicin and LA kanamycin plate with sucrose (5 %) at 30℃. Selection on sucrose aided the loss of residual pDNTOOL-13 still carrying sacB-cat that was not replaced with apramycin, gentamicin or kanamycin encoding PCR product while maintaining the successful plasmids, pDNTOOL-10 (encoding apramycin resistance), pDNTOOL-11 (encoding gentamicin resistance) and pDNTOOL-12 (encoding kanamycin resistance) respectively. The E. coli DH5α carrying pDNTOOL-10 colonies were parallel- patched on ampicillin and apramycin for loss of ampicillin but apramycin. E. coli DH5α carrying 69
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods pDNTOOL-11 were parallel-patched on ampicillin and gentamicin for loss of ampicillin but not gentamicin. Also, E. coli DH5α carrying pDNTOOL-11 were parallel-patched on ampicillin and kanamycin for loss of ampicillin but not kanamycin.
For the construction of pDNTOOL-14, pDNTOOL-15 and pDNTOOL-17, 1-2 µg PCR products of DN33/DN34 (hph, 1059 bp), DN35/DN36 (aph, 859 bp) and DN36/DN37 (aacC1, 598 bp) were transformed into 0.2% arabinose-induced competent E. coli DH5α carrying only pDNTOOL-16. The transformants were separately recovered in hygromycin (for pDNTOOL-14,), kanamycin (for pDNTOOL- 15) and gentamicin (for pDNTOOL-17) plates with 5 % sucrose at 30℃. Selection on sucrose aided the loss of residual pDNTOOL-16 whose sacB-cat) was not replaced with hygromycin, kanamycin or gentamicin while maintaining the successful plasmids (pDNTOOL-14, pDNTOOL-15 and pDNTOOL-17). E. coli DH5α carrying pDNTOOL-14 colonies were parallel-patched on apramycin and hygromycin for the loss of apramycin but not hygromycin. E. coli DH5α carrying pDNTOOL-15 were parallel-patched on apramycin and kanamycin for loss of apramycin resistance, but not kanamycin resistance. Finally, E. coli DH5α carrying pDNTOOL-17 were parallel-patched on apramycin and gentamicin for the loss of apramycin but not gentamicin. All lambda RED variant plasmids were verified using restriction digestion and PCR.
2.4.3 FRT-based antibiotic cassettes/ GFP plasmids
Generally, the selection of antibiotic resistance markers for genetic manipulation in MDR K. pneumoniae strains (which was the case of K. pneumoniae HS11286) poses a significant difficulty. Hence, a successful attempt was made to increase the pool of FRT-based antibiotic markers that can be repeatedly used in creating a clean markerless gene knockout in most Gram-negative bacterial strains.
To create pDNTOOL-32, primer-pair DN39/DN40 (707 bp) was used to amplify cat gene from pJTOOL- 3 and SOE-PCR joined together with LF and RF from pUC18R6K-mini-tn7t-Gm using primer pairs DN45/DN46 (617 bp) and DN47/DN48 (610 bp), respectively. The 1887 bp LF-cat-RF SOE-PCR product (1-2 µg) was then transformed into 0.2 % arabinose-induced competent E. coli DH5α carrying target plasmid pUC18R6K-mini-tn7t-Gm and pDNTOOL-15 (lambda red recombination variant) The transformants were recovered in LB + chloramphenicol at 37℃. The grown colonies were then parallel- patched on chloramphenicol, kanamycin and gentamicin LB agar plates for the loss of kanamycin and gentamicin resistance but not chloramphenicol. The FRT-cat-FRT based plasmid, pDNTOOL-32, was further verified by restriction digestion and PCR.
The plasmid pDNTOOL-31 (Figure 2.5a) was created by amplifying sacB-cat, (2199 bp) from pJTOOL-3 using primer-pair DN41/DN42 and Mlul/ Pacl-cloning it into an inverse-PCR product of 3796 bp amplicon
70
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods from pUC18R6K-mini-tn7t-Gm (amplified with DN43/DN44). The ligation mixture of sacB-cat and pUC18R6K-mini-tn7t-Gm backbone which was transformed into competent E. coli DH5α resulted in the replacement of the aacC1 gene in pUC18R6K-mini-tnt-Gm with sacB-cat genes. This plasmid, pDNTOOL-31 (carrying FRT-sacB-cat-FRT) was subsequently used as a parent plasmid with negative (sacB) and positive selection (cat) for the creation of other FRT-based antibiotic cassettes in the pUC18R6K-mini-tn7t backbone. Plasmid pDNTOOL-31 was now used as parent plasmid in the creation of pDNTOOL-1 (pUC18R6K-mini-tn7t-aac(3)-IV) pDNTOOL-33 (pUC18R6K-mini-tn7t-hph), pDNTOOL-34 (pUC18R6K-mini-tn7t-hph-gfp) and pDNTOOL-35 (pUC18R6K-mini-tn7t-aac(3)-IV- gfp).
To create plasmid pDNTOOL-1 carrying FRT-aac(3)-IV-FRT (Figure 2.5b), the amplicons of DN54/DN55 (aac(3)-IV, 836 bp) from pKOBEG-Apra, DN45/DN46 (LF, 617 bp) and DN47/DN48 (RF, 610 bp) from pDNTOOL-31 were SOE-PCR joined together to create a mutant allele ( 2016 bp) targeting the replacement of sacB-cat in pDNTOOL-31. The LF-aac(3)-IV-RF SOE-PCR product (2-5 µg) was transformed into 0.2 % arabinose-induced competent E. coli DH5α carrying target plasmid pDNTOOL-31 (FRT-sacB-cat-FRT version of pUC18R6K-mini-tn7t) and pDNTOOL-15 (lambda red recombination variant). The transformants were recovered on apramycin plate with sucrose (5 %) at 37 ℃. Colonies were parallel patched for loss of chloramphenicol and kanamycin resistance but not apramycin. Restriction digest and PCR were used to further verify the plasmid, pDNTOOL-1.
71
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.5 Construction of pDNTOOL-31 and pDNTOOL-1. A. Construction of pDNTOOL-31, carrying sacB-cat insert as a negative (sacB in the presence of sucrose) and positive (chloramphenicol) selection markers during lambda RED mutagenesis. The backbone amplicon of pUC18R6K-mini-tn7t- Gm without the aacC1 and sacB-cat amplicon were digested with MluI and PacI enzymes, ligated and transformed into E. coli to give rise to pDNTOOL-31. B. Construction of pDNTOOL-1 was done by transforming a 0.2% arabinose induced competent E. coli carrying pDNTOOL-31 and lambda RED plasmid pDNTOOL-15 with a 2 kb LF-aac(3)-IV-RF SOE-PCR product and recovered on apramycin at 37℃. Similarly, pDNTOOL-33, pDNTOOL-34 and pDNTOOL-35 were all constructed by transforming 0.2% arabinose induced competent E. coli carrying pDNTOOL-31 and pDNTOOL-15 with SOE-PCR products (LF-hph-RF, LF-hph-gfp-RF and LF- aac(3)-VI-gfp-RF and transformants were recovered on LA plus respective antibiotics at 37℃. Also, pDNTOOL-36, pDNTOOL-37 and pDNTOOL-38 construction were done by transforming, the SOE-PCR products (LF-sacB-aacC1-RF, LF-sacB-hph-RF and LF-sacB-aac(3)-IV-RF) into an E. coli carrying pDNTOOL-32 and pDNTOOL-15 and the transformants were recovered in the gentamicin, hygromycin and apramycin without sucrose at 37℃.
Like pDNTOOL-1 construction, pDNTOOL-33 was constructed by first SOE-PCR joining the hph amplicon DN49/DN50 (1046 bp) from pMQ300 to pDNTOOL-31 LF (DN45/DN46, 617 bp) and RF (DN47/DN48, 610 bp) amplicons. The resultant SOE-PCR product (LF-hph-RF, 2226 bp), was transformed into 0.2 % arabinose-induced competent E. coli DH5α carrying target plasmid pDNTOOL-31 (carrying FRT-sacB-cat-FRT) and pDNTOOL-15 (lambda red recombination) and recovered in hygromycin LA plate with sucrose (10%) at 37℃. Grown colonies were parallel-patched on hygromycin, chloramphenicol
72
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods LA plates. The plasmid was restriction-digest and PCR. In PDNTOOL-33, hph replaced the sacB-cat and is flanked by two FRTs.
The fluorescent-tagged (GFP) pDNTOOL-34 was constructed from by first joining hph (DN49/DN51, 1043 bp) with gfp (DN52/DN53, 912 bp) amplicons amplified from pMQ300 and pIM438, respectively. The hph-gfp SOE-PCR product (1935 bp) is further joined together with pDNTOOL-31 LF (DN45/DN46, 617 bp) and RF (DN47/DN48, 610 bp) amplicons to form a mutant allele (LF-hph-gfp-RF, 3115 bp) that was used for the replacement of sacB-cat in pDNTOOL-31. The LF-hph-gfp-RF mutant allele was transformed into 0.2 % arabinose-induced competent E. coli DH5α carrying target plasmid pDNTOOL-31 and pDNTOOL-15 and recovered in hygromycin LA plate with sucrose (5 %) at 37℃. Colonies were verified phenotypically by parallel-patching and fluorescent microscopy and genotypically by restriction digest and PCR.
To construct pDNTOOL-35, SOE-PCR was used to join aac(3)-IV (DN54/DN56, 836 bp) and gfp (DN52/DN53 912 bp) to yield 1725 bp PCR product in the first round. The second round of SOE-PCR was performed using the 1.7 kb aac(3)-VI-gfp SOE-PCR product together with pDNTOOL-31 LF (DN45/DN46, 617 bp) and RF (DN47/DN48, 610 bp) amplicons. The LF-aac(3)-IV-gfp- RF SOE-PCR product (2905 bp) was then transformed into 0.2 % arabinose-induced competent E. coli DH5α carrying target plasmid pDNTOOL-31 ( with FRT-sacB-cat-FRT) and pDNTOOL-15 (lambda red recombination) The transformed were recovered in apramycin LA plate with sucrose (10%) at 37℃. Colonies were parallel- patched on LA apramycin, chloramphenicol and kanamycin to ensure the loss of both kanamycin resistance (encoded by temperature-sensitive plasmid pDNTOOL-15) and chloramphenicol (encoding by pDNTOOL- 31). Any colony with residual pDNTOOL-31 and pDNTOOL-15 were lost due to the negative sacB selection and temperature-sensitive origin of replication (37-42℃), respectively
Three more negative-positive antibiotic selections marker plasmids flanked by FRTs (pDNTOOL-36, pDNTOOL-37 and pDNTOOL-38) were created for other genetic manipulation purposes.
An FRT-sacB-aacC1-FRT based plasmid (pDNTOOL-36) was created by SOE-PCR joining sacB (DN57/DN58, 1543 bp) and aacC1 (DN59/DN60, 578 bp) amplicons in the first round to give 2100 bp product. The second round of SOE-PCR joining was doing by SOE-PCR joining LF (DN45/DN46, 617 bp from pDNTOOL-32) and RF (DN47/DN48, 610 bp from pDNTOOL-32) amplicons with the PCR product from the first round, this resulted in a final 3280 bp SOE-PCR product (LF-sacB-aacC1-RF). The LF-sacB- aacC1-RF SOE-PCR product (1-2µg) was transformed into 0.2 % arabinose-induced competent E. coli DH5α carrying target plasmid pDNTOOL-32 and pDNTOOL-15. The transformants were recovered in gentamicin LA plates at 37℃ resulting in the lost chloramphenicol resistance as the cat gene was replaced
73
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods with the FRT-sacB-aacC1-FRT and no pDNTOOL-15. The colonies were parallel-patched on gentamicin, chloramphenicol and kanamycin and the final plasmid, pDNTOOL-36, was verified by restriction digest and PCR.
Like pDNTOOL-36 construction, FRT-sacB-hph-FRT based plasmid (pDNTOOL-37) and FRT-sacB- aac(3)-IV-FRT based plasmid (pDNTOOL-38) were created by transforming the respective a 0.2 % arabinose-induced competent E. coli DH5α (carrying pDNTOOL-32 and pDNTOOL-15) with 1-2µg SOE- PCR products (LF-sacB-hph-RF and LF-sacB-aac(3)-IV-RF respectively). Four amplicons using primer- pair DN61/DN62 (to amplify hph from pMQ300, 1043 bp), DN57/DN58 (sacB from pJTOOL-3, 1543 bp), DN45/DN46 (LF from pDNTOOL-32, 617 bp) and DN47/DN48 (RF from pDNTOOL-32, 610 bp) were joined together to produce 3745 bp LF-sacB-hph-RF mutant allele that was used for the construction of pDNTOOL-37. For the construction of pDNTOOL-38, a 3535 bp SOE-PCR product (LF-sacB-aac(3)-IV- LF) was produced from DN57/DN58, (sacB from pJTOOL-3, 1543 bp), DN63/DN64 (aac(3)-IV amplified from pKOBEG-Apra, 833 bp ), DN45/DN46 (LF from pDNTOOL-32, 617 bp) and DN47/DN48 (RF from pDNTOOL-32, 610 bp) for construction of pDNTOOL-38. Transformant colonies were parallel patched on hygromycin or apramycin, chloramphenicol and kanamycin and the right plasmids were verified by PCR and restriction digestion.
2.4.4 Flp recombinase- encoding plasmid construction
Flp-recombinase encoding plasmid is very important in the creation of markerless mutant when used in combination with FRT-based antibiotic cassettes. This ensured the repeated used of a single antibiotic cassette in the same MDR K. pneumoniae while creating multiple gene knockouts in that strain. To increase the availability of antibiotic-resistant variants of Flp-recombinase encoding plasmids that mediate FRT recombination, pDNTOOL-2, pDNTOOL-18, pDNTOOL-19, pDNTOOL-20 and pDNTOOL-21 were constructed.
74
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.6 Construction of pDNTOOL-19 and pDNTOOL-2. A. Construction of inducible Flp recombinase-expressing plasmid, pDNTOOL-19; a 1.29 kb flp insert ( amplified from pFLP2 using DN75/DN76 primer-pair) was cloned into a 5 kb pKOBEG-Apra backbone (amplified from pKOBEG-Apra using DN77/DN78 primer-pair), the flp gene essentially replaced the three lambda red genes B. Construction of pDNTOOL-2: a 1.2 kb insert (amplified using DN65/DN66 primer-pair and pKOBEG-Apra as PCR template) was cloned into pFLP2 backbone (amplified from pFLP2 using DN73/DN74 primer-pair), resulting in the loss of the beta-lactamase expressing gene. Just like pDNTOOL-2 construction, pDNTOOL-18, pDNTOOL-20 and pDNTOOL-21 were constructed by cloning an antibiotic cassette (hph, aacC1 or aph genes respectively) into the pFLP2 backbone.
Antibiotic variants of pFLP2 were constructed by amplifying and ligating 8187 bp pFLP2- backbone (DN73/DN74 primer- pair) amplicon with PCR product of the primer-pair DN65/DN66 (1208 bp aac(3)- IV from pKOBEG-Apra), DN67/DN68 (1198 bp hph from pMQ300), DN69/DN70 (828 bp aacC1 from pUC18R6K-mini-Tn7t-Gm) or DN71/DN72 (1072 bp aph from pJTOOOL-8), respectively. The ligation mixtures were individually transformed into E. coli DH5α and recovered at 37℃ in apramycin (for pDNTOOL-2, see Figure 2.6b), hygromycin (for pDNTOOL-18), gentamicin (for pDNTOOL-20) or kanamycin (for pDNTOOL-21).
75
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods Also, arabinose inducing flippase expression plasmid (pDNTOOL-19, see Figure 2.6a) was constructed by amplifying flippase encoding gene from pFLP2 and cloning it in place of the lambda red recombination encoding genes in pKOBEG-Apra. Briefly, the PCR product of flp amplicon (1290 bp) using the primer- pair DN75/DN76 and was PstI/ ApaI digested and ligated to the 5036 bp pKOBEG-backbone amplicon (using primer-pair DN77/DN78). The ligation mix was transformed into E. coli DH5α and recovered at 30℃ on apramycin LA for pDNTOOL-19.
All the Flp recombinase-expressing plasmids (pDNTOOL-2, pDNTOOL-18, pDNTOOL-19, pDNTOOL- 20 and pDNTOOL-21) were verified by restriction digestion and PCR and the strains carrying the respective plasmids were subsequently archived in BHI with 30 % glycerol at -80℃.
2.4.5 Cloning and inducible expression plasmids/ GFP plasmid Construction
Several expressing plasmids (from pDNTOOL-3, pDNTOOL-4, and pDNTOOL-22 to pDNTOOL-30) were constructed using amplicons from the pWSK29 backbone, an inducible promoter from pKOBEG- Apra, pKPHS6 and different antibiotic markers with or with GFP. First, pDNTOOL-22 was created by PCR amplifying and ligating pWSK29 backbone (using primer-pair DN81/DN82, 4591 bp) and sacB-cat amplicons (using primer-pair DN79/DN80, 2225 bp from pJTOOL-3). The ligation mix was then transformed into E. coli DH5α. The transformants carrying pDNTOOL-22 (see Figure 2.7) were recovered on chloramphenicol before being parallel-patched on chloramphenicol and ampicillin. Colonies with only chloramphenicol resistance were considered for molecular confirmation of pDNTOOL-22 (by plasmid extraction, restriction digestion a PCR)
To construct pDNTOOL-3 (as shown in Figure 2.7), pDNTOOL-4, pDNTOOL-23 and pDNTOOL-24 (apramycin, hygromycin, gentamicin and kanamycin versions of pWSK29), the PCR products of aac(3)- IV (DN83/DN84, 849 bp from pDNTOOL-1), hph (DN85/DN86, 1059 bp from pMQ300), aacC1 (DN87/DN88, 594 bp from pUC18R6K-mini-tn7t-Gm) and aph (DN89/DN90, 855 bp from pJTOOL-8) were individually transformed into 0.2% arabinose induced competent E. coli DH5α carrying both pDNTOOL-22 and pKD46. The transformants were recovered in their respective antibiotic LA plates at 37℃ and patched on chloramphenicol, ampicillin and the associated antibiotic plates (apramycin, hygromycin, gentamicin or kanamycin). In each case, only colonies that were not resistant to chloramphenicol and ampicillin but resistant to apramycin (pDNTOOL-3), hygromycin (pDNTOOL-4), gentamicin (pDNTOOL-23) or kanamycin (pDNTOOL-24) were considered for restriction-digest and PCR confirmation.
76
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.7 Construction of pDNTOOL-22 and pDNTOOL-3. First, pDNTOOL-22 was constructed by digesting and ligating PCR amplified pWSK29 backbone (using primer- pairDN81/DN82) and sacB-cat (using primer-pair DN79/DN80). The resultant plasmid, pDNTOOL-22 was the target plasmid for the replacement of sacB-cat with aac(3)-IV gene (DN83/DN84 amplified from Pdntool-1) for the construction of pDNTOOL-3. The PCR product, aac(3)-IV) consisting of 30-40 bp left and right flanks homologous to pDNTOOL-22 target plasmid was used to transform arabinose induced competent E. coli DH5αharbouring pDNTOOL-22 and pKD46 and recovered at 37℃. Like the construction of and pDNTOOL-3, the same strategy was employed in the creation of pDNTOOL-4 (encoding hygromycin resistance), pDNTOOL-23 (encoding gentamicin resistance), pDNTOOL-24 (encoding kanamycin resistance) and their GFP-expressing variants.
GFP expressing variants of the pDNTOOL-3, pDNTOOL-4, pDNTOOL-23 and pDNTOOL-23 were constructed by ligating gfp amplicon from pIM438 to the 3’ends of the induvial antibiotic cassettes for each case. The GFP expressing pDNTOOL-25 was constructed by transforming E. coli DH5α (carrying pDNTOOL-22 and pKD46) with aac(3)-IV-gfp (DN91/ND92, 1738 bp) PCR amplicon from pDNTOOL- 35 and selecting them on apramycin LA plate grown at 37 ℃. Transformant colonies were patched on chloramphenicol, ampicillin and apramycin and colonies with only GFP expressing apramycin resistance were verified by fluorescent microscopy, restriction-digest and PCR. The GFP expressing pDNTOOL-26 with hygromycin resistance was constructed by transforming E. coli DH5α carrying both pDNTOOL-22 and pKD46 with hph-gfp (DN93/ND94, 1948 bp) PCR amplicon from pDNTOOL-34 and subsequently
77
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods selecting the transformants hygromycin LA plate at 37 ℃. Transformant colonies were patched on chloramphenicol, ampicillin and hygromycin and colonies that were only apramycin resistant and GFP expressing under fluorescent microscopy were verified by restriction digest and PCR.
The GFP expressing pDNTOOL-27 was constructed by transforming E. coli DH5α carrying both pDNTOOL-22 and pKD46 with aacC1-gfp SOE-PCR product (1483 bp) of aacC1 (DN95/DN96 583 bp from pUC18R6K-mini-tn7t-Gm) and gfp amplicon (DN52/DN97, 919 bp from pIM438). Transformant colonies were patched on chloramphenicol, ampicillin and apramycin and colonies with only apramycin resistance and GFP expressing under fluorescent microscopy were verified by restriction digest and PCR. While GFP expressing pDNTOOL-28 was constructed by transforming E. coli DH5α carrying both pDNTOOL-22 and pKD46 with aph-gfp, (1744 bp) SOE-PCR amplicon. The SOE-PCR product was done by joining aph amplicon (DN99/DN100, 844 bp from pJTOOL-8) and gfp amplicon (DN52/DN97, 919 bp from pIM438). The transformant colonies were parallel-patched on chloramphenicol, ampicillin and apramycin and only GFP expressing kanamycin-resistant colonies were verified using fluorescent microscopy, restriction digest and PCR.
Finally, two additional protein expression plasmids (pDNTOOL-29 and pDNTOOL-30) with arabinose inducible promoters with or without GFP at the MCS site, were constructed for future protein expression, GFP tagging and complementation studies. The PCR amplicons of DN101/DN102 (1334 bp from pKPHS6) and DN103/DN104 (1287 bp from pKD46) were joined together to produce a 2586 bp SOE-PCR amplicon (pKPHS6 backbone + arabinose-inducible promoter) with NotI and KpnI sites. A transcriptional terminator sequence was amplified from pKD46 with DN106/DN107 (308 bp) and then used as a template in second PCR re-amplification using DN105/DN107 (329 bp). Also, aacC1 was amplified from pUC18R6K-mini- Tn7t-Gm using DN108/DN109 (854bp). The final transcriptional terminator amplicon (332 bp) and the aacC1 amplicon were joined together to produce 1140 bp SOE-PCR product with NotI and KpnI sites. The two SOE-PCR products (2586 bp and 1144 bp) were digested (NotI and KpnI) and ligated and subsequently transformed into E. coli DH5α at 37 ℃. The transformant carrying pDNTOOL-29 (3.7 kb as shown in Figure 2.8) were recovered on gentamicin LA plate and verified by restriction digest and PCR.
78
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.8 Construction of pDNTOOL-29 and pDNTOOL-30. The backbone of pKPHS6 was amplified from K. pneumoniae HS11286 was joined by SOE-PCR with araC-ParaB amplicon from pKD46 to yield a 2.6 kb SOE-PCR product. Also, aacC1 amplicon from Puc18r6k-mini-tn7t-Gm was SOE-PCR joined with a tL3-mcs amplicon, resulting in a 1140 bp SOE-PCR product. The 2.6 kb amplicon and 1.1 kb amplicon were digested with NotI and KpnI and ligated to produce a 3.7 kb plasmid. The ligation mixture was transformed into E. coli DH5α. To confirm the arabinose inducibility of pDNTOOL-29, a gfp amplicon from pIM438 was also cloned inframe into the multiple cloning site (at PacI/SphI sites) resulting in pDNTOOL-30
To confirm the arabinose inducibility of the promoter for gene expression and as well create protein-GFP tagging tool, pDNTOOL-30 (see Figure 2.8) was constructed by re-amplifying a 752 bp gfp amplicon (DN111/DN112, from pIM438) with primer-pair DN110/DN112 (773 bp) and the final gfp amplicon was digest (SphI/ PacI) and ligated to form pDNTOOL-29. The ligation mix was transformed into E. coli DH5α at 37 ℃, and the transformants were recovered in gentamicin LA and verified by fluorescent microscopy, restriction-digestion and PCR.
79
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods 2.5 Genetic manipulation
2.5.1 Preparation of Competent bacterial cells
Generally, all plasmid and linear DNA were transformed into chemically competent or electrocompetent bacterial cells. While the transformations of DNA into E. coli were primarily done using both chemically and electrocompetent cells, K. pneumoniae transformation was only done in electrocompetent cells to maximize the transformation efficiency.
2.5.1.1 Chemically competent E. coli preparations and transformation Chemically competent E. coli DH5α, CC118-λpir and S17-λpir were prepared by inoculating 5 ml LB + appropriate antibiotics /additional supplements (e.g. L-arabinose) if required in a 20 ml tube at 37℃ 200 rpm overnight. E. coli carrying temperature-sensitive origin of replication such pKD46and pKOBEG-Apra derivatives were grown at 30℃ to avoid loss of the plasmid. The overnight culture was subcultured (1:100 ration) into fresh sterile 1 L LB broth with appropriate supplements or antibiotics if required. The cells were then grown in the proper temperature (30℃ or 37℃) with shaking at 200 rpm until they reached OD600nm of 0.3 to 0.4. The cells were harvested (3000 ×g 10 minutes at 4℃) and gently washed three times with 50 ml ice-cold 100 mM MgCl2 (Sigma Aldrich, UK) with intermittent ice incubation for 10 minutes. The final cell pellet was resuspended in 5 ml ice-cold, sterile 100 mM CaCl2 (Sigma, UK) in 15 % (w/v) glycerol (Fisher, UK) and 50 µl aliquots were stored in -80℃ until needed.
To transform the chemically competent E. coli using heat shock method, DNA ligation mixture (1-4 µl), plasmid (10-100 ng) or linear DNA (50 ng– 500 ng) was gently mixed with 50 µl aliquot of thawed chemically competent E. coli on ice. The DNA-bacterial mixture was ice-incubated for 20 minutes before placing the tube of the DNA-bacteria mixture in a heat block at 42℃ for 45 seconds and immediately returned on the ice. After 2 minutes of ice-incubation, 950 µl of Super Optimal broth with catabolite repression (SOC) broth was added to the DNA-bacteria mixture and incubated at 30 or 37 with shaking (200 rpm) for 1.5 h. The transformant cells were then recovered in LA plates containing the appropriate antibiotics and or supplements.
2.5.1.2 Electrocompetent cells preparation and transformation To prepare electrocompetent E. coli or K. pneumoniae, a single colony of the bacteria was inoculated 5 ml LB + appropriate antibiotics /additional supplements (e.g. L-arabinose) if required in a 20 ml tube at 30℃
80
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods or 37℃ 200 rpm overnight. E. coli or K. pneumoniae carrying temperature-sensitive origin of replication such pKD46 and pKOBEG-Apra derivatives were grown at 30℃ to avoid loss of the plasmid. The overnight bacterial culture was subcultured (1:100 ration) into fresh sterile LB broth with appropriate supplements/ antibiotics if required and grown until cells reached OD600nm of 0.3 to 0.4 The cells were pelleted (3000 ×g 10 minutes at 4℃) and washed three times with successively smaller volumes (100 ml, 50 ml and 25 ml) of ice-cold 10 % (v/v) glycerol. After the final wash, the cells were resuspended in 4 -10 µl of ice-cold 10 % (v/v) glycerol and aliquoted 50 µl aliquots were stored at -80℃ until needed. EDTA (0.7 mM) was added to growth medium when higher competency was required for K. pneumoniae.
The bacteria (E. coli or K. pneumoniae) were transformed in 0.2 cm cuvettes using Bio-Rad Gene Pulser system (Bio-Rad) at the setting of 2.5 kV/cm, 25 µF and 200 Ω. The transformants were recovered in 500- 950 l of SOC immediately after electroporation and grown for 1 h. The electroporated cells were then plated on LA plates with the appropriate antibiotics/ supplements when required at 30℃ 0r 37℃.
2.5.2 Suicide vector-based allelic exchange
E. coli S17-1λpir was used in conjugation as a donor strain for the mobilization of suicide vectors into K. pneumoniae NTUH-K2044 for T6SS1 and T6SS3 deletion. E. coli S17-1λpir encoded broad-host-range tra (transfer) genes of RP4 conjugation system which enable the successful transfer of the mobilization of vectors with RP4 plasmid mobilization (mob RP4) region. Briefly, E. coli S17-1λpir carrying suicide vector pDNTOOL-8 or pDNTOOL-9, containing the respective T6SS1 or T6SS3 mutant alleles were grown overnight in LB plus gentamicin at 37℃, 200 rpm. Also, the recipient K. pneumoniae strain was simultaneously grown in LB only overnight at 37, rpm. The overnight culture of both bacteria was then subcultured (1:100) in fresh LB medium with (1:50 for E. coli S17-1λpir carrying pDNTOOL-8 or pDNTOOL-9) or without (1:100 for K. pneumoniae NTUH-K2044) gentamicin antibiotic and grown to
OD600nm 0.6 - 0.8. A 1:1 ratio (1 ml: 1ml) of the donor to recipient mixture was pelleted and resuspended in
20 µl of 10 mM MgSO4 and aseptically spotted on 2 cm by 2 cm nitrocellulose filter paper (0.45 m pore size) on a pre-warmed LA plate and incubated at 37℃ overnight. Also, a 1:1 ratio of the donor to donor and recipient to the recipient were included as necessary controls. The overnight matings on the nitrocellulose paper were resuspended in 1.5 ml of 10 mM MgSO4, and dilutions were plated on M9 minimal medium plus gentamicin agar plates and incubated at 37℃ overnight. Single colonies were parallel-patched on LA only, LA plus gentamicin and LA plus chloramphenicol, to screen for the integration of PDNTOOL-8 or pDNTOOL-9. The single crossover, SCO (merodiploid) were colony-PCR confirmed for the vector integration using primer-pair GmF/ DN6 and GmR/DN5 for pDNTOOL-8 integration and primer-pair
81
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods GmF/DN11 and GmR/DN12 for pDNTOOL-9 integration. Also, vector backbone and antibiotic cassette were confirmed using primer-pair DN21/DN22 and GmF/GmR. A confirmed SCO (merodiploid)colony was grown in LB and the appropriate dilutions were plated on LA plus 10 % sucrose at 25℃ overnight. The recovered colonies were then parallel patched onto LA plus gentamicin and LA plus chloramphenicol at 37℃ overnight. Colonies resistant to gentamicin but sensitive to chloramphenicol were selected a potential T6SS1 or T6SS6 mutants (double crossover, DCOs). Few DCO colonies were chosen for PCR confirmation using primer-pair DN5/DN6 for ∆T1:aacC1 or DN11/DN12 for ∆T3:aacC1 and the presence of the gentamicin cassette using GmF/GmR in the mutants. The gentamicin cassette was mapped onto the targeted locus by using GmF/ DN6 or GmR/DN5 for ∆T1:aacC1, and primer-pair GmF/DN11 or GmR/DN12 for ∆T3:aacC1. Also, PCR to confirm the absence of the vector backbone in the mutants was performed using DN21/DN22. Only T6SS1 deletion was successful in K. pneumoniae NTUH-K2044 but not T6SS3, and lambda Red recombination-based allelic exchange in the stain proved to be difficult because it's high mucoviscosity and low electroporation efficiency.
2.5.3 Lambda RED recombination-based allelic exchange for KPHST6SS mutation
Lambda Red recombination-based allelic exchange uses overexpressed phage λ Red recombinase system (γ, β, exo) in bacteria to enhance the homologous exchange linear DNA fragments (mostly SOE-PCR generated mutant alleles with antibiotic cassette) with bacteria chromosome or plasmid ((Davidson and Szybalski, 1971; Murphy, 1998). All T6SS gene cluster knockout (such as ∆T1:hph ∆T3:hph and ∆T1∆T3:hph) in K. pneumoniae HS11286 were created via lambda Red recombination-based allelic exchange using T6SS1 and T6SS3 mutant alleles.
82
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.9 K. pneumoniae HS11286 T6SS1 mutant allele and knockout. A. KPHST6SS1 mutant allele (3116 bp) was created by SOE-PCR joining the LF and RF of the locus to a hygromycin cassette (FRT-hph-FRT). B. The KPHST6SS1 mutant allele created in A was then used to knockout (lambda Red recombination method) 25411 bp region of KPHST6SS1 (creating ∆T1:hph) which included all essential and accessory genes of T6SS1. PCR (2202 bp) using DN117/DN118 primer-pair was used to verify successful KPHST6SS1 knockout after Flprecombinase-mediated excision of the antibiotic cassette, leaving residual 84 bp FRT scar (only FRT sequence is in grey).
83
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Both T6SS single and double knockouts were all done in antibiotic resistance ‘disarmed background’ of the originally K. pneumoniae HS11286 strain, see published data (Bi et al., 2015), represented in this work as DN2. To create ∆T1:hph, ∆T3:hph and ∆T1∆T3:hph in DN2, the lambda Red recombination-based plasmid (pKOBEG-Apra or its derivatives) was initially transformed into in DN2 and recovered on LA apramycin or the appropriate antibiotics at 30℃. The presence of the pKOBEG-Apra was confirmed by colony PCR using the primer-pair DN125/DN126 (1949 bp). A single colony of PCR-confirmed DN2 carrying pKOBEG-Apra was inoculated in 5 ml LB with apramycin and grown at 30℃ overnight. A 1:100 subculture of the overnight DN2/pKOBEG-Apra culture was made in fresh LB with antibiotics and 0.2 % arabinose. The culture was grown to OD600nm 0.8 - 1.0 before being harvested for electrocompetent DN2/pKOBEG-Apra preparation. T6SS mutant alleles were constructed by SOE-PCR joining T6SS LF, hygromycin cassette and T6SS RF to produce a 3.5 kb T6SS1 or 3.2 kb T6SS3 mutant alleles (Figure 2.9a and Figure 2.10a). The 0.5 - 1 µg of the SOE-PCR joined T6SS1, or T6SS3 mutant allele was then electroporated into the arabinose induced electrocompetent DN2/pKOBEG-Apra K. pneumoniae. The transformants were recovered in 950 µl of SOC for 1.5 h at 37℃ and then plated onto the LA plus hygromycin at 37℃.
To create a T6SS1 and T6SS3 double cluster knockout (∆T1∆T3:hph), an arabinose-induced competent markerless ∆T1 strain carrying pKOBEG-Apra was electroporated with T6SS3 mutant allele (0.5-1µg), and the transformants were selected at 37℃ overnight on LA hygromycin after a brief recovery in SOC at 37℃ for 1.5 h. Colonies were parallel-patched on LA plus hygromycin and LA plus apramycin overnight grown at 37℃. Only hygromycin-resistant colonies were PCR verified for the expected knockout (DN117/DN118, 3588 bp for ∆T1 and DN123/124, 3417 bp for ∆T3) and the absence of pKOBEG-Apra (DN125/DN126, 1949 bp).
84
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
Figure 2.10 K. pneumoniae HS11286 T6SS3 mutant allele creation and knockout. A. KPHST6SS3 mutant allele (3209 bp) was created by SOE-PCR joining the LF and RF of the locus to a hygromycin cassette (FRT-hph-FRT). B. The KPHST6SS3 mutant allele generated in step A was then used to knockout 30509 bp region of KPHST6SS3, which included all essential and accessory T6SS3 genes. PCR (1984 bp) using DN123/DN124 primer-pair was used to verify successful KPHST6SS3 knockout after Flprecombinase-mediated excision of the antibiotic cassette by FRTs recombining and leaving residual 84 bp FRT scar (only FRT sequence in grey only for FRT) was observed. A markerless ∆T1 was used for KPHST6SS1 and KPHST6SS3 double knockout (∆T1∆T3) by electroporating the arabinose induced strain (∆T1carrying lambda red plasmid) with KPHST6SS3 mutant allele. Transformants were selected on LA hygromycin plate at 37℃. Just like the excision of the antibiotic marker in the single mutants (∆T1 and ∆T3), the antibiotic cassette in the double mutant was also excised.
85
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods Similarly, lambda Red recombination allelic exchange was also primarily employed in the creation of many genetic tools as described earlier in this chapter. Briefly, a PCR amplified mutant allele was used to replace the target gene on a plasmid in E. coli strain also carrying a lambda Red recombination plasmid derivative. Briefly, E. coli carrying lambda red recombination plasmid and target plasmid were grown in the 5ml LB and appropriate antibiotics overnight at 30℃ overnight. A 1:50 ratio subculture was made in fresh LB with appropriate antibiotics supplemented 0.2 % arabinose and grown until OD600nm 0.6-1.0 where they were harvested for electrocompetent cell preparation. The electrocompetent E. coli was then electroporated either PCR amplified sacB-cat (negative and positive selection markers) or the appropriate SOE-PCR amplified linear DNA/ mutant allele. The transformants were selected on the appropriate LA antibiotic plates per temperature requirements overnight and subsequently parallel-patched on the right antibiotic plates.
2.5.4 Flp-mediated FRT recombination
All the antibiotic cassettes used in the construction of T6SS1 and T6SS3 mutant allele for the T6SS cluster knock out in K. pneumoniae NTUH-K2044 and K. pneumoniae HS11286, carry two FRT sites flanking the antibiotic cassette (FRT-antibiotic cassette-FRT). The use of Flp recombinase encoding plasmid to excise the antibiotic cassette using site-specific recombination of the two FRTs was necessary for the creation of markerless mutant or double gene knockout for this study.
To excise antibiotic cassette (FRT-aacC1-FRT and FRT-hph-FRT) mediated by Flp-FRT recombination, a Flp recombinase encoding plasmid, pDNTOOL-2 was electroporated into competent K. pneumoniae T6SS mutants (K. pneumoniae NTUH-K2044∆T1:aacC1, K. pneumoniae HS11286 ∆T1:hph, K. pneumoniae HS11286 ∆T3:hph and K. pneumoniae HS11286 ∆T1∆T3:hph) and recovered in LA apramycin at 37℃ overnight. The presence on the pDNTOOL-2 plasmid in the bacteria was PCR-confirmed using DN129/DN130 (2062 bp). Obtained colonies were phenotypically screened by parallel-patched on LA plus apramycin, LA plus gentamicin (K. pneumoniae NTUH-K2044∆T1) and LA plus hygromycin (for K. pneumoniae HS11286 ∆T1:hph, K. pneumoniae HS11286∆T3:hph and K. pneumoniae HS11286 ∆T1∆T3:hph) for hph cassette excision. Colonies resistant to apramycin but not gentamicin and hygromycin (in each case) were considered for PCR verification of loss of aacC1 with one FRT and hph with one FRT using mutant screening primers and antibiotic cassette primers. The Flp recombinase encoding plasmid was kicked out by sucrose counterselection by growing bacterial on LA 5% sucrose at 37℃ overnight. Colonies were parallel-patched, and PCR confirmed (DN) for the loss of the antibiotic cassette and the Flp recombinase encoding plasmid using T6SS mutant screening primer-pairs, GmF/GmR and DN129/DN130 primer-pair (see Appendix 1). PCR amplicons across the excised region (using mutant screening primers) was sequenced for residual FRT sequence analysis.
86
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods As a result of successful aacC1 or hph excision, an inframe residual FRT scar (Figure 2.9b and Figure 2.10b) encoding a non-functional protein was created in the bacterial mutant chromosome for each antibiotic cassette excision using an Flp recombinase encoding plasmid (pDNTOOL-2).
2.5.5 Sucrose counterselection
Sucrose counter selection is a negative selection method performed when needed to get rid of plasmids carrying the sacB gene (encoding for levansucrase in the presence of sucrose which is lethal to the bacteria). Briefly, after Flp-FRT excision, appropriate dilutions of K. pneumoniae mutants carrying the Flp recombinase encoding plasmids (pDNTOOL-2) were grown on LA plus 5 % sucrose at 37℃ overnight. The colonies were then patched on LA and LA plus gentamicin or hygromycin to screen for the loss of the Flp recombinase encoding plasmid (pDNTOOL-2). Colonies that were gentamicin or hygromycin sensitive but grew well on LA only were PCR screen for the loss of pDNTOOL-2 using primer-pair DN129/130 (2062 bp) The gentamicin or hygromycin sensitive K. pneumoniae T6SS mutants were grown on LA and achieved in BHI with 30 glycerol at -80℃.
Also, sucrose counterselection was performed during lambda Red recombination-mediated plasmid construction. Briefly, arabinose induced competent E. coli strains carrying both the lambda Red plasmids (pKD46 or other derivatives) and sacB-cat derivative plasmid (pDNTOOL-13, pDNTOOL-16, pDNTOOL- 22 or pDNTOOL-31) were transformed with the appropriate SOE-PCR mutant allele and selected on LA with 5 % sucrose and antibiotics at 37℃ overnight. This aided the replacement of the sacB-cat region on the plasmids or loss of residual sacB-cat carrying plasmid and pKD46. To the best of my knowledge, this is the first time such a novel plasmid construction strategy (without restriction or ligation) is reported. This strategy was very efficient and reduced the difficulty of restriction-ligation as restriction enzymes sites selection can be very difficult in certain plasmid construction. This method could be extended to chromosomal complementation of genes when well optimized.
2.6 Other methods
2.6.1 Biofilm formation
2.6.1.1 Microplate-based biofilm assay Modified microtitre plate-based method (O'toole and Kolter, 1998) was used to perform biofilm assays. Briefly, overnight cultures (in LB for 16 h at 37°C, 200 rpm) of K. pneumoniae strains were subcultured (1:100) into 100 µl LB in 96-well polystyrene (NUNC) microtitre plates and subsequently incubated at 30℃ or 37℃ for 24 h to 72 h without shaking. After the appropriate time, the bacterial cultures inside the
87
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods wells were discarded, and the plate gently washed once with 200µl of dH2O followed by the addition of 125 µl of 0.1 % crystal violet for 10 minutes. The crystal violet was discarded, and the microtitre plate was washed twice with dH2O (200 µl). After thorough drying, 200 µl of 95 % ethanol was added to each well and gently vortexed. The absorbance was measured at 595 nm (BioRad Model 680 Microplate reader). Biofilm data was analyzed from three independent experiments, and each strain had eight well repeats for each experiment
2.6.1.2 Coverslip based bacterial biofilm-like association To perform bacterial association with a microscopic coverslip, a 1:100 subculture of overnight culture (in LB for 16 h at 37°C, 200 rpm) of each K. pneumoniae strains was made into fresh sterile 3ml LB in 6-well plates containing coverslips. The 6-well plates containing the coverslips and bacterial cultures were incubated at 30℃ or 37℃ for 24 h or 48 h without shaking. After the set time, coverslips were carefully washed in a new 6-well plate containing 5ml dH20. The coverslips were stained with 3 ml crystal violet
(0.1 %) for 10 minutes and washed twice with 5 ml dH20. The coverslips were carefully mounted on microscopic slides and visualize on the light microscope.
2.6.2 Growth and cell viability
2.6.2.1 Bacterial growth curves. Both bacterial growth measurement in 96 microtitre plate and CFU were employed to assess the growth of the K. pneumoniae strains. Briefly, 5 ml of LB was inoculated with a colony of K. pneumoniae strains and incubated 37℃, 200 rpm for overnight. A 1:100 subcultures (37oC at 200rpm) of each strain and grown until OD600nm 0.6. The bacterial cultures were then normalized to OD600nm 0.06 in 150 µl of LB in 96 microtitre plate (NUNC). The plates with the cultures were immediately placed into a pre-set Varioskan® flash spectral scanning multimode reader with continuous shaking at 37°C for 24 h. Also, dilutions of each initial inoculum (at OD600nm 0.06) were plated on LA and incubated at 37℃ overnight to ensure that all the inoculum gave rise to similar CFUs. The machine measured the absorbance (600 nm) of the cultures in the microtiter plates every 10 minutes, and the data was retrieved after 24 h for analysis using GraphPad Prism. Each strain for the growth curves had three biological repeats and three experimental repeats. Also, analysis of growth fitness of bacterial cell with various plasmid constructs was examined using growth curves, and inducers such as IPTG were added where required.
Also, growth assessment by CFU was done by making 1:100 subculture of K. pneumoniae overnight cultures were grown until OD600nm 0.6 and normal to OD600nm 0.06. 100 µl of the normalised bacterial cultures (OD600nm 0.06) were added to fresh sterile LB (20 ml) in a flask and incubated at 37℃ for 24 h with shaking (200 rpm). 100 µl of the bacterial cultures were taken from each flask every 2 h, and the
88
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods appropriate dilutions were plated on LA and incubated overnight at 37℃ for colonies. The CFU were counted and compared to the data obtained from Varioskan® flash spectral scanning multimode reader for microtiter plate.
2.6.3 Antibiotic susceptibility testing
Before using bacterial strains for experiment or when needed, the antibiotic profile of the K. pneumoniae strains was established using minimum inhibition concentration (MIC) and E-test strips diffusion methods. After the disarming of the antibiotic resistance in original K. pneumoniae HS11286, the antibiotic profile for the mutant was necessary to ensure that the strain was safe to use for downstream experiments such as T6SS studies. The antibiotic susceptibility data (CLSI and BAC) obtained was used for antibiotic marker selection for mutant creation or plasmid transformation and selection. Briefly, 2-4 K. pneumoniae colonies from a fresh overnight LA plate cultures were picked and homogenously resuspended in 0.9 % NaCl. The turbidity of the bacterial suspensions was adjusted to 0.5 McFarland (0.08-0.13 at OD625nm) containing 1 × 108 CFU/ml and used with 15 minutes. With the aid of a sterile cotton swab, a semi-confluent lawn of the bacteria was created on pre-warmed Mueller-Hinton agar (MHA) plates and allowed for 10 minutes to dry. The E-test strips for various antibiotics were aseptically placed on the lawn, and the plates were then incubated at 37℃ for 20 h. The results for the E-test strips (µg/ml) were read the following day from the scale on the Etest strip where the symmetrical inhibition ellipse edge intercepts the E-test strip. BSAC version 2013 guideline (Wootton 2013) was referred to interpret the MIC and zone diameter breakpoints for K. pneumoniae.
To perform MIC per CLSI guidelines, increasing dilutions of antibiotic concentrations (0-2000 µg/ml) in 100 µl Mueller-Hinton broth (MHB) were put into in 96-well microtiter plate. Fresh bacterial inoculum (5×104 CFU/well in 100 µl) made from overnight cultures was carefully mixed with the MHB antibiotics medium in the microtitre plate and incubated at 37 for 24h or 48 h. To prepare by mixing 50 µl of 0.5 McFarland (1 × 108 CFU/ml) of bacterial suspension with 9.95 ml of MHB and 100 µl of this mixture was added to each well as the bacterial inoculum (5×104 CFU per well). Note, the final antibiotic concentrations in the 96-well were adjusted after the addition of the bacterial inoculum, and the appropriate controls were included. The growth inhibition was observed and recorded in wells with the lowest antibiotic concentration where the bacteria failed to growth after the incubated time. The MIC experimental data were pooled from three experimental repeats with triplicate wells for each experiment. Where necessary, antibiotic Etest strips were used to determine the MIC of the bacteria.
89
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods 2.6.4 Co-culture experiments
Basically, for the bacteria-bacteria co-cultures (K. pneumoniae - K. pneumoniae, K. pneumoniae- E. coli, K. pneumoniae - P. aeruginosa) at 1:1 ratio mixture was made to compete for a certain duration before CFU were enumerated. For bacterial - amoeba co-culture was used for the bacterial association and phagocytosis assay while bacteria - amoeba zone clearance was done by spotting A. castellanii on a lawn K. pneumoniae grown in M9 Minimal medium or LA. Also, K. pneumoniae was used in cell line co-culture/ infection assays such as attachment, invasion and survival.
2.6.5 Bacterial competition and plasmid mobilization
In this study, bacteria-bacteria contact competition on agar surface or in the broth was used to access the impact of T6SS in bacterial competition in a polymicrobial environment. The bacterial competition included K. pneumoniae head-to-head intra-strain competition, Head-to-head K. pneumoniae - E. coli inter- competition and Head-to-head K. pneumoniae - P. aeruginosa inter-species competition.
2.6.5.1 Intra-strain competition An antibiotic disarmed version of K. pneumoniae (Bi et al., 2015) was competed head-to-head against its T6SS1 mutant, T6SS3 mutant, and T6SS1 and T6SS3 double knockout mutant in both LB broth and nitrocellulose filter paper (0.45 µm pore size) placed on LA. Subculture (1:100) of K. pneumoniae HS11286 antibiotic disarmed version (DN2T) and its associated T6SS mutants were made from overnight cultures (37℃, 200rpm for 16 h). All the K. pneumoniae T6SS mutants (∆T1, ∆T3 and ∆T1∆T3) previously show similar growth pattern to their respective parent strains (DN2 or DN2T). The subculture of each strain in LB was grown to OD600nm 0.3 – 0.4 at 37℃, 200rpm.
For intra K. pneumoniae strain LA plate competition, 300 µl of each subculture was pelleted and resuspended in 300 µl of PBS (Sigma Aldrich). A 1:1 ratio mixture of DN2T (2 ×108 CFU in 100 µl PBS ) to T6SS mutant (2 ×108 CFU in 100 µl PBS of ∆T1, ∆T3 or ∆T1∆T3) was made and 20 µl of the mixtures (DN2T + ∆T1, DN2T + ∆T3, or DN2T + ∆T1∆T3) were aseptically spotted on a pre-warmed filter paper placed on LA. Individual strains (20 µl the of DN2T only, ∆T1 only, ∆T3 only and ∆T1∆T3 only) were also spotted for comparative CFU data. The bacterial mixtures were incubated for 2 - 4 days and the CFU estimated by resuspending the filter paper with the bacteria in 1000 µl of PBS and appropriate dilutions plated on LA only and LA plus hygromycin and incubated at 37℃ overnight. Note that, K. pneumoniae (DN2T) has hygromycin resistance-encoding gene, this enabled the differential CFU count on LA plus antibiotics and LA only.
90
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods For intra-K. pneumoniae strain competition in Liquid medium (LB), the inoculum was prepared just as
T before, 300 µl of fresh subculture (grown to OD600nm 0.3 – 0.4 at 37℃. 200 rpm) of K. pneumoniae (DN2 ) was mixed with 300 µl of a new subculture of T6SS mutants (∆T1, ∆T3 or ∆T1∆T3). Then, 100 µl of each 1:1 ratio mixture (DN2T + ∆T1, DN2T + ∆T3, DN2T + ∆T1∆T3) or individual strains (DN2T only, ∆T1 only, ∆T3 only or ∆T1∆T3 only) were aseptically added to 100 ml LB in labelled 500 ml flasks. The individual K. pneumoniae strains (DN2T, ∆T1, ∆T3 or ∆T1∆T3) were necessary to enable the appropriate comparative CFU estimation. The culture in the flask was grown at 37℃ with shaking (200 rpm) for seven days. The CFU from each flask was estimated daily by sampling 100 µl of the bacterial culture and plating the appropriate dilution on LA only and LA plus hygromycin and incubated at 37℃ overnight.
All intra-strain competition data was pooled from three experimental repeats and used to analyze the competitive fitness of each K. pneumoniae strains.
2.6.5.2 Head-to-head inter-bacterial species Like intra-K. pneumoniae strain competition described above, the inter-species competition of K. pneumoniae strains against E. coli, or P. aeruginosa was also performed on both agar surface (LA) and liquid medium (LB) to access the effect of T6SS deletion on K. pneumoniae interaction with other bacteria.
For the agar-based inter-bacterial competition, 1:100 subculture of overnight K. pneumoniae, E. coli and P. aeruginosa were made in fresh sterile LB and grown to OD600nm 0.3 - 0.5 at 37℃ with shaking (200rpm). A volume (300 µl) of each bacteria subculture was pelleted (3000 ×g) and resuspended in 300 µl of PBS. A 1:1 ratio of K. pneumoniae (2 ×108 CFU in 100 µl PBS) to E. coli (2 ×108 CFU in 100 µl PBS ) or P. aeruginosa (2 ×108 CFU in 100 µl PBS ) mixtures were made, and 20 µl of the K. pneumoniae - E. coli mixtures (DN2T + E. coli, ∆T1T + E. coli, ∆T3T + E. coli, and ∆T1∆T3T + E .coli) or K. pneumoniae – P. aeruginosa mixtures (DN2T + PA14, ∆T1T + PA14, ∆T3T + PA14, and ∆T1∆T3T + PA14) were spotted on sterile filter paper placed on a pre-warmed LA. Also, 20 µl of individual bacterial strains (DN2T only, ∆T1T, ∆T3T, ∆T1∆T3 T, E. coli and PA14) were spotted on a filter paper placed on LA plates. After incubating the inoculated plates for 1 - 4 days at 37℃, the CFUs (K. pneumoniae, E. coli and P. aeruginosa) were estimated by resuspending the individual or mix bacterial cultures on the filter paper in 1000 µl of PBS and the appropriate dilutions were plated on LA only, LA + hygromycin, LA + streptomycin, LA + apramycin, LA + streptomycin & apramycin. IPTG/ X-gal was added to the recovery media when required. All plates were incubated at 37℃ overnight for bacterial CFU enumeration.
Unless otherwise stated, when E. coli DH5α (carrying pDNTOOL-39) or E. coli HB101 (carrying pDNTOOL-39) was used in the competition assay, it was recovered in LA + apramycin supplemented with IPTG/ X-gal, or LA + apramycin & streptomycin supplemented with IPTG/ X-gal for the E. coli HB101.
91
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods For head-to-head inter-bacterial competition in liquid medium (LB) 300 µl of K. pneumoniae was mixed with 300 µl of the other competing bacteria (E. coli or P. aeruginosa) to make a 1:1 ratio mixture. The mixtures were pelleted and resuspended in 600 µl of sterile LB, and 100 µl of K. pneumoniae - E. coli mixtures (DN2T + E. coli, ∆T1T + E. coli, ∆T3T + E. coli, and ∆T1∆T3T + E .coli) or K. pneumoniae – P. aeruginosa mixtures (DN2T + PA14, ∆T1T + PA14, ∆T3T + PA14, and ∆T1∆T3T + PA14) containing 2 ×108 CFU was added to 100 ml of LB in labelled flasks. Also, 100 µl (2 ×108 CFU in LB) of the individual strains (DN2T only, ∆T1T, ∆T3T, ∆T1∆T3 T, E. coli and PA14) were added to 100 ml of LB in separately labelled flasks for comparative CFU estimation. The cultures were incubated at 37℃ with shaking (200 rpm) for four days. The CFU K. pneumoniae, E. coli and P. aeruginosa from the individual or mix cultures were estimated by plating on LA only, LA + hygromycin, LA + streptomycin, LA + apramycin, LA + streptomycin & apramycin and IPTG/ X-gal were added to the recovery media when required. All plates were incubated at 37℃ overnight for bacterial CFU enumeration.
All inter-species competition data was pooled from three experimental repeats and used to analyze the competitive fitness of each K. pneumoniae relative E. coli and P. aeruginosa strains.
2.6.5.3 T4SS conjugative plasmid mobilization assay. Being a multi-drug resistant strains with many integrative conjugative elements (ICEs), K. pneumoniae HS11286 has been purported to be a bacterial antibiotic sink. Hence K. pneumoniae HS11286 with active T6SS could potentially use independent DNA uptake mechanisms such as T4SS to scavenge for other genetic elements/ virulence genes or work together with other secretory systems such as T6SS enhance its take- (DNA)-and kill (bacteria) method of environmental survival. T4SS-mediated conjugative mobilization of pACYC184-oriT-ICEKP-1 into E. coli HB101 was used assessed the effect of T6SS deletion on MDR K. pneumoniae plasmid mobilization.
ICE1 marker conjugative plasmid (pACYC184-oriT-ICEKP-1) was constructed to ensure that K. pneumoniae HS11286 has a functional T4SS. The plasmid pACYC184-oriT-ICEKp-1 was constructed by cloning a 1760 bp oriT amplicon of ICEKp-1 from K. pneumoniae NTUH-K2044 into HindII/ SalI sites in pACYC184 (a non-conjugative plasmid) as this plasmid has been previously used in similar studies (Schubert et al., 2004; Lin et al., 2008). Filter mating conjugation was performed between K. pneumoniae strains carrying pACYC184-oriT-ICEKp-1 and streptomycin-resistant E. coli HB101. The frequency of mobilization of pACYC184-oriT-ICEKp-1 from either K. pneumoniae DN2 or TSS mutants (donor) to E. coli HB101 (recipient) was assessed from the bacterial mixtures mated overnight on a membrane filter. The transconjugants E. coli carrying three plasmids were enumerated in the antibiotic medium.
92
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods Briefly, pACYC184-oriT-ICEKp-1 was electroporated into K. pneumoniae strains (DN2, ∆T1, ∆T3 or ∆T1∆T3) and were recovered in LA chloramphenicol. They were colony-PCR verified for the presence of the plasmid (pACYC184-oriT-ICEKp-1) using DN/DN. Single colonies of each K. pneumoniae strain carrying pACYC184-oriT-ICEKp-1 was put into 5 ml LB plus chloramphenicol for overnight cultures at 37℃, 200 rpm. Also, a colony of streptomycin-resistant E. coli HB101 was put into 5 ml of LB with streptomycin and incubated at 37℃ overnight. A 1:100 of a subculture of E. coli HB101 and K. pneumoniae were made and grow to exponential phase, ~4.5 hr and ~4 hr with shaking at 37℃ respectively. K. pneumoniae (DN2, ∆T1, ∆T3 and ∆T1∆T3) carrying pACYC184-oriT-ICEKp-1 were considered as the donor while E. coli HB101 as the recipient.
Bacterial cells (1ml each) from the subcultures were harvest and pelleted (3000 ×g for 10 min) and washed twice with 1 ml of PBS to remove residual antibiotics media. A 10:1 ratio (10 or 20 µl) of the donor (K. pneumoniae) to recipient (E. coli HB101) mixture was spotted on 2 cm x 2 cm 0.45 µm membrane filter (Thermo Fisher) placed on a pre-warmed LA plate. Also, individual strains only were included as controls for comparative CFU counts. The inoculated plates were incubated at 37 for 20 h before the membranes were resuspended in 1 ml PBS and vortexed. The appropriate dilutions from the mixtures or neat suspensions were plated on LA antibiotics plates for bacteria CFU.
The CFU of the output K. pneumoniae donor or E. coli HB101 recipient were enumerated by plating the mixtures or the individual cultures on LA only, LA + streptomycin, and LA + ampicillin, LA+ chloramphenicol and LA + chloramphenicol & streptomycin. The plates were incubated at 37℃ overnight, and only E. coli HB101 transconjugants carrying the mobilized plasmid (pACYC184-oriT-ICEKp-1) grew on LA with chloramphenicol & streptomycin plates. Transconjugants (E. coli HB101 carrying pACYC184- oriT-ICEKp-1) were PCR confirmed with ICEKp-1 oriT specific primers and E. coli specific primers (see Appendix 1). Data from three experimental repeats were analyzed for the K. pneumoniae conjugation efficiency.
The conjugation efficiency was estimated using the below formula;
Conjugation efficiency= (# of Transconjugants) / (# of recipients recovered) CFU/ml
% Conjugation efficiency = [= (# of Transconjugants) / (# of recipients recovered) CFU/ml] x 100
2.6.6 Agglutination assay
Agglutination assays were performed using guinea pig red blood cells (GP-RBCs). GP-RBCs were stored at 4℃ as 20 % solutions in Alsever’s (Matrix Biologicals). When required, a 5% suspension of GP-RBCs was freshly prepared by dilution the 20% stock solution 1 in 4 ml PBS. Briefly, agglutination assays were
93
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods performed by mixing 10 µl of overnight K. pneumoniae cultures (37°C, 200 rpm) separately with 10 µl of the 5 % guinea pig red blood cells suspension on a microscopic slide. The microscope slide was tipped back and forth and observed for signs of agglutination for up to 15 minutes. To test for mannose-sensitivity, 20 μl of 10 % (w/v) mannose was added to the agglutination reaction. Also, to test for type 3 fimbria expression by the various K. pneumoniae strains, 10 µl of overnight K. pneumoniae strain each was mixed with 10 µl of 5% tannic acid-treated Oxblood with or without 5% mannose. The mixture was gently rocked on a microscope slide for 10-15 for visible agglutination.
2.6.7 G. mellonella larvae In vivo virulence model
The unpigmented wax moth (G. mellonella) larvae were all purchased from Livefood UK Ltd and stored in darkness at 15℃ and used with 2-3 days upon arrival as previous studies have reported that long-time food deprivation may lead to a reduction in cellular and immune response (Banville, Browne and Kavanagh, 2012; Browne et al., 2015). The use of G. mellonella as a K. pneumoniae virulence model has been widely described (Insua et al., 2013b; Wand et al., 2013a). To investigate K. pneumoniae T6SS-induced virulence in Galleria larvae and the interplay between K. pneumoniae (DN2, ∆T1, ∆T3 and ∆T1∆T3) and Galleria larva innate immune system, the larvae were infected with either 2 × 108 CFU or 2 × 106 CFU of K. pneumoniae for the examination of for Galleria mortality, K. pneumoniae recovery, phenoloxidase activity, and viable hemocyte counts.
2.6.7.1 Galleria killing assay To prepare bacterial inoculums for Galleria larvae infection, a single colony of each K. pneumoniae strain was inoculated in 5ml LB for overnight at 37℃, 200 rpm. A 1:100 subculture of each strain was made in fresh 5 ml LB to grow for approximately 4 h at 37℃ 200 rpm. The 5 ml subcultures were pelleted (3000
×g, 10 min, room temperature) and washed twice in 10 ml of 10 mM MgSO4 for OD600nm adjustment to 0.2. Prior to the injection of the larvae with 10 µl of the bacterial inoculum (2 × 108 CFU) into the last right proleg, the larvae were swabbed with 70% (v/v) ethanol. Random selection of 30 larvae for each group
(untouched, MgSO4 only, DN2 only, ∆T1 only, ∆T3 only, ∆T1∆T3 only, KR1730 only and NTUH∆T1) in labelled Petri dishes. After injection of larvae with 10 µl of bacterial inoculum containing 2 × 108 CFU (using a BD micro-fine 1 ml syringe affixed on a repetitive pipette from StepperTM series), the larvae were incubated at 37℃ for seven days. Dilutions of the inoculums were also made and plated on LA to enumerate inoculum CFUs. No larva from the control groups (untouched and MgSO4) died until the experiments were terminated at day 7. A larva was considered dead when it fails to elicit a response to physical stimuli and the larva mortality from each group was recorded daily post-infection. The progression of K. pneumoniae
94
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods infection in Galleria larva was observed to be associated with increased pigmentation. Statistical analysis was performed analyzed from triplicate experiments.
2.6.7.2 K. pneumoniae 50% Lethal dose (LD50) determination
To enable bacterial recovery and prevent the larvae from dying during the experimental time, 50% lethal dose (LD50) experiments was determined by inoculating larvae with 10 µl K. pneumoniae inoculum from a
4 8 series of 10-fold dilutions (2 × 10 to 2 × 10 CFU) prepared in 10 mM MgSO4. Twenty larvae were used for each 10-fold dilution, and the larvae were incubated at 37℃ for seven days. The inoculum was also plated on LA to confirm the bacterial numbers injected into the worms. The inoculum, with about 50 % mortality by the end of day seven, was used as LD50. Data from three independent experiments were pooled
6 and used for the calculation of LD50 (2 × 10 CFU) according to the formula of Reed and Muench (Thakur and Fezio, 1981).
2.6.7.3 In vivo bacterial recovery from Galleria larva
6 For bacterial recovery, 25 larvae per group were infected with 10 µl of LD50 (2 × 10 CFU) of K. pneumoniae individual strains only (DN2T, ∆T1, ∆T3, ∆T1∆T3, KR1730 and NTUH∆T1::aacC1 only) or mixture ( 1:1 ratio of DN2T + ∆T1, DN2T + ∆T3, DN2T + ∆T1∆T3, and KR1730 + NTUH∆T1::aacC1) and incubated for 4 days post-infection. Also, the necessary controls (untouched and injected with 10 mM MgSO4) were included. The inoculum was also plated on LA to confirm the bacterial numbers injected into the worms. No larva from the control group died until the experiments were terminated. To recover bacteria, five larvae per group were randomly selected and homogenized in 5 ml of 0.5% Triton X-100/PBS lysis buffer (containing phenylthiourea). The appropriate dilutions of the larva homogenates/lysates were a plate on LA only, LA + ampicillin, LA + ampicillin + hygromycin or LA + ampicillin + gentamicin and incubated at 37℃ overnight to enumerate the CFU of bacterial from individual inoculation or the mixtures culture inoculation. No bacterial growth was recovered from the untouched or MgSO4 injected larvae grown on LA agar supplemented with ampicillin at 37℃ overnight. At least three independent experiments were performed, and the data pooled were subjected to statistical analysis.
2.6.7.4 Phenoloxidase activity (PO) from Galleria larvae
PO activity was performed as previously described (Insua et al., 2013b). Fifteen larvae per group were injected 10 µl LD50 of K. pneumoniae (DN2 only, ∆T1 only, ∆T3 only, ∆T1∆T3 only, KR1730 and NTUH∆T1only). Five larvae from each group on day two and day four post-infection were surface sterilized with 70% ethanol. The hemolymphs (15 µl each) were collected and diluted in 10 µl of ice-cold
95
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods saturated N-phenylthiourea solution (diluted in dH20) in microcentrifuge tube to prevent melanization. Samples for each group were pooled together and centrifuge (4,000 × g for 10 min at 4℃) to eliminate cell debris. The supernatants (hemolymph plasma) were diluted at 3:1 ratio (v/v) in 50 mM PBS (pH 6.5). The phenoloxidase activity was measured using previously describe microplate enzyme assay (Eleftherianos, Millichap and Reynolds, 2006). Briefly, a reaction mixture was set up containing 10 µl of diluted hemolymph plasma, 115 µl of 50 mM PBS (pH 6.5), 2 µl of E. coli lipopolysaccharide (LPS, 5 mg/ml, Sigma Aldrich) at 25℃. The reaction mixture was left to stand for 60 minutes to activate the enzyme before adding 25 µl of 20 mM 4-methyl catechol (Sigma Aldrich) to initiate the reaction. The final reaction volume was adjusted with dH2O to 200 µl. The durational change in absorbance (490 nm) was measured every 5 minutes using a pre-set Varioskan® flash spectral scanning multimode reader with continuous shaking for 1 h at 25 ℃. The experiment was performed in triplicates for three independent experimental repeats, and the PO was expressed as mean OD490 nm/minute for each of the treatment groups.
2.6.7.5 Hemocytes quantification and viability staining from infected Galleria larva
For viable hemocyte count, 15 larvae per group were injected 10 µl LD50 of K. pneumoniae (DN2 only, ∆T1 only, ∆T3 only, ∆T1∆T3 only, KR1730 and NTUH∆T1only). Larva hemocytes were extracted as previously described (Banville, Browne and Kavanagh, 2012; Insua et al., 2013b). Briefly, five larvae from each infected group at day two and day four were surface sterilized with 70% ethanol and dissected for the hemolymph extraction. The pooled hemolymph samples (10 µl) were mixed immediately with 10 μl of phenylthiourea (Sigma Aldrich) in distilled water in a microcentrifuge tube containing and hemocytes were recovered by centrifugation at 1,500 × g for 3 min. The hemocytes suspension were immediately mixed with 20 μl of 0.4 % trypan blue and incubated for 5 minutes before counting total hemocyte and viable hemocytes using a hemocytometer. The data from three experimental repeats in triplicates were expressed as relative percentage viability of hemocytes.
2.6.8 Eukaryotic cell-based virulence assays and methods
To further investigate the K. pneumoniae T6SS virulence, mouse and human cell lines (J774A.1, H292 and A549), human polymorphonuclear cells (neutrophils) and Acanthamoeba castellani were used in various assays to measure the virulence-related effect of T6SS.
2.6.8.1 Cells and culture conditions Three cell lines were used in this study, a mouse macrophage (J774A.1) and two human epithelial carcinoma cells (H292 and A549) in various assays to evaluate the T6SS dependent virulence in K. pneumoniae. While J774A.l cell line was kindly provided by Dr Coudla Stover’s Lab (University of
96
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods Leicester), H292 and A549 were both provided Dr Yassine Amrani’s Lab (University of Leicester), all cell lines were originally obtained from American Type culture collection.
Mouse macrophage, J774A.1 (ATCC TIB-67) from BalB/cN strain were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 2 mM L-glutamine (Gibco) containing 10% heat-inactivated fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (Gibco). The cell lines were routinely maintained in
3 complete growth medium at 37℃ in 5% CO2 in 75 cm flask for 80-90 % confluence before passaging them. For long term culture, growth medium was changed every 2-3 days. When needed, the appropriate cells were seeded in 6, 24 or 96 well plates with DMEM + 10 % FBS growth medium and incubated for 2-
3 h before use or overnight at 37℃ in 5% CO2 overnight depending on the experiment. The viability (≥ 97%) of the various cell line were periodically tested using trypan blue exclusion method before being used for any experimental assays.
Human bronchial epithelial cells, NCI-H292 (ATCC CLR-1848), were routinely cultured and maintained in 75 cm3 flask containing RPMI-1640 with L-glutamine (Gibco) supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin (Gibco). The cell line was routinely maintained in complete growth medium at
3 37℃ in 5% CO2 in 75 cm flask for 80-90 % confluence before passaging them. For long term culture, growth medium was changed every 2-3 days. When experimental required, the appropriate cell density was seeded in 6, 24 or 96 well plates with RPMI -1640 with 10 % FBS only and incubated at 37℃ in 5% CO2 overnight. Prior to experiments, the viability of the cells (≥ 97%) was usually checked.
A549 cells (ATCC CCL-185) were routinely cultured in 75 cm3 flask in DMEM with 2 mM L-glutamine (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (Gibco) at 37℃ with 5% CO2. When required, the appropriate cell density was seeded in 6, 24 or 96 well plates with DMEM + 10 % FBS growth medium and incubated at 37℃ with 5%
CO2 overnight. Cell viability (≥ 97%) was usually checked before being used for any downstream experiments.
2.6.8.2 Macrophage uptake assay and visualization Murine macrophage, J774A.1 was (1×105/ well) in DMEM with L-glutamine supplemented with only heat- inactivated 10% FBS were seeded in 24-well plates and incubated at 37℃ in 5% CO2 15 h before the experiment. Prior to infection, the spent medium was replaced with complete medium without antibiotics or FBS. Fresh exponential phase K. pneumoniae culture (DN2, ∆T1, ∆T3 and ∆T1∆T3) was PBS-washed three-time and resuspended in DMEM without antibiotics and FBS. The bacteria suspension was then used to infect the monolayer of J774A.1 at MOI 10:1 for 1h at 37℃ in 5% CO2. After 1 h post-infection, each well was wash twice with PBS and incubated with 100 g/ml gentamicin to the well for 20 minutes.
97
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods Gentamicin concentration per time used to kill extracellular bacteria was empirically determined. The cells were then washed three times with PBS and lysed with 0.5 ml of 0.5 % Triton X-100 in PBS. The lysates were diluted and plated on LA and incubated at 37℃ overnight for CFU estimation. The analyzed data were obtained from three independent experiments with triplicate wells in each case.
Also, a monolayer of J774A.1 established on sterile coverslips placed inside 6- well plates were infected with K. pneumoniae (carrying GFP plasmid, pIM438) at MOI of 10:1 for 1 h at 37℃ in 5% CO2. Similarly, the monolayer on the coverslips was washed twice with PBS and gentamicin was added to kill the non- phagocytosed bacteria. The coverslips were washed twice with PBS and then covered with 1 ml of 4% paraformaldehyde for 15 minutes. After few intermittent washes with PBS, the monolayer on the coverslips was permeabilized with 0.2 % Triton X-100 for 5 minutes and nuclei-stained with DAPI and mounted for confocal microscopy. All assays were performed in triplicate experiments.
2.6.8.3 Macrophage survival assay To assess the ability of K. pneumoniae to survive in J774A.1, the cell density of 1×104 per well were seeded in 96-well plates 15 h before infection. Using exponential phase K. pneumoniae, each strain (DN2, ∆T1, ∆T3 and ∆T1∆T3) was used to infect five wells at an MOI of 100:1 for 1h before washing and addition of gentamicin to kill extracellular bacteria. The antibiotics were then maintained in the medium for 2, 4, and
6 h at 37℃ in 5% CO2 and then the antibiotics washed from the cells with PBS. The cells were lysed with 0.5 ml of 0.5 % Triton X-100 in PBS and dilutions of the lysate were plated on LA for CFU estimations. CFUs from three experimental repeats were used for statistical analysis. Data were analyzed from triplicate experiments.
2.6.8.4 K. pneumoniae attachment, invasion and replication in lungs epithelial cells Human lungs epithelial cells, A549 and H292, were challenged with K. pneumoniae strains to assess the effect of T6SS on the attachment, invasion and replication of the bacteria.
2.6.8.4.1 K. pneumoniae H292 and A549 attachment assays H292 cells (1×105) were seeded in a 96-well plate 20 h before infection with K. pneumoniae (DN2, ∆T1, ∆T3 and ∆T1∆T3). Also, a monolayer of H292 was seeded on coverslips a day earlier. The H292 cells in the 96-well plates or on the coverslip were then infected with K. pneumoniae (50:1) for 30 minutes at 37 in 5% CO2. The cells in 96-well plates were then washed 3 times with PBS and lysed with 0.5% Triton X- 100. The lysates were diluted and plated on LA for enumeration of bacteria CFUs. The coverslip monolayer washed three times with PBS and fixed with 4% paraformaldehyde for 15 minutes. With intermittent washes with PBS, the coverslips were stained with rhodamine-phalloidin and DAPI for confocal microscopy. All the experiments were done in triplicates. 98
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods For A549 attachment assay, 1×105 cells per well were seeded 20 h in advance of K. pneumoniae infection. The cells were infected with exponential phase bacteria at MOI of 10:1 and incubated at 37 in 5% for 30 minutes. At the end of the time-point, the cells were washed three times with PBS and lysed with 0.5% Triton X-100. The lysates were plated on LA plated and incubated at 37℃ for CFU enumerations.
2.6.8.4.2 K. pneumoniae H292 and A549 invasion and survival assays
5 The cells (1×10 ) were in 96 well plates and incubated at 37℃ in 5% CO2 20 h before K. pneumoniae infection. Exponential phase K. pneumoniae at MOI of 100:1 was used to infect the cells for 1 h before using antibiotic (gentamicin100 µg/ml for 20 minutes) to kill all extracellular bacteria. The infected H292 and A549 cells were maintained in the gentamicin medium for 2, 4, and 6 h at 37℃ in 5% CO2 and then the antibiotics washed away twice with PBS. The cells were then lysed with 0.5 % Triton X-100/PBS, and the appropriate dilutions were plated on LA and incubated at 37℃ overnight for CFU enumerations.
2.6.8.5 Lactate dehydrogenase (LDH) assay
5 Seeded A549 cells (2 × 10 /well) in 24 well plate at 37℃ in 5% CO2 was infected with K. pneumoniae (DN2, ∆T1, ∆T3 and ∆T1∆T3) at MOI of 100:1 for 1 h. Each strain was used to infect triplicate wells, and the infected cells culture supernatant (500 µl) for each strain was centrifuged to eliminate cell debris at 3000 ×g for 5 minutes. An LDH assay kit (Thermo Fisher) following manufacturer’s recommendation was used to quantify the amount of LDH in each supernatant. This experiment was repeated three times to obtain enough data for statistical analysis.
2.6.8.6 H292 ethidium bromide uptake assay Ethidium bromide (EtBr) assay was used to assess the effect of K. pneumoniae T6SS on H292 membrane integrity and nuclear staining. EtBr (Sigma Aldrich UK) has very low permeability to live cell membrane unlike DAPI, but once the membrane of the cell is compromised, the accumulation EtBr increases and subsequently stains the nuclei of the cells. DAPI (Sigma Aldrich UK) with more specificity and sensitivity to DNA, used a counterstained for any unstained nuclei after fixation.
First, a monolayer of H292 (37℃ in 5% CO2) was established on coverslips 20 h prior to infection. The monolayer was infected with exponential phase K. pneumoniae (non-GFP tagged DN2, ∆T1, ∆T3 and ∆T1∆T3) at MOI of 100:1 for 1.5h and washed twice with PBS. The coverslip monolayers were incubated with antibiotics (gentamicin) in growth medium for 20 minutes and subsequently washed three times with PBS. ErBr in growth medium (100 µg/ml) was added the monolayers and incubated for 30 minutes at 37℃ in 5% CO2. The coverslips were PBS-washed three times and fixed with 4% paraformaldehyde for 15
99
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods minutes. With intermittent PBS washes, the cells were then counterstained with DAPI and mounted on microscopic slides for fluorescent microscopy.
2.6.8.7 K. pneumoniae survival in normal Human Serum and polymorphonuclear cells Venous blood was obtained from 5 consented healthy normal donors who were not on medications or alcohol a month before donation. One portion of the blood was collected in anticoagulant tubes and the other portion collected in tubes without anticoagulants.
Serum isolation: The portion of the blood collected in vacutainer (Becton Dickson) without any anticoagulants was incubated upright at room temperature for 30 minutes until clotting was achieved. The clotted blood was then centrifuged at 2000 RCF for 15 minutes, and the supernatant (serum) was carefully transferred into tubes (NUNC) and stored at -20℃ until needed.
Polymorphonuclear Neutrophil (PMN) isolation: The second portion of the donated blood collected in anticoagulant vacutainer tubes (Becton Dickson) was used for the extraction of polymorphonuclear neutrophils by standard density gradient separation method as previously describe (Oh, Siano and Diamond, 2008; Kuhns et al., 2015). Briefly, 7 ml of neutrophil isolation media called lympholyte-poly solution (a mixture of Sodium metrizoate and Dextran-500, Cedarlane Laboratories) in a 15 ml falcon tube was carefully over layered with an equal volume of the anticoagulated blood (7 ml). The tube was centrifuged (500 RCF at 25℃ for 35 minutes) to separate the mixture into six distinct bands (from top to down; plasma, monocytes, isolation media, neutrophil, more isolation media and red blood cells, RBCs). With the help of Pasteur pipette, the first three layers (plasma, monocytes and isolation media) were discarded while the neutrophil and the below isolation media layers (4th and 5th bands respectively) were collected into a new centrifuge tube. The collected neutrophil containing suspension was diluted with Hank’s Balanced Salt Solution without Ca2+ & Mg2+ (HBSS-, Thermo Fisher) to a final volume of 10 ml while inverting the tube a few times ensure adequate mixing. The suspension was centrifuged (350 RCF at 25℃ for 10 minutes) to obtain a red pellet containing neutrophil and residual RBCs and supernatant was discarded. The residual RBCs in the pellet were lysed by resuspending the pellet in RBCs lysis buffer (2ml, Thermo Fisher) and slowly pulse-vortexed to mix before centrifugation (250 RCF for 5 minutes at 25℃) for a neutrophil pellet. To ensure the elimination of RBCs, the RBCs lysis step above was repeated, and the pellet was resuspended in 500 µl of HBSS- (pulse-vortexed a few times and dilute with HBSS- to 10 ml). The neutrophil suspension in HBSS- was centrifuged and the final pellet was resuspended in 250 µl of HBSS+ (Ca2+ & Mg2+, Thermo Fisher) with 2% human serum albumin (Sigma Aldrich). After counting, more than ≥95.5% of cells were neutrophil (5×106 cells/ml, and ≥96.7% viability), and the desired concentrations were adjusted accordingly for downstream application requirements.
100
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods 2.6.8.7.1 K. pneumoniae serum resistance assay To assess the ability of K. pneumoniae (DN2, ∆T1, ∆T3 and ∆T1∆T3) to survive in serum and cause infection, a serum resistance assay as previously conducted reported (Lai, Peng and Chang, 2003; Sahly et al., 2004) was conducted. Briefly, 1×108 CFU of bacteria in 50 µl of PBS was mixed with 50 µl of pooled normal human Serum and incubated for 1, 2, & 3 h. Also, the same amount of bacterial inoculum was incubated in heat-inactivated of pooled normal human Serum (56℃ for 30 minutes) for 1, 2, & 3 h. At the end of each time point, appropriate dilutions from the incubation mixtures were plated on LA and incubated at 37℃ overnight for the enumeration of bacterial CFU. The percentage K. pneumoniae survival was calculated as;
[(normal serum CFU)/ (heat-inactivated serum CFU)] x 100%
2.6.8.7.2 C3b deposition on K. pneumoniae The deposition of C3 complement on K. pneumoniae assay was carried out as previously reported (de Astorza et al., 2004). Briefly, K. pneumoniae (1×106 CFU per well) was opsonized in 75% normal serum for 20 minutes and 2 hrs. The opsonized bacteria were washed three times in PBS (without ions), and the deposited C3b fragments were dislodged by resuspending the bacteria in 50 nM carbonate-bicarbonate buffer (pH 9.0) containing 1 M NH4OH for 2h at 37℃. The suspension was then centrifuged, and the supernatant containing the dislodged C3b fragments were collected and processed for ELISA. The C3b in the suspension were detected following the manufacturer’s recommendation using Abcam C3b kit catalogue (Ab195461).
2.6.8.7.3 Polymorphonuclear (PMN) leucocytes Internalization of K. pneumoniae Human Polymorphonuclear neutrophils (PMN) are the most abundant nucleated cells circulating in the blood with antimicrobial polypeptides in their characteristic cytoplasmic granules and well as possible antimicrobial reactive oxygen species (Kuhns et al., 2015; Zarember and Kuhns, 2011; Kohanski et al., 2007; Ganz, 1999). To assess the ability of K. pneumoniae to survive in neutrophils, 1×104 isolated PMN cells per well were seeded in 96-well plate and incubated at 37℃ for 2h. The cells were then infected with
6 opsonized K. pneumoniae (1×10 CFU bacteria per well) and incubated at 37℃ with 5% CO2 for 30 minutes. The cells were washed twice with PBS and incubated with gentamicin to eliminate extracellular bacteria and lysed with 0.5% Triton X-100/PBS at 1 and 2 h post-infection. K. pneumoniae CFUs from the lysates were enumerated by plating on LA and incubating at 37℃ overnight. Final data were expressed as CFU/ml from three experimental repeats, with triplicates well for each strain.
101
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods 2.6.8.8 K. pneumoniae interaction with Acanthamoeba castellani 2.6.8.8.1 The culture of A. castellanii The A. castellanii ATCC 30234 was axenically grown in 75 cm3 or 150 cm3 tissue flask in sterile PYG broth at 27℃ to attain at least 95% for trophozoites formation, and the medium changed every 17-20 h. Trophozoites were harvested by tapping flask and subsequently washing trophozoites three times with Page’s modified Neff’s amoeba saline (PAS) or PBS for downstream application. Trophozoite viability (≥ 97%) were checked using trypan blue staining exclusion and hemocytometer under the microscope.
2.6.8.8.2 A. castellanii zone of clearance An overnight culture of K. pneumoniae was subcultured at 1:100 in LB and grown for 4 h. The bacteria were pelleted (3000 ×g for 10 minutes) and resuspended in PBS and the OD600nm adjusted to 0.2. Using a sterile cotton swab, a lawn of K. pneumoniae was made on Mueller Hinton agar (MHA) or M9 agar, and the moisture was allowed to dry. A. castellanii trophozoites (1 ×106) resuspended in 20 µl of PBS was then added to the centre of the bacterial lawn and allowed to dry before incubation. The bacterial lawn together with A. castellanii was incubated at 37℃ for 24 h or 72 h for the zone of clearance caused by the A. castellanii. The zone of clearance was measured, and representative images were also taken. After the incubation, the centre of each zone of clearance was stabbed with a pipette tip and resuspended in PBS. Trypan blue exclusion was used to count the viable of the A. castellanii in the resuspension for the estimation of A. castellani viability.
2.6.8.8.3 K. pneumoniae – A. castellanii association To study the effect of deleting T6SS on the interaction of K. pneumoniae with A. castellanii, an association assay was performed as previously described (Alsam et al., 2006). Briefly, 2 ×105 cells of A. castellanii trophozoites resuspended in 100 µl PAS-containing 10% RPMI (PAS-RMPI) were seeded in 96-well plate and incubated for 2h at 27℃ to allow the cells to adhere to the plate. Exponential phase K. pneumoniae (MOI 100:1) harvested and resuspended in 100 µl of PAS-RPMI containing 2×107 CFU was added to the respective wells of A. castellanii trophozoites. Following 1 h co-incubation of K. pneumoniae and A. castellanii co-culture at 30℃ for 1 h, the mixture was subsequently washed three times with PBS. Using hemocytometer and trypan blue, A. castellanii viability count at the end of the association time point. To enumerate the CFU on LA plates, the A. castellanii was lysed in 0.5% Triton X-100/PBS, and the appropriate dilutions were plated and incubated at 37℃ overnight. The data analyzed was obtained from three experimental repeats, triplicate in each case. The percentage of K. pneumoniae associated with A. castellanii was calculated as;
(number of enumerated bacteria/ numbers of enumerated amoeba) x 100%.
102
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
2.6.8.8.4 K. pneumoniae intracellular survival assay K. pneumoniae intracellular survival was performed as previously reported (Alsam et al., 2006) 2006)). Briefly, A. castellanii (1 ×106 cells/per well) in 400 µl of PAS-RPMI were seeded in 24-well plate and incubated in 27℃ for the cell to adhere to the plate. K. pneumoniae (5 ×107 CFU) at MOI of 50:1 in 100 µl PAS-RPMI was used to infect the cells and incubated for 1 h. Following the incubation of K. pneumoniae – Acanthamoeba co-culture, the cells were washed twice with PBS and maintained in 500 µl of PAS-RPMI with gentamicin (100 µg/ml) for 2 and 4 h post-infection at 30℃. At each time-point, A. castellanii counts were determined using trypan blue and hemocytometer. The infected A. castellanii lysates (0.5% Triton X- 100/PBS) was plated on LA and incubated at 37℃ overnight for CFU were enumerated. The data were analyzed from three experimental repeats, triplicate wells for each strain infection. The percentage of K. pneumoniae survival in A. castellanii was calculated as follows;
(number of enumerated bacteria/ numbers of enumerated amoeba) x 100%.
2.6.8.9 K. pneumoniae induced A549 actin filament polymerization To assess the effect of T6SS deletion on cytoskeletal rearrangement such as actin filaments, a monolayer of A549 was established on sterile coverslips placed in 6-well plates and incubated at 37℃ in 5% CO2. The A549 monolayer of the cell was then infected with K. pneumoniae inoculum (5 × 106 CFU) at MOI of 50:1 and incubated for 1h. Gentamicin was maintained in the medium for 3 and 6 h before they washed three times with PBS. The infected A549 monolayer was then fixed with 4% paraformaldehyde for 15 minutes. After gently washing the coverslips twice with 20 mM glycine and PBS, they were stained with rhodamine- phalloidin (Cytoskeleton Inc) and DAPI (Sigma Aldrich) for 5 minutes and mounted on microscopic slides for confocal microscope.
2.6.8.10 Staining and Confocal microscopy To visualize GFP tagged K. pneumoniae, DAPI, EtBr or rhodamine phalloidin-stained samples, Olympus F1000 confocal microscope at The Center for Core Biotechnology service (University of Leicester) was employed. Basically, after washing the samples with PBS, the samples were fixed with 4% paraformaldehyde (Thermo Fisher) for 15 minutes. After fixation, the free aldehyde groups in the sample were blocked by incubating the samples in 20 mM glycine solution (Sigma Aldrich) for 10 minutes and washing twice with PBS. Triton X-100/PBS (0.5%) were used to permeabilized the samples for 5 minutes, and the samples were then washed twice with PBS. When required, samples were stained with rhodamine- phalloidin (200 µl of 100 nM, Cytoskeleton Inc) for 30 minutes and washed twice with PBS. DAPI (200 µl of 100 nM, Sigma Aldrich) as a counterstain for 5 minutes and washed twice in PBS. GFP (green), 103
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods rhodamine-phalloidin (red) and DAPI (blue) were used to tagged K. pneumoniae, stain actin filaments and nuclei of the cells respectively. To obtain good quality and reproducible results, all washes, fixation and permeabilization were done at room temperature (23℃-24℃) while staining-incubations were carried out in the dark at room temperature. With a drop of vectashield antifade mountain medium (Vector Laboratories), the samples were mounted on microscopic slides and confocally imaged. Slides were usually stored in the Dark until required for imaging. The excitation and emission of 385 nm /505 nm (GFP), 540 nm/540 nm (rhodamine-phalloidin) and 365nm/ 461 nm (DAPI) was used for the visualization of the samples.
2.6.8.11 Proteomic profiling of infected A549 and J774 To explore the innate immune response to K. pneumoniae, various type of cytokines expressed by A549 and J774A.1 cells when infected with the different K. pneumoniae strain (DN2, ∆T1, ∆T3, ∆T1∆T3, KR1730, NTUH∆T1) is imperative in understanding how T6SS may influence the host immune response during infection. A preliminary semi-quantitative method was used to assess the proteomic profile of mouse cytokine array expressed in response to K. pneumoniae infection of A549 and J774A.1 by using the K. pneumoniae - A549 or J774A.1 co-cultured supernatants or cell lysates. Briefly, cell line (A549 or J774A.1) was infected with bacteria in 24-well plate at an MOI of 10:1 or 20:1 and allowed for various time point post-infection. The culture supernatant was collected while the cells were lysed with RIPA lysis buffer (Thermo Fisher). The samples (cell supernatants or lysates) were processed for their cytokine profiling in each case using R&D proteomic profiler human cytokine kit (A549 samples) or proteomic profiler mouse cytokine kit (J774A.1) following manufacturer’s recommendation The proteomic profiler cytokine array kit is a membrane-based sandwich immunoassay where samples are first mixed with a cocktail of biotinylated detection antibiotics as and then incubated with the membrane (carrying the duplicate dot-spots of cytokine capture antibodies arrays). Captured protein was visualized using chemiluminescent detection reagent, and the signal (pixel intensity) was proportional to the amount of the cytokine in the analytes/ samples. ImageJ software package 6.0 was used to acquire and analyzed the pixel intensities of the captured cytokines in the analytes/samples
2.6.8.12 ELISA cytokine/chemokine quantification assay: A549 and J774 Following the use of the semi-quantitative profile cytokine kits, a more specific and fully quantitative traditional sandwich ELISA was performed using various ELISA kits obtained from R&D. Briefly, the supernatant of infected J774A.1 or A549 (infected with K. pneumoniae at MOI 10:1 or 20:1) were collected, centrifuged and filtered with 0.45m filter (Millipore) and stored at -80℃ until required. Abcam or R&D
104
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods Elisa kits for mouse (J774A.1) and human (A549) were used to quantify the amount TNF-α, IL-8, RANTES, IL-1a, IP-10, MIP-1a, MIP-b and MCP-1 in the infected J774A.1 culture supernatant, and IL-6, IL-8, MIF, GRoa, and TNF-α from infected A549 culture supernatant per manufacturer’s recommendations.
2.6.9 Transmission Electron Microscopy
Briefly, a 5 μl volume of K. pneumoniae samples (DN2, ∆T1, ∆T3, ∆T1∆T3, KR1730, NTUH∆T1) were applied to a hydrophilic Formvar-carbon coated copper grid (Agar Scientific). The samples were allowed to adsorb for 5 minutes, and after wicking the excess liquid, the grid was washed once using distilled deionized water and then stained for 15 seconds with 5 μl of 1 % uranyl acetate (pH 4.5). All the Transmission Electron Microscopy were performed at the Centre for Core Biotechnology Services (University of Leicester) with the help of Stefan Hyman using JEOL JEM-1400 microscope at 80 kV.
2.6.10 Data analysis and Statistical Analysis
Various programs/ software packages were used to analyze the data as listed in the bioinformatics section below. The statistical analysis (with the help of Graph pad prism and excel analysis) in growth curves, biofilm assay, survival curves in killing assay, cell association and invasion, bacterial competition, Elisa, and bacteria recovery in Galleria, was performed using of the following; One or two way ANOVA, multiple t-test using Holm-Sidak method, student t-test, Mantel-cox test, non-parametric Kruskal-Wallis test, Dunn’s posthoc analysis, and non-parametric Mann-Whitney U test. The p values less than 0.05 were considered as statistically significant.
2.6.11 Bioinformatic Analysis
A variety of stand-alone or online/web-based programs (listed in the Table 2.4 below) were used in the bioinformatic analysis for this study.
Table 2.4 Bioinformatic resources used in this study Name Purpose Reference PrimerBlast Designing and blasting primers (Jian et al, 2012) Primer3 Designing primers (Koressaar and Remm, 2007; Untergasser et al, 2012) Nebcutter For restriction enzyme selection and digestion (Vincze, Posfai and Roberts, 2003) ORF Finder (NCBI) For identifying open reading frames of (Wheeler et al, 2003) unknown genes https://www.ncbi.nlm.nih.gov/orffinder/ BPROM Identifying the bacterial gene promoters (Salamov and Solovyevand, 2011)
MobilomeFinder Bacterial genomic island identification (Ou et al, 2007)
105
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods APE plasmid editor Linear or circular DNA sequence http://jorgensen.biology.utah.edu/wayned/ap manipulation and analysis e/ Snapgene Manipulation of line or circular DNA, in silico SnapGene® software (from GSL Biotech; PCR and restriction digestion available at snapgene.com) Neural Network promoter Bacteria promoter analysis (Reese, 2001; Reese, 2000) prediction BlasTn Searching NCBI nucleotide database using https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAG nucleotide sequence query E_TYPE=BlastSearch BlasTp Searching NCBI protein database using (Altschul et al, 1997) protein sequence query https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAG E=Proteins BlasTx Using translated nucleotide to search NCBI https://blast.ncbi.nlm.nih.gov/Blast.cgi?LIN protein database K_LOC=blasthome&PAGE_TYPE=BlastSe arch&PROGRAM=blastx tBlasTx Using translated nucleotide to search NCBI https://blast.ncbi.nlm.nih.gov/Blast.cgi?PRO translated nucleotide database GRAM=tblastx&PAGE_TYPE=BlastSearch &BLAST_SPEC=&LINK_LOC=blasttab CDD /RPS-Blast Conserved protein domain/ function search (Marchler-Bauer et al, 2017) https://www.ncbi.nlm.nih.gov/Structure/cdd/ wrpsb.cgi Pfam Conserved protein domain/ function search (Finn et al, 2016) http://pfam.xfam.org/ PROSITE https://prosite.expasy.org/ GeneMark.hmm For gene predictions and analysis http://exon.gatech.edu/GeneMark/gmhmmp. cgi ClustaX In silico PCR Online/web-based PCR analysis with primers (Bikandi et al, 2004; San Millan et al, 2013) Oligo Calc For primer property calculation (such as Tm) (Kibbe, 2007) Phylogeny Fr For phylogenetic tree analysis (Dereeper et al, 2008; Dereeper et al, 2010) MUSCLE Protein/nucleotide sequence alignment https://www.ebi.ac.uk/Tools/msa/muscle/ MAFFT Protein/nucleotide sequence alignment https://www.ebi.ac.uk/Tools/msa/mafft/ Clusta Omega Protein/nucleotide sequence alignment https://www.ebi.ac.uk/Tools/msa/clustalo/ BAGET Bacterial and Archaeal gene exploration tool (Oberto, 2008) Absynte Archaeal and Bacterial Synteny explorer (Despalins, Marsit and Oberto, 2011) SyntTax Prokaryotic synteny and taxonomy explorer (Oberto, 2013) MGcV Microbial genomic context viewer (Overmars et al, 2013) Genearks Microbial gene prediction and trimming (Besemer, Lomsadze and Borodovsky, 2001)
106
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods ARDB Antibiotic resistance database for predictions (Liu and Pop, 2008) CARD Comprehensive antibiotic resistance database (McArthur et al, 2013)
107
David Mwin, Ph.D. Thesis “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Materials and Methods
108
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Chapter Three
Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
109
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
3.1 Constructed molecular tools and strategic genetic manipulation
To help advance T6SS works in K. pneumoniae and ease the genetic manipulation of multidrug-resistant Gram-negative bacterial strains, various molecular tools were constructed and either used in this work or elsewhere by colleagues in Lab 212 or collaborators. Recently, many bacterial species, including the K. pneumoniae, have become resistant to a broad range of antibiotics, thereby evading clinical therapies. K. pneumoniae HS11286 used in this work is clinical isolate with multidrug-resistant properties that was isolated from the sputum of a patient at Huashan Hospital, Shanghai-China (Liu et al., 2012a). The strain is also resistant to carbapenems, which are often considered the “last-resort” antibiotics in Clinical settings. Many of such resistant Gram-negative bacteria such as K. pneumoniae also double their arsenal potency with other virulence factors (e,g T6SS) that may have been acquired via horizontal gene transfer. Also, at the beginning of these research work, there very limited molecular tools that could be used for the genetic manipulation of MDR K. pneumoniae genomes, several molecular tools were constructed to cover for this need. Using allelic exchanged approach via lambda red mutagenesis, a novel strategy was developed to swap genes in plasmids in E. coli background with 100% efficiency without the use of restriction-ligation.
3.1.1 Novel DNA swapping strategy; constructing FRT-flanked antibiotic resistance marker
To create variants of a plasmid, a novel approach was developed by first constructing a negative selection and antibiotic markers (sacB-cat) version of that plasmid before subsequently swapping the negative and antibiotic markers with the required gene/marker in the presence of sucrose. This approach is easy, fast and efficient in constructing varieties of a plasmid by eliminating the difficulty of looking for compatible restriction enzymes sites for cloning purposes. A well-established negative and positive selection marker (sacB-cat) was amplified from pJTOOL-3 and used to replace the target gene in the plasmid of interest (Figure 3.1). This intermediate plasmid (the sac-cat bearing plasmid) was then transformed into an E. coli carrying a lambda red recombination plasmid and recovered at 30℃ with the appropriate antibiotics. The Examples of such constructed intermediate plasmids carrying sacB-cat negative-antibiotic marker include pDNTOOL-13, pDNTOOL-16, pDNTOOL-22 and pDNTOOL-31. A mutant allele constructed by joining the antibiotic marker /gene of interest to LF and RF of the target gene was used to transform arabinose
110
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae induced E. coli carrying both the intermediate plasmid and the lambda red recombination plasmid. The transformants were then recovered at 37 on LA supplemented with 5% sucrose and the appropriate antibiotics. The recovery of the transformants on that appropriate antibiotics LA plate supplemented with 5% sucrose at 30℃ enabled the successful replacement of the sacB-cat on the intermediate plasmid with gene B (Figure 3.1) while losing both the temperature-sensitive lambda Red recombination plasmid and any residual intermediate sacB-cat bearing plasmid. The negative selection pressure in the E. coli is because of the lethality levansucrase expressed by sacB in the presence of sucrose while at a higher temperature (≥37℃) the temperature-sensitive lambda Red recombination plasmid is lost from the E. coli. With this technique, a wide range of plasmid variants (with the same backbone) can be constructed via lambda Red recombination-based mutagenesis using various linear mutant alleles (LF-Antibiotic maker-RF) is a single electroporation event.
The E. coli carrying both the sacB-cat-intermediate plasmid and the lambda Red recombination plasmid was then repeatedly electroporated with mutant alleles resulting in plasmid variant construction. Hence, after transformation with the mutant alleles, only transformants carrying the right constructed plasmid were recovered on the plate at 37℃ and subsequently confirmed by PCR and restriction digestion. This approach was so efficient (Figure 3.3) that with little to no optimization, it could be extrapolated to making marker- less chromosomal complementation.
Based on this novel strategy of gene swapping strategy, several molecular genetic tools have been constructed and used to facilitate the genetic manipulation of various bacteria for this work or elsewhere. Some of the tools constructed include FRT-flanked antibiotic resistance marker, lambda Red variant plasmids, Flprecombinase-expressing variants, and expressing/cloning plasmids.
111
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Figure 3.1 Schematic representation of novel in vivo plasmid manipulation. A negative selection-antibiotic cassette marker, sacB-cat (1a) amplicon from pJTOOL-3 and an inverse-PCR amplicon of the plasmid to be manipulated (1b) were restriction digested and ligated to form the intermediate plasmid (2), which becomes the secondary target plasmid. Gene B was indirectly used to replace gene A via lambda mutagenesis. The intermediate plasmid was then transformed into a competent E. coli strain carrying a lambda Red plasmid recombination plasmid and recovered on LA with chloramphenicol and any other appropriate antibiotic at 30℃. A mutant allele consisting of the antibiotic cassette, LF and RF of the target gene was transformed into a 0.2% arabinose- induced E. coli strain carrying both plasmids (intermediate sacB-cat plasmid and lambda Red recombination plasmid), The transformants were recovered in LA supplemented with 5% sucrose and the appropriate antibiotic at 37℃ overnight. In the presence of sucrose, sacB produces levansucrase which lethal to E. coli. Hence any residual plasmid with sacB-cat is kicked out of bacteria, and only colonies with the appropriate antibiotic marker are retrieved.
To investigate the feasibility of this in vivo plasmid cloning approach using E. coli as a host, the construction of FRT flanked antibiotic marker variants in pUC18R6K-mint-tn7t backbone was used to validate this novel strategy while testing for its versatility and efficiency. An FRT-aacC1-FRT based plasmid (pUC18R6K- mint-tn7t-Gm) was used as the PCR template for the LF and RF of the target gene (aacC1) and as primary target plasmid with the target gene to be replaced. A 2.2 kb amplicon of sacB-cat (using primer-pair DN41/DN42) from pJTOOL-3 was ligated with a 3.8 kb pUC18R6K-mini-Tn7t backbone (using DN43/DN44), and the ligation mixture was transformed into E. coli and recovered on LA + chloramphenicol at 37℃ overnight. To verify the functionality of the sacB-cat on the pDNTOOL-31, a verified transformant colony of E. coli carrying the 6 kb intermediate pDNTOOL-31 was grown in 5ml LB + 5% sucrose overnight at 37℃ with shaking and an appropriate dilution was plated on LA and LA+ chloramphenicol. The plates examine for colonies, but no colonies were noted on LA+ chloramphenicol, unlike LA, indicating that the E. coli had loss the pDNTOOL-31 carrying the sacB-cat in the presence of sucrose due to the lethality of expressed levansucrase. A negative colony PCR results from 10 randomly selected colonies were used a PCR authenticate the loss of sacB-cat bearing pDNTOOL-31.
112
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Figure 3.2 Construction and verification of pDNTOOL-31. The intermediate plasmid (secondary target plasmid), pDNTOOL-31, was constructed by ligating sacB-cat amplicon (DN41/DN42, 2199 bp) with pUC18R6K-mini-Tn7t backbone amplicon (DN43/DN44, 3796 bp) and transforming the ligation mixture into E. coli carrying lambda Red plasmid (pDNTOOL-15). The transformants were recovered at 30℃ on LA plates supplemented with sucrose and the appropriate antibiotics. To construct various antibiotic cassettes flanked by FRTs, arabinose induced E. coli carrying both pDNTOOL-15 and pDNTOOL-31 was transformed with the mutant allele (LF-antibiotic cassette-RF), this resulted in the replacement of the sacB-cat region with the mutant allele by allelic exchange.
The 6 kb intermediate pDNTOOL-31 was extracted and verified by both PCR and restriction digestion (Figure 3.2) before it was transformed into an electrocompetent E. coli carrying pDNTOOL-15 and recovered at 30℃ on LA supplemented with antibiotics. Transformants colonies were parallel patched on LB + chloramphenicol, LA + kanamycin and LB + chloramphenicol and kanamycin at 30℃ overnight. An overnight culture (5 ml in LB + chloramphenicol and kanamycin) from a verified E. coli carrying pDNTOOL-31 & pDNTOOL-15 and grown at 30℃ with shaking. A 1:100 subculture of E. coli (carrying pDNTOOL-31 & pDNTOOL-15) in 100ml of LB + chloramphenicol and kanamycin at 30℃ with shaking to grow to OD600nm 0.2 before the addition of 0.2% arabinose. The culture was harvested for
113
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae electrocompetent cells preparation when the OD600nm of cells was between 0.6-0.8. Aliquots of the arabinose-induced electrocompetent of E. coli (carrying pDNTOOL-31 & pDNTOOL-15) were separately transformed with an array of mutant alleles to give rise to various pDNTOOL plasmids as indicated in Figure 3.4.
Figure 3.3 Colony PCR to confirm the presences or absence of a target gene, lambda Red and constructed plasmids. To test for the efficiency of this in vivo cloning approach, ten E. coli tranformant colonies originally carrying both pDNTOOL-31 & pDNTOOL-15 were randomly selected for PCR confirmation for the presence or absence of pDNTOOL-31, pDNTOOL-15 and constructed plasmid before and after transformation. Before transformation with the mutant alleles, colony PCR amplification of sacB-cat from pDNTOOL-31, beg region (bet, exo, gam) from pDNTOOL- 15, and mutant alleles indicated that only pDNTOOL-31 & pDNTOOL-15 were present in the E. coli. However, after transformation of arabinose induced E. coli carrying the two plasmids (pDNTOOL-31 & pDNTOOL-15) with the various mutant allele, a transformant colony PCR was performed for the presence of sacB-cat bearing-pDNTOOL-31 (DN41/DN42, 2.2 kb), beg-bearing pDNTOOL-15 (DN125/DN126, 1.9 kb) and constructed pDNTOOL-bearing the mutant alleles [DN54/DN55 (aac(3)-IV, 836 bp), DN49/DN50 (hph, 1046 bp), DN49/ DN53(hph-gfp 1935 bp), DN54/DN53 (aac(3)-VI-gfp 1725 bp)]. The efficiency index of the in vivo cloning strategy was calculated as; # of colonies PCR-positive for the plasmid divided by the # of colonies randomly selected, all multiplied by 100%. Unlike before transformation, all the transformant colonies carried only the mutant allele in the constructed plasmid but not pDNTOOL-31 & pDNTOOL-15 after transformation.
114
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Figure 3.4 Confirmation of constructed plasmid carrying FRT-Antibiotic resistance marker-FRT. Constructed plasmids (pDNTOOL-1, pDNTOOL-32, pDNTOOL-33, pDNTOOL-34, pDNTOOL-35, pDNTOOL-35, pDNTOOL-37, pDNTOOL-38) were verified by using various restriction enzymes. Generally, restriction digestion was set up with either a single enzyme or compatible enzymes by mixing the DNA, restriction enzyme buffer and enzymes and incubate at 37 for at least 1h.
During functional gene studies, complementation of the knocked-out gene into its original locus without any upstream or downstream adverse effect on other gene is vital in understanding the functional role of the gene. However, most of such complementations are done in plasmids (trans-complementation) because the technique required for marker-less cis-complementation can be very challenging. When the gene is complemented in trans, several factors such as plasmid copy number, promoter, expression other unknown
115
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae proteins in the plasmid backbone and plasmid compatibility among many others affect the expression of the complemented gene and other neighbouring genes. As a result, the gene could be over-expressed, under- expressed or even not expressed at all, thus affecting the overall complementation studies. Unlike trans- complementation studies, this novel approach of gene swapping can easily be extrapolated for cis- complementation studies. With careful optimization, the gene to be complemented can be precisely put back into its original locus, hence minimizing or eliminating any deleterious effect of trans- complementation.
3.1.2 Other constructed genetic tools
Using the above-described approach, together with standard cloning techniques, other important molecular tools were constructed. These included lambda Red recombination-based variant plasmids, Flp- recombinase encoding plasmids and cloning/expression plasmids. These tools provided the flexibility of antibiotic marker selection during the mutagenesis stage, post-mutation antibiotic resistance marker excision and cloning/ expression of genes for functional studies. In the case of the T6SS study, some of these tools provided the means further to explore the role of T6SS in K. pneumoniae.
3.1.1.1 Lambda Red recombination plasmid derivatives For mutagenesis, variants of lambda red recombination-based plasmids (pKOBEG-Apra and pKD46) were mainly constructed using the in vivo cloning as described earlier in this section. These plasmids include pDNTOOL-5, pDNTOOL-10, pDNTOOL-11, pDNTOOL-12, pDNTOOL-13, pDNTOOL-14, pDNTOOL-15, pDNTOOL-16 and pDNTOOL-17. The lambda red plasmid, pKD46 encoding ampicillin resistance was not selectable during the mutagenesis of MDR K. pneumoniae. Hence, the plasmid was used as the parent plasmid in the construction of hygromycin, apramycin, gentamicin, kanamycin and chloramphenicol variants (pDNTOOL-5, pDNTOOL-10, pDNTOOL-11, pDNTOOL-12, pDNTOOL-13 respectively) of pKD46 were constructed. Though pKOBEG-Apra encoding apramycin resistance was selectable in MDR K. pneumoniae HS11286 during mutagenesis and the availability and diversity of such plasmids are essential in the genetic manipulation of many MDR Gram-negative bacteria. Thus, pKOBEG- Apra was also used as a parent plasmid for the construction of variants including pDNTOOL-14, pDNTOOL-15, pDNTOOL-16 and pDNTOOL-17, encoding hygromycin, kanamycin, chloramphenicol and gentamicin resistance, respectively. All the lambda red recombination-based plasmid variants were verified by phenotypic- selection for that associated antibiotic resistance and genotypically by restriction digestion and PCR. Plasmid and primer sequences are in Table 2.1 and Appendix 1: Primer Table, respectively. Some of these constructed lambda red plasmid variants (pDNTOOL-5, pDNTOOL-10, pDNTOOL-14 and pDNTOOL-17) were used in the constructing various gram-negative bacterial mutants
116
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae including K. pneumoniae, A. baumannii and E. coli. The constructed lambda red recombination-based plasmid carried a temperature-sensitive origin of replication (30℃) and an arabinose-inducible promoter which responded to maximal expression with the addition of 0.2% of L-arabinose.
3.1.1.2 Flp-recombinase encoding plasmids A flippase recombinase encoding plasmid pFL2, carrying ampicillin marker was used for the construction of different antibiotic resistance encoding versions for mutant antibiotic marker excision to generate markerless mutants. The constructed Flp-recombinase encoding plasmids include pDNTOOL-2, pDNTOOL-18, pDNTOOL-19, pDNTOOL-20 and pDNTOOL-21 respectively encoding apramycin, hygromycin, chloramphenicol, gentamicin and kanamycin resistance. The plasmids were mainly constructed by electroporating E. coli carrying the lambda red plasmid and the pFLP2 with an SOE-PCR product (LF-antibiotic marker-RF). This resulted in the successful replacement of the ampicillin gene in the original pFLP2 with the donor antibiotic resistance marker. All the Flp recombinase-based plasmid variants constitutively expressed flippase recombinase which recombines the two FRT sites flanking a mutant antibiotic marker thereby excising the antibiotic marker and making the mutant markerless. Also, these plasmids carry a sacB gene which expresses lethal levansucrase in the presence of sucrose, thus causing the Flp-recombinase plasmid to be negatively selected against by the markerless mutant. With the construction of the Flp-recombinase plasmid variants, it provided the flexibility of antibiotic selection and an efficient and safe way of making MDR bacterial mutants. The Flp recombinase plasmids were verified by the antibiotic selection, restriction digestion and PCR. While the plasmids were widely used by colleagues and collaborators, they were particularly important in the generation of ∆T1, ∆T3 and ∆T1∆T3 for the study of T6SSs in K. pneumoniae.
3.1.1.3 Cloning/expression plasmids For the purposes of gene expression and cloning for functional studies, several plasmids were constructed for used in this work as well as made available to colleagues and collaborators. The cloning/expressing constructed included pDNTOOL-3, pDNTOOL-4, pDNTOOL-22 to pDNTOOL-30 and pDNTOOL-39. These plasmids encoded a variety of antibiotic resistance, promoters and replication origin to diversify the in MDR Gram-negative bacteria. Some of the plasmids (pDNTOOL-26, pDNTOOL-27, pDNTOOL-28 and pDNTOOL-30) expressing GFP can be used for tagging bacteria for confocal/ fluorescence microscopy.
117
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae 3.2 K. pneumoniae HS11286 mobile genome analysis and disarmament antibiotic resistance
3.2.1 The mobile genome of K. pneumoniae HS11286 and analysis
MDR and hyper mucoid K. pneumoniae strains are currently a global threat in many hospitals and rendering most the available antibiotic therapies ineffectual, particularly some last-line antibiotic options such as carbapenem and polymyxins. This chapter specifically focuses on the exploration and mapping of the landscape of ST11 Carbapenem-Resistant K. pneumoniae HS11286 (CRKP) mobile genome. The bacterium is a fully sequenced (GenBank accession number CP003200) and was isolated from the sputum of a patient at Huashan Hospital, Shanghai-China (Liu et al., 2012a). K. pneumoniae HSS11286 is part of dominant ST11 clone in China and closely related to world-wide dominant ST258 clone (Qi et al., 2010; Munoz-Price et al., 2013; Chen et al., 2014b). This makes K. pneumoniae HS11286 a very important model organism to explore its resistance or virulence-associated mechanisms by annotating its resistance mobilome and creating an attenuated model strain. Certain mobile genetic elements (plasmids, integrons, transposons, ISs, prophages, ICEs and GIs) are crucial in the acquisition and spread of virulence or resistance genes, thus playing a role in the bacteria evolution (Frost et al., 2005a; Partridge, 2011a; Partridge, Zong and Iredell, 2011).
K. pneumoniae HSS11286 has one chromosome and six plasmids (pKPHS1, pKPHS2, pKPHS3, pKPHS4, pKPHS5 and pKPHS6), three of which are large plasmids (pKPHS1=122,799 bp, pKPHS2=111,195 bp, pKPHS3=105, 974 bp) believed to be involved in multidrug resistance including carbapenemase producers while the rest are small plasmids (pKPHS4= 3,751 bp, pKPHS5= 3,353 bp and pKPHS6= 1,308 bp) that code for unknown proteins. With a similar backbone to K. pneumoniae plasmid pKP048 (Jiang et al., 2010), pKPHS2 has blaTEM-1 and carbapenemase gene blaKPC-2 genes. Also, pKPHS3 has similarity with Yersinia pestis plasmid pIPI202 (Galimand et al., 1997) with essential resistance genes such as tetG, cat, sulI, dfraI2, aac(3) and aph.
Both pKPHS2 and pKPHS3 has a conjugative transfer (tra) and is thought to play a role in multidrug resistance of the strain. K. pneumoniae HS11286 has a very plastic genome, hence suggesting the role of the mobile genetic elements in the bacteria evolution and the spread of antibiotic resistance/ virulence- associated genes. The K. pneumoniae HS11286 genome has two novel integrative and conjugative elements; a 63 kb asn tRNA gene associated ICEPKpnHS11286-1 and 56 kb phe tRNA gene associated ICEKpnHS11286-6 (Bi et al., 2012; Liu et al., 2012a).
As reported in Bi et al. 2015, various mobile genetic elements including 49 ISs, nine transposons, two separate InC2-like integron remnants, seven prophages, 2 ICEs and four genomic islands were identified (Appendix 2-4- Distribution of mobile genetic elements in K. pneumoniae HS11286) and annotated. The
118
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae replicon IncFIB (pKPHS1), IncFIIK/ IncR (pKPHS2), IncA/C2 (pKPHS3), ColE2-like (pKPHS4), ColE1- like (pKPHS5) and Col (KPHS6) were identified (Appendix 2-5 Replicons of the K. pneumoniae plasmids) to be associated with the plasmids in K. pneumoniae HS11286. Also, pKPHS2 shared similarity to pKP048 and has F-like type IV secretion system (T4SS) gene cluster, an oriT and a relaxase gene traI while pKPHS4 may be mobilizable as it carries relaxase and cognate oriT but not T4SS.plasmid. Among the ISs identified, 30 were in the chromosome, 2 in pKPHS1, 9 in pKPHS2 and 8 in pKPHS3. Plasmid pKPHS1 has one transposon while pKPHS2 or pKPHS3 each carried four transposons. Seven prophages, two ICEs and four other GIs were identified on the chromosome of K. pneumoniae HS11286 (Appendix 2-4- Distribution of mobile genetic elements in K. pneumoniae HS11286). Also, presented in Appendix 2-3 Resistance genes identified in K. pneumoniae HS11286 that could confer resistance in Clinical cases are genes predicted to play a role in antibiotic resistance in clinical practice that was identified in the K. pneumoniae HS11286.
The antibiotic resistance regions/genetic elements on pKPHS2 and pKPHS3 were mapped to fine detail (Figure 3.5) (Bi et al., 2015) and subsequently postulated as the regions responsible for the multidrug resistance of the K. pneumoniae HS11286 including carbapenem. The region includes blaKPC-2 on pKPHS2 and 12 other clustered antibiotic resistance genes on a 26 kb region on pKPHS3. The strain has many mobile genetic elements including six plasmids, 49 ISs, nine transposons, two In2-like integron remnants, two ICEs and seven prophages. Out of 16 identified plasmid-born resistance genes, 14 of them were associated with Tn1721-, Tn3-, Tn5393-, In2-, ISCR2- and ISCR3-derived elements.
Also, the results from resistance mobilome mapping and disarmament in K. pneumoniae HS11286 provided insights and facilitated the easy generation of “resistance-disarmed” model organism (Bi et al., 2015). The antibiotic resistance regions were identified and mapped in K. pneumoniae HS11286, and the knowledge was used to successfully created a safer and easy-to-manipulate resistance disarmed version for further work on T6SS (Bi et al., 2015). First, blaKPC-2 was deleted, then followed by the deletion of 26 kb region (carrying 12 clustered resistance genes) resulting in a significant decrease in the antibiotic resistance spectrum demonstrated by the resultant mutant, DN2 (Bi et al., 2015). The “resistant disarmed” version was created by deleting blaKPC-2, and 26 kb region (12 clustered antibiotic resistance genes and one biocides gene) and the MICs of the mutant was determined to ensure the loss the related antibiotic resistance.
The results re-emphasized plasmid’s role in the acquisition and spread of virulence/ antibiotic resistance in K. pneumoniae and how ISs, transposons and integrons shape the resistance-coding regions in this clinically important strain, K. pneumoniae HS11286 (Bi et al., 2015). Hence, the “resistant-disarmed” K. pneumoniae ST11 strain will offer an easier and modifiable model organism referred to in subsequent chapters of this thesis as DN2 or DN2T strain for T6SS works.
119
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae The mapping out of the resistance region provided an insight into the content and context of the antibiotic resistance region on the two plasmids, and this facilitated the successfully knocking out of the desired regions in K. pneumoniae HS11286. This suggests that acquisition and maintenance of as many as six plasmids in the K. pneumoniae HS11286 through horizontal transfer was critical in mediating plasmid- based antibiotic resistance. Notably, pKPHS2 and pKPHS3 play a significant role in mediating antibiotic resistance, supporting the notion that plasmid is the principal bearer of the resistance genes in K. pneumoniae.
3.2.2 Resistance genes and the broader contexts of the linked regions
In the context of antibiotic resistance, eighteen genes relevant in clinical antibiotic resistance were identified (Appendix 2-3 Resistance genes identified in K. pneumoniae HS11286 that could confer resistance in
Clinical cases). The blaKPC-2 located on pKPHS2 in the context of Tn1721 transposon (truncated by IS26) region and highly syntenic to pKP048 (Jioan et al., 2010). The similarity of pKP048 to blaKPC-2 bearing pKPHS2 plasmid which lacks a 35.3 kb central region with almost perfect identical flanking regions suggest that pKPHS2 may have originated from a pKP048-bearing plasmid with IS26 insertion into Tn 1712 element and subsequent IS26 recombination. This possibly caused the loss of 35.3 kb central region (Partridge, 2011a; Cain and Hall, 2012; Partridge, Zong and Iredell, 2011; Harmer, Moran and Hall, 2014).
Regarding antibiotic resistance, more resistance genes were associated with pKPHS3 (Figure 3.5b) than the other plasmids and were clustered within a 26 kb region that partly shares similarity with an MDR region on pSRC27-H (Cain and Hall, 2012; Bi et al., 2015). Located within In2-derived class 1 integron remnant are aadA2, dfrA12-like gene, sul1and qacED1 and In2-derived integron and pKPHS2 integron are related to Tn21 (Liebert, Hall and Summers, 1999). While tetAR and floR genes may have been acquired through ISCR3-mediated co-transposition, the three copies of blaTEM-1 carried on varying degrees of Tn3 transposons are consistent with IS26-blaTEM or pSRC27-H configuration (Partridge, Zong and Iredell, 2011; Bailey et al., 2011; Cain and Hall, 2012). Also, two copies of blaCTX-14 within Tn721-derived element were identified with the MDR region on the pKHPS3 (Bi et al., 2015). The strA, strB and sul2 may have been acquired similarly to RSF1010 plasmid (Patridge, 2011) and rmtB, aacC2, fosA and blaSHV-11 could rarely be shown to be related to mobile genetic elements though rmtB and blaSHV genes are possibly related to ISCR3 and K. pneumoniae (Bi et al., 2015; Partridge, 2011a; Toleman and Walsh, 2008).
K. pneumoniae HS1128 (dominant CRKP ST11) and other ST11 related strains tend to carry most of the resistance genes on their plasmids (Bi et al., 2015), which aid the acquisition and spread of such antibiotic resistance genes or virulent factor within K. pneumoniae species and other species. In a broader context,
120
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae most of these acquired resistance genes have undergone some form of evolution mostly mediated by mobile genetic elements such as ISs, transposons and integrons. Over time, these evolutionary processes gradually accumulate virulent factor or resistance genes within the bacterial genome, which become crucial factors in the bacteria survival and cause disease potential (Bi et al., 2015).
Figure 3.5 The contexts of resistance genes in K. pneumoniae HS11286 (a) pKPHS2 and (b) pKPHS3 plasmids. The relevant parts of pKP048 and pSRC27-H are also shown to highlight the syntenic regions. The horizontal lines shown above or below the schematics, with one or both ends demarcated by solid triangles to indicated inverted repeats, represent intact, interrupted or truncated ISs, transposons or integrons as appropriate. Interruptions in the above structures are indicated as dashed lines. Regions of synteny between adjacent schematics are indicated by the shaded areas; the matching percentage nucleotide sequence identity for each such region is indicated. Associated flanking direct repeat sequences are shown above matching finer lines linked to the solid triangles. GenBank accession numbers for pKP048 and pSRC27-H are FJ628167 and HQ840942, respectively. The genetic context of the pKPHS3- borne blaCTX-M-14 is not shown here. Schematic: (Bi et al., 2015)
3.2.3 Genetic disarmament of the resistance of K. pneumoniae HS11286
The clinical K. pneumoniae HS11286 strain poses a significant health risk and difficult to genetically manipulate due to the acquired multidrug resistance, thus there was the need to create a safer strain that is easier to manipulate genetically. This was done by sequentially knocking out blaKPC-2 on pKPHS2 and the 26 kb MDR region on pKPHS3. The single (∆KPC) and double knockout (DN2 or ∆KPC∆MDR) were 121
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae employed in antimicrobial susceptibility testing (Appendix 2-2 Antibiotic susceptibility of K. pneumoniae HS11286 and the antibiotic disarmed versions) against a wide range of antibiotics belonging to 19 classes. The ∆KPC mutant was sensitive to cefoxitin and ceftazidime, and dose-dependent susceptibility to cefepime, this indicates that cephalosporin resistance in K. pneumoniae HS11286 most likely due to blaKPC-
2, unlike other b-lactamase encoding genes. As expected, while the wild-type KR3317 was only sensitive to levofloxacin, colistin, polymyxin B and tigecycline, the mutants (especially DN2) were susceptible to a wide range of antibiotics. This suggested that plasmid play a key role in the acquisition and dissemination of resistance genes.
Figure 3.6 Deletion of blaKPC-2 on pKPHS2 and 26 kb MDR region on pKPHS3 in K. pneumoniae HS11286 background. A: Disarming the blaKPC-2 (KPHS_p200360) located on pKPHS2 from the original parent strain (K. pneumoniae HS11286), this resulted in ∆KPC which was then used for the next stage of double knockout. B: Knocking out the 26-kb multidrug resistance region (KPHS_p300510-KPHS_p300880) located on pKPHS3 in a ∆KPC background.
The pKPHS2 blaKPC-2 deleted by first constructing an SOE-PCR product (UF-hph-DF) using FRT flanked hph and ~500 bp upstream and downstream flanks amplified using GmF/GmR, DN157/ DN158 and DN159/ DN160 respectively. Using lambda Red (pKOBEG-Apra) recombination-based allelic exchange, blaKPC-2 was then swapped with the SOE-PCR (UF-hph-DF) and the mutants ∆KPC:hph were selected on LA hygromycin at 37℃. Using a flippase expressing plasmid, the hph cassette in ∆KPC:hph was excised based on flp-FRT recombination to create a marker-less ∆KPC (Figure 3.6). To further knockout the 122
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae pKPHS3 26 kb MDR region (KPHS_p300510-KPHS_p300880) in ∆KPC background, the upstream (DN165/DN166) and downstream flanks (DN167/DN168) and hph cassette (GmF/GmR) were used to form a mutant allele/ SOE-PCR product. Again, the MDR mutant allele was then used to replace the 26 kb MDR region using lambda recombination to create ∆KPC∆MDR:hph (DN2T) at 37℃. Then, the hph cassette in ∆KPC∆MDR:hph was again flipped out using flippase expressing plasmid to induce flp-FRT recombination, resulting in the final attenuated DN2 or ∆KPC∆MDR (Figure 3.6).
After the deletion of blaKPC-2 and 26 kb MDR region that carries genes transposases, regulators and hypothetical proteins with vast resistance arsenal, the final mutant DN2 (∆KPC∆MDR) was susceptible to a wider group of antibiotics (Appendix 2-2 Antibiotic susceptibility of K. pneumoniae HS11286 and the antibiotic disarmed versions) but not certain b-lactam (due to the residual blaTEM-1, blaCTX-M-14 and blaSHV-
11). The MIC data of DN2 mutant also showed attenuated resistance to certain b-lactam, suggesting the loss of the blaTEM-1 and blaKPC-2 contribute to some form of b-lactam resistance. Additionally, both mutants (∆KPC and DN2) showed no reduction in Fosfomycin (due to fosA), nalidixic acid and subtle reduction to ciprofloxacin probably due to due Ser83 Ile mutation in gyrA and the Ser80 Ile mutation in parC (Deguchi et al., 1997; Fu et al., 2008) (Ddeguchi et al., 1997; Fu et al., 2008). Overall, the final mutant ∆KCP∆MDR (DN2) was safer to genetically manipulate and expands its use as K. pneumoniae model organism for future studies such T6SS virulence studies as presented in this report.
To create the attenuated antibiotic-resistant version, blaKPC-2 on pKPHS2 was first replaced with FRT- flanked hph cassette via lambda red recombination and the antibiotic marker cassette was excised through flippase mediated FRT recombination to create a marker-less ∆KPC (blaKPC-2 mutant). Similarly, a 26 kb multi-antibiotic resistant region on PKPHS3 was further deleted from ∆KPC by replacing the 26 kb region with FRT-flanked hph using lambda red recombination. The antibiotic cassette (hph) was then excised by the recombination of FRT mediated by flippase, resulting in the final attenuated model strain DN2 (∆KPC∆MDR). To confirm the associated attenuation in antibiotic resistance, antibiotic susceptibility test (Appendix 2-2 Antibiotic susceptibility of K. pneumoniae HS11286 and the antibiotic disarmed versions) for ∆KPC and DN2 was performed relative to the wild-type strain KR3317.
3.3 Disarmament of antibiotic resistance in K. pneumoniae HS11286 enhanced in vitro fitness not in vivo virulence in G. mellonella.
The original K. pneumoniae HS11286 strain was difficult to genetically manipulate and pose a significant health hazard in the event of acc4idental infection during routine laboratory experiments. As such in order to be able to investigate T6SSs in K. pneumoniae HS11286, a disarmed antibiotic-resistant version of the
123
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae strain (DN2) was created using lambda red recombination-based allelic exchange. This involved the knockout of blaKPC-2 and a 26 kb antibiotic resistance region (consisting of 12 antibiotic resistance genes and one biocide resistance gene, Figure 3.5, Figure 3.6 and Appendix 2). To perform the in vitro competition assay, a 1:1 ratio of the original wild-type strain K. pneumoniae HS11286 (KR3317) and its antibiotic resistance disarmed version (DN2) were mixed and grown in LB for 24 h at 37℃. Additionally, both strains were also separately cultured. A 1:100 subculture of the bacterial mixture was made into a fresh LB and grown for another 24h. At each time-point (day 1 and 2), a sample from the growing mixed culture was then plated onto LA and LA plus antibiotics and the CFU were enumerated. Also, Galleria mellonella larvae killing assay was then used to measure whether there was reduced virulence in DN2 after the disarming of the antibiotic resistance region relative to its parent strain, KR3317. Briefly, 5×106 CFU of either KR3317 and ‘resistance-disarmed’ DN2 strain were used to inoculate the larvae of Galleria mellonella (at least 30 in each group), and the survival of these larvae was measured of 6 days period. Death of Galleria larvae was characterised by lack of sensitivity or response, immobility of the larva and melanisation between 24 h interval inspection post-infection with the various bacteria strains.
The data (Figure 3.7A) obtained from the in vitro culture revealed that more DN2 were recovered from the mixture more than KR3317, suggesting that the resistance disarmed DN2 was much fitter and outcompeted its parent strain. The deletion of the blaKPC-2 and the 26 kb MDR region significantly enhanced the fitness of the DN2 relative to the parent strain, which encountered a huge physiological fitness cost just by bearing more antibiotic resistance regions. This was not very surprising as earlier studies have reported that a large acquisition of antibiotic resistance region poses a high cost to that bacteria growth. Also, the antibiotic susceptibility data (see Appendix 2-2 Antibiotic susceptibility of K. pneumoniae HS11286 and the antibiotic disarmed versions) revealed that the resistance-disarmed strain (DN2) became very susceptible to many antibiotics including ceftazidime, Ceftazidime, imipenem, meropenem, gentamicin, tobramycin, amikacin, streptomycin, kanamycin, levofloxacin, trimethoprim-sulfamethoxazole, trimethoprim and chloramphenicol. The predicted genes with the 26 kb antibiotic region thought to be responsible for the antibiotic resistance in KR3317 are tabulated in Appendix 2-1: List of genes deleted from the 26 kb region.
124
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Figure 3.7 Deletion of the K. pneumoniae HS11286 antibiotic resistance arsenal enhances competitive fitness but not virulence in Galleria larvae. A) The disarmed antibiotic-resistant strain (DN2) competed against its parent strains, wild-type K. pneumoniae HS11286 (KR3317). To perform the competition assay, KR3317 and DN2 were initially subcultured from overnight cultures at 1:100 until the OD600nm of each strain reached 0.2. Then a 1:1 mixture of the two strains (OD600nm=0.2) was grown in 20 ml LB in a flask at 37℃ overnight. At day 2, a 1:100 of the mixture was sampled into a new flask containing in 20 ml LB and grow for another 24 h. At each time-point, 100µl sample from the mix cultures was plated on LA and LA plus antibiotics for CFU enumeration. Though not indicated, the individual cultures of KR3317 and DN2 showed no significant difference in CFU count at both time-points. B) KR3317 and DN2 Galleria larva killing assay. Prior to infection, bacteria were grown to log-phase in LB, pelleted and washed three times in 10 mM MgSO4 6 and resuspended in 10 mM MgSO4 to obtain an inoculum of 10 CFU/ml. The four Galleria larvae groups (30 per group) were then infected with bacteria and the larval mortality examined over six days. After infecting 30 Galleria larvae in each group and observing mortality six days, it was noted a significant killing trend was established from day 4 to day six post-infection (****P<0.0001). Data were generated from two experimental repeats (triplicate repeats in each case) and analysed using 2-way ANOVA using sidak’s multiple comparison test.
Interestingly, the trend of death of the larvae (Figure 3.7B) infected with either the wild-type strain (KR3317) or ‘resistance-disarmed’ strain (DN2) was only similar from day one to day three but and the curves significantly diverged from day 4 to days 6. This suggests that with time, the impact the antibiotic
125
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae resistance genes deletion may be more observable given enough time. DN2 strain killed the least larvae, unlike KR3317 strain that nearly wiped out the entire infected larvae group after day 6. Just as the deletion of antibiotic resistance made the strain susceptible to a wide range of antibiotics (see Appendix 2-2 Antibiotic susceptibility of K. pneumoniae HS11286 and the antibiotic disarmed versions), so did the antibiotic resistance deletion through an unknown mechanism enhance DN2 strain susceptibility to the Galleria larva immune system even though DN2 strain showed an enhanced growth fitness relative to the KR3317 in the in vitro growth assay.
Many studies have linked antibiotic resistance with virulence (Kidd et al, 2017; Padilla et al, 2010b; Kidd et al, 2016) which was reaffirmed by the data obtained from the in vitro and Galleria larvae killing assays. The data suggest that K. pneumoniae HS11286 antibiotic resistance region posed a significant physiological burden to maintain though it enhanced the virulence of KR3317 towards the moth larvae. Though DN2 was safer to work with as a model due to the disarmed resistance, its ability to kill the larvae was stunted relative to the parent, KR3317. Hence, acquisition of antibiotic resistance contributes to the virulence of the bacterial strain enable it to evade the host immune system while inducing a massive physiologically costly in the absence of selection pressure.
3.4 3.6 K. pneumoniae HSS11286 T6SS clusters are syntenic with similarity in flanking regions to other K. pneumoniae strains
Sarris and colleagues (2011) identified several T6SS gene clusters in K. pneumoniae based on in silico data (Sarris et al., 2010). Here, in silico analysis was performed using several databases but most importantly, NCBI to obtained deposited sequence (reference genome data). Also, plasmid editor and snapgene tools were employed in this analysis to further the course of this research piece. A comparative genomic analysis of 14 fully sequenced genomes of K. pneumoniae was analysed (including K. pneumoniae HS11286) with a particular focus on the identified T6SS gene clusters. Core T6SS members’ DNA and protein sequence similarities and syntenies were also performed (data not shown here) to elucidate the intra- and the inter- strain relationship between the putative T6SS gene clusters.
126
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae Table 3.1 K. pneumoniae HS11286 T6SS1 gene cluster: context and content
S/No Protein Locus Tag Strand Location Length (bp) Description
1 KPHS_22930 + 2322412..2322621 210 hypothetical protein 2 KPHS_22940 + 2323071..2324558 1488 putative reverse transcriptase/maturase 3 KPHS_22950 - 2325143..2325391 249 DinI family protein 4 KPHS_22960 + 2325956..2326078 123 hypothetical protein 5 ImpB/ TssB KPHS_22970 + 2326237..2326728 492 hypothetical protein 6 ImpC/ TssC KPHS_22980 + 2326771..2328315 1545 EvpB/family type VI secretion protein 7 ImpJ/ TssK KPHS_22990 + 2328325..2329668 1344 hypothetical protein 8 DotU/ TssL KPHS_23000 + 2329665..2330354 690 hypothetical protein 9 OmpA KPHS_23010 + 2330351..2332057 1707 OmpA/MotB domain-containing protein 10 Hcp/ TssD KPHS_23020 + 2332062..2332553 492 hypothetical protein 11 ClpV/ TssH KPHS_23030 + 2332818..2335472 2655 putative protease 12 VgrG/ TssI KPHS_23040 + 2335474..2337843 2370 Rhs element Vgr protein 13 KPHS_23050 + 2337844..2338623 780 hypothetical protein 14 KPHS_23060 + 2338687..2339217 531 putative lipoprotein 15 KPHS_23070 + 2339286..2339816 531 putative lipoprotein 16 KPHS_23080 + 2339884..2340414 531 putative lipoprotein 17 KPHS_23090 + 2340482..2341012 531 putative lipoprotein 18 KPHS_23100 + 2341000..2342034 1035 hypothetical protein 19 KPHS_23110 + 2342120..2343418 1299 hypothetical protein 20 KPHS_23120 + 2343463..2343720 258 PaaR repeat-containing protein 21 KPHS_23130 + 2343717..2344856 1140 hypothetical protein 22 IcmF/TssM KPHS_23140 + 2344840..2348265 3426 ImcF domain-containing protein
23 ImpA/ TssA KPHS_23150 + 2348265..2348672 408 type VI secretion-associated protein 24 TssA-like KPHS_23160 + 2348724..2349857 1134 type VI secretion-associated protein 25 ImpG/ TssF KPHS_23170 + 2349937..2351691 1755 hypothetical protein 26 ImpH/ TssG KPHS_23180 + 2351655..2352740 1086 hypothetical protein 27 VasD/ TssJ KPHS_23190 + 2352718..2353260 543 hypothetical protein 28 KPHS_23200 - 2353231..2353359 129 hypothetical protein 29 KPHS_23210 + 2353389..2353883 495 hypothetical protein 30 KPHS_23220 + 2353950..2354663 714 Oxidoreductase 31 KPHS_23230 + 2354737..2355330 594 putative regulatory protein TetR 32 KPHS_23240 - 2355335..2356090 756 Putative dehydrogenase/reductase oxidoreductase Note: T6SS1 gene cluster is shaded grey with core T6SS proteins boldened and the flanking upstream (1-4) and downstream (28-32) flanking region/genes are unshaded.
127
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
The result obtained from these analyses suggest that K. pneumoniae HS11286 T6SS gene clusters possess similar upwards flanking (UF) sequences just like many other K. pneumoniae strains as well as similar downwards flanking (DF) regions, hence a possible evolutionary relatedness. T6SS1 and T6SS3 are flanked by conserved regions both upwards and downwards unlike T6SS2. The reserved regions extend over 10 kb for the UF and nearly 5 kb for the DF. While T6SS1 is complete and may be functionally independent of the other clusters, T6SS3 lack some core genes such as clpV and hcp. The result suggests that T6SS2 in K. pneumoniae HS11286 is a degenerated or incomplete cluster and is possibly carrying the T6SS3 missing set of genes such as clpV and hcp. The insights from these basic bioinformatics analyses indicate that K. pneumoniae HS11286 T6SS2 may only be evolutionarily displaced but still complements T6SS3 for functional reasons. Thus, the bacterium has only two sets of functional T6SS gene clusters which are T6SS1 and T6SS3 (the two clusters consider for T6SS mutant generation). Within each cluster, several other genes whose function is unknown or unrelated to T6SSs were found to be present in both T6SS1 and T6SS3. A complete deletion of T6SS1 and T6SS3 were using allelic exchange method was used, this created the non- polar mutants (∆T1, ∆T3 ∆T1∆T3) that were used for K. pneumoniae virulence assays.
128
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Figure 3.8 T6SS gene clusters identified in K. pneumoniae HS21186. Three T6SS gene clusters were identified and annotated in several K. pneumonia strains using comparative genomics and blast aligment tools such as NCBI-Blast, ClustaW and snapgene. Using blastP and blastN, core T6SS proteins and genes were examined and in silico chromosome-walking was performed to obtain the various upstream and downstream flanks of T6SS gene clusters. The K. pneumoniae T6SS gene clusters are conserved in content (have similar in genes within the cluster) as well as in context (homologous upstream and downstream flanks), suggesting a common evolutionary relatedness or acquisition.
129
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Table 3.2 K. pneumoniae HS11286 T6SS3 gene cluster: context and content S/No Protein Locus Tag Strand Location Length (Bp) Description 1 KPHS_32410 + 3231727..3232311 585 peptidyl-tRNA hydrolase 2 KPHS_32420 + 3232429..3233520 1092 translation-associated GTPase 3 KPHS_32430 - 3233604..3233933 330 hypothetical protein 4 KPHS_32440 - 3234017..3234931 915 putative periplasmic sugar-binding protein 5 ImpA KPHS_32450 - 3235063..3236478 1416 hypothetical protein 6 SciN/ TssE KPHS_32460 - 3236498..3236941 444 type VI secretion system lysozyme-like protein 7 VasD/ TssJ KPHS_32470 - 3236944..3237432 489 hypothetical protein 8 ImpH/ TssG KPHS_32480 - 3237461..3238477 1017 hypothetical protein 9 ImpG/ TssF KPHS_32490 - 3238507..3240270 1764 hypothetical protein 10 IcmF/ TssM KPHS_32500 - 3240404..3243814 3411 hypothetical protein 11 KPHS_32510 - 3243798..3244955 1158 hypothetical protein 12 KPHS_32520 - 3244959..3245225 267 hypothetical protein 13 KPHS_32530 - 3245523..3245765 243 hypothetical protein 14 KPHS_32540 - 3245834..3245947 114 hypothetical protein 15 KPHS_32550 - 3245967..3246101 135 hypothetical protein 16 KPHS_32560 - 3246085..3246312 228 hypothetical protein 17 KPHS_32570 - 3246446..3247018 573 sulfatase modifying factor 1 18 KPHS_32580 - 3246982..3247335 354 sulfatase modifying factor 1 19 KPHS_32600 - 3247511..3247768 258 hypothetical protein 20 KPHS_32590 - 3247846..3247968 123 hypothetical protein 21 KPHS_32610 - 3248047..3249015 969 transposase InsC for insertion sequence IS903 22 KPHS_32620 - 3249137..3249349 213 hypothetical protein 23 KPHS_32630 - 3249645..3250538 894 sulfatase modifying factor 1 24 KPHS_32640 - 3250560..3250676 117 hypothetical protein 25 KPHS_32650 - 3250722..3251615 894 sulfatase modifying factor 1 -like protein 26 KPHS_32660 - 3251637..3251948 312 hypothetical protein 27 KPHS_32670 - 3251966..3252994 1029 hypothetical protein 28 KPHS_32680 - 3253359..3253886 528 hypothetical protein 29 KPHS_32690 - 3253952..3254476 525 hypothetical protein 30 KPHS_32700 - 3254553..3255149 597 hypothetical protein 31 KPHS_32710 - 3255146..3255655 510 hypothetical protein 32 KPHS_32720 - 3255656..3257011 1356 hypothetical protein 33 VgrG/ TssI KPHS_32730 - 3257035..3259521 2487 hypothetical protein 34 KPHS_32740 - 3259672..3259797 126 hypothetical protein 35 OmpA KPHS_32750 - 3259981..3261678 1698 hypothetical protein 36 DotU/ TssL KPHS_32760 - 3261682..3262335 654 membrane protein 37 ImpJ/ TssK KPHS_32770 - 3262332..3263672 1341 hypothetical protein 38 KPHS_32780 - 3263910..3264071 162 hypothetical protein 39 KPHS_32790 + 3264242..3264571 330 hypothetical protein
130
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae 40 KPHS_32800 + 3264686..3265225 540 nucleoprotein/polynucleotide-associated enzyme 41 KPHS_32810 - 3265251..3266042 792 ribosomal large subunit pseudouridine synthase A T6SS3 gene cluster (shaded grey) with core T6SS proteins boldened and flanking upstream (1-4) and downstream (38-41) flanking region/genes
131
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae Genome sequence viewer was used to view the genomic location of the T6SS1, T6SS3 and purported TSS2 from an aerial view, and it was stunningly shocking to note the exact similarities in the pattern and location the various T6SS clusters with respect to the origin. The location and arrangement of T6SS gene clusters within K. pneumoniae genomes were observed to appear to have a unique arrangement pattern (T6SS1 coded grey, T6SS3 coded yellow and T6SS2 coded light brown). Based on the 14 analysed K. pneumoniae genomes, the arrangement of these T6SS gene clusters was grouped ton sub into three subgroups. Hence, the results obtained from the genomic sequence viewing suggest syntenic and similarities in the distribution of T6SS gene clusters and flanking regions as well as relatedness even at arrangement/ pattern of the T6SS gene cluster from an aerial viewpoint.
Group A: K. pneumoniae JM45, K. pneumoniae 342, K. pneumoniae 234-12, K. pneumoniae 1084 showing a similar pattern or arrangement of T6SS1, T6SS2 and T6SS3
132
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Group B: K. pneumoniae MGH 78578, K. pneumoniae NTUH-K2044, K. pneumoniae CG43 and K. pneumoniae HS11286 showing a similar pattern or arrangement of T6SS1, T6SS2 and T6SS3 unlike group A
133
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Group A: K. pneumoniae INH27, K. pneumoniae IH31, K. pneumoniae subsp. Rhinoscleromatis SB3432, K. pneumoniae ATTC BAA-2146, K. pneumoniae 52-145 and K. pneumoniae KCTC2242 showing a similar pattern or arrangement of T6SS1, T6SS2 and T6SS3.
Figure 3.9 Arrangement of T6SS1, T6SS2 and T6SS3 gene clusters using genome viewer. Using snapgene genome viewing tool in combination with universally designed K. pneumoniae T6SS primers, T6SS1, T6SS3 (both with functional gene clusters/genes) and T6SS2 (unfunctional gene cluster) in about 14 completely sequenced K. pneumoniae strains were identified and grouped. Conserved T6SS genes were largely present in K. pneumoniae, and the three T6SS gene clusters can be probably grouped in similar cluster context and content relative to the genome. From the above figures, A had slightly different T6SS cluster arrangement pattern compared to B and C despite the overall similarity in gene content and context.
134
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
3.8 Deleting mapped T6SS clusters in resistance-disarmed K. pneumoniae HS11286 for further T6SS studies
Majority of resistance determinants in K. pneumoniae HS11286, a representative of the dominant CRKP ST11 lineage, are plasmid-borne. The wider genetic contexts associated with resistance genes may have undergone complex evolutionary events, driven at least in part by ISs, transposons and integrons, which have resulted in a gradual accumulation of resistance genes and a potential structural, mobility-linked and expression-associated optimization of these hazardous DNA assemblages. The multi-drug resistant K. pneumoniae strain was successfully disarmed of most of the antibiotic-resistant gene resulting in a safer and antibiotic-susceptible strain, DN2, but still exhibiting some level of virulence level when test in Galleria Killing model relative parent strain. Thus, the deletion of these antibiotic regions did not have any impact on the virulence, suggesting that there are other virulent factors expressed by the strain other than antibiotic resistance, these results support the notion that antibiotic resistance contributes to the bacterial virulence and the overall survival and disease-causing potential of the bacterium.
Using defined nucleotide and protein sequence alignments of upward flanks (UF) and downward flanks (DF) of three K, pneumoniae (NTUH-K2044, KCTC AND MGH 78578) T6SS gene clusters from online database and as defined in Sarris et al., (2011), T6SS1, T6SS2 and T6SS3 were captured. All the UFs of T6SS clusters in these strains showed near-perfect 10 kb alignment, and similarly, 5 kb DF of the T6SS clusters was conserved in T6SS1 and T6SS3 but not T6SS2. The lack of conserved DF of T6SS2 was not surprising since this cluster only had two core genes (hcp and clpV) which were distantly apart. Even though three T6SS gene clusters were identified and mapped out, further analysis suggested that the genome of the two K. pneumoniae strains (HS11286 and NTUH-K2044) only had two complete/ functional set of T6SS gene clusters (T6SS1 and T6SS3). T6SS2 was disintegrated and only had two core gene (hcp and clpV) which surprisingly are the only core genes missing from the T6SS3 gene cluster, suggesting that T6SS2 genes (hcp and clpV) could be complementing T6SS3, unlike T6SS1 that had a complete set functional of T6SS core genes. From the T6SS in silico analysis using a wide range of bioinformatic tools, a step-by-step concept of capturing, identifying and successfully knocking out the entire T6SS clusters or individual genes in clinical strains was employed based on the T6SS annotation in the genome of fully sequenced K. pneumoniae strains. Also, the knowledge obtained from these bioinformatic analyses could be extended to other Gram-negative bacterial strain carrying T6SS gene clusters since most of the T6SS genes tend to share high similarity across various bacterial species. The conserved upstream (UF) and downstream (DF) flanks suggest that T6SS may not be native to the bacteria but may have been acquired via horizontal gene transfer and later evolved.
135
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Figure 3.10 Schematic procedure for K. pneumoniae HS11286 T6SS1 deletion. A 3.2 kb T6SS1 mutant allele formed by joining hph resistance cassette, T6SS1 upstream flank (UF) and downstream flank (DF) in a PCR process, was used to replace 25.4 kb region of T6SS1 in arabinose induced DN2 carrying lambda red recombination plasmid. The hph cassette was then excised by flp-FRT recombination to create a maker-less T6SS1 mutant, ∆T1. After the excision of the antibiotic marker, an in-frame 84 bp residual FRT scar was noticed.
136
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Figure 3.11 Schematic procedure for K. pneumoniae HS11286 T6SS3 deletion. A 3.2 kb T6SS3 mutant allele formed by joining hph resistance cassette, T6SS3 upstream flank (UF) and downstream flank (DF) in a PCR process, was used to replace 30.5 kb region of T6SS3 in arabinose induced DN2 carrying lambda red recombination plasmid or ∆T1 carrying lambda red recombination plasmid. The hph cassette was then excised by flp-FRT recombination to create a final maker-less of T6SS3 mutant, (∆T3 or ∆T1∆T3). After the excision of the antibiotic marker, an in-frame 84 bp residual FRT scar was noticed
137
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae The two main T6SS gene clusters were deletion from the DN2 background via lambda red recombination- based allelic exchange where a mutant allelic carrying the antibiotic cassette mostly (hph or aacC1) was used to replace the T6SS1 or T6SS3 gene cluster. A flippase expressing plasmid was then introduced into the T6SS mutant carrying the antibiotic marker to induce flp-FRT recombination to excise the antibiotic marker. All the T6SS mutants were PCR verified, and amplicons of the mutated T6SS regions were sequenced. Briefly, the UF and DF of the T6SS1 of T6SS3 were amplified, and SOE-PCR joined together with FRT-flanked hph antibiotic marker to produce a mutant allele ( see Figure 3.10, Figure 3.11 and Figure 3.12). The T6SS mutant alleles were electroporated into arabinose induced DN2 carrying lambda red recombination plasmid (for T6SS1 or T6SS3 single knockout) or ∆T1 carrying lambda red recombination plasmid (for T6SS1 and T6SS3 double knockout). After each knockout, the temperature-sensitive lambada red recombination plasmid (usually maintained at (25-30℃) was eliminated by growing the mutants at 37℃. Also, the flippase expressing plasmid (pDNTOOL-2) was eliminated by growing the mutant on LA plus 5- 10% sucrose; the sacB gene in the presence of sucrose express levansucrase, which is lethal to the bacteria. As a result, the bacteria kid out the plasmid to avoid expressing the lethal levansucrase.
Unlike the deletion of the T6SS gene clusters in K. pneumoniae HS11286, T6SS1 deletion in K. pneumoniae NTUH-K2044 was doing using a constructed suicide deletion vector (pDNTOOL-8). Briefly, the K. pneumoniae T6SS1 mutant allele cloned into pJTOOL-3 to form pDNTOOL-8. The deletion vector was then electroporated into E. coli cc118 λpir and later into E. coli s17. Using the filter mating technique, the E. coli S17-λpir carrying the plasmid was then conjugated with hyper-mucoid K. pneumoniae NTUH- K2044. Single crossover mutants were selected, and PCR verified before induced double crossover by growing the bacteria in LA plus 5% sucrose. The final double-crossover mutant (NTUH∆T1) was then PCR confirmed and sequenced. Similarly, deletion of K. pneumoniae NTUH-K2044 T6SS3 gene cluster was attempted, and only a single crossover was obtained, but the double crossover failed. The failure to obtain the double crossover mutants of K. pneumoniae NTUH-K2044 T6SS3 gene cluster maybe because of some essential genes within that gene cluster.
Using the above-described method, T6SS1 mutant (∆T1), T6SS3 mutant (∆T3) and T6SS1 and T6SS3 double mutant (∆T1∆T3) all in the resistance disarmed K. pneumoniae HS11286 background (Figure 3.12) and NTUH∆T1 in K. pneumoniae NTUH-K2044 background were created and verified by PCR and sequencing. Based on the sequence analysis of the mutated region, only one in-frame 84 bp FRT scar was left behind after T6SS deletion and subsequent antibiotic marker excision.
138
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
Figure 3.12 T6SS mutant generation in DN2 (resistance disarmed K. pneumoniae HS11286) background and T6SS mutant PCR confirmation. All T6SS mutants; T6SS1 mutant (A), T6SS3 mutant (B) and T6SS1/6SS3 (C) were generated using lambda red recombination-based allelic exchange. T6SS1/T6SS3 mutant (∆T1∆T3) was created in T6SS1 (∆T1) background. For all the T6SS mutants without an antibiotic marker, a residual 84 bp FRT scar remains after the excision of hph marker.
139
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 3: Generation of molecular tools, in silico analysis and genetic manipulation of K. pneumoniae
140
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
Chapter Four
K. pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance
and survival in amoeba
141
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba Chapter 4: K. pneumoniae T6SS enhance bacteria-bacteria interaction and biofilm-like formation 4.1 Overview
Presented in this chapter is the role the putative T6SSs gene clusters play in K. pneumoniae bacteria-bacteria interactions, biofilm formation, surface fimbriation and amoeba phagocytic resistance. The Intra-strain competitive fitness of K. pneumoniae was assessed by competing DN2 (parent strain) against its isogenic T6SS mutants (∆T1, ∆T3 and ∆T1∆T3) and recovering the bacteria growth from bacteria mixed cultures over the examined duration. The T6SS mutants lost the competition relative to DN2 over the examined duration, with ∆T1∆T3, ∆1T1 and ∆T3 showing increasing order of viable bacteria recovery, respectively, relative to DN2. In an inter-species competition, K. pneumoniae DN2 inhibited the growth of Escherichia coli (Non-T6SS prey) in a T6SS-dependent manner whilst the T6SS mutants hardly inhibited the prey. Also, Pseudomonas aeruginosa (T6SS competitor) competed against DN2 and the T6SS mutants, unlike DN2, the mutants easily lost the competition to P. aeruginosa when the bacteria growths were assessed from the mixed culture. This antagonistic property of T6SS affects how K. pneumoniae interacts with other bacteria in a complex ecosystem where other isogenic T6SS mutants (intra-strain competition) or other T6SS and non-T6SS harbouring bacteria such as P. aeruginosa and E. coli (inter-species competition) respectively, will face the defensive-attaching wrath of K. pneumoniae T6SSs. The data suggest that T6SS is offensive and defensive nano-arsenal and is a critical factor for K. pneumoniae survival and subsequent colonisation of the polymicrobial environment with limiting resources. K. pneumoniae in polymicrobial infection may deploy it T6SS to dominant or resist attack from other T6SS harbouring bacteria. The data also suggest K. pneumoniae T6SSs may play a role theT4SS-dependent horizontal transfer of antibiotic resistance and other virulence factors.
Furthermore, deletion of T6SS affected the ability of K. pneumoniae to form biofilm on an abiotic surface (polystyrene and glass coverslip) and surface fimbriae expression. When T6SS1 or T6SS3 was knocked out, ∆T1 and ∆T3 showed enhanced type 1 and type 3 fimbriae-dependent biofilm formation with ∆T3 is being the most biofilm former of all. Just like DN2, ∆T1∆T3 surprisingly showed little to no difference in the amount of biofilm formation relative to DN2. Thus, the TEM visualisation of the bacterial fimbriae agrees with their respective biofilm phenotype. T6SS-dependent phagocytic resistance was noted in K. pneumoniae against A. castellanii. Finally, the ability for K. pneumoniae to combined T6SS antagonistic- defensive behaviour, T4SS-dependent dissemination of resistance, biofilm formation and amoebal phagocytic resistance, will potentially enhance the pathogenicity and environmental persistence of K. pneumoniae.
142
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba Bacteria are ubiquitous in nature and evolve to adapt to their complex ecological niche where they often compete for the limiting resources, of which. K. pneumoniae is not an exception. With over 25% sequenced Gram-negative bacteria harbouring T6SS gene clusters, T6SSs are widely implicated in host-pathogen interaction and bacterial antagonism (Boyer et al., 2009b; Zheng and Leung, 2007b). T6SS, as a puncturing and toxin delivery organelle, that contributes to the bacteria social interaction in a complex microbial community. Though available data describes T6SS in Vibrio, Pseudomonas, Edwardsiella, Bordetella, Bulkodaria, Escherichia, Acinetobacter, Serratia and many other bacteria species (Decoin et al., 2014b; Murdoch et al., 2011a; Sanchez, 2011; Unterweger et al., 2014b; MacIntyre et al., 2010a; Zheng, Ho and Mekalanos, 2011b; Chen et al., 2015; Chieng, Mohamed and Nathan, 2015; Schwarz et al., 2010a; Schwarz et al., 2014), virtually nothing is known about K. pneumoniae, a clinically relevant bacterium in nosocomial infections. Saris and colleagues reported the presence of putative T6SS clusters in some K. pneumoniae strain based on bioinformatics data (Sarris et al., 2011b) though until now, nothing is known about the role of these putative T6SS gene clusters in this important opportunistic pathogen, K. pneumoniae.
T6SS has been implicated in a range of functions, noticeably important bacterial fitness (Murdoch et al., 2011a; Unterweger et al., 2014b; Schwarz et al., 2010a; Hood et al., 2010c). T6SS has been reported to be involved in a myriad of bacterial activities such as biofilm formation, horizontal gene transfers, fitness quorum sensing regulation, and in both the enhancement and attenuation of virulence (Hood et al., 2010a; Aschtgen et al., 2008; De Pace et al., 2010; Enos-Berlage et al., 2005; Borgeaud et al., 2015a; Das et al., 2002; Weber et al., 2009; Zheng et al., 2010; Filloux, 2009). There seems to be a wide range of mechanisms underpinning how the conserved T6SS is able to exert it defence-deleterious effect on other cells, one of such mechanisms using the C-terminal extension on VgrG. T6SS is co-expressed with other bacterial virulent factors). Using eukaryotic cell and whole animal model, T6SS has been shown to exhibit a virulent role while showing antibacterial or inhibitory role towards other non-immune bacteria (Schwarz et al., 2010a). Competitive fitness is a necessary natural strategy used by many bacteria to enable them to obtain the crucial resources for their growth in polymicrobial niches. Many pathogenic gram-negative bacteria employ the phage-tail-like T6SS nano-syringe as an arsenal against other non-immune competing bacteria.
Based on Insilco data, Sarris and colleagues previously reported the presence of putative T6SS gene clusters in Klebsiella Species in K. pneumoniae (Sarris et al., 2011b) even though there is not enough experimental data demonstrating the role of these putative gene clusters in these clinically significant species. Being opportunistic pathogen and ubiquitous, K. pneumoniae is faced with both biological and environmental factors in its quest to colonise a niche. K. pneumoniae is posed with intra-species and interspecies fitness challenge for it to between it and other species but with the same species and strain to survive in
143
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba polymicrobial environment or infection. Hence, this research unravelled how K. pneumoniae may deploy T6SSs in as a virulence and survival organelle.
After the successful creation of the T6SS gene cluster mutants, bacterial curves and RNA expression for important T6SS-related gene were performed. The absorbance (600 nm) and qRT-PCR were analysed to be sure that the T6SS gene clusters were functional and even after knocking them out and did not impact the bacterial growth in any significant way. Also, intra-strain competitions (T6SS mutant against vrs DN2) in both shaking and standing medium and inter-species competitions (K. pneumoniae vs E. coli or P. aeruginosa) was measured to determine the role of T6SS in the fitness of the K. pneumoniae. For all fitness assay, 1:1 ratio of both competing strains were mixed and allowed to compete for a set time, and the bacteria were then recovered. To measure the effect of T6SS deletion on the T4SS conjugal transfer, a plasmid
(pACYC184-oriTICE1) was introduced into the K. pneumoniae donors strain and conjugated with the E. coli HB101 recipient strain on agar surface for overnight. The transconjugants were distinguished on antibiotic selection media which were later PCR-confirmed. Also, T4SS vriB4 and mobB genes expression were determined by measuring the RNA expression using qRT-PCR. One in hundred overnight culture of the K. pneumoniae strains were inoculated in 96-well polystyrene, and 6-well tissue plates (with immersed coverslip) were used to determine and visualise biofilm formation at 37 oC. RNA expression of fim and mrk related genes (fimH and mrkD) and later confirmed with Transmission Electron microscopy (TEM) was used visualise the presence of different surface fimbriae on various the T6SS mutants. To demonstrate the role of T6SS in aiding K. pneumoniae to thrive in the environment and resist amoeba uptake, a lawn of the bacterial was spotted with amoeba, and the zone of clearance was observed. Acanthamoeba monolayer inoculated with bacteria (T6SS mutants and DN2) and on one hand, the percentage association without antibiotic treatment was determined. On the other hand, the internalised bacteria were protected with antibiotics and subsequently lysed to enumerate the amoeba internalised K. pneumoniae. All these data obtained suggest that K. pneumoniae uses T6SSS to survive in a complex polymicrobial environment by defending and attacking other bacteria, forming biofilm and enhancing its amoeba phagocytic resistance while spreading resistance and virulence factors.
4.2 Deletion of T6SS gene clusters (T6SS1 and/ or T6SS3) did not affect the growth of the mutants relative to the parent strain
To determine if the T6SS gene cluster knock introduced any polar effect on the bacterial growth of the mutants relative to their parent strain, the optical density (at 600 nm) as well as the CFU of the bacteria was measured at 2 h time-interval for 16 hours. The growth of all the mutant was in synchrony with the parent strain DN2 suggesting no polar effect of T6SS was invoked, and T6SS may not be any fitness cost on the
144
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba mutants’ relative the parent strains. No significant growth pattern was noticed (Figure 4.1). This data was again confirmed in subsequent competition assays (Figure 4.3).
B a c te r ia G ro w th C u rv e s
2 .5 D N 2
T1 2 .0 T3 O D 6 0 0 n m 1 .5 T1 T3
1 .0
0 .5
0 .0 2 6 1 0 1 4 1 8 T im e (h )
Figure 4.1Growth bacteria strains after T6SS gene cluster knockout. Independently measuring the optical absorbance and CFU/ml of the K. pneumoniae strains (DN2, ∆T1, ∆T3 and ∆T1∆T3) suggested, no growth defect/ cost due to the deletion of the T6SS gene clusters. The optical densities (at 600 nm) of both the T6SS mutants (∆T1, ∆T3, and ∆T1∆T3) and the parent strain were measured from the bacteria cultures inoculated in shaking flask at 37℃, 200 rpm. Briefly, 0.2 OD600nm log-phase each K. pneumoniae strain culture was diluted to 1/100 in 20 LB in a 50 ml flask. At an interval of 2 h, 2 ml of each culture was sampled for optical density (OD600nm) and CFU (CFU data not shown here) simultaneously.
4.3 T6SS hallmark genes hcp1, hcp2, vgrG1 and vgrG3 were expressed in the K. pneumoniae HS11286 strain
The T6SS gene clusters were hallmarked by hcp1, hcp2, vgrG1 and vgrG3 to their respective gene clusters. Hence to access the whether the T6SSs in K. pneumoniae were functional and could contribute to the pathogenicity of the bacterium, RNA was isolated from late log-phase DN2, and T6SS mutants and the expression of the hcp1, hcp2, vgrG1 and vgrG3 genes were examined. All the genes were expressed (at least 6-fold change) in the parent strain at considerable levels to suggest the functional expression of the T6SSs in K. pneumoniae. T6SS double mutant (∆T1∆T3) had the least fold expression of hcp2 since T6SS1 and T6SS3 was absent in this strain (Figure 4.2) A house-keeping gene, rpoB was used for the baseline normalisation to calculate the relative fold change expression in the genes.
145
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
Figure 4.2 T6SS core genes, hcp1, hcp2, vgrG1 and vgrG3 are expressed in K. pneumoniae. After the identification of T6SS gene clusters, RNA expression of several T6SS hallmark geneS (hcp1,vgrG1, hcp2 and vgrG3) was performed to test for a potential express of the various K. pneumoniae T6SS gene clusters in T6SS related T6SS1 gene clusters have hcp1 and vgrG1 while T6SS has vgrG3 of T6SS3and hcp2. A 1/100 subculture from overnight cultures were prepared in LB and allow to grow at 37℃ with shaking until they reached 0.2 OD 600nm mid-log-phase. Triplicate cultures were made for each K. pneumoniae. The bacteria (10 ml) from the cultures were harvested and processed for RNA using Qiagen RNA extraction kit and reverse transcribed for qRT-PCR. RNA expression was determined in the various T6SS mutant and DN2 and normalised with rpoB. All the tested T6SS genes (hcp1, hcp2, vgrG1 and vgrG3) differentially expressed in the parent strain, DN2. DN2 showed at least~6 times fold change in hcp and vgrG expressions relative ∆T1∆T3. For the cDNA amplification from each strain, three biological repeats with two technical repeats were included for statistical analysis The data was analysed using t-test, hcp1 (DN2 vs ∆T3 =P* 0.037); hcp2 (DN2 vs ∆T1 =P* 0.028, DN2 vs ∆T3 =P* 0.15, DN2 vs ∆T1∆T3 =P< 0.001, ∆T1 vs ∆T3 =P* 0.048, ∆T1 vs ∆T1∆T3 =P* 0.008, and ∆T3 vs ∆T1∆T3 =P* 0.004); vgrG1 (DN2 vs ∆T3 =P* 0.027), vgrG3 (DN2 vs ∆T1∆T3 =P* 0.046).
4.4 Deletion of the K. pneumoniae DN2 T6SS1 and/ or T6SS3 locus results in reduced 'intra- strain' fitness
The identified putative T6SS1 (T1) and/or T6SS3 (T3) gene clusters were knocked-out from the 'disarmed' version the MDR K. pneumoniae HS11286 (Bi et al., 2015) yielding the single cluster-deficient mutants ∆T1 and ∆T3, and the double cluster-minus mutant (∆T1∆T3). In this study, the disarmed parent strain is designated as DN2T or DN2 when it is with or without an introduced hygromycin resistance cassette, respectively. The relative competitive fitness of each of these strains was then assessed by co-culture of DN2T with each of the T6SS locus mutants individually in LB broth under shaking aerobic conditions at 37°C using a serial daily subculture model. An initial strain mixture of 1:1 and a total starting bacterial cell density of ~ 2.0 × 106 CFU/ml was used, together with a daily subculture inoculum of 1/100 into fresh medium. Initial and subsequent daily CFU measurements up to Day 7 were performed for DN2T and the corresponding mutants. As controls, DN2T and each of the three mutants were also cultured individually as pure cultures using this same model. The results of this experiment are shown in Figure 4.3A.
Under the growth conditions examined, all three mutants grew to approximately equivalent cell densities as the parent DN2T strain at all-time points studied. Notably, even in the 1:1 strain admixture co-culture assays, the DN2T grew to densities closely approximated to those of the pure DN2T culture. However, the 146
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba concentration as determined by CFU counts of each of the three mutants in the co-culture assays were significantly reduced compared to that of DN2T, with the discordance becoming progressively more pronounced from day 2 to Day 7. Furthermore, the data revealed a pattern of descending competitive fitness relative to DN2T, with the ∆T1∆T3 double-mutant being the least fit, ∆T1 being the next most impaired, and even ∆T3, the least handicapped, still exhibited significant reduced 'intra-strain' fitness in competition with DN2T. Indeed, the DN2T: mutant ratios measured at day 7 for co-culture mixtures with ∆T1∆T3, ∆T1 and ∆T3 were 1:0.04, 1:0.09 and 1:0.4, respectively.
Just as described above, a similar inoculum mixture of DNT and each mutant was spotted on a filter- membrane placed on a warm LB agar surface, and each bacterial strain was then subsequently recovered from the filter-membrane at day 2 and 4. Data from mixed co-cultures (DNT and ∆T1, DNT and ∆T3, and DNT and ∆T1∆T3) retrieved from the filter-membrane are presented here. As shown in Figure 4.3B, ∆T1∆T3 and ∆T1 (P< 0.05 each) began losing the competition unlike ∆T3 (P> 0.05) at day 2 when compared to DNT. Additionally, even though all the mutants were less fit at day four relative to DNT, ∆T1∆T3 and ∆T1 (P<0.01 each) again proved to be the least fit at this time-point.
Interestingly, not much difference in the recovery of the mutants was noted at day 2 of the shaking LB broth aerobic co-culture. However, recoveries made from the filter-membrane surface cultures at day 2 were very apparent with a lot of dramatic differences on day 4. More recovery ratios of DNT to ∆T1 or ∆T3 or ∆T1∆T3 were made from shaking aerobic LB broth (1:0.90, 1:10 and 1:0.71 respectively) than those made when mixtures were grown on a filter membrane (1:0.22, 1:0.34, and 1:0.10) at day 2.
147
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
Figure 4.3 K. pneumoniae intra-strain in vitro competition. DN2T head-head in vitro competition with T6SS mutants were performed to assess the fitness of each K. pneumoniae strain. (A) Shaking liquid LB competition with serial subculture for each overnight culture. Briefly, a 1:1 ratio mixture of DN2T and T6SS mutant (∆T1, ∆T3 or ∆T1∆T3) performed in fresh 2ml LB and a 1/100 subculture was made into sterile 15 ml LB in a 50ml flask. Also, 1/100 subculture of each strain (pure culture) was made into another sterile 15 ml LB in 50m flask. The flasks and their content were incubated at 37℃ with shaking (200 rpm) for 24 h. For seven days, a subculture of 1/100 is made from each flask into a fresh 15ml LB in a 50 ml flask37℃ with shaking (200 rpm) for 24 h. Enumeration of bacterial CFUs was done by harvesting 1ml from each overnight pure or mixed cultures for serial dilution PBS or LB. The appropriate dilutions were plated on LA and LA + hygromycin (37℃ overnight) for CFUs. (B) Filter-membrane based in vitro competition of K. pneumoniae strain. A 1:1 ratio mixture of the DN2T and its T6SS isogenic mutants (∆T1, ∆T3 or ∆T1∆T3) was washed twice and resuspended in PBS or 10 mM Mg SO4 and the OD600nm was adjusted 0.2. A sample (20 µl) from either the pure and mixed cultures were spotted on filter membrane placed on a pre-warmed LA and incubated for four days. After two or four days of competition on the filter membrane, the bacteria were resuspended in PBS for serial dilutions. The CFUs of each strain from the mixed cultures were counted by plating the appropriate dilutions on LA and LA + hygromycin (37℃ overnight). All the experiments were done in triplicate with two biological repeats. Data from three replicative experiments were analysed with two-way ANOVA and Tukey post-hoc comparison test showed a significant bacterial recovery for ∆T1 and ∆T1∆T3 at day two and day four (*< P (0.05) and **< P (0.01), respectively) and ∆T3 (*< P(0.05) only at day four but not day two ns> P(0.05).
148
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba 4.5 K. pneumoniae DN2 inter-species fitness is dependent on which T6SS loci are being deleted
Bacteria fitness is employed by various bacterial species to outwit their competitors in fight for the limiting resources in a mixed bacterial environment (Hibbing et al., 2010). The previous report suggests T6SS may influence the competitive fitness of various gram-negative bacteria by inhibiting their prey (Alcoforado Diniz and Coulthurst, 2015; Borgeaud et al., 2015b) in their quest to survive and colonize their biological niche.
Figure 4.4 Inter-species in vitro competition. The fitness of K. pneumonia strains (DN2T, ∆T1, ∆T3 and ∆T1∆T3) was assessed in a head-to-head- in vitro competition against other bacteria species (E. coli and P. aeruginosa) on a filter membrane placed on antibiotic- free LA for 24 h. The mixtures include; K. pneumoniae vs. K. pneumoniae, K. pneumoniae vs. E. coli, and K. pneumoniae vs. P. aeruginosa. A and B indicate overnight in vitro bacteria recovery when of K. pneumoniae was competed for heads-head against a T6SS- E. coli HB101 in shaking liquid LB and on filter-membrane respectively. C; in vitro competition of K. pneumoniae and T6SS+ P. aeruginosa PA14 on Filter-membrane overnight. MC stands for strains from the same mixed culture. Briefly, a 1:1 ratio mixture of K. pneumoniae and E. cole or P. aeruginosa was from fresh mid-log-phage cultures was washed twice and resuspended in PBS or 10 mM Mg SO4 and the OD600nm was adjusted 0.2. A sample (20 µl) from either the pure (K. pneumoniae only, E. col only or P. aeruginosa only) and mixed cultures (K. pneumoniae + E. coli or K. pneumonia + P. aeruginosa) were spotted on filter membrane placed on a pre-warmed LA and incubated 37℃ overnight. Also, another sample (1/100) of the pure or mixed cultures were subcultured into 15 ml LB at 37℃ with shaking (200 rpm) for 24 h. After 24 h of competition on the filter membrane or LB, the bacteria were resuspended in PBS for serial dilutions or sampled from the LB competition cultures for CFUs enumeration. The CFUs of each bacterial strain from the mixed cultures were counted by plating the appropriate dilutions on LA and LA + ampicillin (37℃ overnight). Note that data from K. pneumoniae + P. aeruginosa liquid LB culture competition is not presented. All the above data are from three experimental replicates, and one-way ANOVA and Tukey post-hoc test were used to analyse the data statistically, ns (P> 0.05), *< P (0.05), **> P(0.01) and ***< P (0.001). K. pneumoniae recovery from different mixtures is shown as solid colour bars while the shaded pattern colour bars represent E. coli or P. aeruginosa PA14 from the mix cultures are shaded/pattern bars..
149
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba In this study, the competitive fitness of E. coli and K. pneumoniae, and P. aeruginosa and K. pneumoniae from mixed cultures was measured. To measure the ability of K. pneumoniae to inhibit E. coli, a 1:1 of E. coli and K. pneumoniae were co-cultured in either shaking liquid LB broth or on filter membrane at 37⁰C and the individual bacteria were subsequently recovered after 24 hours of competition (). While no significant observable difference in bacteria recoveries was noted when E. coli HB101 and K. pneumoniae DN2 or T6SS mutants were co-cultured in shaking LB broth, a dramatic reduction in the recovered E. coli was evident when the bacteria mixture was co-cultured on a filter-membrane placed on a pre-ward LB agar plate. From the Filter membrane co-culture, the E. coli HB101 growths in the admixtures were as significantly inhibited by K. pneumoniae DN2T and ∆T3 but not ∆T1 and ∆T1∆T3. As predicted, K. pneumoniae DN2T caused a 10.56 or 1.31 or 15.39-fold more reduction in the E. coli HB101 recovered relative to that of ∆T1 or ∆T3 or ∆T1∆T3, respectively. Additionally, a 8.034 and 11.71 fold increase in the E. coli HB101 recoveries were made when it was co-cultured with ∆T1 and ∆T1∆T3 respectively, relative to the E. coli HB101 recovery from the admixture with ∆T3. Though no statistically significant difference in E. coli HB101 recoveries from the admixture with ∆T1 or ∆T1∆T3 was obtained, a 1.46-fold increase in E. coli HB101 was observed from ∆T1∆T3 admixture.
The killing behaviour that was observed during the plasmid mobilization prompted for a more visual way of assessing T6SS killing impact of K. pneumoniae of E. coli. An E. coli DH5α carrying PDNTOOL-39 encoding apramycin resistance and blue colour phenotype on X-gal/IPTG media was mixed at a 1:1 ratio with the various K. pneumoniae strains and allowing to compete overnight. The mixture was then spotted on apramycin media with X-gal/IPTG, killing all the K. pneumoniae and allowing the blue forming E. coli colonies to grow. As can be seen in Figure 4.5, DN2 and ∆T3 yielded fewer colonies of E. coli DH5α colonies compared to the ones recovered from ∆T1 and ∆T1∆T3 mixture with E. coli DH5α. This data presented in Figure 4.4A, Figure 4.4B, and Figure 4.5 suggest that K. pneumoniae HSS11286 T6SS was actively involved in the killing of E. coli numbers as means to out-competing other bacteria in the mix- culture environment. Similarly, the only successful K. pneumoniae NTUH-K2044 T6SS mutant (NTUH∆T1) or its wildtype was mixed with GFP tagged E. col DH5α and grown for 20 hr, the recovered E. coli DH5α by both colony counting and fluorescence imaging (Figure 4.6) revealed that the T6SS1 mutant could barely inhibit the growth of the E. coli DH5α unlike its parent strain (KR1730).
P. aeruginosa has previously been reported to secrete an abundance of Hcp even under laboratory conditions (Jiang et al., 2014; Hood et al., 2010a; Bleves et al., 2010; Pukatzki et al., 2006b; Bernard et al., 2011; Mougous et al., 2006b). Hence, understanding how K. pneumoniae T6SS may influence its survival in a polymicrobial community with other T6SS positive bacteria such as P. aeruginosa may improve the overall understanding of the interaction among T6SS positive bacteria of different species.
150
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba Having noted that, the K. pneumoniae T6SS direct contact and killing effect on E. coli HB101 was further enhanced when the bacteria admixtures were co-cultured on a filter-membrane surface, another K. pneumoniae competition assay as similarly described above was performed. A 1:1 ratio mixture of K. pneumoniae DN2 or T6SS mutants and P. aeruginosa were co-cultured on filter-membrane for 24 hours and the bacteria CFU subsequently recovered. As presented in Figure 4.4C, the P. aeruginosa being T6SS positive bacteria species had a significant huge inhibitory growth effect on the K. pneumoniae T6SS mutants but not DN2T. Unlike the absence of noticeable P. aeruginosa inhibitory effect on K. pneumoniae DNT, the T6SS mutants’ growth (∆T1, ∆T3 and ∆T1∆T3) were significantly reduced by 4.40, 2.90 and 8.65 folds respectively, relative the DN2T recovered. Among the T6SS mutants, ∆T3 was the least inhibited by P. aeruginosa while ∆T1∆T3 was the most handicapped in its recovery. Interestingly, the P. aeruginosa recoveries from the admixture with K. pneumoniae did not vary significantly.
Figure 4.5 E. coli DH5α colony reduction due to K. pneumoniae T6SS activity. K. pneumoniae preyed upon E. coli in a T6SS dependent manner as revealed by spotting growing a mixture of K. pneumoniae (predator) and E. coli DH5α (prey) together. The E. coli DH5α used in this assay carry pDNTOOL-39 which express blue colonies on LA (X-gal + IPTG) supplemented with apramycin. All the K. pneumoniae strain are sensitive to apramycin. Briefly, 20µl of a 1:1 mixture of log-phase K. pneumoniae and E. coli DH5α was spotted on a nitrocellous membrane on an antibiotic-free agar at 37℃ for 24 h. The bacteria spot mixtures on the membranes were recovered and resuspended in PBS, and 10µl from the appropriate dilution of each mixture was spotted in duplicates on LA+apramycin and X-gal/IPTG and incubated at 37℃ for 16 h. Only E. coli colonies carrying the resistance plasmid were recovered from the mixtures since all the K. pneumoniae strains are susceptible to apramycin.
151
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
Figure 4.6 K. pneumoniae NTUH-K2044 T6SS1-dependent inhibition of E. coli DH5α. Bacteria recovery and fluorescent imaging were performed to examine the survival of the E. coli DH5α after co- culture with either K. pneumoniae NTUH-K2044 wildtype (KR1730) or its associated T6SS1 mutant (NTUH∆T1) for 20 hours. E. coli DH5α carried pIM438 that encoded GFP, Kanamycin and hygromycin resistance for the colony selection, unlike the K. pneumoniae strains which were sensitive to both kanamycin and hygromycin. A 1:1 mixture of log-phase K. pneumoniae and E. coli DH5α were grown on nitrocellous membrane placed on an antibiotic-free agar at 37℃ overnight. The spot mixtures on the membranes were recovered, and the appropriate dilutions were plated on LA and LA+kanamycin+hygromycin for enumeration. Also, 20µl of the undiluted mixtures were on a thin layer of media (LA+kanamycin+hygromycin) in a plate or coated on a sterile slide. The plates and/ or slides were incubated 37℃ for 20 h. The percentage recovery was estimated as several E. coli DH5α colonies recovered from the mixed culture divided by the number of E. coli DH5α colonies from E. coli DH5α pure culture multiplied by 100%. The data was analysed using student t-test, and P-value for the difference in percentage recovery of E. coli was 0.002.
4.6 Absence of T6SS1 and T6SS3 enhanced plasmid DNA mobilization via conjugation
In the natural environment, bacteria spread resistance and virulence through horizontal gene transfer to improve their subsequent survival in host or environment. Previous studies suggest an interplay between T6SS and horizontal gene transfer (Blokesch, 2015a; Borgeaud et al., 2015a; Das et al., 2002; Ho, Basler and Mekalanos, 2013).
In this section, pACYC184-oriTICE plasmid mobilisation frequency from either K. pneumoniae DN2 or TSS mutants (∆T1, ∆T3 and ∆T1∆T3) to E. coli HB101 (recipient) was assessed. The bacterial mixtures were mated overnight on a membrane filter. The transconjugants E. coli carrying three plasmids were enumerated in an antibiotic medium that killed all the K. pneumoniae donor cells. The transconjugants were then PCR- confirmed for the presence of the plasmid. The deletion of either T6SS1 or T6SS3 resulted in about 6 or 2– fold increase in the frequency of plasmid mobilization respectively, from K. pneumoniae to E. coli HB101 via conjugation. Surprisingly, ∆T1∆T3 relative to DN2 showed no difference in the plasmid mobilization frequency. This was quite unexpected as the deletion of both T6SS1, and T6SS3 (∆T1∆T3) resulted in more E. coli HB101 recoveries. Among the T6SS mutants, ∆T1 was the most efficient in the conjugal 152
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba mobilization of the plasmid, and next was the ∆T3 while ∆T1∆T3 was the least efficient. To have observed an increased transconjugant frequency in ∆T1 and ∆T3 but not ∆T61∆T3 was quite surprising (Figure 4.7A). One would have thought that the deletion of both clusters will then result in a higher E. coli HB101 recovery (this was later answered with TEM and virB4 and mobB expression data).
But interestingly, ∆T1∆T3 expectedly yielded the most E. coli recovery (Figure 4.4 and Figure 4.5), but with the lowest transconjugants (Figure 4.7A), predicting that the different levels of expression of the T4SS conjugative machinery could affect the frequencies of the plasmid mobilization. The expression of key genes (virB4 and mobB) known to be involved in the expression of the T4SS conjugative module was analysed by qRT-PCR. K. pneumoniae house-keeping gene (rpoB) was used for all normalization purposes. The expression data revealed that ∆T1∆T3 had its mobB and virbB4 at least two folds down-regulated relative to its DN2 while that of ∆T3 had at least two-fold increase (Figure 4.7B). There was no significant difference in the virB4 and mob expression for ∆T1 and that of the parent strain DN2. The expression data support the conjugation frequency data all together reinforcing the hypothesis that, T6SS-dependent killing of E. coli and the co-regulation with T4SS conjugative system synergistically accounts for K. pneumoniae- E. coli predatory interaction and horizontal gene transfer of resistance between the two bacteria (target-kill- and-prey-for-for colonization or cooperate in spreading resistance).
4.7 T6SS deletion enhanced biofilm formation in K. pneumoniae.
T6SS has previously been linked to biofilm formation of Vibrio, P. aeruginosa, E. coli (Aschtgen et al., 2008; De Pace et al., 2010; Enos-Berlage et al., 2005). Biofilm formation in K. pneumoniae is a critical mechanism in nosocomial infection by evading the host immune system and antibiotic treatment (Fierer, 2012; Boddicker et al., 2006; Huang et al., 2014; Olson et al., 2012). Previous studies suggest that some virulent factors are possibly tightly co-regulated or induced by specific cues their co-expression (Hood et al., 2010c; Bernard et al., 2011; Russell et al., 2011a). Thus, understanding how the presence or absence of T6SSs could impact biofilm formation is vital in studying the virulence mechanism of K. pneumoniae. T6SS, with its diverse role, has now been implicated in fimbriae and biofilm formation (Aschtgen et al., 2008; De Pace et al., 2010; Enos-Berlage et al., 2005). Biofilm formation at 37ᴼC was quantified by measuring the absorbance (595 nm) after staining with crystal violet and biofilm formed on coverslips were imaged after overnight incubation where coverslips were submerged in the bacterial cultures at 37ᴼC. Note that two KR161 and KR162 are positive and negative biofilm former previously validated (van Aartsen, 2012). Biofilm was also formed at 30 ᴼC, and it showed similar results (data not included). Thus, understanding how the presence or absence of T6SSs could impact biofilm formation is critical in studying
153
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba the virulence mechanism of K. pneumoniae. To test the impact of T6SS deletion on the K. pneumoniae biofilm phenotype, the strains were grown at 1/100 subculture from overnight cultures for biofilm formation in 9-well plate and 6-well tissue culture plates with an immersed coverslip. And the data collected at the at various time-points.
All the T6SS mutants have either formed more biofilm or almost equivalent to that of the parent strain (DN2) at all the time-points. Generally, all the strains (DN2, ∆T1, ∆T3, and ∆T1∆T3) formed biofilm at 24, 48, and 72 h with relatively no significant difference between time points. From the biofilm data (Figure 4.8A), deletion of either T6SS1 or T6SS3 in K. pneumoniae further enhanced their ability to form biofilm but not when both T6SS1 and T6SS3 clusters are deleted as it results in no significant biofilm formation relative to the parent strains, DN2. Interestingly, while ∆T3 had the most biofilm formation relative to DN2 and the other mutants, ∆T1∆T3 was the least biofilm former though there was no significant difference (P>0.05) for day 48 and 72 h except 24h. The loss of both T6SS clusters (T6SS1 and T6SS3). The visualized images of all the biofilm formed (Figure 4.8B) support the quantitative biofilm data in Figure 4.8A. The imaged biofilm of ∆T3 shows bacterial aggregates or clusters, unlike ∆T1 and DN2. Biofilm formation at 30ᴼC for all the strains was significantly enhanced (data are not shown) than those obtained from 37ᴼC suggesting the how temperature difference could influence T6SS-dependent biofilm formation. The quantitative Biofilm data are from three experimental replicates while the imaged biofilm data are representative of data form only overnight biofilm formation.
154
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
Figure 4.7 Plasmid mobilization and expression T4SS –related genes. Plasmid mobilization and expression T4SS–related gene. (A) Plasmid (PACYC184-oriTICE1) mobilization. The frequency of plasmid mobilization K. pneumoniae (donor) to E. coli HB101(recipient) was measured when the strains were mated on the filter membrane. The aim was to move the plasmid (PACYC184-oriTICE1) from K. pneumoniae (DN2, ∆T1, ∆T3 and ∆T1∆T3) to E. coli HB101 and measure how T6SS impact the frequency of mobilization. Briefly, K. pneumoniae strains (DN2, ∆T1, ∆T3 and ∆T1∆T3) carrying PACYC184-oriTICE1 and E. coli HB101 were grown in LB+apramycin and LB +chloramphenicol respectively at 37℃ overnight with shaking. A 1/100 subculture from mid-log phage was made from each strain and mixed at 1:1 (K. pneumoniae: E. coli. Sample (1 ml) of the mixtures or pure cultures was washed three times and resuspended in 10 µl of 10 mM MgSO4 and spotted on a filter membrane placed on a prewarmed LA. After overnight incubation at 37℃, the mixture or pure cultures from the membranes were resuspended in 1 ml10 mM MgSO4 for serial dilution. The appropriate dilutions were plated on LA, LA+apramycin+chloramphenicol, LA+ampicilin and LA+chloramphenicol and then incubated at 37℃ overnight for CFU enumeration. E. coli HB101 is naturally resistant to chloramphenicol but susceptible apramycin. K. pneumoniae strains are resistant to ampicillin and carry apramycin reistant plasmid (PACYC184- oriTICE1) but susceptible to chloramphenicol. Thus, only transconjugant E. coli colonies carrying (PACYC184- oriTICE1) grew on LA+apramycin+chloramphenicol. Primers specific to PACYC184-oriTICE1 were used to PCR- confirm ten randomly selected putative transconjugants colonies, all ten of ten were positive for both PCRs. Using unpaired t-test on data from three repeats, a significant difference in the frequency of conjugation was observed for ∆T1 and ∆T3 but not ∆T1∆T3 relative to DN2T (B) RNA expression of T4SS conjugative module. RNA was extracted from strains and cDNA quantified for the expression of keys genes from T4SS conjugative module of ICE1. Data were normalised against rpoB and two ways another was used to test for the significant difference from three biological repeats. A 1/100 subculture from overnight cultures were prepared in LB and allow to grow at 37℃ with shaking until they reached 0.2 OD 600nm mid-log-phase. Triplicate cultures were made for each K. pneumoniae. To extract RNA, 10 ml of pure K. pneumoniae cultures were harvested and processed for RNA using Qiagen RNA extraction kit and reverse transcribed for qRT-PCR. RNA expression for T4SS conjugative module of ICE1 was determined in the various T6SS mutants and DN2 and normalised with rpoB. T4SS conjugative module related genes, virB4 and mobB differentially expressed in the parent strain, DN2. For the cDNA amplification from each strain, three biological repeats with two technical repeats were included for statistical analysis The data was analysed using t-test, virB4 (DN2 vs ∆T1 =P* 0.31; DN2 vs ∆T3 =P* 0.035, DN2 vs ∆T1∆T3 =P< 0.01) and mobB (DN2 vs ∆T1 =P* 0.31; DN2 vs ∆T3 =P* 0.12, DN2 vs ∆T1∆T3 =P<0.01).
155
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
Figure 4.8 Biofilm formation and visualisation. (A) Biofilm formation 96-well polystyrene plate and (B) biofilm formation and visualization on submerged cover- slips. Briefly, K. pneumoniae strains (DN2, ∆T1, ∆T3 and ∆T1∆T3) were grown in LB overnight and subcultured (1/100) in 96-well polystyrene plate at 37℃ for 24, 48 and 72 h. For visualization of formed biofilms on coverslips, a 1/100 subculture was made into 6- well tissue culture plates containing submerged coverslips in sterile LB and grown for 24 h at 37℃. After the formation of biofilm, the cultures were gently discared, washed three times with distilled water and stained with crystal violet. Residual crystal violet was washed away, and the plate air-dried and solubilized in 95% ethanol for the measurement of OD595nm. The coverslips were mounted on slides for light microscopy. Data is a representation of three experimental repeats, and the statistical difference was tested using two-way ANOVA with Tukey post-hoc test. P-values; *<0.05, **<0.01, ***<0.001 and ****<0.0001 (B). The scale indicated on all the images is 10 µm.
156
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba 4.8 Deletion of T6SS1 and T6SS3 clusters enhanced type 1 and type 3 fimbriae expression respectively
Transmembrane bacterial surface appendages such as pili and fimbriae are major organelles used in bacteria-bacteria interaction or bacteria-abiotic surface interactions (Alcántar-Curiel et al., 2013; Huang et al., 2014), indicating their crucial role in colonization, dissemination of antibiotic resistance and pathogen- host interaction. Previous studies have suggested that certain pathogenic bacteria may explore an interplay between T6SS and fimbriae/ biofilm/ conjugation (De Pace et al., 2010; Blokesch, 2015b; Ho, Basler and Mekalanos, 2013) as a virulence mechanism towards the host. Having observed unique T6SS-dependent pattern in conjugation and biofilm, thus an investigation of the potential surface structures such as fimbriae was performed. The deletion of T6SS clusters was predicted to significantly altered the type and pattern of pili and fimbriae on the bacterial surface. The examination of expressed fimbriae using agglutination assay, qRT-PCR and Transmission Electron Microscopic (TEM) was conducted.
Agglutination assay was performed to test for the presence of type 1 and type 3 fimbriae which were expressed by each K. pneumoniae strain and how these fimbriae may play a role in the biofilm formation. Briefly, overnight K. pneumoniae cultures were either mixed with guinea pig red blood cells or 5% tannic acid-treated Oxblood (TATOXB) with or without mannose. From Table 4.1, while all the K. pneumoniae strains agglutinated GP-RBCs with 15 minutes with mannose sensitivity, suggesting the presence of type 1 fimbria, only ∆T3 showed mannose-resistant agglutination of tannic acid-treated ox blood unlike DN2, ∆T1 and ∆T1∆T3. The results from GP-RBCs and TATOXB agglutination assay suggested that DN2, ∆T1 and ∆T1∆T3 probably expressed only type 1 fimbria while ∆T3 expressed both type 1 and type 3 fimbriae. The deletion of either T6SS cluster the K. pneumoniae strain affected the fimbriation of the bacterium and its ability to form biofilm formation as presented in Table 4.1 and Figure 4.8. The possible expression of type two fimbriae by ∆T3 could be linked to the enhanced biofilm formation as observed Figure 4.8.
Table 4.1 Agglutination Assay GP-RBC TATOXB DN2 + / S - ∆T1 + / S - ∆T3 + / S + / R ∆T1∆T3 + / S - +; agglutinate within 15 minutes, -; no agglutinate within 15 minutes, S; mannose sensitive and R; mannose resistant Agglutination assay was by mixing each overnight K. pneumoniae cultures (109 CFU/ml) independently with 5% GP- RBCs or 5% TATOXB with or with 5% mannose on the slide for visible agglutination within 15 minutes
157
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba To confirm the presence of type 1 and type 3 fimbriae on the various K. pneumoniae, RNA was extracted from log-phase culture, and revere transcribed into cDNA which was subsequently used for RT-PCR analysis. The level of expression of FimH an MrkD in the cDNA was used as a measure of the expression of type 1 and type 3 fimbriae, respectively. From the cDNA analysis, FimH was noted to have been significantly expressed by ∆T1 by almost 2-fold increase relative to DNA but was attenuated in ∆T1∆T3 by an almost 1-fold decrease. The expression of fimH in ∆T3 showed no significant difference relative to DN2 but not to ∆T1∆T3. For the expression of type 3 fimbria associated mrkD, ∆T3 significantly expressed MrkD relative to the other K. pneumoniae strains. Just like the fimH expression, mrkD was least expressed by ∆T1∆T3 with at least a fold decrease relative to DN2. The RT-qPCR data suggest that K. pneumoniae express type 1 and type 3 fimbriae which are widely reported to be associated with biofilm formation. ∆T1 and ∆T3 exhibited higher levels of fimH (type 1 fimbria related) and MrkD (type 3 fimbria related) unlike DN2 and ∆T1∆T3.
Figure 4.9 Expression of mrkD and fimH of K. pneumoniae surface fimbriae. Quantitative qRT-PCR of RNA of mrkD and fimH extracted from K. pneumoniae and T6SS mutants was assessed. RNA was extracted from the strains and cDNA quantified for the expression of type 1 and type 3 fimbriae. A 1/100 subculture from overnight cultures were prepared in LB and allow to grow at 37℃ with shaking until they reached 0.2 OD 600nm mid-log-phase. Triplicate cultures were made for each K. pneumoniae. To extract RNA, 10 ml of pure K. pneumoniae cultures were harvested and processed for RNA using Qiagen RNA extraction kit and reverse transcribed for qRT-PCR. RNA expression for type 1 and type3 was determined in the various T6SS mutants and DN2 and normalised with rpoB. Type 1 and type 3 related genes, mrkD and FimH were differentially expressed in the parent strain the K, pneumoniae strains. For the cDNA amplification from each strain, three biological repeats with two technical repeats were included for statistical analysis The data were analysed using one-way ANOVA with Tukey post-hoc test t-test, mrkDvirB4 (DN2 vs ∆T1 =P> 0.05; DN2 vs ∆T3 =P< 0.001, DN2 vs ∆T1∆T3 =P< 0.05) and fimH (DN2 vs ∆T1 =P<0.05; DN2 vs ∆T3 =P>0.05 0.12, DN2 vs ∆T1∆T3 =P<0.05).
158
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba The RNA expression data (Figure 4.9) for ∆T3 indicated about two or more folds increase in the expression of mrKD relative to DN2 or T6SS mutant, respectively. Two or more-fold increase in the expression of fimH was observed in ∆T1 when compared to the other strain (DN2. ∆T3, and ∆T1∆T3). While ∆T1∆T3 showed the least fimH and mrkD expression supporting its visualised fimbriae-like structures, no significant difference in the expression of fimH was observed between DN2, and ∆T3 neither was there any difference between DN2 and ∆T6S1 for the expression of mrkD. All RT-qPCR data were from three biological repeats and normalised the house-keeping gene, rpoB.
Having confirmed the presence expression of type 1 and type 3 fimbriae using agglutination and RT-qPCR, Transmission Electron Microscopic (TEM) imaging was used to visualise the expressed surface appendages. The data obtained from TEM imaging supports the biofilm, agglutination and RNA expression data; highly expressed fimbriae with different types were noted on ∆T3 but not the other mutants or DN2. The mutation of T6SS clusters in the K. pneumoniae HS11286 consequentially induced the expression of different surface fimbriae-like structures (Figure 4.10) on ∆T3 and ∆T1.
The TEM images revealed three types of fimbriae; long-thick fimbriae (1.4 ± 0.4 µm long and 9.50 ± 3 nm wide), long-thin fimbriae (1.2 ± 0.2 µm long and 7.2 ± 0.3 nm wide) and short-thin fimbriae (400 ± 100 nm long and 5.2 ± 0.5 nm wide). All fimbriae were digitally measured based on un-stretched fimbriae length and width (Figure 4.10). T6SS3 mutant (∆T3) was highly fimbriated with an abundance of surface appendages, most of which are long thick and bundled fimbriae covering the whole surface of the bacterial cell (1.2 ± 0.4 µm long 7.2 ± 0.3 nm width) and few thin long and short fimbriae. While ∆T3 revealed numerous long-thick and short-thin fimbriae, ∆T1 expressed both showing long-thin and short-thin fimbriae, and ∆T1∆T3 only had fewer long-thin fimbriae just like DN2.
The T6SS1 mutant (∆T1) equally expressed a good amount of long thin fimbriae that appear to span across the surface of the bacterium. Unlike ∆T1 and ∆T3, the parent strain (DN2) and ∆T1∆T3 barely expressed any surface fimbriae, and this was not surprising as biofilm, agglutination and RNA fimbriae expression data corroborated with the TEM data. Unlike ∆T3, few long thin fimbriae-like structures were visualized on the surface of ∆T1 and DN2 while much fewer long thin fimbriae-like structures were also seen on the surface of ∆T1∆T3.
159
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
Figure 4.10 Transmission electron microscopic (TEM) visualization of K. pneumoniae surface fimbriae. TEM was used to assess the T6SS-dependent expression of surface fimbriae (such type 1 and type 3) on the various K. pneumoniae strains. The above TEM images represent the surface fimbriae visualised on K. pneumoniae (DN2, ∆T6S1, ∆T6S3 and ∆T6S13) with scale bar indicated is 200 nm on each. ∆T3 showed pronounced images have been digitally zoomed in 2 times the original size at a key point to reveal the difference in the surface fimbriae identified. Briefly, K. pneumoniae strains were grown in LB at 37µ overnight with shaking. A subculture of 1/100 was made into fresh LB and allowed to grow until OD600nm reach 0.2. The bacterial strains were harvested and resuspended in PBS at 105 CFU for TEM. Samples (5 µl) were applied to a hydrophilic Formvar-carbon coated copper grid and allowed to adsorb for 5 minutes. After wicking the excess liquid and washing with distilled deionized water, samples were stained 15 seconds with 5 μl of 1 % uranyl acetate (pH 4.5). All the Transmission Electron Microscopy were performed at the Centre for Core Biotechnology Services (University of Leicester) using JEOL JEM-1400 microscope at 80 kV.
160
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
4.9 K. pneumoniae T6SSs mediate resistance to Acanthamoeba castellanii, complement- mediated killing and PMN internalisation
K. pneumoniae, in its natural habitat or host, faces phagocytic pressure and hence, the organism may have evolved new mechanisms to evading phagosome or possible strike back when under attack. To survive in both the host and environment, K. pneumoniae is taking no chances but T6SS deploy its T6SS as a full virulence factor. To demonstrate that K. pneumoniae requires T6SSs to avoid phagocytic protozoans such as environmental amoeba and persist in the environment, A. castellanii-K. pneumoniae interaction put to the test relative T6SS mutagenesis in K. pneumoniae. Briefly, a monolayer of A. castellanii was infected with the various K. pneumoniae strains at an MOI of 100. A blank media without Aa castellanii was inoculated with the different strains and counted at the end of the time point to serve as the denominator in the calculation of the percentage. Percentage survival is equal to CFU/ml from the sample (with amoeba) divided by the CFU/ml of bacterial strains from the blank medium multiply by 100%. For association assay, the A. castellanii monolayer was washed three times with PBS after infection and lysed to determine the bacterial CFU. In the case of bacterial internalisation assay, 100µg/ml kanamycin was used to kill the extracellular bacteria for 20 minutes after post-infection, and the bacterial CFU were then determined after three repeated washes with PBS. To perform A. castellanii zone of clearance, thin lawns of the various bacterial strains were on a solid agar surface. A. castellanii plaque formation was observed after ~ 2 ₓ 105 was spotted on the bacterial lawn and incubated at 37ᴼC overnight for the zone of clearance. Similarly, just like the plaque formation, the percentage viability of the A. castellanii spotted on the agar surface was to determine using trypan blue staining after 2 h post-infection and the viability of the amoeba estimated.
For the first time, I shown K. pneumoniae resist A. castellanii phagocytosis through a T6SS-dependent puncturing mechanism, rendering the inviable with short space of time. From the data collected, the parent strain (DN2) was able to comfortably resist the amoeba both in the association and the invasion assays compared to the other strains, while both ∆T1 and ∆T3 showed show 20-30 fold change in the association assay (Figure 4.11A). ∆T1∆T3 was not able to attach to the amoeba well even though it did not have active T6SS to have resisted. This was not surprising since it was demonstrated earlier where ∆T1∆T3 showed
161
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba the poor formation of biofilm and surface fimbriae (Figure 4.8, Figure 4.9 and Figure 4.10) though it was the most internalised of all the mutants relative to DN2. As shown in Figure 4.11A about 5-times, more of ∆T1 was internalised compared to ∆T3. In the amoeba plaque formation (Figure 4.11B), ∆T1∆T3 lawn showed the widest and most visible zone of clearance by the A. castellanii with about 91% of the initial A. castellanii still viable surviving after the 2-hr endpoint. Once again, DN2 just like the phenotypes shown in both the association and internalisation assays was able to resist the clearance by the amoeba and lowed the viability of the amoeba to a damming 78% (Figure 4.11). ∆T3 was the next most internalised with after DN2 while ∆T1 shown arguably wide zone of clearance after ∆T1∆T3.
Figure 4.11 T6SS enhances K. pneumoniae against Acanthamoeba castellanii. (A) At an MOI of 100, the bacterial strains association or internalisation with A. castellanii after 2 h post-infection. For association assay, the A. castellanii monolayer was infected with K pneumoniae (MOI 1:100) FOR 1 h at 30℃ and subsequently washed three times with PBS. K. pneumoniae CFUs were enumerated by lyzing the A.castellanii trophozoites and plating the diluted lysates on LA and LA+ ampicillin. In the case of bacterial internalisation assay, 100µg/ml kanamycin was used to kill the extracellular bacteria for 20 minutes post-infection, and the bacterial CFU were then determined as decribed above. Plates were incubated at 37 overnight for K. pneumoniae CFUs. Two-way ANOVA with Tukey post-hoc for multiple comparisons, the data indicate the means from three experimental replicates and experiments (B) A. castellanii plaque formation were observed after ~ 2 ₓ 105 was spotted on the bacterial lawn and incubated at 37ᴼC overnight. The percentage viability of the A. castellanii was determined after 2 h post-infection using trypan blue staining. Using trypan blue and hemocytometer, A.castellanii trophozoites viability was determined by collecting the spotted A.castellanii trophozoites on the bacterial lawns. Data are shown as mean + SD from three experimental replicates.
162
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba Host infection, K. pneumoniae do not only battle with cell uptake but are faced with the full wrath of the human immune system, including the antimicrobial properties of the serum and cells. Unfortunately, the same cannot be said for immunocompromised individuals. The serum has a compliment. Complement- mediated killing is in serums is a significant barrier against K. pneumoniae infection. Complement- mediated killing largely dependents on bacteria surface receptor- binding could affect bacterial clearance in the blood should these surface receptors go imbalance. Here I tested how the deletion T6SS1 and/or T6SS3 could affect the bacterial ability to resist serum-mediated killing and C3b deposition on to the bacterial surface. Briefly, log-phase bacteria (DN2, ∆T1, ∆T3 and ∆T1∆T3) were resuspended in 75% of pool normal human serum (PNHS) and incubated 37 oC for the various time-points. Heat-inactivated PNHS was equally inoculated with the bacteria and used as control and use as the denominator for the calculation of the bacteria percentage survival. For the C3 deposition, the bacteria were opsonised for 20 minutes in PNHS and the C3b was determine by Elisa method. Also, opsonised bacteria used to inoculate a monolayer of polymorphonuclear (PMN) leukocytes A. castellanii monolayer and the internalised bacteria was determined just as in the previous case.
This is the first demonstration of T6SS involvement in the deposition of C3b onto the bacterial surface and resistance to the complement-mediated killing of K. pneumoniae (Figure 4.12). From the date, ∆T1∆T3 was the lest recovered, and less C3b deposition since over 75% of ∆T1 was killed at the endpoint of the experiment. Over 75% of DN2 showed survived the serum killing but had less C3b deposition within the first 20 minutes. ∆T3 had the highest C3b deposition probably accounting for it diminishing survival in the serum after ∆T1 and ∆T1∆T3 C3b deposition. Since the DN2 had a very poor association and internalisation, I decided to enhance the bacteria (DN2, ∆T1, ∆T3 and ∆T1∆T3) uptake by A. castellanii opso-phagocytosis after opsonising the bacteria with PNHS for 20 minutes. The data showed that ∆T1 and ∆T3 were the most internalised after the first 1h. This was not surprising as these bacteria expressed high surface attachments and C3b deposition even though only ∆T1 and ∆T1∆T3 were the most digested after 3 h. DN2 was the most internalised at the end of the 3h, maybe because they can survive within the amoeba.
All these data suggest that T6SS is an essential virulence factor in K. pneumoniae, especially in MDR strains. During K. pneumoniae infection, T6SS may be deployed to enhanced biofilm formation in intravenous devices, fimbriae expression for attachment and resistance to phagocytosis, thereby evading the host immune system. In the environment, K. pneumoniae may be good at using T6SS-dependent killing and defence to outcompete and colonise polymicrobial niche. My data also suggest that T6SS may be involved in resistance to complement-mediated killing and evasion of environmental amoeba phagocytosis. For the first with overwhelming evidence from my data, I suggest that the putative T6SS is a crucial factor in the pathogenicity of K. pneumoniae
163
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
Figure 4.12 K. pneumoniae T6SS-enhanced resistance to Serum mediated Killing, C3b deposition and opsonisation. A). Serum resistance; data are percentage mean ± SD of surviving bacteria recovered from pooled normal human serum after 1, 2, and 3-hour post-incubation. Each K. pneumoniae strain (108 CFU) was inoculated parallel in both heat-inactivated and non-heat inactivated PNHS (75%) and allowed for the various time and the bacteria enumerated. The serum resistance bacterial CFUs were recovered on LA plate at 37℃ overnight. Percentage of bacterial survival was calculated as CFU from non-heat inactivated over that of heat-inactivated multiply by 100%. Data points were obtained for triplicates experiments. B).C3b deposition; the relative concentration of C3b deposited on K. pneumoniae strain was performed using C3b Elisa kit 20 minutes and 2 h post-inoculation of the serum. C). Polymorphonuclear (PMN) internalization of K. pneumoniae; the CFU/ml of PMN internalised K. pneumoniae was determined after the bacteria were opsonized s in normal human serum for 15 minutes. The opsonised K. pneumoniae strains were used to infect a monolayer of the PMN and allowed for 1 and 3 hrs where the external bacteria were eliminated with antibiotic protection. The PMN were lysed and plated for the bacterial CFUs on LA at 37℃ overnight.
164
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 4: Klebsiella pneumoniae T6SS enhances bacterial fitness, fimbria-mediated biofilm formation and resistance and survival in amoeba
165
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host
Chapter Five
K.pneumoniae T6SS mediate virulence and activates a pro-inflammatory innate immune response in the host.
166
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host Chapter 5: K. pneumoniae T6SSs Mediate Virulence and Activation Host Cell Innate Immune Response
5.1 T6SSs in K. pneumoniae promote Galleria killing and in vivo survival of bacteria
Galleria mellonella larvae are widely adopted as an in vivo model in the study of bacterial virulence, and this model has been used for determining the virulence of K. pneumoniae strains(Wand et al., 2013a; Wand et al., 2013b). This in vivo model has been well established in the laboratory for several years and has shown many prospects in studying the virulence of many of the laboratory strains. T6SS has been widely reported to pose not only antagonism towards bacteria but also eukaryotic host cell. To determine the role virulence of K. pneumoniae T6SS exhibit towards larvae, an inoculum of 20µl containing ~108 CFU of each strain (DN2, ∆T1, ∆T3 or ∆T1∆T3) resuspended in 10 mM MgSO4 was injected into twenty larvae for each group and the motility of the larvae was observed and enumerated of time (day 1 to day 6). Two control group (one group untouched and the other group injected with 20µl bMgSO4) were used to assess the quality of each experiment. The percentage motility of the larvae is represented in a graph as shown below. All the larvae were weighed (~250g) to ensure consistency of weight within the various groups and the data points are means of three independent experiments. For the in vivo bacterial survival assay (single
6 strain survival or competition mixtures), the larvae were injected with a sub-lethal dose (2×10 CFU) of either a single bacterial strain (DN, ∆T1, ∆T3 or ∆T1∆T3) or a 1:1 ratio mixtures of DN2 and the mutants (DN2+∆T1, DN2+∆T3 or DN2+∆T1∆T3) to ensure that all the larvae survived by the end of the experiment. The CFU/ml of each bacterial strain either from the single strain inoculation samples or competition mixtures at each time point were enumerated from the 20µl hemocoel extracted from each larva within the group treatments. The virulence of T6SS in hyper mucoid K. pneumoniae NTUH-K2044 (also known as KR1730) was tested relative to its T6SS mutant (NTUH∆T1) as shown in the in Figure 5.3.
From the Galleria larvae mortality data, it was noticed that DN2 had had high mortality effect on the population of the larvae by reducing the infected larvae to about 50% within day 2, steadily to 15% by day 6, and finally to at least 85% mortality rate by the end of the experiment. Similarly, the larvae group that was infected with ∆T3 showed a lower survival (at least 30% by day 6) relative to that of ∆T1 (at least 60% by 6) and ∆T1∆T3 (at least 75% by 6) but not DN2 (at least 15% by day 6). At the end of the experiment, the survival rate of the group treated with ∆T1∆T3 was almost equal to the mortality rate of the group treated with DN. Likewise, ∆T1-treated larva group had a survival rate similar to the mortality rate of the ∆T3-treated larva group. The group treatment with ∆T1∆T3 survived better among all the groups while the group treated with DN2 showed the least survival. The graph shown in Figure 5.1 is from two experimental
167
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host replicates, with each replicate being an average of two technical repeats. For all the Galleria killing assay, all the control groups (untouched and MgSO4 injected larvae) had perfect survival. Hence, the death observed in the various treatment groups was because of the bacterial treatments. The larvae were killed in a T6SS-dependent manner by the different bacterial strains. Thus, T6SS could be involved in the virulence towards the larvae. T6SSs in K. pneumoniae promote Galleria killing.
Figure 5.1 K. pneumoniae T6SS dependent killing of Galleria larvae. K. pneumoniae T6SS dependent killing of Galleria larvae. The Larval mortality was monitored until the experiment terminated on day 6. Larvae were purchased from LIVEFOOD UK, and received the next day but allowed for 48 h at room temperature for acclimatization. The larvae were grouped into at least 30 per each K. pneumoniae strain. The groups were inoculated with 108 CFU of K. pneumoniae resuspended in 10µl of 10 mM MgSO4. Two control groups were included; untouched and MgSO4. Each treatment group is 100% at the beginning of the experiment and no death in control groups was recorded. The percentage survival of the larvae for each group was used to assess the effect of T6SS on K. pneumoniae killing of the larvae. Dead larvae quickly melanise and turn black, dark brown for sick larvae and creamy-coloured for healthy larvae.
The bacterial in vivo survival assay in Galleria larvae was performed to assess the role T6SS plays in the promotion of intracellular survival of K. pneumoniae in T6SS mediated manner during infection. From the obtained data (Figure 5.2) from the bacterial in vivo survival assay in Galleria, DN2 once again demonstrated its effectiveness in the promotion of intracellular competition and subsequently survival in a T6SS-dependent manner to colonizing the Galleria hemocoel. Among the T6SS mutants, ∆T3 yielded growth data indicating a better survival in the hemocoel relative to ∆T1 and ∆T1∆T3. Recovery of DN2 or ∆T3 enumerated from both the single strain and mixture inoculations increased throughout the time while ∆T1 or ∆T1∆T3 relatively decreased, with ∆T1∆T3 being the least enumerated. Also, DN2 could T6SS-
168
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host dependently outcompete all T6SS mutants’ counterparts to colonise the hemocoel. In both assessments (single strain and mixture inoculations), ∆T1∆T3 was the least recovered from the hemocoel followed by ∆T1 and ∆T3. The data (Figure 5.2) suggest that T6SS may be involved in the intracellular survival of K. pneumoniae in the larvae. The experimental data shows the means of three independent repeats
Figure 5.2 In vivo competition: DN2 vs T6SS mutants in Galleria larvae. About 15 larvae in a group were treated with ~2.0×106 CFU of either single strain or a 1:1 ratio mixture of DN2 and any of the T6SS mutants. At each time point, each strain was independently enumerated from 60µl hemocoel of 3 sacrificed larvae (20µl each) from the single-strain treatment group as well as from the mixture treatment groups. By day 4, DN2 in either single strain or mixture inoculation had populated to 2-fold the enumerate ∆T1∆T3 from both treatment groups. ∆T1 depopulated to 1.5×106, and ∆T3 increased with a similar pattern just like DN2 but dropped back to just about the amount inoculated. Each enumerated bacterial strain population in both treatments initially dipped at day one and peaked at day three except ∆T1 (with subtle reduction) and ∆T1∆T3 that progressively reduced until day 4. Finally, there appears to show a similar trend for similar strains irrespective of the treatment type. This shows the independent in vivo behavioural growth, competition and colonization pattern in the Galleria larvae.
In Figure 5.3 below, the virulence of hyper mucoid K. pneumoniae NTUH-K2044 (KR1730) and its associated T6SS1 mutant (NTUH∆T1) in Galleria larvae killing was assessed using inoculum of 106 CFU. The data from KR1730 versus NTUH∆T1 revealed a significant trend in killing the larvae where more 70% of NTUH∆T1-treated larvae survived, unlike KR1730 (only <35%). Similar to that of DN2 versus the T6SS mutants (Figure 5.1), the T6SS mutant treatments (NTUH∆T1) yielded level mortality, unlike their
169
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host hypervirulent parent strain (KR1730). The larvae group that KR1730-treated showed higher mortality (65%) relatively to NTUH∆T1 (25%). By day 3, KR1730 treated group had decreased to about than 35% and remain constant over day 4, day five and day six while the group treated with NTUH∆T1 showed less than 35% mortality rate. T6SS was again demonstrated to be involved promoting KR1730 killing of Galleria, unlike NTUH∆T1.
2 : G a l l e r i a K i l l i n g a s s a y ; K R 1 7 3 0 v s i t T 6 S S 1 m u t a n t E x p 2
1 0 0
9 0
8 0
) %
( 7 0
K R 1 7 3 0
l a
v N T U H T 1
i 6 0 v
r U n t o u c h e d u
5 0
s
t M g S O
4 n
e 4 0
c
r e
3 0 P
2 0
1 0
0
0 1 2 3 4 5 6
t i m e ( d a y s )
Figure 5.3 Hypermucoid K. pneumoniae T6SS enhanced killing of Galleria larvae. The above data are two independent experimental replicates, where T6SS1 in KR1730 is same as (K. pneumoniae NTUH-K2044) was knocked out to give rise to NTUH∆T1. By day 3, more than 65% of the KR1730 treated larvae had melanised (died) while nearly 90% of NTUH∆T1 treated Galleria larvae survived. At the end of the experiment, only 35% of the KR1730 treated Galleria larvae survived as opposed to 75% survival for NTUH∆T1 treated Galleria larvae. Using the Logrank test for curve trend comparison, there is a significant trend (p=0.0156) between KR1730 and NTUH∆T1
Galleria model is a well-established in vivo model for investigating the virulence of many including K. pneumoniae, A. baumannii, E. coli and P. aeruginosa. Galleria larvae death is characterized by an irreversible melaninization activated by phenoloxidase as result of host immune response to bacterial pathogens. The larva innate immune system deposit melanin to encapsulate the bacterial pathogen followed by hemolymph coagulation and opsonization, thereby preventing or retarding the bacteria growth. Phenoloxidase initially produced as an inactive zymogen prophenoloxidase in hemocytes (involved in cellular) (Lu et al., 2014; Söderhäll and Cerenius, 1998). Melanin formation begins when soluble prophenoloxidase contact bacteria surface targets, initiating the conversion of prophenoloxidase to phenoloxidase (Altincicek et al., 2007; Halwani, Niven and Dunphy, 2000). PO polymerises monophenols
170
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host and phenols to quinines resulting in melanin around bacteria as well as the formation of reactive oxygen species (Söderhäll and Cerenius, 1998).
Figure 5.4 Phenoloxidase activity (PO) in infected Galleria larvae. 6 Diluted larvae hemocoel (15µl) extracted from larvae infected with 10 µl LD50 (2 × 10 CFU) of A; (DN2 only, ∆T1 only, ∆T3 only, ∆T1∆T3 only), B; (KR1730 and NTUH∆T1only) at days 2 and 4 post-infection was used to determine PO activities in the hemocoel. Data are expressed as means from three experimental repeats and statistically analysed using 2-way ANOVA and Turkey test posthoc test.
From the PO activity (Figure 5.4A), DN2 induced two times more melanisation relative to ∆T1 and ∆T1∆T3 and about half more relative to ∆T3. While no significant difference (p=0.3562) was noted between ∆T1 and ∆T1∆T3-treated PO activity at day-2, the difference (p=0.006) between the two groups became apparent at day-4. Also, ∆T3 induced more PO activity relative ∆T1 and ∆T1∆T3 at day-2 and day-4 but not DN2. Similarly, hyper mucoid KR1730 induced at least twice PO activity in the larvae at both time- point relative to NTUH∆T1-treated group (Figure 5.4B). The associate-viable hemocytes (Figure 5.5A) from LD50 infection of K. pneumoniae revealed that DN2-treated larvae yielded almost twice less viable hemocytes relative to ∆T1 and ∆T1∆T3 but not ∆T3 at day two and day four post-infection.
171
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host
Figure 5.5 Parentage viability cell count in larvae. 6 Haemocytes viability in larvae infected with 10 µl LD50 (2 × 10 CFU) of A) DN2, ∆T1, ∆T3 and ∆T1∆T3 and B) KR1730 and NTUH∆T1 at 2- and 4-days post-infection. Data are expressed as means from three experimental repeats and statistically analysed using 2-way ANOVA and Turkey test posthoc test
Generally, there was a decrease in the viable hemocytes at days-4 relative to day-2 though ∆T1∆T3 yielded the most viable cells followed by ∆T1 and ∆T3 and DN2, respectively. No significant difference was noted between ∆T1 and ∆T1∆T3 at days-2 (p=0.15) but not at day-4 (p=0.0072) post-infection. NTUH∆T1 (p<0.0001) significantly yielded more viable hemocytes relative to its parent strain, KR1730 at both day-2 and day-4 (Figure 5.5B). The ability of K. pneumoniae to induce melanin formation (Figure 5.4) and reduction in hemocytes viability (Figure 5.5) in a virulent T6SS-dependent-manner was consistent with the larva killing assay (Figure 5.1 and Figure 5.3), suggesting that the killing of the larvae is due to the virulence of the K. pneumoniae strains. The deletion of T6SS1 and/ or T6SS3 clusters in K. pneumoniae significantly attenuate the virulence in G. mellonella larvae.
172
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host 5.2 K. pneumoniae T6SSs enhance phagocytic uptake and survival in murine macrophage
T6SS has been reported to be involved in the mediation of virulence and evasion of host innate immune system (Tan et al., 2010; Suarez et al., 2010b; Ma and Mekalanos, 2010b; Jayamani and Mylonakis, 2014). Phagocytosis is a necessary process used by many host cells such as macrophages to attach and digest pathogens, including bacteria. Briefly, a monolayer of J774.A1 was infected at MOI 10:1 for 1h post- infection, and gentamicin was used to kill the extracellular bacteria, and the bacteria were enumerated on LA at 37 ℃. For visualization of phagocytosed GFP-tagged K. pneumoniae, a J774.A1 monolayer on coverslip was infected for 1h and treated with gentamicin and subsequently fixed with 4% paraformaldehyde and DAPI-stained. Finally, to investigate how K. pneumoniae T6SSs promote phagocytotic uptake and survival, J774.A1 cell line was infected (107 CFU) with DN2, ∆T1, ∆T3 and ∆T1∆T3. After 1hr post-infection, antibiotic was added to the media and maintained for 2, 4, and 6 and subsequently washed three times with PBS before Triton-X lysis for bacteria CFU enumeration.
Presented in Figure 5.6A, the J774.A1 uptake data suggest that the recovered K. pneumoniae was phagocytosed in a manner that is consistent with the presence or absence of T6SSs. J774.A1 phagocytosed more DN2 (p<0.0001) relative to the T6SS mutants (∆T1, ∆T3 and ∆T1∆T1) for the 1 h post-infection. Additionally, ∆T3-treated J774.A1 significantly yielded more bacteria recovery relative to ∆T1 (p=0.0051) and ∆T1∆T3 (p<0.0001) while ∆T1∆T3-treated J774.A1 yielded the least number of bacteria. The data demonstrate that murine macrophages can actively phagocytose K. pneumoniae in a T6SS-dependent manner where the deletion of T6SSs in K. pneumoniae attenuates bacteria recovery from the J774.A1 phagocytosis assay.
To ascertain the K. pneumoniae phagocytosis by J774.A1, the GFP-tagged bacteria were visualized using confocal microscopy. The confocal microscopy data (Figure 5.6B) was consistent with the bacteria recovery data, suggesting that more loads of DN2 unlike ∆T1 or ∆T1∆T3 that were taken- up by the macrophage could easily be seen around the nuclei of the macrophages. More DN2 were visualized to be present in the macrophage more than those of ∆T1, ∆T3 and ∆T1∆T3. Next, a relatively good amount of ∆T3 was noted in the macrophages relative to ∆T1 and ∆T1∆T3. The confocal microscopy data revealed increased intracellular presence of DN2 in J774.A1 when compared to the T6SS mutant (∆T1 and ∆T1∆T3) but not ∆T3, which showed few invaded bacteria. This strongly suggests that K. pneumoniae in T6SS- dependent fashion can be phagocytosed and survive in murine macrophages. K. pneumoniae may be actively using T6SS to engage the macrophage during the uptake and survival within the macrophage. Also, fewer bacteria recovery was observed for K. pneumoniae T6SS mutants, particularly ∆T1 and ∆T1∆T3, which were noted to have reduced it intracellular virulence due to the deletion of T6SSs, thus resulting in lesser intracellular survival even have J774.A1 uptake.
173
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host Having noticed the phagocytotic uptake of the K. pneumoniae at 1 h, to better assess the ability of K. pneumoniae to survive in macrophages, the bacteria recovered from the infected cell line was done at the various time point (2, 4, & 6 h), Figure 5.7. Generally, while all the T6SS mutants yield a reducing bacteria recovery over the 6 h period, their parent strain (DN2) showed an increasing trend in the number of bacteria that were recovered. Among the T6SS mutants, T6SS double knockout (∆T1∆T3) produced the least amount of bacteria while ∆T3 was recovered more than ∆T1. The deletion of T6SSs impaired the ability of the F6SS mutants to survive in the macrophage intracellularly.
DN2 with both active T6SS1 and T6SS3 was largely by phagocytosed by the J774.A1 at all the time points, unlike the T6SS mutants. The results suggest that the presence or absence of T6SS influence the phagocytic uptake of K. pneumoniae and subsequent survival in J774.A1. Though K. pneumoniae is largely considered not to be an intracellular bacterium, more DN2 invaded and survived better in the macrophages and possibly replicated over the examined time-points compared to the T6SS mutants (∆T1, ∆T3 and ∆T1∆T3). Unlike the recovered DN2, T6SS mutants initially invaded the macrophages and over time and subsequently decreased in population/survival in the J774.A1. The recovered population for the highly fimbriated ∆T3 from the macrophages was significantly higher than that of ∆T1 and ∆T1∆T3 but not DN2 suggesting that, though the bacterium was taken up by the macrophage, it subsequently struggled to survive in the macrophage, unlike DN2. After 6 hours post-infection of the macrophage monolayer, while DN2 invaded and survived well in the macrophages, ∆T1, ∆T3 and ∆T1∆T3 that had either one or both T6SS clusters deleted could not progressively invade and survive in the macrophages. These data, as shown in Figure 5.6 and Figure 5.7 suggest that T6SS in mediate virulence towards macrophages by enhancing phagocytic uptake and intracellular survival within the macrophages. The involvement of K. pneumoniae T6SS in macrophage invasion and survival unlike resistance of macrophages reported in other studies is yet another virulence decoy employed by a K. pneumoniae evade host immune system while unleashing its virulence.
This data has there informed me to hypothesizes that the putative T6SS gene clusters (T6SS1 and T6SS3) may play a role in the expression of T6SS -dependent surface antigen/ receptors for binding and surviving in host cells, such macrophages. This would not be surprising since the deletion of T6SSs enhanced surface fimbriae expression and biofilm. This data is the first to demonstrate the virulent of K. pneumoniae T6SSs towards murine macrophages (J774.A1), which in this case, enhanced invasion and intracellular survival within the macrophages.
174
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host
Figure 5.6 J7774.A1 phagocytosis uptake and visualization of K. pneumoniae. K. pneumoniae phagocytic uptake and survival in murine macrophage (J774.A1) is T6SS enhanced. A) Invasion and intracellular survival in J774.A1 at 1 hr post-infection; the infected bacteria strains were recovered on LA at 37 ℃ after gentamicin treatment and several washes. The data is a mean of triplicate experiment with duplicate repeats and statistically analysed using one-way ANOVA with Turkey’s multiple comparisons test. B) J744.A1 infected by GFP-tagged K. pneumoniae strains for 1 h and the extracellular bacteria were killed by gentamicin. The nuclei of the infected monolayer on coverslips were DAPI-stained and visualised with confocal microscopy.
175
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host
Figure 5.7 K. pneumoniae phagocytic survival in murine macrophage (J774.A1) is T6SS enhanced. Invasion and intracellular survival in J774.A1 at 2, 4, 6 post-infection. The various K. pneumoniae strains were used to infect a macrophage monolayer (80-90% confluence) for 1h and treated with gentamicin and several washes before lysing the bacteria with 0.5% Triton-X at the various time points. The data were analysed from three experimental repeats with two technical repeats, using one-way ANOVA ***P<0.0001.
5.3 K. pneumoniae T6SSs promote attachment, invasion and actin polymerisation of host lungs epithelial cells
K. pneumoniae is commonly involved in lung infection, hence attachment and invasion of the lungs epithelial cell is a crucial step in the disease-pathogenesis (Cortes et al., 2002a; Haiko and Westerlund- Wikström, 2013). In the previous chapter, the deletion of T6SS showed a consequential effect on the surface fimbrial expression and attachment to the abiotic surface as presented in the biofilm formation. To illustrate how the deletion of T6SS affect the attachment, invasion, and survival of K. pneumoniae in host cells, two human lungs epithelial cell lines (NCI- H292 and A549) were used. For the attachment assay, an MOI of 100 bacteria (108 CFU) were used to infect H292 cell line for approximately 30 minutes and subsequently washed three times with PBS. The infected H292 cell line was then lysed and plated onto LB agar plates for CFU estimation. To visualize the attachment of the bacteria, a monolayer of H292 coverslip was also
176
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host infected with GFP-tagged bacteria and paraformaldehyde fixed for microscopy. Also, the invasion/ survival assay was performed by infecting A549 monolayer with the bacteria at MOI of 100:1 for 1h and gentamicin was added to media. The cells are then lysed at various time-point to determine the bacteria CFU.
Figure 5.8 K. pneumoniae T6SS-enhanced attachment and survival in lungs epithelial cells. The various bacteria strain (DN2, ∆T1, ∆T3 and ∆T1∆T3) were used to infect; A) A549 and H292 in an attachment assay, the monolayer was infected at MOI 50:1 for 30 minutes before enumerating bacteria CFU. B) A549 in an invasion and survival assay, the monolayer was infected for 1 h and subsequently gentamicin treated before enumerating bacteria CFU. Data obtained from three experimental repeats with duplicate technical repeats were analysed using 2-way ANOVA multiple comparisons with sidak test (attachment) and turkey test posthoc test (invasion and survival) Asterisk used to indicate statistical significance (*p≤0.05, **p≤0.01, ***P≤0.001 and ****p≤0.0001) and ns as not significant (p>0.05)
177
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host The attachment of the bacteria strain to A549 and H292 monolayer (Figure 5.8A) revealed that ∆T3 yielded the highest bacterial attachment/ association with the cells relative to DN2 ∆T1 and ∆T1∆T3, possibly because of the increased surface appendages/ fimbrial expression, unlike the other strain. It was surprising that DN2 that previously showed more phagocytic uptake in macrophage had reduced attachment to the epithelial cells relative to ∆T3. Though T6SS1-related mutants (∆T1 and ∆T1∆T3) were the least attached bacteria to the cells, ∆T1 made a significant attachment more the that of ∆T1∆T3. The slight fimbria expression in ∆T1 could also be aiding more attachment of the strain to the epithelial cells, unlike ∆T1∆T3.
To further investigate the trend of the bacterial attachment to epithelial cells, a monolayer of H292 was infected with GFP-tagged bacteria and visualized using confocal microscopy. The microscopy data (Figure 5.9) further corroborated the quantitative attachment data, revealing that more ∆T3 attached to the cells followed by DN2, then ∆T1 and ∆T1∆T3. Also, even though more ∆T3 attached to H292 cells, DN2-treated cell showed a significant actin filament destruction more than all the T6SS mutants, however, ∆T1∆T3- and ∆T1 treated cells showed little to no filament destruction. The confocal microscopy of the infected cells was reliable confirmatory data that agreed with the attachment quantification data. Once again, the imaged ∆T3 attached to the cells out rated all the other T6SS mutants and the parent strain, DN2. Despite the overwhelming attachment ∆T3 to the epithelial cells but many of the bacteria were not internalised, rather on the surface of the cells yielding little cytoskeletal rearrangement relative to the other T6SS mutant- treated cells (∆T1 and ∆T1∆T3) and DN2.
Interestingly, ∆T1-treated cells also yielded little bacteria invasion when compared to ∆T3 but not invaded ∆T31∆T3, hence minimal actin destruction in the cells. Objectively, no significant difference in actin polymerisation was noted between ∆T1 and ∆T3, although ∆T3 showed more attachment and possibly invaded more quickly relative to ∆T1. This observation was similar to the EtBr assays, noticeably, where there was no difference in the nuclei uptake of EtBr between ∆T1 and ∆T3 but not the same for ∆T1∆T3, all relative to DN2. These observations alongside the quantitative data have led to a hypothesis that, T6SS is used by K. pneumoniae to attach, invade, toxicate the cell as well as mediate actin filament collapse. A limitation in the use of these NCI-H292 was noted, the cells did not have unique actin filament across the cytoplasm.
To understand the mechanistic virulent role of T6SS in K. pneumoniae during infection, T6SS-dependent promotion of the host epithelial cells invasion and survival of K. pneumoniae was examined by infecting A549 monolayer (MOI= 100) with the various K. pneumoniae strains for 1h and recovering the invaded bacteria (2, 4, and 6 h post-infection) after gentamicin treatment to eliminate extracellular bacteria. Having
178
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host confirmed that T6SS affect the ability of K. pneumoniae HS11286 to attach to human epithelial cells, the ability of the various strain to invade and survive in the host epithelial cells made a fascinating revelation Figure 5.8B. From Figure 5.8B, the T6SS mutants’ invasion and survival in A549 at all the investigated time-points were hindered but not their parent strain, DN2. The A549 invasion data revealed that, even though the bacteria invasion of the cell was time-course dependent, DN2 invasion was more pronounced relative to T6SS mutants. Unsurprisingly, the double T6SS mutants ∆T1∆T3, yielded the least recovered bacteria though recovery numbers increased over the time-course. Similarly, ∆T1 and ∆T3 recoveries were attenuated relative to their parent stain DN2 but more than ∆T1∆T3. It was however interesting to note that, despite the high attachment of ∆T3 to A549, it could not invade and survive in the cell when compared to DN2 at all the three time-points. Though ∆T3 invasion and survival was attenuated relative to DN2, ∆T3 recovery revealed that it could invade and survive better than the other two T6SS mutants (∆T1 and ∆T1∆T3).
Inferring from the attachment and invasion data Figure 5.8, ∆T3 yielded more attachment but less invasion because of highly expressed surface adhesins/fimbriae (mostly type 3 fimbria) which enabled the attachment but the associated reduced virulence due to T6SS3 deletion affected the ability of the bacteria to survive in the A549 cells. The expressed type 3 fimbria on ∆T3 does not only enhance biofilm formation but mediate binding to cell surface receptors on lung epithelial cell, A549, which is consistent with previously reported studies have(Murphy et al., 2013; Stahlhut, Struve and Krogfelt, 2012; Schroll et al., 2010; Johnson et al., 2011). Hence, the mutation of T6SS affected the surface fimbrial expression, which in turn affected the ability of the bacteria to attach to surface and receptor. No statistically significant difference was noted between ∆T1 and ∆T1∆T3 at 2h, but the difference became apparent with time, particularly at 6h. ∆T1∆T3 invasion/ survival in A549 was highly attenuated followed by ∆T1 and ∆T3 in decreasing level of attenuation, all relative to the parent strain, DN2. Both ∆T1 and ∆T1∆T3 exhibited less invasion and survival in the A549 cell, which corroborates the attachment data from Figure 5.8A.
179
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host
Figure 5.9 Visualization K. pneumoniae attachment to H292 cells. K. pneumoniae attachment to NCI-H292. An H292 monolayer on coverslips was infected with the various K. pneumoniae strains (DN2, ∆T1, ∆T3 and ∆T1∆T3) at MOI 100 for 30 minutes and subsequently washed three times with PBS (no antibiotics). NCI-H292 actin filament was stained with rhodamine-phalloidin, the nuclei stained with DAPI while the bacteria were tagged green with GFP plasmid. More attachment was observed in the ∆T3 -infected cells relative to DN2-treated cells; the reverse was true for ∆T1∆T3-treated cells. NCI-H292 experienced more actin destruction in cell treated with DN2 followed by ∆T3 and arguably ∆T1. The above figure is representative images taken with a scale bar of 10µm indicate at the lower right corner of each image
180
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host K. pneumoniae HS11286 has three categorised T6SS clusters, but only two of these clusters (T6SS1 and T6SS3) are showed functional potential due to the gene content of these clusters (they contained almost all the known functional T6SS components). But the K. pneumoniae T6SS3 lacks one of the essential components of T6SS (hcp) although an hcp homologue found elsewhere in the genome as truncate T6SS2 may be complementing the T6SS3. Unlike T6SS3, T6SS1 has all the functional T6SS components and contributed significantly to the overall virulence T6SS in K. pneumoniae than T6SS3 cluster. The absence of T6SS1 gene cluster (∆T1) resulted in a significant virulence attenuation, unlike T6SS3 mutant (∆T3) that showed subtle virulence attenuation in attachment and invasion data. The deletion of T6SS3 enhances fimbrial expression that promotes biofilm formation, attachment and invasion to host lungs epithelial cell. Deletion of T6SS1 or T6SS3 increased cell attachment, but the deletion of both clusters terminated virulent attachment and invasion of K. pneumoniae to the host epithelial cells. The invasion and survival assay was also confirmed by confocal microscopy at of infected A549 cell at two-time points (3 and 6 h) as shown in Figure 5.11 and Figure 5.12, suggesting that T6SS is involved the promotion of attachment, invasion and survival. Hence these data indicated that K. pneumoniae uses T6SSs to promote attachment, invasion and survival within host lung epithelial cells and there exist a functional difference in the various T6SS clusters in the genome.
Also, quick ethidium bromide (EtBr) assay was used to assess the viability of the H292. Briefly, the infected monolayer was fixed and first stained with DAPI and then counter-stained with EtBr for confocal microscopy for the presence of DAPI and/ or EtBr. In the presence of EtBr, compromised cell membrane allows EtBr uptake, which may stain the nuclei (replacing lower molecular weight DAPI) unlike healthy viable cells with the uncompromised cell membrane. Consequentially, higher EtBr nuclei fluorescence indicated more EtBr uptake was attained through compromised cell membranes, while DAPI-stained nuclei indicate viable cells. Interestingly, all the K. pneumoniae (DN2, ∆T1 and ∆T3) treated H292 cells except that of ∆T1∆T3 showed the varying level of EtBr fluorescence. From the data, DN2 had much damaging effect on the cells resulting in more EtBr uptake that stained the nuclei of the cells. Though ∆T1 and ∆T3 treated cells show some level of EtBr nuclei fluorescence but not as much as that of DN2-treated cells. The EtBr uptake was attenuated in ∆T1∆T3 treated cells suggesting that ∆T1∆T3 had the least damaging effect on the H292 cells. This was however expected as have been demonstrated extensively in the previous chapters that, the absence of both T6SS clusters in K. pneumoniae (∆T1∆T3) resulted in T6SS1 and T6SS3 synergistic virulence attenuation towards the cells.
181
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host
Figure 5.10 K. pneumoniae T6SS toxicity in H292 cells Confocal microscopy of H292 post-infected monolayer to assess bacterial toxicity by EtBr uptake level after DAPI-staining. DAPI nuclei stained blue while EtBr nuclei stained red. Healthy cells nuclei were stained by DAPI (blue) because they are able to pump out EtBr even after it has gone into the cell cytoplasm, unlike the unhealthy cells (Red). That stained red had a very compromised cell membrane. But do not stain the nuclei, unlike bacteria intoxicated cells, the scale-bare indicated is 10µm.
Bacterial T6SSs are known to secrete effectors that mediate cytoskeletal rearrangement/ actin filament polymerisation in host cells (Ma and Mekalanos, 2010b). Having performed both the attachment and invasion assay, which showed that K. pneumoniae T6SSs promoted attachment, toxicity and invasion of host epithelial cells, then cytoskeletal rearrangement was examined in A549 which had defined actin filaments. To examined how the deletion of T6SS in K. pneumoniae affected actin filament polymerisation, a 3h and 6h post-infection (MOI=100) of A549 were examined under a confocal microscope where the actin filaments were rhodamine-phalloidin stained (red), nuclei blue stained (DAPI) and bacteria tagged green using a GFP plasmid. Also, the confocal microscopy data was a visual confirmation of the invasion and survival data.
From the confocal microscopy data (Figure 5.11 and Figure 5.12), it was evident that more bacteria invaded the A549 monolayer with time. Noticeably, DN2 within the first 3 h post-infection shown significant internalisation, unlike the T6SS mutants. Contrast to the attachment assay, ∆T3, which yielded the highest attachment, did not indicate more invasion at this time-point. As expected, little to no internalisation of ∆T1 and ∆T1∆T3 was observed under the microscope at 3 h post-infection even though their attachment data showed otherwise. It was not surprising that only the cell infected with DN2 showed signs of actin filament polymerisation at the 3 h time-point but not in the T6SS mutant treated A549 monolayers. This can be seen in Figure 5.11 where all the T6SS mutant-treated monolayers showed unperturbed actin filaments similar to those of the control A549 cells with no bacterial infection but not the DN2-treated cell line that showed damaged actin filaments at 3 h post-infection. Also, more DN2 invaded the A549 monolayer than the T6SS 182
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host mutants despite its lower attachment relative to ∆T3. More DN2 was noted in the epithelial cells imaged at 6 h showed better within the epithelial cells unlike The representative images obtained at 6 post-infection were equally confirmatory of T6SS active role in the invasion and survival of K. pneumoniae in the lungs epithelial cell relative to the T6SS mutants derivatives. Also, produced at the 6 h time point was more damaging and disintegration of the A549 actin filaments and rounding-up of the DN2-infected cells. Surprisingly, the nuclei that were easily stained and imaged at 3 h were poorly seen 6 h in the DN2-infected A549 cells. Apart from the DN2 deleterious effect on the cells at 6 h, it was also noted that ∆T3-treated cells also began rounding-up and showed collapsed actin filament as well as more invasion of the bacteria when compared to the other T6SS mutants (∆T1 and ∆T1∆T3) treated A549 cell line. Arguably, though few invaded ∆T1 were observed, the actin filaments were relatively conserved but not as much the conserved actin filaments in the ∆T1∆T3-treated cells. Little to no damage was done to the ∆T1- and ∆T1∆T3-infected cells when compared to the control cells (A549 cells only) unlike the DN2-infected cells, and ∆T3 infected cells. Comparing the images at 3 h to those of the 6 h, more bacteria invaded and internalised at the latter time point and consequently, more cell toxicity, actin filament destruction and cell rounding.
183
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host
Figure 5.11 K. pneumoniae T6SSs mediated A549 invasion and actin polymerisation after 3hrs. Confocal images were taken from DN2, ∆T1, ∆T3 and ∆T1∆T3-infected monolayer after 3 h post-infection. The A549 cell actin filaments with stained with rhodamine-phalloidin, the nuclei stained with DAP1 and the bacteria tagged green (GFP plasmid). Extracellular bacteria were eliminated with 100 µg/ml gentamicin. DN2 bacteria were observed in DN2 treated cells that showed actin filament polymerisation, unlike the T6SS mutant- treated cells and the control cells (A549 only).
184
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host
Figure 5.12 K. pneumoniae A549 invasion and actin polymerisation after 6hrs. K. pneumoniae T6SSs mediated A549 invasion and actin polymerisation after 6hrs. Confocal images were taken from DN2, ∆T1, ∆T3 and ∆T1∆T3-infected monolayer after 6 h post-infection. The A549 cell actin filaments with stained with rhodamine-phalloidin, the nuclei stained with DAP1 and the bacteria tagged green (GFP plasmid). Extracellular bacteria were eliminated with 100 µg/ml gentamicin. DN2 bacteria were observed in DN2, and ∆T3 treated cells that showed even more actin filament polymerisation unlike the ∆T1 and ∆T1∆T3 iT6SS mutant- treated cells and the control cells (A549 only).
185
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host 5.4 T6SSs in K. pneumoniae trigger an inflammatory immune response in both macrophages and epithelial cell (J774 and A549)
Many hosts (including humans) use several evolved mechanisms as a response to the presence of pathogenic microbes, thereby preventing such pathogens from causing infections. One such common mechanism employed by many hosts is the innate immune system, which is the primary immune system that deals with infection. During bacterial infections, immune cells respond by secretion or induction of cytokines and chemokines and activating pathways involved in the clearance of the pathogen. Having looked at several assays that measured the interactive impact of the K. pneumoniae T6SS on abiotic and biotic surfaces (attachment and invasion), a hypothesis that the innate immune system would respond differently to the various T6SS mutants was considered. Here, two forms of binding immunoassays were used, preliminary cytokine array/ proteome profiler to examine the crude cytokine/proteins in the cell line-bacteria induced supernatants, and the other was the traditional ELISA. Supernatants from macrophages (J774) and epithelial (A549) cells were taken at different time points and examined for their cytokine and chemokine response.
Briefly, R&D human/ mouse cytokine array/proteome profiler kit was initially used for the preliminary detection of the various cytokine expression induced by K. pneumoniae T6SS, and the traditional ELISA was later used as a confirmatory test for some of the cytokines detected earlier. The human/ mouse cytokine array/proteome profiler kits are membrane-based sandwich immunoassay where the membranes were incubated in a mixture of samples and cocktail of biotinylated detection antibodies for the chemiluminescent visualisation for the captured proteins. The intensity of the signals (as duplicate dots) produced by each cytokine/chemokine on the membrane was proportional to the amount of the cytokine/chemokine present in the analytes. All supernatants used were filtered to get rid of all bacteria and cells debris. Captured cytokines on the membranes were observed as duplicates and the final images obtained were analysed with ImageJ software for the average pixel intensities represented in graphs (Figure 5.13 and Figure 5.15A). Filtered supernatants meant for ELISA were stored in -80OC until required for the experiment.
To perform the traditional Sandwich ELISA, 96-well plates were pre-coated with the captured antibody for overnight at room temperature. The plates were then washed, blocked and rewashed before adding the samples/ standards to immobilize the cytokines while the unbound materials were washed away. The primary antibodies were added to bind the cytokines, and then an enzyme-linked secondary/ HRP- conjugated antibodies were applied for detection. The substrates for colour development was added, and the absorbance of the wells was measured after being stopped.
186
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host 5.4.1 Expressed macrophage (J774) inflammatory mediators/ cytokines induced in response to K. pneumoniae infection
Macrophages are an essential part of the innate immune cells that act as the first line of defence against pathogens though it plays other roles as well, including homeostasis, coordinate adaptive immune response, inflammation and repair innate immune system (Adams and Hamilton, 1984; Wynn, Chawla and Pollard, 2013; Burke and Lewis, 2002). Macrophage defends the body against invading microbes (bacteria, viruses, fungi and protozoa) by phagocytosis, pathogen destruction, antigen presentation and secretion of cytokine/ chemokine, enzymes, complement, enzyme inhibitors, chemokine the invading pathogen (Burke and Lewis, 2002).
Interestingly, both data obtained from the semi-quantitative mouse cytokine array/ proteome profiler kit (Figure 5.13) and the traditional ELISA kits (Figure 5.14) detected relatively similar J774 cytokines expressed in the culture supernatants. The mouse cytokine array/ proteome profiler kit was used to determine a broad range of cytokines/ transduction signal mediators that were secreted into the J774 culture supernatant upon exposure to the various K. pneumoniae strains (DN2, ∆T1, ∆T3 and ∆T1∆T3). Twelve different cytokine/ chemokine (IL-1a, IL-1ra, MCP-1, MIP-1a, MIP-1b, MIP-2, IP-10, GM-CSF, M-CSF, TNF-a, RANTES and SDF-1), mostly inflammatory mediators were noted to be induced in the infected J774 supernatant. However, for confirmatory purposes, the traditional ELISA was used to measure TNF-a, IL-6, RANTES, IL1a, IP-10, MIP-1a, MIP-1b and MCP-1 in bacteria-treated J774 cell supernatant.
From the preliminary cytokine array data in Figure 5.13, almost the same amount of-of IL-1a, IL-1ra, MIP- 1a, and RANTES was induced by DN2-infected macrophages relative to those expressed by the T6SS mutant treated cell supernatant. Additionally, DN2-infected macrophages secreted a relatively low amount of IP-10, MCP-1, MIP-1b and MIP-2 relative to the T6SS mutant-infected macrophages. In contrast, much lower levels of GM-CSF, M-CSF, SDF-1 and TNF-a were expressed by ∆T1∆T3-infected macrophages relative to the other treatment groups. Generally, variable amounts of T6SSS-dependent induced inflammatory mediators were preliminarily detected in the supernatant of the infected macrophages using the mouse cytokine array/proteome profile.
Granulocyte-macrophage colony-stimulating factor (GM-CSF) and macrophage colony-stimulating factor (M-CSF) are monomeric glycoprotein-based cytokine secreted by macrophages, T cells, mast cells, NK cells, endothelial cells and fibroblast (Francisco-Cruz et al., 2014; Metcalf and Nicola, 1995; Ushach and Zlotnik, 2016). They play an essential role including; acting on WBC and stimulate stem cells to produce granulocytes and monocytes, involved in inflammatory cascade by activating and recruiting cells,
187
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host especially macrophages, hematopoietic cell growth factors, enhance the immune system and promote defence against infection (Metcalf and Nicola, 1995; Hamilton, 2008).
Figure 5.13 A preliminary detection of cytokines array/ proteome profiler of K. pneumoniae-infected J774 cell supernatant at 3h post-infection. An array of cytokines, mostly inflammatory mediators from infected J774 cell supernatant were detected after cells were treated with the various bacterial strains (DN2, ∆T1, ∆T3 AND ∆T1∆T3), using R&D mouse cytokine proteome profiler kit. Differential expression of the IL-1a, IL-1ra, MCP-1, MIP-1a, MIP-1b, MIP-2, IP-10, GM-CSF, M-CSF, TNF-a, RANTES and SDF-1 were detected in the supernatant of both DN2- and the T6SS mutants-infected J774 supernatant. The data represent the mean of the intensity of the duplicate dots for each cytokine detected on the membrane, and this value was considered proportional to the amount of the cytokine in the supernatant. For this experiment, no statistically significant analysis was made because the experiment was only done once and used as a preliminary investigative strategy to know which cytokine to examine further.
To further investigate the quantification of cytokines based on the data obtained using mouse cytokine array/ proteome profiler, specific ELISA kits were performed for several cytokines including TNF-a, IL-6, RANTES, IL-1a, IP-10, MIP-1a, MIP-1b and MCP-1 as a confirmatory quantification of the T6SS-induced J774 secreted cytokines.
Tumour necrosis factor alpha, (TNF-a) is a multifunctional proinflammatory cytokine mostly secreted by macrophages, natural killer cell and lymphocytes. This cytokine is involved in regulating a wide range of processes including cell proliferation, apoptosis, differentiation and inflammation (Popa et al., 2007; Zelová and Hošek, 2013; Page, Bester and Pretorius, 2018; Matsuno et al., 2002). TNF-a as the most crucial pro- inflammatory cytokine facilitates vasodilation and oedema formation and leukocyte adhesion to endothelium by expression of adhesion molecules as well as contributing to oxidative stress at the site of inflammation (Zelová and Hošek, 2013). More TNF-a was secreted in the ∆T3-infected macrophage supernatant (*p≤0.05) more than in DN2-, ∆T1- and ∆T1∆T3-infected macrophage supernatants at 3 h post-
188
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host infection but not at 6 h, (Figure 5.14A). However, at 6h, DN2 strain induced more macrophage secretion of TNF-a than induced by ∆T1 (****p≤0.0001) and ∆T1∆T3 (****p≤0.0001) but not ∆T3 (ns p>0.05) even though ∆T3 (**p≤0.01) induction of TNF-a at 6h was significantly more than that of ∆T1 and ∆T1∆T3 (Figure 5.14A).
Interleukin-6 (IL-6), is a soluble mediator with pleiotropic effect on inflammatory, immunity response and haematopoiesis (Akira, Taga and Kishimoto, 1993). IL-6 is often produced in response to bacterial infection and injuries to the host immune defence and pose a dual effect; as pro-inflammatory and anti-inflammatory role depending on the condition (acts as a defence mechanism and proinflammatory effect in chronic inflammation) (Gabay, 2006; Scheller et al., 2011; Tanaka, Narazaki and Kishimoto, 2014). For IL-6 (Figure 5.14B), significantly more amount was detected at in ∆T3-infected macrophage supernatant (*p≤0.05) relative to DN2 at 3h and even more IL-6 was induced at 6h by ∆T3 and DN2 unlike ∆T1 and ∆T1∆T3.
Regulated (increased production) upon Activation, expression of Normal T- cElls (RANTES/ CCL5) is a hematopoietic and non-hematopoietic cell type chemokine that plays a vital role in homing and migration of effector and memory T cells during acute infection (Alam et al., 1993; Hopp, 1994; Levy, 2009). RANTES previous thought to be specific to T cells is now reported to be secreted by many cell types (such as macrophages, platelets, eosinophil, fibroblast, endothelial, epithelial and endometrial cells). RANTES has been reported to exhibit direct antimicrobial activity and beneficial chemotactic activity of bringing immune cells (T cells, dendritic cells, eosinophils, NK cells, mast cell and basophils) to the site of inflammation and infection (Appay and Rowland-Jones, 2001; Levy, 2009; Villalta et al., 1998). It can, however, exhibit deleterious effect when it recruits immune cells that enhance the inflammatory process in arthritis, nephritis, colitis, arteriosclerosis, asthma and endometriosis among other disorders (Appay and Rowland-Jones, 2001; Levy, 2009; Rossi and Zlotnik, 2000). RANTES (Figure 5.14C) was significantly induced at both 3, and 6-h postinfection in DN2-treated macrophage supernatant relative to all the T6SS mutant treated macrophage supernatant (*p≤0.05). No significant difference in RANTES (ns p>0.05) was detected among the T6SS mutant infected macrophage supernatants at 6h but not at 3h (where ∆T3 induced more RANTES relative to ∆T1).
ELISA for other cytokines, IL-1a, IP-10, MIP1a, MIP-1b and MCP-1, was only performed for the infected macrophage supernatant at 3h post-infection only.
Interleukin 1 alpha (L-1a) is a known cytokine mainly produced by activated macrophages, epithelial neutrophil and endothelial cells responsible for the production of inflammation, fever and sepsis (Di Paolo and Shayakhmetov, 2016; Dube et al., 2001; Dinarello, 2011). It’s on the same pathway that activates the
189
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host TNF-a and been reported to induced IL-8 during infection (Brito et al., 1999; Cheng et al., 2008; Di Paolo et al., 2015; Oppenheim et al., 1989). IL-1a is constitutively expressed by epithelial cell and in epidermal keratinocyte, playing an essential role in maintaining the skin barrier fidelity to prevent the entry of pathogens. While no significant difference in IL-1a was noted between DN2- and ∆T3-infected macrophage supernatant at 3h, DN2 or ∆T3 significantly induced macrophage expression of IL-1a relative to ∆T1 and ∆T1∆T3 or ∆T1∆T3 infected macrophage supernatants at 3h, respectively (Figure 5.14D).
Interferon-gamma-induced protein 10 (IP-10/ CXCL10) is a chemokine is secreted by a variety of cell types (monocytes, fibroblast and endothelial cells) in response to interferon (IFN-y) and inducing chemoattraction of monocytes/macrophages, T cell, NK cells and dendritic cells, facilitating the attachment of T cell to endothelial cells, among many others (Dufour et al., 2002; Liu et al., 2011; Gotsch et al., 2007; Angiolillo et al., 1995). Also, all the T6SS mutants (∆T1, ∆T3 and ∆T1∆T3) significantly induced more IP-10 in the infected macrophage supernatant than induced by their parent strain, DN2 (**p≤0.01) at 3h (Figure 5.14D). Additionally, ∆T1∆T3 expressed more IP-10 more than ∆T1 (**p≤0.01) but not ∆T3 (ns p>0.05) at 3h.
Macrophage inflammatory protein (MIP-1) is known chemokine secreted by macrophages when they are stimulated by bacterial endotoxins (Sherry et al., 1988). MIP-1 exist as MIP-1a and MIP-1b and are involved in the inflammatory process of the innate immunity, and the recruitment and activation of polymorphonuclear leukocytes, NK cells, monocytes and other immune cells (Bystry et al., 2001; Wolpe et al., 1988). MIP-1a and MIP-1b are a significant immune response to infection and inflammation as well as synthesizing and release of other pro-inflammatory cytokines (IL-1, IL-6 and TNF) from fibroblast and macrophages (Ren et al., 2010; Maurer and Von Stebut, 2004). At the 3h post-infection, ∆T1 and ∆T1∆T3 induced high expression of MIP-1a and MIP-1b (Figure 5.14E) relative to ∆T3 and DN2 infected macrophage supernatant at 3h. While no significant difference between DN2 and ∆T3 was observed for the induced expression of MIP-1a, DN2 induced the substantial expression of MIP-1b than induced by ∆T3. No difference was noted between ∆T1 and ∆T1∆T3 induced expression of MIP-1a and MIP-1b at 3h (see Figure 5.14E).
Monocytes chemoattractant protein 1 and 2 (MCP-1 and MCP-2 ) are cytokines involved in the initiation, regulation and recruitment of monocytes, granulocytes, NK cell, memory T cells and dendritic cells to the inflammatory sites during injury/ infection (Carr et al., 1994; Xu et al., 1996; Proost, Wuyts and Van Damme, 1996; Gong et al., 1998). Finally, the infected macrophage was induced to express more MCP-1 (Figure 5.14E) in their supernatant by ∆T3 (***P≤0.001) than induced DN2, ∆T1, and ∆T1∆T3 at 3h. Also,
190
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host DN2 induce the least amount of macrophage-expressed MCP-1 in the culture supernatant relative to ∆T1 (****p≤0.0001), and ∆T1∆T3 (****p≤0.0001) at 3h.
In summary; T6SS mutants induced more expression of IP-10, MIP-1a, MIP-1b and MCP-1 except for IL- 1a, DN2- and ∆T1∆T3 -infected macrophage showed the highest and least expressions of IL-a respectively and ∆T3 induced more expression of IL-1a than induced by ∆T1. Also, it was not surprising that ∆T1- and ∆T1∆T3- treated cells yielded the most expression of MIP-1a and MIP-b compared to DN2 and ∆T3 - treated cells. However, ∆T3 -treated cell expressed the least MIP-1a and MIP-1b compared to the rest of the treatment. Increased expression of IP-10 was induced T6SS mutants (∆T1∆T3, ∆T3 and ∆T1 in decreasing manner) was observed when compared to that the parent strain DN2. More distinctively, ∆T3 - treated cell expressed the highest level of MCP-1 in the supernatant than DN2-, ∆T1- and ∆T1∆T3- treated macrophage supernatants. DN2 significantly inhibited the expression of MCP-1 compared to ∆T1, ∆T3 and ∆T1∆T3 -treated cells. Notably, DN2 carrying both active T6SS clusters induced more expression of TNF- a, IL-6, RANTES and IL-1a (at 6h) than induced by the T6SS mutants. Also, while ∆T3 induced more expression of MCP-1, ∆T1 and ∆T1∆T3 induced more expression of MIP-1a and MIP-1b; and macrophage IP-10 was expressed more in all the T6SS mutants infected supernatant.
Generally, K. pneumoniae, in a T6SS-dependent manner, trigger a variable expression of inflammatory signal transduction mediators in macrophages (Figure 5.14). On a broad scale, DN2 treatment inhibited of increased expression of the inflammatory cytokines through a yet-to-be-explored mechanism as an evasive strategy to prevent the recruitment of immune cells and factors to the area of infection.
191
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence and activates pro- inflammatory innate immune response in host
Figure 5.14 ELISA quantification of K. pneumoniae T6SS-dependent induction of inflammatory mediators in infected J774 supernatant. TNF-a (A), IL-6 (B) and RANTES (C) were measured from the K. pneumoniae (DN2, ∆T1, ∆T3 AND ∆T1∆T3) infected J774 culture supernatant at 3h and 6h post-infection. Before the ELISA, supernatants were collected, filtered and stored at -80oC. Also, IL-1a and IP-10 (D) and, MIP-1a, MIP-1b and MCP-1 (E) were measured from the infected J774 supernatant at only 3h- post-infection. The traditional sandwich ELISA was used to detect the various cytokines that were induced by different bacterial strains. Background expression of each cytokine from uninfected cell supernatant was used to normalise the respective cytokine, and the experiment was performed twice with three biological repeats and according to manufacturer instructions. The data were analysed using 2-way ANOVA and turkey test posthoc test and where asterisk used to indicate statistical significance (*p≤0.05, **p≤0.01, ***P≤0.001 and ****p≤0.0001) and ns as not significant (p>0.05). 192
David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence in host and activates host pro- inflammatory innate immune response 5.4.2 Expressed epithelial (A549) inflammatory mediators/ cytokines stimulated in response to K. pneumoniae
Human cytokine array/ proteome profile was used to preliminarily detected the various A549 cytokines expressed in the supernatant upon induction by K. pneumoniae. Briefly, the membrane with the duplicates captured cytokines antibodies were incubated with the supernatants of DN2, ∆T1, ∆T3 and ∆T1∆T3 infected epithelial cells at 3 h post-infection. Using the detection antibodies, the cytokines were detected at duplicate black dots on the membrane, and their average pixel intensities were obtained using ImageJ. Five different inflammatory cytokines (IL-8, MIF, PAI-1, sICAM-1, and GROa) were detected using the human cytokine array/ proteome profiler. The data (Figure 5.15A) revealed that while DN2 stimulated the highest expression of GROa and MIF, ∆T1∆T3 induced the least expression of GROa and MIF in A549 cells.
Additionally, A549 cells that were infected with ∆T3 showed increased expression of IL-8 and PAI-1 relative to DN2, ∆T1 and ∆T1∆T3. Similarly, ∆T1 and ∆T3 infected epithelial cells showed increased expression of sCAM-1 relative to DN2 and ∆T1∆T3. Among five induced A549 cytokines, ∆T1∆T3-treated A549 cell showed the least expression of IL-8, MIF, PAI-1, sICAM-1, and GROa while DN2-treated cell supernatant expressed higher in MIF and GROa but not PAI-1. This experiment was only performed once as a preliminary screening strategy for target ELISA quantification. Thus, no statistical analysis was performed to determine the significant difference among the various cytokines.
Soluble intracellular adhesion molecule-1 (sICAM-1) are cell adhesion molecules representing the circulating form of ICAM constitutively expressed or inducible on many cell lines surface as an important inflammatory biomarker for activation and destruction of the endothelium(Mendez et al., 2011; Witkowska and Borawska, 2004). It serves as a counter-receptor for lymphocytes function-associated antigen (LFA-1) and the interaction between endothelial ICAM-1 and LFA-1 promote leukocyte attachment and migration through the endothelium (Witkowska and Borawska, 2004; Meyer, Dustin and Carron, 1995; Abe et al., 1998). DN2- and ∆T1∆T3-treated cells supernatant yielded lesser sICAM-1 when compared to ∆T1- and ∆T3-treated cell supernatant
To quantify the elicited cytokines induced in the epithelial cell line, ELISA was performed for some of the A549 inflammatory mediators (IL-8, GROa and MIF) induced by K. pneumoniae. DN2- treated cell expressed more GROa and MIF compared to the other treatments but not IL-8. ∆T1∆T3-treated A549 cells secreted the least amount the assessed inflammatory mediators (IL-8, GROa and MIF) followed by ∆T1 for IL-8 and GROa mediators but not MIF. Unlike in the quantified of MIF mediator quantification in A549, ∆T3 induced more IL-8 and GROa production compared to the other T6SS mutants. Among the T6SS
193 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence in host and activates host pro- inflammatory innate immune response mutants, ∆T3 induced higher expression of IL-8 and GROa but not MIF, which showed increased expression in ∆T1-treated cells compared to the other T6SS mutants.
IL-8 (also known as CXCL8) is an essential inflammatory chemokine of the innate immune response known to mediate chemotaxis of neutrophils and other granulocytes to migrate to the area of infection as well as stimulating phagocytosis (Harada et al., 1994; Köhidai and Csaba, 1998). It is widely secreted by macrophages and epithelial. After examining the supernatant for IL-8 using ELISA kit, it was realised that ∆T3-infected A549 cells expressed more IL-8 in the supernatant than induced by DN2 (*p=0.019), ∆T1 (***p=0.0002) and ∆T1∆T3 (***p≤0.0001) infection of d epithelial cell. While ∆T1 and ∆T1∆T3 significantly induced different amounts of IL-8 (*p=0.0239), no difference was noted between DN2 and ∆T1 induced expression of IL-8 (ns p=0.2528). The drastic induced expression of IL-8 by ∆T3 maybe because of the high expression of surface fimbriae and combination with the bacteria native virulence factors
Growth-regulated alpha protein (GROa), has chemotactic neutrophils and plays a role in inflammation and exerts its effect on endothelial cells (Son et al., 2007; Cubitt, Lausch and Oakes, 1997). More GROa was secreted by DN2-treated A549 cells and followed by ∆T3-treated A549. The least amount of GROa was secreted by ∆T1∆T3-treated A549 relative to all the other bacterial strain.
Macrophage migration inhibitory factor (MIF) is an important inflammatory cytokine that is involved in the regulation of innate immunity by binding to CD70 on other immune cells to trigger an acute immune response (Calandra and Roger, 2003; Günther et al., 2018). It is mostly realised into the blood when bacterial antigen stimulates leukocytes. It is involved in cell mediated-immunity and inflammation as well as suppress the anti-inflammatory effect of glucocorticoids to regulate macrophage function in the host (Larson and Horak, 2006; Lue et al., 2002). The preliminary data indicated high expression of MIF for DN2-treated cell supernatant when compared to the T6SS mutant. Among the T6SS mutant treated cell supernatant, ∆T1, ∆T3 and ∆T1∆T3 expressed a decreasing amount of MIF, respectively.
194 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence in host and activates host pro- inflammatory innate immune response
Figure 5.15 K. pneumoniae T6SS induced secretion of lungs epithelial A549 inflammatory mediators in the supernatant at 3 post-infection. Two methods were used: A) A preliminary R&D human cytokine/proteomic array profile. K. pneumoniae (DN2, ∆T1, ∆T3 AND ∆T1∆T3) infected cell culture supernatants were collected and filtered and either stored at -80℃ or used right away for downstream experiments. Following manufacturer’s instructions, after detecting the various cytokines (IL-8, MIF, PAI-1, sICAM-1, and GROa), the average pixel densities for the duplicate dot of cytokine (proportional to the amount of analyte present) were obtained. B) ELISA quantification of a specific inflammatory mediator from infected A549 culture supernatant after 3-h post-K. pneumoniae (DN2, ∆T1, ∆T3 AND ∆T1∆T3) infection. Notably, different levels of inflammatory mediators (IL-8, GROa and MIF) from K. pneumoniae -treated A549 cell supernatant were detected and quantified. Prior to the ELISA, supernatants were collected, filtered and stored at -80oC and following Manufacturer instructions (R&D), the experiment was performed once but with three biological repeats. Background expression of each cytokine from uninfected cell supernatant was used to normalise the respective cytokine, and the experiment was performed once but with three biological repeats and according to manufacturer instructions. The data were analysed using 2-way ANOVA and turkey test posthoc test and where asterisk used to indicate statistical significance (*p≤0.05, **p≤0.01, ***P≤0.001 and ****p≤0.0001) and ns as not significant (p>0.05). Different level of expression of IL-8, MIF, PAI-1, sICAM-1, and GROa was noted for various treatments though ∆T1∆T3-treated A549 supernatant yielded the least expression compared to the other treatments
195 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence in host and activates host pro- inflammatory innate immune response The result obtained from these experiments suggests that K. pneumoniae was able to induce an innate inflammatory response in both host A549 human epithelial cell and J774 mouse cells in a T6SS-dependent manner. The data suggest that K. pneumoniae T6SS via an unknown mechanism, stimulates an inflammatory response in the host cells. More so, the K. pneumoniae parent strain, DN2 and sometimes ∆T3 was found to induced higher expression of the inflammatory immune proteins (TNF-a, IL-6, RANTES and IL-1a) unlike ∆T1 and ∆T1∆T3 (IP-10, MCP-1 and MIP-1) infected host macrophages. Also, the epithelial cells infected with DN2 expressed more IL-8, GROa and MIF than induced by ∆T1∆T3 or ∆T1. Except for IP-10 from infected macrophage, and IL-8, GROa and MIF from infected A549, there was no significant difference between ∆T1 or ∆T1∆T3 treatment groups was observed. T6SS3 mutants (∆T3), though induced more cytokines expression than ∆T1 and ∆T1∆T3, attenuated cytokine expression was induced by ∆T3 relative DN2.
5.5 J774 inflammatory mediators induced by hyper mucoid K. pneumoniae NTUH-K2044 T6SS
Despite the inability to create the T6SS3 mutant in K. pneumoniae NTUH-K2044, the T6SS1 mutant (NTUH∆T1) and its parent strain (KR1730) were used in the innate immune response mediator immunoassay was performed using the parent strain (KR1730) and its T6SS1 mutant in J774 cell line infection. Both the supernatant and the cell lysate were analysed for the expression of cytokines. However, the results obtained were interestingly similar to the J774 inflammatory mediators induced by DN2 and its T6SS derivatives. Generally, all the NTUH∆T1 induced inflammatory mediators were highly expressed in the cell supernatant, while the KR1730 induced inflammatory mediators were significantly in the cell lysate. The J774 induced inflammatory mediators from the cell supernatant included IL-ra, IP-10, MCP-1, MIP1a, MIP2, SDF-1 and TNF-a while that from the cell lysate included sICAM-1, IL-a, IL-ra, MCP-1, MIP1a, MIP2, SDF-1 and TNF-a.
No significant difference was noted for the induced IL-1a and TNF-a from the cell lysate but not from the cell supernatant. NTUH∆T1 induced cell supernatant showed the presence of MCP-1, MIP-1a, SDF-1 and TNF-a just like IL-area that was only present in KR1730 induced cell lysate. Comparatively, the little expression of IL-1ra, IP-10 and MIP-2 were detected in KR1730 induced cell supernatant unlike NTUH∆T1 induced cell supernatant. Also, sICAM-1, MIP-1a, MIP-2 and SDF-1.
196 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence in host and activates host pro- inflammatory innate immune response
Figure 5.16 Inflammatory mediators induced by hyper mucoid K. pneumoniae NTUH-K2044. A) K. pneumoniae (KR1730 and NTUH∆T1) induced J774 innate proinflammatory mediators in; A) culture supernatant and B) cell lysate after infection in the supernatant at 3h post-infection. K. pneumoniae (KR1730 and NTUH∆T1) infected cell culture supernatants were collected and filtered and either stored at -80℃ for downstream experiments or used right away mouse cytokine/proteomic array profile. Following manufacturer’s instructions, after detecting the various cytokines (IL-1ra, IP-10, MCP-1, MIP-1a MIP-2, SDF- 1 & TNF-a for supernatant and, sCAM-1, IL-1a, IL-1ra, MIP-1a MIP-2, SDF-1 & TNF-a FOR cell lysates), the average pixel densities for the duplicate dot of cytokine (proportional to the amount of analyte present) were obtained.
From the hyper mucoid K. pneumoniae NTUH-K2044 induction, NTUH∆T1 induced higher expression of inflammatory mediators in the cell supernatant but not in the cell lysate while KR1730 induced inflammatory mediators were more expressed in the cell lysate unlike in the cell supernatant. DN2 and its mutants distinctly demonstrated variable inflammatory mediator expressions in both hosts epithelial cell (human lungs A549) and macrophages (mouse J774). The presence or absence of T6SS in K. pneumoniae influenced the host cell immune response. Hence these results suggest that T6SSs plays a significant role in the activation of host innate immune systems
197 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 5: Klebsiella pneumoniae T6SS mediate virulence in host and activates host pro- inflammatory innate immune response
198 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion
Chapter Six
General Discussion
199 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion Chapter 6: General Discussion
The natural environment, plant and animal hosts provide a home to diverse pathogenic and non-pathogenic microbial species (Fuqua et al., 2010). Not only are resources limited in such ecological important niche but many of the microbes are faced with unfavourable environmental factors where only the fittest or those that are well adapted survive (Fuqua et al., 2010; Feldman et al., 2002; Wloch-Salamon et al., 2008). Most well study populations are either driven by a transition (competitive forces) or a balanced population. K. pneumoniae survival and subsequent colonization in a mixed microbial niche depend on how successful it favourably competes with the diverse normal flora and other pathogenic bacteria species for the niche’s limited resources in the face of all the opposing forces posed by other competing bacteria species. Competition within K. pneumoniae (intraspecies competition) and among diverse bacterial species (inter- species competition) including those with or without T6SS immunity is key to microbial survival and colonization.
T6SS is a transmembrane spring-loaded nano-molecular dagger expressed by a quarter of Gram-negative bacteria for diverse use ranging from competition and antimicrobial to virulence towards host cells (Dong et al., 2013a; Schwarz et al., 2010b; Hood et al., 2010b; Miyata et al., 2011; Mulder, Cooper and Coombes, 2012b; Bönemann, Pietrosiuk and Mogk, 2010; MacIntyre et al., 2010b). Earlier study bioinformatically identified putative T6SS clusters in K. pneumoniae by comparative sequenced genome analysis. However, the role of these putative T6SS clusters in K. pneumoniae were unknown. In the natural environment, K. pneumoniae is faced with many environmental or host obliterating factor if it must survive to colonize or cooperate in a polymicrobial community. With the recent discovery of T6SS in most Gram-negative bacteria and the rise of carbapenem-resistant K. pneumoniae (CRK) related infection threatening last medical antibiotic resort, the opportunistic pathogens keep evolving in many virulent factors which are yet to be understood.
Hence, the purpose of this research was to explore the role of these putative T6SS clusters in K. pneumoniae using less antibiotic-resistant K. pneumoniae NTUH-K2044 and a multidrug-resistant K. pneumoniae HS11286 as model strains. Unfortunately, as at the time of this research, the lab had limited molecular tools that could be used to explore the MDR K. pneumoniae HS11286 hence new molecular tools were built to facilitate the easy genetic manipulation of the Gram-negative multidrug-resistant strains especially, K. pneumoniae, E. coli and A. baumannii. MDR strains. Briefly, chapter three of this research work describe the various constructed molecular tools, and the novel gene swapping technique that was used in the construction of the molecular tools, and the role of T6SS in biofilm, fimbriae and competition was
200 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion demonstrated in chapter four while chapter five elucidated the role of T6SS in posing virulence towards host cells.
Presented in chapter three is a novel DNA swapping technique (Figure 3.1) that was used mainly in the rapid and efficient construction of a library of unique molecular tools (pDNTOOL) for exploring T6SS virulent role in K. pneumoniae. This strategy involved the use of a sucrose counterselection marker, sacB together with an antibiotic resistance gene (such as cat for chloramphenicol resistance) as a gene knockout selection marker to first replace the target region via lambda red recombination or traditional cloning method. Then the intermediate sacB-cat plasmid-bearing strain was then selected, and PCR verified. A library of plasmids with different resistance markers or GFP were then created by transforming an arabinose-induced E. coli strain carrying both sacB-cat intermediate plasmid and a lambda red plasmid with different SOE-PCR products and simultaneously selecting on LA sucrose plate with or without antibiotics as required. During this allelic exchange, the lambda red recombination used 30-100 bp as flanking up and downstream target sequence to replace sacB-cat with the desired SOE-PCR product. As in most cases, the intermediate sacB-cat bearing plasmid exists in multiple copies in the E. coli, and not all these copies are mutated. To eliminate these residual/ unmutated sacB-cat bearing plasmids, the transformants were selected on LA sucrose and antibiotics at 37-42℃, this caused sacB to express lethal levansucrase as a counter- selection marker resulting in the loss of the all the sacB-cat bearing plasmids. Also, by growing transformant at 37-42℃ resulted in the loss of the temperature-sensitive lambda red plasmid. Thus, the final desired constructed plasmid was maintained in the E. coli with antibiotic selection while both the temperature-sensitive lambda red plasmid and residual sacB-cat bearing plasmid were lost simultaneously.
The uniqueness of this novel strategy was not only in the creation of various tools that were used for T6SS related downstream application but how rapid and efficient this method facilitated the construction of the pNDTOOOLs without any false-positive results (Figure 3.2 and Figure 3.3). Surprisingly, after the transformation of SOE-PCR product into the E. coli strain carrying both the intermediate sacB-cat and lambda red plasmids (on LA sucrose plus antibiotic selection), only the desired plasmid was obtained without any residual sacB-cat or lambda, indicating that was near This suggested that this method is near perfect in the generation of genetic tool library. More importantly, this method avoided the cost associated oligo primers and restriction enzymes, technical issue and time associated with standard cloning technique. Generating a genetic tool library using standard cloning technique is not only time consuming but very costly and technically challenging. Hence this novel strategy offers a new approach of rapidly generating a diverse library of molecular genetic tools while mitigating all the issues associated with traditional cloning method. Based on the demonstrated efficiency and results of this novel DNA swapping method, the technique could be further optimized for marker-less chromosomal gene complementation.
201 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion
Using the novel DNA swapping strategy and standard cloning method (occasionally), an array of genetic tools was constructed for downstream use or increase the antibiotic selection option of various necessary plasmid available in Lab 212 archive. The MDR K. pneumoniae HS11286 genetic manipulation offered the use of limited antibiotic-resistant markers. Hence the diversification and increase of antibiotic-resistant variants of such suitable plasmids were necessary to aid gene knockout and DNA manipulation in multidrug-resistant Gram-negative bacteria strains including K. pneumoniae HS11286. Notably, several antibiotic resistance derivatives of lambda red plasmids (pDNTOOL-5, pDNTOOL-10, pDNTOOL-11, pDNTOOL-12, pDNTOOL-13, pDNTOOL-14, pDNTOOL-15, pDNTOOL-16 and pDNTOOL-17) were constructed using pKOBEG-Apra (expressing apramycin resistance) and pKD46 (ampicillin resistance) the backbone plasmid. Several FRT-flanked antibiotic-resistant markers (pDNTOOL-1, pDNTOOL-32, pDNTOOL-33, pDNTOOL-34, pDNTOOL-35, pDNTOOL-35, pDNTOOL-37, pDNTOOL-38) were constructed to provided reusable makers during gene knockout. Another important group of plasmid derivatives that were created included flippase-encoding plasmids which were used in excising antibiotic- resistant marker after gene knockout. These plasmids include pDNTOOL-2, pDNTOOL-18, pDNTOOL- 19, pDNTOOL-20 and pDNTOOL-21. Also cloning/ expression plasmids derivatives (pDNTOOL-3, pDNTOOL-4, pDNTOOL-22 to pDNTOOL-30, pDNTOOL-39, pDNTOOL-26, pDNTOOL-27, pDNTOOL-28 and pDNTOOL-30) were constructed for gene expression and GFP tagging. This wide array of plasmids was constructed using the novel DNA swapping strategy or traditional cloning method and were subsequently use used for exploring the role of T6SS in K. pneumoniae. These plasmids also increase the availability of diverse antibiotic-resistant derivatives of various plasmids that could potentially be used for other research purposes.
Also, in chapter three, it was demonstrated that the resistance repertoire of the MDR K. pneumoniae HS11286 strain could be mapped out and conveniently disarmed to create a model K. pneumoniae safer to work with for T6SS functional studies and future routine laboratory usage. K. pneumoniae HS11286 is carbapenem-resistant strain isolated from the sputum of a patient at Huashan Hospital, Shanghai-China (Liu et al., 2012a). The strain has a plastic genome and six plasmids (pKPHS1, pKPHS2, pKPHS3, pKPHS4, pKPHS5 and pKPHS6) but more importantly, pKPHS2 and pKPHS3 played a significant role in the antibiotic resistance of the strain. Multidrug resistance of the strain was primarily mediated via its plasmids (Appendix 2-3 Resistance genes identified in K. pneumoniae HS11286 that could confer resistance in
Clinical cases). While pKPHS2 (similar backbone to K. pneumoniae plasmid pKP048) has blaTEM-1 and carbapenemase gene blaKPC-2 genes and, pKPHS3 showed significant similarity to Yersinia pestis plasmid pIPI202 and possessed several resistant genes (genes such as tetG, cat, sulI, dfraI2, aac(3) and aph) contributing to the multidrug resistance of K. pneumoniae HS11286. The blaKPC-2 gene on pKPHS2 and a 26 kb MDR region containing 12 clustered antibiotic resistance genes and one biocide resistance gene on
202 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion pKPHS3 (Appendix 2-1: List of genes deleted from the 26 kb region) were mapped out and successfully deleted for safer use of the strain for downstream T6SS related work. After the deletion of the antibiotic resistance genes, the MIC data (Appendix 2-2 Antibiotic susceptibility of K. pneumoniae HS11286 and the antibiotic disarmed versions) of the antibiotic disarmed strain (DN2) relative to the parent strain (KR3317) showed an attenuated resistance to a wide range of antibiotics including cefoxitin, ceftazidime, imipenem, meropenem, gentamicin, tobramycin, amikacin, streptomycin, kanamycin, levofloxacin, trimethoprim- sulfamethoxazole, trimethoprim, chloramphenicol, tetracycline, spectinomycin, colistin, polymyxin B and tigecycline.
The deletion of only blaKPC-2 on pKPHS2 resulted in a significant loss of carbapenem (imipenem and meropenem), cefoxitin and ceftazidime which remained unchanged even after the deletion of the 26 kb MDR region on pKPHS3. After the deletion of the 26 kb MDR region, the attenuation aminoglycoside resistance was most likely due to the loss of aacC2, aacA2, rmtB and strAB while the loss of aacA2, the dfrA12-like gene, floR, and tetAR resulted in susceptibility to spectinomycin, trimethoprim, chloramphenicol and tetracycline respectively. Likewise, loss of dfrA12-like, sul1 and sul2 most likely resulted in the loss of resistance to trimethoprim-sulfamethoxazole. The disarmament of both the blaKPC-2 and 26 kb MDR region on the K. pneumoniae HS11286, therefore, resulted in a safer generation of a more harmless and antibiotic-susceptible strain (DN2) which was easily genetically manipulated as model K. pneumoniae.
Additionally, the antibiotic susceptible strain, DN2, showed a significant increase in competition relative to the parent strain in an in-vitro culture but not in vivo Galleria larvae model, suggesting that the deleted resistance repertoire posed a physiological and energetic cost to K. pneumoniae HS11286 while enhancing virulence in the strain. This was not surprising as other studies have reported similar observations where enhanced antibiotic resistance acquisition increased physiological burden on the bacteria but provide a mechanism of subduing and evading host defence (Kidd et al., 2017; Campos et al., 2004b; Padilla et al., 2010a; Sahly et al., 2008; Beceiro, Tomas and Bou, 2013; Beyrouthy et al., 2014; Bialek-Davenet et al., 2015; Cannatelli et al., 2013; Chen et al., 2010; da Silva and Mendonça, 2012; El Fertas-Aissani et al., 2013; Lavigne et al., 2013; McLaughlin et al., 2014; Ramirez et al., 2014).
The acquisition and spread of resistance-associated genes and evolution of bacteria are significantly influenced by certain types of mobile genetic elements including plasmids, ISs, transposons, integrons and associated gene cassettes, prophages, integrative and conjugative elements (ICEs) and genomic islands (GIs) (Frost et al., 2005b; Frost et al., 2005c; Kottara et al., 2017; Partridge, 2011b; Thomas and Nielsen, 2005). The mapping and disarmament of resistance
203 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion genes on pKPHS2 and pKPHS3 (blaKPC-2 and the 26 kb MDR region, respectively) reiterated the role of plasmids as one of the most important mobile genetic elements that bear many resistance genes in K. pneumoniae for dissemination. The resistance-disarmed K. pneumoniae HS11286 (∆kpc∆MDR or DN2) generated in this study offered a more suitable, safer and genetically modifiable K. pneumoniae model strain that was later used for T6SS functional studies and future works.
An in silico analysis showed the presence of different types of T6SS gene clusters (T6SS1, T6SS2 and T6SS3) of in K. pneumoniae (Sarris et al., 2011a). However, no experimental data investigating the contributory role of such putative T6SS gene clusters in K. pneumoniae was presented. Also, the in silico analysis that was done then was only limited to few strains of K. pneumoniae, including K. pneumoniae NTUH-K2044, K. pneumoniae MGH78578 and K. pneumoniae 342. But MDR K. pneumoniae HS11286 sequenced data was only published a year later (Liu et al., 2012a) and being dominant KPC-producing ST11clone in China and closely related to CRKP clone ST258 (dominant Worldwide), it was imperative to assess the virulence of this strain and the role of T6SS virulence in it pathogenicity. Comparative genomic analysis revealed that K. pneumoniae carried two putative T6SS clusters (T6SS1 and T6SS3) and a disintegrated T6SS2 (notably carrying hcp and clpV genes).
Interestingly, the T6SS1 was not only similar in content (genes within the cluster) but in context (upstream and downstream flanking regions) to those predicted earlier by Saris et al., (2011). T6SS1 had all the important genes considered to be necessary for assemblage and functioning of T6SS in bacteria and was flanked by at least 5 kb conserved upstream and downstream sequences (Figure 3.8). Similarly, T6SS3 had almost all the hallmark genes for a functional T6SS except hcp (which encodes both structural and effector proteins) and ATPase energizing clpV genes. Also, T6SS had unique conserved upstream and downstream sequences flanking T6SS3. However, the disintegrated T6SS2 notably had hcp and clpV as the only T6SS hallmark genes among other genes. Based on this surprising observation, it was postulated the hcp and clpV in T6SS2 were functionally complementing the T6SS3 while T6SS1 can independently function on its own. Inferring from these in silico analyses, it seems that K. pneumoniae possess two functional T6SS gene clusters, T6SS1 and T6SS3.
Based on the similarity of the T6SS genes and conserved upstream and downstream flanking sequences, unique probing primers were designed and used to identify T6SS1, T6SS2 and T6SS3 in the fourteen sequenced K. pneumoniae strains with high specificity (Figure 3.9). These strains included K. pneumoniae JM45, K. pneumoniae 342, K. pneumoniae 234-12, K. pneumoniae 1084, K. pneumoniae MGH 78578, K. pneumoniae NTUH-K2044, K. pneumoniae HS11286, K. pneumoniae CG43, K. pneumoniae INH27, K.
204 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion pneumoniae IH31, K. pneumoniae subsp. Rhinoscleromatis SB3432, K. pneumoniae ATTC BAA-2146, K. pneumoniae 52-145 and K. pneumoniae KCTC2242. The identified T6SS1, T6SS2 and T6SS3 in the fourteen K. pneumoniae strains showed different parent of arrangement in the strains. Majority of these strain only had two functional T6SS gene clusters as it is the case of K. pneumoniae HS11286 and K. pneumoniae NTUH-K2044. The in silico analysis provides a means of identifying and broadening the list of sequenced K. pneumoniae strains with putative T6SS gene clusters. This also suggests that T6SS in K. pneumoniae T6SS gene clusters may have evolved through horizontal gene transfer, supporting the notion that T6SS is an ancestral/rudimentary feature of phage tail.
Having successfully identified the various T6SS gene clusters in K. pneumoniae, the required molecular tools from the constructed genetic tool library were employed to generate multiple T6SS mutants in K. pneumoniae NTUH-K2044 and resistance disarmed K. pneumoniae HS11286. Initially, the aim was to create T6SS1 and T6SS3 single and double mutants in both strains but unfortunately, for some unknown reason, knocking out T6SS3 in K. pneumoniae NTUH-K2044 proved unsuccessful. However, while T6SS1 and T6SS3 single or double mutants were created in K. pneumoniae HS11286, only T6SS1 mutant was successfully created in K. pneumoniae NTUH-K2044. The susceptibility of DN2 to a wide range of antibiotic and the availability of constructed molecular tools together with the knowledge obtained from the in silico T6SS analysis significantly aided the generation of T6SS1 and T6SS3 single or double mutants in K. pneumoniae HS11286 and T6SS1 mutant in K. pneumoniae NTUH-K2044. These mutants, together with their parent strains were then employed in downstream assays to assess the virulent contributory role of T6SS in K. pneumoniae.
In a nutshell, chapter one of this report presented a novel DNA swapping technique that was developed and used to create a library of molecular genetic tools. Also, the antibiotic resistance landscape of K. pneumoniae was mapped and knocked out to create a safer model strain for future K. pneumoniae studies. Additionally, the T6SS in silico analysis provided an insight into the various type of putative T6SS gene clusters and their conserved upstream and downstream regions present in fourteen sequenced K. pneumoniae strains. The constructed plasmids and resistance-disarmed DN2 were used to generate various T6SS mutants in the K. pneumoniae for functional studies based on the knowledge obtained from the T6SS in silico analysis.
Presented in chapter four is the role of the putative K. pneumoniae T6SS gene clusters in competitive fitness, biofilm, fimbriation and amoeba phagocytic resistance. Both intra (K. pneumoniae-K. pneumoniae interaction) and interspecies (K. pneumoniae-E. coli or K. pneumoniae-P. aeruginosa interaction)
205 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion competition were employed to study how T6SS mediated antibacterial/competitive interaction in K. pneumoniae. Biofilm formation in 96-well polyvinyl plate both at 30℃ and 37℃ was used to assess the role of T6SS in enhancing biofilm formation in K. pneumoniae. TEM visualisation of the surface fimbriae was then used to confirm the expressed fimbrial type that was involved in the biofilm formation. T6SS mediation of antiphagocytic resistance to environmental amoeba was assessed using A. castellanii. This provides insight as to how K. pneumoniae may survive in its natural environment.
After the deletion of T6SS gene clusters from DN2, both the mutant and parent strains were grown separately, and the bacterial OD600nm or CFU was assessed to determine the bacteria growth curve. It was observed that the deletion of the T6SS gene clusters did not significantly alter the growth curves of the strains over an 18 h period, suggesting that the deleted T6SS gene clusters. Additionally, to assess whether the T6SS gene clusters were functional or not, RNA expression of several T6SS core gene (hcp and vgrG) were used the determinant of the functionality of the two gene clusters in K. pneumoniae. Hcp and VgrG are two important components of T6SS that both act as a structural and effector proteins (Silverman et al., 2012b; Cascales and Cambillau, 2012b; Zoued et al., 2014b), the RNA expression of hcp1 and vgrG1 for T6SS1, hcp2 for T6SS2 and vgrG3 for T6SS3. Interestingly, hcp1 and vgrG1 expressed at least 5-fold more when compared to hcp2 and vgrG3 in the wild-type K. pneumoniae (DN2) relative to the T6SS mutants.
Similarly, hcp2 which was deleted expressed more in the wild-type parent K. pneumoniae followed by T6SS1 and T6SS3 single mutants. It was noted that hcp1 was expressed in ∆T3 despite T6SS1 deletion. Likewise, vgrG3 was expressed in ∆T1 even after T6SS3 deletion, suggesting that the T6SS1 gene cluster did not significantly affect T6SS3 gene cluster and the vice versa. Studies have demonstrated that different T6SS gene clusters in the same bacteria may contribute differently to the overall role of T6SS (Zoued et al., 2014c; Repizo et al., 2015c). Collectively, the RNA expression data (Figure 4.2) indicates that T6SS1- related genes were more expressed in K. pneumoniae relative T6SS3, suggesting that both T6SS1 and T6SS3 were both functional and contributed to the overall role played by K. pneumoniae T6SS.
Bacterial fitness and survival are essential in their colonization and subsequent disease-causation in the polymicrobial environment (Sanchez, 2011; Fuqua et al., 2010; Stubbendieck, Vargas-Bautista and Straight, 2016; Sistrunk et al., 2016; Messer et al., 2017). Since the discovery of T6SS in bacteria, many studies have reported that T6SS is used by the bacteria in intra and interspecies bacteria competition and fitness and evasion of amoeba (Alcoforado Diniz and Coulthurst, 2015; Alteri et al., 2013; Bartonickova et al., 2013; Borgeaud et al., 2015c; Brunet et al., 2013a; Carruthers et al., 2013; Decoin et al., 2015; Decoin et al., 2014a; Haapalainen et al., 2012; Hachani, Lossi and Filloux, 2013; MacIntyre et al., 2010c; Pukatzki et al., 2006b; Repizo et al., 2015d; Russell et al., 2013; Sanchez, 2011; Unterweger et al., 2014a; Unterweger et al., 2012; Zheng, Ho and Mekalanos, 2011a). From the bacteria-bacteria interaction data
206 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion reported in chapter four, it was noted that when T6SS mutants competed against their parent strain (DN2), a significant attenuation in competitive fitness was observed in the T6SS mutants relative to the parent strains. Similarly, T6SS mediated killing of E. coli was abrogated in the mutants but not the parent strain. Among the mutants, T6SS mutant-mediated more competitive fitness or killing when it was competed head- to-head with its parent strains or E. coli, respectively. The T6SS1 and T6SS3 double mutant (∆T1∆T3) could barely keep up relative to the other mutants in competition or E. coli killing assay. The absence of both T6SS gene clusters significantly lowered the competitive fitness or antibacterial potential of the K. pneumoniae. Also, when K. pneumoniae competed against P. aeruginosa with active T6SS, it was observed that more bacterial recovery was obtained for the DN2 but not the T6SS mutants which were significantly inhibited P. aeruginosa. Cell contact-mediated T6SS action of T6SS bearing bacteria (Brunet et al, 2013b; Wösten et al, 2013) is used to deliver t6ss toxins to other bacteria. A direct contact-mediated antibacterial action of T6SSof K. pneumoniae T6SS was observed as a critical factor in the killing of E. coli. When the bacterial mixtures were co-cultured in liquid media, K. pneumoniae could barely inhibit the growth of the E. coli unlike when bacterial mixtures were cultured on the static surface (filter membrane). The effect of K. pneumoniae T6SS antibacterial killing of E. coli was evident in the static bacteria mixed cultures on the filter paper. The antibacterial action of K. pneumoniae T6SS mediated and enhanced via direct contact delivery of effectors onto its prey, E. coli.
This was not surprising as many studies have reported T6SS immune system mostly located within the T6SS cluster employed in protecting themselves against other bacteria T6SS (Dong et al., 2013b; Hood et al., 2010b; MacIntyre et al., 2010a; Ishikawa et al., 2012; Murdoch et al., 2011b). Both T6SS gene clusters individually or synergistically enhanced K. pneumoniae competitive fitness, antibacterial potential and immunity against other bacterial T6SS action. K. pneumoniae in its native environment may employ the use of T6SS to mediate survival and colonization by the release of T6SS effectors into the environment or directly into competitively inhibiting the growth of other competing bacteria in the same biological niche. These data were in concordance with earlier reports, supporting the hypothesis that K. pneumoniae uses its T6SS to mediates antibacterial competition in the polymicrobial environment, thus, suggesting how K. pneumoniae may persist in many habitats such as human gut and nasopharynx, water and soil.
207 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion
Figure 6.1 Schematic representation of K. pneumoniae T6SS used for bacteria competition involved in DN2 interaction. K. pneumoniae uses T6SS for bacteria competition where it targets other competing bacteria with its spring- loaded nano-weapon while shielding itself from incoming T6SS toxins with T6SS immune proteins. K. pneumoniae, DN2 obliterates E. coli, ∆T1 and ∆T1∆T3 competition assay but can resist p. aeruginosa antibacterial killing using it T6SS machinery
Several studies have implicated T6SS in the induction of bacterial competence and the acquisition of foreign DNA via horizontal transfer such conjugation in the natural environment (Blokesch, 2015a; Borgeaud et al., 2015a; Das et al., 2002; Ho, Basler and Mekalanos, 2013; Sexton et al., 2004). K. pneumoniae HS11286 being a MDR strain of dominant ST11 in Asia and closely related to the world-wide dominant ST258, the isolate carries a wide range of resistance genes including carbapenem which is one of the last lines of antimicrobial therapies in Hospitals (Liu et al., 2012b; Bi et al., 2015). Also, Also, the mapping and analysis of the resistance mobilome in the strain revealed that the strain over an evolutionary time acquired many foreign DNA/ mobile genetic elements, which shaped the resistance/ virulence arsenal of the strain. During
208 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion plasmid transfer via conjugation, T6SS lethal response may be triggered by mating pair formation (Mpf) encoded by the recipient bacterial T4SS conjugation system (Ho, Basler and Mekalanos, 2013). Thus, it was postulated that K. pneumoniae presence or absence of T6SS could significantly affect the ability of K. pneumoniae to acquire mobile genetic elements such as plasmids via T4SS conjugative transfer to enhance resistance and survival.
Have demonstrated that K. pneumoniae T6SS was able to induce a direct antibacterial activity on E. coli, a plasmid mobilization assay was used to examine the how K. pneumoniae T6SS could affect the frequency of plasmid transfer to an E. coli donor. K. pneumoniae strains carrying a pACYC184-oriTICE were separately mated with streptomycin-resistant E. coli HB101, and E. coli HB101 transconjugants were subsequently selected on LA plus streptomycin or LA plus streptomycin and chloramphenicol on a filter paper. Surprisingly, only E. coli HB101 transconjugants recovered from a mixture of with T6SS1 mutant and E. coli HB101 showed an elevated conjugal transfer of the plasmid but not T6SS3 mutant or T6SS1/T6SS3 double mutant. A reduced plasmid mobilization frequency was induced by both the parent K. pneumoniae HS11286 strain (DN2) and ∆T1∆T3 (T6SS1/T6SS3 double mutant) relative to T6SS1 and T6SS3 single mutants. However, the CFU of the E. coli recovered from ∆T1∆T3 + E. coli HB101 or ∆T1 + E. coli HB101 was significantly higher than that of the DN2. Thus, though ∆T1∆T3 showed a lower plasmid mobilization frequency just like DN2 strain. The antibacterial killing of E. coli was significantly diminished just like ∆T1 strain but not DN2. Also, ∆T3 induced a significant plasmid mobilization relative to DN2, and ∆T1∆T3 strains even though the E. coli recovered from the mixture not substantial relative to DN2 strains. The RNA expression of two crucial T4SS genes (virB4 and mobB) was assessed to understand further why T6SS1/T6SS3 double mutant (∆T1∆T3) did not yield higher frequency as anticipated. The RNA expression data revealed the both virB4 and mobB were highly expressed in DN2, ∆T1 and ∆T3 strain but not ∆T1∆T3 strain. The lower expression of the T4SS conjugative machinery in ∆T1∆T3 accounted for its lower induced plasmid mobilization frequency despite its abrogated E. coli killing ability. The results suggest that the deletion of T6SS1 in K. pneumoniae may induce an enhanced conjugative plasmid mobilization or mobile genetic elements but reduced antibacterial killing potential. On the other hand, though the deletion of T6SS3 in K. pneumoniae may relatively enhance T4SS conjugal transfer of genetic elements, its T6SS antibacterial activity was not abolished since T6SS1 may still be active in the background. These findings suggest that T6SS and T4SS may be working together to attract other bacteria via conjugal mating pair formation, kill them and subsequently some genetic material when required to survive. Thus, T6SS in K. pneumoniae exhibits direct antibacterial and anti-genetic material transfer against other bacteria. This agrees with other studies suggesting that T6SS may be triggered by the mating pair formation T4SS conjugal machinery and actively used as an antibacterial and genetic material sequestrating arsenal in partnership with other virulent
209 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion factors to out-compete other bacteria to survive in the same environment (Ho, Basler and Mekalanos, 2013; Blokesch, 2015a; Borgeaud et al., 2015a; Das et al., 2002).
Biofilm formation associated with bacterial fimbriae and capsule remains one of the most explored virulent related area of bacteria investigated for their role in antibiotic resistance and bacterial pathogenicity(Dos et al., 2014; Fierer, 2012; Hancock, Witsø and Klemm, 2011; Klausen et al., 2003; Stahlhut et al., 2012; Olson et al., 2012; Schembri et al., 2005). T6SS has been reported to play a significant role in biofilm formation and fimbriae expression (De Pace et al., 2010; Aubert, Flannagan and Valvano, 2008b; Gallique et al., 2017; Khajanchi et al., 2009; Linares et al., 2016; Tian et al., 2015; Vaysse et al., 2009). It was hypothesized that K. pneumoniae HS11286 T6SS contributes to biofilm formation and the expression of surface appendages such as fimbriae. The biofilm data revealed that the deletion of T6SS1 (∆T1) or T6SS3 (∆T3) significantly enhanced the biofilm formation at all the time-points and temperatures relative to the parent strain, DN2 and ∆T1∆T3. The T6SS double mutant (∆T1∆T3) showed lesser biofilm formation phenotype at 48h and 72 h but not 24 h post-inoculation. A microscopic visualisation the biofilm formation on coverslips confirmed the data obtained from the biofilm formation in the polyvinyl 96 well plates; many attached ∆T1 films were almost evenly distributed on the coverslips unlike many massive clumps/ clusters of ∆T3 films relative to the biofilm associated with the parent strain, DN2. Also, few scattered clumps of ∆T1∆T3 films were observed but did not amount to the biofilm-associated with ∆T1 and ∆T3. An agglutination test confirmed the expression of different fimbrial types induced by T6SS. The ∆T3 strain agglutinated GP-RBCs and TATOXB but was mannose-sensitive or mannose- resistant respectively. The agglutination data suggested T6SS-induced differential expression of various type of fimbriae on K. pneumoniae. A further investigation using, a fimH (type 1 fimbria) and mrkD (type 3 fimbria) RNA expression and Transmission Electron Microscopy (TEM) data revealed that the deletion of T6SS1 (∆T1) resulted in an enhanced expression of type 1 fimbriae while the deletion of T6SS3 (∆T3) resulted in a much- enhanced type 3 fimbria expression relative to the other K. pneumoniae HS11286 strains (DN2 and ∆T1∆T3). The observed poor biofilm formation in DN2 and ∆T1∆T3 strains could be associated with low expression of type 1 and type 3 fimbriae. Once again, this data suggests that T6SS is not only co-expressed with T4SSS but are also involved with the expression of K. pneumoniae fimbrial appendages (type 1 and 3) and associated biofilm formation, this has been reported in other bacteria (De Pace et al., 2010; Gallique et al., 2017; Linares et al., 2016; Tian et al., 2015).
210 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion
Figure 6.2 K. pneumoniae T6SS induces type 1 and 3 fimbria-associated biofilm form. The enhance biofilm formation was primarily mediated by the type 1 and 3 fimbriae in the T6SS1 and T6SS3 mutants respectively. The T6SS1 /T6SS3 mutant and DN2 showed relatively amount of biofilm formation due to the attenuated expression of type 1 and 3 fimbriae
In the natural environment, K. pneumoniae also encounter other bacteria-eating single-celled eukaryotes such as amoeba, and for K. pneumoniae to survive, it must over be able to evade the phagocytic cell or intracellularly survive within the amoeba. Amoeba-bacteria interaction is a widely used phagocytic model used for investigating bacteria interaction and phagocytic uptake by amoeba similar to host macrophage phagocytosis (Alsam et al., 2006; Benge, 1988; Chekabab et al., 2012; De Moraes and Alfieri, 2008; Hsieh et al., 2013; Iqbal, Siddiqui and Khan, 2014; Jung et al., 2007; Jung et al., 2008; Khan and Siddiqui, 2014; Lambrecht et al., 2013; Siddiqui et al., 2011; Siddiqui, Lakhundi and Khan, 2015; Yousuf, Siddiqui and Khan, 2013; Steinert and Heuner, 2005). Earlier studies reported the T6SS-induced antiphagocytic activities or intracellular survival within amoeba posed by many bacteria (Zheng, Ho and Mekalanos, 2011b; Miyata et al., 2011; Dong et al., 2013c). An amoeba phagocytosis model using the trophozoites of A. castellanii
211 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion was used to investigate the role of T6SS in amoeba phagocytosis of K. pneumoniae HS11286. Data from the bacterial association and internalization assay revealed that the deletion of T6SS1 or T6SS3 enhanced K. pneumoniae HS11286 association with A. castellanii however the deletion of T6SS1 (∆T1) or T6SS1/T6SS3 (∆T1∆T3) increased K. pneumoniae uptake and internalization within A. castellanii relative to the parent K. pneumoniae HS11286, DN2 strain. The enhanced bacterial association and internalization, viable amoeba recovery and amoeba clearance of the K. pneumoniae T6SS mutant could be associated with the attenuation in virulence-associated with T6SS deletion. Expectedly, the deletion of both T6SS1 and T6SS3 gene clusters significantly impaired the antiphagocytic activity of K. pneumoniae HS11286 and enhanced the ability of A. castellanii to phagocytose and digest K. pneumoniae suggesting that T6SS was prominent in the survival of K. pneumoniae HS11286 in an aquatic environment when interacting with the amoeba. Also, the ability for K. pneumoniae to combined T6SS antagonistic- defensive behaviour, T4SS- dependent acquisition of mobile genetic elements, biofilm formation and amoebal phagocytic resistance adds to K. pneumoniae pathogenicity in the host and environmental persistence.
Host blood serum with abundance complements present a significant immune bactericidal barrier to invading bacterial pathogens and results in the elimination of the pathogen. However, when pathogens evade the bactericidal activities of serum, they persist, spread and pose serious virulence to the host. Many K. pneumoniae strains via various mechanisms such as capsule, lipopolysaccharide among others has been reported to resist serum bactericidal activities posing significant diseases potential (Sharma, Fatma and Thukral, 1999; Shankar-Sinha et al, 2004b; Sahly et al, 2004; Kumar et al, 2011a; Hsieh et al, 2012b; Doorduijn et al, 2016; de Astorza et al, 2004; Cox et al, 2015). MDR K. pneumoniae HS11286 exhibit a broad range of antibiotic resistance even though its serum bactericidal resistance was unknown. Having observed the varying impact of T6SS deletion on the K. pneumoniae HS1186 phenotype, resistance to pool normal human serum and C3b deposition was used to assess T6SS role in serum bactericidal resistance. C3b through the various downstream processes of serum factor binding and cleavage is converted to form C3 convertase which cleaves C3 (C3a and C3b) leading C5 convertase. The C5 convertase then cleaves C5 into C5a and C5b where the latter bind to C6, C7 and C8 in succession to form C5b-8 complex which gets polymerise after forming a complex with C9, leading to membrane attack complex formation on the bacteria membrane. The data revealed that T6SS mutants were impaired in survival, suggesting reduced resistance to the pooled normal human serum relative to the parent strains due to the high deposition of C3b. Noticeably, though the deletion of T6SS3 mutant showed the highest C3b deposition, more T6SS3 mutant was recovered from the serum when compared to T6SS1 (∆T1), and T6SS1/T6SS3 (∆T1∆T3), however the parent K. pneumoniae HS11286 strain (DN2) showed the most serum resistance and but low C3b deposition. Also, the deletion of T6SS gene clusters enhanced opso-phagocytosis by PMN at 1h post- infection a 1h but not at 3 h. Thus, the low C3b deposition and opso-phagocytosis in T6SS1 (∆T1) a and
212 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion
T6SS1/T6SS3 (∆T1∆T3) resulted in attenuated survival of T6SS1 (∆T1), and T6SS1/T6SS3 (∆T1∆T3) relative to DN2 and T6SS3 mutant at 2 and 3h post-inoculation. The T6SS3 mutant surprisingly exhibited more C3b deposition, serums survival and internalization within neutrophils when compared to the other T6SS mutant at 3 h post-inoculation/infection. This may be because of the residual functional T6SS1 and increased fimbrial expression in ∆T3 mutant. These data revealed that K. pneumoniae HS11286 T6SS via an unknown mechanism promotes resistance to opso-phagocytosis and serum bactericidal resistance.
Many studies have demonstrated that T6SS is involved in a host in vivo virulence among various model (Weyrich et al., 2012; Ma and Mekalanos, 2010a; Schell et al., 2007; Brodmann et al., 2017; Lennings, West and Schwarz, 2018; Ungureanu et al., 2019; Repizo et al., 2015a). G. mellonella larvae killing is a well-established and widely used bacterial in vivo model used to assess the virulence of bacteria. The larvae hemocoel carry specialized phagocytic cells called hemocytes as part of the larva innate immunity resemble mammalian phagocytes (Mylonakis, Casadevall and Ausubel, 2007). These cells kill pathogen by releasing antimicrobial properties during phagocytosis and reactive oxygen species (human neutrophil to NADPH oxidase homologue) (Bergin et al., 2005). Few studies have reported the use of Galleria larvae to assess the T6SS in vivo virulence in bacteria and remains a cost-effective in vivo model for virulence exploration. Mortality of Galleria larvae whose phagocytic antimicrobial innate immunity share similarity with the phagocytic mechanism used by host phagocytes, was used to assess the in vivo virulence role of T6SS in K. pneumoniae HS11286. Melanisation of larvae which often leads to death, is consistent with the virulence of the infecting strains, this was measured using phenoloxidase activities. I postulated that K. pneumoniae T6SS enhances the bacterial in vivo virulence in the host organism. As expected, the deletion of T6SS related gene clusters significantly mitigated the T6SS-associated in vivo virulence evidenced by the reduced killing of Galleria larvae, low phenoloxidase activities and inferior competitive edge. The attenuation of T6SS mutant virulence in the larvae ultimately enhanced more hemocyte viability (expressing more antimicrobial properties), reduced melanisation rate and low mortality. Also, the T6SS promoted in vivo competing in the larvae hemocoel where more parent DN2 strains were significantly recovered, unlike the T6SS mutants that were least recovered from parent + T6SS mutant mixture. Among T6SS mutants, the deletion of both T6SS gene clusters (∆T1∆T3) did not only attenuate in vivo virulence but also impaired K. pneumoniae HS11286 in vivo competition potential against the other T6SS mutants ((∆T1 and ∆T3) strains or parent strains, DN2. DN2 strain (carrying both T6SS gene clusters) induced early melanisation of infected larvae leading to high larval mortality which was corroborated by the increased phenoloxidase activities stimulated by DN2 larval infection. Thus, these obtained data proved that Galleria larvae is very good in vivo virulence model for opportunistic pathogens and was used to confirm the hypothesis that K. pneumoniae T6SS does not only enhance antibacterial competition but promotes in vivo virulence in the host organism.
213 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion
Host immunity system has evolved via perpetual interaction of pathogens and multicellular host under acting bidirectional selective pressure leading to the diverse mechanism of attack- and counter-attack relationship between the pathogen and host, respectively. Host innate immune system is populated with a myriad of immune cells (macrophages, dendritic cells, neutrophils, epithelial cells, etc.) which acts as a line of defence against invading pathogens via of mechanisms (Chaplin, 2006; Chaplin, 2010; Parkin and Cohen, 2001). Host macrophage is on one of the first cells to response at the site of infection by initiating phagocytosis and subsequent release of inflammatory cytokines and other immune products to orchestrate cellular defence in the host organisms. Some of the immune products released include IL-12 for activation of NK cells, neutrophil chemoattractant LTB4 via IL-8, harmful oxygen radicals, T-cell stimulatory and pro-inflammatory cytokines (TNF-a, IL-1a) and antimicrobial lactoferrin and lysozyme among many others (Adams and Hamilton, 1984; Burke and Lewis, 2002; Gordon and Read, 2002; Parameswaran and Patial, 2010; Ross and Auger, Wynn, Chawla and Pollard, 2013). Similarly, epithelial cells play an important role in initiating and regulating both innate and adaptive immunity. Host epithelial cells are involved mucociliary clearance, production of enzymes and complements, permeabilizing peptides, inhibitors, reactive oxygen species and stimulatory cytokines among other products as a means of defence against pathogens (Bals and Hiemstra, 2004; Schleimer et al, 2007; Stanke, 2015). Bacterial virulence via various mechanism towards host immune cell as a strategy to evade the host immune system to enhance its pathogenicity presents a significant danger to the host. Many reports have suggested that T6SS induced virulence toward host by targeting and picturing host cells with the loaded toxin in a contact-dependent manner (Sana et al., 2012b; Bröms et al., 2012b; Burtnick et al., 2010; Ma and Mekalanos, 2010b; De Ceuleneer, Vanhoucke and Beyaert, 2015; Wan et al., 2017; Weyrich et al., 2012; Zhang et al., 2012; Russell et al., 2011b) and some accompanying phenotypic immune cell response such as actin cross- linking/cytoskeletal rearrangement and cytokine induction (Satchell, 2009; Ma et al., 2009b; Dutta et al., 2017; Durand et al., 2012; Suarez et al., 2010a; Suarez et al., 2010b; Ma and Mekalanos, 2010b)
Data obtained from macrophage infection revealed that the presence of T6SS gene clusters in the parent strain, DN2 promotes the antiphagocytic resistance and subsequent survival of K. pneumoniae within the murine macrophage. However, the deletion of T6SS gene clusters resulted in attenuated antiphagocytic resistance and reduced survival within the macrophage. Interestingly, the T6SS3 mutant resisted and survived better in the macrophages relative to the T6SS1 and T6SS1/T6SS3 mutants. Relatively in order increasing attenuation, T6SS1 mutant (∆T1) and T6S T6SS1/T6SS3 mutants (∆T1∆T3) were the least recovered or visualized surviving bacteria within the macrophages and could hardly keep up with the other K. pneumoniae strains. Among the T6SS mutants, more T6SS3 mutants were visualized or recovered from the macrophage relative to the other T6SS mutants, which maybe because of the presence of the functional T6SS1 gene cluster in the T6SS3 mutant background. Importantly, while the presence of T6SS in DN2
214 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion gradually promoted increased bacterial CFU recovery from the macrophages, the absence of T6SS -related gene clusters in theT6SS mutants significantly inhibited the recovery of the T6SS mutants. The low visualization or bacterial CFU recovery for the T6SS mutant could be associated with the abolished virulence in the T6SS mutants but not in the parent K. pneumoniae strains.
It was observed that K. pneumoniae T6SS enhanced the attachment, invasion and survival of epithelial cells (A549 and H292) and caused polymerization of the actin filaments of the cells. Additionally, the deletion of T6SS3 gene cluster significantly enhanced the attachment of the K. pneumoniae to the epithelial cells when compared to the attachment of DN2 and the other T6SS mutants. However, T6SS3 mutants could not invade and survive within the epithelial cell as much as the parent strains DN2. The deletion of T6SS1 and T6SS1/T6SS3 abrogated the attachment, invasion and survival of K. pneumoniae in the epithelial cell relative to the T6SS mutant or DN2 parent strain. The enhanced attachment of T6SS3 mutants is possibly imitated by the abundant expression of surface fimbriae, mostly type 3 fimbriae. Confocal microscopy data confirmed that more T6SS3 mutants followed by DN2 parent strain attached to the epithelial cells but lesser T6SS3 mutant were recovered from the epithelial cell invasion and survival assay relative to DN2 strain.
Furthermore, the staining of the actin filament with rhodamine-phalloidin revealed that T6SS in K. pneumoniae stimulated rearrangement and polymerization of the epithelial cell actin filament. The parent strains DN2 enhanced cell membrane permeability and toxicity and completely obliterated the epithelial cell actin filament relative to the T6SS mutant. Among the mutants, while actin filament and cell membrane fidelity were almost preserved in epithelial cells infected by T6SS1 and T6SS1/T6SS3. T6SS3 mutant showed a relative level of actin-cross linking polymerization because of its increased invasion and survival in the epithelial cell relative to the other T6SS mutants. The data suggest that increased K. pneumoniae invasion, survival and actin-cross linking polymerization of the epithelial cells was facilitated by T6SS. The induction of cell actin-cross linking/ actin filament polymerization by T6SS associated toxins was reported in several studies (Ma and Mekalanos, 2010b; Dutta et al., 2017; Durand et al., 2012; Satchell, 2009). While K. pneumoniae is mainly extracellular opportunistic pathogens, is capable of intracellular survival within host cells. Opportunistic pathogens such as K. pneumoniae via the release of effector proteins such as those associated with T6SS exploit actin filament/cytoskeletal rearrangement to enable anti-phagocytosis, attachment, invasion, movement and survival within host cells, thereby facilitating infection.
While K. pneumoniae T6SS may differentially stimulate J774 to express a wide range of cytokines as demonstrated with the mouse cytokine array proteome profiler kit, several inflammatory cytokines (such as TNF-a, IL-6, RANTES, IL-1a, IP-10, MIP-1a and MCP-1) were considered for quantitative ELISA. Elevated expression of TNF-a, IL-6 and RANTES in the infected J774 supernatant was initially stimulated
215 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion by T6SS3 mutant (at 3 h) but was later more expressed my DN2-infected macrophages at 6 h. The T6SS mutants failed to stimulate the expression of TNF-a, IL-6 and RANTES in the macrophages when compared to that of the parent K. pneumoniae strain, DN2. Mainly, the T6SS1/T6SS3 mutant (∆T1∆T3) stimulated the least J774 induced expression of TNF-a, IL-6 and RANTES followed by T6SS1 mutant (∆T1). Additionally, more macrophage-induced expression of IP-10 and MCP-1 were stimulated T6SS mutants, unlike the parent strain where T6SS1/T6SS3 mutant T6SS3 mutant stimulated the highest IP-10 and MCP- 1 respectively. Also, T6SS mutants (∆T1 and ∆T1∆T3) stimulated more expression of macrophage MIP-1 (a and b subunits) and IL-1a when compared to DN2- and ∆T3- induced macrophages expression of MIP- 1 and IL-1a. Similarly, it was also observed K. pneumoniae stimulated the expression of several inflammatory cytokines such as IL-8, GROa and MIF in lungs epithelial cell, A549 supernatant. T6SS3 mutant stimulated more expression of IL-8, unlike T6SS1/T6SS3 mutant which stimulated the least IL-8, GROa and MIF. More expression of GROa and MIF were significantly stimulated by DN2 more than T6SS mutants, T6SS1, T6SS3 or T6SS1/T6SS3 mutants. T6SS mutants (∆T1, ∆T3 and ∆T1∆T3 in decreasing order) stimulation of A549 to expressed MIF was noticeably attenuated relative to their parent strain DN2. The T6SS1/T6SS3 mutant (∆T1∆T3) among all the T6SS mutants stimulated the least amount of IL-8, GROa and MIF. The K. pneumoniae stimulated macrophage, and epithelial induced cytokine expression data suggest that T6SS is actively involved in triggering an elicited inflammatory cytokine immune response where different K. pneumoniae T6SS gene cluster could potentially stimulate specific inflammatory cytokine in host organisms, thereby recruiting inflammatory-associated cellular infiltration to the site of infection.
Generally, K. pneumoniae T6SS facilitated an enhanced host cell attachment, invasion, survival and the collapse of the actin filament cytoskeletal structure. The various T6SS gene clusters mediated varying level of virulence towards the target competing bacterial or host cells. This was not surprising as the in silico mapping and comparative T6SS gene cluster analysis in K. pneumoniae HS11286 revealed that T6SS1 VgrG1 might be conically sharpened with pAAR (proline-alanine-alanine-arginine) repeat protein which tends to carry different cell targeting effector domain proteins unlike the T6SS3 VgrG3 with a C-terminal S-type pyocin that share similarity with that of P. aeruginosa suggesting a novel antibacterial mechanism. While K. pneumoniae T6SS generally promoted competition and virulence, deletion of T6SS1 and/ or T6SS3 revealed different phenotypic interaction with bacteria or host cells. The distribution of pAAR related VgrG1 and s-type pyocin related VgrG3 for T6SS1 and T6SS3 respectively was widely distributed among the analysed K. pneumoniae genome. Thus, the unique phenotype exhibited by T6SS1 and T6SS3 gene cluster may be due to the specific effectors expressed by each T6SS gene cluster for different requirements. The different effector proteins possibly translocated by T6SS1 and T6SS3 onto target cells may account for the displayed difference in virulence towards bacterial and host cell targets and the wide
216 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion range of induced inflammatory cytokines elicited. K. pneumoniae T6SS may not only release toxins in the extracellular milieu but mechanistically puncture the target cells to deliver effector proteins during competition or anti-phagocytosis (Figure 6.3).
Figure 6.3 Multipurpose K. pneumoniae T6SS directly interact with target cells in a contact-dependent manner. The K. pneumoniae T6SS is used to attack both T6SS+ and T6SS- bacterial competitor and resist or invade host immune cells. Hcp and VgrG structure were bioinformatically modelled base on the protein sequence.
217 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 6: General Discussion
218 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 7: Conclusion
Chapter Seven
Conclusion
219 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 7: Conclusion
Chapter 7: Conclusion
Genetic manipulation in hyper mucoid and multidrug-resistant K. pneumoniae can be very daunting, especially when the needed genetic tools are limited or unavailable. The generation of genetic tool library required to investigate the virulence and functional studies of K. pneumoniae and other Gram-negative bacteria can be very laborious and costly. Thus a need for a more efficient strategy of gene swapping and DNA manipulating during plasmid construction cannot be overemphasized. In this report, a novel gene swapping and manipulating strategy were established and used to generate a library of genetic tools efficiently. This technique used a negative selection marker (sacB) together with an antibiotic selection marker and flanking upstream and downstream homologues regions to first swab the gene via lambda red recombination to create an intermediate plasmid in E. coli background. The desired library of SOE-PCR products/ mutant alleles with matching upstream and downstream homologues regions was used to swap the sacB + antibiotic marker on the intermediate plasmid via lambda red recombination. The E. coli transformants were first selected on LA + required antibiotic before subsequently selection them on LA sucrose + required antibiotic to eliminate residual intermediate plasmid (carrying sacB) while maintaining the desired constructed plasmid in the E. coli. This strategy was easier and very efficient (100%) in the generation of various genetic tools (pDNTOOOL plasmids) of interest with and little or use of restriction enzymes and fewer oligonucleotide primers (with 30-100 bp homologous upstream and downstream flanks). Some of these generated tools were used employed in the genetic manipulation of MDR K. pneumoniae for T6SS functional studies. This gene/DNA swapping technique with little optimization could be potentially extended to generate markerless chromosomal gene complementation for functional gene studies in most Gram-negative bacteria. This novel gene/DNA swapping strategy proved to be a very efficient method. It aided the generation of a wide range of plasmids that were desperately needed for exploring K. pneumoniae.
The antibiotic resistance mobilome of K. pneumoniae HS11286 was successfully identified, mapped and disarmed to produce a susceptible K. pneumoniae HS11286 strains that were subsequently used for T6SS functional studies. The antibiotic resistance of K. pneumoniae HS11286 was mediated mainly by plasmids carrying the resistance genes and other mobile genetic elements acquired via horizontal gene transfer. It may have undergone several evolutionary events to shape the resistance mobilome of the bacterium. Using
220 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 7: Conclusion lambda red recombination strategies, blaKPC-2 (on pKPHS2) and a 26 kb antibiotic resistance region (on pKPHS2) were sequentially deleted from K. pneumoniae HS11286 to produced resistance disarmed and safer K. pneumoniae model strain. The deletion of only blaKPC-2 resulted in carbapenem (imipenem and meropenem), cefoxitin and ceftazidime resistance attenuation. The deletion of the 26 kb resistance region further abrogated aminoglycoside spectinomycin, trimethoprim, trimethoprim-sulfamethoxazole, chloramphenicol and tetracycline resistance. Antibiotic susceptibility testing of the resistance disarmed K. pneumoniae strain revealed that the strain was susceptible to a wide range of antibiotics, including meropenem. The resistance regions were easily identified, mapped and knocked out with the use of some of the constructed genetic tools. The mapping and disarmament of blaKPC-2 and the 26 kb MDR region on pKPHS2 and pKPHS3 respectively and subsequent antibiotic susceptibility testing indeed confirmed associated-multidrug resistance observed in the original K. pneumoniae HS11286 isolate while highlighting the role of plasmids as the main bearer of these resistance genes in K. pneumoniae HS11286.
Additionally, the deletion of the resistance regions in K. pneumoniae HS11286 enhanced in vitro competition but showed dwindled virulence in Galleria larvae relative to the parent strain. This agrees with other studies and confirms the associated burden of physiological and energetic cost accompanying the acquisition of antibiotic resistance to enhance bacterial virulence. The resistance-disarmed K. pneumoniae HS11286 (∆kpc∆MDR or DN2) provided a more suitable, safer and genetically modifiable K. pneumoniae model strain for T6SS functional studies and other future research. Based on in silico analysis, only two major T6SS gene clusters, T6SS1 and T6SS3 were identified (T6SS1 and T6SS3) and noted to be widely distributed among K. pneumoniae genomes. T6SS1 gene cluster carried all the known hallmark genes of T6SS within the same cluster, unlike T6SS3 missing ClpV and Hcp genes within the cluster.
The hcp2 and ClpV2 distantly located away from T6SS3 gene cluster is believed to be a complementing the missing Hcp and ClpV genes in T6SS3 Per the analysed K. pneumoniae genomes, T6SS1 and T6SS3 have unique conserved upstream and downstream flanking regions across the K. pneumoniae genome, suggesting the common ancestral evolution of the T6SS gene clusters. Also, carefully analysing each K. pneumoniae T6SS cluster, the VgrG terminal shaping protein for each cluster may be different; a pAAR protein that can carry other effector domains was associated with VgrG1 of the T6SS1 while S-type pyocin protein was found to be associated with VgrG3 of the T6SS3. The knowledge obtained from T6SS in silico analysis together resistance disarming of MDR K. pneumoniae and the constructed library of molecular genetic tools were used to successfully generate was T6SS1 mutant, T6SS3 mutant and TSS1/T6SS3 double
221 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 7: Conclusion mutant all in resistance-disarmed K. pneumoniae HS11286 background and T6SS1 in hyper mucoid K. pneumoniae NTUH-K2044 though knocking out T6SS3 in K. pneumoniae NTUH-K2044 was unsuccessful. These T6SS mutants were then used in various downstream virulence determining assay to assess the role of K. pneumoniae T6SS.
The data obtained from the bacteria-bacteria suggest that T6SS in K. pneumoniae facilitates antibacterial competition bacteria by targeting both T6SS negative and T6SS positive Gram-negative competing bacteria with toxins in a T6SS contact-dependent manner. The deletion of T6SS1 and/or T6SS3 significantly attenuated the antibacterial virulence of K. pneumoniae even though deletion of only T6SS3 still showed a significant antibacterial virulence when compared to that of T6SS1 and T6SS1/T6SS3 mutants. Inferring from this, K. pneumoniae T6SS gene clusters (T6SS1 and T6SS3) exhibit different levels of antibacterial virulence and possibly play a different role since each carry’s different effector proteins. Furthermore, the frequency plasmid mobilization from the T6SS mutant (T6SS1 and T6SS3 but not T6SS1/ T6SS3 mutant) to donor E. coli was enhanced compared to the parent strain. The low plasmid mobilization frequency and attenuated antibacterial virulence induced by T6SS1/T6SS3 was because of the reduced expression of T4SS conjugal machinery and T6SS inactivation, respectively. This suggests that MDR K. pneumoniae HS11286 may be acting as an antibiotic resistance sink by actively using T6SS to target and kill other bacteria while acquiring foreign DNA/ mobile genetic elements via horizontal gene transfer. This T6SS antibacterial mechanisms and acquisition of mobile genetic elements are probably explored by K. pneumoniae to survive in a complex microbial community in the natural environment or host.
The deletion K. pneumoniae T6SS gene cluster differentially induced significant type 1 and 3 fimbriae expression which is responsible for the upregulated biofilm formation in the T6SS mutants (T6SS1 or T6SS3) but not T6SS1/T6SS3 double mutants. Confirmed with GP-RBS and TATOXB agglutination teste, RNA expression and electron microscopy, T6SS1 mutant mainly expressed type 1 fimbria while type 3 fimbriae expressed by T6SS3 mutants. The expression T6SS1 and T6SS3 gene clusters may be tightly regulated with virulence gene such as biofilm forming type1 and type 3 fimbriae. Additionally, K. pneumoniae T6SS promotes resistance and survival in amoeba and macrophage and serum complement- mediated bactericidal resistance, confirming the T6SS virulence mechanism toward host cells. The various K. pneumoniae T6SS gene cluster exports different effector protein to mediate varying level of antiphagocytic virulence to amoeba and host macrophages. The attenuated serum complement-mediated bactericidal resistance was because of the increased deposition of complements (C3b) on the T6SS mutants. K. pneumoniae T6SS also mediate enhanced invasion and intracellular survival of K. pneumoniae within the host epithelial and PMN cells while activating actin filament cross-linking/ cytoskeletal rearrangement. Mutation of K. pneumoniae T6SS1 or T6SS1/T6SS3 significantly attenuated the actin filament
222 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 7: Conclusion polymerization and cell toxicity relative to T6SS3 mutant and the parent strain. This indicates that K. pneumoniae T6SS gene clusters (particularly T6SS1) may potentially secrete actin filament targeting effectors as VgrG1 (T6SS1) and VgrG3 (T6SS3) carry different effector domain. Host cell cytokine expression analysis revealed that K. pneumoniae T6SS sufficiently triggered the host innate immune system by stimulating differential expression of pro-inflammatory cytokines/ chemokines such IL-1, MIP-1 MCP- 1, IL-6, TNF-a, RANTES, IP-10, IL-8, GROa and MIF These cytokines and chemokines may eventually enhance the inflammation reaction or chemokines induce the chemoattraction of immune cell to the infection site in the host, respectively.
Finally, K. pneumoniae T6SS induced in vivo virulence to Galleria larvae by resisting the bactericidal clearance activities of the larvae innate immunity, particularly the haemocytes and stimulating phenoloxidase-mediated larval melanisation and mortality. The diminished mortality of T6SS infected larvae was because of the attenuated in vivo virulence to the larvae. K. pneumoniae T6SS did not only promote in vitro antibacterial coemption but enhanced in vivo competition, survival and virulence in Galleria larvae.
7.1 General conclusion
In summary, the in silico and bioinformatic analysis aided the identification and mapping of the resistance mobilome and the T6SS gene clusters (T6SS1 and T6SS3) in K. pneumoniae to further enhanced insight on how these virulence-associated regions shape the genome and pathogenicity of K. pneumoniae. Notably, the content and context of T6SS gene clusters in K. pneumoniae are highly conserved and suggest a similar common evolutionary event. The various tools within the genetic library constructed using a novel DNA swapping technique provided a flexible and applicable range of molecular genetic tools for the deletion of the mapped resistance mobilome or T6SS gene clusters in K. pneumoniae.
K. pneumoniae T6SS promoted antibacterial competitive fitness against other bacteria, horizontal mobilization of mobile genetic elements such as plasmids, type 1 and 3 fimbria-mediate biofilm formation, phagocytic and serum bactericidal resistance. The T6SS mediated anti-phagocytic virulence is probably enable K. pneumoniae survival in the environment (soil and water) and host.
K. pneumoniae T6SS induces invasion, survival and actin filament / cytoskeletal rearrangement in host cells. The various T6SS gene cluster stimulated differential expression pro-inflammatory innate immune response in target host cells. Loss of T6SS gene clusters inhibited K. pneumoniae T6SS-induced melanisation, in vivo bacterial competition and survival, and mortality in Galleria larva, thereby signifying attenuated in vivo virulence stimulated by the T6SS mutants.
223 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 7: Conclusion
The differential plasmid mobilization frequencies, antibacterial, in vitro and in vivo virulence mediated by T6SS1 and T6SS3 gene clusters suggest that the various K. pneumoniae T6SS gene clusters within the same genome may independently secrete different effectors for a different function. Also, mutation of T6SS gene clusters that significantly impacted the expression of T4SS, type 1 and 3 fimbriae emphasizing the potential tight co-regulation of other virulent factors and T6SS expression in K. pneumoniae.
7.2 Future work
As it is the case for most research work, many aspects of this research were limited by several factors such as time, resources and technical expertise. These factors, together with other bacterial strain intrinsic problem and limited knowledge on various aspects of this research, impeded the progress of the project. Thus, the following aspects of the project will be investigated in the future to advance the understanding of this research;
1. To optimize the novel DNA/gene swapping technique for maker-less chromosomal gene complementation. 2. To design a novel single-step markerless deletion of the large pathogenic island (e,g T6SS) as well as capture such large pathogenic islands in plasmid for T6SS mobilization and functional studies. 3. To perform in-depth T6SS bioinformatic analysis and experimental assays to elucidate the mechanism responsible for the co-regulation of how T6SS gene clusters and other virulence factors. 4. To investigate the mechanism underpinning specific antibiotic resistance virulence in K. pneumoniae and other bacteria. 5. To generate express Hcp1, VgrG1 and Hcp2 and VgrG3 protein of T6SS1 and T6SS3 clusters at under various conditions. 6. To generate hcp1 vgrG1, hcp2 and vgrG3 mutant and assess their specific role in antibacterial and in vivo virulence. 7. To tag expressing T6SS1 and T6SS3 with a separate fluorescent protein and capture T6SS in action during interaction with other bacteria, amoeba and host cells. 8. To determine the various T6SS secreted effectors that are translocated with VgrG during virulence-targeting of host and bacteria. 9. To design new assays to measure virulence mediated by T6SS and other virulent factors in bacteria.
224 David Mwin Ph.D. Thesis, “The role of Type VI secretion system in the virulence of Klebsiella pneumoniae”, University of Leicester, UK. Chapter 7: Conclusion
10. To measure T6SS mediated antibacterial virulence in gut, nasopharyngeal and urinary tract complex microbial communities. 11. To assess bacterial T6SS mediated resistance to viral genomic integration and predation 12. Re-examine T6SS gene cluster in K. pneumoniae NTUH-K2044 to create T6SS3 and T6SS1/T6SS3 mutants and perform functional studies in the hyper mucoid strain.
225 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Bibliography
Abbott S. (ed.) (2007) Klebsiella, Enterobacter, Citrobacter, and Serratia. In, Murray PR (Ed), Manual of Clinical Microbiology . 9th Ed edn. Washington DC: ASM Press.
Abbott, S. (2003) '44. Klebsiella, Enterobacter, Citrobacter, Serratia, Plesiomonas, and other Enterobacteriaceae. W: Manual of clinical microbiology, Murray PR i in', ASM Press, Washington, DC, 1, pp. 684-700.
Abe, Y., El-Masri, B., Kimball, K.T., Pownall, H., Reilly, C.F., Osmundsen, K., Smith, C.W. and Ballantyne, C.M. (1998) 'Soluble cell adhesion molecules in hypertriglyceridemia and potential significance on monocyte adhesion', Arteriosclerosis, Thrombosis, and Vascular Biology, 18(5), pp. 723-731.
Abrusci, P., McDowell, M.A., Lea, S.M. and Johnson, S. (2014) 'Building a secreting nanomachine: a structural overview of the T3SS', Current opinion in structural biology, 25, pp. 111-117.
Adams, D.O. and Hamilton, T.A. (1984) 'The cell biology of macrophage activation', Annual Review of Immunology, 2(1), pp. 283-318.
Ah, Y., Kim, A. and Lee, J. (2014) 'Colistin resistance in Klebsiella pneumoniae', International journal of antimicrobial agents, 44(1), pp. 8-15.
Akira, S., Taga, T. and Kishimoto, T. (1993) 'Interleukin-6 in biology and medicine', in Anonymous Advances in immunology. Elsevier, pp. 1-78.
Alam, R., Stafford, S., Forsythe, P., Harrison, R., Faubion, D., Lett-Brown, M.A. and Grant, J.A. (1993) 'RANTES is a chemotactic and activating factor for human eosinophils', Journal of immunology (Baltimore, Md.: 1950), 150(8 Pt 1), pp. 3442-3448.
Alcántar-Curiel, M.D., Blackburn, D., Saldaña, Z., Gayosso-Vázquez, C., Iovine, N.M., De la Cruz, M.A. and Girón, J.A. (2013) 'Multi-functional analysis of Klebsiella pneumoniae fimbrial types in adherence and biofilm formation', Virulence, 4(2), pp. 129-138.
Alcoforado Diniz, J., Liu, Y. and Coulthurst, S.J. (2015) 'Molecular weaponry: diverse effectors delivered by the Type VI secretion system', Cellular microbiology, 17(12), pp. 1742-1751.
Alcoforado Diniz, J. and Coulthurst, S.J. (2015) 'Intraspecies Competition in Serratia marcescens Is Mediated by Type VI-Secreted Rhs Effectors and a Conserved Effector-Associated Accessory Protein', Journal of Bacteriology, 197(14), pp. 2350-2360.
Al-Husseiny, K.R. and Nakkash, A.F. (2008) 'Study Some Virulence Factors of Klebsiella pneumoniae Isolated From Clinical Sources', J.Thi-Qar Univ, 4(3), pp. 45-50.
Alsam, S., Jeong, S.R., Sissons, J., Dudley, R., Kim, K.S. and Khan, N.A. (2006) 'Escherichia coli interactions with Acanthamoeba: a symbiosis with environmental and clinical implications', Journal of medical microbiology, 55(6), pp. 689-694.
226 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Alteri, C.J., Himpsl, S.D., Pickens, S.R., Lindner, J.R., Zora, J.S., Miller, J.E., Arno, P.D., Straight, S.W. and Mobley, H.L. (2013) 'Multicellular bacteria deploy the type VI secretion system to preemptively strike neighboring cells', PLoS pathogens, 9(9), pp. e1003608.
Altincicek, B., Linder, M., Linder, D., Preissner, K.T. and Vilcinskas, A. (2007) 'Microbial metalloproteinases mediate sensing of invading pathogens and activate innate immune responses in the lepidopteran model host Galleria mellonella', Infection and immunity, 75(1), pp. 175-183.
Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. (1997) 'Gapped BLAST and PSI-BLAST: a new generation of protein database search programs', Nucleic acids research, 25(17), pp. 3389-3402.
Alvarez-Martinez, C.E. and Christie, P.J. (2009) 'Biological diversity of prokaryotic type IV secretion systems', Microbiology and molecular biology reviews : MMBR, 73(4), pp. 775-808.
Angiolillo, A.L., Sgadari, C., Taub, D.D., Liao, F., Farber, J.M., Maheshwari, S., Kleinman, H.K., Reaman, G.H. and Tosato, G. (1995) 'Human interferon-inducible protein 10 is a potent inhibitor of angiogenesis in vivo', The Journal of experimental medicine, 182(1), pp. 155-162.
Appay, V. and Rowland-Jones, S.L. (2001) 'RANTES: a versatile and controversial chemokine', Trends in immunology, 22(2), pp. 83-87.
Aschtgen, M., Thomas, M.S. and Cascales, E. (2010) 'Anchoring the type VI secretion system to the peptidoglycan TssL, TagL, TagP,... what else?', Virulence, 1(6), pp. 535-540.
Aschtgen, M.S., Bernard, C.S., De Bentzmann, S., Lloubes, R. and Cascales, E. (2008) 'SciN is an outer membrane lipoprotein required for type VI secretion in enteroaggregative Escherichia coli', Journal of Bacteriology, 190(22), pp. 7523-7531.
Aubert, D.F., Flannagan, R.S. and Valvano, M.A. (2008a) 'A novel sensor kinase-response regulator hybrid controls biofilm formation and type VI secretion system activity in Burkholderia cenocepacia', Infection and immunity, 76(5), pp. 1979-1991.
BAER, H. and EHRENWORTH, L. (1956) 'The pathogenicity of Klebsiella pneumoniae for mice: the relationship to the quantity and rate of production of type-specific capsular polysaccharide', Journal of Bacteriology, 72(5), pp. 713-717.
Bagley, S.T. (1985) 'Habitat association of Klebsiella species', Infection control, 6(02), pp. 52-58.
Bailey, J.K., Pinyon, J.L., Anantham, S. and Hall, R.M. (2011) 'Distribution of the bla TEM gene and bla TEM-containing transposons in commensal Escherichia coli', Journal of antimicrobial chemotherapy, 66(4), pp. 745-751.
Balakrishnan, L., Hughes, C. and Koronakis, V. (2001) 'Substrate-triggered recruitment of the TolC channel-tunnel during type I export of hemolysin by Escherichia coli', Journal of Molecular Biology, 313(3), pp. 501-510.
Baldi, D.L., Higginson, E.E., Hocking, D.M., Praszkier, J., Cavaliere, R., James, C.E., Bennett-Wood, V., Azzopardi, K.I., Turnbull, L., Lithgow, T., Robins-Browne, R.M., Whitchurch, C.B. and Tauschek,
227 David Mwin Ph.D. Thesis, University of Leicester, UK. References
M. (2012) 'The type II secretion system and its ubiquitous lipoprotein substrate, SslE, are required for biofilm formation and virulence of enteropathogenic Escherichia coli', Infection and immunity, 80(6), pp. 2042-2052.
Ballister, E.R., Lai, A.H., Zuckermann, R.N., Cheng, Y. and Mougous, J.D. (2008) 'In vitro self-assembly of tailorable nanotubes from a simple protein building block', Proceedings of the National Academy of Sciences of the United States of America, 105(10), pp. 3733-3738.
Ballows, A., Truper, H., Dworkin, M., Harder, W. and Schleifer, K. (1992) 'The prokaryotes, a handbook on the biology of bacteria: Ecophysiology, isolation, identification, applications', .
Bals, R. and Hiemstra, P.S. (2004) 'Innate immunity in the lung: how epithelial cells fight against respiratory pathogens', The European respiratory journal, 23(2), pp. 327-333.
Banville, N., Browne, N. and Kavanagh, K. (2012) 'Effect of nutrient deprivation on the susceptibility of Galleria mellonella larvae to infection', Virulence, 3(6), pp. 497-503.
Barret, M., Egan, F., Fargier, E., Morrissey, J.P. and O'Gara, F. (2011) 'Genomic analysis of the type VI secretion systems in Pseudomonas spp.: Novel clusters and putative effectors uncovered', Microbiology, 157(6), pp. 1726-1739.
Bartonickova, L., Sterzenbach, T., Nell, S., Kops, F., Schulze, J., Venzke, A., Brenneke, B., Bader, S., Gruber, A.D., Suerbaum, S. and Josenhans, C. (2013) 'Hcp and VgrG1 are secreted components of the Helicobacter hepaticus type VI secretion system and VgrG1 increases the bacterial colitogenic potential', Cellular microbiology, 15(6), pp. 992-1011.
Basler, á, Pilhofer, M., Henderson, G., Jensen, G. and Mekalanos, J. (2012a) 'Type VI secretion requires a dynamic contractile phage tail-like structure', Nature, 483(7388), pp. 182-186.
Basler, M. and Mekalanos, J.J. (2012) 'Type 6 secretion dynamics within and between bacterial cells', Science (New York, N.Y.), 337(6096), pp. 815.
Basler, M., Pilhofer, M., Henderson, G.P., Jensen, G.J. and Mekalanos, J.J. (2012b) 'Type VI secretion requires a dynamic contractile phage tail-like structure', Nature, 483(7388), pp. 182.
Beceiro, A., Tomas, M. and Bou, G. (2013) 'Antimicrobial resistance and virulence: a successful or deleterious association in the bacterial world?', Clinical microbiology reviews, 26(2), pp. 185-230.
Beeckman, D. and Vanrompay, D. (2010) 'Bacterial secretion systems with an emphasis on the chlamydial Type III secretion system', Curr Issues Mol Biol, 12(1), pp. 17-41.
Benge, G.R. (1988) 'Bactericidal activity of human serum against strains of Klebsiella from different sources', Journal of medical microbiology, 27(1), pp. 11.
Bergey, D.H., Harrison F.C., Breed, R.S., Hammer, B.W. and Huntoon F.M. (1925) Bergey’s Manual of Determinative Bacteriology. 1st edn. Baltimore, MD: W illiams and Wilkins.
228 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Bergin, D., Reeves, E.P., Renwick, J., Wientjes, F.B. and Kavanagh, K. (2005) 'Superoxide production in Galleria mellonella hemocytes: identification of proteins homologous to the NADPH oxidase complex of human neutrophils', Infection and immunity, 73(7), pp. 4161-4170.
Bernard, C.S., Brunet, Y.R., Gavioli, M., Lloubès, R. and Cascales, E. (2011) 'Regulation of type VI Secretion gene clusters by σ 54 and cognate enhancer binding proteins', Journal of Bacteriology, 193(9), pp. 2158-2167.
Bernstein, H.D. (2007) 'Are bacterial ‘autotransporters’ really transporters?', Trends in microbiology, 15(10), pp. 441-447.
Besemer, J., Lomsadze, A. and Borodovsky, M. (2001) 'GeneMarkS: a self-training method for prediction of gene starts in microbial genomes. Implications for finding sequence motifs in regulatory regions', Nucleic acids research, 29(12), pp. 2607.
Beyrouthy, R., Robin, F., Dabboussi, F., Mallat, H., Hamze, M. and Bonnet, R. (2014) 'Carbapenemase and virulence factors of Enterobacteriaceae in North Lebanon between 2008 and 2012: evolution via endemic spread of OXA-48', The Journal of antimicrobial chemotherapy, 69(10), pp. 2699-2705.
Bhatty, M., Gomez, J.A.L. and Christie, P.J. (2013) 'The expanding bacterial type IV secretion lexicon', Research in microbiology, 164(6), pp. 620-639.
Bi, D., Jiang, X., Sheng, Z.K., Ngmenterebo, D., Tai, C., Wang, M., Deng, Z., Rajakumar, K. and Ou, H.Y. (2015) 'Mapping the resistance-associated mobilome of a carbapenem-resistant Klebsiella pneumoniae strain reveals insights into factors shaping these regions and facilitates generation of a 'resistance-disarmed' model organism', The Journal of antimicrobial chemotherapy, .
Bi, D., Xu, Z., Harrison, E.M., Tai, C., Wei, Y., He, X., Jia, S., Deng, Z., Rajakumar, K. and Ou, H.Y. (2012) 'ICEberg: a web-based resource for integrative and conjugative elements found in Bacteria', Nucleic acids research, 40(Database issue), pp. D621-6.
Bialek-Davenet, S., Lavigne, J.P., Guyot, K., Mayer, N., Tournebize, R., Brisse, S., Leflon-Guibout, V. and Nicolas-Chanoine, M.H. (2015) 'Differential contribution of AcrAB and OqxAB efflux pumps to multidrug resistance and virulence in Klebsiella pneumoniae', The Journal of antimicrobial chemotherapy, 70(1), pp. 81-88.
Bikandi, J., San Millán, R., Rementeria, A. and Garaizar, J. (2004) 'In silico analysis of complete bacterial genomes: PCR, AFLP-PCR and endonuclease restriction', Bioinformatics (Oxford, England), 20(5), pp. 798.
Bingle, L.E., Bailey, C.M. and Pallen, M.J. (2008) 'Type VI secretion: a beginner's guide', Current opinion in microbiology, 11(1), pp. 3-8.
Bistué, A.J.S., Birshan, D., Tomaras, A.P., Dandekar, M., Tran, T., Newmark, J., Bui, D., Gupta, N., Hernandez, K. and Sarno, R. (2008) 'Klebsiella pneumoniae multiresistance plasmid pMET1: similarity with the Yersinia pestis plasmid pCRY and integrative conjugative elements', PloS one, 3(3), pp. e1800.
229 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Bladergroen, M., Badelt, K. and Spaink, H. (2003) 'Infection-blocking genes of a symbiotic Rhizobium leguminosarum strain that are involved in temperature-dependent protein secretion', Molecular Plant-Microbe Interactions, 16(1), pp. 53-64.
Bleves, S., Viarre, V., Salacha, R., Michel, G.P.F., Filloux, A. and Voulhoux, R. (2010) 'Protein secretion systems in Pseudomonas aeruginosa: A wealth of pathogenic weapons', International Journal of Medical Microbiology, 300(8), pp. 534-543.
Blokesch, M. (2015a) 'Competence‐induced type VI secretion might foster intestinal colonization by Vibrio cholerae', BioEssays, 37(11), pp. 1163-1168.
Blokesch, M. (2015b) 'Competence-induced type VI secretion might foster intestinal colonization by Vibrio cholerae: Intestinal interbacterial killing by competence-induced V. cholerae', BioEssays : news and reviews in molecular, cellular and developmental biology, 37(11), pp. 1163.
Blondel, C.J., Yang, H.-., Castro, B., Chiang, S., Toro, C.S., Zaldïvar, M., Contreras, I., Andrews- Polymenis, H.L. and Santiviago, C.A. (2010) 'Contribution of the type VI secretion system encoded in SPI-19 to chicken colonization by Salmonella enterica serotypes Gallinarum and enteritidis', PLoS ONE, 5(7).
Boddicker, J.D., Anderson, R.A., Jagnow, J. and Clegg, S. (2006) 'Signature-Tagged Mutagenesis of Klebsiella pneumoniae To Identify Genes That Influence Biofilm Formation on Extracellular Matrix Material', Infection and immunity, 74(8), pp. 4590-4597.
Bönemann, G., Pietrosiuk, A. and Mogk, A. (2010) 'Tubules and donuts: A type VI secretion story: MicroReview', Molecular microbiology, 76(4), pp. 815-821.
Borgeaud, S., Metzger, L.C., Scrignari, T. and Blokesch, M. (2015a) 'The type VI secretion system of Vibrio cholerae fosters horizontal gene transfer', Science, 347(6217), pp. 63-67.
Borgeaud, S., Metzger, L.C., Scrignari, T. and Blokesch, M. (2015b) 'The type VI secretion system of Vibrio cholerae fosters horizontal gene transfer', Science, 347(6217), pp. 63-67.
Borgeaud, S., Metzger, L.C., Scrignari, T. and Blokesch, M. (2015c) 'The type VI secretion system of Vibrio cholerae fosters horizontal gene transfer', Science, 347(6217), pp. 63-67.
Boucher, H.W., Talbot, G.H., Bradley, J.S., Edwards, J.E., Gilbert, D., Rice, L.B., Scheld, M., Spellberg, B. and Bartlett, J. (2009) 'Bad bugs, no drugs: no ESKAPE! An update from the Infectious Diseases Society of America', Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 48(1), pp. 1-12.
Boye, K. and Hansen, D.S. (2003) 'Sequencing of 16S rDNA of Klebsiella: taxonomic relations within the genus and to other Enterobacteriaceae', International journal of medical microbiology, 292(7), pp. 495-503.
Boyer, F., Fichant, G., Berthod, J., Vandenbrouck, Y. and Attree, I. (2009a) 'Dissecting the bacterial type VI secretion system by a genome wide in silico analysis: what can be learned from available microbial genomic resources?', BMC genomics, 10, pp. 104-2164-10-104.
230 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Boyer, F., Fichant, G., Berthod, J., Vandenbrouck, Y. and Attree, I. (2009b) 'Dissecting the bacterial type VI secretion system by a genome wide in silico analysis: what can be learned from available microbial genomic resources?', BMC genomics, 10, pp. 104-2164-10-104.
Boyer, W.H. and Roullard Dessoix, D. (1969) Journal of Molecular Biology, 41, pp. 459-472.
Braiteh, F. and Golden, M.P. (2007) 'Cryptogenic invasive Klebsiella pneumoniae liver abscess syndrome', International journal of infectious diseases, 11(1), pp. 16-22.
Brandon, L.D., Goehring, N., Janakiraman, A., Yan, A.W., Wu, T., Beckwith, J. and Goldberg, M.B. (2003) 'IcsA, a polarly localized autotransporter with an atypical signal peptide, uses the Sec apparatus for secretion, although the Sec apparatus is circumferentially distributed', Molecular microbiology, 50(1), pp. 45-60.
Brisse, S., Grimont, F. and Grimont, P.A. (2006) 'The Genus Klebsiella', in Anonymous The Prokaryotes. Springer, pp. 159-196.
Brisse, S. and Verhoef, J. (2001a) 'Phylogenetic diversity of Klebsiella pneumoniae and Klebsiella oxytoca clinical isolates revealed by randomly amplified polymorphic DNA, gyrA and parC genes sequencing and automated ribotyping.', International Journal of Systematic and Evolutionary Microbiology, 51(3), pp. 915-924.
Brisse, S. and Verhoef, J. (2001b) 'Phylogenetic diversity of Klebsiella pneumoniae and Klebsiella oxytoca clinical isolates revealed by randomly amplified polymorphic DNA, gyrA and parC genes sequencing and automated ribotyping.', International Journal of Systematic and Evolutionary Microbiology, 51(3), pp. 915-924.
Brisse, S., Issenhuth-Jeanjean, S. and Grimont, P.A.D. (2004) 'Molecular Serotyping of Klebsiella Species Isolates by Restriction of the Amplified Capsular Antigen Gene Cluster', Journal of clinical microbiology, 42(8), pp. 3388.
Brito, B.E., O’Rourke, L.M., Pan, Y., Anglin, J., Planck, S.R. and Rosenbaum, J.T. (1999) 'IL-1 and TNF receptor–deficient mice show decreased inflammation in an immune complex model of uveitis', Investigative ophthalmology & visual science, 40(11), pp. 2583-2589.
Brock, J.H., Williams, P.H., Liceaga, J. and Wooldridge, K.G. (1991) 'Relative availability of transferrin- bound iron and cell-derived iron to aerobactin-producing and enterochelin-producing strains of Escherichia coli and to other microorganisms', Infection and immunity, 59(9), pp. 3185-3190.
Brodmann, M., Dreier, R.F., Broz, P. and Basler, M. (2017) 'Francisella requires dynamic type VI secretion system and ClpB to deliver effectors for phagosomal escape', Nature communications, 8, pp. 15853.
Bröms, J.E., Meyer, L., Lavander, M., Larsson, P. and Sjöstedt, A. (2012a) 'DotU and VgrG, core components of type VI secretion systems, are essential for Francisella LVS pathogenicity', PLoS ONE, 7(4).
231 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Bröms, J.E., Meyer, L., Sun, K., Lavander, M. and Sjöstedt, A. (2012b) 'Unique Substrates Secreted by the Type VI Secretion System of Francisella tularensis during Intramacrophage Infection', PLoS ONE, 7(11).
Brooks, T.M., Unterweger, D., Bachmann, V., Kostiuk, B. and Pukatzki, S. (2013) 'Lytic activity of the Vibrio cholerae type VI secretion toxin VgrG-3 is inhibited by the antitoxin TsaB', The Journal of biological chemistry, 288(11), pp. 7618-7625.
Broug-Holub, E., Toews, G.B., van Iwaarden, J.F., Strieter, R.M., Kunkel, S.L., Paine, R.,3rd and Standiford, T.J. (1997) 'Alveolar macrophages are required for protective pulmonary defenses in murine Klebsiella pneumoniae: elimination of alveolar macrophages increases neutrophil recruitment but decreases bacterial clearance and survival', Infection and immunity, 65(4), pp. 1139- 1146.
Brown, C. and Seidler, R.J. (1973) 'Potential pathogens in the environment: Klebsiella pneumoniae, a taxonomic and ecological enigma', Applied Microbiology, 25(6), pp. 900-904.
Browne, N., Surlis, C., Maher, A., Gallagher, C., Carolan, J.C., Clynes, M. and Kavanagh, K. (2015) 'Prolonged pre-incubation increases the susceptibility of Galleria mellonella larvae to bacterial and fungal infection', Virulence, 6(5), pp. 458-465.
Brunet, Y.R., Henin, J., Celia, H. and Cascales, E. (2014) 'Type VI secretion and bacteriophage tail tubes share a common assembly pathway', EMBO reports, 15(3), pp. 315-321.
Brunet, Y.R., Espinosa, L., Harchouni, S., Mignot, T. and Cascales, E. (2013a) 'Imaging type VI secretion-mediated bacterial killing', Cell reports, 3(1), pp. 36-41.
Brunet, Y.R., Espinosa, L., Harchouni, S., Mignot, T. and Cascales, E. (2013b) 'Imaging type VI secretion-mediated bacterial killing', Cell reports, 3(1), pp. 36-41.
Bullen, J., Rogers, H.J. and Griffiths, E. (1978) 'Role of iron in bacterial infection', in Anonymous Current topics in microbiology and immunology. Springer, pp. 1-35.
Bullen, J.J., Rogers, H.J., Spalding, P.B. and Ward, C.G. (2006) 'Natural resistance, iron and infection: a challenge for clinical medicine', Journal of medical microbiology, 55(3), pp. 251-258.
Bullen, J., Griffiths, E., Rogers, H. and Ward, G. (2000) 'Sepsis: the critical role of iron', Microbes and Infection, 2(4), pp. 409-415.
Buré, A., Legrand, P., Arlet, G., Jarlier, V., Paul, G. and Philippon, A. (1988) 'Dissemination in five French hospitals of Klebsiella pneumoniae serotype K25 harbouring a new transferable enzymatic resistance to third generation cephalosporins and aztreonam', European Journal of Clinical Microbiology and Infectious Diseases, 7(6), pp. 780-782.
Burke, B. and Lewis, C.E. (2002) 'The macrophage', .
Burkinshaw, B.J. and Strynadka, N.C. (2014) 'Assembly and structure of the T3SS', Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1843(8), pp. 1649-1663.
232 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Burtnick, M.N., Brett, P.J., Harding, S.V., Ngugi, S.A., Ribot, W.J., Chantratita, N., Scorpio, A., Milne, T.S., Dean, R.E., Fritz, D.L., Peacock, S.J., Prior, J.L., Atkins, T.P. and DeShazer, D. (2011) 'The cluster 1 type VI secretion system is a major virulence determinant in Burkholderia pseudomallei', Infection and immunity, 79(4), pp. 1512-1525.
Burtnick, M.N., DeShazer, D., Nair, V., Gherardini, F.C. and Brett, P.J. (2010) 'Burkholderia mallei cluster 1 type VI secretion mutants exhibit growth and actin polymerization defects in RAW 264.7 murine macrophages', Infection and immunity, 78(1), pp. 88-99.
Bush, K. (2012) 'Improving known classes of antibiotics: an optimistic approach for the future', Current opinion in pharmacology, 12(5), pp. 527-534.
Buttner, D. (2012) 'Protein export according to schedule: architecture, assembly, and regulation of type III secretion systems from plant- and animal-pathogenic bacteria', Microbiology and molecular biology reviews : MMBR, 76(2), pp. 262-310.
Bystry, R.S., Aluvihare, V., Welch, K.A., Kallikourdis, M. and Betz, A.G. (2001) 'B cells and professional APCs recruit regulatory T cells via CCL4', Nature immunology, 2(12), pp. 1126.
Cain, A.K. and Hall, R.M. (2012) 'Evolution of a multiple antibiotic resistance region in IncHI1 plasmids: reshaping resistance regions in situ', Journal of antimicrobial chemotherapy, 67(12), pp. 2848-2853.
Calandra, T. and Roger, T. (2003) 'Macrophage migration inhibitory factor: a regulator of innate immunity', Nature reviews immunology, 3(10), pp. 791.
Calhau, Vera Mónica Tavares Vinhas (2015) 'Virulence factors associated with antimicrobial resistance determinants among Escherichia coli and Klebsiella spp', .
Campos, M.A., Vargas, M.A., Regueiro, V., Llompart, C.M., Alberti, S. and Bengoechea, J.A. (2004a) 'Capsule polysaccharide mediates bacterial resistance to antimicrobial peptides', Infection and immunity, 72(12), pp. 7107-7114.
Campos, M.A., Vargas, M.A., Regueiro, V., Llompart, C.M., Alberti, S. and Bengoechea, J.A. (2004b) 'Capsule Polysaccharide Mediates Bacterial Resistance to Antimicrobial Peptides', Infection and immunity, 72(12), pp. 7107.
Cannatelli, A., D'Andrea, M.M., Giani, T., Di Pilato, V., Arena, F., Ambretti, S., Gaibani, P. and Rossolini, G.M. (2013) 'In vivo emergence of colistin resistance in Klebsiella pneumoniae producing KPC-type carbapenemases mediated by insertional inactivation of the PhoQ/PhoP mgrB regulator', Antimicrobial Agents and Chemotherapy, 57(11), pp. 5521-5526.
Caplenas, N.R., Kanarek, M.S. and Dufour, A.P. (1981) 'Source and extent of Klebsiella pneumoniae in the paper industry', Applied and Environmental Microbiology, 42(5), pp. 779-785.
Carpenter, J.L. (1990) 'Klebsiella pulmonary infections: occurrence at one medical center and review', Review of Infectious Diseases, 12(4), pp. 672-682.
233 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Carr, M.W., Roth, S.J., Luther, E., Rose, S.S. and Springer, T.A. (1994) 'Monocyte chemoattractant protein 1 acts as a T-lymphocyte chemoattractant', Proceedings of the National Academy of Sciences of the United States of America, 91(9), pp. 3652-3656.
Carruthers, M.D., Nicholson, P.A., Tracy, E.N. and Munson, J.,Robert S. (2013) 'Acinetobacter baumannii utilizes a type VI secretion system for bacterial competition', PloS one, 8(3), pp. e59388.
Cascales, E. (2008) 'The type VI secretion toolkit', EMBO reports, 9(8), pp. 735-741.
Cascales, E. and Cambillau, C. (2012a) 'Structural biology of type VI secretion systems', Philosophical transactions of the Royal Society of London.Series B, Biological sciences, 367(1592), pp. 1102- 1111.
Cascales, E. and Cambillau, C. (2012b) 'Structural biology of type VI secretion systems', Philosophical Transactions of the Royal Society B: Biological Sciences, 367(1592), pp. 1102-1111.
Chang, S., Fang, C., Hsueh, P., Chen, Y. and Luh, K. (2000) 'Klebsiella pneumoniae isolates causing liver abscess in Taiwan', Diagnostic microbiology and infectious disease, 37(4), pp. 279-284.
Chang, F.Y. and Chou, M.Y. (1995) 'Comparison of pyogenic liver abscesses caused by Klebsiella pneumoniae and non-K. pneumoniae pathogens', Journal of the Formosan Medical Association = Taiwan yi zhi, 94(5), pp. 232-237.
Chaplin, D.D. (2010) 'Overview of the immune response', Journal of Allergy and Clinical Immunology, 125(2), pp. S3-S23.
Chaplin, D.D. (2006) '1. Overview of the human immune response', Journal of allergy and clinical immunology, 117(2), pp. S430-S435.
Chaveroche, M., Ghigo, J. and d’Enfert, C. (2000) 'A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans', Nucleic acids research, 28(22), pp. e97-e97.
Chawla, R. (2008) 'Epidemiology, etiology, and diagnosis of hospital-acquired pneumonia and ventilator- associated pneumonia in Asian countries', American Journal of Infection Control, 36(4), pp. S93- S100.
Chekabab, S.M., Daigle, F., Charette, S.J., Dozois, C.M. and Harel, J. (2012) 'Survival of enterohemorrhagic Escherichia coli in the presence of Acanthamoeba castellanii and its dependence on Pho regulon', MicrobiologyOpen, 1(4), pp. 427-437.
Chen, Z., Liu, M., Cui, Y., Wang, L., Zhang, Y., Qiu, J., Yang, R., Liu, C. and Zhou, D. (2014a) 'A novel PCR-based genotyping scheme for clinical Klebsiella pneumoniae', Future microbiology, 9(1), pp. 21-32.
Chen, J.H., Siu, L.K., Fung, C.P., Lin, J.C., Yeh, K.M., Chen, T.L., Tsai, Y.K. and Chang, F.Y. (2010) 'Contribution of outer membrane protein K36 to antimicrobial resistance and virulence in Klebsiella pneumoniae', The Journal of antimicrobial chemotherapy, 65(5), pp. 986-990.
234 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Chen, L., Mathema, B., Pitout, J.D., DeLeo, F.R. and Kreiswirth, B.N. (2014b) 'Epidemic Klebsiella pneumoniae ST258 is a hybrid strain', mBio, 5(3), pp. e01355-14.
Chen, L., Zou, Y., She, P. and Wu, Y. (2015) 'Composition, function, and regulation of T6SS in Pseudomonas aeruginosa', Microbiological research, 172, pp. 19.
Cheng, W., Shivshankar, P., Zhong, Y., Chen, D., Li, Z. and Zhong, G. (2008) 'Intracellular interleukin- 1alpha mediates interleukin-8 production induced by Chlamydia trachomatis infection via a mechanism independent of type I interleukin-1 receptor', Infection and immunity, 76(3), pp. 942-951.
Chieng, S., Mohamed, R. and Nathan, S. (2015) 'Transcriptome analysis of Burkholderia pseudomallei T6SS identifies Hcp1 as a potential serodiagnostic marker', Microbial pathogenesis, 79, pp. 47-56.
Chiu, C., Lin, D. and Liaw, Y. (1988) 'Metastatic septic endophthalmitis in pyogenic liver abscess.', Journal of clinical gastroenterology, 10(5), pp. 524-527.
Choi, K.H., Gaynor, J.B., White, K.G., Lopez, C., Bosio, C.M., Karkhoff-Schweizer, R.R. and Schweizer, H.P. (2005) 'A Tn7-based broad-range bacterial cloning and expression system', Nature methods, 2(6), pp. 443-448.
Choi, M.J. and Ko, K.S. (2015) 'Loss of hypermucoviscosity and increased fitness cost in colistin- resistant Klebsiella pneumoniae sequence type 23 strains', Antimicrobial Agents and Chemotherapy, 59(11), pp. 6763-6773.
Chou, H.C., Lee, C.Z., Ma, L.C., Fang, C.T., Chang, S.C. and Wang, J.T. (2004) 'Isolation of a chromosomal region of Klebsiella pneumoniae associated with allantoin metabolism and liver infection', Infection and immunity, 72(7), pp. 3783-3792.
Chow, J. and Mazmanian, S.K. (2010) 'A pathobiont of the microbiota balances host colonization and intestinal inflammation', Cell Host and Microbe, 7(4), pp. 265-276.
Christie, P.J. and Cascales, E. (2005) 'Structural and dynamic properties of bacterial type IV secretion systems (review)', Molecular membrane biology, 22(1-2), pp. 51-61.
Christie, P.J., Whitaker, N. and González-Rivera, C. (2014) 'Mechanism and structure of the bacterial type IV secretion systems', Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1843(8), pp. 1578-1591.
Chung, D., Lee, S., Lee, H., Kim, H., Choi, H., Eom, J., Kim, J., Choi, Y., Lee, J. and Chung, M. (2007) 'Emerging invasive liver abscess caused by K1 serotype Klebsiella pneumoniae in Korea', Journal of Infection, 54(6), pp. 578-583.
Cianciotto, N.P. (2013) 'Type II secretion and Legionella virulence', in Anonymous Molecular Mechanisms in Legionella Pathogenesis. Springer, pp. 81-102.
Cianciotto, N.P. (2005) 'Type II secretion: a protein secretion system for all seasons', Trends in microbiology, 13(12), pp. 581-588.
235 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Clements, A., Tull, D., Jenney, A.W., Farn, J.L., Kim, S.H., Bishop, R.E., McPhee, J.B., Hancock, R.E., Hartland, E.L., Pearse, M.J., Wijburg, O.L., Jackson, D.C., McConville, M.J. and Strugnell, R.A. (2007) 'Secondary acylation of Klebsiella pneumoniae lipopolysaccharide contributes to sensitivity to antibacterial peptides', The Journal of biological chemistry, 282(21), pp. 15569-15577.
Cornelis, G.R. (2006) 'The type III secretion injectisome', Nature Reviews Microbiology, 4(11), pp. 811- 825.
Cortes, G., Alvarez, D., Saus, C. and Alberti, S. (2002a) 'Role of lung epithelial cells in defense against Klebsiella pneumoniae pneumonia', Infection and immunity, 70(3), pp. 1075-1080.
Cortes, G., Borrell, N., de Astorza, B., Gomez, C., Sauleda, J. and Alberti, S. (2002b) 'Molecular analysis of the contribution of the capsular polysaccharide and the lipopolysaccharide O side chain to the virulence of Klebsiella pneumoniae in a murine model of pneumonia', Infection and immunity, 70(5), pp. 2583-2590.
Costa, T.R., Felisberto-Rodrigues, C., Meir, A., Prevost, M.S., Redzej, A., Trokter, M. and Waksman, G. (2015) 'Secretion systems in Gram-negative bacteria: structural and mechanistic insights', Nature reviews.Microbiology, 13(6), pp. 343-359.
Cotton, M., Wasserman, E., Pieper, C., Theron, D., Van Tubbergh, D., Campbell, G., Fang, F. and Barnes, J. (2000) 'Invasive disease due to extended spectrum beta-lactamase-producing Klebsiella pneumoniae in a neonatal unit: the possible role of cockroaches', Journal of Hospital Infection, 44(1), pp. 13-17.
Coulthurst, S.J. (2013) 'The Type VI secretion system - a widespread and versatile cell targeting system', Research in microbiology, 164(6), pp. 640.
Cox, B.L., Schiffer, H., Dagget Jr, G., Beierschmitt, A., Sithole, F., Lee, E., Revan, F., Halliday- Simmonds, I., Beeler-Marfisi, J. and Palmour, R. (2015) 'Resistance of Klebsiella pneumoniae to the innate immune system of African green monkeys', Veterinary microbiology, 176(1-2), pp. 134-142.
Craig-Mylius, K.A. and Weiss, A.A. (1999) 'Mutants in the ptlA-H genes of Bordetella pertussis are deficient for pertussis toxin secretion', FEMS microbiology letters, 179(2), pp. 479-484.
Cryz, S.J.,Jr, Furer, F. and Germanier, R. (1984) 'Experimental Klebsiella pneumoniae burn wound sepsis: role of capsular polysaccharide', Infection and immunity, 43(1), pp. 440-441.
Cryz, S.J.,Jr, Mortimer, P.M., Mansfield, V. and Germanier, R. (1986) 'Seroepidemiology of Klebsiella bacteremic isolates and implications for vaccine development', Journal of clinical microbiology, 23(4), pp. 687-690.
Cubitt, C.L., Lausch, R.N. and Oakes, J.E. (1997) 'Differential induction of GRO alpha gene expression in human corneal epithelial cells and keratocytes exposed to proinflammatory cytokines.', Investigative ophthalmology & visual science, 38(6), pp. 1149-1158. da Silva, F.G., Shen, Y., Dardick, C., Burdman, S., Yadav, R.C., de Leon, A.L. and Ronald, P.C. (2004) 'Bacterial genes involved in type I secretion and sulfation are required to elicit the rice Xa21- mediated innate immune response', Molecular Plant-Microbe Interactions, 17(6), pp. 593-601.
236 David Mwin Ph.D. Thesis, University of Leicester, UK. References da Silva, G.J. and Mendonça, N. (2012) 'Association between antimicrobial resistance and virulence in Escherichia coli', Virulence, 3(1), pp. 18-28.
Dalbey, R.E. and Kuhn, A. (2012) 'Protein traffic in Gram-negative bacteria--how exported and secreted proteins find their way', FEMS microbiology reviews, 36(6), pp. 1023-1045.
Darfeuille-Michaud, A., Jallat, C., Aubel, D., Sirot, D., Rich, C., Sirot, J. and Joly, B. (1992) 'R-plasmid- encoded adhesive factor in Klebsiella pneumoniae strains responsible for human nosocomial infections', Infection and immunity, 60(1), pp. 44-55.
Das, S. and Chaudhuri, K. (2003) 'Identification of a unique IAHP (IcmF associated homologous proteins) cluster in Vibrio cholerae and other proteobacteria through in silico analysis', In silico biology, 3(3), pp. 287-300.
Das, S., Chakrabortty, A., Banerjee, R. and Chaudhuri, K. (2002) 'Involvement of in vivo induced icmF gene of Vibrio cholerae in motility, adherence to epithelial cells, and conjugation frequency', Biochemical and biophysical research communications, 295(4), pp. 922-928.
Datsenko, K.A. and Wanner, B.L. (2000) 'One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products', Proceedings of the National Academy of Sciences of the United States of America, 97(12), pp. 6640.
Davidson, N. and Szybalski, W. (1971) 'In The Bacteriophage Lambda (Hershey, AD, ed.)', Cold Spring Harbor Laboratory, New York.DNA CONDENSATION WITH POLYAMINES.II, 337, pp. 45-82.
Davis, G. and Price, L. (2016) 'Recent Research Examining Links Among Klebsiella pneumoniae from Food, Food Animals, and Human Extraintestinal Infections', Current Environmental Health Reports, 3(2), pp. 128-135. de Astorza, B., Cortes, G., Crespi, C., Saus, C., Rojo, J.M. and Alberti, S. (2004) 'C3 promotes clearance of Klebsiella pneumoniae by A549 epithelial cells', Infection and immunity, 72(3), pp. 1767-1774. de Bruin, O.M., Duplantis, B.N., Ludu, J.S., Hare, R.F., Nix, E.B., Schmerk, C.L., Robb, C.S., Boraston, A.B., Hueffer, K. and Nano, F.E. (2011) 'The biochemical properties of the Francisella pathogenicity island (FPI)-encoded proteins IglA, IglB, IglC, PdpB and DotU suggest roles in type VI secretion', Microbiology, 157(12), pp. 3483-3491.
De Bruin, O.M., Ludu, J.S. and Nano, F.E. (2007) 'The Francisella pathogenicity island protein IglA localizes to the bacterial cytoplasm and is needed for intracellular growth', BMC microbiology, 7(1), pp. 1.
De Ceuleneer, M., Vanhoucke, M. and Beyaert, R. (2015) 'Role of the bacterial type VI secretion system in the modulation of mammalian host cell immunity', Current medicinal chemistry, 22(14), pp. 1734-1744.
De Jesus, M.B., Ehlers, M.M., Dos Santos, R.F. and Kock, M.M. (2015) 'Review-Understanding β- lactamase Producing Klebsiella pneumoniae', .
237 David Mwin Ph.D. Thesis, University of Leicester, UK. References de Lorenzo, V., Cases, I., Herrero, M. and Timmis, K.N. (1993) 'Early and late responses of TOL promoters to pathway inducers: identification of postexponential promoters in Pseudomonas putida with lacZ-tet bicistronic reporters', Journal of Bacteriology, 175(21), pp. 6902-6907.
De Moraes, J. and Alfieri, S.C. (2008) 'Growth, encystment and survival of Acanthamoeba castellanii grazing on different bacteria', FEMS microbiology ecology, 66(2), pp. 221-229.
De Pace, F., Nakazato, G., Pacheco, A., De Paiva, J.B., Sperandio, V. and Da Silveira, W.D. (2010) 'The type VI secretion system plays a role in type 1 fimbria expression and pathogenesis of an avian pathogenic Escherichia coli strain', Infection and immunity, 78(12), pp. 4990-4998.
Deane, J.E., Cordes, F.S., Roversi, P., Johnson, S., Kenjale, R., Picking, W.D., Picking, W.L., Lea, S.M. and Blocker, A. (2006) 'Expression, purification, crystallization and preliminary crystallographic analysis of MxiH, a subunit of the Shigella flexneri type III secretion system needle', Acta Crystallographica Section F: Structural Biology and Crystallization Communications, 62(3), pp. 302-305.
Decoin, V., Gallique, M., Barbey, C., Le Mauff, F., Poc, C.D., Feuilloley, M.G., Orange, N. and Merieau, A. (2015) 'A Pseudomonas fluorescens type 6 secretion system is related to mucoidy, motility and bacterial competition', BMC microbiology, 15, pp. 72-015-0405-9.
Decoin, V., Barbey, C., Bergeau, D., Latour, X., Feuilloley, M.G.J., Orange, N. and Merieau, A. (2014a) 'A type VI secretion system is involved in Pseudomonas fluorescens bacterial competition', PloS one, 9(2), pp. e89411.
Decoin, V., Barbey, C., Bergeau, D., Latour, X., Marc G J Feuilloley, Orange, N. and Merieau, A. (2014b) 'A Type VI Secretion System Is Involved in Pseudomonas fluorescens Bacterial Competition: e89411', PLoS One, 9(2).
Deguchi, T., Fukuoka, A., Yasuda, M., Nakano, M., Ozeki, S., Kanematsu, E., Nishino, Y., Ishihara, S., Ban, Y. and Kawada, Y. (1997) 'Alterations in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in quinolone-resistant clinical isolates of Klebsiella pneumoniae', Antimicrobial Agents and Chemotherapy, 41(3), pp. 699-701.
Delepelaire, P. (2004) 'Type I secretion in gram-negative bacteria', Biochimica et Biophysica Acta (BBA)- Molecular Cell Research, 1694(1), pp. 149-161.
Demers, J., Habenstein, B., Loquet, A., Vasa, S.K., Giller, K., Becker, S., Baker, D., Lange, A. and Sgourakis, N.G. (2014) 'High-resolution structure of the Shigella type-III secretion needle by solid- state NMR and cryo-electron microscopy', Nature communications, 5.
Dereeper, A., Guignon, V., Blanc, G., Audic, S., Buffet, S., Chevenet, F., Dufayard, J., Guindon, S., Lefort, V., Lescot, M., Claverie, J. and Gascuel, O. (2008) 'Phylogeny.fr: robust phylogenetic analysis for the non-specialist', Nucleic acids research, 36, pp. W465.
Dereeper, A., Audic, S., Claverie, J. and Blanc, G. (2010) 'BLAST-EXPLORER helps you building datasets for phylogenetic analysis', BMC Evolutionary Biology, 10(1), pp. 8-8.
238 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Despalins, A., Marsit, S. and Oberto, J. (2011) 'Absynte: a web tool to analyze the evolution of orthologous archaeal and bacterial gene clusters', Bioinformatics (Oxford, England), 27(20), pp. 2905.
Di Martino, P., Bertin, Y., Girardeau, J.P., Livrelli, V., Joly, B. and Darfeuille-Michaud, A. (1995) 'Molecular characterization and adhesive properties of CF29K, an adhesin of Klebsiella pneumoniae strains involved in nosocomial infections', Infection and immunity, 63(11), pp. 4336-4344.
Di Martino, P., Livrelli, V., Sirot, D., Joly, B. and Darfeuille-Michaud, A. (1996) 'A new fimbrial antigen harbored by CAZ-5/SHV-4-producing Klebsiella pneumoniae strains involved in nosocomial infections', Infection and immunity, 64(6), pp. 2266-2273.
Di Paolo, N.C., Shafiani, S., Day, T., Papayannopoulou, T., Russell, D.W., Iwakura, Y., Sherman, D., Urdahl, K. and Shayakhmetov, D.M. (2015) 'Interdependence between interleukin-1 and tumor necrosis factor regulates TNF-dependent control of Mycobacterium tuberculosis infection', Immunity, 43(6), pp. 1125-1136.
Di Paolo, N.C. and Shayakhmetov, D.M. (2016) 'Interleukin 1α and the inflammatory process', Nature immunology, 17(8), pp. 906.
Diancourt, L., Passet, V., Verhoef, J., Grimont, P.A.D. and Brisse, S. (2005) 'Multilocus Sequence Typing of Klebsiella pneumoniae Nosocomial Isolates', Journal of clinical microbiology, 43(8), pp. 4178.
Dillon, R., Vennard, C. and Charnley, A. (2002) 'A note: gut bacteria produce components of a locust cohesion pheromone', Journal of applied microbiology, 92(4), pp. 759-763.
Dinarello, C.A. (2011) 'Interleukin-1 in the pathogenesis and treatment of inflammatory diseases', Blood, 117(14), pp. 3720-3732.
Dolores, J.S., Agarwal, S., Egerer, M. and Satchell, K.J. (2015) 'Vibrio cholerae MARTX toxin heterologous translocation of beta‐lactamase and roles of individual effector domains on cytoskeleton dynamics', Molecular microbiology, 95(4), pp. 590-604.
Domenico, P., Schwartz, S. and Cunha, B.A. (1989) 'Reduction of capsular polysaccharide production in Klebsiella pneumoniae by sodium salicylate', Infection and immunity, 57(12), pp. 3778-3782.
Dong, Y., Iniguez, A.L. and Triplett, E.W. (2003) 'Quantitative assessments of the host range and strain specificity of endophytic colonization by Klebsiella pneumoniae 342', Plant and Soil, 257(1), pp. 49- 59.
Dong, T.G., Ho, B.T., Yoder-Himes, D.R. and Mekalanos, J.J. (2013a) 'Identification of T6SS-dependent effector and immunity proteins by Tn-seq in Vibrio cholerae', Proceedings of the National Academy of Sciences of the United States of America, 110(7), pp. 2623-2628.
Dong, T.G., Ho, B.T., Yoder-Himes, D.R. and Mekalanos, J.J. (2013b) 'Identification of T6SS-dependent effector and immunity proteins by Tn-seq in Vibrio cholerae', Proceedings of the National Academy of Sciences, 110(7), pp. 2623-2628.
239 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Dong, T.G., Ho, B.T., Yoder-Himes, D.R. and Mekalanos, J.J. (2013c) 'Identification of T6SS-dependent effector and immunity proteins by Tn-seq in Vibrio cholerae', Proceedings of the National Academy of Sciences, 110(7), pp. 2623-2628.
Doorduijn, D.J., Rooijakkers, S.H., van Schaik, W. and Bardoel, B.W. (2016) 'Complement resistance mechanisms of Klebsiella pneumoniae', Immunobiology, 221(10), pp. 1102-1109.
Dos, S.G., Delattre, C., Balestrino, D., Charbonnel, N., Elboutachfaiti, R., Wadouachi, A., Badel, S., Bernardi, T., Michaud, P. and Forestier, C. (2014) 'Anti-Biofilm Activity: A Function of Klebsiella pneumoniae Capsular Polysaccharide.(Research Article)', PLoS ONE, 9(6).
Drancourt, M., Bollet, C., Carta, A. and Rousselier, P. (2001) 'Phylogenetic analyses of Klebsiella species delineate Klebsiella and Raoultella gen. nov., with description of Raoultella ornithinolytica comb. nov., Raoultella terrigena comb. nov. and Raoultella planticola comb. nov.', International Journal of Systematic and Evolutionary Microbiology, 51(3), pp. 925-932.
Dube, P.H., Revell, P.A., Chaplin, D.D., Lorenz, R.G. and Miller, V.L. (2001) 'A role for IL-1 alpha in inducing pathologic inflammation during bacterial infection', Proceedings of the National Academy of Sciences of the United States of America, 98(19), pp. 10880-10885.
Dufour, J.H., Dziejman, M., Liu, M.T., Leung, J.H., Lane, T.E. and Luster, A.D. (2002) 'IFN-gamma- inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking', Journal of immunology (Baltimore, Md.: 1950), 168(7), pp. 3195-3204.
Duguid, J. (1959) 'Fimbriae and adhesive properties in Klebsiella strains', Microbiology, 21(1), pp. 271- 286.
Duguid, J., Smith, I.W., Dempster, G. and Edmunds, P. (1955) 'Non‐flagellar filamentous appendages (“fimbriæ”) and hæmagglutinating activity in Bacterium coli', The Journal of pathology and bacteriology, 70(2), pp. 335-348.
Duncan, D.W. and Razzell, W.E. (1972) 'Klebsiella biotypes among coliforms isolated from forest environments and farm produce', Applied Microbiology, 24(6), pp. 933-938.
Durand, E., Derrez, E., Audoly, G., Spinelli, S., Ortiz-Lombardia, M., Raoult, D., Cascales, E. and Cambillau, C. (2012) 'Crystal structure of the VgrG1 actin cross-linking domain of the Vibrio cholerae type VI secretion system', The Journal of biological chemistry, 287(45), pp. 38190-38199.
Dutta, P., Jijumon, A., Mazumder, M., Dileep, D., Gourinath, S., Mukhopadhyay, A.K. and Maiti, S. (2017) 'Presence of WH2 like domain in VgrG-1 toxin of Vibrio cholerae reveals the molecular mechanism of actin cross-linking', BioRxiv, , pp. 226605.
El Fertas-Aissani, R., Messai, Y., Alouache, S. and Bakour, R. (2013) 'Virulence profiles and antibiotic susceptibility patterns of Klebsiella pneumoniae strains isolated from different clinical specimens', Pathologie Biologie, 61(5), pp. 209-216.
Eleftherianos, I., Millichap, P.J. and Reynolds, S.E. (2006) 'RNAi suppression of recognition protein mediated immune responses in the tobacco hornworm Manduca sexta causes increased susceptibility
240 David Mwin Ph.D. Thesis, University of Leicester, UK. References
to the insect pathogen Photorhabdus', Developmental & Comparative Immunology, 30(12), pp. 1099- 1107.
Elhani, D., Bakir, L., Aouni, M., Passet, V., Arlet, G., Brisse, S. and Weill, F. (2010) 'Molecular epidemiology of extended‐spectrum β‐lactamase‐producing Klebsiella pneumoniae strains in a university hospital in Tunis, Tunisia, 1999–2005', Clinical Microbiology and Infection, 16(2), pp. 157-164.
Enos-Berlage, J.L., Guvener, Z.T., Keenan, C.E. and McCarter, L.L. (2005) 'Genetic determinants of biofilm development of opaque and translucent Vibrio parahaemolyticus', Molecular microbiology, 55(4), pp. 1160-1182.
Ensminger, A.W. and Isberg, R.R. (2009) 'Legionella pneumophila Dot/Icm translocated substrates: a sum of parts', Current opinion in microbiology, 12(1), pp. 67-73.
Escherich, T. (1885) 'D ie darmbakterien des neugeborenen und saunglings. . 3:515–522.', Fortsch. Deutsch. Med, 3, pp. 515-522.
EUZéBY, J.P. (1997) 'List of Bacterial Names with Standing in Nomenclature: a folder available on the Internet', International Journal of Systematic and Evolutionary Microbiology, 47(2), pp. 590-592.
Evrard, B., Balestrino, D., Dosgilbert, A., Bouya-Gachancard, J.L., Charbonnel, N., Forestier, C. and Tridon, A. (2010) 'Roles of capsule and lipopolysaccharide O antigen in interactions of human monocyte-derived dendritic cells and Klebsiella pneumoniae', Infection and immunity, 78(1), pp. 210-219.
Fader, R.C., Duffy, L.K., Davis, C.P. and Kurosky, A. (1982) 'Purification and chemical characterization of type 1 pili isolated from Klebsiella pneumoniae', The Journal of biological chemistry, 257(6), pp. 3301-3305.
Fang, G., Fine, M., Orloff, J., Arisumi, D., Victor, L.Y., Kapoor, W., Grayston, J.T., Wang, S.P., Kohler, R. and Muder, R.R. (1990) 'New and emerging etiologies for community-acquired pneumonia with implications for therapy: a prospective multicenter study of 359 cases.', Medicine, 69(5), pp. 307- 316.
Fang, C.T., Chuang, Y.P., Shun, C.T., Chang, S.C. and Wang, J.T. (2004) 'A novel virulence gene in Klebsiella pneumoniae strains causing primary liver abscess and septic metastatic complications', The Journal of experimental medicine, 199(5), pp. 697-705.
Fang, C.T., Lai, S.Y., Yi, W.C., Hsueh, P.R., Liu, K.L. and Chang, S.C. (2007) 'Klebsiella pneumoniae genotype K1: an emerging pathogen that causes septic ocular or central nervous system complications from pyogenic liver abscess', Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 45(3), pp. 284-293.
Fang, F.C., Sandler, N. and Libby, S.J. (2005) 'Liver abscess caused by magA+ Klebsiella pneumoniae in North America', Journal of clinical microbiology, 43(2), pp. 991-992.
241 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Farmer, J. and Hickman-Brenner, F. (1992) 'The prokaryotes. A handbook on the biology of bacteria: ecophysiology, isolation, identification, applications', Edited by A.Balows.New York: Springer, , pp. 2952-3011.
Feldman, C., Ross, S., Mahomed, A.G., Omar, J. and Smith, C. (1995) 'The aetiology of severe community-acquired pneumonia and its impact on initial, empiric, antimicrobial chemotherapy', Respiratory medicine, 89(3), pp. 187-192.
Feldman, C., Smith, C., Levy, H., Ginsburg, P., Miller, S. and Koornhof, H. (1990) 'Klebsiella pneumoniae bacteraemia at an urban general hospital', Journal of Infection, 20(1), pp. 21-31.
Feldman, M.W., Riley, M.A., Kerr, B. and Bohannan, B.J.M. (2002) 'Local dispersal promotes biodiversity in a real-life game of rock-paper-scissors', Nature, 418(6894), pp. 171-174.
Felisberto-Rodrigues, C., Durand, E., Aschtgen, M., Blangy, S., Ortiz-Lombardia, M., Douzi, B., Cambillau, C. and Cascales, E. (2011) 'Towards a structural comprehension of bacterial type VI secretion systems: characterization of the TssJ-TssM complex of an Escherichia coli pathovar', PLoS Pathog, 7(11), pp. e1002386.
Fierer, J. (2012) 'Biofilm formation and Klebsiella pneumoniae liver abscess: True, true and unrelated?', Virulence, 3(3), pp. 241-242.
Filloux, A. (2009) 'The type VI secretion system: a tubular story', The EMBO journal, 28(4), pp. 309-310.
Finn, R.D., Coggill, P., Eberhardt, R.Y., Eddy, S.R., Mistry, J., Mitchell, A.L., Potter, S.C., Punta, M., Qureshi, M., Sangrador-Vegas, A., Salazar, G.A., Tate, J. and Bateman, A. (2016) 'The Pfam protein families database: towards a more sustainable future', Nucleic acids research, 44, pp. D279.
Fodah, R.A., Scott, J.B., Tam, H., Yan, P., Pfeffer, T.L., Bundschuh, R. and Warawa, J.M. (2014) 'Correlation of Klebsiella pneumoniae comparative genetic analyses with virulence profiles in a murine respiratory disease model', PloS one, 9(9), pp. e107394.
Francisco-Cruz, A., Aguilar-Santelises, M., Ramos-Espinosa, O., Mata-Espinosa, D., Marquina-Castillo, B., Barrios-Payan, J. and Hernandez-Pando, R. (2014) 'Granulocyte–macrophage colony-stimulating factor: not just another haematopoietic growth factor', Medical oncology, 31(1), pp. 774.
French, C.T., Toesca, I.J., Wu, T.-., Teslaa, T., Beaty, S.M., Wong, W., Liu, M., Schröder, I., Chiou, P.-., Teitell, M.A. and Miller, J.F. (2011) 'Dissection of the Burkholderia intracellular life cycle using a photothermal nanoblade', Proceedings of the National Academy of Sciences of the United States of America, 108(29), pp. 12095-12100.
Fresno, S., Jimenez, N., Canals, R., Merino, S., Corsaro, M.M., Lanzetta, R., Parrilli, M., Pieretti, G., Regue, M. and Tomas, J.M. (2007) 'A second galacturonic acid transferase is required for core lipopolysaccharide biosynthesis and complete capsule association with the cell surface in Klebsiella pneumoniae', Journal of Bacteriology, 189(3), pp. 1128-1137.
Friedländer, C. (1882) 'Über die Schizomyceten bei der acuten fibrösen Pneumonie', Virchows Archiv, 87(2), pp. 319-324.
242 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Fronzes, R., Christie, P.J. and Waksman, G. (2009) 'The structural biology of type IV secretion systems', Nature Reviews Microbiology, 7(10), pp. 703-714.
Frost, L.S., Leplae, R., Summers, A.O. and Toussaint, A. (2005a) 'Mobile genetic elements: the agents of open source evolution', Nature Reviews Microbiology, 3(9), pp. 722.
Frost, L.S., Leplae, R., Summers, A.O. and Toussaint, A. (2005b) 'Mobile genetic elements: the agents of open source evolution', Nature Reviews Microbiology, 3(9), pp. 722.
Frost, L.S., Leplae, R., Summers, A.O. and Toussaint, A. (2005c) 'Mobile genetic elements: the agents of open source evolution', Nature Reviews Microbiology, 3(9), pp. 722.
Fu, Y., Guo, L., Xu, Y., Zhang, W., Gu, J., Xu, J., Chen, X., Zhao, Y., Ma, J., Liu, X. and Zhang, F. (2008) 'Alteration of GyrA amino acid required for ciprofloxacin resistance in Klebsiella pneumoniae isolates in China', Antimicrobial Agents and Chemotherapy, 52(8), pp. 2980-2983.
Fumagalli, O., Tall, B.D., Schipper, C. and Oelschlaeger, T.A. (1997) 'N-glycosylated proteins are involved in efficient internalization of Klebsiella pneumoniae by cultured human epithelial cells', Infection and immunity, 65(11), pp. 4445-4451.
Fuqua, C., Hibbing, M.E., Peterson, S.B. and Parsek, M.R. (2010) 'Bacterial competition: surviving and thriving in the microbial jungle', Nature Reviews Microbiology, 8(1), pp. 15-25.
Fuursted, K., Scholer, L., Hansen, F., Dam, K., Bojer, M.S., Hammerum, A.M., Dagnaes-Hansen, F., Olsen, A., Jasemian, Y. and Struve, C. (2012) 'Virulence of a Klebsiella pneumoniae strain carrying the New Delhi metallo-beta-lactamase-1 (NDM-1)', Microbes and infection / Institut Pasteur, 14(2), pp. 155-158.
Gabay, C. (2006) 'Interleukin-6 and chronic inflammation', Arthritis research & therapy, 8(2), pp. S3.
Galimand, M., Guiyoule, A., Gerbaud, G., Rasoamanana, B., Chanteau, S., Carniel, E. and Courvalin, P. (1997) 'Multidrug resistance in Yersinia pestis mediated by a transferable plasmid', New England Journal of Medicine, 337(10), pp. 677-681.
Gallique, M., Decoin, V., Barbey, C., Rosay, T., Feuilloley, M.G., Orange, N. and Merieau, A. (2017) 'Contribution of the Pseudomonas fluorescens MFE01 type VI secretion system to biofilm formation', PLoS One, 12(1), pp. e0170770.
Ganz, T. (1999) 'Defensins and host defense', Science (New York, N.Y.), 286(5439), pp. 420-421.
Garcia-Sureda, L., Domenech-Sanchez, A., Barbier, M., Juan, C., Gasco, J. and Alberti, S. (2011) 'OmpK26, a novel porin associated with carbapenem resistance in Klebsiella pneumoniae', Antimicrobial Agents and Chemotherapy, 55(10), pp. 4742-4747.
Gasink, L.B., Edelstein, P.H., Lautenbach, E., Synnestvedt, M. and Fishman, N.O. (2009) 'Risk factors and clinical impact of Klebsiella pneumoniae carbapenemase-producing K. pneumoniae', Infection Control & Hospital Epidemiology, 30(12), pp. 1180-1185.
243 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Gavrilin, M.A., Abdelaziz, D.H.A., Mostafa, M., Abdulrahman, B.A., Grandhi, J., Akhter, A., Khweek, A.A., Aubert, D.F., Valvano, M.A., Wewers, M.D. and Amer, A.O. (2012) 'Activation of the pyrin inflammasome by intracellular Burkholderia cenocepacia', Journal of Immunology, 188(7), pp. 3469-3477.
Gerlach, G.F., Clegg, S. and Allen, B.L. (1989) 'Identification and characterization of the genes encoding the type 3 and type 1 fimbrial adhesins of Klebsiella pneumoniae', Journal of Bacteriology, 171(3), pp. 1262-1270.
Giamarellou, H. (2010) 'Multidrug-resistant Gram-negative bacteria: how to treat and for how long', International journal of antimicrobial agents, 36, pp. S50-S54.
Giske, C.G., Monnet, D.L., Cars, O., Carmeli, Y. and ReAct-Action on Antibiotic Resistance (2008) 'Clinical and economic impact of common multidrug-resistant gram-negative bacilli', Antimicrobial Agents and Chemotherapy, 52(3), pp. 813-821.
Golia, P. and Sadler, M. (2006) 'Pyogenic liver abscess: Klebsiella as an emerging pathogen', Emergency radiology, 13(2), pp. 87-88.
Gong, W., Howard, O.M., Turpin, J.A., Grimm, M.C., Ueda, H., Gray, P.W., Raport, C.J., Oppenheim, J.J. and Wang, J.M. (1998) 'Monocyte chemotactic protein-2 activates CCR5 and blocks CD4/CCR5-mediated HIV-1 entry/replication', The Journal of biological chemistry, 273(8), pp. 4289-4292.
Gordon, D.M. and FitzGibbon, F. (1999) 'The distribution of enteric bacteria from Australian mammals: host and geographical effects', Microbiology, 145(10), pp. 2663-2671.
Gordon, S. and Read, R. (2002) 'Macrophage defences against respiratory tract infections: The immunology of childhood respiratory infections', British medical bulletin, 61(1), pp. 45-61.
Gorrie, C.L., Mirceta, M., Wick, R.R., Edwards, D.J., Thomson, N.R., Strugnell, R.A., Pratt, N.F., Garlick, J.S., Watson, K.M., McGloughlin, D.V.P.S.A., Spelman, D.W., Jenney, A.W.J. and Holt, K.E. (2017) 'Gastrointestinal Carriage Is a Major Reservoir of Klebsiella pneumoniae Infection in Intensive Care Patients.(Report)', Clinical Infectious Diseases, 65(2), pp. 208.
Gotsch, F., Romero, R., Friel, L., Kusanovic, J.P., Espinoza, J., Erez, O., Than, N.G., Mittal, P., Edwin, S. and Yoon, B.H. (2007) 'CXCL10/IP-10: a missing link between inflammation and anti-angiogenesis in preeclampsia?', The Journal of Maternal-Fetal & Neonatal Medicine, 20(11), pp. 777-792.
Grant, S.R., Fisher, E.J., Chang, J.H., Mole, B.M. and Dangl, J.L. (2006) 'Subterfuge and manipulation: type III effector proteins of phytopathogenic bacteria', Annu.Rev.Microbiol., 60, pp. 425-449.
Green, E.R. and Mecsas, J. (2016) 'Bacterial Secretion Systems: An Overview', Microbiology spectrum, 4(1), pp. 10.1128/microbiolspec.VMBF-0012-2015.
Griffith, E. (1987) 'The iron-uptake systems of pathogenic bacteria', Iron and Infection: Molecular, Physiological and Clinical Aspects, , pp. 69-137.
244 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Griffiths, E. (1988) 'High-affinity iron uptake systems and bacterial virulence', Virulence mechanisms of bacterial pathogens, , pp. 121-137.
Grimont F., Grimont P.A.D. and Richard C. (1992) 'The genus Klebsiella', in Balows A, , T.H.G., Dworkin M., Harder W. and Schleifer K. H. (eds.) The Prokaryotes. III edn. New York: Springer- Verlag, pp. 2775-2795.
Günther, S., Fagone, P., Jalce, G., Atanasov, A., Guignabert, C. and Nicoletti, F. (2018) 'Role of MIF and D-DT in immune-inflammatory, autoimmune, and chronic respiratory diseases: From pathogenic factors to therapeutic targets', Drug discovery today, .
Haapalainen, M., Mosorin, H., Dorati, F., Wu, R.-., Roine, E., Taira, S., Nissinen, R., Mattinen, L., Jackson, R., Pirhonen, M. and Lin, N.-. (2012) 'Hcp2, a secreted protein of the phytopathogen Pseudomonas syringae pv. tomato DC3000, is required for fitness for competition against bacteria and yeasts', Journal of Bacteriology, 194(18), pp. 4810-4822.
Hachani, A., Wood, T.E. and Filloux, A. (2016) 'Type VI secretion and anti-host effectors', Current opinion in microbiology, 29, pp. 81-93.
Hachani, A., Lossi, N.S. and Filloux, A. (2013) 'A visual assay to monitor T6SS-mediated bacterial competition', Journal of visualized experiments : JoVE, (73), pp. e50103.
Haiko, J. and Westerlund-Wikström, B. (2013) 'The role of the bacterial flagellum in adhesion and virulence', Biology, 2(4), pp. 1242-1267.
Hakansson, S., Bergman, T., Vanooteghem, J.C., Cornelis, G. and Wolf-Watz, H. (1993) 'YopB and YopD constitute a novel class of Yersinia Yop proteins', Infection and immunity, 61(1), pp. 71-80.
Hakansson, S., Schesser, K., Persson, C., Galyov, E.E., Rosqvist, R., Homble, F. and Wolf-Watz, H. (1996) 'The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity', The EMBO journal, 15(21), pp. 5812-5823.
Halwani, A., Niven, D. and Dunphy, G. (2000) 'Apolipophorin-III and the interactions of lipoteichoic acids with the immediate immune responses of Galleria mellonella', Journal of invertebrate pathology, 76(4), pp. 233-241.
Hamilton, J.A. (2008) 'Colony-stimulating factors in inflammation and autoimmunity', Nature Reviews Immunology, 8(7), pp. 533.
Hanahan, D. (1983) 'Studies on transformation of Escherichia coli with plasmids', Journal of Molecular Biology, 166(4), pp. 557-580.
Hancock, V., Witsø, I.L. and Klemm, P. (2011) 'Biofilm formation as a function of adhesin, growth medium, substratum and strain type', International Journal of Medical Microbiology, 301(7), pp. 570-576.
245 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Hansen, D.S., Gottschau, A. and Kolmos, H.J. (1998) 'Epidemiology of Klebsiella bacteraemia: a case control study using Escherichia coli bacteraemia as control', Journal of Hospital Infection, 38(2), pp. 119-132.
Hansen, D., Skov, R., Benedi, J., Sperling, V. and Kolmos, H. (2002) 'Klebsiella typing: pulsed‐field gel electrophoresis (PFGE) in comparison with O: K‐serotyping', Clinical microbiology and infection, 8(7), pp. 397-404.
Hansen, D.S., Aucken, H.M., Abiola, T. and Podschun, R. (2004) 'Recommended test panel for differentiation of Klebsiella species on the basis of a trilateral interlaboratory evaluation of 18 biochemical tests', Journal of clinical microbiology, 42(8), pp. 3665-3669.
Harada, A., Sekido, N., Akahoshi, T., Wada, T., Mukaida, N. and Matsushima, K. (1994) 'Essential involvement of interleukin‐8 (IL‐8) in acute inflammation', Journal of leukocyte biology, 56(5), pp. 559-564.
Harmer, C.J., Moran, R.A. and Hall, R.M. (2014) 'Movement of IS26-associated antibiotic resistance genes occurs via a translocatable unit that includes a single IS26 and preferentially inserts adjacent to another IS26', mBio, 5(5), pp. e01801-14.
He, S.Y., Lindeberg, M., Chatterjee, A.K. and Collmer, A. (1991) 'Cloned Erwinia chrysanthemi out genes enable Escherichia coli to selectively secrete a diverse family of heterologous proteins to its milieu', Proceedings of the National Academy of Sciences of the United States of America, 88(3), pp. 1079-1083.
Henderson, I.R., Navarro-Garcia, F., Desvaux, M., Fernandez, R.C. and Ala'Aldeen, D. (2004) 'Type V protein secretion pathway: the autotransporter story', Microbiology and molecular biology reviews : MMBR, 68(4), pp. 692-744.
Hennequin, C. and Robin, F. (2016) 'Correlation between antimicrobial resistance and virulence in Klebsiella pneumoniae', European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology, 35(3), pp. 333-341.
Herrero, M., de Lorenzo, V. and Timmis, K.N. (1990) 'Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram- negative bacteria', Journal of Bacteriology, 172(11), pp. 6557-6567.
Hibbing, M.E., Fuqua, C., Parsek, M.R. and Peterson, S.B. (2010) 'Bacterial competition: surviving and thriving in the microbial jungle', Nature reviews.Microbiology, 8(1), pp. 15-25.
Highsmith, A.K. and Jarvis, W.R. (1985) 'Klebsiella pneumoniae: selected virulence factors that contribute to pathogenicity', Infection control : IC, 6(2), pp. 75-77.
Ho, B.T., Dong, T.G. and Mekalanos, J.J. (2014) 'A view to a kill: the bacterial type VI secretion system', Cell host & microbe, 15(1), pp. 9-21.
Ho, B.T., Basler, M. and Mekalanos, J.J. (2013) 'Type 6 secretion system-mediated immunity to type 4 secretion system-mediated gene transfer', Science (New York, N.Y.), 342(6155), pp. 250-253.
246 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Hoang, T.T., Karkhoff-Schweizer, R.R., Kutchma, A.J. and Schweizer, H.P. (1998) 'A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants', Gene, 212(1), pp. 77-86.
Hobbs, M. and Mattick, J.S. (1993) 'Common components in the assembly of type 4 fimbriae, DNA transfer systems, filamentous phage and protein‐secretion apparatus: a general system for the formation of surface‐associated protein complexes', Molecular microbiology, 10(2), pp. 233-243.
Holmström, A., Olsson, J., Cherepanov, P., Maier, E., Nordfelth, R., Pettersson, J., Benz, R., Wolf‐Watz, H. and Forsberg, Å (2001) 'LcrV is a channel size‐determining component of the Yop effector translocon of Yersinia', Molecular microbiology, 39(3), pp. 620-632.
Hood, R.D., Singh, P., Hsu, F., Güvener, T., Carl, M.A., Trinidad, R.R.S., Silverman, J.M., Ohlson, B.B., Hicks, K.G., Plemel, R.L., Li, M., Schwarz, S., Wang, W.Y., Merz, A.J., Goodlett, D.R. and Mougous, J.D. (2010a) 'A Type VI Secretion System of Pseudomonas aeruginosa Targets a Toxin to Bacteria', Cell Host and Microbe, 7(1), pp. 25-37.
Hood, R.D., Singh, P., Hsu, F., Güvener, T., Carl, M.A., Trinidad, R.R.S., Silverman, J.M., Ohlson, B.B., Hicks, K.G., Plemel, R.L., Li, M., Schwarz, S., Wang, W.Y., Merz, A.J., Goodlett, D.R. and Mougous, J.D. (2010b) 'A Type VI Secretion System of Pseudomonas aeruginosa Targets a Toxin to Bacteria', Cell Host and Microbe, 7(1), pp. 25-37.
Hood, R.D., Singh, P., Hsu, F., Güvener, T., Carl, M.A., Trinidad, R.R.S., Silverman, J.M., Ohlson, B.B., Hicks, K.G., Plemel, R.L., Li, M., Schwarz, S., Wang, W.Y., Merz, A.J., Goodlett, D.R. and Mougous, J.D. (2010c) 'A Type VI Secretion System of Pseudomonas aeruginosa Targets a Toxin to Bacteria', Cell Host & Microbe, 7(1), pp. 25-37.
Hopp, R.J. (1994) 'RANTES is a chemotactic and activating factor for human eosinophils', Pediatrics, 94(2), pp. 259-260.
Hormaeche, E. and Edwards P. R. (1960) 'A proposal genus Enterobacter', 10, pp. 71-74.
Hou, S.R., Xu, X.J. and Yi, P. (1992) 'Nosocomial pneumonia: a report of 372 cases', Zhonghua nei ke za zhi, 31(6), pp. 338-40, 380.
Houwink, A. and Van Iterson, W. (1950) 'Electron microscopical observations on bacterial cytology II. A study of flagellation', Biochimica et biophysica acta, 5, pp. 10-44.
Hsieh, P., Lin, T., Yang, F., Wu, M., Pan, Y., Wu, S. and Wang, J. (2012a) 'Lipopolysaccharide O1 antigen contributes to the virulence in Klebsiella pneumoniae causing pyogenic liver abscess', PloS one, 7(3), pp. e33155.
Hsieh, P., Lin, T., Yang, F., Wu, M., Pan, Y., Wu, S. and Wang, J. (2012b) 'Lipopolysaccharide O1 antigen contributes to the virulence in Klebsiella pneumoniae causing pyogenic liver abscess', PloS one, 7(3), pp. e33155.
Hsieh, P.F., Lin, T.L., Lee, C.Z., Tsai, S.F. and Wang, J.T. (2008) 'Serum-induced iron-acquisition systems and TonB contribute to virulence in Klebsiella pneumoniae causing primary pyogenic liver abscess', The Journal of infectious diseases, 197(12), pp. 1717-1727.
247 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Hsieh, P., Liu, J., Pan, Y., Wu, M., Lin, T., Huang, Y. and Wang, J. (2013) 'Klebsiella pneumoniae peptidoglycan-associated lipoprotein and murein lipoprotein contribute to serum resistance, antiphagocytosis, and proinflammatory cytokine stimulation', The Journal of infectious diseases, 208(10), pp. 1580.
Hsu, C., Lin, T., Pan, Y., Hsieh, P. and Wang, J. (2013) 'Isolation of a bacteriophage specific for a new capsular type of Klebsiella pneumoniae and characterization of its polysaccharide depolymerase', PLoS One, 8(8), pp. e70092.
Huang, T., Lam, I., Chang, H., Tsai, S., Palsson, B.O. and Charusanti, P. (2014) 'Capsule deletion via a [lambda]-Red knockout system perturbs biofilm formation and fimbriae expression in Klebsiella pneumoniae MGH 78578', BMC Research Notes, 7, pp. 13.
Hubber, A.M., Sullivan, J.T. and Ronson, C.W. (2007) 'Symbiosis-induced cascade regulation of the Mesorhizobium loti R7A VirB/D4 type IV secretion system', Molecular Plant-Microbe Interactions, 20(3), pp. 255-261.
Hunt, J.J., Wang, J. and Callegan, M.C. (2011) 'Contribution of mucoviscosity-associated gene A (magA) to virulence in experimental Klebsiella pneumoniae endophthalmitis', Investigative ophthalmology & visual science, 52(9), pp. 6860-6866.
Huntley, B., Jones, A. and Cabelli, V.J. (1976) 'Klebsiella densities in waters receiving wood pulp effluents', Journal (Water Pollution Control Federation), , pp. 1766-1771.
Insua, J.L., Llobet, E., Moranta, D., Perez-Gutierrez, C., Tomas, A., Garmendia, J. and Bengoechea, J.A. (2013a) 'Modeling Klebsiella pneumoniae pathogenesis by infection of the wax moth Galleria mellonella', Infection and immunity, 81(10), pp. 3552-3565.
Insua, J.L., Llobet, E., Moranta, D., Pérez-Gutiérrez, C., Tomás, A., Garmendia, J. and Bengoechea, J.A. (2013b) 'Modeling Klebsiella pneumoniae pathogenesis by infection of the wax moth Galleria mellonella', Infection and immunity, 81(10), pp. 3552.
Iqbal, J., Siddiqui, R. and Khan, N.A. (2014) 'Acanthamoeba and bacteria produce antimicrobials to target their counterpart', Parasites & vectors, 7(1), pp. 56-56.
Ishida, T., Hashimoto, T., Arita, M., Ito, I. and Osawa, M. (1998) 'Etiology of community-acquired pneumonia in hospitalized patients: a 3-year prospective study in Japan', Chest, 114(6), pp. 1588- 1593.
Ishikawa, T., Sabharwal, D., Bröms, J., Milton, D.L., Sjöstedt, A., Uhlin, B.E. and Wai, S.N. (2012) 'Pathoadaptive conditional regulation of the type VI secretion system in Vibrio cholerae O1 strains', Infection and immunity, 80(2), pp. 575-584.
Jacob-Dubuisson, F., Fernandez, R. and Coutte, L. (2004) 'Protein secretion through autotransporter and two-partner pathways', Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1694(1), pp. 235-257.
Janda, J. and Abbott, S. (2006) 'The Genera Klebsiella and Raoultella', The Enterobacteria, , pp. 115-129.
248 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Jani, A.J. and Cotter, P.A. (2010) 'Type VI Secretion: Not just for pathogenesis anymore', Cell Host and Microbe, 8(1), pp. 2-6.
Jayamani, E. and Mylonakis, E. (2014) 'Effector triggered manipulation of host immune response elicited by different pathotypes of Escherichia coli', Virulence, 5(7), pp. 733-739.
Jean, S.S., Lee, W.S., Lam, C., Hsu, C.W., Chen, R.J. and Hsueh, P.R. (2015) 'Carbapenemase-producing Gram-negative bacteria: current epidemics, antimicrobial susceptibility and treatment options', Future microbiology, 10(3), pp. 407-425.
Jian, Y., George, C., Irena, Z., Ioana, C., Steve, R. and Madden Thomas, L. (2012) 'Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction', BMC Bioinformatics, 13(1), pp. 134.
Jiang, B. and Howard, S.P. (1992) 'The Aeromonas hydrophila exeE gene, required both for protein secretion and normal outer membrane biogenesis, is a member of a general secretion pathway', Molecular microbiology, 6(10), pp. 1351-1361.
Jiang, F., Waterfield, N.R., Yang, J., Yang, G. and Jin, Q. (2014) 'A Pseudomonas aeruginosa type VI secretion phospholipase D effector targets both prokaryotic and eukaryotic cells', Cell host & microbe, 15(5), pp. 600-610.
Jiang, Y., Yu, D., Wei, Z., Shen, P., Zhou, Z. and Yu, Y. (2010) 'Complete nucleotide sequence of Klebsiella pneumoniae multidrug resistance plasmid pKP048, carrying blaKPC-2, blaDHA-1, qnrB4, and armA', Antimicrobial Agents and Chemotherapy, 54(9), pp. 3967-3969.
Johnson, J.G., Murphy, C.N., Sippy, J., Johnson, T.J. and Clegg, S. (2011) 'Type 3 Fimbriae and Biofilm Formation Are Regulated by the Transcriptional Regulators MrkHI in Klebsiella pneumoniae', Journal of Bacteriology, 193(14), pp. 3453-3460.
Jonas, D., Spitzmüller, B., Daschner, F.D., Verhoef, J. and Brisse, S. (2004) 'Discrimination of Klebsiella pneumoniae and Klebsiella oxytoca phylogenetic groups and other Klebsiella species by use of amplified fragment length polymorphism', Research in microbiology, 155(1), pp. 17-23.
Jong, G., Hsiue, T., Chen, C., Chang, H. and Chen, C. (1995) 'Rapidly fatal outcome of bacteremic Klebsiella pneumoniae pneumonia in alcoholics', CHEST Journal, 107(1), pp. 214-217.
Jung, S., Alsam, S., Kim, K.S. and Khan, N.A. (2008) 'Pathogen–pathogen interactions: a comparative study of Escherichia coli interactions with the clinical and environmental isolates of Acanthamoeba', World Journal of Microbiology and Biotechnology, 24(10), pp. 2339-2348.
Jung, S., Matin, A., Kim, K.S. and Khan, N.A. (2007) 'The capsule plays an important role in Escherichia coli K1 interactions with Acanthamoeba', International journal for parasitology, 37(3), pp. 417-423.
Kabha, K., Nissimov, L., Athamna, A., Keisari, Y., Parolis, H., Parolis, L.A., Grue, R.M., Schlepper- Schafer, J., Ezekowitz, A.R. and Ohman, D.E. (1995) 'Relationships among capsular structure, phagocytosis, and mouse virulence in Klebsiella pneumoniae', Infection and immunity, 63(3), pp. 847-852.
249 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Kalivoda, E.J., Horzempa, J., Stella, N.A., Sadaf, A., Kowalski, R.P., Nau, G.J. and Shanks, R.M. (2011) 'New vector tools with a hygromycin resistance marker for use with opportunistic pathogens', Molecular biotechnology, 48(1), pp. 7-14.
Kang, C.I., Kim, S.H., Bang, J.W., Kim, H.B., Kim, N.J., Kim, E.C., Oh, M.D. and Choe, K.W. (2006) 'Community-acquired versus nosocomial Klebsiella pneumoniae bacteremia: clinical features, treatment outcomes, and clinical implication of antimicrobial resistance', Journal of Korean medical science, 21(5), pp. 816-822.
Kang, Y., Tian, P. and Tan, T. (2015) 'Research advances in the virulence factors of Klebsiella pneumoniae--A review', Wei sheng wu xue bao = Acta microbiologica Sinica, 55(10), pp. 1245- 1252.
Kesteman, A.S., Perrin-Guyomard, A., Laurentie, M., Sanders, P., Toutain, P.L. and Bousquet-Melou, A. (2010) 'Emergence of resistant Klebsiella pneumoniae in the intestinal tract during successful treatment of Klebsiella pneumoniae lung infection in rats', Antimicrobial Agents and Chemotherapy, 54(7), pp. 2960-2964.
Khajanchi, B.K., Sha, J., Kozlova, E.V., Erova, T.E., Suarez, G., Sierra, J.C., Popov, V.L., Horneman, A.J. and Chopra, A.K. (2009) 'N-acylhomoserine lactones involved in quorum sensing control the type VI secretion system, biofilm formation, protease production, and in vivo virulence in a clinical isolate of Aeromonas hydrophila', Microbiology (Reading, England), 155(Pt 11), pp. 3518-3531.
Khan, N.A. and Siddiqui, R. (2014) 'Predator vs aliens: bacteria interactions with Acanthamoeba', Parasitology, 141(7), pp. 869.
Kibbe, W.A. (2007) 'OligoCalc: an online oligonucleotide properties calculator', Nucleic acids research, 35, pp. W43-W46.
Kidd, T.J., Mills, G., Brennan, I., Dumigan, A., Hobley, L., Insua, J.L., Sá-Pessoa, J., Roets, L. and Bengoechea, J.A. (2016) 'Molecular mechanisms and virulence of colistin-resistant klebsiella pneumoniae', European Respiratory Journal, 48, pp. PA2625.
Kidd, T.J., Mills, G., Sá‐Pessoa, J., Dumigan, A., Frank, C.G., Insua, J.L., Ingram, R., Hobley, L. and Bengoechea, J.A. (2017) 'A Klebsiella pneumoniae antibiotic resistance mechanism that subdues host defences and promotes virulence', EMBO Molecular Medicine, 9(4), pp. 430-447.
Kim, J.M., Park, E.S., Jeong, J.S., Kim, K.M., Kim, J.M., Oh, H.S., Yoon, S.W., Chang, H.S., Chang, K.H. and Lee, S.I. (2000) 'Multicenter surveillance study for nosocomial infections in major hospitals in Korea', American Journal of Infection Control, 28(6), pp. 454-458.
Klausen, M., Heydorn, A., Ragas, P., Lambertsen, L., Aaes‐Jørgensen, A., Molin, S. and Tolker‐Nielsen, T. (2003) 'Biofilm formation by Pseudomonas aeruginosa wild type, flagella and type IV pili mutants', Molecular microbiology, 48(6), pp. 1511-1524.
Kline, K.A., Dodson, K.W., Caparon, M.G. and Hultgren, S.J. (2010) 'A tale of two pili: assembly and function of pili in bacteria', Trends in microbiology, 18(5), pp. 224-232.
250 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Knittel, M.D., Seidler, R.J., Eby, C. and Cabe, L.M. (1977) 'Colonization of the botanical environment by Klebsiella isolates of pathogenic origin', Applied and Environmental Microbiology, 34(5), pp. 557- 563.
Ko, W., Paterson, D.L., Sagnimeni, A.J., Hansen, D.S., Von Gottberg, A., Mohapatra, S., Casellas, J.M., Goossens, H., Mulazimoglu, L. and Trenholme, G. (2002) 'Community-acquired Klebsiella pneumoniae bacteremia: global differences in clinical patterns', Emerging infectious diseases, 8(2), pp. 160-166.
Koczura, R. and Kaznowski, A. (2003) 'Occurrence of the Yersinia high-pathogenicity island and iron uptake systems in clinical isolates of Klebsiella pneumoniae', Microbial pathogenesis, 35(5), pp. 197-202.
Kohanski, M.A., Dwyer, D.J., Hayete, B., Lawrence, C.A. and Collins, J.J. (2007) 'A common mechanism of cellular death induced by bactericidal antibiotics', Cell, 130(5), pp. 797-810.
Köhidai, L. and Csaba, G. (1998) 'Chemotaxis and chemotactic selection induced with cytokines (IL-8, Rantes and TNF-α) in the unicellular Tetrahymena pyriformis', Cytokine, 10(7), pp. 481-486.
Kohno, K., Yamamoto, T., Kuroiwa, A. and Amako, K. (1984) 'Purification and characterization of Serratia marcescens US5 pili', Infection and immunity, 46(2), pp. 295-300.
Kolenbrander, P.E., Palmer, R.J., Periasamy, S. and Jakubovics, N.S. (2010) 'Oral multispecies biofilm development and the key role of cell–cell distance', Nature Reviews Microbiology, 8(7), pp. 471- 480.
Konovalova, A., Petters, T. and Sogaard-Andersen, L. (2010) 'Extracellular biology of Myxococcus xanthus', FEMS microbiology reviews, 34(2), pp. 89-106.
Koressaar, T. and Remm, M. (2007) 'Enhancements and modifications of primer design program Primer3', 23(10), pp. 1289-1291.
Korhonen, T.K., Lounatmaa, K., Ranta, H. and Kuusi, N. (1980) 'Characterization of type 1 pili of Salmonella typhimurium LT2', Journal of Bacteriology, 144(2), pp. 800-805.
Korotkov, K.V., Gonen, T. and Hol, W.G. (2011) 'Secretins: dynamic channels for protein transport across membranes', Trends in biochemical sciences, 36(8), pp. 433-443.
Korotkov, K.V., Sandkvist, M. and Hol, W.G. (2012) 'The type II secretion system: biogenesis, molecular architecture and mechanism', Nature Reviews Microbiology, 10(5), pp. 336-351.
Kottara, A., Hall, J.P., Harrison, E. and Brockhurst, M.A. (2017) 'Variable plasmid fitness effects and mobile genetic element dynamics across Pseudomonas species', FEMS microbiology ecology, 94(1), pp. fix172.
Kovtunovych, G., Lytvynenko, T., Negrutska, V., Lar, O., Brisse, S. and Kozyrovska, N. (2003) 'Identification of Klebsiella oxytoca using a specific PCR assay targeting the polygalacturonase pehX gene', Research in microbiology, 154(8), pp. 587-592.
251 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Kruse, W. (ed.) (1896) Systematik der Streptothricheen and Bakterien.
Kubori, T., Matsushima, Y., Nakamura, D., Uralil, J., Lara-Tejero, M., Sukhan, A., Galan, J.E. and Aizawa, S.I. (1998) 'Supramolecular structure of the Salmonella typhimurium type III protein secretion system', Science (New York, N.Y.), 280(5363), pp. 602-605.
Kuhns, D.B., Priel, D.A.L., Chu, J. and Zarember, K.A. (2015) 'Isolation and functional analysis of human neutrophils', Current protocols in immunology, 111(1), pp. 7.23. 1-7.23. 16.
Kulkarni, R., Dhakal, B.K., Slechta, E.S., Kurtz, Z., Mulvey, M.A. and Thanassi, D.G. (2009) 'Roles of putative type II secretion and type IV pilus systems in the virulence of uropathogenic Escherichia coli', PLoS One, 4(3), pp. e4752.
Kumar, A., Chakraborti, S., Joshi, P., Chakrabarti, P. and Chakraborty, R. (2011a) 'A multiple antibiotic and serum resistant oligotrophic strain, Klebsiella pneumoniae MB45 having novel dfrA30, is sensitive to ZnO QDs', Annals of clinical microbiology and antimicrobials, 10(1), pp. 19-19.
Kumar, V., Sun, P., Vamathevan, J., Li, Y., Ingraham, K., Palmer, L., Huang, J. and Brown, J.R. (2011b) 'Comparative genomics of Klebsiella pneumoniae strains with different antibiotic resistance profiles', Antimicrobial Agents and Chemotherapy, 55(9), pp. 4267-4276.
Ladha, J., Barraquio, W. and Watanabe, I. (1983) 'Isolation and identification of nitrogen-fixing Enterobacter cloacae and Klebsiella planticola associated with rice plants', Canadian journal of microbiology, 29(10), pp. 1301-1308.
Lai, Y.C., Peng, H.L. and Chang, H.Y. (2003) 'RmpA2, an activator of capsule biosynthesis in Klebsiella pneumoniae CG43, regulates K2 cps gene expression at the transcriptional level', Journal of Bacteriology, 185(3), pp. 788-800.
Lambert‐Buisine, C., Willery, E., Locht, C. and Jacob‐Dubuisson, F. (1998) 'N‐terminal characterization of the Bordetella pertussis filamentous haemagglutinin', Molecular microbiology, 28(6), pp. 1283- 1293.
Lambrecht, E., Baré, J., Damme, I.V., Bert, W., Sabbe, K. and Houf, K. (2013) 'Behavior of Yersinia enterocolitica in the Presence of the Bacterivorous Acanthamoeba castellanii', Applied and Environmental Microbiology, 79(20), pp. 6407-6413.
Larson, D.F. and Horak, K. (2006) 'Macrophage migration inhibitory factor: controller of systemic inflammation', Critical Care, 10(2), pp. 138.
Lathem, W.W., Grys, T.E., Witowski, S.E., Torres, A.G., Kaper, J.B., Tarr, P.I. and Welch, R.A. (2002) 'StcE, a metalloprotease secreted by Escherichia coli O157: H7, specifically cleaves C1 esterase inhibitor', Molecular microbiology, 45(2), pp. 277-288.
Lavander, M., Ericsson, S.K., Broms, J.E. and Forsberg, A. (2006) 'The twin arginine translocation system is essential for virulence of Yersinia pseudotuberculosis', Infection and immunity, 74(3), pp. 1768-1776.
252 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Lavigne, J., Cuzon, G., Combescure, C., Bourg, G., Sotto, A. and Nordmann, P. (2013) 'Virulence of Klebsiella pneumoniae isolates harboring bla KPC-2 carbapenemase gene in a Caenorhabditis elegans model', PloS one, 8(7), pp. e67847.
Lawlor, M.S., O'connor, C. and Miller, V.L. (2007) 'Yersiniabactin is a virulence factor for Klebsiella pneumoniae during pulmonary infection', Infection and immunity, 75(3), pp. 1463-1472.
Lecher, J., Schwarz, C.K., Stoldt, M., Smits, S.H., Willbold, D. and Schmitt, L. (2012) 'An RTX transporter tethers its unfolded substrate during secretion via a unique N-terminal domain', Structure, 20(10), pp. 1778-1787.
Lederman, E.R. and Crum, N.F. (2005) 'Pyogenic liver abscess with a focus on Klebsiella pneumoniae as a primary pathogen: an emerging disease with unique clinical characteristics', The American Journal of Gastroenterology, 100(2), pp. 322-331.
Lee, D.G., Urbach, J.M., Wu, G., Liberati, N.T., Feinbaum, R.L., Miyata, S., Diggins, L.T., He, J., Saucier, M. and Déziel, E. (2006) 'Genomic analysis reveals that Pseudomonas aeruginosa virulence is combinatorial', Genome biology, 7(10), pp. R90.
Leiman, P.G., Basler, M., Ramagopal, U.A., Bonanno, J.B., Sauder, J.M., Pukatzki, S., Burley, S.K., Almo, S.C. and Mekalanos, J.J. (2009a) 'Type VI secretion apparatus and phage tail-associated protein complexes share a common evolutionary origin', Proceedings of the National Academy of Sciences of the United States of America, 106(11), pp. 4154-4159.
Leiman, P.G., Basler, M., Ramagopal, U.A., Bonanno, J.B., Sauder, J.M., Pukatzki, S., Burley, S.K., Almo, S.C. and Mekalanos, J.J. (2009b) 'Type VI Secretion Apparatus and Phage Tail-Associated Protein Complexes Share a Common Evolutionary Origin', Proceedings of the National Academy of Sciences of the United States of America, 106(11), pp. 4154-4159.
Lennings, J., West, T.E. and Schwarz, S. (2018) 'The Burkholderia type VI secretion system 5: composition, regulation and role in virulence', Frontiers in microbiology, 9.
Leo, J.C., Grin, I. and Linke, D. (2012) 'Type V secretion: mechanism(s) of autotransport through the bacterial outer membrane', Philosophical transactions of the Royal Society of London.Series B, Biological sciences, 367(1592), pp. 1088-1101.
Lertpiriyapong, K., Gamazon, E.R., Feng, Y., Park, D.S., Pang, J., Botka, G., Graffam, M.E., Ge, Z. and Fox, J.G. (2012) 'Campylobacter jejuni type VI secretion system: roles in adaptation to deoxycholic acid, host cell adherence, invasion, and in vivo colonization', PLoS One, 7(8), pp. e42842.
Lery, L.M., Frangeul, L., Tomas, A., Passet, V., Almeida, A.S., Bialek-Davenet, S., Barbe, V., Bengoechea, J.A., Sansonetti, P. and Brisse, S. (2014) 'Comparative analysis of Klebsiella pneumoniae genomes identifies a phospholipase D family protein as a novel virulence factor', BMC biology, 12(1), pp. 1.
Lesic, á, Starkey, á, He, J., Hazan, R. and Rahme, L. (2009) 'Quorum sensing differentially regulates Pseudomonas aeruginosa type VI secretion locus I and homologous loci II and III, which are required for pathogenesis', Microbiology, 155(9), pp. 2845-2855.
253 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Letoffe, S., Delepelaire, P. and Wandersman, C. (1996) 'Protein secretion in gram-negative bacteria: assembly of the three components of ABC protein-mediated exporters is ordered and promoted by substrate binding', The EMBO journal, 15(21), pp. 5804-5811.
Leverstein-Van Hall, M.A., Stuart, J.C., Voets, G.M., Versteeg, D., Tersmette, T. and Fluit, A.C. (2010) 'Global spread of New Delhi metallo-beta-lactamase 1', The Lancet.Infectious diseases, 10(12), pp. 830-831.
Levy, J.A. (2009) 'The unexpected pleiotropic activities of RANTES', Journal of immunology (Baltimore, Md.: 1950), 182(7), pp. 3945-3946.
Leyton, D.L., Rossiter, A.E. and Henderson, I.R. (2012a) 'From self sufficiency to dependence: mechanisms and factors important for autotransporter biogenesis', Nature Reviews Microbiology, 10(3), pp. 213-225.
Leyton, D.L., Rossiter, A.E. and Henderson, I.R. (2012b) 'From self sufficiency to dependence: mechanisms and factors important for autotransporter biogenesis', Nature Reviews Microbiology, 10(3), pp. 213-225.
Li, B., Yi, Y., Wang, Q., Woo, P.C., Tan, L., Jing, H., Gao, G.F. and Liu, C.H. (2012) 'Analysis of drug resistance determinants in Klebsiella pneumoniae isolates from a tertiary-care hospital in Beijing, China', PLoS One, 7(7), pp. e42280.
Li, B., Zhao, Y., Liu, C., Chen, Z. and Zhou, D. (2014a) 'Molecular pathogenesis of Klebsiella pneumoniae', Future Microbiology, 9(9), pp. 1071.
Li, W., Sun, G., Yu, Y., Li, N., Chen, M., Jin, R., Jiao, Y. and Wu, H. (2014b) 'Increasing occurrence of antimicrobial-resistant hypervirulent (hypermucoviscous) Klebsiella pneumoniae isolates in China', Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 58(2), pp. 225-232.
Liam, C., Lim, K. and Wong, C.M. (2001) 'Community‐acquired pneumonia in patients requiring hospitalization', Respirology, 6(3), pp. 259-264.
Liao, C.H., Hsueh, P.R., Jacoby, G.A. and Hooper, D.C. (2013) 'Risk factors and clinical characteristics of patients with qnr-positive Klebsiella pneumoniae bacteraemia', The Journal of antimicrobial chemotherapy, 68(12), pp. 2907-2914.
Liebert, C.A., Hall, R.M. and Summers, A.O. (1999) 'Transposon Tn21, flagship of the floating genome', Microbiology and molecular biology reviews : MMBR, 63(3), pp. 507-522.
Lin, T., Yang, F., Yang, A., Peng, H., Li, T., Tsai, M., Wu, S. and Wang, J. (2012) 'Amino acid substitutions of MagA in Klebsiella pneumoniae affect the biosynthesis of the capsular polysaccharide', PloS one, 7(10), pp. e46783.
Lin, T.L., Lee, C.Z., Hsieh, P.F., Tsai, S.F. and Wang, J.T. (2008) 'Characterization of integrative and conjugative element ICEKp1-associated genomic heterogeneity in a Klebsiella pneumoniae strain isolated from a primary liver abscess', Journal of Bacteriology, 190(2), pp. 515-526.
254 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Linares, D., Jean, N., Van Overtvelt, P., Ouidir, T., Hardouin, J., Blache, Y. and Molmeret, M. (2016) 'The marine bacteria Shewanella frigidimarina NCIMB400 upregulates the type VI secretion system during early biofilm formation', Environmental microbiology reports, 8(1), pp. 110-121.
Lindeberg, M., Biehl, B.S., Glasner, J.D., Perna, N.T., Collmer, A. and Collmer, C.W. (2009) 'Gene Ontology annotation highlights shared and divergent pathogenic strategies of type III effector proteins deployed by the plant pathogen Pseudomonas syringae pv tomato DC3000 and animal pathogenic Escherichia coli strains', BMC microbiology, 9(1), pp. 1.
Liu, B. and Pop, M. (2008) 'ARDB—antibiotic resistance genes database', Nucleic acids research, 37(suppl_1), pp. D443-D447.
Liu, H., Coulthurst, S.J., Pritchard, L., Hedley, P.E., Ravensdale, M., Humphris, S., Burr, T., Takle, G., Brurberg, M. and Birch, P.R. (2008) 'Quorum sensing coordinates brute force and stealth modes of infection in the plant pathogen Pectobacterium atrosepticum', PLoS Pathog, 4(6), pp. e1000093.
Liu, M., Guo, S., Hibbert, J.M., Jain, V., Singh, N., Wilson, N.O. and Stiles, J.K. (2011) 'CXCL10/IP-10 in infectious diseases pathogenesis and potential therapeutic implications', Cytokine & growth factor reviews, 22(3), pp. 121-130.
Liu, P., Li, P., Jiang, X., Bi, D., Xie, Y., Tai, C., Deng, Z., Rajakumar, K. and Ou, H.Y. (2012a) 'Complete genome sequence of Klebsiella pneumoniae subsp. pneumoniae HS11286, a multidrug- resistant strain isolated from human sputum', Journal of Bacteriology, 194(7), pp. 1841-1842.
Liu, P., Li, P., Jiang, X., Bi, D., Xie, Y., Tai, C., Deng, Z., Rajakumar, K. and Ou, H.Y. (2012b) 'Complete genome sequence of Klebsiella pneumoniae subsp. pneumoniae HS11286, a multidrug- resistant strain isolated from human sputum', Journal of Bacteriology, 194(7), pp. 1841-1842.
Livrelli, V., De Champs, C., Di Martino, P., Darfeuille-Michaud, A., Forestier, C. and Joly, B. (1996) 'Adhesive properties and antibiotic resistance of Klebsiella, Enterobacter, and Serratia clinical isolates involved in nosocomial infections', Journal of clinical microbiology, 34(8), pp. 1963-1969.
Llobet, E., Tomas, J.M. and Bengoechea, J.A. (2008) 'Capsule polysaccharide is a bacterial decoy for antimicrobial peptides', Microbiology, 154(12), pp. 3877-3886.
Llobet, E., Campos, M.A., Gimenez, P., Moranta, D. and Bengoechea, J.A. (2011) 'Analysis of the networks controlling the antimicrobial-peptide-dependent induction of Klebsiella pneumoniae virulence factors', Infection and immunity, 79(9), pp. 3718-3732.
Llobet, E., March, C., Gimenez, P. and Bengoechea, J.A. (2009) 'Klebsiella pneumoniae OmpA confers resistance to antimicrobial peptides', Antimicrobial Agents and Chemotherapy, 53(1), pp. 298-302.
Lossi, N.S., Dajani, R., Freemont, P. and Filloux, A. (2011) 'Structure–function analysis of HsiF, a gp25- like component of the type VI secretion system, in Pseudomonas aeruginosa', Microbiology, 157(12), pp. 3292-3305.
Lu, A., Zhang, Q., Zhang, J., Yang, B., Wu, K., Xie, W., Luan, Y. and Ling, E. (2014) 'Insect prophenoloxidase: the view beyond immunity', Frontiers in physiology, 5, pp. 252.
255 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Lu, H.M. and Lory, S. (1996) 'A specific targeting domain in mature exotoxin A is required for its extracellular secretion from Pseudomonas aeruginosa', The EMBO journal, 15(2), pp. 429-436.
Lue, H., Kleemann, R., Calandra, T., Roger, T. and Bernhagen, J. (2002) 'Macrophage migration inhibitory factor (MIF): mechanisms of action and role in disease', Microbes and Infection, 4(4), pp. 449-460.
Ma, A.T., McAuley, S., Pukatzki, S. and Mekalanos, J.J. (2009a) 'Translocation of a Vibrio cholerae type VI secretion effector requires bacterial endocytosis by host cells', Cell host & microbe, 5(3), pp. 234- 243.
Ma, A.T., McAuley, S., Pukatzki, S. and Mekalanos, J.J. (2009b) 'Translocation of a Vibrio cholerae type VI secretion effector requires bacterial endocytosis by host cells', Cell host & microbe, 5(3), pp. 234- 243.
Ma, A.T. and Mekalanos, J.J. (2010a) 'In vivo actin cross-linking induced by Vibrio cholerae type VI secretion system is associated with intestinal inflammation', Proceedings of the National Academy of Sciences of the United States of America, 107(9), pp. 4365-4370.
Ma, A.T. and Mekalanos, J.J. (2010b) 'In vivo Actin Cross-Linking Induced by Vibrio cholerae Type VI Secretion System Is Associated with Intestinal Inflammation', Proceedings of the National Academy of Sciences of the United States of America, 107(9), pp. 4365-4370.
Ma, L.C., Fang, C.T., Lee, C.Z., Shun, C.T. and Wang, J.T. (2005) 'Genomic heterogeneity in Klebsiella pneumoniae strains is associated with primary pyogenic liver abscess and metastatic infection', The Journal of infectious diseases, 192(1), pp. 117-128.
Ma, L.S., Lin, J.S. and Lai, E.M. (2009) 'An IcmF family protein, ImpLM, is an integral inner membrane protein interacting with ImpKL, and its walker a motif is required for type VI secretion system- mediated Hcp secretion in Agrobacterium tumefaciens', Journal of Bacteriology, 191(13), pp. 4316- 4329.
MacIntyre, D.L., Miyata, S.T., Kitaoka, M. and Pukatzki, S. (2010a) 'The Vibrio cholerae type VI secretion system displays antimicrobial properties', Proceedings of the National Academy of Sciences of the United States of America, 107(45), pp. 19520-19524.
MacIntyre, D.L., Miyata, S.T., Kitaoka, M. and Pukatzki, S. (2010b) 'The Vibrio cholerae type VI secretion system displays antimicrobial properties', Proceedings of the National Academy of Sciences of the United States of America, 107(45), pp. 19520-19524.
MacIntyre, D.L., Miyata, S.T., Kitaoka, M., Pukatzki, S. and Mekalanos, J.J. (2010c) 'The Vibrio cholerae type VI secretion system displays antimicrobial properties', Proceedings of the National Academy of Sciences of the United States of America, 107(45), pp. 19520-19524.
MAHL, M.C., WILSON, P.W., FIFE, M.A. and EWING, W.H. (1965) 'Nitrogen Fixation by Members of the Tribe Klebsielleae', Journal of Bacteriology, 89, pp. 1482-1487.
256 David Mwin Ph.D. Thesis, University of Leicester, UK. References
March, C., Cano, V., Moranta, D., Llobet, E., Pérez-Gutiérrez, C., Tomás, J.M., Suárez, T., Garmendia, J. and Bengoechea, J.A. (2013) 'Role of bacterial surface structures on the interaction of Klebsiella pneumoniae with phagocytes', PLoS One, 8(2), pp. e56847.
March, C., Moranta, D., Regueiro, V., Llobet, E., Tomas, A., Garmendia, J. and Bengoechea, J.A. (2011) 'Klebsiella pneumoniae outer membrane protein A is required to prevent the activation of airway epithelial cells', The Journal of biological chemistry, 286(12), pp. 9956-9967.
Marchler-Bauer, A., Bo, Y., Han, L., He, J., Lanczycki, C.J., Lu, S., Chitsaz, F., Derbyshire, M.K., Geer, R.C., Gonzales, N.R., Gwadz, M., Hurwitz, D.I., Lu, F., Marchler, G.H., Song, J.S., Thanki, N., Wang, Z., Yamashita, R.A., Zhang, D., Zheng, C., Geer, L.Y. and Bryant, S.H. (2017) 'CDD/SPARCLE: functional classification of proteins via subfamily domain architectures', Nucleic acids research, 45, pp. D200.
Maroncle, N.M., Sivick, K.E., Brady, R., Stokes, F.E. and Mobley, H.L. (2006) 'Protease activity, secretion, cell entry, cytotoxicity, and cellular targets of secreted autotransporter toxin of uropathogenic Escherichia coli', Infection and immunity, 74(11), pp. 6124-6134.
Marston, B.J., Plouffe, J.F., File, T.M., Hackman, B.A., Salstrom, S., Lipman, H.B., Kolczak, M.S. and Breiman, R.F. (1997) 'Incidence of community-acquired pneumonia requiring hospitalization: results of a population-based active surveillance study in Ohio', Archives of Internal Medicine, 157(15), pp. 1709-1718.
Matsuno, H., Yudoh, K., Katayama, R., Nakazawa, F., Uzuki, M., Sawai, T., Yonezawa, T., Saeki, Y., Panayi, G. and Pitzalis, C. (2002) 'The role of TNF‐α in the pathogenesis of inflammation and joint destruction in rheumatoid arthritis (RA): a study using a human RA/SCID mouse chimera', Rheumatology, 41(3), pp. 329-337.
Maurer, M. and Von Stebut, E. (2004) 'Macrophage inflammatory protein-1', The international journal of biochemistry & cell biology, 36(10), pp. 1882-1886.
Mazzariol, A., Zuliani, J., Cornaglia, G., Rossolini, G.M. and Fontana, R. (2002) 'AcrAB Efflux System: Expression and Contribution to Fluoroquinolone Resistance in Klebsiella spp', Antimicrobial Agents and Chemotherapy, 46(12), pp. 3984-3986.
McArthur, A.G., Waglechner, N., Nizam, F., Yan, A., Azad, M.A., Baylay, A.J., Bhullar, K., Canova, M.J., De Pascale, G., Ejim, L., Kalan, L., King, A.M., Koteva, K., Morar, M., Mulvey, M.R., O'Brien, J.S., Pawlowski, A.C., Piddock, L.J., Spanogiannopoulos, P., Sutherland, A.D., Tang, I., Taylor, P.L., Thaker, M., Wang, W., Yan, M., Yu, T. and Wright, G.D. (2013) 'The comprehensive antibiotic resistance database', Antimicrobial Agents and Chemotherapy, 57(7), pp. 3348-3357.
McCann, J.R. and Geme III, Joseph W St (2014) 'The HMW1C-like glycosyltransferases—an enzyme family with a sweet tooth for simple sugars', PLoS Pathog, 10(4), pp. e1003977.
McDonough, J.A., McCann, J.R., Tekippe, E.M., Silverman, J.S., Rigel, N.W. and Braunstein, M. (2008) 'Identification of functional Tat signal sequences in Mycobacterium tuberculosis proteins', Journal of Bacteriology, 190(19), pp. 6428-6438.
McLaughlin, M.M., Advincula, M.R., Malczynski, M., Barajas, G., Qi, C. and Scheetz, M.H. (2014) 'Quantifying the clinical virulence of Klebsiella pneumoniae producing carbapenemase Klebsiella
257 David Mwin Ph.D. Thesis, University of Leicester, UK. References
pneumoniae with a Galleria mellonella model and a pilot study to translate to patient outcomes', BMC infectious diseases, 14(1), pp. 1.
Mendez, M.P., Monroy, Y.K., Du, M., Preston, A.M., Tolle, L., Lin, Y., VanDussen, K.L., Samuelson, L.C., Standiford, T.J. and Curtis, J.L. (2011) 'Overexpression of sICAM-1 in the alveolar epithelial space results in an exaggerated inflammatory response and early death in Gram negative pneumonia', Respiratory research, 12(1), pp. 12.
Merino, S., Altarriba, M., Izquierdo, L., Nogueras, M.M., Regue, M. and Tomas, J.M. (2000) 'Cloning and sequencing of the Klebsiella pneumoniae O5 wb gene cluster and its role in pathogenesis', Infection and immunity, 68(5), pp. 2435-2440.
Messer, J.S., Liechty, E.R., Vogel, O.A. and Chang, E.B. (2017) 'Evolutionary and ecological forces that shape the bacterial communities of the human gut', Mucosal immunology, 10(3), pp. 567.
Metcalf, D. and Nicola, N. (1995) The hemopoietic colony-stimulating factors: from biology to clinical applications. Cambridge University Press.
Meyer, D.M., Dustin, M.L. and Carron, C.P. (1995) 'Characterization of intercellular adhesion molecule-1 ectodomain (sICAM-1) as an inhibitor of lymphocyte function-associated molecule-1 interaction with ICAM-1', Journal of immunology (Baltimore, Md.: 1950), 155(7), pp. 3578-3584.
Miethke, M. and Marahiel, M.A. (2007) 'Siderophore-based iron acquisition and pathogen control', Microbiology and molecular biology reviews : MMBR, 71(3), pp. 413-451.
Mikula, K.M., Kolodziejczyk, R. and Goldman, A. (2014) 'Yersinia infection tools—characterization of structure and function of adhesins', The pathogenic Yersiniae–advances in the understanding of physiology and virulence, , pp. 7.
Mirza, M.S., Ahmad, W., Latif, F., Haurat, J., Bally, R., Normand, P. and Malik, K.A. (2001) 'Isolation, partial characterization, and the effect of plant growth-promoting bacteria (PGPB) on micro- propagated sugarcane in vitro', Plant and Soil, 237(1), pp. 47-54.
Miyata, S.T., Kitaoka, M., Brooks, T.M., McAuley, S.B. and Pukatzki, S. (2011) 'Vibrio cholerae requires the type VI secretion system virulence factor vasx to kill Dictyostelium discoideum', Infection and immunity, 79(7), pp. 2941-2949.
Miyata, S.T., Bachmann, V. and Pukatzki, S. (2013) 'Type VI secretion system regulation as a consequence of evolutionary pressure', Journal of medical microbiology, 62(Pt 5), pp. 663.
Mobley, H.L., Island, M.D. and Hausinger, R.P. (1995) 'Molecular biology of microbial ureases', Microbiological reviews, 59(3), pp. 451-480.
Monnet, D., Freney, J., Brun, Y., Boeufgras, J. and Fleurette, J. (1991) 'Difficulties in identifying Klebsiella strains of clinical origin', Zentralblatt für Bakteriologie, 274(4), pp. 456-464.
Monnet, D. and Freney, J. (1994) 'Method for differentiating Klebsiella planticola and Klebsiella terrigena from other Klebsiella species', Journal of clinical microbiology, 32(4), pp. 1121-1122.
258 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Montgomerie, J.Z. (1979) 'Epidemiology of Klebsiella and hospital-associated infections', Reviews of infectious diseases, , pp. 736-753.
Mota, L.J. and Cornelis, G.R. (2005) 'The bacterial injection kit: type III secretion systems', Annals of Medicine, 37(4), pp. 234-249.
Mougous, J.D., Cuff, M.E., Raunser, S., Shen, A., Zhou, M., Gifford, C.A., Goodman, A.L., Joachimiak, G., Ordonez, C.L., Lory, S., Walz, T., Joachimiak, A. and Mekalanos, J.J. (2006a) 'A virulence locus of Pseudomonas aeruginosa encodes a protein secretion apparatus', Science (New York, N.Y.), 312(5779), pp. 1526-1530.
Mougous, J.D., Cuff, M.E., Raunser, S., Shen, A., Zhou, M., Gifford, C.A., Goodman, A.L., Joachimiak, G., Ordonez, C.L., Lory, S., Walz, T., Joachimiak, A. and Mekalanos, J.J. (2006b) 'A virulence locus of Pseudomonas aeruginosa encodes a protein secretion apparatus', Science (New York, N.Y.), 312(5779), pp. 1526-1530.
Moya, B., Juan, C., Alberti, S., Perez, J.L. and Oliver, A. (2008) 'Benefit of having multiple ampD genes for acquiring beta-lactam resistance without losing fitness and virulence in Pseudomonas aeruginosa', Antimicrobial Agents and Chemotherapy, 52(10), pp. 3694-3700.
Mulder, D.T., Cooper, C.A. and Coombes, B.K. (2012a) 'Type VI secretion system-associated gene clusters contribute to pathogenesis of Salmonella enterica serovar typhimurium', Infection and immunity, 80(6), pp. 1996-2007.
Mulder, D.T., Cooper, C.A. and Coombes, B.K. (2012b) 'Type VI secretion system-associated gene clusters contribute to pathogenesis of Salmonella enterica serovar typhimurium', Infection and immunity, 80(6), pp. 1996-2007.
Müller, M. (2005) 'Twin-arginine-specific protein export in Escherichia coli', Research in microbiology, 156(2), pp. 131-136.
Munoz-Price, L.S., Poirel, L., Bonomo, R.A., Schwaber, M.J., Daikos, G.L., Cormican, M., Cornaglia, G., Garau, J., Gniadkowski, M. and Hayden, M.K. (2013) 'Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases', The Lancet infectious diseases, 13(9), pp. 785-796.
Murdoch, S.L., Trunk, K., English, G., Fritsch, M.J., Pourkarimi, E. and Coulthurst, S.J. (2011a) 'The opportunistic pathogen Serratia marcescens utilizes type VI secretion to target bacterial competitors', Journal of Bacteriology, 193(21), pp. 6057-6069.
Murdoch, S.L., Trunk, K., English, G., Fritsch, M.J., Pourkarimi, E. and Coulthurst, S.J. (2011b) 'The opportunistic pathogen Serratia marcescens utilizes type VI secretion to target bacterial competitors', Journal of Bacteriology, 193(21), pp. 6057-6069.
Murin, C.D., Segal, K., Bryksin, A. and Matsumura, I. (2012) 'Expression vectors for Acinetobacter baylyi ADP1', Appl.Environ.Microbiol., 78(1), pp. 280-283.
Murphy, C.N. and Clegg, S. (2012) 'Klebsiella pneumoniae and type 3 fimbriae: nosocomial infection, regulation and biofilm formation', Future microbiology, 7(8), pp. 991-1002.
259 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Murphy, C.N., Mortensen, M.S., Krogfelt, K.A. and Clegg, S. (2013) 'Role of Klebsiella pneumoniae type 1 and type 3 fimbriae in colonizing silicone tubes implanted into the bladders of mice as a model of catheter-associated urinary tract infections', Infection and immunity, 81(8), pp. 3009-3017.
Murphy, K.C. (1998) 'Use of bacteriophage lambda recombination functions to promote gene replacement in Escherichia coli', Journal of Bacteriology, 180(8), pp. 2063-2071.
Mylonakis, E., Casadevall, A. and Ausubel, F.M. (2007) 'Exploiting amoeboid and non-vertebrate animal model systems to study the virulence of human pathogenic fungi', PLoS pathogens, 3(7), pp. e101.
Nassif, X. and Sansonetti, P.J. (1986) 'Correlation of the virulence of Klebsiella pneumoniae K1 and K2 with the presence of a plasmid encoding aerobactin', Infection and immunity, 54(3), pp. 603-608.
Natale, P., Brüser, T. and Driessen, A.J. (2008) 'Sec-and Tat-mediated protein secretion across the bacterial cytoplasmic membrane—distinct translocases and mechanisms', Biochimica et Biophysica Acta (BBA)-Biomembranes, 1778(9), pp. 1735-1756.
Niemela, S.I. and Vaatanen, P. (1982) 'Survival in lake water of Klebsiella pneumoniae discharged by a paper mill', Applied and Environmental Microbiology, 44(2), pp. 264-269.
Nuccio, S.P. and Baumler, A.J. (2007) 'Evolution of the chaperone/usher assembly pathway: fimbrial classification goes Greek', Microbiology and molecular biology reviews : MMBR, 71(4), pp. 551- 575.
Oberto, J. (2013) 'SyntTax: a web server linking synteny to prokaryotic taxonomy.(Report)', BMC Bioinformatics, 14(1).
Oberto, J. (2008) 'BAGET: a web server for the effortless retrieval of prokaryotic gene context and sequence', Bioinformatics (Oxford, England), 24(3), pp. 424.
Ochsner, U.A., Snyder, A., Vasil, A.I. and Vasil, M.L. (2002) 'Effects of the twin-arginine translocase on secretion of virulence factors, stress response, and pathogenesis', Proceedings of the National Academy of Sciences of the United States of America, 99(12), pp. 8312-8317.
Oelschlaeger, T.A. and Tall, B.D. (1997) 'Invasion of cultured human epithelial cells by Klebsiella pneumoniae isolated from the urinary tract', Infection and immunity, 65(7), pp. 2950-2958.
Ofek, I., Goldhar, J., Keisari, Y. and Sharon, N. (1995) 'Nonopsonic phagocytosis of microorganisms', Annual Reviews in Microbiology, 49(1), pp. 239-276.
Ogawa, W., Onishi, M., Ni, R., Tsuchiya, T. and Kuroda, T. (2012) 'Functional study of the novel multidrug efflux pump KexD from Klebsiella pneumoniae', Gene, 498(2), pp. 177-182.
Oh, H., Siano, B. and Diamond, S. (2008) 'Neutrophil isolation protocol', Journal of visualized experiments : JoVE, (17). pii: 745. doi(17), pp. 10.3791/745.
Okano, H., Shiraki, K., Inoue, H., Kawakita, T., Yamamoto, N., Deguchi, M., Sugimoto, K., Sakai, T., Ohmori, S. and Murata, K. (2002) 'Clinicopathological analysis of liver abscess in Japan', International journal of molecular medicine, 10, pp. 627-630.
260 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Old, D. (1972) 'Inhibition of the interaction between fimbrial haemagglutinins and erythrocytes by D- mannose and other carbohydrates', Microbiology, 71(1), pp. 149-157.
Olson, R., MacDonald, U., Pomakov, A.O., Shon, A.S., Kong, Q., Metzger, D.J., Russo, T.A. and Beanan, J.M. (2012) 'Biofilm formed by a hypervirulent (hypermucoviscous) variant of Klebsiella pneumoniae does not enhance serum resistance or survival in an in vivo abscess model', Virulence, 3(3), pp. 309-318.
Oppenheim, J., Matsushima, K., Yoshimura, T., Leonard, E. and Neta, R. (1989) 'Relationship between interleukin 1 (IL1), tumor necrosis factor (TNF) and a neutrophil attracting peptide (NAP-1)', Agents and Actions, 26(1-2), pp. 134-140.
Ørskov, I. (1984) 'Genus v. Klebsiella', Bergey's manual of systematic bacteriology, 1, pp. 461-465.
Ørskov, I. and Ørskov, F. (1984) '4 Serotyping of Klebsiella', Methods in microbiology, 14, pp. 143-164.
O'toole, G.A. and Kolter, R. (1998) 'Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis', Molecular microbiology, 28(3), pp. 449-461.
Ou, H., He, X., Harrison, E.M., Kulasekara, B.R., Thani, A.B., Kadioglu, A., Lory, S., Hinton, J.C.D., Barer, M.R., Deng, Z. and Rajakumar, K. (2007) 'MobilomeFINDER: web-based tools for in silico and experimental discovery of bacterial genomic islands', Nucleic acids research, 35, pp. W97.
Overmars, L., Kerkhoven, R., Siezen, R.J. and Francke, C. (2013) 'MGcV: the microbial genomic context viewer for comparative genome analysis', BMC Genomics, 14(1), pp. 209-209.
Padilla, E., Llobet, E., Domenech-Sanchez, A., Martinez-Martinez, L., Bengoechea, J.A. and Alberti, S. (2010a) 'Klebsiella pneumoniae AcrAB efflux pump contributes to antimicrobial resistance and virulence', Antimicrobial Agents and Chemotherapy, 54(1), pp. 177-183.
Padilla, E., Llobet, E., Domenech-Sanchez, A., Martinez-Martinez, L., Bengoechea, J.A. and Alberti, S. (2010b) 'Klebsiella pneumoniae AcrAB Efflux Pump Contributes to Antimicrobial Resistance and Virulence', Antimicrobial Agents and Chemotherapy, 54(1), pp. 177.
Page, M.J., Bester, J. and Pretorius, E. (2018) 'The inflammatory effects of TNF-α and complement component 3 on coagulation', Scientific reports, 8(1), pp. 1812.
Pan, Y., Lin, T., Chen, Y., Hsu, C., Hsieh, P., Wu, M. and Wang, J. (2013) 'Capsular types of Klebsiella pneumoniae revisited by wzc sequencing', PLoS One, 8(12), pp. e80670.
Pan, P.C., Chen, H.W., Wu, P.K., Wu, Y.Y., Lin, C.H. and Wu, J.H. (2011) 'Mutation in fucose synthesis gene of Klebsiella pneumoniae affects capsule composition and virulence in mice', Experimental biology and medicine (Maywood, N.J.), 236(2), pp. 219-226.
Pan, Y.J., Fang, H.C., Yang, H.C., Lin, T.L., Hsieh, P.F., Tsai, F.C., Keynan, Y. and Wang, J.T. (2008) 'Capsular polysaccharide synthesis regions in Klebsiella pneumoniae serotype K57 and a new capsular serotype', Journal of clinical microbiology, 46(7), pp. 2231-2240.
261 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Papanikou, E., Karamanou, S. and Economou, A. (2007) 'Bacterial protein secretion through the translocase nanomachine', Nature Reviews Microbiology, 5(11), pp. 839-851.
Parameswaran, N. and Patial, S. (2010) 'Tumor necrosis factor-α signaling in macrophages', Critical Reviews™ in Eukaryotic Gene Expression, 20(2).
Parizad, E.G., Parizad, E.G., Pakzad, I. and Valizadeh, A. (2016) 'A Review of Secretion Systems in Pathogenic and Non-Pathogenic Bacteria', Biosciences Biotechnology Research Asia, 13(1), pp. 135- 145.
Parkin, J. and Cohen, B. (2001) 'An overview of the immune system', The Lancet, 357(9270), pp. 1777- 1789.
Parsons, D.A. and Heffron, F. (2005) 'sciS, an icmF homolog in Salmonella enterica serovar Typhimurium, limits intracellular replication and decreases virulence', Infection and immunity, 73(7), pp. 4338-4345.
Partridge, S.R. (2011a) 'Analysis of antibiotic resistance regions in Gram-negative bacteria', FEMS microbiology reviews, 35(5), pp. 820-855.
Partridge, S.R. (2011b) 'Analysis of antibiotic resistance regions in Gram-negative bacteria', FEMS microbiology reviews, 35(5), pp. 820-855.
Partridge, S.R., Zong, Z. and Iredell, J.R. (2011) 'Recombination in IS26 and Tn2 in the evolution of multiresistance regions carrying blaCTX-M-15 on conjugative IncF plasmids from Escherichia coli', Antimicrobial Agents and Chemotherapy, 55(11), pp. 4971-4978.
Paterson, D.L. and Bonomo, R.A. (2005) 'Extended-spectrum beta-lactamases: a clinical update', Clinical microbiology reviews, 18(4), pp. 657-686.
Pedersen, W.L., Chakrabarty, K., Klucas, R.V. and Vidaver, A.K. (1978) 'Nitrogen fixation (acetylene reduction) associated with roots of winter wheat and sorghum in Nebraska', Applied and Environmental Microbiology, 35(1), pp. 129-135.
Pell, L.G., Kanelis, V., Donaldson, L.W., Howell, P.L. and Davidson, A.R. (2009) 'The phage lambda major tail protein structure reveals a common evolution for long-tailed phages and the type VI bacterial secretion system', Proceedings of the National Academy of Sciences of the United States of America, 106(11), pp. 4160-4165.
Perry, R.D. and San Clemente, C.L. (1979) 'Siderophore synthesis in Klebsiella pneumoniae and Shigella sonnei during iron deficiency', Journal of Bacteriology, 140(3), pp. 1129-1132.
Peters, B.M., Jabra-Rizk, M.A., O'May, G.A., Costerton, J.W. and Shirtliff, M.E. (2012) 'Polymicrobial interactions: impact on pathogenesis and human disease', Clinical microbiology reviews, 25(1), pp. 193-213.
Pfaffl, M.W. (2001) 'A new mathematical model for relative quantification in real-time RT-PCR', Nucleic acids research, 29(9), pp. e45.
262 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Picking, W.L., Nishioka, H., Hearn, P.D., Baxter, M.A., Harrington, A.T., Blocker, A. and Picking, W.D. (2005) 'IpaD of Shigella flexneri is independently required for regulation of Ipa protein secretion and efficient insertion of IpaB and IpaC into host membranes', Infection and immunity, 73(3), pp. 1432- 1440.
Piddock, L.J. (2006) 'Multidrug-resistance efflux pumps? not just for resistance', Nature Reviews Microbiology, 4(8), pp. 629-636.
Podschun, R., Acktun, H., Okpara, J., Linderkamp, O., Ullmann, U. and Borneff-Lipp, M. (1998) 'Isolation of Klebsiella planticola from newborns in a neonatal ward', Journal of clinical microbiology, 36(8), pp. 2331-2332.
Podschun, R., Pietsch, S., Holler, C. and Ullmann, U. (2001) 'Incidence of Klebsiella species in surface waters and their expression of virulence factors', Applied and Environmental Microbiology, 67(7), pp. 3325-3327.
Podschun, R. and Ullmann, U. (1998) 'Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors', Clinical microbiology reviews, 11(4), pp. 589-603.
Pohlner, J., Halter, R. and Meyer, T. (1988) 'Neisseria gonorrhoeae IgA protease. Secretion and implications for pathogenesis', in Anonymous Gonococci and Meningococci. Springer, pp. 427-432.
Pohlner, J., Halter, R., Beyreuther, K. and Meyer, T.F. (1987) 'Gene structure and extracellular secretion of Neisseria gonorrhoeae IgA protease', Nature, 325(6103), pp. 458-462.
Poirel, L., Heritier, C., Tolun, V. and Nordmann, P. (2004) 'Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae', Antimicrobial Agents and Chemotherapy, 48(1), pp. 15-22.
Pollack, M., Nieman, R., Reinhardt, J., Charache, P., Jett, M. and Hardy, P. (1972) 'Factors influencing colonisation and antibiotic-resistance patterns of gram-negative bacteria in hospital patients', The Lancet, 300(7779), pp. 668-671.
Popa, C., Netea, M.G., van Riel, P.L., van der Meer, J.W. and Stalenhoef, A.F. (2007) 'The role of TNF- alpha in chronic inflammatory conditions, intermediary metabolism, and cardiovascular risk', Journal of lipid research, 48(4), pp. 751-762.
Potgieter, P.D. and Hammond, J. (1992) 'Etiology and diagnosis of pneumonia requiring ICU admission.', CHEST Journal, 101(1), pp. 199-203.
Potvin, E., Lehoux, D.E., Kukavica‐Ibrulj, I., Richard, K.L., Sanschagrin, F., Lau, G.W. and Levesque, R.C. (2003) 'In vivo functional genomics of Pseudomonas aeruginosa for high‐throughput screening of new virulence factors and antibacterial targets', Environmental microbiology, 5(12), pp. 1294- 1308.
Pradel, N., Ye, C., Livrelli, V., Xu, J., Joly, B. and Wu, L.F. (2003) 'Contribution of the twin arginine translocation system to the virulence of enterohemorrhagic Escherichia coli O157:H7', Infection and immunity, 71(9), pp. 4908-4916.
263 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Price, S.B., Cowan, C., Perry, R.D. and Straley, S.C. (1991) 'The Yersinia pestis V antigen is a regulatory protein necessary for Ca2(+)-dependent growth and maximal expression of low-Ca2+ response virulence genes', Journal of Bacteriology, 173(8), pp. 2649-2657.
Proost, P., Wuyts, A. and Van Damme, J. (1996) 'Human monocyte chemotactic proteins‐2 and‐3: structural and functional comparison with MCP‐1', Journal of leukocyte biology, 59(1), pp. 67-74.
Pugsley, A.P., Chapon, C. and Schwartz, M. (1986) 'Extracellular pullulanase of Klebsiella pneumoniae is a lipoprotein', Journal of Bacteriology, 166(3), pp. 1083-1088.
Pukatzki, S., Ma, A.T., Sturtevant, D., Krastins, B., Sarracino, D., Nelson, W.C., Heidelberg, J.F. and Mekalanos, J.J. (2006a) 'Identification of a conserved bacterial protein secretion system in Vibrio cholerae using the Dictyostelium host model system', Proceedings of the National Academy of Sciences of the United States of America, 103(5), pp. 1528-1533.
Pukatzki, S., Ma, A.T., Revel, A.T., Sturtevant, D. and Mekalanos, J.J. (2007) 'Type VI Secretion System Translocates a Phage Tail Spike-Like Protein into Target Cells Where It Cross-Links Actin', Proceedings of the National Academy of Sciences of the United States of America, 104(39), pp. 15508-15513.
Pukatzki, S., Ma, A.T., Sturtevant, D., Krastins, B., Sarracino, D., Nelson, W.C., Heidelberg, J.F. and Mekalanos, J.J. (2006b) 'Identification of a Conserved Bacterial Protein Secretion System in Vibrio cholerae Using the Dictyostelium Host Model System', Proceedings of the National Academy of Sciences of the United States of America, 103(5), pp. 1528-1533.
Qi, Y., Wei, Z., Ji, S., Du, X., Shen, P. and Yu, Y. (2010) 'ST11, the dominant clone of KPC-producing Klebsiella pneumoniae in China', Journal of Antimicrobial Chemotherapy, 66(2), pp. 307-312.
Rahn, A., Drummelsmith, J. and Whitfield, C. (1999) 'Conserved organization in the cps gene clusters for expression of Escherichia coli group 1 K antigens: relationship to the colanic acid biosynthesis locus and the cps genes from Klebsiella pneumoniae', Journal of Bacteriology, 181(7), pp. 2307-2313.
Ramirez, M.S., Traglia, G.M., Lin, D.L., Tran, T. and Tolmasky, M.E. (2014) 'Plasmid-Mediated Antibiotic Resistance and Virulence in Gram-negatives: the Klebsiella pneumoniae Paradigm', Microbiology spectrum, 2(5), pp. 1-15.
Ramos, P.I.P., Picão, R.C., Vespero, E.C., Pelisson, M., Zuleta, L.F.G., Almeida, L.G.P., Gerber, A.L., Vasconcelos, A.T.R., Gales, A.C. and Nicolás, M.F. (2012) 'Pyrosequencing-based analysis reveals a novel capsular gene cluster in a KPC-producing Klebsiella pneumoniae clinical isolate identified in Brazil', BMC microbiology, 12(1), pp. 1.
Reddy, J.D., Reddy, S.L., Hopkins, D.L. and Gabriel, D.W. (2007) 'TolC is required for pathogenicity of Xylella fastidiosa in Vitis vinifera grapevines', Molecular Plant-Microbe Interactions, 20(4), pp. 403-410.
Reese, M.G. (2001) 'Application of a time-delay neural network to promoter annotation in the Drosophila melanogaster genome', Computers & chemistry, 26(1), pp. 51-56.
264 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Reese, M.G. (2000) PhD thesis. University of California, Berkeley, CA/University of Hohenheim, Stuttgart, Germany.
Regue, M., Izquierdo, L., Fresno, S., Pique, N., Corsaro, M.M., Naldi, T., De Castro, C., Waidelich, D., Merino, S. and Tomas, J.M. (2005) 'A second outer-core region in Klebsiella pneumoniae lipopolysaccharide', Journal of Bacteriology, 187(12), pp. 4198-4206.
Regueiro, V., Moranta, D., Frank, C.G., Larrarte, E., Margareto, J., March, C., Garmendia, J. and Bengoechea, J.A. (2011) 'Klebsiella pneumoniae subverts the activation of inflammatory responses in a NOD1‐dependent manner', Cellular microbiology, 13(1), pp. 135-153.
Ren, M., Guo, Q., Guo, L., Lenz, M., Qian, F., Koenen, R.R., Xu, H., Schilling, A.B., Weber, C., Ye, R.D., Dinner, A.R. and Tang, W.J. (2010) 'Polymerization of MIP-1 chemokine (CCL3 and CCL4) and clearance of MIP-1 by insulin-degrading enzyme', The EMBO journal, 29(23), pp. 3952-3966.
Repizo, G.D., Gagné, S., Foucault-Grunenwald, M., Borges, V., Charpentier, X., Limansky, A.S., Gomes, J.P., Viale, A.M. and Salcedo, S.P. (2015a) 'Differential Role of the T6SS in Acinetobacter baumannii Virulence', PloS one, 10(9), pp. e0138265.
Repizo, G.D., Gagné, S., Foucault-Grunenwald, M., Borges, V., Charpentier, X., Limansky, A.S., Gomes, J.P., Viale, A.M. and Salcedo, S.P. (2015b) 'Differential Role of the T6SS in Acinetobacter baumannii Virulence: e0138265', PLoS One, 10(9).
Repizo, G.D., Gagné, S., Foucault-Grunenwald, M., Borges, V., Charpentier, X., Limansky, A.S., Gomes, J.P., Viale, A.M. and Salcedo, S.P. (2015c) 'Differential Role of the T6SS in Acinetobacter baumannii Virulence: e0138265', PLoS One, 10(9).
Repizo, G.D., Gagné, S., Foucault-Grunenwald, M., Borges, V., Charpentier, X., Limansky, A.S., Gomes, J.P., Viale, A.M. and Salcedo, S.P. (2015d) 'Differential Role of the T6SS in Acinetobacter baumannii Virulence: e0138265', PLoS One, 10(9).
Richards, M.J., Edwards, J.R., Culver, D.H. and Gaynes, R.P. (2000) 'Nosocomial infections in combined medical-surgical intensive care units in the United States', Infection Control & Hospital Epidemiology, 21(08), pp. 510-515.
Richards, M.J., Edwards, J.R., Culver, D.H. and Gaynes, R.P. (1999) 'Nosocomial infections in medical intensive care units in the United States. National Nosocomial Infections Surveillance System', Critical Care Medicine, 27(5), pp. 887-892.
Robinson, C. and Bolhuis, A. (2004) 'Tat-dependent protein targeting in prokaryotes and chloroplasts', Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1694(1), pp. 135-147.
Rose, H. and Schreier, J. (1968) 'The effect of hospitalization and antibiotic therapy on the gram-negative fecal flora.', The American Journal of the Medical Sciences, 255(4), pp. 228-236.
Rosen, D.A., Pinkner, J.S., Walker, J.N., Elam, J.S., Jones, J.M. and Hultgren, S.J. (2008) 'Molecular variations in Klebsiella pneumoniae and Escherichia coli FimH affect function and pathogenesis in the urinary tract', Infection and immunity, 76(7), pp. 3346-3356.
265 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Rosenblueth, M., Martínez, L., Silva, J. and Martínez-Romero, E. (2004) 'Klebsiella variicola, a novel species with clinical and plant-associated isolates', Systematic and applied microbiology, 27(1), pp. 27.
Ross, J. and Auger, M.'The biology of the macrophage. Burke B, Lewis CE, editors', .
Rossi, D. and Zlotnik, A. (2000) 'The biology of chemokines and their receptors', Annual Review of Immunology, 18(1), pp. 217-242.
Rossier, O. and Cianciotto, N.P. (2005) 'The Legionella pneumophila tatB gene facilitates secretion of phospholipase C, growth under iron-limiting conditions, and intracellular infection', Infection and immunity, 73(4), pp. 2020-2032.
Ruiz-Perez, F., Henderson, I.R., Leyton, D.L., Rossiter, A.E., Zhang, Y. and Nataro, J.P. (2009) 'Roles of periplasmic chaperone proteins in the biogenesis of serine protease autotransporters of Enterobacteriaceae', Journal of Bacteriology, 191(21), pp. 6571-6583.
Russell, A.B., Peterson, S.B. and Mougous, J.D. (2014) 'Type VI secretion system effectors: poisons with a purpose', Nature Reviews Microbiology, 12(2), pp. 137-148.
Russell, A.B., Hood, R.D., Bui, N.K., LeRoux, M., Vollmer, W. and Mougous, J.D. (2011a) 'Type VI secretion delivers bacteriolytic effectors to target cells', Nature, 475(7356), pp. 343-347.
Russell, A.B., Hood, R.D., Bui, N.K., LeRoux, M., Vollmer, W. and Mougous, J.D. (2011b) 'Type VI secretion delivers bacteriolytic effectors to target cells', Nature, 475(7356), pp. 343-347.
Russell, A.B., Hood, R.D., Bui, N.K., LeRoux, M., Vollmer, W. and Mougous, J.D. (2011c) 'Type VI secretion delivers bacteriolytic effectors to target cells', Nature, 475(7356), pp. 343-347.
Russell, A.B., LeRoux, M., Hathazi, K., Agnello, D.M., Ishikawa, T., Wiggins, P.A., NyuntWai, S., Mougous, J.D., Molekylär Infektionsmedicin, S.(., Institutionen för molekylärbiologi (Medicinska fakulteten), Medicinska fakulteten and Umeå universitet (2013) 'Diverse type VI secretion phospholipases are functionally plastic antibacterial effectors', Nature, 496(7446), pp. 508-512.
Russotto, V., Cortegiani, A., Raineri, S.M. and Giarratano, A. (2015) 'Bacterial contamination of inanimate surfaces and equipment in the intensive care unit', Journal of Intensive Care, 3(54).
Saenghirunvattana, S., Charoenpan, P., Kiatboonsri, S. and Aeursudkij, B. (1991) 'Nosocomial pneumonias in Thailand.', Group, .
Sahly, H., Podschun, R. and Ullmann, U. (2002) 'Klebsiella infections in the immunocompromised host', in Anonymous The Biology and Pathology of Innate Immunity Mechanisms. Springer, pp. 237-249.
Sahly, H., Aucken, H., Benedí, V.J., Forestier, C., Fussing, V., Hansen, D.S., Ofek, I., Podschun, R., Sirot, D., Tomás, J.M., Sandvang, D. and Ullmann, U. (2004) 'Increased Serum Resistance in Klebsiella pneumoniae Strains Producing Extended-Spectrum β-Lactamases', Antimicrobial Agents and Chemotherapy, 48(9), pp. 3477-3482.
266 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Sahly, H., Navon-Venezia, S., Roesler, L., Hay, A., Carmeli, Y., Podschun, R., Hennequin, C., Forestier, C. and Ofek, I. (2008) 'Extended-spectrum beta-lactamase production is associated with an increase in cell invasion and expression of fimbrial adhesins in Klebsiella pneumoniae', Antimicrobial Agents and Chemotherapy, 52(9), pp. 3029-3034.
Sahly, H., Podschun, R., Oelschlaeger, T.A., Greiwe, M., Parolis, H., Hasty, D., Kekow, J., Ullmann, U., Ofek, I. and Sela, S. (2000) 'Capsule impedes adhesion to and invasion of epithelial cells by Klebsiella pneumoniae', Infection and immunity, 68(12), pp. 6744-6749.
Saier Jr, M.H. (2006) 'Protein Secretion and Membrane Insertion Systems in Gram-Negative Bacteria', Journal of Membrane Biology, 214(1), pp. 75-90.
Salamov, V.S.A. and Solovyevand, A. (2011) 'Automatic annotation of microbial genomes and metagenomic sequences', Metagenomics and its applications in agriculture.Nova Science Publishers, Hauppauge, , pp. 61-78.
Salit, I.E. and Gotschlich, E.C. (1977) 'Hemagglutination by purified type I Escherichia coli pili', The Journal of experimental medicine, 146(5), pp. 1169-1181.
San Millan, R.M., Martinez-Ballesteros, I., Rementeria, A., Garaizar, J. and Bikandi, J. (2013) 'Online exercise for the design and simulation of PCR and PCR-RFLP experiments.(Report)', BMC Research Notes, 6(1).
Sana, T.G., Hachani, A., Bucior, I., Soscia, C., Garvis, S., Termine, E., Engel, J., Filloux, A. and Bleves, S. (2012a) 'The second type VI secretion system of Pseudomonas aeruginosa strain PAO1 is regulated by quorum sensing and fur and modulates internalization in epithelial cells', Journal of Biological Chemistry, 287(32), pp. 27095-27105.
Sana, T.G., Hachani, A., Bucior, I., Soscia, C., Garvis, S., Termine, E., Engel, J., Filloux, A. and Bleves, S. (2012b) 'The second type VI secretion system of Pseudomonas aeruginosa strain PAO1 is regulated by quorum sensing and Fur and modulates internalization in epithelial cells', The Journal of biological chemistry, 287(32), pp. 27095-27105.
Sanchez, C. (2011) 'Vibrio cholerae beats the competition', Nature Reviews Microbiology, 9(1), pp. 3.
Sandkvist, M., Michel, L.O., Hough, L.P., Morales, V.M., Bagdasarian, M., Koomey, M., DiRita, V.J. and Bagdasarian, M. (1997) 'General secretion pathway (eps) genes required for toxin secretion and outer membrane biogenesis in Vibrio cholerae', Journal of Bacteriology, 179(22), pp. 6994-7003.
Sargent, F., Stanley, N.R., Berks, B.C. and Palmer, T. (1999) 'Sec-independent protein translocation in Escherichia coli. A distinct and pivotal role for the TatB protein', The Journal of biological chemistry, 274(51), pp. 36073-36082.
Sarris, P.F., Skandalis, N., Kokkinidis, M. and Panopoulos, N.J. (2010) 'In silico analysis reveals multiple putative type VI secretion systems and effector proteins in Pseudomonas syringae pathovars', Molecular Plant Pathology, 11(6), pp. 795-804.
267 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Sarris, P.F., Zoumadakis, C., Panopoulos, N.J. and Scoulica, E.V. (2011a) 'Distribution of the putative type VI secretion system core genes in Klebsiella spp', Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 11(1), pp. 157-166.
Sarris, P.F., Zoumadakis, C., Panopoulos, N.J. and Scoulica, E.V. (2011b) 'Distribution of the putative type VI secretion system core genes in Klebsiella spp.', Infection, Genetics and Evolution, 11(1), pp. 157-166.
Satchell, K.J. (2009) 'Actin crosslinking toxins of Gram-negative bacteria', Toxins, 1(2), pp. 123-133.
Sauvonnet, N., Vignon, G., Pugsley, A.P. and Gounon, P. (2000) 'Pilus formation and protein secretion by the same machinery in Escherichia coli', The EMBO journal, 19(10), pp. 2221-2228.
Schell, M.A., Ulrich, R.L., Ribot, W.J., Brueggemann, E.E., Hines, H.B., Chen, D., Lipscomb, L., Kim, H.S., Mrázek, J., Nierman, W.C. and DeShazer, D. (2007) 'Type VI secretion is a major virulence determinant in Burkholderia mallei', Molecular microbiology, 64(6), pp. 1466-1485.
Scheller, J., Chalaris, A., Schmidt-Arras, D. and Rose-John, S. (2011) 'The pro-and anti-inflammatory properties of the cytokine interleukin-6', Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1813(5), pp. 878-888.
Schembri, M.A., Blom, J., Krogfelt, K.A. and Klemm, P. (2005) 'Capsule and fimbria interaction in Klebsiella pneumoniae', Infection and immunity, 73(8), pp. 4626-4633.
Schleimer, R.P., Kato, A., Kern, R., Kuperman, D. and Avila, P.C. (2007) 'Epithelium: at the interface of innate and adaptive immune responses', The Journal of allergy and clinical immunology, 120(6), pp. 1279-1284.
Schroeter, J. (ed.) (1889) Kriptogamen Flora von Schlesien.
Schroeter, J. (1886) 'In: F. Cohn, Kriptogamen Flora von Schlesien.', 3, pp. 131-256.
Schroll, C., Barken, K.B., Krogfelt, K.A. and Struve, C. (2010) 'Role of type 1 and type 3 fimbriae in Klebsiella pneumoniae biofilm formation', BMC microbiology, 10(1), pp. 179-179.
Schubert, D., Lechtenberg, B., Forsbach, A., Gils, M., Bahadur, S. and Schmidt, R. (2004) 'Silencing in Arabidopsis T-DNA transformants: the predominant role of a gene-specific RNA sensing mechanism versus position effects', The Plant Cell, 16(10), pp. 2561-2572.
Schwarz, S., Singh, P., Robertson, J.D., LeRoux, M., Skerrett, S.J., Goodlett, D.R., West, T.E. and Mougous, J.D. (2014) 'VgrG-5 is a Burkholderia type VI secretion system-exported protein required for multinucleated giant cell formation and virulence', Infection and immunity, 82(4), pp. 1445-1452.
Schwarz, S., West, T.E., Boyer, F., Chiang, W., Carl, M.A., Hood, R.D., Rohmer, L., Tolker-Nielsen, T., Skerrett, S.J. and Mougous, J.D. (2010a) 'Burkholderia type vi secretion systems have distinct roles in eukaryotic and bacterial cell interactions', PLoS Pathogens, 6(8), pp. 77-78.
268 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Schwarz, S., West, T.E., Boyer, F., Chiang, W., Carl, M.A., Hood, R.D., Rohmer, L., Tolker-Nielsen, T., Skerrett, S.J. and Mougous, J.D. (2010b) 'Burkholderia type vi secretion systems have distinct roles in eukaryotic and bacterial cell interactions', PLoS Pathogens, 6(8), pp. 77-78.
Schwarz, S., West, T.E., Boyer, F., Chiang, W., Carl, M.A., Hood, R.D., Rohmer, L., Tolker-Nielsen, T., Skerrett, S.J. and Mougous, J.D. (2010c) 'Burkholderia type VI secretion systems have distinct roles in eukaryotic and bacterial cell interactions', PLoS pathogens, 6(8), pp. e1001068.
Seaton, D. (2000) 'Pneumonia', in Seaton, D., Seaton and Leitch A.G. (eds.) Crofton and Douglas's respiratory diseases . 1st edn. Malden, MA.: Blackwell Science, pp. 406-407.
Seidler, R.J. (1981) 'The genus Klebsiella (nonmedical aspects)', The Prokaryotes: a handbook on habitats, isolation, and identification of bacteria.Berlin: Springer-Verlag, , pp. 1166-1172.
SELDEN, R., Lee, S., WANG, W.L.L., BENNETT, J.V. and EICKHOFF, T.C. (1971) 'Nosocomial Klebsiella infections: intestinal colonization as a reservoir', Annals of Internal Medicine, 74(5), pp. 657-664.
Sexton, J.A., Miller, J.L., Yoneda, A., Kehl-Fie, T.E. and Vogel, J.P. (2004) 'Legionella pneumophila DotU and IcmF are required for stability of the Dot/Icm complex', Infection and immunity, 72(10), pp. 5983-5992.
Shalom, G., Shaw, J.G. and Thomas, M.S. (2007) 'In vivo expression technology identifies a type VI secretion system locus in Burkholderia pseudomallei that is induced upon invasion of macrophages', Microbiology, 153(8), pp. 2689-2699.
Shankar-Sinha, S., Valencia, G.A., Janes, B.K., Rosenberg, J.K., Whitfield, C., Bender, R.A., Standiford, T.J. and Younger, J.G. (2004a) 'The Klebsiella pneumoniae O antigen contributes to bacteremia and lethality during murine pneumonia', Infection and immunity, 72(3), pp. 1423-1430.
Shankar-Sinha, S., Valencia, G.A., Janes, B.K., Rosenberg, J.K., Whitfield, C., Bender, R.A., Standiford, T.J. and Younger, J.G. (2004b) 'The Klebsiella pneumoniae O antigen contributes to bacteremia and lethality during murine pneumonia', Infection and immunity, 72(3), pp. 1423-1430.
Sharma, S.K., Fatma, T. and Thukral, S.S. (1999) 'A simple and rapid serum bactericidal assay and its evaluation in clinical isolates of Klebsiella pneumoniae', Journal of microbiological methods, 39(1), pp. 45-48.
Sherry, B., Tekamp-Olson, P., Gallegos, C., Bauer, D., Davatelis, G., Wolpe, S.D., Masiarz, F., Coit, D. and Cerami, A. (1988) 'Resolution of the two components of macrophage inflammatory protein 1, and cloning and characterization of one of those components, macrophage inflammatory protein 1 beta', The Journal of experimental medicine, 168(6), pp. 2251-2259.
Shevchik, V.E., Robert-Baudouy, J. and Condemine, G. (1997) 'Specific interaction between OutD, an Erwinia chrysanthemi outer membrane protein of the general secretory pathway, and secreted proteins', The EMBO journal, 16(11), pp. 3007-3016.
269 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Shin, J. and Soo Ko, K. (2014) 'Single origin of three plasmids bearing blaCTX-M-15 from different Klebsiella pneumoniae clones', The Journal of antimicrobial chemotherapy, 69(4), pp. 969-972.
Shneider, M.M., Buth, S.A., Ho, B.T., Basler, M., Mekalanos, J.J. and Leiman, P.G. (2013a) 'PAAR- repeat proteins sharpen and diversify the type VI secretion system spike', Nature, 500(7462), pp. 350-353.
Shneider, M.M., Buth, S.A., Ho, B.T., Basler, M., Mekalanos, J.J. and Leiman, P.G. (2013b) 'PAAR- repeat proteins sharpen and diversify the type VI secretion system spike', Nature, 500(7462), pp. 350-353.
Shon, A.S., Bajwa, R.P. and Russo, T.A. (2013) 'Hypervirulent (hypermucoviscous) Klebsiella pneumoniae: a new and dangerous breed', Virulence, 4(2), pp. 107-118.
Shon, A.S. and Russo, T.A. (2012) 'Hypervirulent Klebsiella pneumoniae: the next superbug?', Future microbiology, 7(6), pp. 669-671.
Short, J.M., Fernandez, J.M., Sorge, J.A. and Huse, W.D. (1988) 'λ ZAP: a bacteriophage λ expression vector with in vivo excision properties', Nucleic acids research, 16(15), pp. 7583-7600.
Shrivastav, A., Lee, J., Kim, H.Y. and Kim, Y.R. (2013) 'Recent insights in the removal of Klebseilla pathogenicity factors for the industrial production of 2,3-butanediol', Journal of microbiology and biotechnology, 23(7), pp. 885-896.
Shrivastava, S. and Mande, S.S. (2008) 'Identification and functional characterization of gene components of Type VI Secretion system in bacterial genomes', PloS one, 3(8), pp. e2955.
Shu, H., Fung, C., Liu, Y., Wu, K., Chen, Y., Li, L., Liu, T., Kirby, R. and Tsai, S. (2009) 'Genetic diversity of capsular polysaccharide biosynthesis in Klebsiella pneumoniae clinical isolates', Microbiology, 155(12), pp. 4170-4183.
Shyntum, D.Y., Venter, S.N., Moleleki, L.N., Toth, I. and Coutinho, T.A. (2014) 'Comparative genomics of type VI secretion systems in strains of Pantoea ananatis from different environments', BMC genomics, 15(1), pp. 1.
Siddiqui, R., Lakhundi, S. and Khan, N.A. (2015) 'Interactions of Pseudomonas aeruginosa and Corynebacterium spp. with non-phagocytic brain microvascular endothelial cells and phagocytic Acanthamoeba castellanii', Parasitology research, 114(6), pp. 2349-2356.
Siddiqui, R., Malik, H., Sagheer, M., Jung, S. and Khan, N.A. (2011) 'The type III secretion system is involved in Escherichia coli K1 interactions with Acanthamoeba', Experimental parasitology, 128(4), pp. 409-413.
Silverman, J.M., Brunet, Y.R., Cascales, E. and Mougous, J.D. (2012a) 'Structure and regulation of the type VI secretion system', Annual Review of Microbiology, 66, pp. 453-472.
Silverman, J.M., Brunet, Y.R., Cascales, E. and Mougous, J.D. (2012b) 'Structure and regulation of the type VI secretion system', Annual Review of Microbiology, 66, pp. 453-472.
270 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Sirot, D., Sirot, J., Labia, R., Morand, A., Courvalin, P., Darfeuille-Michaud, A., Perroux, R. and Cluzel, R. (1987) 'Transferable resistance to third-generation cephalosporins in clinical isolates of Klebsiella pneumoniae: identification of CTX-1, a novel beta-lactamase', The Journal of antimicrobial chemotherapy, 20(3), pp. 323-334.
Sistrunk, J.R., Nickerson, K.P., Chanin, R.B., Rasko, D.A. and Faherty, C.S. (2016) 'Survival of the Fittest: How Bacterial Pathogens Utilize Bile To Enhance Infection', Clinical microbiology reviews, 29(4), pp. 819-836.
Sjogren, R.E. and Gibson, M.J. (1981) 'Bacterial survival in a dilute environment', Applied and Environmental Microbiology, 41(6), pp. 1331-1336.
Skerman, V.B.D., McGowan, V. and Sneath, P.H.A. (1989) Approve Lists of Bacterial Names. Amended edition edn. Washington: American Society for Microbiology.
Söderhäll, K. and Cerenius, L. (1998) 'Role of the prophenoloxidase-activating system in invertebrate immunity', Current opinion in immunology, 10(1), pp. 23-28.
Son, D., Parl, A.K., Montgomery Rice, V. and Khabele, D. (2007) 'Keratinocyte chemoattractant (KC)/human growth-regulated oncogene (GRO) chemokines and pro-inflammatory chemokine networks in mouse and human ovarian epithelial cancer cells', Cancer biology & therapy, 6(8), pp. 1308-1318.
Songer, J.G. (1997) 'Bacterial phospholipases and their role in virulence', Trends in microbiology, 5(4), pp. 156-161.
Souza, R.C., Saji, Guadalupe del Rosario Quispe, Costa, M.O., Netto, D.S., Lima, N.C., Klein, C.C., Vasconcelos, A.T.R. and Nicolás, M.F. (2012) 'AtlasT4SS: a curated database for type IV secretion systems', BMC microbiology, 12(1), pp. 1.
Srinivasan, V.B., Venkataramaiah, M., Mondal, A., Vaidyanathan, V., Govil, T. and Rajamohan, G. (2012) 'Functional characterization of a novel outer membrane porin KpnO, regulated by PhoBR two-component system in Klebsiella pneumoniae NTUH-K2044', PloS one, 7(7), pp. e41505.
Stahlhut, S.G., Struve, C. and Krogfelt, K.A. (2012) 'Klebsiella pneumoniae type 3 fimbriae agglutinate yeast in a mannose-resistant manner', Journal of medical microbiology, 61(3), pp. 317-322.
Stahlhut, S.G., Struve, C., Krogfelt, K.A. and Reisner, A. (2012) 'Biofilm formation of Klebsiella pneumoniae on urethral catheters requires either type 1 or type 3 fimbriae', FEMS Immunology & Medical Microbiology, 65(2), pp. 350-359.
Stanke, F. (2015) 'The Contribution of the Airway Epithelial Cell to Host Defense', Mediators of inflammation, 2015, pp. 463016.
Steinert, M. and Heuner, K. (2005) 'Dictyostelium as host model for pathogenesis', Cellular microbiology, 7(3), pp. 307-314.
271 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Struve, C., Bojer, M. and Krogfelt, K.A. (2009) 'Identification of a conserved chromosomal region encoding Klebsiella pneumoniae type 1 and type 3 fimbriae and assessment of the role of fimbriae in pathogenicity', Infection and immunity, 77(11), pp. 5016-5024.
Struve, C. and Krogfelt, K.A. (2003) 'Role of capsule in Klebsiella pneumoniae virulence: lack of correlation between in vitro and in vivo studies', FEMS microbiology letters, 218(1), pp. 149-154.
Struve, C., Roe, C.C., Stegger, M., Stahlhut, S.G., Hansen, D.S., Engelthaler, D.M., Andersen, P.S., Driebe, E.M., Keim, P. and Krogfelt, K.A. (2015) 'Mapping the Evolution of Hypervirulent Klebsiella pneumoniae', mBio, 6(4), pp. e00630-15.
Stubbendieck, R.M., Vargas-Bautista, C. and Straight, P.D. (2016) 'Bacterial communities: interactions to scale', Frontiers in microbiology, 7, pp. 1234.
Suarez, G., Sierra, J.C., Sha, J., Wang, S., Erova, T.E., Fadl, A.A., Foltz, S.M., Horneman, A.J. and Chopra, A.K. (2008) 'Molecular characterization of a functional type VI secretion system from a clinical isolate of Aeromonas hydrophila', Microbial pathogenesis, 44(4), pp. 344-361.
Suarez, G., Sierra, J.C., Erova, T.E., Sha, J., Horneman, A.J. and Chopra, A.K. (2010a) 'A type VI secretion system effector protein, VgrG1, from Aeromonas hydrophila that induces host cell toxicity by ADP ribosylation of actin', Journal of Bacteriology, 192(1), pp. 155-168.
Suarez, G., Sierra, J.C., Kirtley, M.L. and Chopra, A.K. (2010b) 'Role of Hcp, a type 6 secretion system effector, of Aeromonas hydrophila in modulating activation of host immune cells', Microbiology, 156(12), pp. 3678-3688.
Sun, W.W., Syu, W., Ho, W., Lin, C., Tsai, S. and Wang, S. (2014) 'SitA contributes to the virulence of Klebsiella pneumoniae in a mouse infection model', Microbes and Infection, 16(2), pp. 161-170.
Symmons, M.F., Bokma, E., Koronakis, E., Hughes, C. and Koronakis, V. (2009) 'The assembled structure of a complete tripartite bacterial multidrug efflux pump', Proceedings of the National Academy of Sciences of the United States of America, 106(17), pp. 7173-7178.
Tablan, O.C., Anderson, L.J., Arden, N.H., Breiman, R.F., Butler, J.C., McNeil, M.M. and Pearson, M.L. (1997) 'Guidelines for prevention of nosocomial pneumonia', Morbidity and Mortality Weekly Report: Recommendations and Reports, , pp. i-79.
Tablan, O.C., Anderson, L.J., Arden, N.H., Breiman, R.P., Butler, J.C. and McNeil, M.M. (1994) 'Guideline for prevention of nosocomial pneumonia', Infection Control & Hospital Epidemiology, 15(09), pp. 588-627.
Tan, K.S., Chen, Y., Lim, Y.C., Tan, G.Y., Liu, Y., Lim, Y.T., Macary, P. and Gan, Y.H. (2010) 'Suppression of host innate immune response by Burkholderia pseudomallei through the virulence factor TssM', Journal of immunology (Baltimore, Md.: 1950), 184(9), pp. 5160-5171.
Tanaka, T., Narazaki, M. and Kishimoto, T. (2014) 'IL-6 in inflammation, immunity, and disease', Cold Spring Harbor perspectives in biology, 6(10), pp. a016295.
272 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Tauschek, M., Gorrell, R.J., Strugnell, R.A. and Robins-Browne, R.M. (2002) 'Identification of a protein secretory pathway for the secretion of heat-labile enterotoxin by an enterotoxigenic strain of Escherichia coli', Proceedings of the National Academy of Sciences of the United States of America, 99(10), pp. 7066-7071.
Thakur, A.K. and Fezio, W.L. (1981) 'A computer program for estimating LD50 and its confidence limits using modified Behrens-Reed-Muench cumulant method', Drug and chemical toxicology, 4(3), pp. 297-305.
Thomas, C.M. and Nielsen, K.M. (2005) 'Mechanisms of, and barriers to, horizontal gene transfer between bacteria', Nature reviews microbiology, 3(9), pp. 711.
Thomas, S., Holland, I.B. and Schmitt, L. (2014) 'The type 1 secretion pathway—the hemolysin system and beyond', Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1843(8), pp. 1629- 1641.
Tian, Y., Zhao, Y., Wu, X., Liu, F., Hu, B. and Walcott, R.R. (2015) 'The type VI protein secretion system contributes to biofilm formation and seed‐to‐seedling transmission of A Cidovorax citrulli on melon', Molecular plant pathology, 16(1), pp. 38-47.
Toleman, M.A. and Walsh, T.R. (2008) 'Evolution of the ISCR3 group of ISCR elements', Antimicrobial Agents and Chemotherapy, 52(10), pp. 3789-3791.
Tóth, A., Kocsis, B., Damjanova, I., Kristóf, K., Jánvári, L., Pászti, J., Csercsik, R., Topf, J., Szabó, D. and Hamar, P. (2014) 'Fitness cost associated with resistance to fluoroquinolones is diverse across clones of Klebsiella pneumoniae and may select for CTX-M-15 type extended-spectrum β- lactamase', European journal of clinical microbiology & infectious diseases, 33(5), pp. 837-843.
Trevisan, V. (1887) 'Sul micrococco della rabia e sulla possibilità di r iconoscere durante il periodo d’incubazione, dall’esame del sangue della persona morsicata, se ha contratta l’infezione rabbica. R. C', Ist. Lombardo, 20(ser. II), pp. 88-105.
Trevisan, V. (1885) 'Caratteri di alcuni nuovi generi di Batteriaceae', Atti. Accad. fis.- med-stat. M ilano Ser, 4(3), pp. 92-106.
Troisfontaines, P. and Cornelis, G.R. (2005) 'Type III secretion: more systems than you think', Physiology (Bethesda, Md.), 20, pp. 326-339.
Trokter, M., Felisberto-Rodrigues, C., Christie, P.J. and Waksman, G. (2014) 'Recent advances in the structural and molecular biology of type IV secretion systems', Current opinion in structural biology, 27, pp. 16-23.
Tsai, F., Huang, Y., Chang, L. and Wang, J. (2008) 'Pyogenic liver abscess as endemic disease, Taiwan', Emerg Infect Dis, 14(10), pp. 1592-1600.
Tsai, Y.K., Fung, C.P., Lin, J.C., Chen, J.H., Chang, F.Y., Chen, T.L. and Siu, L.K. (2011) 'Klebsiella pneumoniae outer membrane porins OmpK35 and OmpK36 play roles in both antimicrobial resistance and virulence', Antimicrobial Agents and Chemotherapy, 55(4), pp. 1485-1493.
273 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Tseng, T., Tyler, B.M. and Setubal, J.C. (2009) 'Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology', BMC microbiology, 9(1), pp. 1.
Tugal, D., Lynch, M., Hujer, A.M., Rudin, S., Perez, F. and Bonomo, R.A. (2015) 'Multi-drug-resistant Klebsiella pneumoniae pancreatitis: a new challenge in a serious surgical infection', Surgical infections, 16(2), pp. 188-193.
Ungureanu, V.A., Stratakos, A.C., Gundogdu, O., Stef, L., Pet, I., Pet, E., Pacala, N. and Corcionivoschi, N. (2019) 'Virulence of a T6SS Campylobacter jejuni chicken isolate from North Romania', BMC Research Notes, 12(1), pp. 180.
Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M. and Rozen, S.G. (2012) 'Primer3--new capabilities and interfaces', Nucleic acids research, 40(15), pp. e115.
Unterweger, D., Miyata, S.T., Bachmann, V., Brooks, T.M., Mullins, T., Kostiuk, B., Provenzano, D. and Pukatzki, S. (2014a) 'The Vibrio cholerae type VI secretion system employs diverse effector modules for intraspecific competition', Nature communications, 5, pp. 3549.
Unterweger, D., Kitaoka, M., Miyata, S.T., Bachmann, V., Brooks, T.M., Moloney, J., Sosa, O., Silva, D., Duran-Gonzalez, J., Provenzano, D. and Pukatzki, S. (2012) 'Constitutive Type VI Secretion System Expression Gives Vibrio cholerae Intra- and Interspecific Competitive Advantages: e48320', PLoS One, 7(10).
Unterweger, D., Miyata, S.T., Bachmann, V., Brooks, T.M., Mullins, T., Kostiuk, B., Provenzano, D. and Pukatzki, S. (2014b) 'The Vibrio cholerae type VI secretion system employs diverse effector modules for intraspecific competition', Nature communications, 5, pp. 3549.
Ushach, I. and Zlotnik, A. (2016) 'Biological role of granulocyte macrophage colony‐stimulating factor (GM‐CSF) and macrophage colony‐stimulating factor (M‐CSF) on cells of the myeloid lineage', Journal of leukocyte biology, 100(3), pp. 481-489. van Aartsen, J.J. (2012) Genetic and Functional Characterisation of a Novel Klebsiella pneumoniae Genomic Island Harbouring an Accessory Chaperone/Usher Fimbrial Operon. University of Leicester. van Ulsen, P., ur Rahman, S., Jong, W.S., Daleke-Schermerhorn, M.H. and Luirink, J. (2014) 'Type V secretion: from biogenesis to biotechnology', Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1843(8), pp. 1592-1611.
Vasconcelos, G.J. and Swartz, R.G. (1976) 'Survival of bacteria in seawater using a diffusion chamber apparatus in situ', Applied and Environmental Microbiology, 31(6), pp. 913-920.
Vaysse, P., Prat, L., Mangenot, S., Cruveiller, S., Goulas, P. and Grimaud, R. (2009) 'Proteomic analysis of Marinobacter hydrocarbonoclasticus SP17 biofilm formation at the alkane-water interface reveals novel proteins and cellular processes involved in hexadecane assimilation', Research in microbiology, 160(10), pp. 829-837.
274 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Veleba, M., Higgins, P.G., Gonzalez, G., Seifert, H. and Schneiders, T. (2012) 'Characterization of RarA, a novel AraC family multidrug resistance regulator in Klebsiella pneumoniae', Antimicrobial Agents and Chemotherapy, 56(8), pp. 4450-4458.
Viale, P., Giannella, M., Lewis, R., Trecarichi, E.M., Petrosillo, N. and Tumbarello, M. (2013) 'Predictors of mortality in multidrug-resistant Klebsiella pneumoniae bloodstream infections', Expert review of anti-infective therapy, 11(10), pp. 1053-1063.
Victor, L.Y. (2007) 'Virulence characteristics of Klebsiella and clinical manifestations of K. pneumoniae bloodstream infections', Emerging Infectious Disease, 13(7), pp. 123-128.
Villalta, F., Zhang, Y., Bibb, K.E., Kappes, J.C. and Lima, M.F. (1998) 'The cysteine-cysteine family of chemokines RANTES, MIP-1alpha, and MIP-1beta induce trypanocidal activity in human macrophages via nitric oxide', Infection and immunity, 66(10), pp. 4690-4695.
Vincze, T., Posfai, J. and Roberts, R.J. (2003) 'NEBcutter: A program to cleave DNA with restriction enzymes', Nucleic acids research, 31(13), pp. 3688.
Vogwill, T. and MacLean, R.C. (2015) 'The genetic basis of the fitness costs of antimicrobial resistance: a meta‐analysis approach', Evolutionary applications, 8(3), pp. 284-295.
Von Frisch, A. (1882) 'Zur aetiologie des rhinoskleroms', Wien. Med. Wschr. Jahrg, (32), pp. 969-972.
Voth, D.E., Broederdorf, L.J. and Graham, J.G. (2012) 'Bacterial Type IV secretion systems: Versatile virulence machines', Future Microbiology, 7(2), pp. 241-257.
Voulgari, E., Zarkotou, O., Ranellou, K., Karageorgopoulos, D.E., Vrioni, G., Mamali, V., Themeli- Digalaki, K. and Tsakris, A. (2013) 'Outbreak of OXA-48 carbapenemase-producing Klebsiella pneumoniae in Greece involving an ST11 clone', The Journal of antimicrobial chemotherapy, 68(1), pp. 84-88.
Voulhoux, R., Ball, G., Ize, B., Vasil, M.L., Lazdunski, A., Wu, L.F. and Filloux, A. (2001) 'Involvement of the twin-arginine translocation system in protein secretion via the type II pathway', The EMBO journal, 20(23), pp. 6735-6741.
Wagner, J.K., Heindl, J.E., Gray, A.N., Jain, S. and Goldberg, M.B. (2009) 'Contribution of the periplasmic chaperone Skp to efficient presentation of the autotransporter IcsA on the surface of Shigella flexneri', Journal of Bacteriology, 191(3), pp. 815-821.
Waksman, G. and Hultgren, S.J. (2009) 'Structural biology of the chaperone–usher pathway of pilus biogenesis', Nature Reviews Microbiology, 7(11), pp. 765-774.
Wallden, K., Rivera-Calzada, A. and Waksman, G. (2010) 'Type IV secretion systems: versatility and diversity in function', Cellular microbiology, 12(9), pp. 1203-1212.
Wan, B., Zhang, Q., Ni, J., Li, S., Wen, D., Li, J., Xiao, H., He, P., Ou, H. and Tao, J. (2017) 'Type VI secretion system contributes to Enterohemorrhagic Escherichia coli virulence by secreting catalase against host reactive oxygen species (ROS)', PLoS pathogens, 13(3), pp. e1006246.
275 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Wand, M.E., McCowen, J.W., Nugent, P.G. and Sutton, J.M. (2013a) 'Complex interactions of Klebsiella pneumoniae with the host immune system in a Galleria mellonella infection model', Journal of medical microbiology, 62(12), pp. 1790-1798.
Wand, M., McCowen, J., Nugent, P. and Sutton, J. (2013b) 'Use of the Galleria mellonella infection model to study the opportunistic pathogen Klebsiella pneumoniae supports the presence of a multifaceted interaction with the host immune response', J Med Microbiol, 62(Pt 12), pp. 1790-1798.
Wang, R.F. and Kushner, S.R. (1991) 'Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli', Gene, 100, pp. 195-199.
Wang, X., Wang, Q., Xiao, J., Liu, Q., Wu, H., Xu, L. and Zhang, Y. (2009) 'Edwardsiella tarda T6SS component evpP is regulated by esrB and iron, and plays essential roles in the invasion of fish', Fish & shellfish immunology, 27(3), pp. 469-477.
Wang, Z., Huang, C., Huang, Y., Wu, C. and Peng, H. (2013) 'FimK regulation on the expression of type 1 fimbriae in Klebsiella pneumoniae CG43S3', Microbiology, 159(7), pp. 1402-1415.
Wang, J.H., Liu, Y.C., Lee, S.S., Yen, M.Y., Chen, Y.S., Wang, J.H., Wann, S.R. and Lin, H.H. (1998) 'Primary liver abscess due to Klebsiella pneumoniae in Taiwan', Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 26(6), pp. 1434-1438.
Weber, B., Hasic, M., Chen, C., Wai, S.N. and Milton, D.L. (2009) 'Type VI secretion modulates quorum sensing and stress response in Vibrio anguillarum', Environmental microbiology, 11(12), pp. 3018- 3028.
Weinberg, E.D. (1978) 'Iron and infection', Microbiological reviews, 42(1), pp. 45-66.
Weller, T., MacKenzie, F. and Forbes, K. (1997) 'Molecular epidemiology of a large outbreak of multiresistant Klebsiella pneumoniae', Journal of medical microbiology, 46(11), pp. 921-926.
Weyrich, L.S., Rolin, O.Y., Muse, S.J., Park, J., Spidale, N., Kennett, M.J., Hester, S.E., Chen, C., Dudley, E.G. and Harvill, E.T. (2012) 'A Type VI Secretion System Encoding Locus Is Required for Bordetella bronchiseptica Immunomodulation and Persistence In Vivo', PLoS ONE, 7(10).
Wheeler, D.L., Church, D.M., Federhen, S., Lash, A.E., Madden, T.L., Pontius, J.U., Schuler, G.D., Schriml, L.M., Sequeira, E., Tatusova, T.A. and Wagner, L. (2003) 'Database resources of the National Center for Biotechnology', Nucleic acids research, 31(1), pp. 28.
Whitfield, C. (2006) 'Biosynthesis and assembly of capsular polysaccharides in Escherichia coli', Annu.Rev.Biochem., 75, pp. 39-68.
Whitfield, C., Richards, J.C., Perry, M.B., Clarke, B.R. and MacLean, L.L. (1991) 'Expression of two structurally distinct D-galactan O antigens in the lipopolysaccharide of Klebsiella pneumoniae serotype O1', Journal of Bacteriology, 173(4), pp. 1420-1431.
Williams, P., Chart, H., Griffiths, E. and Stevenson, P. (1987) 'Expression of high affinity iron uptake systems by clinical isolates of Klebsiella', FEMS microbiology letters, 44(3), pp. 407-412.
276 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Williams, P., Lambert, P.A., Brown, M.R. and Jones, R.J. (1983) 'The role of the O and K antigens in determining the resistance of Klebsiella aerogenes to serum killing and phagocytosis', Microbiology, 129(7), pp. 2181-2191.
Witkowska, A.M. and Borawska, M.H. (2004) 'Soluble intercellular adhesion molecule‐1 (sICAM‐1): an overview', European cytokine network, 15(2), pp. 91-98.
Wloch-Salamon, D.M., Gerla, D., Hoekstra, R.F. and J. Arjan G.M de Visser (2008) 'Effect of dispersal and nutrient availability on the competitive ability of toxin-producing yeast', Proceedings of the Royal Society B: Biological Sciences, 275(1634), pp. 535-541.
Wolpe, S.D., Davatelis, G., Sherry, B., Beutler, B., Hesse, D.G., Nguyen, H.T., Moldawer, L.L., Nathan, C.F., Lowry, S.F. and Cerami, A. (1988) 'Macrophages secrete a novel heparin-binding protein with inflammatory and neutrophil chemokinetic properties', The Journal of experimental medicine, 167(2), pp. 570-581.
Wood, L., Klucas, R. and Shearman, R. (1981) 'Nitrogen fixation (acetylene reduction) by Klebsiella pneumoniae in association with'Park'Kentucky bluegrass (Poa pratensis L.)', Canadian journal of microbiology, 27(1), pp. 52-56.
Wösten, M.M.S.M., Bleumink-Pluym, N.M.C., van Alphen, L.B., Bouwman, L.I. and van Putten, J.P.M. (2013) 'Identification of a functional type VI secretion system in Campylobacter jejuni conferring capsule polysaccharide sensitive cytotoxicity', PLoS Pathogens, 9(5), pp. e1003393.
Wu, C., Huang, Y., Fung, C. and Peng, H. (2010) 'Regulation of the Klebsiella pneumoniae Kpc fimbriae by the site-specific recombinase KpcI', Microbiology, 156(7), pp. 1983-1992.
Wu, J.H., Wu, A.M., Tsai, C.G., Chang, X.Y., Tsai, S.F. and Wu, T.S. (2008) 'Contribution of fucose- containing capsules in Klebsiella pneumoniae to bacterial virulence in mice', Experimental biology and medicine (Maywood, N.J.), 233(1), pp. 64-70.
Wu, K.H. and Tai, P.C. (2004) 'Cys32 and His105 are the critical residues for the calcium-dependent cysteine proteolytic activity of CvaB, an ATP-binding cassette transporter', The Journal of biological chemistry, 279(2), pp. 901-909.
Wu, K.M., Li, L.H., Yan, J.J., Tsao, N., Liao, T.L., Tsai, H.C., Fung, C.P., Chen, H.J., Liu, Y.M., Wang, J.T., Fang, C.T., Chang, S.C., Shu, H.Y., Liu, T.T., Chen, Y.T., Shiau, Y.R., Lauderdale, T.L., Su, I.J., Kirby, R. and Tsai, S.F. (2009) 'Genome sequencing and comparative analysis of Klebsiella pneumoniae NTUH-K2044, a strain causing liver abscess and meningitis', Journal of Bacteriology, 191(14), pp. 4492-4501.
Wynn, T.A., Chawla, A. and Pollard, J.W. (2013) 'Macrophage biology in development, homeostasis and disease', Nature, 496(7446), pp. 445.
Xu, L.L., Warren, M.K., Rose, W.L., Gong, W. and Wang, J.M. (1996) 'Human recombinant monocyte chemotactic protein and other C‐C chemokines bind and induce directional migration of dendritic cells in vitro', Journal of leukocyte biology, 60(3), pp. 365-371.
277 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Yang, F.L., Yang, Y.L., Liao, P.C., Chou, J.C., Tsai, K.C., Yang, A.S., Sheu, F., Lin, T.L., Hsieh, P.F., Wang, J.T., Hua, K.F. and Wu, S.H. (2011) 'Structure and immunological characterization of the capsular polysaccharide of a pyrogenic liver abscess caused by Klebsiella pneumoniae: activation of macrophages through Toll-like receptor 4', The Journal of biological chemistry, 286(24), pp. 21041- 21051.
Yeh, K.M., Lin, J.C., Yin, F.Y., Fung, C.P., Hung, H.C., Siu, L.K. and Chang, F.Y. (2010) 'Revisiting the importance of virulence determinant magA and its surrounding genes in Klebsiella pneumoniae causing pyogenic liver abscesses: exact role in serotype K1 capsule formation', The Journal of infectious diseases, 201(8), pp. 1259-1267.
Yeung, A.T., Bains, M. and Hancock, R.E. (2011) 'The sensor kinase CbrA is a global regulator that modulates metabolism, virulence, and antibiotic resistance in Pseudomonas aeruginosa', Journal of Bacteriology, 193(4), pp. 918-931.
Yousuf, F.A., Siddiqui, R. and Khan, N.A. (2013) 'Acanthamoeba castellanii of the T4 genotype is a potential environmental host for Enterobacter aerogenes and Aeromonas hydrophila', Parasites & vectors, 6(1), pp. 169-169.
Yu, Y., Yang, H., Li, J., Zhang, P., Wu, B., Zhu, B., Zhang, Y. and Fang, W. (2012) 'Putative type VI secretion systems of Vibrio parahaemolyticus contribute to adhesion to cultured cell monolayers', Archives of Microbiology, 194(10), pp. 827-835.
Yu, W.L., Chuang, Y.C. and Walther-Rasmussen, J. (2006) 'Extended-spectrum beta-lactamases in Taiwan: epidemiology, detection, treatment and infection control', Journal of microbiology, immunology, and infection = Wei mian yu gan ran za zhi, 39(4), pp. 264-277.
Zarember, K.A. and Kuhns, D.B. (2011) 'Will the real neutrophil please stand up?', Journal of leukocyte biology, 90(6), pp. 1039-1041.
Zelová, H. and Hošek, J. (2013) 'TNF-α signalling and inflammation: interactions between old acquaintances', Inflammation Research, 62(7), pp. 641-651.
Zhang, W., Wang, Y., Song, Y., Wang, T., Xu, S., Peng, Z., Lin, X., Zhang, L. and Shen, X. (2012) 'A type VI secretion system regulated by OmpR in Yersinia pseudotuberculosis functions to maintain intracellular pH homeostasis', Environmental microbiology, .
Zheng, J. and Leung, K.Y. (2007a) 'Dissection of a type VI secretion system in Edwardsiella tarda', Molecular microbiology, 66(5), pp. 1192-1206.
Zheng, J., Ho, B. and Mekalanos, J.J. (2011a) 'Genetic analysis of anti-amoebae and anti-bacterial activities of the type vi secretion system in vibrio cholerae', PLoS ONE, 6(8).
Zheng, J., Ho, B. and Mekalanos, J.J. (2011b) 'Genetic analysis of anti-amoebae and anti-bacterial activities of the type vi secretion system in vibrio cholerae', PLoS ONE, 6(8).
Zheng, J. and Leung, K.Y. (2007b) 'Dissection of a type VI secretion system in Edwardsiella tarda', Molecular microbiology, 66(5), pp. 1192-1206.
278 David Mwin Ph.D. Thesis, University of Leicester, UK. References
Zheng, J., Shin, O.S., Cameron, D.E. and Mekalanos, J.J. (2010) 'Quorum sensing and a global regulator TsrA control expression of type VI secretion and virulence in Vibrio cholerae', Proceedings of the National Academy of Sciences of the United States of America, 107(49), pp. 21128-21133.
Zhou, Y., Tao, J., Yu, H., Ni, J., Zeng, L., Teng, Q., Kim, K.S., Zhao, G.-., Guo, X. and Yao, Y. (2012) 'Hcp family proteins secreted via the type VI secretion system coordinately regulate Escherichia coli K1 interaction with human brain microvascular endothelial cells', Infection and immunity, 80(3), pp. 1243-1251.
Zoued, A., Durand, E., Brunet, Y.R., Spinelli, S., Douzi, B., Guzzo, M., Flaugnatti, N., Legrand, P., Journet, L. and Fronzes, R. (2016) 'Priming and polymerization of a bacterial contractile tail structure', Nature, 531(7592), pp. 59-63.
Zoued, A., Durand, E., Bebeacua, C., Brunet, Y.R., Douzi, B., Cambillau, C., Cascales, E. and Journet, L. (2013) 'TssK is a trimeric cytoplasmic protein interacting with components of both phage-like and membrane anchoring complexes of the type VI secretion system', The Journal of biological chemistry, 288(38), pp. 27031-27041.
Zoued, A., Brunet, Y.R., Durand, E., Aschtgen, M., Logger, L., Douzi, B., Journet, L., Cambillau, C. and Cascales, E. (2014a) 'Architecture and assembly of the Type VI secretion system', Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 1843(8), pp. 1664-1673.
Zoued, A., Brunet, Y.R., Durand, E., Aschtgen, M., Logger, L., Douzi, B., Journet, L., Cambillau, C. and Cascales, E. (2014b) 'Architecture and assembly of the Type VI secretion system', Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 1843(8), pp. 1664-1673.
Zoued, A., Brunet, Y.R., Durand, E., Aschtgen, M., Logger, L., Douzi, B., Journet, L., Cambillau, C. and Cascales, E. (2014c) 'Architecture and assembly of the Type VI secretion system', Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 1843(8), pp. 1664-1673.
279 David Mwin Ph.D. Thesis, University of Leicester, UK. References
280 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
Appendices
281 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
Appendix 1: Primer Table Primer Sequence (5’→3’) Feature Template Purpose
GmF CGAATTAGCTTCAAAAGCGCTCTGA - pUC18R6K-mini-tn7-Gm Amplification of GmR AATTGGGGATCTTGAAGTTCCT - pUC18R6K-mini-tn7-Gm antibiotic cassettes DN1 ATACTCGAGGCCGACCAGCATTAGGATT XhoI site K. pneumoniae NTUH K2044 DN2 agagcgcttttgaagctaattcgTGGGGACTTCATTCTGGA with overlap K. pneumoniae NTUH K2044 T6SS1 mutant allele DN3 aacttcaagatccccaattAGTCTGAATATGCCGCTGG with overlap K. pneumoniae NTUH K2044 (2595 bp) in pDNTOOL-8 DN4 ATAACTAGTTCGCCTGTCAGGGATCTT SpeI site K. pneumoniae NTUH K2044 DN5 CTAGCGCATCGTAGTTCTCG - Kp. NTUH-K2044 ∆T1 T6SS1 mutation DN6 GTCGGTGGTGTTTAGCTATTCC - Kp. NTUH-K2044 ∆T1 verification primers DN7 TTATACTAGTGTTCGCTGCTTTGAAAACG SpeI site K. pneumoniae NTUH K2044 DN8 aggAacttcaagatccccaattATATTGTGGAGTAGCGTGTC with overlap K. pneumoniae NTUH K2044 T6SS3 mutant allele in DN9 tcagagcgcttttgaagctaattcgAGATACCCGGAGGAGTGC with overlap K. pneumoniae NTUH K2044 pDNTOOL-9 DN10 ATGTCTCGAGACCGTAATGCGGTTCATCTC XhoI site K. pneumoniae NTUH K2044 DN11 TCCAAAGGTGAAGGTCTTGG - Kp. NTUH-K2044 ∆T3 T6SS3 mutant verification DN12 TCACCTTCGGGCTTGTTATC - Kp. NTUH-K2044 ∆T3 primers DN13 TGAAATTGAACGCGCGAACG - pJTOOL-3 LF of pJTOOL-3 DN14 TTTAGCTTCCTTAGCTCCTGCC - pJTOOL-3 DN15 TTCCCGGGTCATGGCTGCG - pJTOOL-3 RF of pJTOOL-3 DN16 ACATCAAGGCCAAGCCCGCC - pJTOOL-3 DN17 ccatagggcaggagctaaggaagctaaaATGGTGCAATACGAATGGCGAAAAG with overlap pKOBEG-Apra aac(3)-IV for PNDTOOL-6 DN18 cgggtgtcggggcgcagccatgacccgggaaTCATGAGCTCAGCCAATCG with overlap pKOBEG-Apra DN19 ccatagggcaggagctaaggaagctaaaATGACACAAGAATCCCTGTT with overlap pMQ300 hph for PNDTOOL-7 DN20 cgggtgtcggggcgcagccatgacccgggaaTCAGGCGCCGGGGGCGGT with overlap pMQ300 DN21 tctGGGCCCATGAACATCAAAAAGTTTGCAAAAC ApaI site pJTOOL-3 sacB-cat for pDNTOOL-13 DN22 ctcTTAATTAATTACGCCCCGCCCTGCCAC PacI site pJTOOL-3 and pDNTOOL-16
282 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
DN23 tctGGGCCCACTCTTCCTTTTTCAATATTATTG ApaI site pKD46 For pDNTOOL-13 DN24 ctcTTAATTAACTGTCAGACCAAGTTTACTCATATATAC PacI site pKD46 DN25 tctGGGCCCGACATTGCACTCCACCGCTG ApaI site pKOBEG-Apra For pDNTOOL-16 DN26 ctcTTAATTAAGCGGAGAACGAGATGACGTTGGAG PacI site pKOBEG-Apra DN27 aaatgcttcaataatattgaaaaaggaagagtATGGTGCAATACGAATGG with overlap pKOBEG-Apra aac(3)-IV for PNDTOOL- DN28 taaagtatatatgagtaaacttggtctgacagTCATGAGCTCAGCCAATC with overlap pKOBEG-Apra 10 DN29 aaatgcttcaataatattgaaaaaggaagagtATGTTACGCAGCAGCAAC with overlap pUC18R6K-mini-tn7-Gm aacC1 for PNDTOOL-11 DN30 taaagtatatatgagtaaacttggtctgacagTTAGGTGGCGGTACTTGG with overlap pUC18R6K-mini-tn7-Gm DN31 aaatgcttcaataatattgaaaaaggaagagtATGATTGAACAAGATGG with overlap pJTOOL-8 aph for pNDTOOL-12 DN32 taaagtatatatgagtaaacttggtctgacagTCAGAAGAACTCGTCAAG with overlap pJTOOL-8 DN33 ctgatgtcatcagcggtggagtgcaatgtcATGACACAAGAATCCCTG with overlap pMQ300 hph for for pNDTOOL-14 DN34 ttgcccctccaacgtcatctcgttctccgcTCAGGCGCCGGGGGCGGT with overlap pMQ300 DN35 gactgatgtcatcagcggtggagtgcaatgtcATGATTGAACAAGATGGA with overlap pJTOOL-8 aph for for pNDTOOL-15 DN36 ccttgcccctccaacgtcatctcgttctccgcTCAGAAGAACTCGTCAAG with overlap pJTOOL-8 DN37 gactgatgtcatcagcggtggagtgcaatgtcATGTTACGCAGCAGCAAC with overlap pUC18R6K-mini-tn7-Gm aacC1 for pNDTOOL-17 DN38 ccttgcccctccaacgtcatctcgttctccgcTTAGGTGGCGGTACTTGG with overlap pUC18R6K-mini-tn7-Gm DN39 gtttgatgttatggagcagcaacgATGGAGAAAAAAATCACTGGATATAC with overlap pJTOOL-3 cat for pNDTOOL-32 DN40 ccgatctcggcttgaacgaattgTTACGCCCCGCCCTGCCACT with overlap pJTOOL-3 DN41 acgACGCGTatgaacatcaaaaagtttgc MluIsite pJTOOL-3 sacB-cat for pNDTOOL-31 DN42 ttgTTAATTAAttacgccccgccctgccact PacI site pJTOOL-3 DN43 catACGCGTcgttgctgctccataacatcaaac MluI site pUC18R6K-mini-tn7-Gm pUC18R6K-mini-tn7-Gm DN44 ccgTTAATTAAcaattcgttcaagccgagatcg PacI site pUC18R6K-mini-tn7-Gm for pNDTOOL-31 DN45 GCGCCCAAACATAACAGGAAG - pUC18R6K-mini-tn7-Gm LF of pUC18R6K-mini- DN46 CGTTGCTGCTCCATAACATCAAAC - pUC18R6K-mini-tn7-Gm tn7-Gm DN47 CAATTCGTTCAAGCCGAGATCGG - pUC18R6K-mini-tn7-Gm RF of pUC18R6K-mini- DN48 GCAAACTCTTCATTTTCTGAAGTGC - pUC18R6K-mini-tn7-Gm tn7R-Gm DN49 gtttgatgttatggagcagcaacgATGACACAAGAATCCCTGTTAC with overlap pMQ300 DN50 ccgatctcggcttgaacgaattgTCAGGCGCCGGGGGCGGTGT with overlap pMQ300
283 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
hph and hph-gfp for DN51 ctgtctcattgtgtacatccTCAGGCGCCGGGGGCGGTG with overlap pMQ300 pNDTOOL-33 pNDTOOL- 33 DN52 GGATGTACACAATGAGACAGAAGAGGC - pIM418 gfp for pNDTOOL-34 DN53 ccgatctcggcttgaacgaattgTTATTTGTATAGTTCATCCATG with overlap pIM418 pNDTOOL-35 DN54 gtttgatgttatggagcagcaacgATGGTGCAATACGAATGGCGAAAAG with overlap pKOBEG-Apra aac(3)-IV and aac(3)-IV- DN55 ccgatctcggcttgaacgaattgTCATGAGCTCAGCCAATCG with overlap pKOBEG-Apra gfp for pNDTOOL-1 and DN56 cttctgtctcattgtgtacatccTCATGAGCTCAGCCAATCG with overlap pKOBEG-Apra pNDTOOL-35 DN57 gtttgatgttatggagcagcaacgATGAACATCAAAAAGTTTGC with overlap pJTOOL-3 sacB for pDNTOOL36 to DN58 TTTAGCTTCCTTAGCTCCTGCCCTATG - pJTOOL-3 pDNTOOL-38 DN59 gcaggagctaaggaagctaaaATGTTACGCAGCAGCAACG with overlap pUC18R6K-mini-tn7-Gm aacC1 for pDNTOOL-36 DN60 ccgatctcggcttgaacgaattgTTAGGTGGCGGTACTTGGGTCG with overlap pUC18R6K-mini-tn7-Gm DN61 gcaggagctaaggaagctaaaATGACACAAGAATCCCTGTTAC with overlap pMQ300 hph for pDNTOOL-37 DN62 ccgatctcggcttgaacgaattgTCAGGCGCCGGGGGCGGTGT with overlap pMQ300 DN63 gcaggagctaaggaagctaaaATGGTGCAATACGAATGGCG with overlap pKOBEG-Apra aac(3)-IV for pDNTOOL- DN64 ccgatctcggcttgaacgaattgTCATGAGCTCAGCCAATCGAC with overlap pKOBEG-Apra 38 DN65 ggaTTAATTAATCCCCTGCTCGCGCAGGCTG PacI site pKOBEG-Apra aac(3)-IV for pDNTOOL-2 DN66 cacGGGCCCGTGTTGCCCCAGCAATCAG ApaI site pKOBEG-Apra DN67 ggaTTAATTAACTAAATACATTCAAATATGTATCCGCTCATGAG PacI site pMQ300 hph for pDNTOOL-18 DN68 cacGGGCCCGCCGATCTCGGCTTGAACGAATTG ApaI site pMQ300 DN69 ggaTTAATTAACCTGATTCCCTTTGTCAACAGC PacI site pUC18R6K-mini-tn7t-Gm aacC1 for pDNTOOL-20 DN70 cacGGGCCCGCCGATCTCGGCTTGAACG ApaI site pUC18R6K-mini-tn7t-Gm DN71 ggaTTAATTAACTGGACAAGGGAAAACGCAAG PacI site pJTOOL-8 aph for for pNDTOOL-21 DN72 cacGGGCCCTCGAACCCCAGAGTCCCGC ApaI site pJTOOL-8 DN73 ggaTTAATTAAAGCTTGTCTGTAAGCGGATGC PacI site pFLP2 pFLP2 backbone for pNTOOL-2, pNTOOL-18, DN74 cacGGGCCCCCAAGTTTACTCATATATAC ApaI site pFLP2 pNTOOL-20 and pNTOOL- 21
284 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
DN75 aaaCTGCAGATGCCACAATTTGGTATATTATG PstI site pFLP2 Flp for pNTOOL-19 DN76 gcgGGGCCCTTATATGCGTCTATTTATGTAG ApaI site pFLP2 DN77 catCTGCAGTTTTTATAAGCGTCGACGGCTTCACG PstI site pKOBEG-Apra pKOBEG-Apra without DN78 taaGGGCCCCGCATCCTCACGATAATAAGCTTC ApaI site pKOBEG-Apra beg for pDNTOOL-19 DN79 agtGTGCACATGAACATCAAAAAGTTTGC ApaLI site pJTOOL-3 sacB-cat for pDNTOOL-22 DN80 cagACGCGTTTACGCCCCGCCCTGCCAC MluI site pJTOOL-3 DN81 catGTGCACACTCTTCCTTTTTCAATATTATTGAAGC ApaLI site pWSK29 pWSK29 backbone for DN82 taaACGCGTCTGTCAGACCAAGTTTACTCATATATAC MluI site pWSK29 pDNTOOL-22 DN83 atgcttcaataatattgaaaaaggaagagtATGGTGCAATACGAATGGCG with overlap pDNTOOL-1 aac(3)-IV for pDNTOOL-3 DN84 aagtatatatgagtaaacttggtctgacagTCATGAGCTCAGCCAATCGA with overlap pDNTOOL-1 DN85 atgcttcaataatattgaaaaaggaagagtATGACACAAGAATCCCTGTT with overlap pMQ300 hph for pDNTOOL-4 DN86 aagtatatatgagtaaacttggtctgacagTCAGGCGCCGGGGGCGGTGT with overlap pMQ300 DN87 atgcttcaataatattgaaaaaggaagagtATGTTACGCAGCAGCAACGA with overlap pUC18R6K-mini-tn7t-Gm aacC1 for pDNTOOL-23 DN88 aagtatatatgagtaaacttggtctgacagTTAGGTGGCGGTACTTGGGT with overlap pUC18R6K-mini-tn7t-Gm DN89 atgcttcaataatattgaaaaaggaagagtATGATTGAACAAGATGGATT with overlap pJTOOL-8 aph for pDNTOOL-24 DN90 aagtatatatgagtaaacttggtctgacagTCAGAAGAACTCGTCAAGAA with overlap pJTOOL-8 DN91 atgcttcaataatattgaaaaaggaagagtATGGTGCAATACGAATGGCG with overlap pDNTOOL-35 aac(3)-IV -gfp for DN92 aagtatatatgagtaaacttggtctgacagTTATTTGTATAGTTCATCCA with overlap pDNTOOL-35 pDNTOOL-25 DN93 atgcttcaataatattgaaaaaggaagagtATGACACAAGAATCCCTGTT with overlap pDNTOOL-34 hph-gfp for pDNTOOL-26 DN94 aagtatatatgagtaaacttggtctgacagTTATTTGTATAGTTCATCCA with overlap pDNTOOL-34 DN95 atgcttcaataatattgaaaaaggaagagtATGTTACGCAGCAGCAACGA with overlap pUC18R6K-mini-tn7t-Gm DN96 tgtctcattgtgtacatccTTAGGTGGCGGTACTTGGGT with overlap pUC18R6K-mini-tn7t-Gm aacC1-gfp for pDNTOOL- - DN52 - pDNTOOL-35 27 DN97 aagtatatatgagtaaacttggtctgacagTTATTTGTATAGTTCATCCATGC with overlap pDNTOOL-35 DN99 atgcttcaataatattgaaaaaggaagagtATGATTGAACAAGATGGATT with overlap pJTOOL-8 DN100 tgtctcattgtgtacatccTCAGAAGAACTCGTCAAGAAGG with overlap pJTOOL-8 aacC1-gfp for pDNTOOL- - DN52 - pDNTOOL-35 28 - DN97 with overlap pDNTOOL-35
285 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
DN101 cctGCGGCCGCATTTTTTTGTTGCCAACGCACCG NotI site pKPHS6 pKPHS6 backbone for DN102 gccgtcaagttgtcataataaatcgCGGAACCCCTGAAGGGGCCC with overlap pKPHS6 pDNTOOL-29 DN103 gggccccttcaggggttccgCGATTTATTATGACAACTTGACGGC with overlap pKD46 Arabinose inducible promoter for pDNTOOL- DN104 cggGGTACCGTGCACCTGCAGAAGCTTTTTTTATAACCTCCTTAGAGCTC with overlap pKD46 29 DN105 attGGTACCCCGCGGCCCGGGTCTAGAACTAGTCCATGGGCATGCTT with overlap Multiple cloning site (MCS) MCS DN106 AGAACTAGTCCATGGGCATGCTTAATTAACGCATCCTCACGATAATATCC with overlap pKD46 Terminator sequence DN107 gttcaagccgagatcggctATTCTTCGTCTGTTTCTACTGGTATTG with overlap pKD46 from pKD46 DN108 caataccagtagaaacagacgaagaatAGCCGATCTCGGCTTGAACG with overlap pUC18R6K-mini-tn7t-Gm aacC1 for pDNTOOL-29 DN109 aatGCGGCCGCAAGATCCCCTGATTCCCTTTG NotI site pUC18R6K-mini-tn7t-Gm DN110 tggGCATGCGCAGAAGCAGCTGCAAAGGAGGCTGCTGCAAAGGCA SphI site - MCS-polylinker sequence DN111 gcaaaggaggctgctgcaaaggcaATGCGTAAAGGAGAAGAACTTTTC with overlap pMQ300 gfp for pDNTOOL-230 DN112 gcgTTAATTAATTATTTGTATAGTTCATCCATGCC PacI site pMQ300 DN113 GAGATGATTACTAGTCAAATGGATTG - K. pneumoniae HS11286 DN114 tcagagcgcttttgaagctaattcgCATAGCAGTTCCTTTCCTTAAGG with overlap K. pneumoniae HS11286 3166 bp KPHST6SS1 DN115 aggAacttcaagatccccaattTGGAATGGGAAGAGAAGCACAGC with overlap K. pneumoniae HS11286 mutant allele DN116 AGCAGGATGAGAAAGTCCC - K. pneumoniae HS11286 DN117 CCGCGAATGATTATATAGACCGATC - K. pneumoniae HS11286 ∆T1 For KPHS∆T1 DN118 TTCATACCGAGCCAGAACGG - K. pneumoniae HS11286 ∆T1 verification (3588 bp) DN119 GTGGTTCGCTGCTTTGAAAACG - K. pneumoniae HS11286 DN120 aggAacttcaagatccccaattATATTGTGGAGTAGCGTGTCG with overlap K. pneumoniae HS11286 3209 bp KPHST6SS1 DN121 agagcgcttttgaagctaattcgAGATGCCCGGAGGAGCGCC with overlap K. pneumoniae HS11286 mutant allele DN122 CCGTAATGCGGTTCATCTCG - K. pneumoniae HS11286 DN123 TCCAAAGGTGAAGGTCTTGGC - K. pneumoniae HS11286 ∆T3 For KPHS∆T1 DN124 TCACCTTCGGGCTTGTTATCC - K. pneumoniae HS11286 ∆T3 verification (3417 bp) DN125 CTAGCGAAAAGATGTTTCGTGAAGC -- pKOBEG-Apra For pKOBEG-Apra DN126 GCTTATTATCGTGAGGATGCGTCA - pKOBEG-Apra & derivatives verification (1949 bp) ND127 GGGAATTCGAGCTCTAAGGAGG - pKD46 and derivatives
286 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
For pKD46 and DN128 GAGGATGCGTCATCGCCATTG - pKD46 and derivatives derivatives verification (1949 bp) DN129 CTGGGAGTAATAATCCAGTGTTTAGTG - pFLP2 and derivative Presence of pFLP2 and DN130 CTACGTAGTGAGGATCTCTCAGC - pFLP2and derivative derivatives (2062 bp) DN131 ggaAGATCTCTAAATTGTAAGCGTTAATATTTTG BglII site pBleuescript II KS (II) pBluescript backbone + DN132 acaATTTAAATGTCAGACCAAGTTTACTCATATATAC SwaI site pBleuescript II KS (II) aac(3)-IV to form DN133 tagAGATCTTCCCCTGCTCGCGCAGGCTG BglII site pKOBEG-Apra pDNTOOL-39 DN134 gacATTTAAATTGTTGCCCCAGCAATCAGCGCG swaI site pKOBEG-Apra DN135 TGAATCCCCTGATGCACGAC qPCR_hcp1 K. pneumoniae HS11286 DN136 TCGTTCCAGCTATCGGAGTG qPCR_hcp1 K. pneumoniae HS11286 136 bp DN137 GGGCTTCGGCATCAATGTTC qPCR_vgrG1 K. pneumoniae HS11286 DN138 ACTGGTCCTGGTAAATGGCG qPCR_vgrG1 K. pneumoniae HS11286 167 bp DN139 ATTGCGCGCAGTGAATCATC qPCR_hcp2 K. pneumoniae HS11286 DN140 TCGACCTTCACAAAGAGCCC qPCR_hcp2 K. pneumoniae HS11286 148 bp DN141 AGCTTGATATGCTCCTCGCC qPCR_vgrG3 K. pneumoniae HS11286 DN142 GCGATTGCTTTCCACGAAGG qPCR_vgrG3 K. pneumoniae HS11286 173 bp DN143 GCGACTCCTTCCAGTTCATC qPCR_fimH K. pneumoniae HS11286 DN144 GTGGTGCCGGAGAGGTAATA qPCR_fimH K. pneumoniae HS11286 187 bp DN145 GGCTTTTTCATTCAGCAAGG qPCR_mrkD K. pneumoniae HS11286 DN146 AATGTCGATGTGGGTTCCAT qPCR_mrkD K. pneumoniae HS11286 198 bp DN147 AAAACCAAACGGCTGACAAC qPCR_virB4 K. pneumoniae HS11286 DN148 GCGGGTACAAAGGATTTTCA qPCR_virB4 K. pneumoniae HS11286 189 bp DN149 GCGGATATTATTGGCACCAC qPCR_mobB K. pneumoniae HS11286 DN150 AAAGGGTTTTCCTGCATCCT qPCR_mobB K. pneumoniae HS11286 165 bp DN151 CACAGCTGAAGCTTCTTGTCC qPCR_rpoD K. pneumoniae HS11286 DN152 ATCCGGTGCTTCTTCCATC qPCR_rpoD K. pneumoniae HS11286 164 bp
287 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
DN153 GATGACGGTTTGTCACATGG - E. coli specific To verify E. coli in co- DN154 TTGTATGTCTTCGCCGATCAG - E. coli genome specific cultures DN155 ggcAAGCTTCAAATAAAATGACAGTCATCATCCT HindII site K. pneumoniae NTUH-K2044 To amplify 1778 bp DN156 taaGTCGACGGCATCGCCCCATCAATTC SalI site K. pneumoniae NTUH K2044 ICEKP-1 oriT DN157 CCTCGTCATCCGCAGACCAA KPC2-UF-F K. pneumoniae HS11286 Amplify upstream flank, DN158 TCAGAGCGCTTTTGAAGCTAATTCGCAGTGACATCAACGATATTCCTTG KPC2-UF-R K. pneumoniae HS11286 564 bp DN159 AGGAACTTCAAGATCCCCAATTGGGCAGTAAGGCTCTGAAAATC KPC2-DF-F K. pneumoniae HS11286 Amplify downstream DN160 GTGAAGATGCCAAGGTCAAT KPC2-DF-F K. pneumoniae HS11286 flank, 522 bp DN161 AGTGGCGACTTCCTCAACAAA KPC2-Ups-F ∆KPC To amplify ∆KPC across DN162 CCGAGCAGAGCTACAACGGGT KPC2-dwF-R ∆KPC the deleted region K. pneumoniae HS11 DN163 KPC2-In-F CAGCTCATTCAAGGGCTTTC 286or∆KPC To amplify the internal K. pneumoniae HS11286 or part of KPC DN164 KPC2-In-R GCAGAGCCCAGTGTCAGTTT ∆KPC DN165 GCTGGCAATAGAATGGTTCCC MDR-UF-F ∆KPC Amplify upstream flank, DN166 TCAGAGCGCTTTTGAAGCTAATTCGTATGCTGAGACGTGTCGGGTG MDR -UF-R ∆KPC 440 bp DN167 AGGAACTTCAAGATCCCCAATTTTCTGAGCATGGTATTTTTCATGGT MDR -DF-F ∆KPC Amplify downstream DN168 CGCTTATTGACAAGGTTTGTG MDR -DF-F ∆KPC flank, 435 bp DN169 GGCGGCTGTACGGTAGTCA MDR -Ups-F DN2T or ∆KPC∆MD:hph To amplify ∆MDR across DN170 GAGCGTGGAGGCAGGAAT MDR -dwF-R DN2T or ∆KPC∆MD:hph the deleted region
DN171 ATACGGATGCTCGGGTCG MDR -In-F DN2T or ∆KPC∆MD:hph To amplify the internal DN172 TTGGTTTCTCGCAGGTGA MDR -In-R DN2T or ∆KPC∆MD:hph part of MDR
288 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
Appendix 2 Appendix 2-1: List of genes deleted from the 26 kb region
Locus tag Gene Length/aa Product KPHS_p300510 - 65 ArsR family transcriptional regulator KPHS_p300520 tnpAIS26 234 IS26 transposase KPHS_p300530 ΔtnpRTn3 185 Truncated Tn3 resolvase KPHS_p300540 blaTEM-1 286 Beta-lactamase TEM-1 KPHS_p300550 rmtB 251 16S rRNA methylase KPHS_p300560 - 182 Putative Na(+)/H(+) antiporter KPHS_p300570 groEL-intI1 125 GroEL-like/integrase protein KPHS_p300590 - 52 Hypothetical protein KPHS_p300580 tnp 217 Transposase KPHS_p300600 tnpISCR3 281 ISCR3 transposase KPHS_p300620 - 159 Putative LysR-type transcriptional regulator KPHS_p300610 - 92 Hypothetical protein KPHS_p300630 tetA 391 Tetracycline resistance protein KPHS_p300640 tetR 208 Tetracycline repressor protein class G KPHS_p300650 - 60 Hypothetical protein KPHS_p300660 floR 404 FloR KPHS_p300670 sul1Δ1 323 Truncated dihydropteroate synthetase KPHS_p300680 qacEΔ1 115 Orf3/QacEdelta1 fusion protein KPHS_p300690 aadA2 259 Aminoglycoside adenylyltransferase KPHS_p300700 - 37 Hypothetical protein KPHS_p300710 - 40 Hypothetical protein KPHS_p300720 dfrA12-like 151 DfrA12-like dihydrofolate reductase KPHS_p300730 - 337 Class I integron integrase KPHS_p300740 - 59 Putative transcriptional regulator KPHS_p300750 - 234 Hypothetical protein KPHS_p300760 aacC2 257 Aminoglycoside-(3)-N-acetyltransferase KPHS_p300770 - 180 Hypothetical protein KPHS_p300780 - 57 Hypothetical protein KPHS_p300790 - 75 Hypothetical protein KPHS_p300800 - 378 Hypothetical protein KPHS_p300810 - 49 Hypothetical protein KPHS_p300820 tnpAISCfr1 456 ISCfr1 transposase KPHS_p300830 - 41 Hypothetical protein KPHS_p300840 blaTEM-1 286 Beta-lactamase TEM-1 KPHS_p300850 - 48 Hypothetical protein KPHS_p300860 strB 278 Aminoglycoside phosphotransferase KPHS_p300870 strA 267 Aminoglycoside phosphotransferase KPHS_p300880 sul2 271 Dihydropteroate synthase
Bold highlighted locus tags are resistance (Bi et al., 2015) genes)
289 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
Appendix 2-2 Antibiotic susceptibility of K. pneumoniae HS11286 and the antibiotic disarmed versions
Antibiotics Class KR3317 ΔKPC DN2 (ΔkpcΔMDR) Piperacillin Penicillin (β-lactam) >128 [R] >128 [R] >128 [R] Cefuroxime (parenteral) Second-generation >128 [R] >128 [R] >128 [R] cephalosporin (β-lactam) Cefoxitin 32 [R] 4 [S] 4 [S] Cefotaxime Third-generation cephalosporin 64 [R] 64 [R] 32 [R] (β-lactam) Ceftriaxone >128 [R] 64 [R] 64 [R] Ceftazidime 96 [R] 4 [S] 3 [S] Cefoperazone >128 [R] >128 [R] 128 [R] Cefepime Fourth-generation 16 [R] 8 [SDD] 8 [SDD] cephalosporin (β-lactam) Ceftaroline Fifth-generation cephalosporin >32 [R] >32 [R] >32 [R] (β-lactam) Piperacillin-tazobactam β-lactam/β-lactamase inhibitor >128/4 [R] >128/4 [R] 64/4 [I] combination Cefoperazone-sulbactam a >128/64 [R] >128/64 [R] 64/32 [R] Imipenem Carbapenem (β-lactam) 8 [R] 0.125 [S] 0.125 [S] Meropenem 16 [R] 0.064 [S] 0.064 [S] Aztreonam Monobactam (β-lactam) >128 [R] 64 [R] 32 [R] Gentamicin Aminoglycoside >128 [R] >128 [R] 0.5 [S] Tobramycin >256 [R] >256 [R] 1 [S] Amikacin >128 [R] >128 [R] 0.5 [S] Streptomycin b >512 >512 8 Kanamycin >512 [R] >512 [R] 4 [S] Ciprofloxacin Second-generation 8 [R] 8 [R] 6 [R] fluoroquinolone Levofloxacin Third-generation 1 [S] 2 [S] 1 [S] fluoroquinolone Trimethoprim-sulfamethoxazole Folate pathway inhibitor >8/152 [R] >8/152 [R] 0.06/1.14 [S] Trimethoprim >512 [R] >512 [R] 2 [S] Chloramphenicol Phenicol >128 [R] >128 [R] 4 [S] Tetracycline Tetracycline 256 [R] 256 [R] 8 [I] Spectinomycin c Aminocyclitol 384 384 8 Nalidixic acid Quinolones >512 [R] >512 [R] >512 [R] Fosfomycin Fosfomycin 256 [R] 256 [R] 256 [R] Colistin Polymyxin 0.5 [S] 0.25 [S] 0.25 [S] Polymyxin B 0.5 [S] 0.5 [S] 0.5 [S] Tigecycline Glycylcycline 1 [S] 1 [S] 0.5 [S]
S, susceptible; SDD, susceptible-dose dependent; I, intermediate; R, resistant (Bi et al., 2015)
290 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
Appendix 2-3 Resistance genes identified in K. pneumoniae HS11286 that could confer resistance in Clinical cases
Replicon Gene Locus tag Product Antibiotics to which resistance is known to be conferred pKPHS1 blaCTX-M-14 KPHS_p100340 Beta-lactamase CTX-M-14 Cefotaxime, ceftriaxone, and aztreonam pKPHS2 blaKPC-2 KPHS_p200360 KPC-2 Doripenem, ertapenem, imipenem, and meropenem st blaTEM-1 KPHS_p200640 Beta-lactamase TEM-1 Penicillin antibiotics and 1 generation cephalosporin st pKPHS3 blaTEM-1 KPHS_p300540 Beta-lactamase TEM-1 Penicillin antibiotics and 1 generation cephalosporin rmtB KPHS_p300550 16S rRNA methylase Amikacin, gentamicin, tobramycin, and kanamycin tetA (G) KPHS_p300630 Tetracycline resistance protein Tetracycline floR KPHS_p300660 FloR Florfenicol and chloramphenicol sul1Δ1 KPHS_p300670 Truncated dihydropteroate Sulfonamide antibiotics synthetase qacEΔ1 KPHS_p300680 QacEdelta1 fusion protein Intercalating dyes and quaternary ammonium compounds aadA2 KPHS_p300690 Aminoglycoside adenylyltransferase Streptomycin and spectinomycin. dfrA12-like KPHS_p300720 Dihydrofolate reductase Trimethoprim aacC2 KPHS_p300760 Aminoglycoside-(3)-N- Gentamicin and tobramycin acetyltransferase st blaTEM-1 KPHS_p300840 Beta-lactamase TEM-1 Penicillin antibiotics and 1 generation cephalosporin strB KPHS_p300860 Aminoglycoside Streptomycin phosphotransferase strA KPHS_p300870 Aminoglycoside Streptomycin phosphotransferase sul2 KPHS_p300880 Dihydropteroate synthase Sulfonamide antibiotics blaCTX-M-14 KPHS_p301310 Beta-lactamase CTX-M-14 Cefotaxime, ceftriaxone, and aztreonam Chromosome blaSHV-11 KPHS_25220 Beta-lactamase SHV-11 Oxacillin, cloxacillin, cefotaxime and ceftriaxon fosA KPHS_06030 Glutathione transferase Fosfomycin
(Bi et al., 2015)
291 David Mwin Ph.D. Thesis, University of Leicester, UK. Appendices
Appendix 2-4- Distribution of mobile genetic elements in K. pneumoniae HS11286
IS Transposon Integron Prophage ICE Other GI Chromosome 30 0 0 7 2 4 pKPHS1 2 1 0 0 0 0 pKPHS2 9 4 tni-remnant 0 0 0 pKPHS3 8 4 intI1-remnant 0 0 0 pKPHS4 0 0 0 0 0 0 pKPHS5 0 0 0 0 0 0 pKPHS6 0 0 0 0 0 0 Total 49 9 2 7 2 4 (Bi et al., 2015)
Appendix 2-5 Replicons of the K. pneumoniae plasmids
Plasmid Replicon type Length (bp) GC content % pKPHS1 IncFIB 122,799 49.5 pKPHS2 IncFIIK, IncR 111,195 53.3
pKPHS3 IncA/C2 105,974 52.5 pKPHS4 ColE2-like 3,751 52.2 pKPHS5 ColE1-like 3,353 42.8 pKPHS6 Col 1,308 47.9 (Bi et al., 2015)
Appendix 2-6 Other GIs identified in K. pneumoniae HS11286 genome
Genomic island Insertion site Location Length (bp) G+C content % GI-KPHS1 NA 594569-605255 10,687 50.3 GI-KPHS2 NA 902508-906671 4,163 51.7 GI-KPHS3 NA 3243798-3257011 13,214 43.9 GI-KPHS4 NA 3555090-3587723 32,634 45.5 (Bi et al., 2015)
Appendix 2-7 T6SS gene cluster in K. pneumoniae HS11286 and NTUH-K2044
T6SS Location Length (bp) GC % T6SS1 KPHS_22970 - KPHS_23190 27024 60.34 K. pneumoniae HS11286 T6SS3 KPHS_32450 - KPHS_32770 28610 53 T6SS1 KP1_2392 – KP1_2421 29687 54 K. pneumoniae NTUH-K2044 T6SS3 KP1_3362 – KP1_3388 26379 55
292