Investigating Monoamine Regulation: the Transport of the Dopamine

Home , AMPT, Catecholamine

Investigating Monoamine Regulation: The Transport Of The Dopamine Transporter To Striatal Terminals And The Effects Of Tyrosine Hydroxylase Overexpression On Dopaminergic and Noradrenergic-Related Phenotypes

Laura Marie Vecchio

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Pharmacology and Toxicology University of Toronto

Laura Marie Vecchio

Doctorate of Philosophy

Department of Pharmacology University of Toronto

2016 Abstract

Monoamines are a class of neurotransmitter responsible for a variety of functions, from the orchestration of movement to the feeling of reward. The maintenance of homeostatic levels of monoamines in the central nervous system is largely regulated by enzymes responsible for their synthesis, by transporters that package transmitters into vesicles and by transporters clear neurotransmitters from the synaptic cleft, terminating neurotransmission. This thesis focuses on two aspects of monoaminergic regulation. The first project centres around the dopamine transporter protein, describing the biochemical features of a transgenic mouse expressing a dopamine transporter with a hemagglutinin tag at its amino terminus. The mouse was developed with the intention of using proteomic techniques to identify proteins that form a complex with the transporter and aid in its expression and functioning. However, we observed that amino-terminal tagged transporters demonstrated a disproportionally weak expression in the striatum as compared to the midbrain, where cell bodies reside, indicating an interruption of the translocation of HA-tagged transporter from the cell bodies to the terminals. The second project involved the development of a novel mouse line

ii overexpressing tyrosine hydroxylase (TH), the rate-limiting enzyme in the synthesis of dopamine and noradrenaline. The aim of this study was to determine whether increased production of catecholamines could create conditions of oxidative stress, particularly in those regions most susceptible to neurodegeneration in Parkinson's disease. The transgenic mice were extensively characterized to demonstrate that functional TH was successfully overexpressed. These mice demonstrated behavioural phenotypes consistent with deleterious dopaminergic and noradrenergic abnormalities. Moreover, they possess biochemical features indicative of oxidative stress, suggesting proof-of-principle that poorly regulated production of monoamines - particularly dopamine - could contribute to neurotoxicity in these cells.

Together, the aim of these studies was to better understand aspects of monoaminergic systems that maintain proper functioning, and factors that might contribute to a disordered condition.

iii

Acknowledgments

I would like to thank my parents, Anna and Frank Vecchio, for their constant and unfaltering support. They have long nurtured a love of learning and instilled in me a curiosity about the world around us. They have motivated me to work hard and encouraged me to hold my personal best as the benchmark for success and fulfilment. A special thank you to all of my grandparents, who moved to this country with nothing. They worked hard to build a new life so that their children and grandchildren might enjoy opportunities that they did not have; there was never a better example of what dedication, perseverance and honest hard-work could accomplish. To Nonno Magno and Nonna Anna, who remind me that they love me "three times a day", and to Nonna Assunta, who at every parting reminds me both to "eat" and "be good!", I am forever grateful.

Thank you to my sister, Christina, and to my aunts, uncles, and cousins, who have always encouraged me and taken an interest in what I was learning about "at school". Thank you to every one of my very supportive, very patient friends. To my best friend, Kevin, with whom I began graduate school: I'm so glad to have shared this incredible experience with you.

I would like to thank my supervisor, Dr. Ali Salahpour, for his mentorship: thank you for encouraging my scientific creativity, my confidence, and for helping me become a better scientist. It has been a tremendous experience. Thank you to Dr. Amy Ramsey for her generous input, support, and encouragement. I am grateful to my committee members, Drs. Susan George, Dennis Grant, Rebecca Laposa, and Anurag Tandon for their helpful insight and guidance. Thank you to Wendy Horsfall, our lab manager, teacher, and adviser — none of us could do it without you. Thank you to all of my labmates, past and present — it has been truly wonderful working with you. I am grateful for the contributions of those that have assisted me in planning/executing aspects of the experiments in this thesis: Wendy Horsfall, Pieter Beerepoot, Kristel Bermejo, Marija Milenkovic and Shababa Masoud, as well as Dr. Nikhil Urs and Dr. Gary Miller. Thank you to my students, Lien Nyugen and Lauren Tessier, for your hard work. Specific experimental acknowledgements, Vecchio et al. (2014): Radiolabelled dopamine uptake was performed by Pieter Beerepoot, and real-time PCR quantification of mRNA was performed with the assistance of Kristel Bermejo.

Table of Contents

Acknowledgments ...... iv

Table of Contents ...... v

List of Abbreviations ...... x

List of Tables ...... xv

List of Figures ...... xvi

List of Appendices ...... xx

Chapter 1 Introduction ...... 1

1 Introduction and Literature Review ...... 1

1.1 Preface ...... 1

1.2 Monoamines ...... 4

1.3 Dopamine ...... 5

1.3.1 Dopamine Pathways ...... 5

1.3.2 Dopamine Transmission ...... 7

1.3.3 The Relationship between Trace Monoamines and Dopamine ...... 9

1.4 Noradrenaline ...... 10

1.4.1 Central Noradrenergic Pathways ...... 11

1.4.2 The Locus Coeruleus: a Hub of Connectivity ...... 13

1.4.3 Peripheral Noradrenaline ...... 14

1.4.4 Adrenoreceptors and Noradrenaline Transmission ...... 15

1.5 Drugs and Monoaminergic Systems ...... 16

1.6 Tyrosine Hydroxylase and the Production of Monoamines ...... 17

1.6.1 Phosphorylation and the Activity of Tyrosine Hydroxylase ...... 20

1.6.2 Regulation of Tyrosine Hydroxylase Activity ...... 24

1.7 Monoamine Transport Proteins ...... 28

1.7.1 The Dopamine Transporter ...... 30

1.8 Diseases That Affect Monoamergic Systems ...... 34

1.9 Parkinson's Disease ...... 35

1.9.1 Genetic Heritability and Environmental Risks ...... 36

1.9.2 Staging and Neuropathology ...... 38

1.9.3 Symptoms ...... 43

1.9.4 Mechanisms of Cell Toxicity...... 45

1.9.5 Animal Models of Parkinson's Disease ...... 52

1.10 Oxidative Stress and Tyrosine Hydroxylase...... 58

1.11 Project One: Rationale and Hypothesis ...... 62

1.12 Project Two: Rationale and Hypothesis ...... 63

Chapter 2 Methodology, Project One ...... 67

2 Methods for Project One: N-terminal Tagging of the Dopamine Transporter ...... 67

2.1 Development of Transgenic Mice Expressing HA-tagged Dopamine Transporter...... 67

2.2 Molecular and Biochemical Assessments ...... 71

2.2.1 Quantitative PCR ...... 71

2.2.2 Protein Quantification by Western Blot ...... 72

2.2.3 Immunohistochemistry ...... 74

2.2.4 Radiolabelled Dopamine Uptake into Striatal Synaptosomes ...... 76

2.3 Behavioural Phenotypes ...... 77

2.3.1 Locomotor Analysis...... 77

2.3.2 Rescue of DAT-KO Mice ...... 77

2.3.3 Amphetamine Challenge ...... 79

2.3.4 Statistics ...... 79

Chapter 3 Methodology, Project Two and Three ...... 80

3 Methods for Project Two and Three: The Biochemical and Behavioural Consequences of Tyrosine Hydroxylase-Overexpression ...... 80

3.1 Generation of Tyrosine Hydroxylase-Overexpressing Mice ...... 80

3.2 Molecular and Biochemical Assessments ...... 81

3.2.1 Quantitative PCR ...... 81

3.2.2 Western Blot ...... 82

3.2.3 Immunohistochemistry ...... 84

3.2.4 Tissue Content ...... 84

3.2.5 Glutathione Assay ...... 86

3.3 Behavioural Phenotypes ...... 86

3.3.1 Locomotor Analysis...... 86

3.3.2 Y Maze...... 87

3.3.3 The Puzzle Box ...... 87

3.3.4 Challenging Beam Traversal ...... 91

3.3.5 Pre-Pulse Inhibition ...... 91

3.3.6 Elevated Plus Maze...... 92

3.3.7 Statistics ...... 94

Chapter 4 Results ...... 95

4 Project One: N-Terminal Tagging of the Dopamine Transporter Impairs Protein Expression and Trafficking In Vivo ...... 95

4.1 Generation of Transgenic Mice Expressing HA-tagged Dopamine Transporter ...... 95

4.1.1 HA-DAT Is Expressed in Regions Endogenously Expressing DAT...... 96

4.1.2 N-Terminal Tagging of the Dopamine Transporter Interrupts Expression in the Striatum...... 103

vii

4.1.3 HA-tagged DAT Expression Partially Rescues Hyperactivity of DAT Knockout Mice ...... 103

4.1.4 Response to Amphetamine is Attenuated in Mice Expressing Only HA- tagged DAT ...... 106

4.1.5 N-Terminal HA Tagging of DAT Interrupts Transport from the Midbrain to Striatum ...... 109

Chapter 5 Results ...... 113

5 Project Two: The Influence of High-Copy Tyrosine Hydroxylase Overexpression On Biochemical and Behavioural Features of the Dopaminergic and Noradrenergic Systems ...... 113

5.1 Development of Transgenic Mice Overexpressing Tyrosine Hydroylase ...... 113

5.2 Biochemical Characteristics of TH-HI Mice ...... 116

5.2.1 TH Protein Expression and Enzymatic Activity in Dopaminergic Regions: The striatum and midbrain ...... 116

5.2.2 Expression of TH at the Site of Central Noradrenaline Synthesis: The locus coeruleus...... 122

5.2.3 Expression of TH in the Periphery: The adrenal medulla ...... 122

5.2.4 Tissue Content of Dopamine and Its Metabolites ...... 124

5.2.5 Expression of Proteins Regulating the Synthesis and Localization of Dopamine In The Cell ...... 125

5.2.6 Markers of Oxidative Stress in TH-HI Mice ...... 129

5.3 Behavioural Phenotype of TH-HI Mice ...... 129

5.3.1 Locomotor Response to Psychostimulant Drug Challenges ...... 129

5.3.2 Assessment of Fine Motor Skills ...... 134

5.3.3 Anxiety Assessments by Elevated Plus Maze ...... 136

5.3.4 Sensory-Motor Gating ...... 136

5.3.5 Spatial Memory and Cognitive Flexibility ...... 136

Chapter 6 Results ...... 143

viii

6 Project Three: The Biochemical and Behavioural Consequence of Tyrosine Hydroxylase Overexpression in a Transgenic Mouse With Three Gene Copies...... 143

6.1 Development and Biochemical Characterization of TH-Y Mice ...... 143

6.2 Behavioural Characterization of TH-Y Mice ...... 150

Chapter 7 Discussion ...... 155

7 Project One: N-Terminal Tagging of the Dopamine Transporter Impairs Protein Expression and Trafficking In Vivo ...... 155

Chapter 8 Discussion ...... 161

8 Project Two and Three: The Effect of Tyrosine Hydroxylase Overexpression On Biochemical and Behavioural Features of the Dopaminergic and Noradrenergic Systems ...... 161

Chapter 9 Concluding Remarks and Future Directions ...... 172

References...... 177

Appendix One ...... 224

Appendix Two ...... 248

List of Abbreviations

AIMS abnormal voluntary movements scoring ALDH aldehyde dehydrogenase ASK apoptosis signal-regulating kinase 1 ATP adenosine triphosphate BAC bacterial artificial chromosome BAD Bcl-2-associated death promotor

BH4 tetrahydrobiopterin BME β-mercaptoethanol BRET bioluminescence resonance energy transfer BSA bovine albumin serum C– carboxyl Ca2+ calcium CaMKII calcium- and calmodulin-stimulated protein kinase ii cAMP cyclic adenosine monophosphate cDNA complementary deoxyribonucleic acid cGMP cyclic guanosine monophosphate Cl- chloride COMT catechol-O-methyltransferase Cys– cysteinyl- DAT dopamine transporter Dbh dopamine β-hydroxylase ddH2O double distilled water DDT dithiothreitol dH2O distilled water DHBA 2,3-dihydroxybenzoic acid DLB dementia with Lewy bodies DNA deoxyribonucleic acid DOPAC dihydroxyphenylacetic acid

DOPAL 3,4-dihydroxyphenyl-acetaldehyde EDTA ethylenediaminetetraacetic acid ER endoplasmic recticulum ERK extracellular signal-regulated kinases Fe iron Fe2+ ferrous iron Fe3+ ferric iron FRAP fluorescence recovery after photobleaching FRET fluorescence resonance energy transfer GAPDH glyceraldehyde 3-phosphate dehydrogenase GPase glutathione peroxidase GSH glutathione (reduce-form glutathione) GSSG glutathione disulfide (oxidized-form glutathione) GST pull-down glutathione S-transferase pull-down assay HA– human influenza haemagglutinin

HClO4 perchloric acid HEK human embryonic kidney [cells] HEK293 a cell line derived from human embryonic kidney cells –HET heterozygote 5HIAA 5-hydroxyindoleacetic acid

H2O2 hydrogen peroxide HPLC high-performance liquid chromatography 5'HT serotonin HTH hypothalamus HVA homovanillic acid IP intraperitoneal K+ potassium

Ki inhibition constant –kd knockdown –KO knockout

LB lysogeny broth LC locus coeruleus MAO monoamine oxidase MAPK mitogen-activated protein kinase MAPKAPK2 MAPK-activated protein kinase MB midbrain MES 2(N-morpholino)ethanesulphonic acid Mg2+ magnesium MN9D immortalized dopamine-containing neuronal hybrid cell line (a fusion of embryonic ventral mesencephalic and neuroblastoma cells) MOPS 3-(N-morpholino)propanesulfonic acid MPP+ 1-methyl-4-phenylpyridinium MPTP 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mRNA messenger ribonucleic acid MS mass spectrometry MSK mitogen- and stress-activated protein kinase 3-MT 3-methoxy-4-hydroxyphenethylamine N– amino Na+ sodium Na+/K+-ATPase sodium/potassium ATP-driven pump NET noradrenaline/norepinephrine transporter •NO nitric oxide NSD-1015 3-hydroxybenzylhydrazine dihydrochloride - O2 superoxide anion OD optical density OH- hydroxide ∙OH hydroxyl radical 6-OHDA 6-hydroxyldopamine ONOO- peroxynitrite oQ dopamine quiones PAGE polyacrylamide gel electrophoresi

xii

PBS phosphate-buffered saline

PC12 cell line derived from a pheochromocytoma of the rat adrenal medulla (embryonic origin from the neural crest, mixture of neuroblastic cells and eosinophilic cells) PCR polymerase chain reaction PDPK proline-directed protein kinase PFC prefrontal cortex PGK1 phosphoglycerate kinase 1 PKA protein kinase A, also known as cAMP-dependent protein kinase PKC protein kinase C PKG protein kinase G, also known as cGMP-dependent protein kinase PP– protein phosphatase PPT pedunculopontine tegmentum PRAK p38-regulated/activated kinase PVDF polyvinylidene difluoride qPCR quantitative polymerase chain reaction RBD rapid-eye movement sleep behaviour disorder REM rapid-eye movement sleep RIPA radioimmunoprecipitation assay RNA ribonucleic acid ROS reactive oxygen species SDS sodium dodecyl sulfate SEM standard error of the mean Ser– serine SERT serotonin transporter SN substantia nigra pars compacta SNARE soluble N-ethylmaleimide–sensitive factor attachment receptor SOD superoxide dismutase sQ semiquinones ST striatum STN subthalamic nucleus

xiii

TBS Tris-buffered saline TBST Tris-buffered saline with Tween-20 (0.05% unless otherwise noted) TE Tris-EDTA solution TEAM triethanolamine Tfrc transferrin receptor –Tg transgenic TH tyrosine hydroxylase TH-HI transgenic mice with high TH copy number (six total TH gene copies) TH-Y Y-linked transgenic mice, overexpressing TH (three total gene copies)

Vm maximal reaction rate VMAT vesicular monoamine transporter VTA ventral tegmental area v/v volume-to-volume

xiv

List of Tables

Chapter 1

Table 1.1: Serine phosphorylation sites regulating the activity of tyrosine hydroxylase 21

Chapter 2

Table 2.1: The development of mice expressing exclusively HA-tagged transporter 78

Chapter 3

Table 3.1: The 'Puzzle Box' paradigm 90

List of Figures Chapter 1

Figure 1.1: Dopaminergic pathways in the brain 6

Figure 1.2: Central noradrenergic pathways 12

Figure 1.3: The synthetic pathway of catecholamines 18

Figure 1.4: Dopamine homeostasis. in the presynaptic neuron 29

Figure 1.5: Schematic of the dopamine transporter proteome 32

Figure 1.6: The pathological and symptomatic progression of Parkinson's disease 41

Figure 1.7: Reactions within the metabolic pathway... 48

Figure 1.8: Free radical formation mediated by monoamine oxidase... 49

Figure 1.9: Iron bound in the active site of tyrosine hydroxylase... 60

Chapter 2

Figure 2.1: Schematic representation of HA-tag insertion... 69

Figure 2.2: Delineation of striatum and midbrain regions for ratiometric analysis 75

Chapter 3

Figure 3.1: The Puzzle Box 89

Figure 3.2: Challenging Beam Traversal Task 93

xvi

Chapter 4

Figure 4.1: Gene copy number and mRNA levels for the dopamine transporter 97

Figure 4.2: Expression pattern of HA-tagged dopamine transporter (DAT)... 98

Figure 4.3: Protein expression of the dopamine transporter (DAT)... 100

Figure 4.4: Western blot comparing antibodies that recognise the N- and C-terminus... 101

Figure 4.5: Separate, uncut western blots ... antibodies against N- and C-terminus 102

Figure 4.6: Striatal dopamine transporter (DAT) protein levels in HAD-Tg mice... 104

Figure 4.7: Midbrain dopamine transporter (DAT) protein levels in HAD-Tg mice... 105

Figure 4.8: Rescue of dopamine transporter (DAT)-knockout hyperactivity... 107

Figure 4.9: Locomotor response to amphetamine 108

Figure 4.10: Western blot of dopamine transporter levels in striatum and midbrain... 111

Figure 4.11: Immunofluorescence staining to detect distribution... 112

Chapter 5

Figure 5.1: Development of TH-HI mice 114

Figure 5.2: Gene copy number and mRNA levels in transgenic mice... 115

Figure 5.3: Midbrain and striatal tyrosine hydroxylase protein levels... 117

Figure 5.4: Tyrosine hydroxylase protein expression patterns in dopaminergic regions... 118

Figure 5.5: Levels of phosphorylated tyrosine hydroxylase is increased in the striatum... 120

Figure 5.6: L-3,4-dihydroxyphenylalanine (L-DOPA) accumulation... 121

xvii

Figure 5.7: Tyrosine hyroxylase protein expression in... noradrenergic regions 123

Figure 5.8: Striatal tissue content of dopamine and its metabolites 126

Figure 5.9: Protein regulating phosphorylation of tyrosine hydroxylase... 127

Figure 5.10: Striatal protein levels of the vesicular monoamine transporter (VMAT2) ... 128

Figure 5.11: Markers of oxidative stress in adult mice 130

Figure 5.12: Locomotor activity at baseline and the response to amphetamine (adults) 131

Figure 5.13: Locomotor response to amphetamine at four weeks of age 132

Figure 5.14: Cocaine causes hyperactivity in adult transgenic mice 133

Figure 5.15: Fine motor skills are not significantly impaired in transgenic mice 135

Figure 5.16: Anxiety in wildtype and transgenic mice 139

Figure 5.17: Sensory motor gating in mice overexpressing tyrosine hydroxylase 140

Figure 5.18: Cognitive alterations in mice overexpressing tyrosine hydroxylase 141

Figure 5.19: Cognitive flexibility in mice overexpressing dopamine transporter 142

Chapter 6

Figure 6.1. The development of mice expressing three copies of tyrosine hydroxylase... 144

Figure 6.2. Protein localization of tyrosine hydroxylase 145

Figure 6.3: Protein expression in juvenile mice (four weeks) and aged adults... 147

Figure 6.4: Tissue content of dopamine and its metabolites in adult mice 148

Figure 6.5: Tissue content of dopamine and its metabolites in juvenile mice 149

xviii

Figure 6.6: Locomotor response to saline and amphetamine... 152

Figure 6.7: Assessments of cognitive and motor impairment in adult transgenic mice 154

xix

List of Appendices

Appendix One: Proteins Regulating the Dopamine Transporter

Appendix Two: List of Publications

xx 1

Chapter 1 Introduction 1 Introduction and Literature Review 1.1 Preface

Dopamine, noradrenaline and adrenaline belong to a family of neurotransmitters identified as catecholamines; they are classical monoamine molecules that share a common ancestry, originating from the amino acid tyrosine 1. Catecholamines are critically involved in cognition, mood, and motor activity, and underlie several basic physiological functions such as the modulation of sleep/arousal, the "fight-or-flight" stress response and lactation 2-6. As such, their dysregulation has been linked to a number of neurological disorders, including Parkinson's disease 7, attention deficit/hyeractive disorder 8, 9, schizophrenia 10, 11, mood disorders 12-14, gambling and addiction 15-17, and autonomic dysfunction 18, 19. Importantly, these disorders and others like them arise from either hypo- or hyper-transmission within a given pathway. Neurotransmission can be regulated by the control of the synthesis, release or degradation of a neurotransmitter; by alterations to the expression of a neurotransmitter's specific transport proteins and receptors; and by how postsynaptic cells process a signal downstream to its membrane receptors 20. Yet the concentration of neurotransmitters available for signalling is determined by processes in the presynaptic neuron, including the rate of synthesis and packaging of the transmitter into vesicles, as well as successful exocytosis of vesicular content in response to presynaptic stimulation. Following release, the efficient clearance or degradation of neurotransmitters from the synaptic cleft is crucial to the termination of stimulation of receptors — both receptors located postsynaptically as well as those located on the presynaptic neuron, which feedback to affect neurotransmitter synthesis, expression of transporter proteins, and more 21. A failing at any point can cause hyperstimulation or hypostimulation of the intended neuronal targets and in turn, dramatically alters the successful output of the signal. Indeed, the balance of these processes is of the upmost importance, both to normal transmission and to the survival of catecholamine neurons themselves. With a focused interest on the dopaminergic and noradrenergic systems, this

2 thesis will describe an investigation of two of these processes, occurring at the stages of monoamine synthesis and clearance.

The dopamine transporter (DAT) is the primary, presynaptic membrane protein responsible for the clearance of extracellular dopamine and the cessation of neurotransmission 22. In this capacity, it is also an integral partner of the vesicular monoamine transporter (VMAT2) — an intracellular transport protein located in the vesicular membrane — in the processes of recycling and repackaging of dopamine for subsequent use 23-26. Therefore, variability in the expression of DAT at the plasma membrane affects levels of dopamine inside the presynaptic neuron as well as in the extracellular space; this, in turn, can influence and the synthesis of fresh neurostransmitter, baseline dopaminergic tone, and neurotransmission. Studies have linked genetic polymorphisms and variability in the expression of DAT to impulse control problems, attention-deficit disorder, major depression, binge eating, sleep abnormalities, and restless leg syndrome 27-33. In addition, the level of membrane expression is a principal factor in the physiological response of psychoactive drugs such as amphetamine and cocaine, owing to the direct involvement of DAT in controlling extracellular dopamine levels. These drugs, albeit via different mechanisms, act to increase the concentration of dopamine in the extracellular space, leading to prolonged stimulation of postsynaptic cells 34-40.

The rate of dopamine synthesis and the expression of dopamine transporter proteins and receptors play interconnected roles in maintaining dopamine homeostasis. The development of DAT knock-out (DAT-KO) mice has shown that many aspects of dopamine regulation can be influenced by the absence of the transporter and a persistent increase in extracellular dopamine 41. Knockout mice have a fivefold increase in extracellular dopamine, affecting homeostatic levels of the transmitter within presynaptic neurons, where there is a 95% reduction in striatal tissue content of dopamine and a 75% reduction in its release relative to wildtype littermates 41. Interestingly, the expression and phosphorylation of dopamine's rate- limiting synthetic enzyme, tyrosine hydroxylase (TH), is decreased in neuronal terminals of DAT-KO mice but not in somatodendric compartments, indicating a location-specific divergence in dopamine regulation 42. In addition, a persistent increase in dopaminergic tone also has significant effects on dopamine receptors: DAT-KO mice demonstrate a marked loss of (presynaptic) autoreceptor function and a 50% reduction in postsynaptic dopamine

3 receptors compared to wildtype littermates 34, 36, 41, 43, 44. Taken together, studies of mice lacking DAT have demonstrated a complicated relationship between the proteins involved in catecholamine homeostasis; however, they have shown that these proteins work in unison to regulate catecholamine levels, and each has the capacity to be upregulated or downregulated in response to changes in another 45, 46.

An understanding of catecholamine homeostasis requires a comprehensive understanding of each of the proteins and enzymes involved in maintaining appropriate intracellular and extracellular levels. We aimed to better understand one aspect of this balance, the process of dopamine re-uptake, by studying the regulation of DAT. Decades of studies have shown that DAT functions as a multi-protein complex, with several binding partners regulating its expression, trafficking and functioning 22, 47. The first major project of this thesis describes the biochemical features of a transgenic mouse expressing DAT tagged with hemagglutinin (HA–) at its amino (N–) terminus, developed with the objective of using proteomic techniques to identify proteins that form a complex with the transporter and aid in its expression and functioning in vivo. We hypothesized that tagging DAT would permit the use of high-affinity commercial antibodies available for epitope tags, and aid in the identification of in vivo binding partners through a immunoprecipitation/mass spectrometry approach. Our specific objective was to identify proteins-binding partners that aid in the regulation of DAT in vivo, and to validate binding partners identified in vitro.

The first aim of this thesis focuses on understanding an important aspect of catecholamine homeostasis by examining the regulation of the dopamine transporter under normal conditions; the second, on why catecholamine cells are particularly vulnerable in neurodegenerative disease. Parkinson’s disease is a well-known disorder, characterized by profound and distinctive degeneration of dopaminergic cells in the nigrostriatal pathway as well as the development of protein aggregates known as Lewy-body inclusions. However, in reality, Parkinson's disease is a multisystem disorder predominantly affecting catecholamine cells, with massive loss of dopaminergic and noradrenergic cells, but also affecting other cells groups including serotonergic and cholinergic cells 48-50. Oxidative stress is believed to contribute to the neuropathology of Parkinson's disease 51-54, yet why dopaminergic and noradrenergic neurons are particularly susceptible remains unclear. Tyrosine hydroxylase is

4 present in both dopamine and noradrenergic cells, as the rate-limiting enzyme in the synthesis of catecholamines; importantly, small amounts of reactive oxygen species (ROS) are normally produced as by-products of the TH system 55-57. Reactive oxygen species are also produced in the metabolism of catecholamines by monoamine oxidase (MAO), a process that is enhanced by the presence of iron 58. By both of these means, an increase in the activity of the TH system can lead to increased ROS production that is specific to catecholamine cells. In addition, over-activity of TH can directly contribute to an accumulation of free cytosolic dopamine, known to be neurotoxic due (in part) to the capacity of dopamine to autoxidize 58- 60. The second major project described in this thesis investigated the consequences of an overproduction of catecholamines by developing a novel mouse that, to our knowledge, is the first to successfully overproduce functional TH. We hypothesized that an overexpression of TH would lead to biochemical and behavioural phenotypes consistent with a disruption in dopamine homeostasis.

Before describing the experiments undertaken here, I will present background information that describes the dopaminergic and noradrenergic systems under normal conditions and in disordered states. I will also discuss the enzymes and regulatory proteins involved in the synthesis of monoamines, and the regulation of key transport proteins involved in maintaining their homeostasis.

1.2 Monoamines

Monoamines are a class of neurotransmitters and neuromodulators structurally composed of one amino group connected to an aromatic ring by a two-carbon chain (-CH2-CH2): each originates from an aromatic amino acid (i.e., histidine, tryptophan, phenylalanine and tyrosine) and is synthesized along a pathway of transformations orchestrated by a number of enzymatic reactions. Broadly, monoamines are comprised of two main categories: classical monoamines and trace amines. Classical monoamines can function as neurotransmitters and as hormones in both the central and peripheral nervous systems; they include histamines, catecholamines (dopamine, noradrenaline and adrenaline), and tryptamines (serotonin and melatonin) 22, 61, 62. Trace amines are endogenous metabolites of amino acids, structurally

5 similar to biogenic amines, that function primarily as neuromodulators of classical monoaminergic systems 63, 64. Recent studies have suggested they can also directly affect neuronal activity via interactions with trace amine receptors and ligand-gated receptor channels 65. Together, monoamines represent a powerful group of molecules with influence over many aspects of our daily lives, from the fluidity of our movements, to our sleeping patterns, to the experience of reward.

1.3 Dopamine

Dopamine is a wide-reaching neurotransmitter involved in a variety of functions: among them, motor control 66, 67, executive function 62, sleep-wake modulation 68, 69, and reinforcement learning and reward 70-73. The dopamine system is therefore a regular target of both therapeutic and recreational drugs. Neurons that produce and release dopamine are most often identified by the co-expression of the rate-limiting enzyme in its synthesis, TH, and DAT, which in the central nervous system, is a specific marker of the dopamine cell group 74; these neurons then project throughout the brain in four main pathways (Figure 1.1). Because of the diversity of structures under dopaminergic control, agents influencing the system are capable of inducing a number of behavioural, psychological and physiological effects (both intended and otherwise) 34, 38, 75-77.

1.3.1 Dopamine Pathways

The mesocorticolimbic pathway sends dopamine to the frontal cortex from cells originating in the ventral tegmental area (VTA) 78. It is further differentiated into two major pathways: the mesolimbic pathway and the mesocortical pathway. The mesolimbic pathway projects from the VTA to the limbic system and is highly involved in reward and, in turn, addiction 70-73; the mesocortical pathway projects from the VTA to the frontal cortex and, more specifically, to the frontal lobes, forming a dopaminergic system believed to be involved in motivation and cognition as well as emotional responses. Importantly, dysregulation within the mesolimbic and mesocortical pathways have been implicated in disorders such as schizophrenia and attention deficit/hyperactivity disorder (ADHD) 10, 28, 77, 79, 80. While

Figure 1.1: Dopaminergic pathways in the brain. Dopamine is projected through the brain in four main pathways: (1) the nigrostriatal pathway; (2) the mesolimbic pathway; (3) the mesocortical pathway; and (4) the tuberoinfundibular pathway. Abbreviations: HTH, hypothalamus; PFC, prefrontal cortex; SN, substantia nigra pars compacta; ST, striatum; VTA, ventral tegmental area.

pharmacotherapies may hope to ameliorate dopaminergic dysregulation in any one pathway, because their action is not restricted to one pathway alone, a limitation of these drugs is that they are unable to target pathway-specific abnormalities. Therefore, many of the associated side effects and risks accompanying treatment are the result of modulation within other dopaminergic and, in fact, other monoaminergic systems, such as the central and peripheral noradrenergic pathways.

The nigrostriatal pathway originates in the substantia nigra pars compacta and projects to the medium spiny neurons in the striatum. As part of the basal ganglia loop, the nigrostriatal pathways is involved in the execution of fine motor skills 66, 67. Degeneration within this pathway is critically associated with movement disorder such as Parkinson's disease, in which an 80% loss of nigrostriatal neurons leads to the characteristic motor impairment 48. Abnormal firing in the nigrostriatal pathway is also associated with chorea, abnormal involuntary movements symptomatic of Huntington's disease 81, 82, as well as with dyskinesia, uncontrolled and irregular movements induced by drugs that target the dopaminergic system, including levodopa (L-DOPA) and some antipsychotics 83-87.

Projecting from the tuberal region of the hypothalamus to the pituitary median eminence, the tuberoinfundibular pathway is involved in neuroendocrine and hormonal control, such as regulation of the secretion of prolactin from the pituitary 88. In turn, prolactin enhances the discharge and spike duration of dopaminergic neurons in the tuberoinfundibular pathway, in a feedback mechanism believed to protect against hyperprolactinaemia 89. This pathway can also be affected by drugs that modulate dopaminergic transmission, such as antipsychotics 90.

1.3.2 Dopamine Transmission

Normal dopamine transmission is critical for the execution of numerous physiological and psychological functions, and its breakdown is at the root of many neurological disorders. Please note that the details of dopamine synthesis and its regulation will be discussed in subsequent sections of this thesis (see Section 1.6). Briefly, the synthesis of dopamine and all other catecholamines begins with the conversion of L-tyrosine to dopamine's precursor, L-

3,4-dihydroxyphenylalanine (i.e., L-DOPA), by TH. However, the presence of L-DOPA is transient as it is rapidly converted to dopamine by dopa decarboxylase 55, 56, 91. Following its synthesis, dopamine is sequestered by VMAT2 into vesicles, readied for calcium (Ca2+)- induced release after neuronal stimulation 25, 92.

Once in the synaptic cleft, dopamine acts upon G-protein coupled dopamine receptors located on both the pre- and postsynaptic membranes, through which it initiates signal cascades to affect target proteins. There are at least five types of dopamine receptors (D1 to

D5) located broadly throughout the brain and periphery, which are subdivided into families of receptors: D1 and D5 receptors are part of the D1-like family of dopamine receptors that mainly couple to Gs, a G-protein that stimulates the second messenger cyclic adenosine monophosphate (cAMP). The D2, D3, and D4 receptors are part of the D2-like family that 93 couples to Gi proteins and inhibits cAMP . Through the modulation of cAMP, the D1-like and D2-like families primarily exert intracellular effects on target proteins by upregulating or downregulating cyclic AMP-dependent protein kinase (protein kinase A, PKA), respectively. However, effects can also be exerted through alternative signalling pathways, such as those involving the modulation of phospholipase C, and via direct interactions with ionotropic receptors 93-95.

The D1 receptors are the most abundant and widespread dopamine receptor. In the brain, they are densely expressed throughout the nigrostriatal, mesolimbic and mesocortical pathways: levels of mRNA are highest in the striatum, nucleus accumbens, and the olfactory tubercle, 96, 97 and also elevated in the limbic systems, hypothalamus and thalamus . Importantly, D2 receptors share similar regional expression, with high levels in the striatum, nucleus accumbens, olfactory tubercle, but also in substantia nigra, VTA as well as cortical, thalamic and limbic regions. While D3, D4, and D5 receptors exist in many of these locations, they do 96, 97 have more limited regional expression patterns and are present at lower levels . The D1 and D2 receptors are both heavily involved in reward, goal-directed behavioural, learning, and orchestrating movements. However, while they are localized in many of the same regions, they can be expressed on different subpopulations of neurons. For instance, within the striatum, there exists different populations of postsynaptic medium spiny neurons with divergent projection pathways that differentially and selectively express D1 or D2 receptors

— only very a small fraction of striatal medium spiny neurons co-express both D1 and D2 93, 98-101 receptors . Importantly, D1 and D2 postsynaptic receptors also have different affinity profiles: D1 receptors, having stronger affinity, are more sensitive to changes in tonic levels 46 of dopamine and D2 receptors respond greatest to phasic levels . Perhaps unsurprisingly, evidence suggests that both D1 and D2 postsynaptic receptors can be involved in the control of the same behaviours and physiological responses, yet with diverging outcomes that depend on their internal signalling cascades. In addition, D2 receptors are also located on presynaptic neurons, where they function as autoreceptors. In this role, they are able to monitor basal levels of extracellular dopamine and induce compensatory changes in the presynaptic neuron.

Activation of D2 autoreceptors negatively regulates synthesis and/or release of dopamine in nigrostriatal, mesolimbic and hypothalamic axon terminals, and also enhances reuptake through a direction interaction with intracellular DAT that recruits transporter to the plasma membrane 102-106.

Neurotransmission is terminated when dopamine is released from receptors and degraded by enzymes in neighbouring astrocytes or when it is taken back into the presynaptic neurons, to be metabolised or repackaged into vesicles. As previously mentioned, transport via DAT is the chief presynaptic mechanism for regulation of both the intensity and the duration of transmission 21, 22, 47, 107-111. The importance of degradation relative to reuptake in the clearance of dopamine varies regionally, depending on the relative expression of DAT and metabolic enzymes. Owing to structural similarities, substrates of DAT — including dopamine itself — can also be taken into presynaptic neurons by the noradrenaline transporter (NET), although such an interaction has much lower affinity 112.

1.3.3 The Relationship between Trace Monoamines and Dopamine

Trace amines are endogenous metabolites of amino acids structurally and metabolically related to classical monoaminergic transmitters; however, they are present in very low concentrations heterogeneously throughout the central and peripheral nervous system 113-115. Those that are derived from phenylalanine are called phenylamines and share similarities with catecholamines, some produced in offshoots of the same synthetic and metabolic pathways by MAO–B 116. Despite their low concentrations, they play a significant role in the

10 modulation of the dopaminergic and serotoninergic systems, and possibly the glutamatergic, system in part by modulating the quantity of neurotransmitter concentrated in the synaptic cleft 117. In addition, like classical monoamines, trace monoamines have been linked to affective and cognitive disorders including schizophrenia, Parkinson's disease, attention deficit/hyperactive disorder (ADHD), Tourette syndrome, and major depression 118, 119. For this reason, their synthesis and pathways have been harnessed in pharmacological treatments. The trace amine associated receptors are G-protein coupled receptors localized on pre- and postsynaptic cells, expressed particularly in dopaminergic and serotonergic cells; trace amine associate receptor 1 (TAAR1) has been shown to be a target for endogenous amines and monoaminergic-like compounds, including psychoactive drugs such as amphetamine, to which they share structural similarities 113, 116, 118, 119. Knock-out studies revealed that mice lacking TAAR1 have enhanced sensitivity to the effects of amphetamine, particularly hyperlocomotion and augmented dopamine release 116, 120, 121. In murine brain slices, application of a uniquely-engineered, high-affinity TAAR1 agonist inhibited cell firing of dopamine cells as well as serotonergic cells in the VTA and raphe nucleus (respectively), but had no effective on cells within the noradrenergic locus coeruelus, which is devoid of TAAR1 122. Moreover, TAAR1 agonists have been shown to have antipsychotic- and antidepressive-like effects in both rodents and non-human primates, improving cognitive functions as potently as current schizophrenia treatment olanzapine, a dopamine antagonist, but without major side effects. In addition, when co-administered, it potentiated the antipsychotic properties of olanzepine treatment and protected against some side effects of antipsychotic treatment, such as weight gain 113. This is an important advancement over existing therapies as it may improve compliance. TAAR1 represents a potential therapeutic target not only for schizophrenia, but for other dopamine-related disorders such as ADHD and Parkinson's disease 119, 123. While trace amines are not the focus of this thesis, their contributions to the regulation of dopamine transmission are worthy of acknowledgment.

1.4 Noradrenaline

Noradrenaline serves as both a neurotransmitter in the central nervous system, and as a peripheral hormone in the sympathetic branch of the autonomic nervous system. In these

11 roles, it has been linked to cortical arousal in sleep-wake pathways, attention, memory formation and retrieval, and the stress response 124-127. In addition, it has also been proposed to work synergistically with dopamine in coordinating fine movement 128. While the number noradrenergic cells in the central system are comparative few, they send extensive projections throughout the brain, exerting powerful effects (Figure 1.2). The cell bodies of these neurons are confined to a small number of minute brain regions in the caudal ventrolateral and brainstem, which were originally labelled A1 - A7 1, 129. Since noradrenaline is produced along the same biosynthetic pathway as dopamine and adrenaline, noradrenergic cells are identified as those that produce TH and dopamine β-hydroxylase (Dbh), which coverts dopamine to noradrenaline, but do not possess the enzyme responsible for the subsequent conversion to adrenaline, phenylethanolamine-N-methyltransferase 1. They can also be immunohistologically distinguished by the presence of NET. Importantly, not every region containing noradrenergic cells is homogenous in nature: such is the case of the adrenal medulla, which contains a mix of adrenergic and noradrengic cells.

1.4.1 Central Noradrenergic Pathways

Noadrenergic cell groups A1 and A2 reside in the dorsal vagus complex of the ventrolateral medulla as well as the solitary nucleus, and have been shown to have reciprocal connections with multiple regions in the brainstem, hypothalamus, limbic forebrain and cortex 130-134. Noradrenergic inputs originating from A1 and A2 are believed to play a role in vagal sensory-motor reflexes and the physiological stress response 130-134. Descending afferent inputs to A1 and A2 arriving from the cortex, limbic and hypothamic regions have been linked to visceral reactions to emotions; in turn, ascending efferent pathways to higher order structures are believed to provide the foundation for physiological stress responses to affect cognition and emotional learning 124, 130, 135-137.

The pontine A5 through A7 provide noradrenergic innervation of the spinal cord, with varying routes and roles 138. Importantly, A6 — a small structure known as the locus coeruleus — not only descends to the spinal cord but has projections to every other major part of the brain: it extensively innervates the forebrain, diencephalon, brainstem, thalamus, hypothalamus, amydgala, and cerebellum (Figure 1.2) 139. In return, retrograde tracing studies

Figure 1.2: Central noradrenergic pathways. Noradrenergic pathways originate from several small loci in the caudal ventral lateral medulla and the brainstem, specifically the pons and nucleus of the solitary tract. However, the primary source of central noradrenaline originates in the locus coeruleus of the pons, which projects widely throughout the brain and also descends to the spinal cord. Abbreviations: AMG, amygdala; CTX, cortex; HTH, hypothalamus; LC, locus coeruleus.

13 have shown consistent labelling from comparatively few structures, with strong labelling observed in the nucleus prepositus hypoglossi and nucleus paragigantocellularis, and somewhat weaker (albeit consistent) labelling of the dorsal cap of the paraventricular hypothalamus 140, 141. (Tracing studies have also shown that the locus coeruleus receives afferent input from the VTA, dorsal preoptic nucleus, posterior hypothalamus, mesencephalic reticular formation, Kölliker-Fuse nucleus, and paraventricular nucleus 139-142.) In this way, the locus coeruleus participates in the arousal network, as well as the regulation of attention and reward-expectation, executive functions and task-related decision making, and behavioural plasticity 125, 126, 143-145.

1.4.2 The Locus Coeruleus: a Hub of Connectivity

The interconnectedness of the locus coeruleus is of particular significance when considered in the context of the network architecture of the brain, i.e. small world architecture. Small world architecture refers to a clustering network that is neither purely random nor regular, wherein there is both a high level of local clustering and a short path that connects all nodes of the larger network 146, 147. Most nodes within such a network are sparsely connected relative to a small few that are highly connected, which permits a highly connected by cost-efficient system. The small world network model can describe a number of virtual and real-world relationships including economic theories, transportation networks (i.e., airline flight networks), social networks, and biological systems. 146-149. Many neural networks in the brain have been shown to be small world networks constrained by a "exponentially truncated power law", which represents a limited capacity to make connections due to wiring costs and physical limitations 146, 149. The architecture is such that neuronal connections are topologically organized to minimize wiring costs — maintaining topologically close network connections that permit the efficient regulation of metabolic needs and gene expression — while still allowing for adaptive value and global efficiency in information transfer between nodes that may be anatomically located far apart from each other 146-150. Neurons and brain structures in close anatomical proximity have a high probably of being connected, and those farther apart have a lower probability of being connected (following a power law of probability decay) 149. To this end, most nodes are connected only to a small number of

14 nearby nodes, which are in turn connected to a small number of other nodes, and so on, expanding the neural network within the brain while reducing wiring costs. However, a small number of nodes are highly connected "hubs" and possess long-reaching projections, which allows for efficient information transfer between distant nodes. The locus coeruleus is one such node in the brain, known to send extensive noradrenergic efferents throughout the brain. It is noteworthy, then, that there is profound degeneration of the locus coeruleus in the early stages of Parkinson's disease 48, 151, 152. In light of its role as a highly connected hub, it is likely that the loss of noradrenergic input originating from the locus coeruleus is at least partially involved in the onset of many of symptoms of Parkinson's disease.

1.4.3 Peripheral Noradrenaline

In addition to being an important neurotransmitter in the central nervous system, noradrenaline also functions as a hormone in sympathetic branch of the autonomic nervous system 4, 153, 154. Peripheral noradrenaline is produced and released by sympathetic postganglionic cells and by chromaffin cells of the adrenal medulla 155, 156. In part, its release is controlled by the central nervous system, owing to the inputs that postganglionic and chromaffin cells receive from the cortex, hypothalamus and spinal cord. Importantly, the adrenal medulla contains both noradrenergic and adrenergic cells that participate in the "fight or flight" reaction of the hypothalamic-pituitary-adrenal axis, and are able to induce an adaptive response to stressful stimuli 155, 156. Importantly, these groups are not only innervated by different central loci but also possess different populations of membrane receptors 157, 158. The frequency, type and source of stimulation to the adrenal medulla influences whether adrenaline or noradrenaline is released 155, 156, 159, 160. Peripheral circulation of noradrenaline controls many autonomic functions and is responsible for preparing the body for energy expenditure 4. Among its many effects, stimulated peripheral noradrenaline release results in vasoconstriction and an increase in blood pressure, increased metabolism, a reduction in gut mobility, and the release of renin from the kidneys 153, 154, 161-164. Due to the array of functions under the control of the noradrenergic/adrenergic systems, adrenergic and noradrenergic receptors ("adrenoceptors") have been pharmacologically targeted for the treatment of a variety of disorders. Noradrenaline itself is used clinically to treat critically low blood

15 pressure, and drugs that target α- and β- adrenoceptors are often used in the treatment of cardiovascular and psychiatric conditions 165.

1.4.4 Adrenoreceptors and Noradrenaline Transmission

Adrenoceptors are subtyped as alpha (α) or beta (β), and all are G-protein coupled receptors:

α1A,B,D and α2A-D receptors are coupled to Gq and Gi, respectively, while β1-3 are linked to Gs proteins. These receptors are expressed throughout the brain and periphery, to varying degrees of concentration 139. Nonetheless, within a given region, there can be discrete localization of subtypes: for example, within the neocortex, β adrenoceptors seem to be mainly localized in the laminae whereas α subtypes more densely populate superficial layers 166 . Generally, α1 and β subtypes are localized to postsynaptic neurons, while α2 can be situated on neurons on both sides of a synapse; however exceptions to this rule exist, and all adrenoreceptors have been found at both pre- and postsynaptic locations 166. Stimulation of presynaptic receptors by catecholamine release can initiate an important feedback mechanism in both the central and peripheral systems, most often mediated by α adrenoceptors. To this end, both α1 and α2 receptors are capable of functioning as autoreceptors, stimulating and inhibiting catecholamine release, respectively. In the adrenal medulla, feedback onto α2 receptors mediates a reduction in catecholamines released into circulation; likewise, in the locus coeruleus, α2 receptor stimulation results in membrane hyperpolarization, suppressing neuronal firing and thereby constraining noradrenaline release 167-172. In contrast, stimulation of α1 receptors causes depolarization of somatodentric membranes thereby resulting in excitation of locus coeruleus neurons. Several early studies demonstrated that iontophoretic application of noradrenaline caused a suppression of neuronal firing which could be blocked with the α2 receptor antagonist, piperoxane; however, studies revealed that piperoxane could not block noadrenaline-induced inhibition in animals younger than 8 days postnatal 173-175.

Therefore, in the developing brain, the sensitivity of α1 may be higher than α2 receptors: in vivo iontophoretic applications of noradrenaline at low concentrations causes excitation while high concentrations result in inhibition. However, α1-mediated excitation diminished with age and could not be produced beyond postnatal day 20 169, 173-175. There is some evidence that while autoreception is by in large mediated by α-receptors, stimulation of the β2 receptor is

16 also capable of facilitating noradrenaline release 176, 177. As in the dopaminergic system, the cessation of noradrenergic transmission is partially controlled by reuptake through a membrane monoaminergic transporter, i.e., NET.

1.5 Drugs and Monoaminergic Systems

Many drugs with clinical and recreational uses act upon the monoaminergic system by targeting classical monoamine receptors and transporters, some of which also act upon trace amine receptors. In this way, exogenous agents can compensate for pathological hyper- or hypo-transmission, or potentiate transmission in a given pathway. Antidepressants such as monoamine oxidase inhibitors, selective serotonin reuptake inhibitors, and serotonin- noradrenaline reuptake inhibitors act to keep monoamines in the extracellular space by preventing the reuptake into presynaptic neurons or inhibiting their degradation 178-181. While they are commonly used to treat depression and anxiety disorders, they have a wide range of uses that include — but are not limited to — attention-deficit-disorder, migraines and chronic pain. Antipsychotics act by blocking receptors and limiting postsynaptic stimulation: both typical (first-generation) and atypical (second-generation) antipsychotics block D2 receptors of the dopaminergic pathway, while atypical antipsychotics also affect serotonergic and noradrenergic receptors 182-184. In addition, peripheral monoamine receptors are also targeted therapeutically: both agonists and antagonists of the α- and β- adrenoceptors are used to treat cardiovascular problems, pulmonary disease, asthma, essential tremor, and pain, among others 165.

Psychoactive drugs such as amphetamine and cocaine act to increase extracellular levels of monoamines, by targeting reuptake transporters. While both historically had clinical uses — amphetamines are still prescribed for the treatment of ADHD — both are drugs of abuse and tightly controlled. The specific mechanisms of amphetamines and cocaine action are of relevance here, as they are often used in animal models to assess the integrity of monoaminergic systems. Amphetamine and methamphetamine are exogenous agents that act as substrates for the monoaminergic transporters, particularly DAT 38, 185, 186. In this way, amphetamines compete with monoamines for entry into the presynaptic neuron. Once inside

17 the cell, they are transported into vesicle through VMAT2 38, 185. By alkalinizing the interior of the vesicle, they dissipate the proton gradient of the vesicles, inhibiting VMAT2 function and redistributing monoamines to the cytosol 38, 185. This marks the initiation of a chain of events that leads to the reversal of the transporter and massive efflux of monoamines, resulting in the potentiation of dopamine- and noradrenaline-controlled functions 36-38, 77. The massive efflux of dopamine in the striatum results in locomotor hyperactivity and stereotypic behaviour, and also stimulates reward pathways. Additional (peripheral) consequences of the drugs such as abnormal heart rate, rapid breathing and pupil dilation are mainly mediated by the noradrenergic system 77, 187. However, the psychological, addictive, and motor effects of amphetamine administration are in large-part mediated by the dopamine system, making them an ideal choice for the study of the system in animal models.

In contrast to amphetamines, cocaine and chemically related-drugs do not act as substrates for transporters but instead are non-selective, competitive inhibitors, sustaining elevated extracellular monoamines by binding to and blocking DAT as well as SERT and NET 34, 35, 39. Like amphetamine, cocaine administration results in easily measurable behavioural consequences, making it a commonly-used drug to test the integrity of monoaminergic systems; however, its non-selectivity for monoamine transporters (DAT, SERT, and NET) can also make results difficult to interpret. The development of transgenic mice that under- or overexpress monoamine transport proteins and vesicular transporters have helped elucidate the mechanisms of drug action, and have been instrumental in identifying the monoamine system to which drug behaviours can be attributed 34-36, 38, 188-191.

1.6 Tyrosine Hydroxylase and the Production of Monoamines

As products of the same biosynthetic pathway, dopamine, noradrenaline and adrenaline share a common rate-limiting enzyme, TH (Figure 1.3). Tyrosine hydroxylase, along with phenylalanine hydroxylase and tryptophan hydroxylase, is part of a family of enzymes responsible for hydroxylation of the aromatic ring of an amino acid 192. In the case of TH, tyrosine is hydroxylated to form L-DOPA, a precursor to all catecholamines. The enzyme contains a single iron atom per subunit, located in its active site 192, 193. It uses diatomic

Figure 1.3: The synthetic pathway of catecholamines. Catecholamines are produced along the same biosynthetic pathway, beginning with hydroxylation of tyrosine by the rate-limiting enzyme tyrosine hydroxylase. Tetrahydrobiopterin and diatomic oxygen (O2) are important cofactors in the initial conversion of tyrosine to L-3,4-dihydroxyphenylalanine (L-DOPA).

2+ oxygen (O2), and tetrahydrobiopterin (BH4) in a reaction with ferrous iron (Fe ) to covert tyrosine to L-DOPA 55, 192. The iron molecule must be in its ferrous form for catalytic action. During catalytic turnover, Fe2+ is oxidized to its ferric form (Fe3+); Fe3+ must be re-reduced 192-194 by a BH4 molecule for further activity . Importantly, small amounts of ROS are regularly produced by the TH system, which are normally handled by internal defence systems (see Section 1.10) 56.

The catalytic activity of TH is subject to feedback inhibition by its endogenous end-products, the catecholamines, which competitively bind to its iron molecule 195; importantly, only when iron has been oxidized to Fe3+ does it binds to catechols. In this way, catechols compete with

BH4 for binding at the catalytic site of the enzyme and thereby inhibit the binding of co- 2+ factors; as BH4 is no longer able to access and reduce the iron to Fe , the enzyme remains in its inactive form as long as the catechols are bound 192, 193, 196-199. This feedback mechanism allows local concentrations of end-products to adjust the activity of their synthetic enzyme 200-203. The activity of TH is also highly responsive to chemical and electrical cellular inputs. An early investigation into TH activity and L-DOPA production showed that in isolated guinea pig vas deferens, the addition of Ca2+, electrical stimulation, or a potassium-induced depolarization led to an increase in enzymatic activity above control conditions 204. Application of Ca2+ and stimulation treatments resulted in a fivefold decrease in the Michaelis constant (Km) for TH's natural substrate, tyrosine, as well as a fourfold decrease in the Km for

6,7-dimethyl-5,6,7,8-tetrahydropterin (Me2H4pterin), an artificial co-factor similar to BH4. In addition, the inhibition constant (Ki) for noradrenaline was increased fourfold and 16-fold with Ca2+ and electrical-stimulation, respectively, indicating a higher concentration is required to decrease the enzymatic reaction to half of the maximal rate 204. Authors concluded that nerve stimulation may mediate a cascade of intracellular events that resulted in the observed increase in binding of tyrosine and enzymatic cofactors, as well as the decrease in affinity for endogenous end-product inhibitors (i.e. catecholamines themselves), and suggested that this may be the result of allosteric modulation or covalent modifications of TH 204. It has since been shown that the phosphorylation of TH is largely responsible for kinetic alternations to the enzyme's activity.

1.6.1 Phosphorylation and the Activity of Tyrosine Hydroxylase

The regulation of TH activity in response to short-term stimuli — and therefore, changes in catecholamine production — is primarily controlled by dynamic changes in the phosphorylation state of the enzyme at its N-terminus 205. Phosphorylation is believed to influence synthetic activity in large part by dramatically decreasing feedback inhibition from catecholamines 195. It does so through a conformational change in the enzyme that decreases the affinity of catechols for the catalytic binding site and increases their rate of dissociation; 3+ in turn, dissociation of the catechols allows Fe to be accessed and reduced by BH4, returning the enzyme to its active state 196-199. Furthermore, phosphorylation has been shown 195, 206 to lower the Km for BH4, increasing the maximal reaction rate (Vm) .

Tyrosine hydroxylase is phosphorylated at serine residues Ser8, Ser19, Ser31, and Ser40 within its regulatory domain in vitro, a process mediated by a number of different protein kinases 207. Importantly, the TH isoforms of some species — including humans — have a threonine rather than serine at position 8 that, while capable of phosphorylation, does not regulate synthetic activity in vivo 91, 196. As far back as the mid-1970s, it was noted that direct phosphorylation of TH by cyclic AMP-dependent protein kinase (PKA) led to an increase in activity 208, 209. In isolated and purified bovine adrenal chromaffin cells, it was demonstrated that acetylcholine and other nicotinic cholinergic agonists caused Ca2+-dependent secretions of noradrenaline and adrenaline, and that this was associated with an increase in catecholamine biosynthesis dependent on the phosphorylation and activation of TH 210. (Similar results had previously been observed after nerve stimulation of isolated guinea pig vas deferentia by electrical or potassium-induced depolarization, as noted in Section 1.6 204.) In these early studies, it was suggested that the Ca2+ influx that follows cell stimulation may directly or indirectly facilitate the phosphorylation of TH and thus, the biosynthesis of catecholamines 204, 210. Not long after the effects of PKA were demonstrated, cyclic GMP- dependent protein kinase (PKG), Ca2+– and calmodulin-stimulated protein kinase II (CaMK II), and Ca2+– and phospholipid-dependent protein kinase (PKC) were also shown to phosphorylate TH at the same site, and all were associated with increased activity 208, 209, 211- 216. The identification of phosphorylation sites at Ser8, Ser19, and Ser40 was made by sequencing purified TH from rodent pheochromocytoma cells that had been phosphorylated

Table 1.1: Serine phosphorylation sites regulating the activity of tyrosine hydroxylase. The kinases that phosphorylate and phosphatases that dephosphorylate tyrosine hydroxylase have been identified using in vitro, in situ, and stimulation techniques. Kinases and phosphatases in bold are believed to have the strongest effect on the phosphorylation/dephosphorylation at a given site. Abbreviations: CaMPK, calcium- and calmodulin-stimulated protein kinase; ERK, extracellular signal-regulated protein kinase; MAPKAPK, MAPK-activated protein kinase; MSK, mitogen- and stress-activated protein kinase; PDPK, proline-directed protein kinase; PKA, protein kinase A; PKC, protein kinase C; PKG, protein kinase G; PRAK, p38-regulated/activated kinase. Based on Dunkley, et al. (2004) 195.

Serine Phosphorylation Kinases Phosphatases sites on N-terminus of phosphorylation and dephosphorylation and tyrosine hydroxylase activation inactivation

Serine 8 PDPK PP2A ERK1/2 ? Serine 19 CaMKII PP2A MAPKAPK2 PP2C PRAK Serine 31 ERK1/2 PP2A PDPK Serine 40 PKA PP2A PKG PP2C PKC CaMKII MSK1 MAPKAPK1 MAPKAPK2 PRAK

22 with PKA or CaMKII and a radioactive phosphorous, [γ-32P], digested with trypsin and eluted using reversed phase high-performance liquid chromatograohy (HPLC) 211. Since the early experiments of the 1970s and 1980s, several other kinases were shown to phosphorylate TH using a variety of in vitro, in situ and in vivo techniques (Table 1.1), however not all have been validated using every methodology and the relative role of the kinases was in some cases dependent on the experimental preparation 91, 195, 217, 218.

The predominant source of TH activation, particularly in response to cell depolarization, is phosphorylation at Ser40 205, 207, 219. In situ studies have reliably demonstrated that PKA is the primary kinase involved in phosphorylating Ser40 218, 219. Importantly, PKA-mediated phosphorylation most profoundly affects TH that is inactive (i.e. that which possesses Fe3+ , and which may be bound to dopamine). Indeed, PKA treatment has been shown to increase the activity of dopamine-bound TH by up to 20-fold in vitro, using physiologically relevant concentrations of the catechol. In 1992, Daubner et al. demonstrated that while phosphorylation of unbound TH produced a twofold decrease in the Km for the enzyme's substrate BH4, indicating that less substrate is required to reach maximum rate of synthesis 202 achieved by the system, it did not significantly alter the Vmax value . However, PKA- mediated phosphorylation of dopamine-bound TH reduced KBH4 twofold and increased the 91, 202, 203, 205 Vmax up to 10-fold .

The most prominent effect of Ser40 phosphorylation is the elimination of feedback inhibition produced by the binding of catechols to Fe3+-bound TH, achieved by a dramatic increase in their dissociation rate constants 196, 199, 203. Phosphorylation of Ser40 on Fe3+-bound TH resulted in a 17-fold decrease in the affinity of the enzyme for its immediate product, L- DOPA, and a 300-fold decrease in the affinity of enzyme for dopamine 196. In contrast, phosphorylation of TH in its ferrous form confers little change in activity, demonstrated both in purified TH as well as recombinant rat PC12 TH 196, 203. Together, these results have demonstrated that PKA-mediated phosphorylation activates TH in its inactive form by releasing it from end-product inhibition.

While phosphorylation of Ser19 is also known to affect the activity of TH, there is little evidence that Ser19 has a direct effect on TH activity and catecholamine production. Studies instead suggest it may facilitate phosphorylation of Ser40 and in this way, contribute to the

23 synthesis of catecholamines. The rate constant of Ser40 phosphorylation is two- to threefold higher when it is preceded by Ser19 phosphorylation, as determined by electrospray ionization mass spectrometry, whereas the opposite has no effect 220, 221. When Ser19 was identified as a site of phosphorylation by Campbell and colleagues (1986), it was shown to be the site of CaMKII-mediated phosphorylation; however, activation was determined to be dependent on the presence of an "activator protein", later identified as 14-3-3 protein 211, 222. In the absence of co-binding of 14-3-3, phosphorylation of Ser19 by CaMKII does not influence the enzymatic activity of TH 223-226. Importantly, phosphorylation of TH has been shown to decrease thermal stability and has also been shown to increase the vulnerability of the enzyme to tryptic digestion, results that may be indicative of a conformational change 227- 229. Following these observations, gel filtration chromatography was employed to measure the extent of conformational change that could be induced by phosphorylation at Ser40 and Ser19. The experiments demonstrated that phosphorylation at both Ser19 and Ser40 has an additive effect, inducing a more open and extended conformation than phosphorylation at either site alone 220. These results suggest that the Ser-19-phosphorylation induces a conformational change that allows Ser40 to be more easily accessed by kinases, allowing for additional conformation changes that may more profoundly affect catalytic activity.

The phosphorylation of TH at Ser31 is believed to be mediated by extracellular signal-related protein kinases I and II (ERKI and II) and proline-directed protein kinase (PDPK) 195, 230. While TH activation via Ser31 phosphorylation has not been as extensively studied as Ser40 and Ser19, some studies suggest it can directly influence TH activity and contribute to dynamic changes in the demand for catecholamine production. In a 6-hydroxyldopamine (6- OHDA) lesion model of neurodegeneration in dopaminergic cells, an increase in phosphorylated Ser31 but not Ser40 matched a greater dopamine recovery per TH protein in the substantia nigra, suggesting that the phosphorylation of Ser31 may be a compensatory mechanism to increase dopamine biosynthesis against TH protein loss 231. Studies in aged rats (assesssed at 12, 23, and 30 months) also suggested that phosphorylation of Ser31 in the substania nigra may play a role in dopamine bioavailability in aged rodents and on some behavioural outcomes dependent on catecholamines, such as locomotor activity 232.

1.6.2 Regulation of Tyrosine Hydroxylase Activity

1.6.2.1 Protein 14-3-3

Several proteins have been shown to interact with TH, post-translationally modulating its activity. 14-3-3 is a brain-specific chaperone protein 223, 233-235, with a variety of functions and binding partners 236-240. It has been shown to mediates an anti-apopotic pathway and to promote pro-survival signalling 241, and is also believe to be involved in vesicular transport 242, 243. Importantly, 14-3-3 has been shown to modify and stabilize the structural conformation of its binding partners 239, 244. As previously noted, 14-3-3 is believed to increase catalytic activity of tyrosine and tryptaphan hydroxylases, by interacting with phosphorylated TH at its regulatory domain and inducing a conformational change 220, 222, 223, 226, 245. In this way, it is required for CaMKII-mediated phosphorylation and activation of TH 222, 224, 226. 14-3-3 binds with highest affinity to TH phosphorylated at Ser19, and to enzyme that is phosphorylated at both Ser19 and Ser40 178, 179, 204, 205; specific isoforms of 14-3-3 also interact with TH phosphorylated at Ser40 alone, albeit with lower affinity than when the enzyme is phosphorylated at both sites 246. Studies suggest that the conformational change induced by 14-3-3 may influence the activity of TH, in part, by diminishing sensitivity of phosphorylated enzyme to proteolysis and reducing the rate of dephosphorylation by protein phosphatase 2A (PP2A) 246, 247.

1.6.2.2 Protein phosphatases

In 1987, Nelson and Kaufman described a striatal protein phosphatase that dephosphorylated 248 TH, inhibiting activity, which was in fact stimulated by BH4 . This phosphatase, identified as PP2A, was determined to catalyze almost all dephosphorylation of TH phosphorylated by PKA and CaMKII in the brain 249 and the adrenal medulla 250. As previously mentioned, PKA and CaMKII chiefly phosphorylate Ser40 and Ser19, respectively. Dephosphorylation by PP2A accounted for approximately 90% of dephosphorylation in both the bovine adrenal medulla and rabbit striatum, while protein phosphatase 2C (PP2C), a magnesium-dependent (Mg2+) phosphatase, accounted for the remaining 10%; protein phosphatase type 1 and type 2B had no effect on phosphorylation 249, 250. The dominant role of PP2A on dephosphorylation was demonstrated by incubating phosphorylated TH in striatal and adrenal

25 medulla extracts with a PP2A inhibitor, okadaic acid, resultant in a 206% increase in TH phosphorylation and a 77% increase in activity. In the presence of okadaic acid, any dephosphorylation that occurred was completely dependent on magnesium (Mg2+), indicating that PP2C was capable of actively regulating TH activity — albeit to a lesser degree than PP2A — at physiological-relevant levels of free Mg2+ (i.e., equivalent to Mg2+ conditions that occur in vivo) 249, 250. Moreover, activation of PP2A was shown to cause a decrease in catecholamine release, while inhibition with okadaic acid increased it 251-253. Later studies examining specific serine residues corroborated these results, finding that PP2A was entirely responsible for dephosphorylation at Ser19, Ser31, and Ser40 in permeabilized bovine adrenal chromaffin cells and contributed to the dephosphorylation of Ser8, although evidence suggested other mechanisms were also involved at the latter residue 251.

1.6.2.3 Alpha-synuclein

Alpha-synuclein, a small soluble protein, is highly enriched at the terminals of presynaptic neurons 254. While the full contribution of alpha-synuclein to normal brain functioning is not well understood, a 40% homology with the chaperon protein 14-3-3 has been noted and several interactions with both intracellular and membrane proteins have been observed 255-257. Alpha-synuclein has been linked to membrane remodelling, and shown to facilitate the docking of synaptic vesicles to the plasma membrane by SNARE-complex formations 256, 258- 263. However, large-scale alpha-synuclein oligomers have notably been linked to the disruption of vesicles in the readily-releasable pool, and to an inhibition of synaptic vesicular fusion and neurotransmitter release 264. In dopaminergic neurons, an interaction between alpha-synuclein and DAT is believed to modulate functional activity of the transporter, thereby regulating dopaminergic tone (see Appendix One) 265-269. Alpha-synuclein has also been linked to mitochondrial function and cellular health 241, 270-274. In addition, it has been shown to interact with several proteins and kinases affecting cell viability — including the Bcl-2-associated death promotor (BAD), PKC, and ERK — many of which also bind to 14-3- 3, albeit with contrasting effects 255. In a similar way, both 14-3-3 and alpha-synuclein have been shown to interact with TH but with opposing results: while 14-3-3 stimulates the

26 activity of TH, likely by facilitating phosphorylation, alpha-synuclein has been shown to inhibit it 235, 256, 275.

A direct interaction between alpha-synuclein and TH has been demonstrated both in vitro and in vivo. Using rodent brain homogenate, immunoblotting revealed the co- immunoprecipitation of alpha-synuclein and TH, the extent to which was not diminished in high-stringency conditions 235, 275. Importantly, pre-incubation of alpha-synuclein antibody with recombinant alpha-synuclein blocked the pull-down of TH; in like manner, the pre- incubation of homogenate with recombinant TH also blocked the immunoprecipitation of alpha-synuclein and TH. The effect of this interaction was a dose-dependent inhibition of TH activity by alpha-synuclein. Overexpression of wildtype alpha-synuclein in transfected dopaminergic MN9D cells did not alter total TH protein levels but resulted in a significant reduction in TH activity and a corresponding reduction in dopamine synthesis, suggesting a role for alpha-synuclein in the regulation of catecholamine synthesis 235, 275. In compliment to these findings, silencing alpha-synuclein gene expression by RNA interference in MN9D cells significantly enhanced both the phosphorylation of TH and dopamine production 276. Viral transfection of alpha-synuclein in knock-out mice has also shown that cells bearing aggregated alpha-synuclein were co-labelled for increased levels of phosphorylated TH. This same tissue had no changed in total-TH revealed by immunoblots and, in fact, showed lower total-TH levels when dopaminergic cells were assessed by immunoreactivity 277. These results indicate that alpha-synuclein can affect levels of phosphorylated TH in the absence of changes to total protein expression.

In addition to negative regulation via a direct protein interaction, alpha-synuclein may also regulate catecholamine production through indirect mechanisms. First, alpha-synuclein binds directly with 14-3-3, possibly at sites of homology between alpha-synuclein and 14-3-3 that are known to span a region mediating the dimerization of 14-3-3. This interaction was demonstrated by immunoprecipation: when rat homogenates were fractionized into cytoplasmic and membrane components, alpha-synuclein co-precipitated with 14-3-3 with the strongest association observed in the cytoplasmic component 255. By way of this interaction, alpha-synuclein may act to hamper 14-3-3 and prevent it from promoting TH phosphorylation at Ser19 and Ser40 255. Interestingly, in the brains of Parkinson's disease patients, 14-3-3 and

27 alpha-synuclein have been shown to selectively form a complex in the substantia nigra, but not in the cerebellum or cortex 278. In addition to other toxic consequences, the formation of this complex could increase vulnerability by reducing the normal anti-apoptotic activity of 14-3-3 278, 279.

Alpha-synuclein may further limit the activity of TH by promoting its dephosphorylation: in dopaminergic cells and primary cortex neurons, alpha-synuclein has been shown to activate PP2A through a functional interaction, in turn reducing the activity of TH 280, 281. Importantly, PP2A activity increased alongside alpha-synuclein overexpression although total levels of PP2A remained unchanged. Furthermore, in MN9D and inducible PC12 cells, an overexpression of alpha-synuclein caused a reduction in Ser40 phosphorylation by PKA 280. A more recent study expanded on these findings, showing more specifically that alpha- synuclein overexpression can regulate TH phosphorylation by enhancing the methylation of PP2A, which renders the phosphatase active, and that this could be abolished by okadaic acid 281. In contrast, cells transfected with mutated alpha-synuclein showed increased levels of phosphorylated PP2A, which corresponds to the inactivation of the phosphatase enzyme 281. In addition, mice with genetically mutated alpha-synuclein (A53T) had a diminished ability to stimulate soluble PP2A protein. The reduction in PP2A activity directly corresponded to increased phosphorylation at Ser40 and increased TH activity, demonstrated by immunoblot and enzymatic assays of samples harvested from the adrenal medulla 282. Interestingly, transgenic mice with the A53T mutation also had Lewy-like protein aggregation and exhibited behavioural abnormalities consistent with the early, non-motor symptoms of Parkinson's disease 282.

In addition to the mechanisms of alpha-synuclein mediated regulation of TH activity discussed in the preceding paragraphs, dysregulation of alpha-synuclein may have further negative effects on catecholamine biosynthesis. Overexpression of alpha-synuclein has also been shown to inhibit the activity of PKC, representing another potential pathway by which it is capable of controlling phosphorylation and activity of TH 255. In addition, overexpression of wildtype but not mutant alpha-synuclein has been shown to downregulate a number of genes involved in dopamine synthesis, including both TH and aromatic acid decarboxylase; the effect of alpha-synuclein on TH transcription was demonstrated using mRNA microarrays

28 and confirmed by assessing TH+ immunoreactivity in transfected cell cultures 257, 283. Based on its ability to regulate TH activity, the loss of soluble alpha-synuclein — as is the case with mutated or aggregated protein — could result in an increase in dopamine synthesis and a parallel increase in metabolite production 235, 256, 275. Therefore, in principle, there lies a potential for the alpha-synuclein dysfunction to contribute to accumulation of reactive dopamine metabolites and ROS.

1.7 Monoamine Transport Proteins

Regulation of transmitter synthesis is one level by which neurotransmission is modulated; another, controlling both tonic feedback and evoked signalling, is the clearance of transmitters from the extracellular space (Figure 1.4). The paradigm of monoaminergic reuptake was first introduced by Julius Axelrod in 1961 to describe how noradrenaline was taken up by presynaptic nerve terminals; a mechanism he hypothesized was responsible for the cessation of neurotransmission 22, 162. Within a short time, similar mechanisms were proposed for the termination of dopaminergic and serotonergic transmission 22, 284. Together, the three monoamine transporters — DAT, NET and the sertonin transporter (SERT) — belong to a family of protein transporters structurally comprised of 12 transmembrane domains, with intracellular terminals on both the N- and carboxyl (C-) ends 22, 107-109, 285. They are symporters, driven by an energetically-favourable sodium/chloride exchange that co- transports monoamines (or other substrates) across the plasma membrane; the sodium concentration gradient required for transport is maintained by the sodium/potassium pump (Na+/K+-ATPase), located ubiquitously on the plasma membrane 21. Under normal conditions, monoamines move intracellularly into the presynaptic neuron by coupling with two sodium ions and one chloride ion, with both the ions and the substrate moving down their respective concentration gradient 22, 107-110. Mechanistically, transport requires the sequential binding of sodium and chloride ions along with the substrate, be it endogenous or pharmacological, to binding sites on the extracellular side of the plasma membrane. Because the exchange induces a conformational change that exposes the binding sites to the intracellular side of the membrane, this model also allows for the possibility that transporters can function in "reverse" in certain conditions, allowing substrates to travel outward should

Figure 1.4: Schematic representation of intracellular and membrane proteins involved in maintaining dopamine homeostasis in the presynaptic cell. A schematic representation of a terminal button on a dopaminergic cell. Dopamine levels inside the cell's cytosol are controlled by the rate of synthesis from tyrosine, packaging into vesicles by the vesicular monoamine transporter (VMAT2), and by degradation to 3,4-dihydroxyphenylacetic acid (DOPAC ) by monoamine oxidase (MAO) and aldehyde dehydrogenase (ALDH). After dopamine is released, the neurotransmitter remains in the extracellular space — free to act on pre- and postsynaptic receptors — until it is metabolised by enzymes in astrocytes or postsynaptic cells (not shown), or taken back up by presynaptic neurons by the dopamine transporter (DAT). The dopamine transporter is a symporter, co-transporting two sodium (Na+) ions and one choride ion (Cl-) with dopamine. As it is located perisynaptically, extracellular dopamine must diffuse away from the synaptic cleft for transport. The sodium- potassium (Na+/K+) pump, located ubiquitously along the plasma membrane, is required to maintain the necessary chemical gradient to drive Na+ and Cl- down their concentration gradient through DAT. In addition, the D2 autoreceptor provides information to the presynaptic neuron regarding extracellular concentrations of dopamine which can affect both the rate of synthesis and the density of DAT on the membrane. Additional abbreviations: TH, tyrosine hydroxylase; DDC, dopamine decarboxylase.

30 the concentration gradient change 22, 107-110. This is one way by which pharmacological agents such as amphetamine modify monoamine transmission.

In the brain, monoamine transporters are selectively expressed in neurons producing their "name" transmitter (i.e., DAT is expressed in dopamine neurons), and can therefore be used as immunomarkers of specific cell types. They are positioned perisynaptically in neuronal terminals, where they take up neurotransmitter that has diffused away from the synaptic cleft. In addition, transporters are strongly expressed at the plasma membrane of the soma, and along dendrites and the axonal shaft 286, 287. The somatic expression of DAT is predominately localized in the substantia nigra and VTA. Owing to the widespread projections of these dopaminergic neurons, DAT can also be found in far-reaching terminals. Thus, DAT immunoreactivity can be detected in the striatum and nucleus accumbens, olfactory tuberacle, cingulate cortex, prefrontal cortex, and more 22, 23, 288-291. Cell bodies in the locus coeruleus and other small brainstem nuclei strongly express NET, which is also found in regions such as central hippocampal and cortical terminals. Likewise, SERT is expressed in the soma of cells in the raphe nuclei, and in the many regions to which its serotonergic neurons send projections 22, 292-295. Some monoamine transporters can also be found peripherally; NET, for instance, is expressed in the heart, ovaries, and other peripheral organs 296-300. In the brain, the exclusivity of transporter expression permits the detection of specific groups of cells using immunoreactivity. This, in turn, allows for use of transporters as markers when evaluating cell loss. In addition, it allows for the assessment of alterations in neurotransmission within specific pathways that can result from fluctuations in the membrane expression of transporter proteins, irrespective of cell loss. The following section will specifically focus on DAT.

1.7.1 The Dopamine Transporter

The density of monoamine transporters at the plasma membrane is fluid, changing rapidly in response to sustained changes in extracellular transmitter concentrations and to exogenous drug substrates or inhibitors. Importantly, the distribution of transporters is tightly controlled by intracellular signals. Indeed, following its discovery, decades of studies have revealed that DAT interacts with a number of intracellular proteins, kinases and phosphatases — interactions that are crucial to the regulation, expression and functioning of the transporter 22,

35, 36, 38, 301-303. The on-going study of these protein interactions has led to the appreciation that DAT exists in a highly-regulated protein complex rather than as an independent protein residing at the plasma membrane, with each partner contributing to the overall task of transporting substrates into the cell and to a shared goal of dopamine homeostasis 47, 288, 304 (Figure 1.5). Many of the known DAT interactions were first identified in vitro, by screening human clone libraries with the yeast-two-hybridization system (Y2H), and through glutathione S-transferase (GST) fusion protein precipitations and immunoprecipitation using transfected cells; however, because many early experiments used heterologous cell lines, they may not offer a complete picture of the interactions that occur in natural conditions. A more accurate representation of in vivo interactions has been attempted by immunoprecipitation and mass spectrometry using homogenized striatal samples, yet these studies did not reveal any interactors previously identified in vitro 288, 305. Refinement of these methods will lead to a more precise characterization of the participants in the DAT proteome

This section will provide a brief overview of the interactions involved in DAT regulation; a detailed review of these interactions can be found in its entirety in Appendix 1. Understanding the nature of the DAT proteome is of significance because these interactions are, in principle, responsible for the ability of the transporter to maintain dopamine homeostasis. In addition, a better understanding of these interactions and how they regulate DAT expression, specifically, may reveal potential therapeutic targets for dopamine dysregulation.

The cycle of DAT begins in the endoplasmic recticulum (ER), where it is synthesized and glycosylated before it is exported to the plasma membrane. Mutagenesis studies have revealed that in transfected cells, protein interactions at the carboxyl terminus of the human DAT are involved in the efficient export of newly synthesized transporter and in this way, influence the surface expression of DAT 306, 307. Human DAT with point mutations and/or progressive truncation of the carboxyl end has impaired targeting to the plasma membrane and decreased transporter activity 308-310. In addition, alanine substitutions of lysine at position 590 and aspartate at 600 resulted in retention of DAT in the ER and a significantly delayed delivery of the transporter to the membrane, demonstrated using live cell fluorescence microscopy and cell surface biotinylation; a substitution at glycine-585 blocked

Figure 1.5: Schematic of the dopamine transporter proteome. Several proteins have been shown to interact with different domains of the dopamine transporter. These include Synaptogyrin-3, RACK1 and Syntaxin 1A on the N-terminus, and Hic5, PICK1, Synuclein, and CAMKIIα on the C-terminus. A number of other proteins may have direct interactions, or indirect interactions, such as protein kinase C (PKC), protein phosphatase 2A (not shown), protein kinase A (not shown). Figure based on Torres et al. (2006) 47.

33 its export completely 306. The translocation of DAT from the cytosol to the plasma membrane may also be at least partially dependent on the dimerization of transporters, an interaction maintained at the cell surface 307, 311-314: mutational studies in HEK-293 cells have suggested that the oligomerization of DAT is involved in both functioning and trafficking of the transporter, revealing a dominant-negative effect on wildtype transporter co-expressed with non-functional DAT mutants, as well as an accumulation of the transporter oligomers in the ER 309.

Once at the plasma membrane, DAT expression is regulated by direct protein interactions and by second messenger systems acting on phosphorylation consensus sites located on its intracellular loops, which include kinases (e.g. PKA, PKC, PKG, tyrosine kinase, and CaMKI/II), phosophatases, and arachidonic acid 22, 285, 315-317. The interaction of DAT with second messengers is believed to modulate surface expression of the transporter by inducing internalization and cycling of the transporter. Importantly, trafficking of transporters to and from the membrane can also be modified by substrates of the transporter, including both dopamine and pharmacological agents such as cocaine and amphetamines 318.

Instrumental in determining the subcellular distribution of transport proteins, immunolabelling and electron microscopy have demonstrated that in the brain, DAT is exclusively expressed in the cell bodies, dendrites and axonal membranes of dopaminergic cells. In the dendritic processes and spines of the substantia nigra, DAT can be visualized on both the plasma membrane and in the smooth ER 286, 287. It is also highly expressed along neuronal extensions and varicosities however, again, DAT is not localized directly at the synapse but rather is perisynaptic, a position visualized both at neuronal terminals of the striatum and in dendritic processes within the VTA 286, 287. As previously mentioned, NET and SERT are also localized extrasynaptically 295, 319. Dopamine and other monoamine transmitters must therefore diffuse away from the synaptic cleft before they are taken back up by presynaptic neurons. The distribution of DAT in the plasma membrane of the soma and neuronal extensions is uniform, which was determined by directly observing trafficking in dopamine neurons using fluorescently tagged cocaine-analogs in live midbrain slices 320. Importantly, fluorescence recovery after photobleaching (FRAP) allowed for the observation that DAT is highly mobile, moving bidirectionally in both the extensions and varicosities,

34 with mobile fractions constituting more than 70% of the total population. The mobile nature of membrane transporters allows the proteins to efficiently perform two primary tasks: clearing extracellular dopamine after a stimulated release and effectively controlling basal levels of dopamine 286, 287, 320.

1.8 Diseases That Affect Monoamergic Systems

To this point, we have discussed a number of proteins and enzymes that contribute to normal functioning of monoaminergic systems: those responsible for proper catecholamine synthesis, the monoamine transporters and receptors, and several proteins that are involved in a regulatory role. All of these proteins function as part of a broader system that both controls monoamine homeostasis and allows for efficient neurotransmission. Variability in the expression or functionality of any one of these proteins can influence the output of the system to varying degrees, along a spectrum of severity ranging from insignificant to profound impairment 321. For instance, polymorphisms in monoamine transporters have been shown to have a range of phenotypic consequences in humans. For example, genetically-linked variations in DAT expression and functioning have been associated with responsiveness to reward, possibly rendering an individual more susceptible to addiction and risk-taking behaviour such as gambling, and have also been linked to ADHD 28, 31, 322-326. Furthermore, reductions in transporter density have also been linked to the pathology of REM-sleep behaviour disorder and schizophrenia 10, 327-329. The susceptibility to major depression, anxiety, and post-traumatic stress has been associated with polymorphisms of NET and variations in transporter availability, as has the risk of suicide in depressed individual 330-334. In addition, the magnitude of cardiovascular responses to stress have also been linked to variability in NET in the locus coeruleus 296, 335, 336. Indeed, there are innumerable examples of how variability in transport expression or functioning can affect physiological and behavioural outputs in humans and in animals, alike; similar examples can be made for how variability in receptors affects monoaminergic circuitry. Neurodegenerative diseases are a class of disorders that arise from the progressive loss of specific cell groups which not only result in structural loss but cause interruptions in functional circuitry with profound consequences. The following sections will be focused on Parkinson's disease — a

35 multisystem neurodegenerative disorder that principally targets catecholamine cells — and the cellular mechanisms that may contribute to its pathogenesis.

1.9 Parkinson's Disease

Parkinson's disease is a progressive neurodegenerative disease, famously recognised by characteristic motor impairment such as a resting tremor, slow movement and abnormal gait. Affecting 1-2% of the population over 65 years of age, it is one of the most common neurodegenerative disorders, second only to Alzheimer's disease in prevalence 337-339. While the risk of development is known to increase with age, a small subset of patients experience an early-onset of symptoms.

The distinctive motor symptoms of Parkinson's disease largely arise from a profound loss of dopaminergic cells in the nigrostriatal pathway of the basal ganglia, estimated at 70-80%. In addition, there is comparable degeneration of noradrenergic cells in the locus coeruleus and a great number of non-motor symptoms that precede the presentation of motor impairment 340- 343; the serotoninergic and cholinergic systems are also disrupted, albeit to a lesser extent. Importantly, symptoms often don't clinically manifest, or are not recognised, until after pathology has reached an advanced stage. Moreover, heterogeneity exists both in age of onset and the manifestation of symptoms: a characteristic tremor is one of the discernible symptoms observed in individuals with early-onset Parkinson's disease while symptoms of postural instability and abnormal gait seem most pronounced in individuals with a later onset 344, 345. Currently, the gold standard of pharmacology treatment, L-DOPA therapy, seeks to control symptoms and restore lost dopamine by providing the chemical precursor to monoamines. However, the benefits of L-DOPA therapy are limited since long-term use results in a number of unpleasant side effects, some of them motor, such as drug-induced dyskinesia 83. Deep-brain stimulation — a pacemaker-like stimulation of small loci in the thalamus, globus pallidus or subthalamic nuclei — is a surgical procedure available to patients who no longer benefit from pharmacological treatment that effectively blocks abnormal neuronal activity and burst frequencies in the basal ganglia 346, 347. Still under development, stem-cell treatment aims to replace lost cells and restore normal transmission in

36 affected pathways 348-351. Ultimately, the goal of Parkinson's disease research is intervention rather than symptomatic treatment; however, this requires a better understanding of the complexities underlying pathogenesis and mechanisms of cell death. Importantly, the etiology of the disease is not always clear: while a number of genes have been linked to the development of Parkinson's disease (producing 'familial' Parkinson's disease), approximately 90% of the cases are termed "sporadic" and of idiopathic origin.

1.9.1 Genetic Heritability and Environmental Risks

Accounting for up to 10% of cases, a number of gene variants have been identified as causal factors, or shown to correlate with susceptibility, in the development of familial Parkinson's disease. Recent genome-wide association studies has identified up to 28 variants across 24 chromosomal loci associated with an increased risk of Parkinson's disease 352. Of these, monogenic mutations in 9 individual genes at 15 loci (termed Park1–15) have a well- documented link to the heritable form of the disease 353-355. Perhaps unsurprisingly, a rare form of Parkinson's is conferred by dominant point mutations and multiplications (duplications and triplications) of SNCA, which is believed to cause structural instability of the alpha-synuclein protein and cellular toxicity 356. A more prevalent mutation in the leucine-rich repeat kinase 2 (LRRK2) gene is known to result in another autosomal dominant form of familial Parkinson's disease. Some variants—including loss-of-function mutations in Parkin, PINK1, DJ-1, and ATP12A2—have been linked to early-onset Parkinson's disease, a recessive form of the disorder in which symptoms manifest before the age of 40. Other genetic variants have been shown to increase susceptibility, including certain polymorphisms in SNCA, LRRK2 and in the β-glucocerebrosidase gene (GBA). (For further discussion on the genetic components of familial Parkinson's disease, please refer to one of the many excellent reviews referenced 353-355.) The identification of these genes has allowed us to better understand the heritable forms of the disease, and undoubtedly, genome-wide association studies will soon reveal further associations.

While 90% of Parkinson's cases are termed sporadic and of unknown etiology, there are several environmental toxicants that are known risk factors 357-359. The use of pesticides has long been linked to the development of sporadic Parkinson's disease. A case-controlled study

37 evaluating lifetime pesticide exposure in humans found a positive association between the development of Parkinson's disease and a group of agents that induce mitochondrial dyfunction, as well as with a group that increases oxidative stress; these groups included rotenone and paraquat, respectively 360. Causal connections have been established in rodent models: in 2000, it was demonstrated that chronic injections of rotenone — at the time, a widely used pesticide — could induce parkinsonian features in wildtype rats, including alpha- synuclein and ubiquitin inclusions, dopaminergic neurodegeneration and parkinsonian behaviour 358, 361. Rotenone and paraquat are now commonly used in non-human animals to examine the mechanisms of cellular toxicity in induced-models of Parkinson's disease 360, 362- 365.

In addition to these (and other) pesticides, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) has been shown to be highly — and selectively — neurotoxic to dopamine cells. A synthetic compound originally synthesized in an attempt to produce a street analogue of the narcotic meperidine, MPTP was quickly shown to induce acute and irreversible parkinsonianism in those exposed to it. It is rapidly converted to 1-methyl-4- phenylpyridinium (MPP+) which once inside the cell, accumulates in the mitochondria, inhibiting complex I, and creates conditions of oxidative stress 52, 53, 366-368. MPTP is perhaps the most commonly used pharmacological agent to study the mechanisms of Parkinson's disease, as it causes a specific toxicity of dopamine cells that can be attributed to the high affinity of DAT for MPP+ 369. However, it is also taken up by NET, albeit to a much lesser extent 370. Therefore, the possibility that some of the behavioural outcomes could be a result of synergistic damage to the dopaminergic and noradrenergic systems cannot be overlooked 301, 370-373.

The traditional concepts and approaches towards Parkinson's disease face a degree of challenge, as there is a measure of heterogeneity in the clinical presentation of symptoms, onset and progression of the disease. While Parkinson's disease is still segregated into two categories — familial and sporadic — there is great value in both identifying genetic mutations and environmental risk factors that lead to the manifestation of disease 374. In reality, it is prudent to consider Parkinson's to be a family of disorders, with similar mechanisms and pathologies, rather than a single disease. Importantly, an understanding of

38 the genetic and environmental risks associated with the clinical presentation of Parkinson's disease has permitted us to create in vivo models to study pathogenesis and the mechanisms of cell death.

1.9.2 Staging and Neuropathology

The development and progression Parkinson's disease is accompanied by striking and distinctive pathological changes in the brain. Its diagnosis post-mortem, whether in a symptomatic or pre-symptomatic phase, requires the presence of specific inclusions that form spindle- or thread-like Lewy neurites in neural processes and/or globular Lewy bodies in neuronal perikarya 48, 49. A major component of these inclusions is aggregated alpha- synuclein which, as previously discussed, is a small hydrophilic protein normally found in presynaptic terminals that is believed to have a variety of chaperone-like roles. And as previously mentioned, many of these roles are linked to the overall function and viability of the cell; alpha-synuclein has been linked to SNARE-complex assembly and synaptic vesicle exocytosis, DAT functioning and internalization, and even apoptosis 255, 268, 274, 375, 376. The aggregation of alpha-synuclein, then, can limit its functionality and have dramatic effects on the intracellular environment. In neuropathologies, alpha-synuclein inclusions are also a characteristic feature of dementia with Lewy bodies (DLB); for this reason, both Parkinson's disease and DLB are defined as "synucleinopathic" disorders. Similar inclusions, consisting of tau-protein aggregates, are a cardinal feature of Alzheimer's disease.

When undergoing pathological state changes, alpha-synuclein misfolds and associates with other intracellular components — including phosphorylated neurofilaments, heat-shock protein 90 and ubiquitin — thereby forming higher order oligomers and insoluable protein aggregates 48, 377, 378. These, then, can combine to form disease-specific structures such as the Lewy fibrils and inclusion bodies seen in Parkinson's disease. Recent, ground-breaking research have shed some light on how Lewy body inclusions expand throughout the brain, travelling from one brain region to the next, as the disease progresses. Studies have shown that the injection of proteinaceous aggregates can induce pathology within healthy cells, and also transmit pathological misfolding to uninfected, anatomically connected regions 376-379. In primary neurons expressing wildtype levels of the protein, the inoculation of pre-formed

39 fibrils (constructed from purified recombinant human wildtype alpha-synuclein) was shown to recruit endogenous alpha-synuclein into insoluable aggregates 376, 377. Interestingly, overexpression or mutation of alpha-synuclein was not required for this recruitment or the subsequent development of Lewy formations. In addition, the accumulation of pathological alpha-synuclein eventually led to selective decreases in synaptic proteins, progressively diminished neuronal excitability and connectivity, and neuronal death — again demonstrating that functional alpha-synuclein protein makes strong contributions to monoaminergic cell functioning and viability 376, 379. Next, it was demonstrated that a single intrastriatal inoculation of synthetic alpha-synuclein fibrils (referred to as misfolded alpha-synuclein "seeds") led to cell-to-cell transmission of pathological aggregation to healthy neighbouring neurons in wildtype mice 377, 378. These studies were perhaps the first demonstration of a pervasive spread of Lewy inclusions in the absence of alpha-synuclein mutations. Importantly, the cell-to-cell transmission of alpha-synuclein aggregation was followed by reductions in dopamine levels in the nigrostriatal pathway and motor impairment, and a single innoculation into the dorsal striatum of wildtype mice resulted in Lewy body formation and progressive dopaminergic neurodegeneration in the ipsilateral substania nigra pars compacta, but not in the neighbouring VTA. Such an observation is consistent with the regional pathology of Parkinson's disease; however, unlike in Parkinson's, the locus coeruleus and the (serotonergic) raphe nucleus remained largely unaffected 377, 378. This observation suggests that in addition to alpha-synuclein aggregation, other underlying characteristics or mechanisms may be operative, and could contribute to the susceptibility of certain cells to degeneration while other are spared. After innoculation, alpha-synuclein accumulation was discovered in several structures directly connected to the striatum — regions that are known to accumulate Lewy formations in Parkinson's disease. These results demonstrate that direct connections between infected cells are highly conducive to the spread of alpha-synuclein pathology 377, 378. Importantly, the formation of Lewy body inclusions follows a predictable, ascending progression beginning in the brainstem and moving into higher order structures 48, 49, 380. In the context of the brain's small world architecture (i.e., a network with an exponentially truncated power law), the cell-to-cell transmission becomes particularly interesting, and may mechanistically explain the predictable pathological course from highly connected hubs in the brainstem to higher order structures.

In addition to the appearance of Lewy formations, Parkinson's disease is known to progress with a slow and unremitting loss of particular groups of catecholamine cells. To better understand this progression, Braak et al. (2003b) examined whether pathology in affected areas develops concurrently or sequentially. To this end, he defined the staging of Parkinson's disease by examining the brains (post-mortem) of 41 individuals diagnosed with Parkinson's disease, 69 individuals with minor inclusions but no clinical record of Parkinson's-like symptoms, and 58 individuals with no record of neurological or psychiatric disease and no inclusions 48. The severity of Parkinson's-related pathology ranged from a single Lewy neurite in the dorsal IX/X motor nucleus to high density inclusions in multiple sites, including higher order structures such as the cerebral cortex. Each subsequent stage contained all the pathologies of the preceeding stages plus the appearance of lesions in newly-affected regions. In brief, brains that were considered to be 'least affected' only displayed lesions in the olfactory bulb and the dorsal motor nucleus (Stage 1). In Stage 2, additional lesions in the caudal raphe nuclei, gigantocellular recticular nucleus, and the locus coeruleus- subcoeruleus complex were observed; in Stage 3, additional lesions in the midbrain, particularly the substantia nigra pars compacta; in Stage 4, the addition of prosencephalic lesions, with cortical lesions confined to the temporal mesocortex and allocortex; Stage 5 included lesions in high order sensory association areas of the neocortex and prefrontal neocortex; and Stage 6, additional lesions in first order structures of the neocortex and premotor areas 48, 49 (Figure 1.6). Together, the appearance of Lewy inclusions and the progressive neurodegeneration of specific cell groups mark determinable stages in the progression of yet-unstoppable pathology of Parkinson's disease.

The cardinal motor symptoms of Parkinson's disease are primarily associated with degeneration of dopaminergic cells bodies in the substantia nigra and the corresponding loss of dopaminergic innervation to the striatum. However, neither alpha-synuclein inclusions nor neurodegeneration are confined to nigrostriatal pathway. Importantly, Braak and colleagues (2002) observed Lewy neurite and Lewy body inclusions in a number of brainstem and pontine structures: the dorsal motor nucleus, reticular formation, gigantocellular recticular nucleus, caudal raphe, and locus coreuleus-subcoeruleus have all been observed to undergo pathological changes early in the disease's progression. These loci send efferent projections to the limbic system, cortex, thalamus, cerebellum, among others 48, 49.Furthermore, while

Figure 1.6: The pathological and symptomatic progression of Parkinson's disease. Braak's staging of idiopathic Parkinson's disease involves the appearance of Lewy neurite and Lewy body lesions, beginning in the dorsal IX/X nuclei and intermediate reticular zone of the brainstem and ascends into higher order structures in the cortex. The formation of proteinaceous inclusion bodies is hypothesized to underlie the mechanisms of neurodegeneration in vulnerable cell groups. Each stage (i.e, 1 through 6) is characterized by lesions in all of the structures affected in the preceding stages, plus the appearance of lesions in a new set of structures. Premotor symptoms occur in Stages 1 and 2, coincident with noradrenergic cell loss, while motor symptoms do not typically emerge until 60-70 % of nigral cells are lost (Stage 3/4) 48, 49, 343. Cognitive impairment and Lewy-body dementia are typically seen in later stages, and attributed to multi-system deficits; late stage Parkinson's disease is marked by extranigral Lewy body inclusions that are sometimes accompanied by other pathologies, such as senile plaques, as well as degeneration in cholinergic structures of basal forebrain and cerebral cortex 343, 381. Figure based on Braak et al. (2002a; 2002b) 48, 49.

42 dopaminergic deficits have also been linked to some non-motor symptoms as well, including some mood and sleep irregularities, early dopaminergic disregulation may not arise from loss of dopamine neurons per se but rather loss of afferent innervation to dopaminergic regions. For instance, the cholinergic/glutamatergic pedunculopontine tegmental nucleus (PPT) of the reticular activating system projects to the substantia nigra pars compacta, as well as other areas in the basal ganglia such as the subthalamic nucleus and globus pallidus internus; it also sends targets to the thalamus, cerebellum, basal forebrain, lower brainstem, and cortical supplementary motor, motor, and somatosensory cortices. The wide projections of the PPT have been associated with motor functions — such as voluntary movement and locomotion — attention, arousal and more 382-385. Degeneration in this area occurs in the earliest stages of Parkinson's disease (i.e., Stage 1 and 2) and the loss of PPT efferent projections have been implicated in motor abnormalities, such as impairment in gait and balance, as well as non- motor symptoms such as sleep architecture. Moreover, there is a comparable if not greater loss of noradrenergic cells in the locus coeruleus that precedes nigrostriatal cells death, estimated at 70-80% 152, 386, 387; the loss of these and other brainstem neurons are likely primarily responsible for the abnormalities that emerge in "presymptomatic" stage of Parkinson's disease as well as many of the advance symptoms 388-391. The loss of central noradrenergic neurons, also believed to contribute to motor abnormalities 128, 151, 386, 389, 392, have been associated with sleep disturbances and neuropsychiatric symptoms, including depression, dementia and psychosis 143, 151, 386, 388, 392-394. Importantly, noradrenergic loss also extends into the peripheral nervous system: cardiac sympathetic denervation occurs in many cases of Parkinson's disease, often manifesting prior to motor symptoms 390, 395, 396. The massive loss of catecholamine neurons and the consequential impairment in dopaminergic and noradrenergic neurotransmission is unquestionably responsible for a wide range of motor and non-motor symptoms. Yet while Parkinson's disease predominantly affects catecholaminergic cells, it does not do so exclusively; it remains important to recognise that concomitant pathologies observed in other neurotransmitter systems might contribute to its symptoms, including the serotonergic and cholinergic systems. For instance, both imaging and postmortem studies show Lewy body inclusions and degeneration in cholinergic systems in the basal forebrain and cortex; cholinergic deficits worsens in later stages, coincident with the onset of more severe symptoms of cognitive impairment and dementia 343, 381. In addition,

43 the disease follows a predictable path beginning first in the brainstem, then moving upwards into the midbrain and then the cortex. The predictable, ascending appearance of inclusions bodies not only has implications for the onset of symptoms but may offer some insight into the spread of pathological alpha-synuclein aggregation.

1.9.3 Symptoms

The cardinal motor features of Parkinson's disease include a resting tremor, bradykinesia, abnormal posture and gait, instability and muscle rigidity, resulting from a loss of dopaminergic neurons in the nigrostriatal pathway. Dopaminergic transmission is vital to the induction of voluntary movement and movement regulation: stimulation of D1 and D2 receptors on postsynaptic medium spiny neurons in the striatum, in a respective order, are believed to coordinate movement — first reducing muscle tone in the antagonist muscle before inducing contraction in the agonist muscle 397. However, motor symptoms do not arise until approximately 60-70 % of nigral neurons have been lost, at which point there not only exists extensive multi-system Lewy bodies but significant neurodegeneration in a number of other structures. In addition to motor symptoms are a number of sensory, autonomic, and psychiatric symptoms, some of which precede the onset of motor impairment. Identifying the earliest symptoms may be the first steps toward early detection and, it is hoped, intervention.

Evidence suggests that the appearance of certain, diagnosable sleep disorders may be an early indication of the onset of neurodegenerative disorders, particularly synucleinopathies such as Parkinson's disease, DLB, or multiple system atrophy 342, 343, 398. The development of rapid eye movement (REM) behaviour disorder (RBD) — a disorder in which individuals "act out their dreams" due to a dissociation between electroencephalic REM sleep and motor atonia — is at present, the strongest clinical predictor of onset of neurodegenerative disease. Longitudinal studies have shown that 40-45 % of patients diagnosed with RBD develop Parkinson's disease within the 5 years and an estimated 80-98% are diagnosed with synucleopathic disorders within 15 years 342, 343, 398, 399. In idiopathic RBD patients, recent studies have shown both the severity of loss of REM sleep atonia and electroencephalogram slowing to be predictive of neurodegeneration and the development of Parkinson's disease 400, 401. A predisposition to neurodegenerative disorders might be due to the breakdown in the

44 circuitry that underlies REM sleep 398; in the case of Parkinson's disease, this may include changes to the integrity of the locus coeruleus/subcoeruleus complex and the reticular activating system. A study combining polysomnography and neuromelanin-sensitive imaging showed evidence of reduced signal intensity in the locus coeruleus/subcoeruleus of patients with RBD and — to a greater extent — those with both RBD and Parkinson's disease, as compared to age-matched healthy controls 402. The signal intensity negatively correlated with the level of muscle tone during REM: that is, reduced levels of melanization were associated with increased muscle tone in REM, which under normal conditions, is absent. Importantly, the extent of melanization of catecholamine-containing cells is inversely related to cell death in disease, suggesting less melanized cells are more vulnerable to neurodegeneration 403, 404. In addition, a correlation has also been found between decreased DAT levels in the striatum and the presentation of RBD 405, 406. Both daytime sleepiness and abnormalities in sleep architecture are common in the prodromal phase of Parkinson's disease 399, 407-409. The appearance of sleep abnormalities in the early premotor phase of Parkinson's is unsurprising and consistent with the known progression of neurodegeneration beginning in early stages with neurodegeneration in the brainstem, home to many loci involved in modulating sleep and arousal 382, 384, 399. Cells located in locus coeruleus, the paragigantocellular reticular nucleus, the raphe nucleus, and the PPT are all putative components of the reticular activating system; importantly, these regions are among the first to undergo pathological changes in Parkinson's disease, observed as early as Stage 1 and 2 383, 394, 407, 408, 410. Moreover, non- motor symptoms of Parkinson's disease are not limited to disturbances in sleep and arousal, and all can impact a patient's quality of life to varying degrees. Hyposmia, or impaired olfaction, has been reported by a very high proportion of Parkinson's disease patients and is associated with very early Lewy body formation and degeneration in the anterior olfactory nucleus, and extensive Lewy body formation in the olfactory bulb, both occurring in Stage 1 48, 342, 411. Symptoms of autonomic dysfunction are also prevalent in newly diagnosed patients, including constipation and cardiac abnormalities, and likely result from the loss of peripheral noradrenaline 343, 395, 396, 412. In addition, behavioural changes and impulse control issues have been reported with increased frequency in Parkinson's patients, particularly in young men with early onset. One such example is pathological gambling, which has been linked to abnormal transmission in the frontostriatal reward network and to reduced DAT density in

45 the ventral striatum 413-415. It is possible that quite apart from alternations in dopamine neurotransmission that results from cell loss, dopamine-replacement treatment could exacerbate impulse control symptoms 416-418.

Mood and cognitive disorders are commonly co-morbid with Parkinson's disease, but may also be a manifestation of early Parkinson's-related pathology. Depression and anxiety diagnoses have been found to be significantly more prevalent in Parkinson's patients, especially those who are prodromal to, or in the early stages, of disease 343, 419-421. Furthermore, cognitive impairment has been reported in up to 36% of newly diagnosed Parkinson's patients, and rose to over 50% at a 5 year-follow up 343, 422, 423. While there is evidence of cognitive impairment in the early stages of the disease, profound impairment in executive functions and Parkinson's disease-related dementia are most often correlated with advanced disease progression and result from alpha-synuclein deposits together with degeneration in multiple neurotransmitter systems 50, 62, 424-426.

It is interesting to think of the progressive presentation of these symptoms in the context of the small world architecture of the brain, particularly with respect to the early degeneration of the locus coreuleus. Recalling that the locus coeruleus is one of the few highly connected nodes in the brain, with extensive projections throughout the brain and periphery, it is understandable that the early presentation of symptoms in Parkinson's disease follow a predictable path: once the locus coeruleus begins to undergo degeneration, it takes with it the noradrenergic inputs that control autonomic functions, emotional processes, arousal, motor centres, and more. Similarly, lesion formation within the raphe nucleus — which sends numerous serotonergic afferent projections throughout the forebrain — occurs in the early stages of Parkinson's disease and disruption within this system may, too, contribute to the predictable progression of the disease 427.

1.9.4 Mechanisms of Cell Toxicity

1.9.4.1 Mitochondrial dysfunction

Strong evidence implicates mitochondrial dysfunction and oxidative stress as key mechanisms of pathogenesis and cellular toxicity in Parkinson's disease 428-430. Direct

46 evidence for mitochondrial disruption comes from both post-mortem analyses of autopsy tissue and from cells derived from Parkinson's patients 272, 431. Oxidative damage and reduced activity of mitochondrial complex I has been demonstrated in relevant brain regions such as the substantia nigra and frontal cortex, and has also been detected systemically in blood platelets 363, 431-434. This can affect cell survival and functioning in a number of ways: First, hampered complex I functioning leads to a reduction in electron transfer rates, as well as reduced adenosine triphosphate (ATP) production and metabolic abnormalities. It also results in changes to the mitochondrial membrane potential. In turn, the breakdown of complex I- regulated metabolism has been linked to oxidative damage to lipids, protein and DNA 363, 435, 436. There may also be a relationship between abnormal protein aggregation, mitochondrial dysfunction and oxidative stress, as alpha-synuclein transgenic mice develop mitochondrial damage and cell-specific neurodegeneration in relevant pathways 273, 437-439.

Mitochondrial dysfunction may also negatively affect cell viability by permitting an apoptotic cascade. Under normal conditions, the mitochondria play an important role in regulating the apoptotic pathway; importantly, both electron chain dysfunction and oxidative stress can increase the permeability of the mitochondrial membrane to pro-apoptotic molecules 430, 440. A number of genetic mutations associated with Parkinson's disease may exacerbate the apoptotic pathway. For example, under normal conditions, parkin prevents the translocation of Bax — an effector of cell death — from the cytosol to the mitochondria in response to cell stress, instead promoting repair; however, consistent with a loss-of-function point mutation, disease-mutated parkin is unable to inhibit this translocation 441. Inhibition of complex I has also been proposed to render cells vulnerable to lower levels of excitotoxicity leading to radical formation and cell injury; it may also impair the mitochondria's ability to handle rising Ca2+ during an excitotoxic event 363, 428, 442. Importantly, studies in both human tissue and induced-models of Parkinson's disease have demonstrated that both disease-related genetic mutation and environmental toxicants can lead to mitochondrial dysfunction and the inhibition of complex I; however, aging itself is a significant risk factor as the mitochondria can accumulate DNA damage, thereby also increasing the net production of ROS 428-430. This, perhaps, is consistent with an age-related risk of the development of Parkinson's disease, perhaps weakening cells' ability to overcome additional insults.

1.9.4.2 Oxidative stress

Oxidative damage is believed to be a major mechanistic contributor to neurodegeneration in Parkinson's disease, particularly in dopaminergic cells. As previously mentioned, a source of oxidative stress can include mitochondrial dysfunction itself. The electron carriers within the -• mitochondria produce superoxide (O2 ), a damaging ROS, as a normal product of electron transfer, yet the mitochondria also contain a network of antioxidant defences to sequester ROS and mitigate potential damage. However, mitochondrial injury — including oxidative damage — can lead to an imbalance between its net ROS production and antioxidant- mediated rescue 273. Reactive oxygen species are also produced through normal dopamine metabolism: hydrogen peroxide (H2O2) is a biproduct of the metabolic enzyme MAO-B, and is produced during the deamination of dopamine to its metabolites dihydroxyphenylacetic 58 acid (DOPAC) and homovanillic acid (HVA) (Figure 1.7) . Similarly, H2O2 is produced by MAO in the metabolic pathway of noradrenaline, during the conversion of intermediates to the major catabolic products: 3-methoxy-4-hydroxy-phenylethyleneglycol (MHPG), within the central nervous system, and vanillylmandelic acid (VMA) outside of it 443. Importantly,

H2O2 is capable of transformation by iron-mediated Fenton reactions to produce highly toxic hydroxyl radicals (•OH), which in turn can lead to lipid peroxidation and cell death 51, 58, 444 (Figure 1.7, box). Glutathione (GSH, or "reduced" glutathione) is an important antioxidant in the cell capable of scavenging free H2O2 — a process that transforms it to glutathione disulfide (GSSG) 445, 446. In turn, decreased levels of GSH relative to GSSG is diagnostic of rising levels of oxidative stress, possibly due to an increase in dopamine turnover in the cytoplasm; additional contributions to oxidative stress are made by excessive iron, increased intracellular Ca2+, and neuroinflammation 447-451. Important evidence supporting a role for oxidative stress in the pathology of nigrostriatal neurons comes from reduced levels of GSH and increased lipid peroxidation in the substantia nigra detected in autopsy tissue of patients with Parkinson's disease 444, 445, 452. Interestingly, similar markers of oxidative stress were noted in patients with Lewy body disease 445, 453.

Oxidative stress can have a number of damaging effects to vital intracellular components. Like mitchondrial dysfunction, both environmental toxicants and a number of Parkinson's- related genes are believed to be causally linked to increased levels of oxidative stress and

Figure 1.7: Reactions within the metabolic pathway and autoxidation of cytosolic dopamine as sources of reactive oxygen species. Hydrogen peroxide (H2O2) is produced by monoamine oxidase (MAO) –A/B during the normal metabolism of dopamine, both in conversion of dopamine to 3,4-dihydroxyphenylacetic acid (DOPAC), and of 3-methoxy-4- hydroxyphenethylamine (3-MT) to the final metabolite homovanillic acid (HVA). Glutathione peroxidase (GPase) is part of an important internal defence system that 2+ neutralizes normal levels of H2O2 to H2O. However, in the presence of ferrous iron (Fe ), H2O2 can be converted to the highly •OH. box: Unsequestered dopamine can also autoxidize to form dopamine quinones (oQ) by first forming semiquiones (sQ) and superoxide (O2•-). The O2•- form during autoxidation can then be converted to H2O2 and, subsequently, to •OH in a reaction with iron. These represent three processes that are sources of oxidative stress under normal cellular conditions. additional abbreviations: ALDH, aldehyde dehydrogenase; COMT, catechol-O-methyltransferase; QH2, reduced-form dopamine. Figure adapted from Hermida-Ameijeiras et al. (2003) 58 and Fahn,S (2008) 454. 455

Figure 1.8: Free radical formation mediated by monoamine oxidase (MAO) in the metabolism of dopamine. Hydrogen peroxide (H2O2) is produced as a bi-product of the synthetic intermediate 3,4-dihydroxyphenyl-acetaldehyde (3,4-DOPAL) during the metabolism of dopamine to 3,4-dihydroxyphenylacetic acid (DOPAC). Using reduced glutathione (GSH), glutathione peroxidase (GPase) is capable of neutralizing toxicity, by •- forming oxidized glutathione (GSSG) and H2O [2]. Superoxide (O2 ), which can be produced during the autoxidation of dopamine ([4], see Figure 1.7 for details), can be converted to H2O2 by superoxide dismutase (SOD) [3] and, in turn, neutralized by GSH. However, the •- moderately reactive O2 and nitric oxide (•NO) can undergo metabolism through Fenton and peroxynitrite (ONOO-) reactions to form the more dangerous reactive species, •OH (equations [5] and [6]). Figure adapted from Dunnet and Björklund (1999) 456. Most toxic species and pathways appear in red, antioxidant pathways in blue, and the intermediate species in brown.

50 subcellular damage 51. Importantly, oxidative damage has been directly linked to neurodegenerative disorders by selective nitration of the alpha-synuclein protein in synuclein inclusions 457, 458. Nitration may stabilize aggregrates by rendering alpha-synuclein more resistant to proteolysis. Oxidatively damaged or aggregated alpha-synuclein also impairs ubiquitin-proteasomal activity 51. The consequences of this are significant, as the ubiquitin- proteasome system normally acts to remove damaged or unwanted proteins including damaged mitochondria, thereby minimizing ROS formation and insurmountable subcellular damage. It is important to acknowledge that mitochondrial damage, oxidative stress, and alpha-synuclein aggregation are closely linked, yet whether one necessarily occurs first and is causal to the others, or they cause mutual and escalating damage, is unclear.

In addition to the aforementioned sources of oxidative stress, the accumulation of cytosolic dopamine itself has been shown to be cytotoxic. In part, this can be attributed to increased levels of MAO-mediated metabolism and ROS production. However, studies have shown that - unsequestered dopamine can undergo autoxidation to form O2 , H2O2, and dopamine- quinones (Figure 1.8). Superoxide is produced during an intermediate step in the autoxidation of dopamine, which can then be transformed into H2O2; in turn, H2O2 can participate in a Fenton raction to form •OH 58. Dopamine quinones can then interact with cysteine residues on glutathione or other proteins to form cysteinyl-dopamine (Cys-DA) and cysteinyl-DOPAC (Cys-DOPAC) conjugates 58, 59, 459, 460. Intrastriatal injections of dopamine in rats resulted in the specific loss of dopaminergic neuronal terminals, and the formation of Cys-DA and Cys- DOPAC, which could be attenuated by co-injections of eqimolar comcentrations of glutathione or ascorbic acid 459. The toxicity of free cytosolic dopamine was further demonstrated by genetically-altered mouse models. Mice lacking VMAT2 (VMAT2-kd) demonstrated that the loss of machinery required to sequester catecholamines led to dopamine-mediated toxicity and oxidative stress — evidenced by increased protein carbonyl and 3-nitrotyrosine formation — that precipitated neurodegeneration 461. Similar results were seen in mice possessing postsynaptic striatal neurons engineered to take up extracellular dopamine, by means of induced overexpression of ectopic DAT in the forebrain 59. Importantly, these cells do not produce VMAT2, and therefore lack the endogenous machinery necessary to sequester free cytosolic dopamine. The uptake of dopamine into postsynaptic striatal neurons demonstrated that cytosolic dopamine leads to neurotoxicity and

51 neurodegeneration; this was attributed to oxidative stress by reduced glutathione levels and a concomitant increase in Cys-DA and Cys-DOPAC 59. Both models demonstrated that dopamine mishandling can directly lead to oxidative stress and neurodegeneration, and both resulted in the manifestation of behavioural symptoms, including motor impairment. Importantly, cytosolic dopamine can accumulate in presynaptic neurons through a number of ways: dopamine mishandling or the inability to sequester cytosolic dopamine (as illustrated by the models above), increased dopamine uptake via DAT, and/or poorly regulated dopamine synthesis.

1.9.4.3 Neuroinflammation

Neuroinflammatory processes have been shown to be exacerbated in post-mortem tissue of patients with Parkinson's disease, particularly in the substantia nigra 449, 462, 463. Post-mortem analyses also revealed microgliosis in the olfactory bulb of Parkinson's patients, one of the earliest regions affected by the disease 451. Inflammatory processes associated with neuronal damage have included the increased expression of proinflammatory substances, microglial- mediated reactions, and lymphocytic infiltration 447, 448, 462, 464, 465. There is some debate over whether the inflammatory response seen in Parkinson's brains represents a neuroprotective response, or if it mechanistically contributes to cell death. However, support for a mechanistic role of the inflammatory response in neurodegeneration has come from an understanding of how both environmental insults and genetic mutations can initiate or contribute to it 447, 448, 462, 464. In toxicant models of neurodegeneration, MPTP-treated mice showed rapid microglial activation that peaks prior to neuronal degeneration, and mice deficient for inflammatory genes showed attenuated MPTP toxicity 447, 466-468. For instance, mice lacking apoptosis signal-regulating kinase 1 (ASK-/-) have less profound nigral cell loss and motor impairment in response to MPTP as compared to wildtype, coinciding with diminished microglia and astrocyte activation 467. Transgenic mice with an impaired ability to control neuroinflammatory responses showed an increased susceptibility to toxicants 468, 469: knockout mice lacking prodynorphin, an endogenous anti-inflammatory peptide, showed increased susceptibility to toxicity mediated by MPTP and methamphetamine 468. Furthermore, some genes related to familial forms of Parkinson's disease, including LRRK2 and parkin, are also involved in mediating the immune response 470-473. It has also become

52 clear that the processes of oxidative stress and neuroinflammation are related, possibly with one exacerbating the other in a reciprocal relationship. While inflammatory responses may not be a primary cause of neurodegeneration, they may be involved in self-perpetuating deleterious cellular events that exacerbate it 448, 474-477. The hypothesis that stress activates microglia, which in turn release factors that aggravate neuronal damage, has led investigators to explore the potential therapeutic benefit of anti-inflammatory therapy in curbing cell loss in Parkinson's disease; however, to date, results have not been conclusive 447, 450, 476, 478. More studies are required to elucidate the precise mechanistic contributions of inflammation to neurodegeneration and if down-regulating inflammatory processes could slow disease progression 447, 448, 462, 464.

1.9.5 Animal Models of Parkinson's Disease 1.9.5.1 Genetic models

The identification of genetic and environmental factors contributing to the presentation of Parkinson's disease has provided the foundation for developing non-human animal models of disease. Introducing mutations in genes known to be causal in the onset of heritable Parkinson's disease is one method by which we are able to examine the pathways leading to pathogenesis and mechanisms of cell death in animal models 353, 354. Currently, there are five well-established mutations in SNCA causally related to the development of Parkinson's disease 479. Several mutant SNCA lines have been developed to better understand how alpha- synuclein mutations lead to pathogenesis, and some have successfully recapitulated the striatal dopamine loss, Lewy-like fibrils and inclusions, and motor impairment associated with the disease. The most common models produce A30P, A53T, or E46K mutations in mice, rats and Drosophila 282, 439, 480, 481; these models have been instrumental in demonstrating the relationship between the formation of alpha-synuclein inclusions and dysfunction in the dopaminergic nigrostriatal and noradrenergic pathways 282, 482-486. Yet in addition to mutational models, the overexpression of wildtype alpha-synuclein has led to both neuropathology and behavioural impairments 282, 487-489. Furthermore, single inoculations of aggregated alpha-synuclein into wildtype animals have demonstrated that pathological aggregation can spread, triggering pathology and propagating it in neighbouring healthy cells

(see Section 1.8.3) 376-379. Familial Parkinson's disease has also been modelled by inducing mutations in LRRK2 (typically gain-of-function), which have not only shown oxidative stress and mitochondrial damage, but the development of alpha-synuclein aggregation 490-495. Other genetic models of familial Parkinson's disease have loss-of-function point mutations or exonal deletions in Parkin, DJ-1, and PINK1 — these mutations again result in oxidative stress and mitochondrial dysfunction, but have also demonstrated that a potential functional relationship may exist between these genes, particularly PINK1 and Parkin 54, 496-499. In addition, mutational models of SNCA, LRRK2, Parkin, and DJ-I have also been used to investigate neuroinflammatory pathways that can precipitate or exacerbate neuronal damage in the progression of Parkinson's disease, as well as apoptotic pathways that may be involved in cell death 447, 479, 500, 501.

Genetic models of heritable Parkinson's disease continue to provide valuable insight into its pathogenesis. However, not all transgenic models strictly alter genes associated with familial Parkinson's disease. Conditions that initiate neurodegeneration have also been recreated by manipulating a variety of proteins and enzymes that are responsible for maintaining intracellular conditions; these models have also been tremendously valuable in elucidating the mechanisms of cell death. As cytosolic dopamine has been shown to be neurotoxic, several rodent models have focused attention on dopamine handling: manipulating proteins involved in dopamine handling have demonstrated that oxidative stress can be potentiated or attenuated by directly altering dopamine levels. Mice overexpressing DAT (DAT-Tg) have shown a spontaneous loss of nigral and VTA neurons in the midbrain (36 and 30%, respectively, using TH as a specific marker of dopaminergic cells), and increased degeneration resulting from MPTP administration 369. These mice also showed evidence of motor impairment when assessed with a sensitive motor test, the challenging beam traversal. Importantly, there were significant greater cysteinyl dopamine adducts, indicative of oxidative stress. While DAT-Tg mice increased cytosolic dopamine by taking more into the presynaptic neuron, VMAT2-kd mice — expressing only ~5% of normal VMAT levels — lacked the intracellular machinery required to sequester newly synthesized or recycled dopamine 461. The inability to package dopamine into vesicles led to oxidative stress and progressive nigrostriatal degeneration in aged mice, as compared to wildtype littermates (evidenced by the loss of TH+ immunostained cells). Importantly, the pathology was not

54 limited to the dopaminergic system: VMAT2 mice also had progressive degeneration in the locus coeruleus that was evident before nigrostriatal degeneration, mimicking the course of Parkinson's disease, as well as increased deamination of noadrenaline in the cytosol and alpha-synuclein accumulation 390. Degeneration within noradrenergic pathways is consistent with studies in PC12 cells and human ovarian cells that showed that the application of high levels of noradrenaline induces ROS formation, oxidative stress and apoptosis, both through the metabolism of noradrenaline itself and by promoting ER stress and mitochondrial death pathways 502, 503. Eventually, VMAT2-kd mice develop degeneration in the dorsal raphe nucleus, as is seen in late-stage Parkinson's disease. Lastly, the neuropathology in VMAT-kd mice is accompanied by motor and non-motor symptoms that progressively developed from 2 to 30+ months of age: symptoms of sleep abnormalities (shortened latency), anosmia, and delayed gastric emptying were evident in young adult mice, followed closely by anxiety- and depressive- like behaviours, and finally, motor abnormalities at 30 months (shortened stride length) 390, 391, 504. The development of these behavioural and neurodegenerative phenotypes mirrored the features and progressive onset of Parkinson's disease.

1.9.5.2 Toxicant models

In additional to genetic models, toxin-based models have informed our understanding of the relationship between environmental risk factors and intracellular stress 505. As previously mentioned, systemic administration of pesticides to rodents was an important step in determining their mechanism of toxicity: chronic injections of rotenone caused system inhibition of complex I in wildtype rats, leading to highly selective nigrostriatal dopaminergic neurodegeneration 361. Consequentially, all animals with nigrostriatal lesions developed motor abnormalities consistent with parkinsonian behaviour, including hypokinesia, unsteady movements and a hunched posture; the severity of symptoms was proportional to the extent of cell loss. In addition, rotenone induced the formation of fibrillar inclusions in the cytosol of nigral neurons that were positive for ubiquitin and alpha-synuclein 361. Chronic exposure to rotenone also causes both cell loss and alpha-synuclein aggregation in locus coeruleus neurons, while regions that remain relatively spared in Parkinson's disease, such as the VTA, are relatively unaffected by it 506-508. Treatment with L-DOPA was shown to reduce rotenone- induced hypokinesia and rigidity but not neuronal loss, as it alleviates symptoms of human

55 patients but has no effect on disease progression 509. However, studies in both rodents and Drosophila melanogaster show that melatonin, an antioxidant, both alleviates behavioural symptoms and attenuates neurodegeneration of dopaminergic and noradrenergic neurons 508, 510. Similar results were found in midbrain slice cultures, where oxidative stress and neurodegeneration induced by rotenone could be blocked by pre-treatment with the antioxidant alpha-tocopherol 511. These studies have provides evidence that mitochondrial dysfunction and oxidative stress play a mechanistic role in the pathological, neurochemical and behavioural features of pesticide-induced neurotoxicity, particularly disrupting cell groups most vulnerable in synucleiopathic disorders. However, rotenone is highly lipophilic — easily crossing the blood brain barrier — and has a high mortality rate, making it a more difficult choice for toxicant-models 512.

Treatment with the neurotoxin MPTP, whether chronic or acute, very reliably and reproducibly induces nigrostriatal dopaminergic neurodegeneration in both rodents and non- human primates. Because of this, it has become a favourite tool for toxin-induced models of Parkinson's disease. As previously mentioned, in vitro studies have pointed to specific mechanisms, as incubation of brain mitochondria with MPP+ results in ROS formation. Briefly, MPTP is converted to MPP+ inside glia cells by MAO-B. Metabolism of MPTP by -• MAO-B has also been shown to form O2 and H2O2, which in turn can act as an intermediate, reacting with Fe2+ to form •OH 374, 513, 514. As a substrate for monamine transporters, MPP+ is then taken into dopaminergic neurons by DAT, for which it has high affinity. Once inside the cell, it accumulates in the mitochondria, where it hampers the electron transport chain of complex I and impairs ATP synthesis 366-368, 515-517. In human neuroblastoma cells, the blockade of the electron transfer leak from mitochondrial complex I (by MPP+) has been -• shown to cause a build up of mitochondrial O2 that successively oxidizes iron-sulphur 2+ 518, 519 clusters in mitochondrial complex I and aconitase, releasing Fe and H2O2 . This -• increases intracellular iron, also increasing its availability to protonate O2 to form the more toxic •OH. Under normal conditions, intracellular iron facilitates the synthesis of iron-sulphur -• proteins and cytochromes in the mitochondria. However the reaction between O2 and iron- sulphur clusters inactivates mitochondrial iron-sulphur proteins, resulting in an upregulation of the transferrin receptor and iron uptake; this, in turn, was shown to result in an upregulation and aggregation of alpha-synuclein leading to oxidative stress and apoptosis 518, 519.

Pre-treatment with iron chelators offered significant protection against MPP+-mediated oxidative stress and apoptosis 513, 518, 519. In vivo, the acute systemic administration of MPTP in rodents and non-human primates has demonstrated increased ROS, cysteinyl adducts and oxidative stress 369, 520. In addition, chronic MPTP administration (delivered via mini-pump for one month) has also been shown to disrupt the ubiquitin-proteasome system resulting in alpha-synculein and ubiquitin-positive inclusions; the most pronounced disruptions were found in areas that are particularly vulnerable to degeneration in synculeinopathies, including the substania nigra, striatum and the locus coeruleus 437, 521, 522.

Rodent studies have been instrumental in revealing the roles in which monoamine transport proteins are responsible for effects of MPTP on dopaminergic neurons, and the mechanisms of its toxicity. As previously discussed, MPP+ is predominantly taken into presynaptic neurons by DAT, for which it has high affinity. This has been corroborated in vivo by the development of DAT knockout mice, who show no susceptibility to MPTP-mediated toxicity; in contrast, DAT-overexpressing mice (DAT-Tg) show increased vulnerability and exacerbated neurodegeneration 369, 371, 372. As MPP+ is also a substrate for VMAT2, the sequestration of MPP+ into vesicles is (to an extend) protective. A demonstration of the role of VMAT-2 comes from VMAT-kd mice, which are shown to be particularly vulnerable to MPP+-mediated toxicity 92, 520. Conversely, mice overexpressing VMAT2 (VMAT2-Tg) show attenuation of MPTP-mediated toxicity. The protective effects of VMAT2 overexpression likely reflects an augmented ability to sequester MPP+, thereby protecting mitochondria from damage and reducing oxidative stress 92. It is possible that pre-existing conditions of oxidative stress — perhaps induced by increased cytosolic dopamine — may potentiate intracellular stress following exposure to toxicants, having additive effects, and contribute to damage. However, cytosolic dopamine itself is not necessary or sufficient for MTPT toxicity, as TH-knockout mice (TH-ko) and dopamine depleted mice (DDD) are not protected 523.

Worth noting is that the MPTP-model is not without limitations. MPTP does not induce Lewy formations in rodents and very rarely in non-human primate models (one group found nigra inclusions only with continuous low-level MPTP infusions) 437, 524. In addition, it produces neurodegeneration in the locus coeruleus of primates, but not rodents. Nonetheless,

57 transgenic mice already possessing alpha-synuclein inclusions show increased vulnerability to MPTP and more nigrostriatal damage than their wildtype counterparts — highlighting that in these model systems, as in humans, susceptibilities can compound to overwhelm endogenous defence mechanisms 367, 439. Another limitation of MPTP rodent models is that they often do not demonstrate motor impairment as assessed by traditional paradigms. Common motor tests used to assess impairment in rodents include the pole test, rotarod test, challenging beam traversal, automated gait analysis, stride length measurements, grid tests and assessments of spontaneous dyskinesia abnormal voluntary movements scoring (AIMS). However, a study assessing motor impairment in aged mice (10-12 months) showed noradrenaline loss may be necessary for the presentation of motor impairment, indicating that the dopamine and noradrenergic systems may work synergistically 128. Motor impairment was not detected in wildtype mice, even after MPTP treatment produced an 80% loss of nigrostriatal cells; however, Dbh knockout mice (Dbh -/-) lacking noradrenaline demonstrated significant motor impairment, in many cases even in the absence of MPTP. Behavioural abnormalities were recapitulated with central but not peripheral noradrenaline lesions, and could be pharmacologically reversed by restoring noradrenaline or with a dopamine agonist, highlighting the cooperative roles of noradrenaline and dopamine in executing motor tasks in mice 128. In addition, ablation of the locus coeruleus exacerbates the effects of MPTP while knocking out NET attenuates toxicity 370. Therefore, MPTP has been a useful tool not only to elucidate the roles of mitchondrial dysfunction and oxidative stress in neuropathology, but by demonstrating that degeneration of both the dopaminergic system and noradrenergic system is likely responsible for the presentation of parkinsonian symptoms and an understanding of the interplay between these systems is necessary to develop more effective treatments.

The manipulation of DAT and VMAT2 have demonstrated how catecholamine mishandling can lead to increased oxidative stress and progressive loss of dopaminergic and noradrenergic cells. In the case of these two specific alterations, sources of stress could be the cytosolic autoxidation of catecholamines; in the case of VMAT2-kd, this could be exacerbated by the associated amplification of protofibril concentrations. It is important to realize that the sources of autoxidative stress revealed by these models are not likely, on their own, to cause cell death in humans with Parkinson's disease; however, by increasing toxic conditions, such

58 sources may increases the susceptibly of catecholamine cells. Importantly, different groups of cells have different capabilities to handle stress; while some may be able to handle increased levels, others may be overwhelmed when there is an accumulation of insults. For instance, dopaminergic cells in the substania nigra undergoes massive degeneration in Parkinson's while the neighbouring VTA remains relatively spared. The selective susceptibility of nigral dopaminergic neurons, as compared to VTA neurons, may be in part related to unique differences between the two cell groups under baseline conditions. Among other things, there are dissimilarities in transporter protein levels (DAT is increased and VMAT2 is decreased in the substantia nigra relative to the VTA), as well as differences in alpha-synuclein handling and Ca2+ ion-channels 442, 525 — all characteristics that can lend to a more stressful environment at baseline, perhaps rendering cells more susceptible to being "overwhelmed" by additive insults. Worth noting is that VMAT2-Tg are protected against toxicity.

The models discussed here have shown that catecholamine mishandling promotes toxicity. It is possible that poorly-regulated catecholamine synthesis may promote toxicity in similar ways. Indeed, the development of diseases that lack clear heritability suggests that they likely result from additive insults, at a number of stages, that cannot be overcome by internal defence and repair systems: this might include genetic susceptibilities in combination with environment insults. Because breakdown of homeostasis likely occurs at a number of stages that culminate into a diseased state, each of these stages has the potential to be an interventional time point. In Parkinson's disease, an understanding of where and how sources of oxidative stress arise, or what initially causes alpha-synuclein to aggregate, may allow us to develop better therapies.

1.10 Oxidative Stress and Tyrosine Hydroxylase

The tyrosine hydroxylase system has itself been cited as a source of ROS production in vitro, in part because it uses highly reactive intermediates in its hydroxylation reaction 56, 57. First, the Fe2+-bound enzyme has been shown to uncouple with BH4 in a time- and temperature- dependent manner, producing H2O2. Importantly BH4 can autoxidize at a neutral pH in a radical-mediated chain reaction, which generates •OH generating H2O2 and O2-• 55, 56.

Secondly, ROS are also formed during catalytic turnover: the production of H2O2 has been shown to coincide with L-DOPA production, peaking around 3-5 minutes after the start of the 55-57 reaction . However, side-reactions are believed to quickly consume the produced H2O2.

Tyrosine hydroxylase, in the presence of BH4 but in the absence of tyrosine, produces higher 55 radical levels than the autoxidation of of BH4 alone . Remembering that metal ions are the limiting factor in the generation of •OH, the Fe2+ molecule bound in active site of TH may represent a third contributor to ROS generated by the TH system (Figure 1.9). The addition of 2+ • TH to H2O2 and Fe increased the production of OH; it was therefore posited that unbound -• 2+ • H2O2 and/or O2 may interact with the Fe bound in TH's active site, producing OH (as well as Fe3+ and OH-) in a Fenton-type reaction 56, 192. Dopamine is not only a feedback inhibitor of TH limiting catecholamine production, but it also limits radical formation: in chelating the iron molecule, dopamine inhibits radical production 55. Importantly, TH is deactivated in the formation of oxygen radicals. As oxidative deactivation of TH has been shown to increase with age, oxygen radicals produced by TH-positive neurons may be increased with age, rendering them more susceptible to cell damage 55, 526.

It is clear that TH produces ROS in vitro, yet what specific contribution TH may have to the accumulation of oxidative stress in vivo has not been firmly established. Nonetheless, that abnormalities in alpha-synuclein, tyrosine hydroxylase, and dopamine synthesis result in neurodegeneration has been revealed in Drosophilia and Caenorhabditis (C.) elegans 527, 528. Primary neuron cultures derived from Drosophilia expressing a mutated human alpha- synuclein gene (A30P) revealed age-dependent neurodegeneration that could be rescued both by the addition of glutathione to the culture medium and by pharmacological dopamine depletion 528. Cell death could also be rescued by the overexpression of VMAT2 in cells expressing the mutated alpha-synuclein gene, indicating that the source of toxicity was cytoplasmic dopamine. Importantly, in these same studies, overexpression of the human TH gene alone increased cytoplasmic dopamine and caused selective neurodegeneration of dopaminergic cells: this was exacerbated with the co-expression of mutated alpha-synuclein. Together, these results show that disruptions in dopamine homeostasis can cause selective neurodegeneration in dopaminergic cells and that increased cytosolic dopamine is sufficient to induce cell death. A profound increase in dopamine synthesis and catecholamine tissue

Figure 1.9: Iron bound in the active site of tyrosine hydroxylase can contribute to oxidative stress. (A) Tyrosine hydroxylase (TH) contains an iron atom (black, see yellow circle) in the active site of the catalytic domain (blue), held in place by one glutamate and two histidine residues. Only when the iron is in its ferrous state (Fe2+) does it participate in a reaction with tyrosine, forming L-3,4-dihydroxyphenylalanine (L-DOPA). (B) Studies have 2+ shown that TH-bound Fe can also interact with hydroxgen peroxide (H2O2), oxidizing the iron atom to ferrin (Fe3+) and deactivating the enzyme. This reaction also forms peroxide (OH-) and a free hydroxyl radical (•OH). This mechanism is a proposed source of reactive oxygen species in catecholamine cells. Figure based on work by Adams et al. (1997) 55 . (note: The TH schematic in panel A and B is an alteration of a copy-right free stock picture.)

61 content had previously been demonstrated in Drosophilia lacking a regulatory protein of TH, Catsup. This mutation often results in dyskinesia and lethality 529.

Support for the role of alpha-synuclein in the regulation of TH activity has also been directly demonstrated by viral transduction of alpha-synuclein in knockout mice. Dopaminergic cells and tissue bearing aggregated alpha-synuclein co-labelled with increased levels of phosphoserine-TH, while total-TH levels remain unchanged (and by some measures, were decreased) 277. Interestingly, aggregation of mutant alpha-synuclein coincided with an increase in phosphorylated TH and decrease in PP2A in mice showing non-motor phenotypes consistent with early symptoms of Parkinson's disease 277, 282.

C. elegans were also used as an in vivo model of neurodegeneration caused by protein misfolding and oxidative stress 527. To study any divergent mechanisms, neurodegeneration was induced using three independent methods: by alpha-synuclein mutation (as a model of protein misfolding), by acute exposure to 6-OHDA and TH overexpression (as models of oxidative stress caused by ROS formation and altered dopamine metabolism). Importantly, all three models caused neurodegeneration. Although limited in number, past studies have shown that acetaminophen may offer neuroprotective benefits: it has been shown to protect primary embryonic dopamine neurons from glutamate toxicity, in vitro, and has also been shown to partially protect rats from MPP+-induced neurogeneration in vivo 527, 530-532. Locke et al. (2008) further demonstrated acetaminophen-enriched diets (0.1– 9.2 mM) to be neuroprotective against oxidative stress, attenuating degeneration induced by 6-OHDA and TH overexpression. Neurodegeneration induced by 6-OHDA was attenuated at low doses (0.1 and 1.0 mM), while acetaminophen attenuated neurodegeneration caused by TH- overexpression at all doses. However, the enriched diet did not protect against cell loss resulting from alpha-synuclein misfolding 527. Although the mechanisms are undetermined, the results of this study showed that acetaminophen may offer prophylactic benefits against oxidative stress but not protein misfolding. Moreover, the study demonstrated that overexpression of TH in C. elegans leads to a loss of cells, and that the degree of damage can be attenuated by pharmacological treatment 527.

Collectively, past studies have demonstrated a regulatory role of alpha-synuclein in TH regulation. It follows as a consequence of this relationship that an increase in phosphorylated

TH — perhaps resulting from dysfunctional or aggregated alpha-synuclein — can lead to a disruption in dopamine homeostasis. Alpha-synuclein aggregation and TH overexpression lead to increased cytoplasmic dopamine, oxidative stress and neurodegeneration in C. elegans and Drosophilia; in mice, mutations of alpha-synuclein resulted in increased levels of phosphorylated TH 275, 277, 282, 527, 528. Remembering that unsequestered dopamine is neurotoxic, it is possible that under such conditions, dopamine can be produced faster than it can be handled by the cells, promoting toxic conditions. Additionally, augmented oxidative stress can result from ROS produced by the TH system, including that generated during enzymatic catalysis, as well as by increased catecholamine metabolism. Importantly, the distribution of central and peripheral TH corresponds to that of neuronal death in Parkinson's disease areas — areas that have shown to have higher levels of oxidative stress, post-mortem. Taken together, past literature has firmly demonstrated the complexities and concomitant mechanisms that might underlie neurodegeneration. It has also reinforced the importance of considering Parkinson's disease to be a family of disorders that might be caused by a combination of different factors in each individual case. Based on the findings of past studies, a role for TH in the pathogenic accumulation of oxidative stress is worthy of investigation.

1.11 Project One: Rationale and Hypothesis

Dopamine is a catecholamine neurotransmitter involved in the regulation of a variety of functions including cognition, voluntary movement, mood, sleep, learning, motivation and reward 5, 533, 534. The DAT, a transmembrane transporter protein, regulates extracellular dopamine levels by transporting the released transmitter into presynaptic dopaminergic neurons, where it is either degraded or repackaged into vesicles for future release 21, 22, 47, 107, 111, 284, 461. Importantly, levels of DAT on the plasma membrane largely determine the rate of dopamine clearance 284, 315, 535. Numerous proteins, including PICK1, HIC5, alpha-synuclein, syntaxin 1A and RACK, have been shown to interact with DAT in heterologous cells, affecting targeting, total surface expression, and functional properties of the transporter 102, 310, 315, 316, 535-543. In light of these observations, DAT is considered to function as part of a protein complex rather than in isolation.

To study DAT protein-protein interactions and DAT trafficking in vitro, many studies utilize epitope tagged DAT. In these studies, the use of an epitope tag provides enhanced sensitivity and selectivity over the anti-DAT antibodies. It is important to note that numerous studies using in vitro assays have reported that tagging DAT with an HA-epitope on the N-terminus does not disrupt protein expression or activity in heterologous cells 309, 311, 544, 545. N-terminal tagging of the DAT has therefore proven to be a useful strategy to study DAT biology in vitro; however, the utility of N-terminal tagging of DAT for proteomic studies in vivo has not been tested.

While mass spectrometry of striatal tissue had been previously used to probe for in vivo binding partners of DAT, results were weak: many binding partners that had been identified as strong interactors in vitro were not identified as hits, while other 'surprising' partners were identified 288, 305. While we trust both the methodology and the competency of scientists producing these data, much relies on the strength of the pull-down and having a high enough concentration of DAT to reliably identify its partners. For this reason, we aimed to test the potential functionality of an N-terminal tagged DAT in vivo. To achieve this, we developed a new transgenic mouse line by pronuclear injection of a modified bacterial artificial chromosome (BAC). A BAC containing the DAT locus and regulatory regions was chosen, which had been previously used in our lab to develop a DAT overexpressing line 37. Two-step homolgous recombination was used to the modify DAT clone (in bacteria), attaching a triple- HA tag to the N-terminus of DAT 546, 547. We hypothesized that tagging DAT would provide a high-affinity tool that permits the identification of in vivo binding partners of DAT, via immunoprecipitation of striatal samples followed by mass spectrometry. To this end, our specific objectives were to: (1) Develop HA-DAT transgenic mice; (2) Identify proteins- binding partners that aid in the regulation of DAT in vivo, as well as validate those binding partners identified in vitro.

1.12 Project Two: Rationale and Hypothesis

The neuropathology of Parkinson’s disease is characterized by profound degeneration of dopamine and noradrenaline neurons; by the time the disease has quietly progressed into the symptomatic stage, approximately 80% of these cells have been lost 48, 128, 370, 548-550. At such a point, the best options currently available are still aimed at managing the symptoms caused

64 by cell loss — even with the promise that stem cell therapy holds, newly replaced cells would be vulnerable to the same pathological processes that ravaged their predecessors. Our hope for the future is twofold: to determine prodromal markers of the disease that can be used for early diagnosis, and to identify therapeutic targets that can halt the progression of the disease. Our best chance of achieving these goals will be built upon the discovery of what causes cells to die and why certain cells are more vulnerable than others.

Oxidative stress plays a key role in pathogenesis and in the mechanisms of neurodegeneration. Yet the reason why dopaminergic and noradrenergic cells, in discrete regions and pathways, are particularly susceptible remains unclear 60, 374. A unique source of oxidative stress to these cells comes from small amounts of ROS produced as by-products in the synthesis of catecholamines, a reaction that is mediated by the rate-limiting enzyme TH 56, 57. Additional ROS are produced during the metabolism of catecholamines by MAO, a process often referred to as metabolic turnover. These sources of ROS — as well as ROS produced from the normal aerobic metabolism of a cell — can normally be handled by internal defenders such as the antioxidant glutathione. Importantly, the presence of unsequestered catecholamines may itself pose a risk to the cell that created them: the accumulation of free cytosolic dopamine in the cytosol of a cell is now known to be neurotoxic, contributing to oxidative stress by producing dopamine quinones, superoxide and 59, 60, 459 H2O2, and/or cysteinyl adducts . An increase in cytosolic dopamine can result from poorly regulated dopamine synthesis, increased uptake of dopamine from the extracellular space by DAT, and/or the inability to sequester dopamine that has been newly synthesized or recycled.

It has been established that the TH system produces ROS in vitro 55-57, 551, therefore an increase in activity may also accelerate ROS production in vivo. Increased TH activity in vivo may also lead to an accumulation of cytosolic catecholamines, which produce ROS through MAO-mediated metabolism and during the autoxidation of dopamine. Yet to establish the plausibility of a pathogenic role for TH, we must look at its role in a larger system within the cell — a system that may have failures at multiple levels, or may suffer from multiple insults, that co-contribute to the development of a pathological state. Therefore, it is necessary to focus attention on the proteins and enzymes responsible for maintaining homeostasis, which

65 include TH, DAT and VMAT2. In this way, it is important to not only consider how each of these proteins works together to maintain levels of catecholamines in a presynaptic neuron but how the dyfunction or disregulation of any one of them may lead to both disruptions in neurotransmission and cellular toxicity. While Parkinson's disease is often thought of as a "loss-of-TH" disorder, due to the uncontrollable loss of certain cells that contain it, it is possible that TH itself confers an unrecognised risk. The risk might be greatest to cell groups that lack adequate resources to mitigate toxic products, such as the substania nigra which relative to the neighbouring VTA, has reduced levels of VMAT2 and may be more quickly overwhelmed by increased dopamine production.

Past literature suggests that in synucleinopathic disorders, including Parkinson's disease, increased TH activity can come as a result of diminished regulation placed on its enzymatic activity 277, 282, 528, 552. Under normal conditions, the activity of TH is highly regulated by the proteins and enzymes that phosphorylate and dephosphorylate it. Both in vitro and in vivo studies have shown that alpha-synuclein — a protein highly relevant in the pathology of Parkinson's disease — may also have the capacity to negatively regulate the activity of TH 235, 275, 277, 282, 528, 552. In Drosophilia and C. elegans models of oxidative stress, dysfunctional alpha-synuclein has been shown to increase levels of phosphorylated TH and disrupt dopamine homeostasis, ultimately resulting in neurodegeneration 275, 277, 527, 528. Importantly, a direct interaction between alpha-synuclein and TH has been established in dopaminergic cells, which affects enzymatic activity 235 235, 277. However, while a direct interaction shows that alpha-synuclein is capable of affecting catecholamine synthesis, its influence on synthesis may also be indirectly. First, alpha-synuclein has been shown to activate PP2A, the major protein phosphatase dephosphorylating TH at all relevant serine site and reducing enzymatic activity 214, 282. In addition, alpha-synuclein is known to sequester 14-3-3, a protein that binds to the regulatory domain of phosphorylated TH and activates it by inducing a conformational change 223, 257, 282. Therefore, by both direct and indirect means, the dysfunction or aggregation of alpha-synuclein may lead to increased phosphorylation of TH. It follows that a disruption in dopamine homeostasis might arise from increased TH activity, secondary to diminished regulation. In turn, increased TH activity may contribute to oxidative stress and neurodegeneration both by producing ROS as part of its enzymatic reaction and by contributing to an accumulation of free cytosolic dopamine 275, 528.

Importantly, the discrete distribution of TH+ neurons includes cell groups most susceptible to degeneration in Parkinson's disease: dopaminergic and noradrenergic cells. The selective expression of TH in catecholamine neurons, coupled with its role as a rate-limiting biosynthetic enzyme, led us to hypothesize that an increase in TH activity can produce disruptions in catecholamine homeostasis, revealed by biochemical and behavioural features consistent with an impairment in catecholamine handling. To evaluate the potential of TH to contribute to catecholamine mishandling, with a focus on the dopaminergic system, we overexpressed TH in mice using BAC transgenesis. Importantly, previous attempts to produce TH overexpressing mice were unsucessful as they did have ectopic protein expression and did not overproduced catecholamines 553. Because the BAC contains regions of genomic DNA upstream and downstream to a murine TH gene, it contains endogenous regulatory sequences and is presumed to promote gene expressions only in regions that natively express it. Therefore, our aims were to: (1) Produce TH-overexpressing mice using BAC transgenesis. To this end, we sought to verify overproduction of the gene product, to assess expression in native regions, and to ensure that the transgene was functional; (2) Characterize the biochemical and behavioural phenotypes of transgenic mice, and to evaluate the capacity of TH to contribute to disruptions in catecholamine homeostasis.

Chapter 2 Methodology, Project One

2 Methods for Project One: N-terminal Tagging of the Dopamine Transporter

Experimental procedures outlined in this section appear in a published manuscript 554. (Note: HA-tagged DAT mice were originally developed by Ali Salahpour at Duke University, BAC microinjections performed at the Duke Transgenic Mouse Facility.)

All experiments used age- and gender-matched wildtype and transgenic littermate mice (wildtype, HAD-Tg, DAT-KO, and DAT-heterozygotes [DAT-HET]) maintained on a C57Bl/6J genetic background. Experiments were performed with adult mice, 10-20 weeks, that were housed on a 12 hour light-dark cycle; food and water was provided ad libitum. Procedures conformed to the recommendations of the Canadian Council on Animal Care and the National Institutes of Health guidelines for the care and use of animals, with protocols reviewed and approved by the University of Toronto Faculty of Medicine and Pharmacy Animal Care Committee.

2.1 Development of Transgenic Mice Expressing HA-tagged Dopamine Transporter

Mice possessing an HA-tagged dopamine transporter were developed by means of BAC transgenesis, using homologous recombination to modify an existing artificial chromosome. A BAC containing the murine DAT locus (Scl6a3) ( Figure 2.1A), as well as approximately 80 kb of genomic DNA upstream and downstream to it, was privately obtained from Duke University. The "DAT BAC4" clone was chosen as the DNA for pronuclear injection because it is presumed to contain the regulatory and promoter sequences necessary for exclusively endogenous-like DAT expression within the included genomic DNA 37. In addition, the DAT BAC also contains a gene encoding chloramphenicol resistance. Two-step homologous recombination was used to modify the BAC 547 which enabled the addition of three tandem

68 copies of an HA epitope to the N-terminus of the DAT gene, thereby "tagging" the transporter. When the gene is then transcribed to mRNA, the DAT promotors within the BAC also ensure transcription of the inserted epitope, producing the template for a tagged protein. A pLD53 SC-AB shuttle vector containing the HA epitope flanked by two regions of homology ("A" and "B") — designed to match sequences in the second exon of the DAT gene — was used to insert the epitope into the BAC (Figure 2.1B) 547. The shuttle vector also contained a gene encoding ampicillin-resistance (Amp+) in addition to a number of other genes, including a negative selectable marker, SacB, that converts sucrose into a toxin, an E.coli origin of replication (R6Kγ) that cannot replicated in the BAC host, and a RecA gene used to support homologous recombination; it also contained a AscI and NotI fragment, used to subclone in the HA epitope. Homology arm A was prepared with the following sequences: 5'ggcgcgccctctgtacctgtgtctgt and 3'accagatcgctcagggccatgggtagacgggagcccgaggaag. Homology arm B was prepared with: 5'gatgaagaatctgagagtgactgaggctaaagagcccaatgctgtg and 3'ttaattaagcatcttcttctctcctcagtt. Figure 2.1C depicts the co-integration of the shuttle vector into the DAT BAC via homologous combination of region A (step one). The correct co-integrates contained both the BAC and the vector sequences, and were therefore selected by growth in lysogeny broth (LB) liquid media containing 20 µg/ml chloramphenicol (Sigma, C3175) and 50 µg/ml ampicillin (Bioshop, AMP20125); the presence of the insert was verified by PCR of miniprep DNA 547. A second recombinant event eliminated the pLD53 vector and all unnecessary sequences from the co-integrate clone. The recombinant clones that successfully removed the vector could be identified by the loss of the selectable negative marker gene (SacB); owing to this loss, the resolved clones could grow in media containing sucrose while clones that still possess vector sequences could not 547 (Figure 2.1D). Therefore, clones harbouring the resolved BACs were selected by growth on LB plates with 20 µg/ml chloramphenicol and 4.5% sucrose media, and the correct recombination was verified by PCR of miniprep DNA.

The modified BAC DNA was isolated using the NucleoBond BAC100 preparation kit (Clontech, 740579) and resuspended; after reading the optical density (260/280 μm), the DNA was diluted to 2 ng/μl in injection buffer (0.03 mM spermine/0.07 mM spermidine). The DNA was then used for pronuclear injection of C57BL/6J embryos, performed by Duke University's Transgenic Mouse Facility. One transgenic positive founder was identified by

Figure 2.1: Schematic representation of HA-tag insertion via two-step homologous recombination. Three copies of the hemagglutinin (HA) peptide were inserted on the N- terminus of the DAT protein by using two-step homologous recombination to modify a bacterial artificial chromosome (BAC) containing the DAT gene, as well as a gene encoding resistance to chloramphenicol (Chlr+). Regions of homology, denoted "A" and "B" (approximately 500 bp each), flanked exon 2 of the DAT gene in both the BAC and a shuttle vector containing the HA insert. (A) Schematic of the chosen BAC, containing the DAT gene locus. The ATG start codon is contained within exon 2. (B) A pLD53 shuttle vector was used to insert the HA epitope. It contained a gene encoding ampicillin-resistance (Amp+) in addition to a number of other genes, including a negative selectable marker SacB, an E.coli origin of replication (R6Kγ), and a RecA gene used to support homologous recombination; it

70 also contained a AscI and NotI fragment, used to subclone the HA epitope — flanked by homology regions A and B — in. (C) The first step consisted of the co-integration of the shuttle vector into the BAC via homologous recombination of arm A. Co-integrants were those that survived on plates containing chloramphenicol and ampicillin. The presence of the HA-tag in the pLD53 plasmid (P) (PCR positive control) was confirmed by PCR, which also demonstrated the absence of the HA-tag in the original BAC (BAC4) and a sample of genomic DNA ("G"). Similarly, co-integrants 2 and 3 were demonstrated to be bigger in size (100bp) than the BAC or genomic DNA, suggesting that the HA epitope had successfully integrated. (D) The pLD53 vector sequences was eliminated by a second homologous recombination event; loss of the SacB gene, which converts sucrose into a toxin, allowed resolved BACs to grow on plates containing both sucrose and chloramphenicol within the media. PCR analysis identified resolved co-integrants that contained the transgene. Figure adapted from Gong et al. 2002. (For a detailed methodological description, see Gong et al., 2002 and Gong et al., 2005.) 546, 547, 555

PCR-based genotyping, using primers that amplify BAC vector sequence (forward, 5′- gcatcagccagcgcagaaatatttcc; reverse, 5′-gatacttcgttatcgacaccagctgc) 37. This founder was used to establish the transgenic line used for this study (HAD-Tg); all genotyping was performed using the above primers.

2.2 Molecular and Biochemical Assessments 2.2.1 Quantitative PCR

Genomic DNA was isolated from tail biopsy after Proteinase K digestion and isopropanol precipitation 556, 557; DNA was further cleaned using a chloroform-ammonium acetate method. (Briefly, this consisted of incubation with chloroform in a 1:10 solution with 0.5 TE buffer [Tris-EDTA]; spun for 5 minutes at top speed; 300 μl of supernatant was incubated with 150 μl 7.5 M ammonium acetate and 1 mL 95% ethanol; spun 10 minutes at 15,000 rpm (~21,000 x g); supernatant aspirated off, pellet dried for 30 minutes; pellet resuspended in approximately 100 μl clean, double-distilled H2O [ddH2O].) Optical density was measured at 260/280 nm and dilutions of both 20 ng/ul and 5 ng/ul dilutions were prepared from each DNA sample. Primers were designed to amplify the DAT genomic sequence (forward: 5’- gggcagcatccactagataaa, reverse: 5’-acactctctagactacccatcc); amplicons of the DAT gene sequence were measured and quantified relative to those of a commonly-used reference gene, Tfrc (forward: 5’-cagtcatcagggttgcctaata, reverse: 5’-atcacaacctcaccatgtaact). At both dilutions of the DNA, quantitative PCR (qPCR) was used to determine total allelic copy number of DAT, inclusive of both native alleles as well as any integrated copies of the tagged-DAT transgene, according to methods previously described 557-559. Relative quantification of the gene targets was obtained using the GoTaq® qPCR Master Mix (Promega, Fitchburg, WI, USA), using the Applied Biosystems 7500 Real-Time PCR System. The PCR cycle consisted of 1 repeat at 50 oC lasting 2 minutes, 1 repeat at 95 oC for 10 minutes, 40 repeats at 95 oC for 15 seconds and ended at 60 oC for 1 minute. Analysis of gene copy number was based upon the 2-∆∆CT method, as previously described 560-562. Copy number was determined by normalizing ∆∆CT of transgenic mice to those with wildtype controls, which are known to possess two copies of the target gene.

Reverse-transcriptase quantitative PCR was also used to determine if levels of mRNA were commensurate to the addition of the HA-tagged transgene. Following cervical dislocation, brains were removed and frozen in 2-methylbutane (each in an individual 15 mL tube, RNA- free) over dry ice. Whole brains were stored at -80 C and subsequently used for RNA extraction. To obtain total RNA from tissues, midbrain regions were microdissected from a 1 mm coronal section, homogenized in cold Tri-Reagent (BioShop), and processed as described 563. Optical density readings at 260/280 nm were used to determine the quality and concentration of RNA. For reverse transcriptase PCR, 300 ng of RNA was used to obtain complementary DNA using SuperScript III Reverse Transcriptase (Invitrogen) following the manufacturer’s instructions. As before, relative quantification of gene targets was obtained using the GoTaq® qPCR Master Mix on the Applied Biosystems 7500 Real-Time PCR System. Phosphoglycerate kinase 1 (PGK1) was used as the reference gene (forward primer:5'- ggcctttcgacctcacggtgt; reverse primer: 5'-gtccaccctcatcacgacccg. DAT (forward primer: 5'-ggcctgggcctcaacgacac; reverse primer: 5'-ggtgcagcacaccacgtccaa) and TH (forward primer: 5'-cgggcttctctgaccaggcg; reverse primer: 5'-tggggaattggctcaccctgct) were used as the target genes. Target genes were relatively quantified using the ΔΔCt method, and were normalized to PGK1 560-562. Data are represented as the ratio of the normalized expression of DAT to TH.

2.2.2 Protein Quantification by Western Blot

The midbrain and the striatum were dissected from freshly harvested brains. Brain samples were mechanically homogenized in RIPA buffer (50 mmol/litre Tris·HCl, pH 7.4/150 mmol/litre NaCl/1% Nonidet P-40/0.5% sodium deoxycholate/0.1% SDS; Sigma) plus protease inhibitor mixture (Roche 1873580), and protein concentration was measured by using a BCA protein assay kit (Thermo Scientific). Samples were prepared to the desired loading concentration (25 μg for the striatum, 60 μg for the midbrain) in a solution containing 1x SDS sample buffer (4 x solution: 3.4 g Tris Base, 8.0 g SDS, 40 ml glycerol in

1 L dH2O, pH-ed to 6.8 with concentrated HCl) , 0.05% β-mercaptoethanol (BME), and RIPA buffer. The total loading volume was 20 μl for striatal samples and 25 μl for midbrain. Unless otherwise indicated, samples were heated to 55 oC for ten minutes before loading.

Proteins were separated by 10% SDS/PAGE and transferred to polyvinylidene difluoride (PVDF) membranes.

Both midbrain and striatal membranes were blocked with LI-COR Odyssey blocking buffer for one hour (LI-COR, LIC-927-40000) and immunostained overnight at 4 °C with primary antibodies: N-terminal rat anti-DAT (1:750 dilution; Chemicon, MAB369) and mouse anti- GAPDH (1:2000; Sigma, G8795). After washing, protein bands were revealed by incubating with fluorescence-labelled secondary antibodies donkey anti-rat IRdye 800CW and donkey anti-mouse IRdye 800CW (1:5000; Rockland, 612-732-120 and 610-731-002, respectively) for one hour at room temperature. Membranes were then stripped, blocked in 5% non-fat milk in TBST (tris-buffered saline, 0.05% Tween-20) for one hour and incubated overnight at 4 °C with the primary antibodies rabbit anti-HA (1:1000; Bethyl, A190-108A) and rabbit anti-TH (1:3000; Millipore, AB152). The protein bands were revealed with a goat anti-rabbit Alexa Fluor (AF) 680 secondary antibody (1:5000; Invitrogen, A21076).

In a separate set of experiments, a goat anti-DAT primary antibody selective for the C- terminus was incubated overnight in LI-COR buffer (1:750; Santa Cruz, C-20, SC-1433) along with the N-terminal anti-DAT. The DAT protein was concurrently revealed with secondary antibodies selective for both the goat anti-DAT (donkey anti-goat AF680, 1:5000; Invitrogen, A21084) and rat anti-DAT (anti-rat IRdye 800 CW, as described). The membrane was then stripped and probed for HA and TH. To ensure there was no cross-reactivity between N- and C-terminal antibodies, two separate gels were also run; one was probed only with N-terminal rat anti-DAT and the other, only with C-terminal goat anti-DAT. Both of these membranes were also probed for HA, TH and GAPDH as previously described. These membranes were left uncut to demonstrate that only one species of DAT was detected by both antibodies, which ran at 70-75 KDa (See Chapter 4, Figure 4.5). Densitometric analyses were conducted using Image Processing and Analysis in Java (ImageJ) software (http://rsb.info.nih.gov/ij/index.html).

2.2.3 Immunohistochemistry

Mice were anaesthetized with avertin (250 mg/kg) prior to perfusions. Intracardially perfusion was performed with phosphate buffered saline (PBS) at a flow rate of 80ml∙h-1 for two minutes, followed by 4% paraformaldehyde in PBS for approximately ten minutes. The brains were removed and stored in 4% paraformaldehyde in PBS overnight at 4 oC, then transferred to a 30% sucrose solution for cryoprotection, for 48 hours (4 oC). Tissue was blocked in freezing media HistoPrep (Fisher Chemical, SH75-125D) and cut in 50 µm coronal sections using a cryostat (Leica, CM1510).

Floating sections were quenched in 0.5% sodium borohydride in PBS, washed, and blocked for two hours at room temperature (10% normal goat serum [NGS], 0.75% bovine serum albumin [BSA], 0.1% Triton-X, in PBS). Blocking was followed by an overnight incubation at 4 oC with rat anti-DAT and rabbit anti-HA (1:200 and 1:2000 dilutions, respectively) in antibody solution (10% NGS, 0.75% BSA, and 0.01% Triton-X in PBS). Sections were washed in chilled PBS (three times, 10 minutes each), and incubated with secondary antibodies anti-rat IRdye 800 and anti-rabbit AF680 (1:1000 and 1:4000 dilutions, respectively) for one hour at room temperature. The slices were then mounted by paintbrush onto Goldline microscope slides (VWR, CA48323-185) with Thermo Scientific Aqua-Mount Slide Mounting Media (Thermo Scientific, 143905), coverslipped, and scanned at high resolution with the LI-COR system at an offset of 0.85 mm. In a separate set of experiments, 40 µm sagittal sections were cut and stained as described above.

Densitometric analyses were made to compare HA immunoreactivity of the striatum-to- midbrain in transgenic mice (Figure 2.2). In a similar way, densitometry was used to compare DAT immunoreactivity of the striatum to midbrain in wildtype mice. The optical density of the striatal-to-midbrain ratios were calculated accordingly.

Figure 2.2: Delineation of striatum and midbrain regions for ratiometric analysis. The delination of sagittal and midbrain regions in sagittal sections for densitometric analyses of the expression of DAT and HA-DAT, reported in Chapter 4 (Figure 4.11). (Representative image.)

2.2.4 Radiolabelled Dopamine Uptake into Striatal Synaptosomes

Fresh crude striatal synaptosomes were prepared according to the procedure outlined by Javitch et al. (1985), with modifications 564. Each synaptosome preparation contained the bilateral striata of one mouse. Mice were sacrificed by cervical dislocation; brains were rapidly removed and placed in ice-cold PBS for two minutes. The striata were subsequently dissected from 1 mm thick coronal slices on an ice-cold surface, and tissue homogenized in 0.25 ml of ice-cold sucrose (0.3 M) in a 1.5 ml centrifuge tube using a polypropylene pestle. The homogenate was diluted 1:4 (v/v) in 0.3 M sucrose and centrifuged at 1,000 x g for 10 minutes at 4° C; the supernatant was transferred to a new tube and centrifuged again, at 12,000 x g at 4° C for 20 minutes. After discarding the supernatant, the resulting pellets were resuspended in uptake buffer (4 mM Tris-HCl, 6.25 mM HEPES, 120 mM NaCl, 5 mM KCl, 1.2 mM CaCl, 1.2 mM MeSO, 5.6 mM D-glucose, 0.5 mM ascorbic acid, final pH 7.1). Protein concentrations were determined by BCA assay, after which all samples were diluted to 1μg/μl in uptake buffer.

For uptake analyses, 25 μl of striatal synaptosome preparations were added to tubes containing 450 μl of uptake buffer, pre-warmed to 37 oC, and allowed to incubate for 30 minutes (37 oC). To determine non-specific uptake, a second set of tubes was prepared for each sample, to which 100 μM of cocaine added in addition to pre-warmed uptake buffer. Followed the incubation period, a mixture of 1/8 hot/cold dopamine was added to all samples (0.125 μM hot [2.8125 μCi, 45 Ci/mmol]; 0.875 μM cold, dopamine). After five minutes of incubation, 5 ml of cold uptake buffer was added to stop uptake, followed by filtration through Whatman GF/B glass-fibre filters. The filters were washed twice with 5 ml of 50 mM Tris-HCl and analyzed for tritium radioactivity in a Perkin Elmer Tri-Carb 2900TR liquid scintillation counter. Assays were performed in triplicate for each synaptosome preparation; the average of the triplicate was used for subsequent data analysis.

2.3 Behavioural Phenotypes 2.3.1 Locomotor Analysis

Locomotor activity was assessed in automated locomotor activity monitors (Accuscan Instruments). Mice were placed into the activity monitor chamber (20 cm × 20 cm) and measured at 'baseline' conditions for 120 minutes. Locomotor activity was measured in terms of the total distance covered and stereotypic behaviours over the course of the recording, with data collected and summed in 5 minute epochs.

2.3.2 Rescue of DAT-KO Mice

Mice lacking the dopamine transporter (i.e., DAT-KO) have a well-described hyperactive phenotype, which includes an inability to habituate to a novel environment 565; however, mice that possess even one allelic copy of DAT (heterozygotes, DAT-HET) do not demonstrate similar baseline hyperactivity 43, 45, 565. To confirm that the HA-tagged DAT is a functional transporter protein, HAD-Tg mice were bred into the DAT-KO line to determine whether HA-DAT could rescue the DAT-KO behavioural phenotype. Pups that were non-transgenic for the tagged-transporter are called "non-Tg". Importantly, we determined that copies of the HA-DAT transgene were hemizygous, and so mice could be bred to both completely lack native DAT alleles and to carry the HA-tagged DAT. The only DAT that such mice would carry, then, would be the transgenic tagged transporter. To achieve such a genotype, a DAT- HET mouse was initially bred with a HA-DAT mouse, yielding four distinct genotypes (DAT genotype/HAD genotype): WT/non-Tg, WT/HAD-Tg, DAT-HET/non-Tg, and DAT- HET/HAD-Tg. Next, an F1 offspring with the genotype DAT-HET/HAD-Tg was backcrossed with a DAT-HET. This cross yielded six distinct genotypes, with variations possible at two distinct loci: the site of the native DAT gene and the site of integrated HA- DAT. Therefore, with consideration to the native DAT gene alone, mice could be wildtype (+/+), missing one DAT allele (DAT-HET, +/-), or missing both DAT alleles (homozygous knockouts; DAT-KO, -/-); in addition, they either possessed the transgene (HAD-Tg) or did not (non-Tg) (Table 2.1).

Table 2.1: The development of mice expressing exclusively HA-tagged dopamine transporter (DAT). (Genotypic outcomes of a cross between DAT(+/-) mouse and a DAT(+/-)/HAD-Tg mouse.) Six genotypic outcomes result from a cross between DAT- heterozygous (+/-) mouse and a DAT(+/-)/HAD-Tg mouse. The "DAT" genotype refers only to the presence or absence of the two native alleles: possible genotypes include DAT wildtype (+/+), heterozygous (+/-), or knockout (KO, -/-). The "HA" genotype refers to the presence or absence of the HA-tagged DAT transgene: mice carrying the tagged-DAT gene were called "HA-Tg", and those that did not, "non-Tg". The DAT genotype (two, one, or no native DAT alleles) appears in blue, and the HAD genotype (Tg or non-Tg) appears in orange.

DAT(+/-) x HAD-Tg

DAT(+/-)/non-Tg and DAT(+/-)/HAD-Tg initial cross initial

[as well as DAT(+/+)/non-Tg and DAT(+/+)/HAD-Tg]

parent: DAT(+/-)/HAD-Tg

- DAT(+/+) DAT(+/+) non-Tg HAD-Tg non / ) - DAT(+/-) DAT(+/-) non-Tg HAD-Tg

secondary cross DAT(+/

DAT(-/-) DAT(-/-) non-Tg HAD-Tg

parent: parent:

Therefore, mice of six distinct genotypes were compared: WT/non-Tg; WT/HAD-Tg; DAT- HET/non-Tg; DAT-HET/HAD-Tg; DAT-KO/non-Tg; and DAT-KO/HAD-Tg. Please note that wildtype (WT) is used to refer to WT/non-Tg mice. Baseline locomotor activity was assessed as the total distance travelled in 120 minutes. For these studies, we compared the activity of DAT-KO mice possessing HA-DAT to non-sibling DAT-KO mice. Protein analyses were made by western blot using striatal (25 μg) and substantia nigra (60 μg) samples.

2.3.3 Amphetamine Challenge

The locomotor activity of mice was recorded, as previously described at baseline for 120 minutes. Following baseline recording, mice were given an intraperitoneal (IP) dose of 2 mg/kg amphetamine (injection volume: 0.1 ml/g) and recorded for 90 minutes.

2.3.4 Statistics

Data are reported as means ± standard error of the mean (SEM). Statistical significance was evaluated by two-tailed t test, one-way and two-way analysis of variance (ANOVA), as appropriate. Where a one-way ANOVA was employed to compare two or more conditions to the same control condition, a Dunnet post-hoc test was used; where a two-way ANOVA was employed, a Bonferroni post-hoc test was used.

Chapter 3 Methodology, Project Two and Three

3 Methods for Project Two and Three: The Biochemical and Behavioural Consequences of Tyrosine Hydroxylase-Overexpression

Two lines overexpressing TH were developed and characterized: the first line had three total copies of the TH gene (i.e., one transgenic copy was integrated, called "TH-Y" mice) and the other, six total copies ("TH-HI" mice, denoting the 'high copy' number). The following methods were used in the characterization of both lines, albeit more extensive in the TH-HI line.

All experiments used age- and gender-matched wildtype and transgenic (TH-Y, TH-HI, wildtype) mice maintained on a C57Bl/6J genetic background. Experiments were performed in one or more age cohort: 4 weeks, 10-20 weeks, and 35-52 weeks. Mice were housed on a 12 hour light-dark cycle, with food and water provided ad libitum. Procedures conformed to the recommendations of the Canadian Council on Animal Care, with protocols reviewed and approved by the University of Toronto Faculty of Medicine and Pharmacy Animal Care Committee.

3.1 Generation of Tyrosine Hydroxylase-Overexpressing Mice

Mice overexpressing TH were created by BAC transgenesis using an artificial chromosome containing the murine TH locus, obtained from Genome Sciences. The TH clone (RP23- 350E13) was chosen for pronuclear injection because it contains approximately 90 kb of genomic DNA upstream and downstream to the gene, which is presumed to carry the regulatory and promoter sequences necessary for regionally and temporally-appropriate TH expression 37. In addition, the RP23-350E13 vector sequence contains a gene encoding chloramphenicol resistance. Colonies harbouring the BAC were grown on a chloramphenicol-spiked LB agar plate, and single colonies were randomly selected for

81 growth in liquid media (12.5 µg/ml chloramphenicol). These were verified by PCR-based genotyping using primers that amplify a sequence overlapping the BAC vector and the TH gene (forward, 5’-gaaggctctcaagggcatc; reverse, 5′-acaggtcaggctctcaggtc).

The BAC DNA was isolated using a NucleoBond BAC 100 preparation kit and resuspended in injection buffer (0.03 mM spermine/0.07 mM spermidine). After determining the optical density (260/280 μm), the size of the BAC was confirmed with pulse-field gel electrophoresis (100 ng and 200 ng dilutions, in 15 μl loading volume) (CHEF-DR II Pulsed Field Electrophoresis Systems; Bio-Rad, 170-3690 through 170-3703). The preparation was diluted to 2 ng/μl in injection buffer before in vitro pronuclear microinjection of fertilized eggs; embryos were then implanted into pseudo-pregnant surrogate mothers. Pronuclear microinjections were performed by Dr. Gary Miller's laboratory at Emory University. Several transgenic positive pups were identified by PCR-based genotyping (5’- aggagctgactgggttgaag; reverse, 5′-tcgtggcctgttgtgagtag); again, primer sequences overlapped the vector and gene sequences, thereby differentiating transgenic TH from native TH. Of the F1 generation, a mouse determined by qPCR to possess six copies of TH (Section 3.2.1) was used to found a transgenic high copy line, TH-HI.

In a set of experiments that preceded the development of the TH-HI line, the same BAC (i.e., RP23-350E13) was grown up and purified using the methodology described above; microinjections were performed at the Toronto Centre for Phenogenomics. A transgenic positive pup was used to establish this 'original' line of TH overexpressors, TH-Y, which were determined one additional copy of the TH gene.

3.2 Molecular and Biochemical Assessments 3.2.1 Quantitative PCR

Genomic DNA was isolated and purified as described in Section 2.2.1. Amplicons of the TH genomic sequence (forward: 5’-caccagtcctgagtttcctatt, reverse: 5’- ctggatcacactccaccatatc) were measured relative to those of the reference gene, Tfrc (forward: 5’- cagtcatcagggttgcctaata, reverse: 5’-atcacaacctcaccatgtaact). Similarly, preparation of midbrain tissue for mRNA quantification replicated methods previously described (Section

2.2.1). All qPCRs were performed using the Applied Biosystems 7500 Real-Time PCR System, in accordance with the previously described protocol. To correction for variation due to any possible inconsistency in dissections of the midbrain, TH mRNA levels were normalized to DAT mRNA levels, ensuring that levels were normalized to the volume of dopamine tissue within the dissected area.

3.2.2 Western Blot

The midbrain and striatum were dissected from freshly harvested brains and homogenized in RIPA buffer with protease inhibitors (working concentrations: pepstatin A, 5 μg/mL; leupeptin, 10 μg/mL; aprotinin, 1.5 μg/mL; benzamidine, 0.1 μg/mL; PMSF, 0.1 mM). Western blots were performed to quantify TH and DAT as described in section 2.2.2; however, in these experiments, the Na+/K+-ATPase was used as a loading control (1:2000, rabbit anti-Na+/K+-ATPase; Cell Signaling, 3010S). As the Na+/K+-ATPase antibody works best with a 5% BSA-based or LI-COR buffer, it was probed in conjunction with the DAT before being stripped and reprobed for TH in non-fat milk. Brains were harvested at multiple ages and western blots performed on 4- and 12-week old brains.

Using similar methods, TH protein levels in both central and peripheral noradrenergic regions were examined. Tissue from the TH-rich locus coeruleus and the adrenal medulla, a major source of peripheral TH, was extracted, homogenized in RIPA buffer and spun (15,000 rpm) prior to sample preparation. Samples were run on 10% SDS/PAGE gels (locus coerleus, 60 μg; adrenal medulla, 20 μg) and transferred to PVDF membranes. Membranes were probed for rabbit anti-TH, using mouse anti-tubulin (Developmental Studies Hybridoma Bank, E7) and mouse anti-GAPDH as loading controls for the locus coeruleus and adrenal medulla (respectively), as described in Section 1.2.2.

Additional striatal samples were dissected and homogenized to assess proteins associated with the regulation of TH. Unlike most of the westerns discussed above, these samples were not spun after homogenization. Samples were heated to 95 oC before 30 μg was loaded and run on a 15% SDS/PAGE gel. After transferring overnight, membranes were blocked in 5% milk for one hour and probed for mouse anti-alpha-synuclein (1:1000; BD Transduction,

610786) and mouse anti-protein 14-3-3ε (1:2000; Developmental Studies Hybridoma Bank, CPTC-YWHAE-1) overnight at 4 oC. Proteins were revealed using goat anti-mouse AF680 (1:5000; Invitrogen, A21057). Membranes were reprobed using rabbit-TH and mouse- GAPDH, as previously described. Similarly, striatal samples were run and probed for PP2A, using goat anti-PP2A (1:1000; Santa Cruz, sc-6110) in 5% non-milk, followed by donkey anti-goat AF680 (1:5000; Invitrogen, A21084).

In a separate set of experiments, striatal samples were speedily dissected and homongenized in RIPA containing phosphatase inhibitors (final concentrations: sodium pyrophosphate, 2.5 mM; β-glycerophosphate, 1.0 mM; sodium fluoride, 50 mM; sodium orthovandadate, 1.0 mM) in addition to protease inhibitor. Samples were run on 10% SDS/PAGE gels, transferred, and blocked for one hour in LI-COR buffer. Membranes were incubated overnight (4oC) in solutions containing rabbit anti-phosphoTH-Ser19 (1:2000; Phospho Solutions, p1580-19), rabbit anti-phosphoTH-Ser31 (1:1000; Phospho Solutions, p1580-31) or rabbit anti-phosphoTH-Ser40 (1:2000; Phospho Solutions, p1580-40). Proteins were revealed using goat anti-rabbit AF680 (1:5000) before being stripped, and reprobed using mouse anti-TH (1:2500; Sigma, T2928) and mouse anti-GAPDH in 5% non-fat milk.

Westerns were performed on 4-week old and/or 12-week old mice to assess VMAT2 levels, using pre-cast gels and MOPS (3-(N-morpholino)propanesulfonic acid) buffers. Striatal tissue was dissected from flash-frozen brains and bilateral striata were homogenized together in 750 μl of sucrose-HEPES buffer (320 mM sucrose, 5 mM HEPES, pH 7.4) in 1.5 mL eppendorf tubes. Samples were centrifuged at 4 oC for 5 minutes at 3,500 rpm (~ 1,150 x g). The supernatant was discarded and pellets were resuspended in 100 μl of homogenization buffer. Samples were prepared to achieve a loading concentration of 20 μg in a total volume of 13.3μl by adding sample and an appropriate amount of homogenization buffer to reach a volume of 10 μl, to which 3.3 μl of loading dye was added (plus dithiothreitol, DTT, in lieu of BME). Using pre-cast 10% Nu-Page Bis-Tris gels (Novex, NP0303), samples were loaded and run at 130 V for 45 to 60 minutes in MOPS SDS buffer (Novex, NP0001). Proteins were transferred to a PVDF membrane that had been soaked in ethanol for 1-2 minutes, at 30 V for approximately 90 minutes in Nu-Page transfer buffer (Novex, NP0006-1). Membranes were blocked in 7.5% non-fat milk in TBST for one hour at room temperature (placed on shaker).

Rabbit anti-VMAT2 primary antibody was graciously donated by Dr. Gary Miller; membranes were incubated overnight at 4 oC, at a concentration of 1:5000 in antibody solution, 0.75% milk in TBST (to make solution, 500 mL of milk taken from blocking buffer and added to 4.5 mL TBST (0.1% Tween-20). Membranes washed and incubated with secondary antibody, goat anti-rabbit 800 (1:5000; Rockland, 611-131-002), for one hour at room temperature. The membranes were then probed for TH and GAPDH, as before.

Densitometric analyses were conducted using Image Processing and Analysis in Java (ImageJ) software (http://rsb.info.nih.gov/ij/index.html).

3.2.3 Immunohistochemistry

Mice were perfused and brains were coronally sliced to capture the striatum and midbrain; TH and DAT proteins within the slices were immunolabelled, using methods outlined in Section 2.2.3. In addition, a similar technique was employed for the processing of coronal sections containing the locus coeruleus, substituting anti-NET for anti-DAT (mouse anti- NET, 1:500; donkey anti-mouse 800, 1:2000).

3.2.4 Tissue Content 3.2.4.1 Dopamine, HVA, and DOPAC

Total tissue content levels of dopamine and its metabolites, DOPAC and HVA, were quantified in the striatum using high-performance liquid chromatography (HPLC) 369. Striata were dissected and flash frozen in liquid nitrogen, each side in a separate eppendorf tube. Only one side (the left or right striatum) was used for tissue content experiments.

All tissue content experiments were conducted using an AgAgCl- electrochemical detector (LC-4C Amperometric Detector; BASi) set at an oxidizing potential of + 0.75 V, and a Hypersil Gold C18 column (150 × 3 mm, particle size of 5 μm; Thermo Scientific). The mobile phase contained 24 mM Na2HPO4, 3.6 mM 1-octanesulfonic acid, 30 mM citric acid, and 0.14 mM EDTA in 19% methanol and was adjusted to pH 4.7 using concentrated NaOH. After allowing the column to equilibrate with the mobile phase, the separation of pure

standards was verified (100 ng/mL in HClO4): dopamine, DOPAC, HVA, serotonin, 5- Hydroxyindoleacetic acid (5-HIAA), a metabolite of serotonin, and 2,3-Dihydroxybenzoic acid (DHBA), an internal standard (Purity > 98%; all chemical standards from Sigma.) If separation of the compounds was not satisfactory, minor adjustments were made to the pH using HCl or NaOH, or to the methanol content; were adjustments to the mobile phase required, the column would again be allowed equilibrate. Once separation of standards was achieved, a calibration curve was constructed at eight dilutions, each of which contained dopamine, DOPAC, HVA and DHBA (5, 10, 25, 50, 75, 100, 250, 500 ng/mL). Following successful calibration ( 1≥ R2 ≥ 0.995 for each standard), unilateral striata were weighed while frozen and homogenized in 0.1 M HClO4 spiked with 100 ng/mL DHBA (40 μl per mg of tissue), then centrifuged (10,000 rpm, or 9400 × g, for 10 minutes at 4 °C). The supernatant was carefully removed and filtered through a 0.22 μm membrane (Ultrafree-MC GVWP filters; Millipore, UFC30GV00), again by centrifugation at 10,000 rpm (2 minutes, 4oC). The tissue content of dopamine, DOPAC and HVA was quantified against their respective calibration curves, and normalized to DHBA. The tissue content was quantified in two age cohorts: young mice, 4-5 weeks of age, and adults, 10-20 weeks of age.

3.2.4.2 L-DOPA

Tissue content of L-DOPA, the direct product of TH, was measured in the striatum to confirm increased functional TH in transgenic animals. Mice were given a single IP injection of NSD-1015 (100 mg/kg), a compound known to inhibit the activity of dopamine decarboxylase, thereby preventing the rapid conversation of L-DOPA to dopamine 41. The extent of L-DOPA accumulation in striatal samples is considered a reliable measure of total TH enzymatic activity in vivo 321, and therefore considered a measure of the rate of catecholamine synthesis. After 40 minutes, mice were sacrificed by cervical dislocation and the striatum were dissected and flash frozen in liquid nitrogen. Striatum were weighed and homogenized in 40 μl per mg sample of 0.1 M HClO4 spiked with both DHBA and 100 ng/mL sodium metabisulphate 461, 566. Extracts were then centrifuged and the supernatant filtered through a 0.22 μm membrane 369. L-DOPA and striatal stores of dopamine, DOPAC, and HVA were separated by HPLC and measured by electrochemical detection, using the methods described in the preceding section. The mobile phase was composed of 5.99 mg

86 monobasic sodium phosphate, 200 μM EDTA, 0.684 g sodium chloride, 60 mg octyl sodium sulfate, and 95 mL of methanol in 1 L HPLC-grade water (pH 2.43). Analytes were quantified against standard curves, as in Section 3.2.4.1, with the addition of an L-DOPA standard (Sigma, D9628).

3.2.5 Glutathione Assay

Glutathione (GSH) is a tripeptide (γ-glutamylcysteinylglycine) important in the defence against ROS; among other things, it is an essential electron donor to glutathione peroxidases 446 in the reduction of hydroperoxidases such as H2O2 . Decreasing levels of GSH have been correlated to a rise in oxidative stress, as well an increase in protein carbonyls 59, 567, 568. As an indication of oxidative stress, GSH levels in the striatum and the cortex (a negative control) were assessed using a glutathione assay kit (Cayman, 703002). Brains were removed and quickly rinsed in iced cold PBS; striatal and cortical samples were then dissected and flash frozen in liquid nitrogen. Dissected tissue was weighed while frozen, and homogenized in ice-cold buffer (0.4 M 2(N-morpholino)ethanesulphonic acid, MES; pH 6-7, containing 1mM EDTA; 10 mL per g of tissue). Samples were homogenized at 10,000 x g for 15 minutes at 4oC, and the supernatant removed. The supernatant was deproteinated using metaphosphoric acid (MPA) and 4 M triethanolamine (TEAM) solution, as per kit instructions. The assay was performed as directed, and the absorbance measured at 5 minute intervals for 30 minutes (405 and 414 nm); GSH concentrations were determined using the kinetic method. A subgroup of wildtype mice were injected with 5 mg/kg reserpine (injection volume: 0.2 ml/g) two hours prior to dissection, as a positive control of oxidative stress.

3.3 Behavioural Phenotypes 3.3.1 Locomotor Analysis

Locomotor activity was measured in automated locomotor activity monitors. In these experiments, activity was assessed both by the total distance covered and stereotypic behaviours, collected in 5 minute bins over the course of the test period. Mice were placed

87 into the activity monitor chamber and measured at ‘baseline’ conditions for 60 minutes. Following baseline recording, mice were injected with a dose of saline, 2 mg/kg or 3 mg/kg amphetamine and recorded for an additional 90 minutes (IP, injection volume of 0.1 ml/g). In a separate set of experiments, cocaine injections (30 mg/kg, IP) followed the 60 minute baseline recording; animals were again recorded for 90 minutes post-injection.

3.3.2 Y Maze 569, 570 Working (spatial) memory was assessed with a standard Y-maze paradigm ; the apparatus consisted of three equivalent arms measuring 38 cm long by 7.6 cm wide by 12.7 cm high, meeting in the centre at a 120o angle (San Diego Instruments). Zones for each arm (denoted "A", "B", and "C") were configured and tracked using Bioserve Viewer2 software, with the defined zones ending 5 cm from the centre zone, where arms are adjoined. Mice were placed at the end of one arm and allowed to freely explore the maze for 8 minutes. The number of spontaneous three-arm alternations, defined as successive entry into all three zones without repetition (i.e. ABC, ACB, BAC, BCA, CAB, CBA), was recorded and analysed using the software. Data was represented spontaneous three-arm alterations as a percentage of total arm entries: (number of three-arm alterations)/(total number of arm entries − 2) × 100. All mice were naïve to this task, and required no exposure to the arena prior to testing. The arena was cleaned with Virox between tests.

3.3.3 The Puzzle Box

Cognitive flexibility was assessed using the puzzle box, a paradigm designed to assess executive function in mice, including elements of problem solving, short-term and long-term memory 571, 572. (Note: The test is based on a rodent's innate adversity to bright and open arenas, and their natural impetus to seek safety in dark, enclosed spaces.) As a test of cognitive flexibility, the mouse is "challenged" to find the dark side of a test chamber by overcoming different types of physical obstacles occluding its entryway (Figure 3.2A-F). The test takes place over three successive days (beginning at the same time, every day), each day consisting of three trials (Table 3.1). The mouse is returned to his home cage for two minutes between each trial.

The puzzle box was a custom-made, white acrylic chamber (73 x 28 x 27.5 cm) partitioned into two compartments unequal in size, separated by one of two removable black (opaque) dividers (28 x 27.5 cm) 369, 571, 572. The larger compartment (58 x 28 x 27.5 cm), designated the "start-box", was exposed to room lighting; the smaller compartment (14 x 28 x 27.5 cm), considered the "goal box", had an opaque black ceiling and walls, creating a dark chamber (Figure 3.2A, B). Animals were initially placed in the light side and freely permitted to enter the dark side through an "underpass", or narrow tunnel, beneath the base of the chamber (15 x 4 x 2 cm). The first divider used to separate the chambers had a door (4 x 4 cm) and was only used on the first trial of the first day, allowing the animal to easily discover the dark side (Figure 3.2D). A divider with no door was used in every subsequent trial, forcing the animal to learn that he could still reach the dark side using the underpass (Figure 3.2E). The underpass remained unobstructed for every trial on the first day, and for the first trial of the second day; however, obstacles to the underpass were introduced on the second and third day of testing. On the second trial of the second day (or "trial 5"), the underpass was filled with bedding, forcing the rodent to burrow to reach the dark side of the box (Figure 3.2F). The bedding task was repeated for the final trial on the second day (trial 6) and again on the third day with trial 7, succeeded by the presentation of a new obstacle. A cardboard plug (flat top: 40 mm x 80 mm; bottom 'plug': 40 mm x 30 mm by 15 mm; 3.8 - 4.5 g for females, 4.7 - 5.5 g for males) was introduced during trial 8, and repeated for trial 9 (Figure 3.2C, G); this new obstacle was meant to require a different method of removal (i.e. pulling instead of burrowing) but was not meant to be physically more demanding. By introducing and changing the obstacles to the dark side, this test aims to assess the rodent's ability both to recognise the obstacle has changed and to employ different strategies to remove it. Mice were given a maximum time of 300 seconds to complete each trial, and a failure to complete the task within the allotted time resulted in a score of 300; as the first day was considered "training" day, and any mice who did not successfully complete any one of the three trials on the first day was eliminated from all analyses. The area was cleaned with Virox between animals and if necessary, between trials to clean excrement.

Figure 3.1: The Puzzle Box. (A) Dimensions of the puzzle box, with schematic mouse in start position (Trial 1). (B) The dark ("goal") side versus the bright side of the box (lid lifted). (C) The plug used for Trials 8 and 9. The underpass joining the light ("start") side and goal side is shown, as prepared for Trial 1 (D); Trial 2-4 (E) Trial 5-7; and (D) Trial 8-9. See Table 3.1 for descriptions.

Table 3.1: The Puzzle Box paradigm, consisting of nine trials across three days. The test box has a light "start" side (normal, overhead room lighting) and dark "goal" side (opaque, black walls and roof; red plastic enrichment house), which can be accessed via an underpass. The two sides of the chamber are separated with one of two removable dividers, one possessing a door and the other without. Over the course of testing, the underpass is left unobstructed, is filled with bedding, or blocked with a cardboard plug.

Trial Divider Underpass

trial 1 door no obstacle -- 2 min in home cage -- trial 2 no door no obstacle

ay One ay -- 2 min in home cage --

D trial 3 no door no obstacle

trial 4 no door no obstacle wo -- 2 min in home cage -- trial 5 no door bedding -- 2 min in home cage --

Day T Day trial 6 no door bedding

trial 7 no door bedding -- 2 min in home cage -- Three trial 8 no door plug -- 2 min in home cage -- trial 9 no door plug Day Day

3.3.4 Challenging Beam Traversal

The challenging beam traversal test is capable of detecting a decline in motor skill attributed to subtle alteration in the circuitry of basal ganglia, such as dopaminergic dysfunction resulting from cell loss or age-related alterations in the dopaminergic system 128, 573, 574. Many parkinsonian models show fine motor deficits during challenging beam traversal but not in the popular rotarod test (a motor test sensitive to impairments in balance such as those caused by cerebellar dysfunction), making it a valued alternative 128, 573, 575. Importantly, performance on the challenging beam does not improve with practise and this task is therefore is capable of detecting motor deficits independent of any cognitive or learning aberrations 574. Briefly, animals were trained to traverse the length of a custom-made Plexiglas beam consisting of four sections (25 cm each, 1 m total length) that progressively decreased in width by 1 cm increments, from 3.5 cm to 0.5 cm. For two days, mice were trained to traverse the beam, leading to their home cage (positioned next to the thinnest end of the beam). Each training day consisted of three trials, separated by one minute in the home-cage. On the third day, a mesh grid (1 cm squares) of corresponding width was placed over the beam surface; a space of approximately 1 cm separated the grid from the surface of the beam surface. The third day was considered the "test day", and again, animals completed three trials separated by one minute. Mice were videotaped while traversing the grid-surfaced beam and the video was later replayed in slow motion to detect errors. Errors included both paw slips through the mesh-grid as well as paws placed on the side rather the top of the grid during forward motion (Figure 3.3). Total slips were counted per trial, and the total errors across all trials was averaged for each animal.

3.3.5 Pre-Pulse Inhibition

Sensorimotor gating was tested by pre-pulse inhibition, a behavioural paradigm based on the principle that the startle response to accoustic stimuli is attenuated when preceded by previous sensory input. The manifestation of a startle is determined by the physical movement ("startle") in response to white noise bursts. Accordingly, startle response is measured as acceleration (or "vibration") caused by a mechanical force detected by an accelerometer sensor, a transducer that converts the force to an electrical output measured in

92 millivolts (mV) (San Diego Instruments). During the test, mice are restrained in transparent acrylic enclosure tunnels closely coupled to an accelerometer capable of measuring subtle movements, ensuring animals remain centred over the sensor; both the tunnels and sensor were housed in plastic isolation SR-LAB ABS cabinets (SanDiego Instruments) equipped with lighting and room-air ventilation. Prior to introducing mice to the recording chambers, accelerometers were calibrated using a SR-LAB Standardization Unit, a calibration tool used to send a series of standard vibrations to the accelerometer that are recorded and calibrated to 700 +/- 5 mV. During both calibration and testing, fluctuations in output signal from the accelerometer were collected and recorded with SR-Lab Software (SanDiego Instruments), and subsequently integrated with SR Analysis (SanDiego Instruments).

Mice were placed in the tunnel enclosures and acclimatized to background white noise — maintained at 65 dB — for 5 minutes prior to testing. Each testing period was 30 minutes in length, and consisted of 10 known and 80 randomized trials, falling within four possible experimental conditions: pre-pulse alone (69 dB, 73 dB, or 81 dB), pre-pulse plus test ("startle") pulse, no pulses, and startle pulse alone (165 dB). Five independent 165 dB pulses were delivered both before and after the 80 randomized trials, for a total of 90 trials. For every trial consisting of a pre-pulse/startle-pulse combination, a 100 ms delay separated startle pulses from pre-pulses. The time delay between independent trials was also randomized, ranging from 5–20 seconds. Pre-pulse inhibition was measured as an attenuation of the startle response to a 165 dB startle pulse when it was preceded by pre-pulse, as compared to the startle response to an isolated 165 dB pulse.

3.3.6 Elevated Plus Maze

The elevated plus maze was used to assess anxiety-like behaviour in adult mice. The maze consist of four equal arms, meeting in a centre space 5.0 by 5.0 cm. Two arms opposite arms were "open" (30.5 cm long, 5.0 cm wide, with no walls) and the remaining two were, "closed" (30.5 cm by 5.0 cm, with walls 15.25 cm high). The platform was elevated approximately 39 cm above the surface of a table. Different cohorts of mice performed the test in dim light (15–16 lux) and in room lighting (210–240 lux); during the test, mice were place in the centre zone, facing an open arm, and allowed to freely explore the maze for eight

Figure 3.2: Challenging Beam Traversal Task. Representative images of errors during traversal of the beam on the third day ("test" day). (A) The challenging beam, set up with a mesh-grid overlay, on test day. (B) Front paw slip through the mesh grid. (C) Rear paw placed on the side of the mesh grid, rather than on the surface. (D) Simultaneous misplacement of front and rear paws, the former slipping through the grid while both rear paws unsteadily grasped the side of the grid overlay. Images are representative frames from video recordings.

94 minutes. Zones for each arm were configured and tracked using Bioserve Viewer3 software.

3.3.7 Statistics

Data are reported as means ± SEM. Statistical significance was evaluated by two-tailed t test, one-way and two-way analysis of variance (ANOVA, with or without repeated measures), as appropriate. Where a one-way ANOVA was employed to compare two or more conditions to the same control condition, a Dunnet post-hoc test was used; where a two-way ANOVA was employed, a Bonferroni post-hoc test was used.

Chapter 4 Results 4 Project One: N-Terminal Tagging of the Dopamine Transporter Impairs Protein Expression and Trafficking In Vivo

The following three chapters contain data from three separate studies that examine the effects of modifications to genes encoding proteins involved in the synthesis and homeostasis of monoamines, with a particular focus on the dopaminergic system. Findings in Chapter 4 are as they appear in a published manuscript, with minor modifications for clarity and formatting554.

4.1 Generation of Transgenic Mice Expressing HA-tagged Dopamine Transporter

Two-step homologous recombination was used to modify a BAC (DAT4) that contains the 40 kb murine DAT gene (Slc6a3), flanked by 80 kb of DNA both upstream and downstream to the gene locus; previous work from our laboratory has demonstrated that this BAC contains the necessary sequence for native spatiotemporal expression of the DAT 37. The targeting vector was designed to add three tandem copies of the HA-epitope to the N-terminus of the DAT and following two rounds of homologous recombination, the successful modification of the BAC was confirmed through the identification of HA-DAT BAC clones by PCR (refer to Chapter 2, Figure 2.1). A transgenic founder was generated by pronuclear injection of C57Bl/6J embryos and was identified by PCR genotyping. Subsequent breeding confirmed that the transgene was germline-transmitting, and that the 3HA-DAT BAC integrated in a single locus and was autosomally inherited. Transgenic mice were termed HAD-Tg (HA- DAT transgenic).

The number of copies of HA-DAT integrated into the genome was determined by qPCR of genomic DNA, using primers specific for the Slc6a3 sequence: the rate of amplification of DAT amplicons was compared to those of a reference gene encoding the transferrin receptor

(Tfrc), using genomic DNA from wildtype and HAD-Tg mice. There is an estimated twofold increase in total DAT copy number in HAD-Tg mice as compared to wildtype mice, as shown in Figure 4.1A, indicative of two integrated copies of HA-tagged DAT in addition to the two endogenous alleles. We next evaluated the levels of DAT mRNA in HAD-Tg mice compared to wildtype animals using reverse-transcription quantitative PCR (Figure 4.1B). To ensure that measurements reflected the amount of DAT mRNA in dopaminergic cells, DAT amplicons were normalized to amplicons of TH, a selective marker of dopamine neurons in the midbrain. Midbrain tissue samples from HAD-Tg mice have a 47% increase in DAT mRNA levels relative to wildtype mice (P = 0.011). Noting that the relationship between copy number and mRNA expression is not always linear 576, these results indicate that the addition of the N-terminal tag does not prohibit the transcription of the HA-DAT gene.

4.1.1 HA-DAT Is Expressed in Regions Endogenously Expressing DAT

The localization of HA-DAT protein within the brains of transgenic mice was examined by immunohistochemistry. As shown in Figure 4.2, in dopaminergic regions, HA-tagged DAT is confined to similar patterns as those of endogenous DAT in wildtype mice. Co-localization of HA and DAT immunoreactivity is demonstrated in the striatum (Figure 4.2A) and the midbrain, including both the substantia nigra and the VTA (Figure 4.2B). Importantly, immunoreactivity of HA is undetected in the surrounding regions, such as the motor cortex dorsal to the striatum or the lateral septal nucleus medial to it, where native DAT protein is not expressed; similarly, neither HA nor DAT are detectable in the regions surrounding the substantia nigra and VTA, suggesting that HA-DAT expression is reliably restricted to areas that endogenously express DAT. The achievement of "endogenous-like" expression patterns is one of the main advantages of BAC transgenesis and is presumably owed to the inclusion of genomic DNA surrounding the gene loci of interest within the BAC. Immunohistochemistry of sagittal sections further demonstrates that HA-tagged DAT is expressed along the dopaminergic nigrostriatal and the mesolimbic pathways, in a pattern that mirrors endogenous DAT (Figure 4.2C).

Figure 4.1: Gene copy number and mRNA levels for the dopamine transporter (DAT). (A) Quantitative PCR (q-PCR) of genomic DNA indicates that two copies of the HA-DAT transgene are incorporated into the genome, producing a total of 4 copies of the locus. (B) q- PCR of midbrain cDNA demonstrates a 47% increase in DAT mRNA in transgenic mice (HAD-Tg, n=10) as compared to wildtype (WT, n=13). (t-test, P ≤ 0.01) Mean +/- SEM. note: Wendy Horsfall and Kristel Bermejo assisted with the genomic qPCR and mRNA qPCR featured in panel A and B, respectively.

Figure 4.2: Expression pattern of HA-tagged dopamine transporter (DAT) using immunofluorescence. Co-labelling of DAT protein (green) and HA protein (red) in coronal sections of the striatum (A) and midbrain (B) of wildtype (WT) and transgenic (HAD-Tg) mice. Where both DAT and HA are co-expressed, regions appear yellow. In transgenic mice, HA and DAT are shown to be co-expressed throughout the nigrostriatal pathway, as seen in sagittal sections containing both the midbrain and striatum (C). (Representative samples)

Western blots were performed to demonstrate the presence of HA-DAT in regions that highly express DAT, the midbrain and striatum (Figure 4.3A-D). HA-tagged protein is detected in the striatum (Figure 4.3A) and midbrain (Figure 4.3B) of transgenic mice. However, despite the clear presence of HA-tagged protein in both regions, the total DAT protein level is not significantly increased in the striatum or the midbrain of HAD-Tg mice compared to wildtype (Figure 4.3C-D). As two copies of the transgene were shown to have integrated and there was an approximate 50% increase in total DAT mRNA, expression of tagged protein would be expected to increase total DAT protein levels as a reflection. Therefore, while both immunohistochemistry and western blot clearly confirm expression of HA-tagged DAT in the nigrostriatal pathway, quantification of total DAT protein levels by western blot surprisingly does not provide evidence for increased DAT protein levels in transgenic mice.

One potential explanation for the lack of elevated DAT protein levels in HAD-Tg mice (despite an increase in total DAT mRNA) is that the presence of the HA-tag may prevent antibody binding to the DAT, particularly since the commonly-used DAT antibody MAB369 (used in Figure 4.3), is against the N-terminal sequence of the DAT. To ensure that the lack of detectable DAT levels is not due to the antibody used, striatal protein samples from wildtype and HAD-Tg mice were probed with a C-terminal DAT antibody in addition to the N-terminal DAT antibody. As shown in Figure 4.4A-C, there is no significant difference in DAT levels between wildtype and HAD-Tg mice whether an N-terminal or C-terminal antibody is used, indicating that the apparent paucity of HA-DAT is not an artifact of antibody detection. Importantly, there is no significant difference when comparing the N- terminal and C-terminal DAT signal (N-terminal/C-terminal DAT) within the same animal (Figure 4.4D). The DAT revealed by both the N-terminal and C-terminal antibodies represent mature DAT, approximately 70 KDa in weight (Figure 4.5). As these tests revealed that the lack of a detectable increase in total DAT levels is not a result of an interruption in antibody binding, we sought to determine if expression of the transporter is itself impaired is by the presence of the N-terminal tag.

100

Figure 4.3: Protein expression of the dopamine transporter (DAT) in midbrain and striatum of wildtype (WT) mice and transgenic (HAD-Tg) mice. Western blots of the midbrain (A), and striatum (C) using anti-DAT and anti-HA antibodies. Anti-GAPDH is used as a loading control and anti-tyrosine hydroxylase (TH), as a marker of dopaminergic cells. Densitometric analyses of total DAT (i.e., the sum of both HA-tagged and endogenous DAT) in the midbrain (B), and striatum (D); quantification of the optical signal of DAT is normalized to that of TH, to normalize to dopaminergic cells alone. WT and HAD-Tg, n=4; DAT-KO striatal protein was included to confirm antibody selectivity for DAT, n=1. Mean+/-SEM.

101

Figure 4.4: Western blot comparing antibodies that recognise the N- and C-terminus of the dopamine transporter (DAT). (A) Wildtype (WT) and HA-tagged DAT protein, probed with an N-terminal antibody or a C-terminal antibody in homogenate made from WT or transgenic (HAD-Tg) mouse striata (n=4 for both genotypes). (B) Densitometric analysis of the N-terminal anti-DAT antibody. (C) Densitometric analysis of the C-terminal anti-DAT antibody. (D) The ratio of N-terminal to C-terminal DAT (optical density) in WT compared to HAD-Tg+ samples. For all densitometric analyses, the optical density of N- and C- terminal DAT is normalized to the optical density of tyrosine hydroxylase (TH), and HAD- Tg DAT levels are presented relative to WT. Mean +/- SEM.

102

Figure 4.5: Separate, uncut western blots using dopamine transporter (DAT) antibodies against the N- and C-terminus. Wildtype (WT) and transgenic (HAD-Tg) striatal samples probed with antibody selective for (A) the N-terminus or (B) the C-terminus. Tyrosine hydroxylase (TH) is shown as a marker of dopamine-positive cells. (C) Densitometric analysis of the N-terminal anti-DAT antibody. (D) Densitometric analysis of the C-terminal anti-DAT antibody. The DAT protein recognised by both the N- and C- terminus antibody represents mature DAT, migrating at approximately 70-75 KDa. (WT and HAD-Tg, n=4; DAT-KO, n=1.) Mean+/-SEM.

103

4.1.2 N-Terminal Tagging of the Dopamine Transporter Interrupts Expression in the Striatum

To determine the amount of DAT protein produced by the HA-DAT transgene, we crossed HAD-Tg mice with partners obtained from a DAT-KO line 34 to remove all endogenous DAT; these mice were termed DAT-KO/HAD-Tg. We measured striatal DAT protein levels by western blot from DAT-KO/HAD-Tg mice, wildtype mice, and also DAT-HET mice possessing one allelic copy of endogenous DAT (Figure 4.6A). As expected, DAT-HET mice had approximately half the striatal DAT protein relative to wildtype mice (41%). Importantly, the levels of DAT in the striatum of DAT-KO/HAD-Tg mice was only 8.5% that of wildtype mice (P ≤ 0.001. t-test) (Figure 4.6B). To determine whether the HA-DAT present in the striatum was functional, we performed dopamine uptake experiments from striatal synaptosome preparations. The level of 3H[DA] uptake from DAT-KO/HAD-Tg mice was approximately 12% of wildtype when subtracting background uptake from DAT-KO tissue (P = 0.038, t-test) (Figure 4.6C). These results reveal that despite the 50% increase in DAT mRNA (refer to Figure 4.1), very little HA-DAT protein is in fact present in the striatum of transgenic mice. Importantly, midbrain DAT levels in DAT-KO/HAD-Tg mice were 27% of levels found in wildtype midbrain (Figure 4.7), demonstrating that the impairment in expression of HA-tagged DAT is more profound in the striatum than the midbrain of DAT- KO/HAD-Tg mice (i.e. 10% vs 27% of WT levels, respectively). This is an important observation, as it suggests that not only is expression of the tagged DAT impaired, but that the presence of the tag may also hinder trafficking of the transporter from the cell bodies to the terminals. Before examining this possibility further, we first sought to determine whether despite low expression levels, the tagged transporter was functional in vivo.

4.1.3 HA-tagged DAT Expression Partially Rescues Hyperactivity of DAT Knockout Mice

We evaluated whether the HA-tagged DAT was functional, despite being poorly expressed, by examining whether it could rescue the behavioural phenotype of mice lacking endogenous DAT. Remembering that DAT-KO mice exhibit distinct behavioural phenotypes that include hyperlocomotion and impaired habituation to novel environment 34, 36, 45, 190, we evaluated the

104

Figure 4.6: Striatal dopamine transporter (DAT) levels in HAD-Tg mice lacking native transporter but expressing HA-tagged DAT. (A) Representative western blot showing DAT protein levels in wildtype mice (WT, n=3), DAT heterozygous (DAT-HET, n=3) mice and mice that lack endogenous DAT but express two copies of the HA-tagged DAT gene (DAT-KO/HAD-Tg, n=3). A DAT-KO sample is shown as a control for immunoreactivity (n=1). Tyrosine hydroxylase (TH) is shown as a marker of dopamine-positive cells. (B) Densitometric analysis of DAT protein levels. One-way ANOVA (F2,6 = 30.40, P = 0.0007) (Dunnett's post-hoc: P ≤ 0.05, *; P ≤ 0.01, **; P ≤ 0.001, ***). (C) Uptake of 3H[DA] into striatal synaptosomes of WT and DAT-KO/HAD-Tg mice. Mean values for Vmax shown (pmol per min per mg protein). The average Vmax of DAT-KO controls was deducted from all WT and DAT-KO/HAD-Tg values. (WT and DAT-KO/HAD-Tg, n=3) (t-test, P ≤ 0.05). Mean +/- SEM (P = 0.038). note: Pieter Beerepoot performed radiolabelled uptake experiments featured in panel C.

105

Figure 4.7: Midbrain dopamine transporter (DAT) levels in mice lacking native transporter but expressing HA-tagged DAT. (A) Representative western blot showing DAT protein levels in midbrain of wildtype mice (WT, n=4) and transgenic mice lacking endogenous DAT but expressing tagged transporter (DAT-KO/HAD-Tg, n=4). (B) Densitometric analysis of DAT protein levels normalized to tyrosine hydroxylase (TH) (P ≤ 0.001, ***). Mean+/-SEM.

106 behaviour of DAT-KO mice crossed with HAD-Tg mice to determine whether hyperactivity in DAT-KO mice could be ameliorated by the expression of the HA-DAT transgene. If so, this would indicate that the HA-tagged DAT is functional. Figure 4.8 shows that expression of HA-tagged DAT in DAT-KO mice significantly reduced the total distance travelled by the animals from 26 470 cm to 8583 cm in 120 minutes (P < 0.0001). Therefore, the HA-tagged DAT transgene is sufficient to attenuate the hyperactivity displayed by DAT-KO mice. Interestingly, the locomotor activity of DAT-KO/ HAD-Tg mice is significantly higher than wildtype animals, indicating that the HA-tagged DAT can only partially rescue the DAT-KO hyperactive phenotype (P < 0.0001) (Figure 4.8). This is consistent with western blots showing that the striatal levels of HA-tagged DAT are less than 10% of normal DAT levels.

4.1.4 Response to Amphetamine is Attenuated in Mice Expressing Only HA-tagged DAT

The locomotor response to amphetamine is directly proportional to striatal DAT levels, as previously shown in both DAT overexpressing mice and several DAT-KO mice studies 37, 544, 577. Paradoxically, mice lacking DAT or expressing low-levels of DAT display reduced rather than increased activity in response to amphetamine despite having higher levels of extracellular dopamine at baseline 45, 565, 577; as a control, our tests recapitulated this observation. As expected, both wildtype and HAD-Tg mice display hyperactivity following the administration of a moderate dose of amphetamine (2.0 mg/kg) (Figure 4.9). However, mice that express HA-tagged DAT (DAT-KO/HAD-Tg) alone display a reduction in activity after administration of amphetamine that resembles the behavioural response of DAT-KO mice (P < 0.01), again corroborating impaired expression of tagged transporter in the nigrostriatal pathway.

107

Figure 4.8: Rescue of dopamine transporter (DAT)-knockout hyperactivity by HA- tagged DAT. Total distance travelled (cm) in 120 minutes in a novel environment by wildtype (WT, n=18); transgenic (HAD-Tg, n= 13); dopamine transporter knockout (DAT- KO, n=18); DAT-KO/HAD-Tg (n=10); DAT-heterozygotes (DAT-HET, n=15); DAT- HET/HAD-Tg (n=16). Two-way ANOVA shows an effect of DAT-KO genotype (F2,68 = 46.35, P < 0.0001); effect of HA-DAT genotype (F1,68 = 20.75, P < 0.0001); genotype x genotype interaction F2,68 = 17.69, P = 0.0003). Post-hoc Bonferroni t-test: DAT-KO to DAT-KO/HAD-Tg (P < 0.001); WT to DAT-KO (P < 0.001); WT to DAT-KO/HAD-Tg (P < 0.001); DAT-KO/HAD-Tg to DAT-HET (P = 0.0001). (P ≤ 0.001, ***). Mean +/- SEM.

108

Figure 4. 9: Locomotor response to amphetamine in wildtype (WT, n=8); transgenic (HAD-Tg, n=8); dopamine transporter knockout (DAT-KO, n=8); and DAT-KO/HAD-Tg (n=13) mice. (A) Total distance travelled (cm) in the 60 minutes to injection (baseline) and 60 minutes post-injection of 2.0 mg/kg amphetamine. Repeated-measures two-way ANOVA shows a significant effect of genotype (F3,66 = 15.77, P < 0.0001) and of drug (F1,66 = 17.12, P ≤ 0.01). In addition, a significant genotype x drug interaction was observed (F3,66 = 39.59, P < 0.0001). (Bonferroni post-hoc: P ≤ 0.05,*; P ≤ 0.01,**; P ≤ 0.001,***) (B) Total distance travelled in 5 minute epochs: 120 minutes prior to, and 90 minutes following, the injection of 2.0 mg/kg amphetamine (arrow depicts time of injection). Two-way ANOVA: effect of DAT genotype (F3,1271 = 52.62, P < 0.0001); effect of time (F41,1271 = 45.82, P < 0.0001); interaction F4,1271 = 24.79, P < 0.0001 ). Mean +/- SEM.

109

4.1.5 N-Terminal HA Tagging of DAT Interrupts Transport from the Midbrain to Striatum

In a direct comparison between wildtype and HAD-Tg mice, transgenic mice showed no increase in DAT levels in either the midbrain or the striatum (Figure 4.3). In addition, HAD- Tg mice lacking endogenous DAT, but carrying two copies of the tagged DAT transgene express transporter protein at 8.5% of normal striatal DAT levels (Figure 4.6). To determine the reason for the lack of an appreciable expression of HA-tagged DAT detected in the striatum, we examined whether the HA epitope interfered with targeting of DAT from the dopamine cell bodies in the midbrain to the terminals in the striatum. We performed western blots comparing striatal to midbrain protein using regional samples from the same mice. First, we established the ratio of DAT that is normally present in the striatum versus the midbrain of wildtype mice; then, using samples from DAT-KO/HAD-Tg mice, we established the ratio of HA-tagged DAT present in the striatum versus midbrain using anti-HA antibody (Figure 4.10A-B). In wildtype mice, the striatum-to-midbrain ratio of DAT is approximately 5.24, whereas in HAD-Tg mice the striatum-to-midbrain ratio of HA-tagged DAT is only 2.92 (P = 0.001, t-test) (Figure 4.10C). The striatum-to-midbrain ratio of HA-tagged DAT is approximately 44% lower than the ratio of endogenous DAT in wildtype mice.

Results obtained from the western blot densitometry ratio analysis of HA-tagged DAT (striatum to midbrain) were recapitulated using immunohistochemistry. In sagittal sections, we demonstrated that the ratio of HA-DAT in the striatum compared to midbrain in transgenic mice is significantly reduced as compared to the ratio of DAT in the striatum to midbrain of wildtype mice (0.96 and 1.80, respectively; P = 0.0002) (Figure 4.11).

Both western blot and immunohistochemistry techniques revealed that the striatum-to- midbrain ratio of wildtype DAT is approximately 1.8 times higher than the ratio of striatal:midbrain HA-tagged DAT. These results suggest a reduction in the proportion of HA- tagged DAT that reaches the striatum from the midbrain compared to endogenous DAT, and indicate that the addition of the HA-tag at the N-terminus interferes with targeting and/or transporting of DAT from the midbrain to axonal terminals. Worth noting is that despite low expression levels, immunoprecipitation against the HA-epitope could successfully be performed, likely owing to the high affinity of commercial HA antibodies (results not

110 shown); however, pilot mass spectrometry experiments did not detect adequate DAT peptide hits and therefore, we were unable to establish binding partners within the DAT proteome (results not shown).

111

Figure 4.10: Western blot of dopamine transporter (DAT) levels in striatum and midbrain of WT and DAT-KO/HAD-Tg animals. (A) Western blot of striatum and midbrain protein from wildtype mice (WT, n=5). (B) Western blot of striatum and midbrain protein from mice lacking endogenous DAT but carrying the HA-tagged DAT transgene (DAT-KO/ HAD-Tg, n=4). Tyrosine hydroxylase (TH) marks dopamine-producing cells. (C) Densitometric analysis of the striatum-to-midbrain ratio of DAT protein normalized to TH. (t-test, P < 0.001, ***) Mean +/- SEM.

112

Figure 4.11: Immunofluorescence staining to detect distribution of dopamine transporter (DAT) and HA-tagged DAT. (A) Representative image of immunofluorescence staining for DAT in wildtype (WT) sagittal sections and for HA-DAT in sagittal sections from transgenic mice with a HA-tagged transporter (HAD-Tg). (B) Immunofluorescence detected by Licor imager and converted to greyscale. Arrows denote regions used for densitometric analyses in widtype (using anti-DAT staining) and in HAD-Tg (using anti-HA staining) (C) Densitometric analysis of the striatum:midbrain ratio of DAT protein in WT slices and of HA-DAT in HAD-Tg slices. n=5 per genotype. (t-test, P < 0.001, ***) Mean +/- SEM.

113

Chapter 5 Results 5 Project Two: The Influence of High-Copy Tyrosine Hydroxylase Overexpression On Biochemical and Behavioural Features of the Dopaminergic and Noradrenergic Systems

5.1 Development of Transgenic Mice Overexpressing Tyrosine Hydroylase

Multiple novel mouse lines overexpressing TH were developed using BAC transgenesis. A BAC containing the murine TH gene (RP23-350E13), as well as approximately 90 -100 kb of genomic DNA both upstream and downstream to the gene loci, was grown up and purified (Figure 5.1A). The genomic sequence also contained one other gene sequence (Tspαn32), a transcription factor (Ascl-2), three predicted genes and predicted pseudogenes (R74862, Gm39117, Gm7290), and a portion of the sequence for gene Cd81. These sequences are not believed to affect the outcome of our transgenic model: Tspαn32 is specific to haematopoietic tissues and not expressed in the brain, Ascl-2 requires dimerization with other proteins to function, and the predicted genes have no known function. After resuspension, the size of the isolated BAC was confirmed using pulse-field gel electrophoresis (Figure 5.1B). Diluted BAC was microinjected into the pronucleus of fertilized mouse eggs, which were then transferred into a pseudo-pregnant female recipient.

For the development of our original TH-overexpressing line, termed "TH-Y", pronuclear microinjection was performed at Duke University. One transgenic F1 pup founded the transgenic line. After several generations of exclusively male transgenic pups, the TH transgene was determined to be linked to the Y chromosome. Despite this peculiarity, the linewas healthy and viable, and integration onto the Y-chromosome was of no obvious detriment. Therefore, the line was biochemically and behaviourally characterized; results are discussed in the following section (Chapter 6).

114

Figure 5.1: Development of TH-HI mice. (A) Schematic representation of a bacterial artificial chromosome containing the tyrosine hydroxylase gene, RP23-350E13. (B) Pulsed- field gel electrophoresis. BAC RP23-350E13, 200 ng and 100 ng dilutions. Mid-range ladder (PRG Marker, NEB N3551S). (C) Quantitative PCR of genomic DNA for pups born after pro-nuclear microinjection. Controls include both wildtype and transgenic mice from an original TH-overexpressing line (TH-Y), shown here to possess three total copies of TH, as well as wildtype (WT) mice from a dopamine transporter overexpressing line (DAT-Tg) as a control. Results are the averages obtained from two dilutions of each sample. Mean +/- SEM.

115

Figure 5.2: Gene copy number and mRNA levels in transgenic mice overexpressing tyrosine hydroxylase . (A) Genomic copy number of the gene for tyrosine hydroxylase (TH) in two original overexpressing lines: TH-Y and TH-HI.(one-way ANOVA: F2,12 = 68.41, P ≤ 0.001) (Dunnet's post-hoc, against WT: P ≤ 0.05, *; P ≤ 0.001, ***) (B) TH mRNA levels in wildtype (WT) and TH-HI mice, normalized to dopamine transporter (DAT) mRNA levels as a marker of dopaminergic cells. (t-test, P ≤ 0.0001, ****) Mean +/- SEM. note: Wendy Horsfall and Kristel Bermejo assisted with the genomic qPCR and mRNA qPCR featured in panel A and B, respectively.

116

Microinjection was repeated with freshly prepared BAC sent to a collaborating lab at Emory University, which yielded four positive pups. Using quantitative PCR on genomic DNA, we were able to determine total TH copy number of all pups born to host mothers (Figure 5.1C). A pup shown to carry to carry six total copies of the TH gene was assigned as the founder to a "high-copy" line, TH-HI (Figure 5.1C, Figure 5.2A). Transgenic TH-HI mice did not differ in size or appearance relative to sex- and age-matched wildtype littermates. Average litter sizes was 5.2 pups (excluding the first litter from each breeding pair, which are typically larger), with a breeder retired at a maximum of one year.

There was an approximate threefold increase in mRNA, measured by qPCR in comparison to a commonly-used reference gene, PGK1 (P ≤ 0.0001, t-test) (Figure 5.2B). TH mRNA was normalized to DAT mRNA (after confirming no difference in DAT), to ensure differences measured were restricted to dopaminergic cells. The increase in mRNA is commensurate with total gene copy number of six (acheived by the addition of four additional copies of TH).

5.2 Biochemical Characteristics of TH-HI Mice

5.2.1 TH Protein Expression and Enzymatic Activity in Dopaminergic Regions: The striatum and midbrain

While TH gene copy number was increased threefold with a corresponding increase in mRNA levels, protein levels of TH were assessed to ensure that a protein product was indeed translated. Protein levels were quantified by western blot, in juvenile mice (4 weeks of ages) as well as in adult mice (approximately 12 weeks; range, 10-14 weeks) (Figure 5.3). Transgenic mice aged 4 and 12 weeks showed a threefold increase in the optical density of total TH protein in both the midbrain and striatum (0.0001 ≤ P ≤ 0.05 for all, t-test), commensurate with the observed increase in mRNA, with no significant change in DAT protein. Immunohistochemistry revealed that TH protein expression patterns in the midbrain and striatum are similar between wildtype and TH-HI mice (Figure 5.4). There was no ectopic expression of TH detected in the regions that surround the striatum in the forebrain,

117

Figure 5.3: Midbrain and striatal tyrosine hydroxylase protein levels are increased in juvenile and adult mice, determined by optical density of western blots. (All western blots show representative samples.) Midbrain (MB) protein levels of tyrosine hydroxylase (TH) and the dopamine transporter (DAT) are shown at (A) 4 weeks of age (wildtype, WT, and high-copy transgenic mice, TH-HI; both genotypes, n=4) and (B) 8 weeks of age (WT, TH- HI n=6). Striatal (ST) protein levels are shown at (C) 4 weeks of age (WT n=5, TH-HI n=7) and (D) 12 weeks of age (WT, TH-HI n=6). All samples are normalized to a loading control, NaK-Pase, and averages are normalized to wildtype levels. (t-test: P < 0.05, *; P < 0.01, **; P < 0.001, ***) Mean+/-SEM.

118

Figure 5.4: Tyrosine hydroxylase protein expression patterns in dopaminergic regions are similar between wildtype (WT) and transgenic (TH-HI) mice. Immunohistochemistry reveals protein expression of tyrosine hydroxylase (TH, red) and the dopamine transporter (DAT, green) in the midbrain (A) and striatum (B). Yellow represents co-localized TH and DAT.

119 or the substantia nigra or VTA in the mesencephalon. This is consistent with the advantages of BAC transgenesis, which allows for endogenous-like spatiotemporal protein expression.

Although densitometric analyses provided by western blot demonstrated that total TH protein is increased in the striatum and midbrain (Figure 5.3), it does not indicate whether the overexpressed protein is functional or active. The activity of TH is stimulated by phosphorylation at key residues on the amino terminus. While there are four serine residues on the amino terminus that can be phosphorylated, only Ser31 and Ser40 directly affect the activity of TH 91, 195, 578. Phosphorylation at Ser19 alone is not sufficient to increase TH activity, but studies suggest it faciliates phosphorylation at Ser40 and potentiates the increase in enzymatic activity. Total optical density of phosphorylated TH at Ser 19, Ser31 and Ser40 were, again, increased nearly threefold in the striatum (P ≤ 0.0001 for all, t-test) (Figure 5.5).

Remembering that TH is the rate-limiting enzyme in the synthesis of catecholamines, we next sought to confirm the functionality of the translated protein by measuring its product. As L- DOPA is the direct product of TH, its levels are a reflection the total enzymatic activity of TH in vivo (refer to Chapter 1, Figure 1.3). However, L-DOPA is transient and quickly converted to dopamine by dopamine decarboxylase; it is therefore necessary to inhibit decarboxylation to effectively measure the accumulation of L-DOPA. We used injections of 100 mg/kg NSD-1015 to inhibit dopamine decarboxylase in accordance with previous studies 41, 321, and quantified total tissue content of L-DOPA in the striatum at 4 weeks and in adult mice (10-13 weeks) using HPLC. In both 4 week-old and adult mice Figure 5.6A and B, respectively). L-DOPA accumulation was 200% that of wildtype levels (P ≤ 0.00001 for both, t-test). This directly demonstrates that the TH protein translated from the inserted TH transgene is functional and active, and corroborates results from our phosphorylation analyses. In the same experiment, we also measured the tissue content of dopamine and its metabolites; since NSD-1015 inhibits the activity of TH, the measured dopamine in large-part represents previously made or recycled dopamine stored in vesicles. Importantly, there is an approximate 24% increase of striatal dopamine content of at 4 weeks of age (P = 0.019, t- test) but not in adult mice. Nonetheless, the content of the metabolites in TH-HI mice as compared to wildtype mice in significantly increased at both time points. At 4 weeks of age, HVA — which can be converted from DOPAC or directly from dopamine in astrocytes and

120

Figure 5.5: Levels of phosphorylated tyrosine hydroxylase is increased in the striatum of adult transgenic (TH-HI) mice as compared to wildtype (WT) littermates. Phosphorylation at three main residues affecting activity of tyrosine hydroxylase (TH) was evaluated with western blot (representative samples shown). Levels of protein phosphorylated at serine 19 (A), serine 31 (C), and serine 40 (E) were found to be increased. Optical density of phospho-proteins was normalized to GAPDH: a three– to fourfold increase was demonstrated serine 19 (B), serine 31 (D), and serine 40 (F). (n=6 for all groups.) (t-test, P ≤ 0.0001, ****, for all comparisons.) Mean +/- SEM.

121

Figure 5.6: L-3,4-dihydroxyphenylalanine (L-DOPA) accumulation in striatal samples from both juvenile and adult mice. L-DOPA, dopamine (DA), homovanillic acid (HVA) and 3,4-dihydroxyphenylacetic acid (DOPAC) were measured in striatal tissue samples from wildtype (WT) and transgenic (TH-HI) mice. Forty minutes following the injection of a dopa- decarboxylase inhibitor, NSD-1015, mice were sacrifice. Analyte content was measured in striatal tissue from mice (A) 4-weeks of age (DA: WT n=9, TH-HI n=8; DOPAC: WT n=7, TH-HI n=6; HVA: WT n=9, TH-HI n=8) and (B) 10-20 weeks of age (DA, DOPAC and HVA: WT n=7; TH-HI n=7).The accumulation of L-DOPA is higher at both ages, while stored DA content is only higher in 4-week old mice. Metabolites are significantly increased at both ages. All values are relative to WT. (t-test: P ≤ 0.05, *; P ≤ 0.0001, ****) Mean +/- SEM.

122 the postsynaptic neuron — is increased by approximately 90% over wildtype levels (P = 0.0001, t-test), and DOPAC rose by 55% (P = 0.01). Similarly, in adult TH-HI mice, striatal HVA content is increased over wildtype levels by approximately 58% (P = 0.01) and DOPAC trended towards significance (P = 0.089).

5.2.2 Expression of TH at the Site of Central Noradrenaline Synthesis: The locus coeruleus

The locus coeruleus is the main source of noradrenaline neurons in the brain, projecting widely with an influence on numerous functions: among them, cortical arousal, cognitive and behavioural flexibility, posture and balance, and many others. To assess the levels of TH in the noradrenergic system, we quantified total TH levels in the locus coeruleus by western blot. We found a near threefold increase in TH optical density consistent with results observed in the dopaminergic regions (P = 0.00082, t-test) (Figure 5.7A-B). Next, we examined the expression patterns of TH in the locus coeruleus using immunohistochemistry and demonstrated similar expression patterns between wildtype and TH-HI mice, with no evidence of ectopic TH expression in the surrounding regions, again suggesting that all TH is restricted to native catecholaminergic regions (Figure 5.7C).

5.2.3 Expression of TH in the Periphery: The adrenal medulla

The adrenal medulla is a concentrated source of TH, secreting noradrenaline and adrenaline in response to input from the autonomic nervous system via the thoracic splanchnic nerves (thoracic ganglia T5-T11). Here, monoamines act as hormones rather than neurotransmitters and in this capacity, they influence physiology by affecting heart rate, vasodilation, pulmonary functions, aspects of gastrointestinal functions, metabolism and more. We used western blot to determine if TH is also overexpressed in periphery as it is in the central nervous system. Total TH protein was increased approximately 2.5 times in homogenates made from the adrenal medulla of TH-HI mice (P = 0.00029, t-test), demonstrating the successful overproduction of TH in the peripheral as well as the central nervous system in these novel overexpressing mice (Figure 5.7D-E).

123

Figure 5.7: Tyrosine hyroxylase protein expression in central and peripheral noradrenergic regions. (A) Protein expression of tyrosine hydroxylase (TH) in the locus coeruleus (representative samples), with β-tubulin as a loading control. (B) Optical density of TH in the locus coeruleus (normalized to β-tubulin). (WT, n=5; TH-HI, n=6). (C) Immunohistochemistry reveals protein expression of TH (red), the noradrenaline transporter (NET, green), and co-labelling (yellow). (Representative samples.) (D) Protein expression of TH in the adrenal medulla (representative samples), normalized to GAPDH. (E) Optical density of TH in the adrenal medulla (normalized to GAPDH). (WT n=6, TH-HI, n=5) (t-test: P ≤ 0.01, **; P ≤ 0.001, ***). Mean +/- SEM.

124

5.2.4 Tissue Content of Dopamine and Its Metabolites Both juvenile and adult TH-HI mice were shown to possess an approximate threefold increase in total TH protein expression, which was demonstrated to be functional and active through measures of phosphorylated TH and L-DOPA tissue content (Section 5.2.1). We next measured the total tissue content of dopamine and its metabolites in the striatum (refer to Chapter 1, Figure 1.3 and Figure 1.7). The striatal tissue content of dopamine was increased by approximately 23% in 4 week-old mice (P = 0.018); however, no significant difference was detected in adult mice aged 10 - 20 weeks (Figure 5.8A).

Importantly, the total tissue content of DOPAC and HVA remained high at both 4 weeks and at 10-20 weeks of age (P < 0.001 for all) (Figure 5.8B,C). The ratio of DOPAC to dopamine is significantly increased, as is the ratio of HVA to dopamine at both ages (P < 0.001 for all, Bonferroni t-test) (Figure 5.8D-E). The content of DOPAC was increased by more than 80% and 52% over wildtype levels in 4- and 12-week old mice, respectively, while the content of HVA increased by 63% and 50%. The DOPAC-to-dopamine ratio was increased 51% in juvenile mice and 58% in adults; similarly, the HVA-to-dopamine ratio was increased 36% and 59%. A high metabolite to dopamine ratio represents increased dopamine turnover, which may be an indication of oxidative stress. During metabolism, dopamine is enzymatically deanimated by MAO to form H2O2 and 3,4-dihydroxypheylacetadehyde, which is then converted to DOPAC by aldehyde dehydrogenase 58; some of this DOPAC might further be converted to HVA in postsynaptic cells, astrocytes, or the extracellular space. + However, both H2O2 and NH2 are also produced by MAO during the initial reaction and an increased presence of metabolites would necessarily mean a corresponding increase in these 2+ biproducts. As previously discussed, in the presence of ferrous iron (Fe ), H2O2 can easily be • 58 converted to OH, the most destructive free radical for living cells . The increased presence of striatal dopamine metabolites in the absence of a corresponding increase in dopamine tissue content may suggest that additional dopamine produced in transgenic mice may disproportionally reside in the cytosol where it is quickly metabolised before it can be sequestered by VMAT2.

125

5.2.5 Expression of Proteins Regulating the Synthesis and Localization of Dopamine In The Cell

While TH was increased threefold in both juvenile and adult transgenic mice, HPLC revealed there was an increase in the total striatal tissue content of dopamine only in young mice, but not in adults. This is a meaningful observation as in past studies, decreased dopamine tissue content has been linked to neurodegeneration in the striatum 369. It is possible that in TH overexpressing mice, dopamine content is not increased because regulation of TH increases as compensatory — and protective — strategy by the cell in response to increased translation of the enzyme. However, while this possibility exists, it would seem incongruent with our other observations: levels of phosphorylated TH were increased in both junvenile and adult transgenic mice and this was accompanied by a significant increase in L-DOPA accumulation at both ages, suggesting that if there was an upregulation of the proteins restraining the activity of TH, it was not significant enough to attenuate the synthesis of dopamine so far as to match wildtype levels. Nonetheless, to test this possibility, the expression of proteins influencing TH activity were quantified by western blot (Figure 5.9). There was no change in the optical density of PP2A, the major protein dephosphorylating TH at all relevant residues. Similarly, there was no change in alpha-synuclein, which is believed to both directly inhibit the activity of TH and indirectly influence it, by promoting the activity of PP2A and by sequestering 14-3-3. Finally, there was no change in 14-3-3, which is believed to promote TH phosphorylation on Ser19 and Ser40. This set of experiments suggests some of the key proteins known to influence the activity of TH are not significantly altered.

While HPLC tissue content does not discriminate between vesicular and cytosolic neurotransmitters, changes in VMAT2 levels could give an indication as to how the cell might cope with a potential increase in dopamine production. Recalling that cytosolic dopamine has been shown to be neurotoxic, we used western blot to determine if VMAT2 levels were changed in response to an increase in dopamine synthesis as a protective strategy to sequester it once produced. Protein levels were measured at both 4 weeks and 12 weeks of age (Figure 5.10). Importantly, there was no change in VMAT2 levels at either time point. Recall that Figure 5.7 revealed that while there was no increase in total tissue content of dopamine in adult mice, there was a sustained elevation in the levels of metabolites (mirroring observations made in juvenile mice). Unsurprisingly, the ratio of metabolites-to-

126

Figure 5.8: Striatal tissue content of dopamine and its metabolites. In juvenile and adult mice, tissue content of (A) dopamine (DA) (two-way ANOVA: effect of age, F1,64 = 23.63, P ≤ 0.0001); (B) 3,4-dihydroxyphenylacetic acid (DOPAC) (two-way ANOVA, effect of genotype: F1,64 = 53.28, P ≤ 0.0001) and (D) homovanillic acid (HVA) (two-way ANOVA: effect of age, F1,64 = 19.02, P ≤ 0.0001; effect of genotype, F1,64 = 74.36, P ≤ 0.0001) . The ratios of metabolite-to-dopamine were also determined: (C) DOPAC to DA (two-way ANOVA: effect of age, F1,64 = 18.76, P ≤ 0.0001; effect of genotype: F1,64 = 82.22, P ≤ 0.0001) and (E) HVA to DA (two-way ANOVA, effect of genotype: F1,64 = 55.37, P ≤ 0.0001). (4 weeks: WT n=20, TH-HI n=15; 10-20 weeks: WT n=20, TH-HI n=13) (variation due to age denoted "#": P < 0.0001, ###) (Bonferroni post-hoc test: P ≤ 0.05, *; P ≤ 0.0001, ***) Mean+/-SEM, normalized to 4-week old mice WT levels for each analyte.

127

Figure 5.9: Proteins regulating phosphorylation of tyrosine hydroxylase in the striatum of adult mice. Proteins involved in both the negative regulation, and promotion, of tyrosine hydroxylase phosphorylation remain unchanged in adult mice. (A) Representative samples showing alpha-synuclein and (B) densitometry of the optical density of alpha-synuclein, normalized to GAPDH. (C) Representative samples showing protein phosphatase 2A(PP2A) and (D) densitometry of the optical density of PP2A normalized to GAPDH. (E) Representative samples showing 14-3-3 and (F) densitometry of the optical density of 14-3-3 normalized to GAPDH. (WT and TH-HI, n=6 for all). Mean +/- SEM.

128

Figure 5.10: Striatal protein levels of the vesicular monoamine transporter (VMAT2) in juvenile and adult mice are unchanged. (A) Representative samples showing VMAT2 at 4 weeks of age and (B) densitometry of VMAT2 optical density, normalized to GAPDH. (C) Representative samples showing VMAT2 at 12 weeks of age and (D ) densitometry of VMAT2 optical density, normalized to GAPDH. (one-way ANOVA, Dunnett's post-hoc: P ≤ 0.05, *; P ≤ 0.001,***) (WT and TH-HI, n=6; VMAT-kd, n=2, for both ages) Mean +/- SEM.

129 dopamine is profoundly raised in transgenic mice as compared to wildtype mice at both ages. As previously mentioned, this ratio is often considered to be a reflection of dopamine turnover; an increase in this ratio could then, in turn, reflect conditions of oxidative stress.

5.2.6 Markers of Oxidative Stress in TH-HI Mice

While there was no increase in striatal tissue content of dopamine in adult mice, there were elevated levels of metabolites and evidence of increased dopamine turnover, which can be indicative of oxidative stress. Therefore, we next measured levels of oxidative stress by quantifying glutathione in the striatum using a colourmetric assay. We found that in adult TH-HI mice, glutathione levels were reduced, suggesting elevated levels of reactive oxidative species (Figure 5.11).

5.3 Behavioural Phenotype of TH-HI Mice

At baseline, there was no change in total distance travelled by adult mice, although there is a trend towards increased locomotor behaviour in adult mice (Figure 5.12A), or stereotypic behaviour; baseline activity was determined at the beginning of the light phase, with a start time between 7:00 am and 9:00 am, prior to injection with a psychostimulant. There was also no change in total distance travelled or stereotypic behaviour in juvenile mice at baseline. All behavioural assessments were made between age-matched groups of transgenic and wildtype mice, and included both males and females unless otherwise indicated.

5.3.1 Locomotor Response to Psychostimulant Drug Challenges

To indirectly test dopaminergic transmission, we administered stimulant drugs known to affect the dopaminergic system. Mice were given saline or an amphetamine challenge (2.0 mg/kg or 3.0 mg/kg) after 60 minutes of baseline recording and assessed for 90 minutes post- injection. There was a significant increase in the total distance travelled (Figure 5.12B) and stereotypic behaviour (Figure 5.12C) following amphetamine administration in TH-HI mice relative to WT mice. Similar results were obtained in 4 week-old mice, after receiving a 3.0

130

Figure 5.11: Markers of oxidative stress in adult mice. (A) Total glutathione levels (GSH) were reduced in striatal tissue of adult transgenic mice (TH-HI) as compared to wildtype (WT) (12-15 weeks of age). No significant difference was detected between levels in TH-HI and control mice treated with reserpine two hours prior to dissections (WTres). Reserpine has been shown to cause oxidative stress in dopaminergic regions, and used as a positive control. (WT n=14; TH-HI n=14; WTres n=7) (all data normalized to WT) (one-way ANOVA: F 2, 32 = 7.709, P = 0.0019) (Bonferrori post-hoc, all pairwise comparisons: P ≤ 0.05, *; P ≤ 0.01, **) (B) No change in GSH levels was detected in cortical samples (negative control). (WT n=14; TH-HI n=14; WTres n=7) (all data normalized to WT) Mean +/- SEM.

131

Figure 5.12: Locomotor activity at baseline and the response to amphetamine (adults). (A) Total distance (cm) travelled by wildtype (WT) and transgenic (TH-HI) mice in 60 minutes, at baseline. (repeated-measures two-way ANOVA: effect of time, F29,551 = 64.79, P ≤ 0.0001; effect of genotype, F1,551 = 36.14, P ≤ 0.0001; genotype x time interaction: F29,551 = 17.85, P ≤ 0.0001) (4 weeks: WT/TH-HI, n=10; adults 8-12 weeks: WT n=33, TH-HI, n=28) (B) Total distance travelled in 5 minute epochs, before and after injection with 3.0 mg/kg amphetamine (arrow denotes time of injection). (repeated measures two-way ANOVA: effect of time, F29,290 = 20.33, P ≤ 0.0001; effect of genotype, F1,290 = 9.83, P = 0.011; genotype x drug interaction, F29,290 = 5.49, P ≤ 0.0001) (C) Total distance travelled in 90 minutes after injection of saline (two-way ANOVA: effect of drug, F2,39 = 35.36, P ≤ 0.0001; effect of genotype, F1,39 = 28.45, P ≤ 0.0001; genotype x drug interaction, F2,39 = 6.625, P = 0.0033) (D) Total stereotypic counts in 90 minutes after injection of saline, 2.0 mg/kg, or 3.0 mg/kg amphetamine. (two-way ANOVA: effect of drug, F2,39 = 43.40, P ≤ 0.0001; effect of genotype, F1,39 = 23.73, P ≤ 0.0001; genotype x drug interaction, F2,39 = 5.09, P = 0.011) (WT, n=6; TH-HI, n=6), 2.0 mg/kg (WT, n=13; TH-HI, n=8), or 3 mg/kg of amphetamine (WT, n=6; TH-HI, n=6). (Bonferroni post-hoc: P ≤ 0.05, *, P ≤ 0.01, **; P ≤ 0.001, ***). Mean +/- SEM.

132

Figure 5.13: Locomotor response to amphetamine at four weeks of age. (A) Total distance travelled in 5 minute epochs, 60 minutes before and 90 minutes following injection with saline or 3.0 mg/kg amphetamine (arrow denotes time of injection) (repeated-measures two-way ANOVA: effect of time: F29,348 = 22.79, P ≤ 0.0001; effect of genotype, F1,290 = 54.10, P ≤ 0.0001; genotype x time interaction, F29,290 = 12.30, P ≤ 0.0001) (Bonferroni post- hoc: P ≤ 0.05, *; P ≤ 0.01, **; P ≤ 0.001, ***) (B) Total difference travelled in 90 minutes after injection of saline or 3.0 mg/kg of amphetamine (t-test, P ≤ 0.0001, ***) (C) Total stereotypic counts in 90 minutes after injection of saline or 3.0 mg/kg amphetamine. (t-test, P = 0.0015, **) (wildtype, WT n=6; transgenic, TH-HI n=6 for both saline and drug) Mean +/- SEM.

133

Figure 5.14: Cocaine causes hyperactivity in adult transgenic mice. (A) Total distance travelled in 90 minutes following the injection of 30 mg/kg cocaine in wildtype (WT, n=7) and transgenic mice (TH-HI, n=7). (t-test, P = 0.0017) (P ≤ 0.01, **). (B) Distance travelled in 5 minute epoches, 60 minutes prior to, and 90 minutes following injection (injection is denoted by arrow). (repeated-measures two-way ANOVA: effect of genotype, F1,348 = 8.942, P ≤ 0.05; effect of time, F29,348 = 27.27, P ≤ 0.001; genotype x time interaction, F29,348 = 1.992, P ≤ 0.01) (Bonferroni post-hoc: P ≤ 0.01, **; P ≤ 0.001, ***) Mean +/- SEM.

134 mg/kg dose of amphetamine (Figure 5.13). The potentiated hyperactive response to amphetamine in both juvenile and adult mice is consistent with increased dopamine production which, in turn, would be expected to result in increased cytosolic and/or vesicular stores of the transmitter.

The locomotor response to cocaine was also assessed in adult transgenic mice; as seen in amphetamine challenges, both the total distance travelled and stereotypic behaviour was significantly higher in transgenic mice than wildtype littermates (Figure 5.14). However, the magnitude of change was not increased to the same degree as in amphetamine challenges. While there was a 2.3-fold and 2.4-fold increase in the total distance travelled following amphetamine administration at 2.0 and 3.0 mg/kg, respectively, there was a 1.4-fold increase in the same (locomotor) response induced by a high dose of cocaine (30 mg/kg).

5.3.2 Assessment of Fine Motor Skills

We next assessed fine motor skills using the challenging beam traversal task, a paradigm designed to test the ability of a rodent to walk across a mesh-grid without slipping. This test is often used to assess motor abnormalities in animal models with alterations affecting the nigrostriatal dopamine system. While activity in an open field and the rotarod test of coordination are more commonly used and automated, these paradigms lack the sensitivity to detect more subtle aberrations in dopaminergic functioning. We found no difference in the number of foot slips as adult mice traversed the beam (P = 0.23, t-test), with 7.4 foot slips versus 9.9 in wildtype and TH-HI, respectively (Figure 5.15A). This result is unsurprising given that in adult mice, there is no difference in striatal tissue content of dopamine. While there was no significant difference in the time to traverse the beam, there was a trend towards a quicker traversal time in TH-HI mice as compared to their wildtype littermates, with mice completing the task in an average of 10 seconds and 13.5 seconds, respectively (Figure 5.15B) (P = 0.10). Traversal time, however, could reflect alterations in other systems, such as the centrally-mediated noradrenergic system, or possibly even a peripherally-mediated sympathetic ("fight or flight") response. It could also reflect decreased anxiety, manifested by increased willingness to explore open and elevated spaces.

135

Figure 5.15: Fine motor skills are not significantly impaired in transgenic mice. Motor impairment was assessed by the challenging beam traversal test, by (A) total foot slips and (B) total time to traverse the beam. There was no difference in performance between wildtype (WT) and transgenic (TH-HI) mice at 12-14 weeks of age. (WT=20; TH-HI=16). Mean +/- SEM.

136

5.3.3 Anxiety Assessments by Elevated Plus Maze

Anxiety profiles of genetic mouse models of Parkinson's disease, as assessed by the elevated plus maze paradigm, have yielded mixed results: A53T alpha-syuclein mutant mice have shown reduced anxiety, demonstrated by increased visits to, and total time spent in, the open arms of the apparatus compared to wildtype littermates, while DJ-1 mice do not differ from wildtype mice 579, 580. Conversely, VMAT2-deficient mice demonstrate increased anxiety-like behaviour in the elevated plus maze 391. We assessed the performance of TH-HI mice in both dim– and room ("bright") lighting conditions, to represent two levels of negative conditions 581. In bright light, there was no difference between time spent in the open arms, nor was there a difference in visits to open arms between wildtype and TH-HI mice (Figure 5.16A-F). However, in dim light, TH-HI mice spent more time in the open arm and visited the open arms more often (Figure 5.16G-L), suggesting that under moderately stressful conditions, they may experience attenuated anxiety levels.

5.3.4 Sensory-Motor Gating

Abnormalities in sensory motor gating have been linked to dysfunction within the dopaminergic system but have also been associated with noradrenergic tone, as NET blockade has been shown to alleviate deficits seen into DAT-KO mice 582-584. To study sensory motor-gating in mice overexpressing TH, we assessed PPI in adult mice. There was no significant effect of genotype on startle inhibition (repeated-measures two-way ANOVA:

F1,108 = 2.190, P = 0.145) (Figure 5.17).

5.3.5 Spatial Memory and Cognitive Flexibility

Given the role of the dopaminergic and noradrenergic system in memory and cognition, we next evaluated cognitive skills in TH-HI mice. Notably, impairments in memory and executive function are some of the most troubling, non-motor symptoms of Parkinson's disease. Working memory impairment, assessed by the Y-maze, was shown to be mildly but significantly impaired in transgenic mice, who performed spontaneous arm alternations accounting for 49.7 % +/- 1.26 of three-armed entries as compared to 54.5 % +/- 1.83 in

137 wildtype littermates (P = 0.039, t-test) (Figure 5.18A). Elements of executive functions — problem-solving, cognitive flexibility, and elements of short– and long-term memory — were assessed using the puzzle box, a test previously developed to assess cognitive deficits in models of schizophrenia 571. Using this paradigm, TH-HI mice exhibited evidence of impairment in cognitive functions (effect of genotype: F1, 696 = 6.498, P = 0.0126, repeated- measures two-way ANOVA) (Figure 5.18B). When sexes are separated, it becomes evident that differences are more pronounced in male mice (Figure 5.18C); interestingly, there was no impairment measured in female mice (Figure 5.18D).

Importantly, it is not an incompatible observation to detect differences in cognitive tests although no motor impairment was detected. As motor deficits are more strictly taken as an indication of abnormalities in the nigrostriatal dopaminergic pathway, the absence of an impairment detected by the challenging beam traversal is in agreement with the absence of a change in striatal dopamine tissue content in adult mice. Cognitive functions, in contrast, are believed to be more heavily influenced by other systems 585, 586. As they may have a stronger noradrenergic component, it is conceivable that any deficits observed in the puzzle box are a result of alterations in the noradrenergic system 139, 142, 145, 587; in this way, it is possible for performance in motor and cognitive tests to diverge in transgenic mice with abnormalities in one or more catecholaminergic systems. However, we did not measure tissue content in any other transmitter system or brain region outside the striatum, or within pathways that bear specific relevance to cognitive functioning. Therefore, to explore the strict contribution of dopamine to the cognitive functions tested by the puzzle box, the performance of a DAT overexpressing line (DAT-Tg) was assessed. DAT-Tg mice have decreased extracellular dopamine, presumably in all dopaminergic pathway, and were shown to have 36% spontaneous loss of TH-positive cells in the substantia nigra pars compacta (attributed to oxidative stress) 369. Interestingly, there was no detectable impairment in DAT-Tg mice demonstrated by the puzzle box (Figure 5.19A). In fact, when sexes were separated, female mice showed a shorter "problem-solving" latency (Figure 5.19C). Therefore, cognitive impairment is not evident in DAT-Tg mice during the puzzle box challenge, despite previously reported abnormalities in the dopaminergic system and known behavioural phenotypes, including motor deficiencies demonstrated on the challenging beam 369. Importantly, these results support the hypothesis that potential alternations within the

138 noradrenergic system may affect cognitive flexibility in TH-HI mice; the underlying biochemical features of the noradrenergic systems are worthy of exploration in future experiments.

139

Figure 5.16: Anxiety in wildtype and transgenic mice. Wildtype (WT) and transgenic mice (TH-HI) completed the elevated plus maze in both bright (A-F) and dim light (G-L). Bright light (WT n=26, TH-HI, n=28): (A) time spent in open arm (seconds) (B) time spent in closed arm (seconds) (C) percent of time spent in open arm, as a proportion of total time spent in all arms (open and closed). (D) number of visits to open arms (E) number of visits to closed arms (F) percent of time visits open arm, as a proportion of total visits to any arm (open or closed). Dim light (WT n=25, TH-HI n=27): (G) time spent in open arm (seconds) (H) time spent in closed arm (seconds) (I) percent of time spent in open arm, as a proportion of total time spent in all arms (open and closed). (J) number of visits to open arms (K) number of visits to closed arms (L) percent of time visits open arm, as a proportion of total visits to any arm (open or closed). (t-test: P ≤ 0.05, *; P ≤ 0.01, **) Mean+/- SEM.

140

Figure 5.17: Sensory motor gating in mice over-expressing tyrosine hydroxylase. Sensory motor gating, as assessed by pre-pulse inhibition, is unchanged between wildtype (WT) and transgenic (TH-HI) mice. The percent of startle inhibition was assessed by a pulse at 69 dB, 73 dB, amd 81 dB, following a pre-pulse (PP-s). (WT n=27, TH-HI n=28). (repeated-measures two-way ANOVA: effect of decibels, F2,108 = 183.3, P ≤ 0.0001). Mean+/-SEM. Experiments were performed by summer student, Lien Nyugen.

141

Figure 5.18: Cognitive alterations in mice overexpressing tyrosine hydroxylase. Alterations in cognition were evaluated by the Y-maze and the puzzle box, which assess spatial memory and congitive flexibility, respectively. (A) Spontaneous alternation performance (SAP) in the Y-maze, as a percent of three-arm entry sequences. (wildtype, WT n=23; transgenic, TH-HI. n=21) (t-test, P = 0.039) (light blue squares, male WT; light orange circles, female WT; dark blue squares, male TH-HI; dark orange circles, female TH-HI) (B) Latency to complete challenge (seconds) in puzzle box in trials (T) 1 to 9, both sexes. (WT, n=44; TH-HI, n=45) (repeated-measures two-way ANOVA: effect of trial, F8, 696 = 92.14, P ≤ 0.0001; effect of genotype, F1, 696 = 6.498, P = 0.0126; genotype x trial interaction, F8, 696 = 2.05, P = 0.0386) (C) Latency to complete challenge (seconds) in puzzle box, males only. (WT, n=25; TH-HI, n=24) (repeated-measures two-way ANOVA: effect of trial, F8, 392 = 54.98, P ≤ 0.0001; effect of genotype, F1, 392 = 7.793, P = 0.0075; genotype x trial interaction, F8, 392 = 2.972, P = 0.003) (D) Latency to complete challenge (seconds) in puzzle box, females only. (WT, n=19; TH-HI, n=19) (repeated-measures two-way ANOVA: effect of trial, F8, 288 = 40.67, P ≤ 0.0001). (Bonferroni post-hoc: P ≤ 0.05, *; P ≤ 0.01, **; P ≤ 0.01, ***) Mean +/- SEM.

142

Figure 5.19: Cognitive flexibility in dopamine transporter overexpressing mice. (A) No deficiencies in cognitive flexibility were detected, as assessed by the latency to complete challenges in the puzzle box, in transgenic mice overexpressing the dopamine transporter (DAT-Tg n=21) as compared to wildtype (WT n=18). (repeated-measures two-way ANOVA: effect of trial, F8,288 = 34.62, P ≤ 0.0001; genotype x trial interaction, F8,288 = 2.892, P = 0.0041) (B) No differences in latency were observed when males were analyzed alone (WT n=9; DAT-Tg n=13). (repeated-measures two-way ANOVA: effect of trial, F8,160 = 21.03, P ≤ 0.0001) (C) No impairment was observed in females (WT n=9; DAT-Tg n=8) analyzed alone . Females completed the task significantly quicker in trial (T–) 7 and 8. (repeated- measures two-way ANOVA: effect of trial, F8,120 = 12.55, P ≤ 0.0001; effect of genotype, F1,120 = 6.185, P ≤ 0.025; genotype x trial interaction, F8,120 = 4.095, P = 0.0002). (Bonferroni post=hoc: P ≤ 0.05, *; P ≤ 0.001, ***). Mean+/-SEM.

143

Chapter 6 Results 6 Project Three: The Biochemical and Behavioural Consequence of Tyrosine Hydroxylase Overexpression in a Transgenic Mouse With Three Gene Copies

6.1 Development and Biochemical Characterization of TH-Y Mice

Preceding the generation of our high-copy line (TH-HI), we developed another line of TH- overexpressing mice using the same BAC (RP23-350E13) and similar methodology. This original line was established from one positive pup (named "TH-Y"), born to a host mother impregnated with BAC-injected embryos. As described in Chapter 5, the primers used for genotyping crossed the gene and vector, thereby specifically identifying pups carrying the BAC as potential founders. These primers were used for all subsequent genotyping. After several generations, it was determined that the BAC had integrated on the Y-chromosome, as all positive transgenic mice were male. However, integration on the Y-chromosome did not result in readily-apparent detrimental effects on body weight, grooming, mating or general health; therefore, while a sex-linked transgenic mice is not preferred, we moved forward with characterization. Because the TH transgenic lines are of a C57 background, we used aged- matched male C57B6 mice as controls to minimize intergroup genetic variation unrelated to the transgene. This transgenic line was found to carry three total copies of the gene encoding TH (Figure 6.1A), and a commensurate increase in TH mRNA (approximately 1.5x the value of wildtype mice; t-test, P = 0.0057) (Figure 6.1B).

Protein levels were first assessed in young adult mice (aged 8 to 10 weeks). There was no difference in the optical density of TH in the midbrain or striatum (Figure 6.1C and D, respectively). Protein levels of DAT were also assessed, as a marker of dopaminergic cells; these remained unchanged. As demonstrated by immunohistochemistry, TH was confined to regions endogenously produced it, with similar protein expression patterns as wildtype mice

144

Figure 6.1. The development of mice expressing three copies of the tyrosine hydroxylase gene. Bacterial artificial chromosome transgenesis was used to develop a mouse line overexpressing tyrosine hydroxylase (TH), later determined to be Y-linked (TH-Y). Quantitative PCR was used to determine that TH-Y mice carry three copies of the TH gene (A) and have a 50% increase in TH mRNA (B), which was normalized to mRNA of the vesicular monoamine transporter, VMAT2, as a marker of dopaminergic cells. (C) Protein levels in the midbrain. Densitometry revealed no increase of the dopamine transporter (DAT), a second marker of dopaminergic cells, or of TH in young adult mice (8-10 weeks). (D) Protein levels in the striatum. Densitometry revealed no increase of DAT or of TH in young adult mice (WT, n=7; TH-Y n=7). Mean +/- SEM. note: Wendy Horsfall and Kristel Bermejo assisted with the genomic qPCR and mRNA qPCR featured in panel A and B, respectively.

145

Figure 6.2. Protein localization of tyrosine hydroxylase. Tyrosine hydroxylase expression (TH, red) is limited to dopaminergic regions in the midbrain (A) and the striatum (B), evidenced by co-expression with the dopamine transporter (DAT, green); regions with co- expression is shown in yellow. (C) Similarly, TH is shown in the noradrenergic locus coeruleus, co-expressed with the noradrenaline transporter (NET, green). (Representative samples.)

146

in the mesencephalon, forebrain and pons: Figure 6.2 shows TH staining in the substantia nigra and VTA in the midbrain, the striatum, and the locus coeruleus. We next used western blots to assess protein levels at other age points. Interestingly, TH levels measured at 4 weeks of age were increased in the cell bodies (P = 0.0183) but were not significantly elevated in the striatum (P = 0.132) (Figure 6.3A). Mice aged 35 to 60 weeks, showed no change in TH levels, but striatal DAT levels were significantly reduced (P = 0.0396) (Figure 6.3B). Cumulatively, these results show that while there was a modest but significant increase in total TH protein levels in young mice, this was lost in adult mice despite a sustained increase in mRNA. The lack of increased TH in adult mice could be the result of a number of factors. Firstly, while TH mRNA was shown to be transcribed from the transgene and proportionally increased, there may not necessary be a proportional increase in protein production. While it can be true that mRNA is proportional to DNA copy number, and protein is proportional to mRNA, this is often not the case 576, 588-590. Secondly, there may be post-transcriptional impairment in the translation process that might limit protein production from mRNA derived from the BAC, or there may be a general increase in the regulation of translation. Therefore, it is possible that crude western blotting lacks the sensitivity to measure subtle increases in TH protein level. To address this concern, we used HPLC to assess striatal content of dopamine and its metabolites, to determine if the end-products of TH were increased.

Interestingly, while both the gene copy number and mRNA was increased, and while western blot detected no change in TH protein levels in the adult brain, we found a significant reduction in dopamine tissue content in the striatum of transgenic mice (Figure 6.4A). Among other things, decreased dopamine tissue content can coincide with (and be indicative of) cell loss 59, 369, 591. For example, previous studies have reported that adult DAT-Tg mice show a 33% reduction in striatal tissue content, coincident with a 36% loss of TH+ striatal neurons 369. In addition, the ratio of metabolites to dopamine was profoundly increased (Figure 6.4D, E). As previously discussed, an increase in the ratios of metabolite to dopamine can indicate conditions of oxidative stress. This is a particularly noteworthy observation as no differences in tissue content of dopamine or metabolites were detected in juvenile mice, nor were there differences in the metabolite to dopamine ratios (Figure 6.5A-E). Based on our tissue content data, it is possible that western blot did not reveal an increase in the total TH protein levels in adult TH-Y because there is a reduction in the total number of cells

147

Figure 6.3: Protein expression in juvenile mice (four weeks of age) and aged adults (35– 60 weeks). Protein expression patterns of tyrosine hydroxylase (TH) and the dopamine transporter (DAT) are shown, normalized to GAPDH. (A) Juvenile mice, midbrain, blot and densitometry. (wildtype, WT n=4; transgenic, TH-Y n=5). Optical density of TH in the midbrain of juvenile mice is shown to be significantly increased. (B) Juvenile mice, striatum, blot and densitometry. (WT n=4; TH-Y n=5). (C) Aged mice, midbrain, blot and densitometry. (WT n=5; TH-Y n=5). (C) Aged mice, striatum, blot and densitometry. (WT n=5; TH-Y n=5). Optical density of DAT, used as a marker of dopaminergic cells, is shown to be significantly decreased. (t-test, for all analyses: P ≤ 0.05, *) Mean+/-SEM.

148

Figure 6.4: Tissue content of dopamine and its metabolites in adult mice (8-12 weeks): Striatal content of (A) dopamine (wildtype, WT, n=27; transgenic, TH-Y, n=25) (B) 3,4-dihydroxyphenylacetic acid (DOPAC) (WT, n=26, TH-Y n=25) and (C) homovanillic acid (HVA) (WT, n=27, TH-Y n=25). The ratio of (D) DOPAC-to-dopamine (WT, n=26, TH-Y n=25) and (E) HVA-to-dopamine (WT, n=27, TH-Y n=25) is shown. Young adult transgenic mice showed a significant reduction in striatal dopamine levels and increased in the ratio of metabolites-to-dopamine. (t-test for all: P ≤ 0.01, **; P ≤ 0.001, ***) Mean+/-SEM.

149

Figure 6.5: Tissue content of dopamine and its metabolites in juvenile mice (four weeks): Striatal content of (A) dopamine (B) 3,4-dihydroxyphenylacetic acid (DOPAC) and (C) homovanillic acid (HVA) in wildtype (WT) and transgenic (TH-Y) mice. The ratio of (D) DOPAC-to-dopamine and (E) HVA-to-dopamine is shown. In contrast to striatal content of dopamine and metabolites measured in adult mice (see Figure 6.4), there is no significant difference between TH-Y and wildtype mice at 4 weeks of age. (WT n=10, TH-Y n=12, for all) Mean+/-SEM.

150 producing it (i.e. cell loss). While our data can be interpreted to support this hypothesis, the interpretation could not be confirmed by the tests reported here and require a more in-depth biochemical characterization and cell counts.

6.2 Behavioural Characterization of TH-Y Mice

We next examined the locomotor effects of amphetamine. Based on the mechanisms of amphetamine, an increase in dopamine production would be expected to yield increased locomotor activity. We therefore tested TH-Y mice both in juvenile mice, who were shown to have an increase in total TH protein, and in young adult mice, for which no change in total protein was detected. There was a significant effect of genotype detected both at 4 weeks of age (F1, 377 = 7.905, P = 0.015) and at 8–12 weeks of age (F1, 696 = 9.595, P = 0.0049). Shown in Figure 6.6A-C, the hyperactive response to amphetamine was indeed potentiated in juvenile mice, with Bonferroni post-hoc tests revealing a significant difference in the total distance travelled (90 minutes) at 3.0 mg/kg (P < 0.01). However, the behavioural response to the stimulant was attentuated in adult mice at the same dose (P < 0.01). This behavioural outcome is consistent with the reduction of striatal dopamine content of measured in TH-Y mice at 10-12 weeks of age, as reported in the previous section.

To measure potential abnormalities in cognitive functions, we assessed spatial memory and cognitive flexibility with the Y-maze and puzzle box, respectively. Mice carrying three copies of TH were shown to have a significantly diminished spontaneous alternation performance in the Y-maze, as compared to age-matched wildtype controls, suggesting impaired spatial memory (Figure 6.7A). In addition, genotype was a significant factor in performance in the puzzle box (F1,33 = 9.77, P = 0.0037); Bonferroni post-hoc tests further revealed that TH-Y mice took significantly longer to complete the plug challenge during trials 8 and 9 (Figure 6.7B, P < 0.01 for both). The demonstrated increase in latency to task completion suggests an impairment in executive functions, including problem solving and cognitive flexibility, in TH-Y mice.

Because striatal dopamine strongly contributes to motor functioning, we also assessed fine motor skills using the challenging beam traversal test. Transgenic mice demonstrated motor

151 impairment by increased foot slips (Figure 6.7C), with no significant change in the amount of time taken to traverse the beam and return to the home cage. Both the results of our cognitive and motor tests are consistent with a phenotype of dopaminergic dysfunction. Moreover, all behaviour outcomes reported in adult mice are consistent with biochemical measurements that showed reduced dopamine in adult TH-Y mice and, while far from conclusive, are in agreement with an interpretation of a cell loss.

152

Figure 6.6: Locomotor response to saline and amphetamine (2.0 mg/kg and 3.0 mg/kg) in juvenile (four weeks) and adult mice (10-12 weeks). (A) Total distance travelled by wildtype (WT) and transgenic (TH-Y) juvenile mice, shown in 5 minute epochs, 60 minutes prior to and 90 minutes following the injection of 3.0 mg/kg of amphetamine. Arrow depicts times of injection. (repeated-measures two-way ANOVA: effect of genotype, F1, 377 = 7.905, P = 0.0147; effect of treatment, F29, 377 = 29.99, P ≤ 0.0001; interaction, F29, 377 = 3.765, P ≤ 0.0001) (B) Total distance travelled by juvenile mice in 90 minutes following injection of

153

saline or amphetamine. (two-way ANOVA: effect of treatment, F2, 29 = 21.48, P ≤ 0.0001; interaction, F2, 29 = 3.422, P = 0.0463) (C) Stereotypic behaviour performed by juvenile mice in 90 minutes following injection of saline or amphetamine. (two-way ANOVA: effect of treatment, F2, 29 = 15.13, P ≤ 0.0001). (D) Total distance travelled by adult mice, shown in 5 minute epochs. (repeated-measures two-way ANOVA: effect of genotype: F1, 696 = 9.595, P = 0.0049; effect of treatment, F1, 696 = 38.89, P ≤ 0.0001; interaction, F1, 696 = 2.485, P ≤ 0.0001) (E) Total distance travelled by adult mice in 90 minutes following injection of saline or amphetamine. (two-way ANOVA: effect of genotype, F1, 45 = 4.271, P = 0.0445; effect of treatment, F2, 45 = 44.94, P ≤ 0.0001) (F) Stereotypic behaviour performed by adult mice in 90 minutes following injection of saline or amphetamine. (two-way ANOVA: effect of treatment, F2, 45 = 40.85, P ≤ 0.0001). (Juvenile: saline, WT n=3; TH-Y n=2; 2.0 and 3.0 mg/kg amphetamine, WT n=7, TH-Y n=8. Adult: saline, WT n=6; TH-Y n=5; 2.0 amphetamine, WT n=6, TH-Y n=8; 3.0 mg/kg amphetamine, WT n=13, TH-Y n=13). (Bonferroni post-hoc: P ≤ 0.05, *; P ≤ 0.01, **; P ≤ 0.001, ***). Mean+/-SEM.

154

Figure 6.7: Assessments of cognitive and motor impairment in adult transgenic mice (TH-Y): (A) Spontaneous alternation performance (SAP) in the Y-maze, as a percentage of total three-arm alternations, is significantly reduced in TH-Y mice (10-12 weeks) (wildtype, WT n=11, TH-Y n=10; t-test, P = 0.0333). (B) Latency to task completion in the puzzle box paradigm (WT n=18, TH-Y n=17) (repeated-measures two-way ANOVA: effect of genotype, F1,264 = 9.733, P = 0.0038; effect of trial, F8,264 = 28.10, P ≤ 0.0001; interaction, F8,264 = 2.691, P = 0.073). (C) Fine motor skills are significant impaired in TH-Y, demonstrated by the number of foot slips while completing challenging beam traversal task (WT n=13, TH-Y n=11; t-test, P = 0.0003). (t-test: P < 0.05, *; P < 0.01, **; P < 0.001, ***). Mean +/-SEM

155

Chapter 7 Discussion 7 Project One: N-Terminal Tagging of the Dopamine Transporter Impairs Protein Expression and Trafficking In Vivo

The dopamine transporter has been shown to exist as part of a protein complex, with binding partners regulating many aspects of its expression, trafficking and functioning (see Appendix 1). While several protein interactors have been identified over the past several decades, many binding partners were originally identified in vitro using heterologous cells, and so whether they represent physiological interactions in vivo remains unclear. Our aim was to create a tool for more accurate and efficient in vivo identification of DAT's binding partners by tagging the transporter and taking advantage of high affinity antibodies available for epitope tags. Using homologous recombination to modify a commerically avaiable DAT BAC, we successfully created transgenic mice expressing DAT tagged with a triple-HA epitope on its N-terminus. Our hypothesis was that the epitope would permit the identification of DAT's in vivo binding- partners through HA-mediated immunoprecipitation of striatal samples, followed by mass spectrometry. We chose to tag the N-terminus as several several studies have done so without reporting impairment to expression or functioning of the transporter 309, 311, 544, 545, 592. In doing so, we uncovered an as-of-yet unreported difference in the consequence of tagging the N- terminus in vivo vs in vitro, and revealed an important role of the terminus to the expression and trafficking of transporter.

The HA-tag is considered ideally suited for tagging proteins because of commercially available, high-affinity antibodies. N-terminally HA-tagged DAT has been successfully expressed in mammalian cells and has been used in several studies 309, 311, 544, 545, 592. Additionally, knock-in mice with an HA-tag in the second extracellular loop of DAT have also been generated as a tool for studying endogenous trafficking and subcellular localization of DAT 593, 594. Because of the success of these past models, we created transgenic mice possessing a triple HA-tag on the N-terminus of DAT. Using tissue from HAD-Tg mice, we

156 were able to successfully use immunoprecipitation to isolate HA-DAT from striatal homogenate using anti-HA conjugated agarose beads (results not shown). However, mass spectrometry revealed that despite successfully immunoprecipitating HA-DAT (detected by Western blot), levels of DAT peptide in the striatal homogenate were insufficient to identify binding partners in preliminary experiments (results not shown). We optimized our methods to enrich DAT in our samples, using a size exclusion column to specifically select fractions of the lysate containing the HA-protein before incubation with anti-HA beads; our motivation was to reduce the non-specific binding of contaminants to our anti-HA beads and to ensure a clean elution before proceeding to mass spectrometry. We also attempted to increase the purity of the lysate by reducing the preparation to the synaptic plasma membrane prior to separation by size exclusion, again taking only the fractions containing DAT for incubation with HA beads. Again, mass spectrometry did not detect DAT peptides (and, instead, showed that using the total membrane fraction was a preferrable preparation). These results led us to investigate why there were inadequate levels of the tagged protein to perform proteomic analyses despite the presence of HA-tagged DAT — readily detected by western blot and immunohistochemistry — that could be immunoprecipitated. While our experiments did not follow the course initally projected and we were unable to use HA-DAT trangenic mice for the study of DAT-binding partners, the tagging of the DAT instead revealed an important role for N-terminus for the translation, expression and trafficking of the transporter in vivo which had not previously been observed using heterologous cells. Through a series of methodical experiments, we demonstrated that N-terminal tagging of DAT hinders expression and interrupts trafficking in vivo, which lies in stark contrast to in vitro experiments in which N- terminal tagging was used without any such impairments.

The transgenic mice created for this study (HAD-Tg) had two integrated copies of the gene encoding HA-tagged DAT, inferred by the determination that they possessed four total DAT alleles (Figure 4.1A). However, we showed that despite a 50% increase in DAT mRNA (Figure 4.1B), there was no discernable increase in total DAT protein in the striatum or midbrain of the transgenic animals (Figure 4.3). After determining that the this observation was not a result of masked antibody binding to the N-terminus (to which our preferred antibody was selective), we sought to determine whether — in contrast to in vitro studies —

157 the expression of the transporter was interrupted by the presence of an N-terminal tag. Protein expression can be hampered for several reasons and so this observation may have several etiologies. Therefore, to evaluate the expression and functionality of HA-DAT, we crossed the HAD-Tg mice with DAT-KO mice to generate animals that exclusively express the tagged version of DAT. First, we showed that there is very limited expression of HA-DAT in the midbrain of HA-transgenic animals compared to the expression level of endogenous DAT in wildtype littermates, indicating that there may be an impairment in HA-DAT protein expression or an increase in protein degradation within the midbrain. However, the reduction of tagged DAT (relative to endogenous DAT) in the midbrain is less severe than the reduction that we observed in the striatum: 75% versus 90%, respectively. Therefore an impairment in expression alone cannot fully account for the reductions that we observe in the striatum, indicating that there is also a deficit in trafficking of the transporter from the midbrain to the striatum. Indeed, this would be consistent with our observations indicating that ratio of striatum-to-midbrain DAT protein levels is lower for the tagged DAT compared to the wildtype protein (Figure 4.9). An alternate explanation for reduced DAT levels in the striatum would be increased endocytosis and degradation of the transporter. Past studies have shown that the N-terminus of DAT contains domains that negatively regulate endocytosis 595. It is possible that insertion of the HA epitope in an in vivo setting masks these domains, resulting in reduced accumulation of DAT in the terminals. Taken together, our results show that N-terminal tagging of the DAT impairs both protein expression (either through enhanced degradation or reduced translation) as well as affecting trafficking of the protein.

We next assessed whether N-terminal tagging interfered with functionality in vivo, with results suggesting that the HA-DAT protein that is present is fully functional. First, uptake studies demonstrated 12% DAT activity in HA-DAT mice compared to wildtypes. Second, expression of the HA-DAT was able to partially rescue the hyperlocomotor phenotype of DAT-KO mice. Third, the behavioural response to amphetamine was more consistent with a 90% downregulation rather than a complete absence of DAT. Indeed, while amphetamine is a stimulant in wildtype mice, it reduced activity in mice expressing only HA-tagged DAT. A similar result was previously reported in DAT knockdown animals that only express 10% of wildtype levels 565. It is notable that the “calming” effect of amphetamine was more

158 substantial in DAT-KO mice than in animals only expressing HA-DAT, as this is indicative of the presence of some quantity of functional DAT in HA-tagged animals. Again this supports the conclusion that the N-terminal tag does not interfere with DAT function but instead affects protein levels and trafficking.

Our results can be considered in the context of several studies that have quantified behavioural phenotypes of mice with varying levels of DAT. For example, two different knockdown lines have been previously characterized: in one line, DAT levels are 35% 596, while in the other, DAT levels are 10% of wildtype 565. It has been shown that both knockdown lines display hyperactivity proportional to the extent of DAT knockdown. Importantly, knockdown animals that express 10% normal DAT levels display reduced activity in response to amphetamine, similar to what we observed in our HA-DAT line 565, 596. Behaviours of DAT knockdown animals are similar but less severe than what is observed in DAT knockout mice 34, 45, 565, 596. Furthermore, DAT heterozygous mice that express 50% of normal DAT levels have no basal hyperactivity and are stimulated rather than calmed with amphetamine treatment 190, 372, 544. The behavioural profile of our mice that only express HA- DAT (i.e., basal hyperactivity and amphetamine calming) mirrors DAT knockdown phenotypes rather than DAT heterozygotes.

Numerous in vitro studies have expressed N-terminal tagged DAT in heterologous cell systems, and in those studies DAT function appears to be unaffected by the tag. Our results agree, and also indicate that the tag does not impair the proton/dopamine exchange property of the DAT in vivo. However we do show that trafficking of an N-terminal tagged DAT from the midbrain to the striatum is impaired. This impaired trafficking may be the result of the epitope interrupting important protein-protein interactions that determine DAT localization in vivo. Indeed, the N-terminus of DAT is a site of phosphorylation, which is believed to play an important role in trafficking 317, 542, 543, 597. In addition, as previously mentioned, N-terminal residues have also been shown to negatively regulate DAT endocytosis 595. Furthermore, the amino terminus is a site of direct interaction between DAT with both Syntaxin 1A and RACK1 537, 598-600. The interaction with syntaxin — possibly, via the formation of a syntaxin- RACK1-DAT complex — has been suggested to mediate DAT trafficking through

159 modulation of DAT phosphorylation 537, 597. An interaction between syntaxin and DAT has also been demonstrated in dopamine neurons in C.elegans, where the addition of an N- terminal GFP to DAT both interrupted the syntaxin-DAT association and resulted in disruptions in thrashing behaviour. 598. Our study further supports the notion that the N- terminus is an important site for protein interactions, and that modification of this site disrupts DAT trafficking in vivo.

The C-terminus of DAT has also been shown to be important for trafficking. It contains a PDZ-binding sequence that interacts with the protein PICK1, which was originally proposed to be responsible for the export of DAT from the endoplasmic reticulum (ER) in heterologous cell lines 306, 310. However, a study that shortly followed demonstrated that while surface targeting of DAT does involve the C-terminus, the PDZ domain is neither necessary nor sufficient for DAT surface expression (in heterologous cells) 308. A recent study again presented results to the contrary, demonstrating that the PDZ-domain interactions are critical for membrane distribution of DAT on dopaminergic neurons: a mutant DAT protein with a disrupted PDZ-binding motif resulted in a 90% reduction of DAT in striatal terminals 601. Additionally, disrupting the PDZ-domain in these mutant mice resulted in an attenuated locomotor response to amphetamine, indicating profound loss of striatal DAT 601. However, while the C-terminal PDZ domain was shown to be involved in distribution of striatal DAT in vivo, PICK1 is not believed to be involved in this process, as PICK1 knockout mice were shown to have normal distribution of DAT in both the midbrain and striatum 601.

Our study provides the first evidence that the N-terminus of DAT is also involved in the expression of DAT in striatal terminals in mice. The lack of expression of HA-DAT cannot be explained by the site of insertion of the DAT BAC or improper transcription of the transgene, since a 50% increase in DAT mRNA was detected in HAD-Tg mice. Instead, our data suggests that tagging DAT on the N-terminus both hinders protein expression, particularly at neuronal terminals, and interrupts transport of DAT to terminals. To this point, we showed that the ratio of striatal-to-midbrain HA-DAT is reduced by up to 47% compared to the striatal-to-midbrain ratio of endogenous DAT, as demonstrated by both immunohistochemistry and western blot. The N-terminus of DAT has been previously linked

160 to amphetamine-induced efflux of dopamine 545 and has been identified as a site of phosphorylation 542, 597, 600, as well as a site of ubiquitination leading to transporter endocytosis 602. It is possible that the placement of the tag on the N-terminus interrupts protein interactions that are necessary for proper expression and trafficking in vivo, which may as of yet remain unidentified. Our study has provided foundational support for further investigation into the possible role of the N-terminus of DAT in the targeting and transport of DAT to neuronal terminals in vivo.

161

Chapter 8 Discussion

8 Project Two and Three: The Effect of Tyrosine Hydroxylase Overexpression On Biochemical and Behavioural Features of the Dopaminergic and Noradrenergic Systems

The neuropathology of Parkinson's disease is characterized both by the appearance of Lewy body/fibril inclusions and by the selective loss of monoamergic cells, including approximately 80% of dopaminergic cells in the nigrostriatal pathway and a comparable loss of noradrenergic cells in the locus coeruleus. The loss of these cells is behaviourally manifested by non-motor and motor symptoms, the latter not presenting until profound loss in the nigrostriatal dopamine pathway has already occurred. While neurodegeneration in other cell groups — such as serotonergic and cholinergic neurons — also occurs in both early and late stages of the disease, catecholamine cells within the substantia nigra and locus coeruleus remain most profoundly affected 48, 49. Oxidative stress and mitochondrial dysfunction are believed to be mechanistically involved in initiating neurodegeneration, yet why catecholamine cells are most vulnerable remains unclear. Tyrosine hydroxylase is the rate-limiting enzyme in the synthesis of all catecholamines, and is therefore a common characteristic of these cells; importantly, ROS are known to be produced by the TH system 55- 57. Interestingly, one on the main components of Lewy fibrils and bodies is alpha-synuclein, which has been shown to be capable of negatively regulating the phosphorylation — and thus, the activity — of TH both directly and indirectly 235, 277, 280, 282. Past models with mutated alpha-synuclein have shown increased levels of phosphorylated TH (in the absence of changes to total TH), oxidative stress, and neurodegeneration 277, 527, 528. We therefore hypothesized that increased levels of active TH could contribute to oxidative stress and exacerbate conditions that lead to cell death. Inadequate regulation of the activity of TH could, in principle, contribute to neurotoxicity in two ways: first, by directly contributing to the production of ROS, and second, by leading to an accumulation of cytosolic dopamine, which is known to be neurotoxic. Our study aimed to create a mouse model overexpressing

162

TH to evaluate the biochemical consequences in regions most affected in Parkinson's disease — the substantia nigra and striatum, and the locus coeruleus — as well as to assess level of oxidative stress. Moreover, we aimed to determine the behavioural characteristics that result from increasing TH levels.

To this end, we have developed a novel mouse line ("TH-HI") that possesses six total copies of the TH gene, with a commensurate threefold increase in both mRNA and total protein levels (demonstrated by qPCR and western blot respectively, Figure 5.2 and 5.3). Immunohistochemistry did not detect any ectopic expression surrounding catecholaminergic regions in slices of the midbrain, forebrain, or brainstem, suggesting that the expression of TH is limited to regions that endogenously express it (Figure 5.4). Importantly, the additional TH protein was also shown to be active: levels of phosphorylated TH were also increased threefold (Figure 5.5), and the accumulation of striatal L-DOPA after administration with NSD-1015 was twice the level of wildtype (Figure 5.6).

The increase in TH activity in the striatum was detected both in juvenile and adult mice. Interestingly, this corresponded to a measurable increase in striatal dopamine tissue levels in young mice but not in adults (Figure 5.8). One possible explanation might involve an increase in TH regulation to compensate for increased expression. However, we found no difference in regulatory protein levels, and given that L-DOPA accumulation remained twofold higher in adult mice, we feel that such an explanation is not supported. Furthermore, levels of dopamine's metabolites were dramatically elevated in both juvenile and adult mice, as was the metabolite-to-dopamine ratio, implying increased dopamine turnover. This is both a relevant and significant observation because increased dopamine turnover has been linked to conditions of oxidative stress 369, 461. Therefore, an alternative explanation might involve a reduction in the total number of cells expressing dopamine: although on a cell-by-cell level, there may be increased dopamine content, there may be no measurable change in total striatal content if fewer cells remain intact. Another explanation may involve increased degradation by MAO residing on the outer membrane of mitochondria in presynaptic cells. Both of these possibilities are worthy of further study.

163

Worth noting is that we saw a similar relationship between juvenile and adult tissue content in a second line of TH overexpressing mice ("TH-Tg"). In the TH-Tg line, we showed three total copies of the gene encoding TH protein and approximately 1.5x TH mRNA levels (Figure 6.1). While an increased in TH protein was detected in the midbrain of juvenile mice by western blot, this was no longer evident at 8 weeks or beyond. Importantly, these findings were mirrored in tissue content analyses. There was no difference in striatal dopamine tissue content at 4 weeks of age, nor was there changes in metabolite levels or the metabolite-to- dopamine ratio; however, at 8-12 weeks, there was a reduction in striatal dopamine content and an increase in the ratio of metabolites-to-dopamine (Figure 6.4 and 6.5, respectively). Again, while on an individual level, cells may contain more dopamine, a reduction in total striatal dopamine can reflect fewer dopaminergic cells. As past studies have linked reduced dopamine tissue content with cell loss, and correlated dopamine turnover to oxidative stress 59, 369, 446, 461, a loss of dopaminergic cells in TH-Tg mice could offer an explanation for both the reduced tissue content and the lack of a detectable increase in total TH protein in adult mice — despite an increase in mRNA measured at the same time point. While performance on motor and non-motor behavioural tasks corroborated dysfunction in the dopaminergic and/or noradrenergic system, quantifications of cell numbers was beyond the scope of the study. (Note: Preliminary stereological counts were performed for both the TH-Tg and TH- HI lines [results not shown], but significant technical difficulties prevented us from pursuing the experiments further.) Nonetheless, an important observation is that tissue content analyses in TH-Tg mice corroborate findings in TH-HI mice: there was an age-related reduction in striatal dopamine content in transgenic mice, compared to wildtypes, in both lines. Therefore, it is possible that the apparent "loss" of increased tissue content in adult TH- HI mice, reflects the same cellular mechanisms as those responsible for the significant reduction in TH-Tg mice. This is not only a significant finding, but it also supports the integrity of both the overexpressing lines presented here.

As striatal tissue content of metabolites was significantly higher in TH-HI mice at both time points, we next aimed to evaluate the potential increase in oxidative stress. We hypothesized that increased expression of TH would result in increased enzymatic activity, and that this would be accompanied by an increased in oxidative stress — owing both to an increase in

164

ROS produced by the TH system itself, and by a potential increase in cytosolic dopamine. Importantly, we did not see an increase in VMAT2 expression in the striatum in juvenile or adult mice. Therefore, although more dopamine may be produced, it is handled and sequestered by wildtype levels of vesicular transporters (Figure 5.10). This may not be deleterious to the cell if wildtype levels of VMAT2 are capable of handling an increase in catecholamine production. However, if the rate of synthesis is beyond the rate at which the catecholamines can be sequestered, it is possible that they may linger in cytosol longer and be at increased risk for autoxidation 603. We showed that glutathione was significantly reduced in striatal tissue, consistent with a hypothesis of increased intracellular ROS (particularly,

H2O2). Reduced levels of total glutathione have been found in both animal models exhibiting oxidative stress and in post-mortem analyses of the substantia nigra from Parkinson's patients 59, 452. Past studies have also shown that in striatal tissue, reduced glutathione correlated to an increase in Cys-DA and Cys-DOPAC 59.

Mice that produce six copies of the gene encoding TH also have a potentiated response to amphetamine both at 4 and 12 weeks of age. As previously mentioned, amphetamine is often used to test dopaminergic circuitry by assessing the drug's known influence on locomotor activity. Because of structural similarities with monoamines, amphetamines can gain access to the intracellular space through protein transporters such as DAT, as well as NET and SERT. Once in the cell, amphetamines acts at the vesicles containing dopamine and redistributes vesicular contents to the cytoplasm by dissipating normal proton gradients at VMAT2. Amphetamine also directly acts on DAT, and reverses the direction of dopamine transport through DAT, leading to efflux into the extracellular space 37, 38, 185. It is therefore somewhat surprising to see such a profound potentiation of amphetamine-induced hyperactivity in adult TH-HI mice given that measures of tissue content revealed no increase in dopamine over age-matched wildtype mice. Among the potential explanations, changes in the surface expression or sensitivity of postsynaptic D1 and D2 dopamine receptors may account for this difference. If denervation of the striatum is responsible for the loss of any increase in tissue content of dopamine over wildtype mice, then it is possible that there are compensatory changes in postsynaptic D1 and/or D2 dopamine receptors. A second explanation might include a change in vesicles docked and ready for release in transgenic mice as compared to wildtype mice. Protein 14-3-3 has been linked to vesicular docking and

165 exocytosis 243, 256; up- or downregulation of 14-3-3 may therefore affect the amount of dopamine in the extracellular space in response to stimulated release. While we have shown that total striatal levels of 14-3-3 are unchanged as compared to wildtype littermates, it is possible that 14-3-3 at the synaptic plasma membrane fraction is altered. Currently, we are in the process of evaluating both of these possibilities (preliminary results not shown).

As there was a clear overexpression of active TH in both young and adult TH-HI mice but an absence of increased tissue content in the latter cohort (Figure 5.3 and 5.8, respectively), we evaluated the behavioural characteristics of the adult mice. First, we assessed motor abnormalities by performance on the challenging beam, a sensitive motor test appropriate for animal models with alterations affecting the nigrostriatal dopamine system 574. While activity in an open field and the rotarod test are more commonly used and automated, these paradigms lack the sensitivity to detect more subtle aberrations in dopaminergic functioning 574, 591. This has been demonstrated by DJ-1 and parkin-deficient mice, which have demonstrated impairments on the challenging beam, when no impairment was detected on the rotarod 604-606. The challenging beam has also been used to demonstrate motor deficits in mice with alpha-synuclein mutations, and to elucidate the involvement of noradrenaline in modulating motor phenotypes 128, 487, 573. We did not observe any significant increase in the number of foot slips during the traversal of the challenging beam in adult TH-HI, which is consistent with no difference in dopamine tissue content. In addition, we did not see a significant difference in sensory motor gating, as evaluated by pre-pulse inhibition. However, we did see a significant impairment in spatial memory, determined by spontaneous alternations performance in the Y-maze, and a significant impairment in cognitive flexibility, shown by an increased latency to overcome new obstacles presented in the puzzle box. Impairment in non-motor functioning prior to the onset of motor deficits is not only consistent with the progression of Parkinson's disease in humans but with several Parkinson's mouse models as well 48, 49, 488, some of which never demonstrate motor abnormalities. We next evaluated anxiety behaviour. In highly aversive conditions, we did not detect a change in the time spent in, or visits, to the open arm of the elevated plus maze; however, we saw a significant increase in time and visit to the open arm in dim lighting, suggesting a reduction of anxiety in mildly aversive conditions.

166

Taken together, our behavioural data does not indicate a difference between the performance of adult TH-HI and wildtype mice on motor tests, tests that assess behaviours predominantly under dopaminergic control. In contrast, TH-HI mice did show non-motor alterations. Cognition and anxiety are complex, and can be influenced by a number of neurotransmitter systems. The noradrenergic system exerts profound influences on cognition via ascending projections to the forebrain, mostly originating from the locus coeruleus; this includes influences on attention, working memory, executive functions and cognitive flexibility, response inhibition and emotional memory 586, 587, 607. This is consistent with the locus coeruleus as a hub of connectivity in the small world architecture of the brain. Numerous studies have pointed to the prodromal degeneration of noradrenergic cells in the locus coeruleus as the source of — and possibly, a therapeutic target of — cognitive symptoms in Parkinson's disease 586, 587, age-related dementia 607, 608, and Alzheimer's disease 585. Furthermore, noradrenaline has also been linked to measures of anxiety 609-611. Experimentally, dopamine β-hydroxylase knockout mice completely lacking noradrenaline had normal baseline performance in the elevated plus maze but were entirely resistant to the anxiogenic effects of cocaine 611. Indeed, while motor symptoms of Parkinson's disease have long been managed by focusing on dopamine-replacement therapy, non-motor systems (including those affecting mood and cognition) continued unabated by dopamine treatment 587. For this reason, it is unsurprising that TH-HI mice should demonstrate mild cognitive impairment where no motor impairment was detected. In reality, many symptoms — especially non-motor symptoms — may not be wholly under the influence of one monoamine or another, but may be synergistically controlled by dopamine, noradrenaline and serotonin 612. Therefore, abnormalities in cognitive functions, as well as differences in mood or stress- related behaviours, may reflect changes in the noradrenergic system in TH-HI.

It remains worth noting that our original three-copy line, TH-Tg, showed significant motor and non-motor impairment that complimented results yielded by TH-HI mice. In TH-Tg, motor impairment was manifested and measured as a significant increase in errors (i.e. foot slips) during traversal of the challenging beam. As TH-Tg mice showed a significant reduction in striatal dopamine tissue content as compared to wildtype mice, it is reasonable

167 that motor impairment would be found in these mice although it is not detected in the high- copy line (ie. TH-HI). Additionally, like TH-HI mice, TH-Tg mice demonstrated impairments in problem solving in the puzzle box and spatial memory in the Y-maze. We feel it important to report the phenotype of the TH-Tg mice, and to highlight the strong similarities to TH-HI mice in both biochemical and behavioural characteristics. We acknowledge the potential challenges that come with an unintentional sex-linked transgene. First, it is possible that integration on the Y-chromosome may cause some undesired genetic disruptions. However, this is a possibility regardless of what chromosome a transgene integrates on. In the absence of sequencing the genome, this possibility remains in any transgenic mouse model that is created by inserting DNA. Another criticism of a Y-linked is that all tests will be specific to males, and thus result may not necessarily accurately extrapolate to females. While we cannot speak to the consequences of male-only subjects in our biochemical analyses, it is not uncommon to exclusively use males when conducting behavioural tests (although we agree that male-only behavioural tests are not ideal in most research, and should be avoided wherever possible). We feel that the most relevant issue is that a Y-linked transgene precludes using littermates as controls, a pairing that minimizes both genetic and environmental differences between groups. We sought to mitigate potential confounds by selecting controls that were pure C57B6 mice as these represent the strain on which the transgenic line was bred, thereby minimizing the potential for genetic differences in the absence of littermates controls.

To our knowledge, one past study has attempted to overproduce [human] tyrosine hydroxylase in transgenic mice. In the study by Kaneda and colleagues (1991) 553, transgene mice carried multiple copies of the human TH gene (under the control of the human TH promotor), which corresponded to mRNA expression in the brain and adrenal gland that was 50-fold higher than endogenous murine TH mRNA. For the purposes of this discussion, we will call these mice "HUM-TH" mice. While not quantified, immunohistochemistry revealed increased TH immunoreactivity in the substantial nigra and VTA, but TH protein levels were not elevated to the extent that might be expected based on mRNA levels. In addition, ectopic staining was noted in a number of brain regions. Protein levels were assessed at five months of age, and were shown to be elevated 1.9–2.4x in the brain, and 1.5x in the adrenal medulla.

168

Yet although TH activity levels were shown to be elevated — two- to fivefold in the brain — there was no significant change in tissue catecholamine levels. Furthermore, HUM-TH mice did not exhibit any phenotypic or behavioural abnormalities (although authors did not report which behavioural tests were performed). In contrast, our TH-HI mice not only have protein overexpression commensurate with gene expression, but increased dopamine content in juvenile mice, and increased dopamine turnover at all ages measures. Moreover, TH-HI mice have significant behavioural alterations, as do TH-Tg mice. There are several important differences between the construction of HUM-TH mouse and the TH overexpressors presented in our study. First, as noted, the mice constructed by Kaneda and colleagues expressed human TH. Although human and mouse TH share homology over 85% of coding regions 553, it is difficult to determine if this affected the amount of functional protein expression achieved (even with expression of human TH mRNA being 50-fold that of endogous mRNA). Second, the DNA fragment inserted used was only 11 kb, with 2.5 kb of 5' upstream region and 0.5 kb of the 3' flanking region; in contrast, our BAC was a total of 200 kb, with approximately 90 kb of genomic DNA both up– and downstream to the gene loci. As the regulatory sequences of the TH gene are still unclear, it is possible that the small gene fragment used to create the HUM-TH mice was insufficient to contain all required regulatory sequences. Indeed, to explain ectopic expression, authors suggest that the inserted DNA did not carry the important (yet unidentified) regulatory cis element(s) responsible for strict region-specific and developmental stage-specific expression. They suggest that the lack of increased dopamine content could be explained if other co-factors, such as BH4 were insufficient and therefore functioned as a rate-limiting factor; however, there is inadequate evidence in past literature to support this explanation. Other explanations provided by the authors include regulation of catecholamine synthesis through phosphorylation and augmented dopamine turnover. We find the latter point most compelling, although authors of this study did not measured levels of metabolites. Nonetheless, it is worth noting that the lack of detectable difference in dopamine tissue content (despite an increase in TH activity) is in agreement with our reported results. It is therefore conceivable that had authors been interested in oxidative stress, it would have been detected in the HUM-TH mouse line. In addition, it is possible that an overproduction of TH may have been detected in HUM-TH mice at an earlier time point, but as in our mice, not when measuring total TH levels in adult

169 mice. However, as reported, HUM-TH mice did not exhibit any phenotypic or behavioural changes that might suggest dysfunction within any of the catecholaminergic systems. It is not possible to determine from the reported results whether there was, indeed, no overproduction in HUM-TH mice — possibly due to the methods used in their development — or if there is an alternative explanatation for their findings. Hence our study represents the first successful report of generating transgenic animals that overexpress functional TH.

It is important to note that TH is within all catecholamine cells and yet neurodegeneration in Parkinson's disease is selective, with many catecholamine groups remaining relatively spared. For example, as Parkinson's disease progresses, degeneration of the substantia nigra is severe whereas cells within the neighbouring VTA are relatively intact 48, 49. A study by Maingay et al. (2006) suggests that the selective susceptibility of nigral dopaminergic neurons, as compared to VTA neurons, may be in part related to unique factors involved in the handling of alpha-synuclein which differ from VTA neurons 613. While targeted in vivo gene transfer of human alpha-synuclein led to detectable overexpression and protein aggregation in both the VTA and substantia nigra, 50-60% of nigrostriatal neurons were lost within 5–8 weeks while no neuronal death was detected in the VTA, even 14 weeks post-transduction 613. (Although overexpression of alpha-synuclein in VTA does not induce cell death, it was however shown to be associated with functional impairment). This study is important because it highlights the molecular and electrophysiological heterogenity between groups of dopamine cells, determinants that likely underlie selective cell loss 48, 49. Amongst other factors, the differences between dopamine groups include transcriptional factors, the relative reliance on dihydropyridine-sensitive (L-type) Ca2+ channels (substantia nigra) versus voltage-dependent sodium channels (VTA), Ca2+ handling, and mitochondria and metabolic (energy) demands 613, 614. Another study has shown that cultured midbrain neurons incubated with L-DOPA resulted in two- to threefold higher cytosolic dopamine in substantia nigra neurons than VTA neurons, pointing to dopamine mishandling as a cause of greater suceptibility 615. In addition, DAT levels are increased and VMAT levels are decreased in the substantia nigra neurons relative to the VTA, which could render them more vulnerable to intracellular dopamine-mediated toxicity 520, 613, 616-618. If selective groups of dopamine neurons are more susceptible to pathological aggregation of alpha-synuclein and dopamine

170 mishandling, it is possible that these same neurons may be more vulnerable to additional stress caused by TH dysregulation. The same may be true of cells residing in the locus coeruleus, although equal efforts have not been put towards elucidating the potential vulnerability factors studying these neurons. While all catecholamine cells would be subject to increased levels of ROS when TH is dysregulated, it is possible that some groups are better able to handle an increase in oxidative stress. In cells with pre-existing vulnerabilities or demands, it may be one of many additive factors that can eventually overwhelm the cell's internal defense system. Identifying what factors might mechanistically contribute to stressful conditions is important because each, in principle, may represent a therapeutic target that might stop or slow pathological progression. Results from our studies are significant because they are the first to show that increased TH activity in vivo can have both biochemical and behavioural consequences on catecholamine systems.

We have produced novel transgenic mice overexpressing the TH gene and for the first time, shown successful protein production commensurate with gene expression in both the central and peripheral nervous system, corresponding to a significant increase in TH activity. We showed increased tissue content of dopamine in juvenile TH-HI mice, as compared to littermate controls, and a profound increase in dopamine turnover in both juvenile and adult mice. Importantly, this model has shown that the increased dopamine turnover, resulting from elevated TH activity, is accompanied by a reduction in glutathione, a marker of oxidative stress in vivo. In addition, these mice have abnormal behavioural phenotypes, with some features that resemble parkinsonian symptoms. Past studies have shown that mutated alpha- synuclein results in increased levels of phosphorylated TH, increased dopamine content, and increased oxidative stress; importantly, this was accompanied by neurodegeneration 527, 528. Our results are a significant contribution because by overexpressing TH, they directly show that increased TH activity can lead to aberrant biochemical and behavioural phenotypes, as well as a decrease in striatal glutathione, a marker of oxidative stress. In principle, this might occur in nature due to a loss of adequate regulation. This has important implications for the field of Parkinson's disease, since a core symptom is aggregation of alpha-synuclein, a protein known to directly and indirectly regulate TH activity. While we do not postulate that TH regulation is a leading mechanism in the pathology of Parkinson's disease, we do suggest

171 that it is capable of contributing to the accumulation of ROS and therefore, the mechanisms underlying cell death.

172

Chapter 9 Concluding Remarks and Future Directions

Catecholamines control a variety of important daily functions. Their presence in the brain is a balance between proper synthesis and sequestration into vesicles, release, and degradation and clearance from the extracellular space; a disruption of any one of these processes can have profound biochemical and behavioural consequences.

The removal of dopamine from the extracellular space is achieved through both degradation of the transmitter and through its recycling, which is accomplished by the transporter proteins that take it back into the presynapic neurons and repackage it into vesicles. Dopamine transporters are the primary proteins responsible for that uptake; importantly, their expression, localization and function are regulated through interactions with a number of other intracellular proteins. The first study discussed in this thesis aimed to develop a high- affinity tool for immunoprecipitation and mass spectrometry of DAT, with the goal of confirming and/or identifying binding partners of the transporter proteome in vivo. While there are many proteins known to interact with DAT, many of those binding partners were identified using heterologous cell lines. More recently, studies have used homogenized tissue samples for immunoprecipitation. However, one notable limitation of immunoprecipitation and pull-down assays is the potential for non-specific binding, which can cause artefacts and false positives. Therefore, we aimed to design a system which would allow us to take advantage of high affinity antibodies for HA epitopes, in an effort to minimize non-specific binding and limit artifacts. Although an amino-end tag has not disrupted trafficking of the transporter in vitro, we showed that N-terminal tagging of the transporter dramatically impairs expression in vivo and impairs trafficking to neuronal terminals. It is possible that the placement of the tag interrupts protein interactions responsible for expression and targeting in vivo. A first step in testing this hypothesis may involve immunoprecipitating HA-DAT and probing for known interactors. However, a simple pull-down experiment may not be sufficient to answer such a question. Should all the known interactors be revealed at levels comparable to wildtype, such a result would not preclude the possibility that an N-terminal

173 tag interrupts an interaction relevant to trafficking in vivo which has not yet been identified by in vitro studies. Importantly, Rao et al. (2012) showed that the introduction of HA tag into the second extracellular loop of mouse DAT did not disrupt its expression level in vivo, alter distribution pattern, or perturb substrate uptake kinetics in transgenic mice 593. Future experiments may therefore attempt alternative placements of the HA tag. Since it is clear that any tag has the potential to disrupt interactions, it would be prudent to conduct side-by-side experiments using multiple placements. Such a design would both limit the potential of excluding partners by prohibiting binding, and would confirm binding partners identified by looking for those proteins pulled down with all placements.

Our next study examined the consequences of increased TH activity by creating novel transgenic mice overexpressing the TH gene. As TH is the rate-limiting enzyme in the synthesis of catecholamines, an overproduction may lead to increased cytosolic catecholamines. Past studies have shown that increased cytosolic dopamine results in oxidative stress in postsynaptic cells engineered to take up dopamine 59. Moreover, cells that take up more dopamine are more susceptible to neurotoxicity and cell death 369. Accumulation of cytosolic dopamine may also underlie the selective degeneration of certain groups of dopaminergic cells, such as substantia nigra neurons as compared to those in the VTA; studies have shown that L-DOPA induced accumulation is 2-3x higher in the substantia nigra than the VTA, and this response is dependent on voltage-gated L-type Ca2+ channels 615. In addition, transgenic mice that lack the machinery to sequester dopamine, VMAT2-kd, show increased oxidative oxidative stress and cell loss in several vulnerable catecholaminergic regions, including the substantia nigra and locus coeruleus 390, 391, 461. Indeed, inadequacies in the ability of cells to sequester catecholamines has been implicated in Parkinson's disease: a post-mortem study examining the brain of patients with Parkinson's disease found a 53 and 55% reduction in dopamine uptake per VMAT2 site in the caudate and putamen of the striatum, respectively 619. As the accumulation of cytosolic dopamine alone is sufficient to trigger oxidative stress and a neurodegenerative cascade in vivo, the findings of our study were significant in that they identified TH as a factor that can contribute to catecholamine inbalances that might, in turn, overwhelm a cell's internal defense mechanisms. We hypothesized that increased TH activity is capable of contributing to the

174 conditions that underlie oxidative stress in the most vulnerable cell groups lost to Parkinson's disease, both by contributing to the accumulation of cytosolic catecholamines and/or by the production of ROS.

To conclude, we are the first to make transgenic mice confirmed to overexpress TH. In addition, in support of our hypothesis, we have demonstrated that mice overexpressing TH have biochemical consequences consistent with significant disruptions in catecholamine homeostasis, as well as behavioural phenotypes that resemble early parkinsonsian symptoms. One major limitation of our study is that we were unable to perform stereological counts, linking increased oxidative stress to cell loss. While preliminary counts were performed, technical issues arose because traditionally, co-expression of TH with NeuN is used as a marker of dopaminergic neurons. Therefore, staining could not be optimized for accurate readings of both transgenic and wildtype mice because one of the markers was TH. It is possible that alternative, catecholamine-specific markers could be optimized for stereological counts in future experiments. Indeed, many future experiments might be performed using both TH-HI and TH-Tg mice. First, to assess the degree to which TH overexpression can lead specifically to increased cytosolic catecholamines, neuromelanin can be visualized. Neuromelanin synthesis is believed to be upregulated as an antioxidant mechanism, serving to trap cytosolic quinones and semiquinones in lysosome-associated organelles so that they are no longer reactive with cytosolic components 603. Past studies have shown that incubation of substantia nigra cultured neurons with L-DOPA results in the expression of neuromelanin 603. As neuromelanin is difficult to detect under normal conditions, its detection can be indicative of increased cytosolic dopamine. In addition, future experiments could assess biochemical and behavioural changes in aged cohorts (12, 18, and 24 months); many behavioural and cellular changes were progressively observed in other murine models, including VMAT2-kd, with some abnormalities only apparent in older adults 390, 391, 461. Next, the noradrenergic system should be more fully characterized. This would include both tissue content analyses in the locus coeruleus (noradrenaline and metabolites), as well as assessments of oxidative stress. In compliment to these studies, a more in-depth analysis of non-motor symptoms would be valuable. In particular, sleep analyses would be worth pursuing in light of the early degeneration seen in the reticular activating system and locus

175 coeruleus in Parkinson's disease patients. Finally, a number of rescue experiments could be performed using TH-HI and TH-Tg mice. This might include a genetic cross with mice over- producing VMAT2 (VMAT2-Tg), which may aid in the sequestering of any excess cystolic catecholamines that might result from overproduction 92. An antioxidant-rich diet might also be provided at the time of weaning to determine if any rescue might be potentiated, with a comparison drawn between wildtype mice, TH-HI mice, and TH-HI/VMAT2-Tg mice. Support for the benefits of an antioxidant rich diet comes from past literature: a diet of lipoic acid has been shown to be protective against oxdative stress in a mouse model of Alzheimer's disease, while dietary supplementation of nutritionally-enriched biscuits (with vitamins C and E, zinc, selenium, and beta-carotenes) improves function and reduces oxidative stress in prematurely aging mice 620, 621. Another rescue experiment might involve a chronic regimen of a TH-inhibitor, alpha-methyl-p-tyrosine (AMPT), which competes with tyrosine for the active site of TH. In human patients living with pheochromocytoma — a neuroendocrine tumor of the adrenal medulla, resulting in excessive secretion of catecholamines — AMPT doses of 600 to 4,000 mg per day causes a 20 to 79% reduction in total catecholamine production (dose-dependent) 622. Interestingly, in rats, acute depletion of dopamine caused by injections of AMPT (two injections, four hours apart,150 mg/kg) was correlated with increased dopamine uptake by VMAT2: the magnitude of dopamine depletion was inversely correlated with the degree of increase in vesicular uptake 623. In mice, chronic administration of 100 mg/kg (every three days) resulted in a partial dopamine depletion in wildtype mice 624. It is possible that a similar dose administered to TH-HI and TH-Tg mice would prevent accumulation of cytosolic catecholamines by partially inhibiting synthesis and possibly, by increasing uptake by VMAT2. In addition, AMPT treatment may limit ROS production by the TH system, thereby rescuing conditions of oxidative stress, and normalizing biochemical and behavioural phenotypes. Such a study would be valuable as it would show, proof-of- priniciple, that limiting ROS produced by therapeutically controlling over-active TH can mitigate oxidative stress.

In sum, we have successfully generated the first transgenic mouse line overexpressing functional TH in dopaminergic and noradrenergic neurons, confirmed by increased total and phosphorylated TH levels, and increased L-DOPA production. These animals display interesting biochemical changes that included increased striatal dopamine tissue in juvenile

176 mice but not in adults, which was accompanied by increased dopamine turnover at all ages. We detected a decrease in glutathione, a marker of increased levels of oxidative stress. Biochemical changes were accompanied by behavioural alterations such as impaired working memory and executive function. Future studies on these animals will further elucidated the physiological consequences of TH overexpression, and the mechanisms that lead to them.

177

References

1. Armstrong, D.M., Ross, C.A., Pickel, V.M., Joh, T.H. & Reis, D.J. Distribution of dopamine-, noradrenaline-, and adrenaline-containing cell bodies in the rat medulla oblongata: demonstrated by the immunocytochemical localization of catecholamine biosynthetic enzymes. J Comp Neurol 212, 173-87 (1982).

2. Antelman, S.M. & Caggiula, A.R. Norepinephrine-dopamine interactions and behavior. Science 195, 646-53 (1977).

3. Bromberg-Martin, E.S., Matsumoto, M. & Hikosaka, O. Dopamine in motivational control: rewarding, aversive, and alerting. Neuron 68, 815-34 (2010).

4. Tank, A.W. & Lee Wong, D. Peripheral and central effects of circulating catecholamines. Compr Physiol 5, 1-15 (2015).

5. Tye, K.M. et al. Dopamine neurons modulate neural encoding and expression of depression-related behaviour. Nature 493, 537-41 (2013).

6. Brooks, D.J. & Piccini, P. Imaging in Parkinson's disease: the role of monoamines in behavior. Biol Psychiatry 59, 908-18 (2006).

7. Jankovic, J. & Aguilar, L.G. Current approaches to the treatment of Parkinson's disease. Neuropsychiatr Dis Treat 4, 743-57 (2008).

8. Badgaiyan, R.D., Sinha, S., Sajjad, M. & Wack, D.S. Attenuated Tonic and Enhanced Phasic Release of Dopamine in Attention Deficit Hyperactivity Disorder. PLoS One 10, e0137326 (2015).

9. Badgaiyan, R.D. & Wack, D. Evidence of dopaminergic processing of executive inhibition. PLoS One 6, e28075 (2011).

10. Brisch, R. et al. The role of dopamine in schizophrenia from a neurobiological and evolutionary perspective: old fashioned, but still in vogue. Front Psychiatry 5, 47 (2014).

11. Carlsson, A. et al. Interactions between monoamines, glutamate, and GABA in schizophrenia: new evidence. Annu Rev Pharmacol Toxicol 41, 237-60 (2001).

12. Chen, J., Fang, Y., Kemp, D.E., Calabrese, J.R. & Gao, K. Switching to hypomania and mania: differential neurochemical, neuropsychological, and pharmacologic triggers and their mechanisms. Curr Psychiatry Rep 12, 512-21 (2010).

13. Elhwuegi, A.S. Central monoamines and their role in major depression. Prog Neuropsychopharmacol Biol Psychiatry 28, 435-51 (2004).

178

14. Jukic, M.M. et al. Abnormal development of monoaminergic neurons is implicated in mood fluctuations and bipolar disorder. Neuropsychopharmacology 40, 839-48 (2015).

15. Brewer, J.A. & Potenza, M.N. The neurobiology and genetics of impulse control disorders: relationships to drug addictions. Biochem Pharmacol 75, 63-75 (2008).

16. Volkow, N.D., Fowler, J.S., Wang, G.J. & Swanson, J.M. Dopamine in drug abuse and addiction: results from imaging studies and treatment implications. Mol Psychiatry 9, 557-69 (2004).

17. El-Guebaly, N., Mudry, T., Zohar, J., Tavares, H. & Potenza, M.N. Compulsive features in behavioural addictions: the case of pathological gambling. Addiction.

18. Kurian, M.A., Gissen, P., Smith, M., Heales, S., Jr. & Clayton, P.T. The monoamine neurotransmitter disorders: an expanding range of neurological syndromes. Lancet Neurol 10, 721-33 (2011).

19. Ng, J., Papandreou, A., Heales, S.J. & Kurian, M.A. Monoamine neurotransmitter disorders--clinical advances and future perspectives. Nat Rev Neurol 11, 567-84 (2015).

20. Elsworth, J.D. & Roth, R.H. Dopamine synthesis, uptake, metabolism, and receptors: relevance to gene therapy of Parkinson's disease. Exp Neurol 144, 4-9 (1997).

21. Nelson, N. The family of Na+/Cl- neurotransmitter transporters. J Neurochem 71, 1785-803 (1998).

22. Torres, G.E., Gainetdinov, R.R. & Caron, M.G. Plasma membrane monoamine transporters: structure, regulation and function. Nat Rev Neurosci 4, 13-25 (2003).

23. Hoffman, B.J., Hansson, S.R., Mezey, E. & Palkovits, M. Localization and dynamic regulation of biogenic amine transporters in the mammalian central nervous system. Front Neuroendocrinol 19, 187-231 (1998).

24. Peter, D. et al. Differential expression of two vesicular monoamine transporters. J Neurosci 15, 6179-88 (1995).

25. Patel, J., Mooslehner, K.A., Chan, P.M., Emson, P.C. & Stamford, J.A. Presynaptic control of striatal dopamine neurotransmission in adult vesicular monoamine transporter 2 (VMAT2) mutant mice. J Neurochem 85, 898-910 (2003).

26. Erickson, J.D., Schafer, M.K., Bonner, T.I., Eiden, L.E. & Weihe, E. Distinct pharmacological properties and distribution in neurons and endocrine cells of two isoforms of the human vesicular monoamine transporter. Proc Natl Acad Sci U S A 93, 5166-71 (1996).

179

27. Amsterdam, J.D., Newberg, A.B., Soeller, I. & Shults, J. Greater striatal dopamine transporter density may be associated with major depressive episode. J Affect Disord.

28. Cook, E.H., Jr. et al. Association of attention-deficit disorder and the dopamine transporter gene. Am J Hum Genet 56, 993-8 (1995).

29. Earley, C.J. et al. The dopamine transporter is decreased in the striatum of subjects with restless legs syndrome. Sleep 34, 341-7.

30. Shinohara, M. et al. Eating disorders with binge-eating behaviour are associated with the s allele of the 3'-UTR VNTR polymorphism of the dopamine transporter gene. J Psychiatry Neurosci 29, 134-7 (2004).

31. Chen, C.K. et al. The dopamine transporter gene is associated with attention deficit hyperactivity disorder in a Taiwanese sample. Mol Psychiatry 8, 393-6 (2003).

32. Smith, K.M., Xie, S.X. & Weintraub, D. Incident impulse control disorder symptoms and dopamine transporter imaging in Parkinson disease. J Neurol Neurosurg Psychiatry (2015).

33. Vriend, C. et al. Reduced dopamine transporter binding predates impulse control disorders in Parkinson's disease. Mov Disord 29, 904-11 (2014).

34. Giros, B., Jaber, M., Jones, S.R., Wightman, R.M. & Caron, M.G. Hyperlocomotion and indifference to cocaine and amphetamine in mice lacking the dopamine transporter. Nature 379, 606-12 (1996).

35. Ritz, M.C., Lamb, R.J., Goldberg, S.R. & Kuhar, M.J. Cocaine receptors on dopamine transporters are related to self-administration of cocaine. Science 237, 1219-23 (1987).

36. Jones, S.R., Gainetdinov, R.R., Wightman, R.M. & Caron, M.G. Mechanisms of amphetamine action revealed in mice lacking the dopamine transporter. J Neurosci 18, 1979-86 (1998).

37. Salahpour, A. et al. Increased amphetamine-induced hyperactivity and reward in mice overexpressing the dopamine transporter. Proc Natl Acad Sci U S A 105, 4405-10 (2008).

38. Sulzer, D. et al. Amphetamine redistributes dopamine from synaptic vesicles to the cytosol and promotes reverse transport. J Neurosci 15, 4102-8 (1995).

39. Cagniard, B., Sotnikova, T.D., Gainetdinov, R.R. & Zhuang, X. The dopamine transporter expression level differentially affects responses to cocaine and amphetamine. J Neurogenet 28, 112-21 (2014).

40. Tilley, M.R., O'Neill, B., Han, D.D. & Gu, H.H. Cocaine does not produce reward in absence of dopamine transporter inhibition. Neuroreport 20, 9-12 (2009).

180

41. Jones, S.R. et al. Profound neuronal plasticity in response to inactivation of the dopamine transporter. Proc Natl Acad Sci U S A 95, 4029-34 (1998).

42. Salvatore, M.F., Calipari, E.S. & Jones, S.R. Regulation of tyrosine hydroxylase expression and phosphorylation in dopamine transporter-deficient mice. ACS Chem Neurosci (2016).

43. Gainetdinov, R.R. Dopamine transporter mutant mice in experimental neuropharmacology. Naunyn Schmiedebergs Arch Pharmacol 377, 301-13 (2008).

44. Jones, S.R. et al. Loss of autoreceptor functions in mice lacking the dopamine transporter. Nat Neurosci 2, 649-55 (1999).

45. Gainetdinov, R.R., Jones, S.R. & Caron, M.G. Functional hyperdopaminergia in dopamine transporter knock-out mice. Biol Psychiatry 46, 303-11 (1999).

46. Ghisi, V. et al. Reduced D2-mediated signaling activity and trans-synaptic upregulation of D1 and D2 dopamine receptors in mice overexpressing the dopamine transporter. Cell Signal 21, 87-94 (2009).

47. Torres, G.E. The dopamine transporter proteome. J Neurochem 97 Suppl 1, 3-10 (2006).

48. Braak, H. et al. Staging of brain pathology related to sporadic Parkinson's disease. Neurobiol Aging 24, 197-211 (2003).

49. Braak, H., Rub, U., Gai, W.P. & Del Tredici, K. Idiopathic Parkinson's disease: possible routes by which vulnerable neuronal types may be subject to neuroinvasion by an unknown pathogen. J Neural Transm 110, 517-36 (2003).

50. Langston, J.W., Schule, B., Rees, L., Nichols, R.J. & Barlow, C. Multisystem Lewy body disease and the other parkinsonian disorders. Nat Genet 47, 1378-84 (2015).

51. Dias, V., Junn, E. & Mouradian, M.M. The role of oxidative stress in Parkinson's disease. J Parkinsons Dis 3, 461-91 (2013).

52. Hwang, O. Role of oxidative stress in Parkinson's disease. Exp Neurobiol 22, 11-7 (2013).

53. Zhou, C., Huang, Y. & Przedborski, S. Oxidative stress in Parkinson's disease: a mechanism of pathogenic and therapeutic significance. Ann N Y Acad Sci 1147, 93- 104 (2008).

54. Zhao, J., Yu, S., Zheng, Y., Yang, H. & Zhang, J. Oxidative Modification and Its Implications for the Neurodegeneration of Parkinson's Disease. Mol Neurobiol (2016).

181

55. Adams, J.D., Jr., Klaidman, L.K. & Ribeiro, P. Tyrosine hydroxylase: mechanisms of oxygen radical formation. Redox Rep 3, 273-9 (1997).

56. Haavik, J., Almas, B. & Flatmark, T. Generation of reactive oxygen species by tyrosine hydroxylase: a possible contribution to the degeneration of dopaminergic neurons? J Neurochem 68, 328-32 (1997).

57. Haavik, J. & Toska, K. Tyrosine hydroxylase and Parkinson's disease. Mol Neurobiol 16, 285-309 (1998).

58. Hermida-Ameijeiras, A., Mendez-Alvarez, E., Sanchez-Iglesias, S., Sanmartin- Suarez, C. & Soto-Otero, R. Autoxidation and MAO-mediated metabolism of dopamine as a potential cause of oxidative stress: role of ferrous and ferric ions. Neurochem Int 45, 103-16 (2004).

59. Chen, L. et al. Unregulated cytosolic dopamine causes neurodegeneration associated with oxidative stress in mice. J Neurosci 28, 425-33 (2008).

60. Miyazaki, I. & Asanuma, M. Dopaminergic neuron-specific oxidative stress caused by dopamine itself. Acta Med Okayama 62, 141-50 (2008).

61. Carlsson, A. Perspectives on the discovery of central monoaminergic neurotransmission. Annu Rev Neurosci 10, 19-40 (1987).

62. Robbins, T.W. & Roberts, A.C. Differential regulation of fronto-executive function by the monoamines and acetylcholine. Cereb Cortex 17 Suppl 1, i151-60 (2007).

63. Baldessarini, R.J. Trace amines and alternative neurotransmitters in the central nervous system. Biochem Pharmacol 27, 621-6 (1978).

64. Nelson, D.L. & Gehlert, D.R. Central nervous system biogenic amine targets for control of appetite and energy expenditure. Endocrine 29, 49-60 (2006).

65. Ledonne, A. et al. Trace amines depress D(2)-autoreceptor-mediated responses on midbrain dopaminergic cells. Br J Pharmacol 160, 1509-20 (2010).

66. Gerfen, C.R. & Surmeier, D.J. Modulation of striatal projection systems by dopamine. Annu Rev Neurosci 34, 441-66 (2011).

67. Palmiter, R.D. Dopamine signaling in the dorsal striatum is essential for motivated behaviors: lessons from dopamine-deficient mice. Ann N Y Acad Sci 1129, 35-46 (2008).

68. Qu, W.M. et al. Essential role of dopamine D2 receptor in the maintenance of wakefulness, but not in homeostatic regulation of sleep, in mice. J Neurosci 30, 4382- 9 (2010).

182

69. Dzirasa, K. et al. Dopaminergic control of sleep-wake states. J Neurosci 26, 10577-89 (2006).

70. Dagher, A. & Robbins, T.W. Personality, addiction, dopamine: insights from Parkinson's disease. Neuron 61, 502-10 (2009).

71. Schultz, W. Predictive reward signal of dopamine neurons. J Neurophysiol 80, 1-27 (1998).

72. Sulzer, D. How addictive drugs disrupt presynaptic dopamine neurotransmission. Neuron 69, 628-49 (2011).

73. Wickens, J.R., Reynolds, J.N. & Hyland, B.I. Neural mechanisms of reward-related motor learning. Curr Opin Neurobiol 13, 685-90 (2003).

74. Moore, R.Y. & Bloom, F.E. Central catecholamine neuron systems: anatomy and physiology of the dopamine systems. Annu Rev Neurosci 1, 129-69 (1978).

75. Kilty, J.E., Lorang, D. & Amara, S.G. Cloning and expression of a cocaine-sensitive rat dopamine transporter. Science 254, 578-9 (1991).

76. Wang, Y.M. et al. Knockout of the vesicular monoamine transporter 2 gene results in neonatal death and supersensitivity to cocaine and amphetamine. Neuron 19, 1285-96 (1997).

77. Heal, D.J., Smith, S.L., Gosden, J. & Nutt, D.J. Amphetamine, past and present--a pharmacological and clinical perspective. J Psychopharmacol 27, 479-96 (2013).

78. Adinoff, B. Neurobiologic processes in drug reward and addiction. Harv Rev Psychiatry 12, 305-20 (2004).

79. Waldman, I.D. et al. Association and linkage of the dopamine transporter gene and attention-deficit hyperactivity disorder in children: heterogeneity owing to diagnostic subtype and severity. Am J Hum Genet 63, 1767-76 (1998).

80. Comings, D.E. et al. The dopamine D2 receptor locus as a modifying gene in neuropsychiatric disorders. JAMA 266, 1793-800 (1991).

81. Albin, R.L., Young, A.B. & Penney, J.B. The functional anatomy of basal ganglia disorders. Trends Neurosci 12, 366-75 (1989).

82. Penney, J.B., Jr. & Young, A.B. Speculations on the functional anatomy of basal ganglia disorders. Annu Rev Neurosci 6, 73-94 (1983).

83. Cotzias, G.C., Papavasiliou, P.S. & Gellene, R. Modification of Parkinsonism-- chronic treatment with L-dopa. N Engl J Med 280, 337-45 (1969).

183

84. Zesiewicz, T.A., Sullivan, K.L. & Hauser, R.A. Levodopa-induced dyskinesia in Parkinson's disease: epidemiology, etiology, and treatment. Curr Neurol Neurosci Rep 7, 302-10 (2007).

85. Casey, D.E. Pathophysiology of antipsychotic drug-induced movement disorders. J Clin Psychiatry 65 Suppl 9, 25-8 (2004).

86. Mathews, M. et al. Antipsychotic-induced movement disorders: evaluation and treatment. Psychiatry (Edgmont) 2, 36-41 (2005).

87. Porsolt, R.D., Castagne, V., Hayes, E. & Virley, D. Nonhuman primates: translational models for predicting antipsychotic-induced movement disorders. J Pharmacol Exp Ther 347, 542-6 (2013).

88. Gudelsky, G.A., Koenig, J.I., Koyama, T. & Meltzer, H.Y. Activity of tuberoinfundibular dopaminergic neurons and concentrations of serum prolactin in the rat following lithium administration. Psychopharmacology (Berl) 94, 92-6 (1988).

89. Lyons, D.J., Hellysaz, A. & Broberger, C. Prolactin regulates tuberoinfundibular dopamine neuron discharge pattern: novel feedback control mechanisms in the lactotrophic axis. J Neurosci 32, 8074-83 (2012).

90. Fitzgerald, P. & Dinan, T.G. Prolactin and dopamine: what is the connection? A review article. J Psychopharmacol 22, 12-9 (2008).

91. Daubner, S.C., Le, T. & Wang, S. Tyrosine hydroxylase and regulation of dopamine synthesis. Arch Biochem Biophys 508, 1-12 (2011).

92. Lohr, K.M. et al. Increased vesicular monoamine transporter enhances dopamine release and opposes Parkinson disease-related neurodegeneration in vivo. Proc Natl Acad Sci U S A 111, 9977-82 (2014).

93. Beaulieu, J.M. & Gainetdinov, R.R. The physiology, signaling, and pharmacology of dopamine receptors. Pharmacol Rev 63, 182-217 (2011).

94. Girault, J.A. & Greengard, P. The neurobiology of dopamine signaling. Arch Neurol 61, 641-4 (2004).

95. Greengard, P. The neurobiology of dopamine signaling. Biosci Rep 21, 247-69 (2001).

96. Keeler, J.F., Pretsell, D.O. & Robbins, T.W. Functional implications of dopamine D1 vs. D2 receptors: A 'prepare and select' model of the striatal direct vs. indirect pathways. Neuroscience 282C, 156-175 (2014).

97. Missale, C., Nash, S.R., Robinson, S.W., Jaber, M. & Caron, M.G. Dopamine receptors: from structure to function. Physiol Rev 78, 189-225 (1998).

184

98. Gerfen, C.R. et al. D1 and D2 dopamine receptor-regulated gene expression of striatonigral and striatopallidal neurons. Science 250, 1429-32 (1990).

99. Ena, S., de Kerchove d'Exaerde, A. & Schiffmann, S.N. Unraveling the differential functions and regulation of striatal neuron sub-populations in motor control, reward, and motivational processes. Front Behav Neurosci 5, 47 (2011).

100. Planert, H., Berger, T.K. & Silberberg, G. Membrane properties of striatal direct and indirect pathway neurons in mouse and rat slices and their modulation by dopamine. PLoS One 8, e57054 (2013).

101. Thibault, D., Loustalot, F., Fortin, G.M., Bourque, M.J. & Trudeau, L.E. Evaluation of D1 and D2 dopamine receptor segregation in the developing striatum using BAC transgenic mice. PLoS One 8, e67219 (2013).

102. Lee, F.J. et al. Dopamine transporter cell surface localization facilitated by a direct interaction with the dopamine D2 receptor. EMBO J 26, 2127-36 (2007).

103. Anzalone, A. et al. Dual control of dopamine synthesis and release by presynaptic and postsynaptic dopamine D2 receptors. J Neurosci 32, 9023-34 (2012).

104. Murrin, L.C. & Roth, R.H. Nigrostriatal dopamine neurons: modulation of impulse- induced activation of tyrosine hydroxylation by dopamine autoreceptors. Neuropharmacology 26, 591-5 (1987).

105. Lookingland, K.J. & Moore, K.E. Dopamine receptor-mediated regulation of incertohypothalamic dopaminergic neurons in the male rat. Brain Res 304, 329-38 (1984).

106. Pappas, S.S., Behrouz, B., Janis, K.L., Goudreau, J.L. & Lookingland, K.J. Lack of D2 receptor mediated regulation of dopamine synthesis in A11 diencephalospinal neurons in male and female mice. Brain Res 1214, 1-10 (2008).

107. Gainetdinov, R.R. & Caron, M.G. Monoamine transporters: from genes to behavior. Annu Rev Pharmacol Toxicol 43, 261-84 (2003).

108. Gu, H., Wall, S.C. & Rudnick, G. Stable expression of biogenic amine transporters reveals differences in inhibitor sensitivity, kinetics, and ion dependence. J Biol Chem 269, 7124-30 (1994).

109. Rudnick, G. & Clark, J. From synapse to vesicle: the reuptake and storage of biogenic amine neurotransmitters. Biochim Biophys Acta 1144, 249-63 (1993).

110. Masson, J., Sagne, C., Hamon, M. & El Mestikawy, S. Neurotransmitter transporters in the central nervous system. Pharmacol Rev 51, 439-64 (1999).

185

111. Gainetdinov, R.R., Jones, S.R., Fumagalli, F., Wightman, R.M. & Caron, M.G. Re- evaluation of the role of the dopamine transporter in dopamine system homeostasis. Brain Res Brain Res Rev 26, 148-53 (1998).

112. Moron, J.A., Brockington, A., Wise, R.A., Rocha, B.A. & Hope, B.T. Dopamine uptake through the norepinephrine transporter in brain regions with low levels of the dopamine transporter: evidence from knock-out mouse lines. J Neurosci 22, 389-95 (2002).

113. Revel, F.G. et al. A new perspective for schizophrenia: TAAR1 agonists reveal antipsychotic- and antidepressant-like activity, improve cognition and control body weight. Mol Psychiatry 18, 543-56 (2013).

114. Broadley, K.J. The vascular effects of trace amines and amphetamines. Pharmacol Ther 125, 363-75 (2010).

115. Panas, M.W. et al. Trace amine associated receptor 1 signaling in activated lymphocytes. J Neuroimmune Pharmacol 7, 866-76 (2012).

116. Miller, G.M. The emerging role of trace amine-associated receptor 1 in the functional regulation of monoamine transporters and dopaminergic activity. J Neurochem 116, 164-76 (2011).

117. Sotnikova, T.D. et al. Dopamine transporter-dependent and -independent actions of trace amine beta-phenylethylamine. J Neurochem 91, 362-73 (2004).

118. Lindemann, L. & Hoener, M.C. A renaissance in trace amines inspired by a novel GPCR family. Trends Pharmacol Sci 26, 274-81 (2005).

119. Sotnikova, T.D., Caron, M.G. & Gainetdinov, R.R. Trace amine-associated receptors as emerging therapeutic targets. Mol Pharmacol 76, 229-35 (2009).

120. Lindemann, L. et al. Trace amine-associated receptor 1 modulates dopaminergic activity. J Pharmacol Exp Ther 324, 948-56 (2008).

121. Wolinsky, T.D. et al. The Trace Amine 1 receptor knockout mouse: an animal model with relevance to schizophrenia. Genes Brain Behav 6, 628-39 (2007).

122. Revel, F.G. et al. TAAR1 activation modulates monoaminergic neurotransmission, preventing hyperdopaminergic and hypoglutamatergic activity. Proc Natl Acad Sci U S A 108, 8485-90 (2011).

123. Alvarsson, A. et al. Modulation by Trace Amine-Associated Receptor 1 of Experimental Parkinsonism, L-DOPA Responsivity, and Glutamatergic Neurotransmission. J Neurosci 35, 14057-69 (2015).

124. Schwabe, L., Joels, M., Roozendaal, B., Wolf, O.T. & Oitzl, M.S. Stress effects on memory: an update and integration. Neurosci Biobehav Rev 36, 1740-9 (2012).

186

125. Bouret, S. & Sara, S.J. Network reset: a simplified overarching theory of locus coeruleus noradrenaline function. Trends Neurosci 28, 574-82 (2005).

126. Carter, M.E. et al. Tuning arousal with optogenetic modulation of locus coeruleus neurons. Nat Neurosci 13, 1526-33 (2010).

127. Takahashi, K., Kayama, Y., Lin, J.S. & Sakai, K. Locus coeruleus neuronal activity during the sleep-waking cycle in mice. Neuroscience 169, 1115-26.

128. Rommelfanger, K.S. et al. Norepinephrine loss produces more profound motor deficits than MPTP treatment in mice. Proc Natl Acad Sci U S A 104, 13804-9 (2007).

129. Dahlstroem, A. & Fuxe, K. Evidence for the Existence of Monoamine-Containing Neurons in the Central Nervous System. I. Demonstration of Monoamines in the Cell Bodies of Brain Stem Neurons. Acta Physiol Scand Suppl, SUPPL 232:1-55 (1964).

130. Rinaman, L. Hindbrain noradrenergic A2 neurons: diverse roles in autonomic, endocrine, cognitive, and behavioral functions. Am J Physiol Regul Integr Comp Physiol 300, R222-35 (2011).

131. Rinaman, L. & Schwartz, G. Anterograde transneuronal viral tracing of central viscerosensory pathways in rats. J Neurosci 24, 2782-6 (2004).

132. Ter Horst, G.J., de Boer, P., Luiten, P.G. & van Willigen, J.D. Ascending projections from the solitary tract nucleus to the hypothalamus. A Phaseolus vulgaris lectin tracing study in the rat. Neuroscience 31, 785-97 (1989).

133. Wallace, D.M., Magnuson, D.J. & Gray, T.S. The amygdalo-brainstem pathway: selective innervation of dopaminergic, noradrenergic and adrenergic cells in the rat. Neurosci Lett 97, 252-8 (1989).

134. Wallace, D.M., Magnuson, D.J. & Gray, T.S. Organization of amygdaloid projections to brainstem dopaminergic, noradrenergic, and adrenergic cell groups in the rat. Brain Res Bull 28, 447-54 (1992).

135. Mejias-Aponte, C.A., Drouin, C. & Aston-Jones, G. Adrenergic and noradrenergic innervation of the midbrain ventral tegmental area and retrorubral field: prominent inputs from medullary homeostatic centers. J Neurosci 29, 3613-26 (2009).

136. Williams, C.L. & McGaugh, J.L. Reversible inactivation of the nucleus of the solitary tract impairs retention performance in an inhibitory avoidance task. Behav Neural Biol 58, 204-10 (1992).

137. Williams, C.L., Men, D. & Clayton, E.C. The effects of noradrenergic activation of the nucleus tractus solitarius on memory and in potentiating norepinephrine release in the amygdala. Behav Neurosci 114, 1131-44 (2000).

187

138. Bruinstroop, E. et al. Spinal projections of the A5, A6 (locus coeruleus), and A7 noradrenergic cell groups in rats. J Comp Neurol 520, 1985-2001 (2012).

139. Samuels, E.R. & Szabadi, E. Functional neuroanatomy of the noradrenergic locus coeruleus: its roles in the regulation of arousal and autonomic function part I: principles of functional organisation. Curr Neuropharmacol 6, 235-53 (2008).

140. Aston-Jones, G., Ennis, M., Pieribone, V.A., Nickell, W.T. & Shipley, M.T. The brain nucleus locus coeruleus: restricted afferent control of a broad efferent network. Science 234, 734-7 (1986).

141. Luppi, P.H., Aston-Jones, G., Akaoka, H., Chouvet, G. & Jouvet, M. Afferent projections to the rat locus coeruleus demonstrated by retrograde and anterograde tracing with cholera-toxin B subunit and Phaseolus vulgaris leucoagglutinin. Neuroscience 65, 119-60 (1995).

142. Samuels, E.R. & Szabadi, E. Functional neuroanatomy of the noradrenergic locus coeruleus: its roles in the regulation of arousal and autonomic function part II: physiological and pharmacological manipulations and pathological alterations of locus coeruleus activity in humans. Curr Neuropharmacol 6, 254-85 (2008).

143. Bouret, S. & Sara, S.J. Reward expectation, orientation of attention and locus coeruleus-medial frontal cortex interplay during learning. Eur J Neurosci 20, 791-802 (2004).

144. Aston-Jones, G. & Cohen, J.D. Adaptive gain and the role of the locus coeruleus- norepinephrine system in optimal performance. J Comp Neurol 493, 99-110 (2005).

145. Aston-Jones, G. & Cohen, J.D. An integrative theory of locus coeruleus- norepinephrine function: adaptive gain and optimal performance. Annu Rev Neurosci 28, 403-50 (2005).

146. Bassett, D.S. & Bullmore, E. Small-world brain networks. Neuroscientist 12, 512-23 (2006).

147. Bullmore, E. & Sporns, O. The economy of brain network organization. Nat Rev Neurosci 13, 336-49 (2012).

148. Bassett, D.S., Meyer-Lindenberg, A., Achard, S., Duke, T. & Bullmore, E. Adaptive reconfiguration of fractal small-world human brain functional networks. Proc Natl Acad Sci U S A 103, 19518-23 (2006).

149. Bullmore, E. & Sporns, O. Complex brain networks: graph theoretical analysis of structural and functional systems. Nat Rev Neurosci 10, 186-98 (2009).

150. Modha, D.S. & Singh, R. Network architecture of the long-distance pathways in the macaque brain. Proc Natl Acad Sci U S A 107, 13485-90 (2010).

188

151. Gesi, M. et al. The role of the locus coeruleus in the development of Parkinson's disease. Neurosci Biobehav Rev 24, 655-68 (2000).

152. Zarow, C., Lyness, S.A., Mortimer, J.A. & Chui, H.C. Neuronal loss is greater in the locus coeruleus than nucleus basalis and substantia nigra in Alzheimer and Parkinson diseases. Arch Neurol 60, 337-41 (2003).

153. Chistiakov, D.A., Ashwell, K.W., Orekhov, A.N. & Bobryshev, Y.V. Innervation of the arterial wall and its modification in atherosclerosis. Auton Neurosci 193, 7-11 (2015).

154. Thorp, A.A. & Schlaich, M.P. Relevance of Sympathetic Nervous System Activation in Obesity and Metabolic Syndrome. J Diabetes Res 2015, 341583 (2015).

155. de Diego, A.M., Gandia, L. & Garcia, A.G. A physiological view of the central and peripheral mechanisms that regulate the release of catecholamines at the adrenal medulla. Acta Physiol (Oxf) 192, 287-301 (2008).

156. Teschemacher, A.G. Real-time measurements of noradrenaline release in periphery and central nervous system. Auton Neurosci 117, 1-8 (2005).

157. Aunis, D. & Langley, K. Physiological aspects of exocytosis in chromaffin cells of the adrenal medulla. Acta Physiol Scand 167, 89-97 (1999).

158. Goldstein, D.S., Eisenhofer, G. & Kopin, I.J. Sources and significance of plasma levels of catechols and their metabolites in humans. J Pharmacol Exp Ther 305, 800- 11 (2003).

159. Edwards, S.L., Anderson, C.R., Southwell, B.R. & McAllen, R.M. Distinct preganglionic neurons innervate noradrenaline and adrenaline cells in the cat adrenal medulla. Neuroscience 70, 825-32 (1996).

160. Morrison, S.F. & Cao, W.H. Different adrenal sympathetic preganglionic neurons regulate epinephrine and norepinephrine secretion. Am J Physiol Regul Integr Comp Physiol 279, R1763-75 (2000).

161. Axelrod, J. & Kopin, I.J. The uptake, storage, release and metabolism of noradrenaline in sympathetic nerves. Prog Brain Res 31, 21-32 (1969).

162. Hertting, G. & Axelrod, J. Fate of tritiated noradrenaline at the sympathetic nerve- endings. Nature 192, 172-3 (1961).

163. Lund, D.D. et al. Comparison of tyrosine hydroxylase and choline acetyltransferase activity in response to sympathetic nervous system activation. Brain Res 156, 192-7 (1978).

189

164. Damanhuri, H.A. et al. Tyrosine hydroxylase phosphorylation in catecholaminergic brain regions: a marker of activation following acute hypotension and glucoprivation. PLoS One 7, e50535 (2012).

165. Kalant, H., Grant, D.M. & Mitchell, J. Principles of medical pharmacology (Saunders Elsevier, Toronto, 2007).

166. Berridge, C.W. & Waterhouse, B.D. The locus coeruleus-noradrenergic system: modulation of behavioral state and state-dependent cognitive processes. Brain Res Brain Res Rev 42, 33-84 (2003).

167. Aghajanian, G.K., Cedarbaum, J.M. & Wang, R.Y. Evidence for norepinephrine- mediated collateral inhibition of locus coeruleus neurons. Brain Res 136, 570-7 (1977).

168. Aghajanian, G.K. & VanderMaelen, C.P. alpha 2-adrenoceptor-mediated hyperpolarization of locus coeruleus neurons: intracellular studies in vivo. Science 215, 1394-6 (1982).

169. Nakamura, S. & Sakaguchi, T. Development and plasticity of the locus coeruleus: a review of recent physiological and pharmacological experimentation. Prog Neurobiol 34, 505-26 (1990).

170. Shimizu, N. & Imamoto, K. Fine structure of the locus coeruleus in the rat. Arch Histol Jpn 31, 229-46 (1970).

171. Shimizu, N., Katoh, Y., Hida, T. & Satoh, K. The fine structural organization of the locus coeruleus in the rat with reference to noradrenaline contents. Exp Brain Res 37, 139-48 (1979).

172. Sundaresan, P.R., Guarnaccia, M.M. & Izzo, J.L., Jr. Adrenal medullary regulation of rat renal cortical adrenergic receptors. Am J Physiol 253, F1063-7 (1987).

173. Kimura, F. & Nakamura, S. Locus coeruleus neurons in the neonatal rat: electrical activity and responses to sensory stimulation. Brain Res 355, 301-5 (1985).

174. Kimura, F. & Nakamura, S. Postnatal development of alpha-adrenoceptor-mediated autoinhibition in the locus coeruleus. Brain Res 432, 21-6 (1987).

175. Nakamura, S., Sakaguchi, T., Kimura, F. & Aoki, F. The role of alpha 1- adrenoceptor-mediated collateral excitation in the regulation of the electrical activity of locus coeruleus neurons. Neuroscience 27, 921-9 (1988).

176. Murugaiah, K.D. & O'Donnell, J.M. Beta adrenergic receptors facilitate norepinephrine release from rat hypothalamic and hippocampal slices. Res Commun Mol Pathol Pharmacol 90, 179-90 (1995).

190

177. O'Donnell, J.M. Effect of the beta-2 adrenergic agonist zinterol on norepinephrine turnover. Res Commun Chem Pathol Pharmacol 80, 113-6 (1993).

178. Charney, D.S., Menkes, D.B. & Heninger, G.R. Receptor sensitivity and the mechanism of action of antidepressant treatment. Implications for the etiology and therapy of depression. Arch Gen Psychiatry 38, 1160-80 (1981).

179. Feighner, J.P. Mechanism of action of antidepressant medications. J Clin Psychiatry 60 Suppl 4, 4-11; discussion 12-3 (1999).

180. Linde, K. et al. Efficacy and acceptability of pharmacological treatments for depressive disorders in primary care: systematic review and network meta-analysis. Ann Fam Med 13, 69-79 (2015).

181. Vincent, S. et al. Clinical assessment of norepinephrine transporter blockade through biochemical and pharmacological profiles. Circulation 109, 3202-7 (2004).

182. Horacek, J. et al. Mechanism of action of atypical antipsychotic drugs and the neurobiology of schizophrenia. CNS Drugs 20, 389-409 (2006).

183. Seeman, P. Atypical antipsychotics: mechanism of action. Can J Psychiatry 47, 27-38 (2002).

184. Tort, A.B., Souza, D.O. & Lara, D.R. Theoretical insights into the mechanism of action of atypical antipsychotics. Prog Neuropsychopharmacol Biol Psychiatry 30, 541-8 (2006).

185. Sulzer, D., Sonders, M.S., Poulsen, N.W. & Galli, A. Mechanisms of neurotransmitter release by amphetamines: a review. Prog Neurobiol 75, 406-33 (2005).

186. Goodwin, J.S. et al. Amphetamine and methamphetamine differentially affect dopamine transporters in vitro and in vivo. J Biol Chem 284, 2978-89 (2009).

187. Rothman, R.B. et al. Amphetamine-type central nervous system stimulants release norepinephrine more potently than they release dopamine and serotonin. Synapse 39, 32-41 (2001).

188. Rocha, B.A. et al. Cocaine self-administration in dopamine-transporter knockout mice. Nat Neurosci 1, 132-7 (1998).

189. Tilley, M.R. et al. Cocaine reward and locomotion stimulation in mice with reduced dopamine transporter expression. BMC Neurosci 8, 42 (2007).

190. Fukushima, S. et al. Methamphetamine-induced locomotor activity and sensitization in dopamine transporter and vesicular monoamine transporter 2 double mutant mice. Psychopharmacology (Berl) 193, 55-62 (2007).

191

191. Takahashi, N. et al. VMAT2 knockout mice: heterozygotes display reduced amphetamine-conditioned reward, enhanced amphetamine locomotion, and enhanced MPTP toxicity. Proc Natl Acad Sci U S A 94, 9938-43 (1997).

192. Ramsey, A.J., Hillas, P.J. & Fitzpatrick, P.F. Characterization of the active site iron in tyrosine hydroxylase. Redox states of the iron. J Biol Chem 271, 24395-400 (1996).

193. Fitzpatrick, P.F. The metal requirement of rat tyrosine hydroxylase. Biochem Biophys Res Commun 161, 211-5 (1989).

194. Hoeldtke, R. & Kaufman, S. Bovine adrenal tyrosine hydroxylase: purification and properties. J Biol Chem 252, 3160-9 (1977).

195. Dunkley, P.R., Bobrovskaya, L., Graham, M.E., von Nagy-Felsobuki, E.I. & Dickson, P.W. Tyrosine hydroxylase phosphorylation: regulation and consequences. J Neurochem 91, 1025-43 (2004).

196. Ramsey, A.J. & Fitzpatrick, P.F. Effects of phosphorylation of serine 40 of tyrosine hydroxylase on binding of catecholamines: evidence for a novel regulatory mechanism. Biochemistry 37, 8980-6 (1998).

197. Kumer, S.C. & Vrana, K.E. Intricate regulation of tyrosine hydroxylase activity and gene expression. J Neurochem 67, 443-62 (1996).

198. Ramsey, A.J. & Fitzpatrick, P.F. Effects of phosphorylation on binding of catecholamines to tyrosine hydroxylase: specificity and thermodynamics. Biochemistry 39, 773-8 (2000).

199. Sura, G.R., Daubner, S.C. & Fitzpatrick, P.F. Effects of phosphorylation by protein kinase A on binding of catecholamines to the human tyrosine hydroxylase isoforms. J Neurochem 90, 970-8 (2004).

200. Andersson, K.K., Cox, D.D., Que, L., Jr., Flatmark, T. & Haavik, J. Resonance Raman studies on the blue-green-colored bovine adrenal tyrosine 3-monooxygenase (tyrosine hydroxylase). Evidence that the feedback inhibitors adrenaline and noradrenaline are coordinated to iron. J Biol Chem 263, 18621-6 (1988).

201. Andersson, K.K. et al. Purification and characterization of the blue-green rat phaeochromocytoma (PC12) tyrosine hydroxylase with a dopamine-Fe(III) complex. Reversal of the endogenous feedback inhibition by phosphorylation of serine-40. Biochem J 284 ( Pt 3), 687-95 (1992).

202. Daubner, S.C., Lauriano, C., Haycock, J.W. & Fitzpatrick, P.F. Site-directed mutagenesis of serine 40 of rat tyrosine hydroxylase. Effects of dopamine and cAMP- dependent phosphorylation on enzyme activity. J Biol Chem 267, 12639-46 (1992).

203. Ribeiro, P., Wang, Y., Citron, B.A. & Kaufman, S. Regulation of recombinant rat tyrosine hydroxylase by dopamine. Proc Natl Acad Sci U S A 89, 9593-7 (1992).

192

204. Morgenroth, V.H., 3rd, Boadle-Biber, M. & Roth, R.H. Tyrosine hydroxylase: activation by nerve stimulation. Proc Natl Acad Sci U S A 71, 4283-7 (1974).

205. Lehmann, I.T., Bobrovskaya, L., Gordon, S.L., Dunkley, P.R. & Dickson, P.W. Differential regulation of the human tyrosine hydroxylase isoforms via hierarchical phosphorylation. J Biol Chem 281, 17644-51 (2006).

206. Markey, K.A., Kondo, H., Shenkman, L. & Goldstein, M. Purification and characterization of tyrosine hydroxylase from a clonal pheochromocytoma cell line. Mol Pharmacol 17, 79-85 (1980).

207. Haycock, J.W. Phosphorylation of tyrosine hydroxylase in situ at serine 8, 19, 31, and 40. J Biol Chem 265, 11682-91 (1990).

208. Joh, T.H., Park, D.H. & Reis, D.J. Direct phosphorylation of brain tyrosine hydroxylase by cyclic AMP-dependent protein kinase: mechanism of enzyme activation. Proc Natl Acad Sci U S A 75, 4744-8 (1978).

209. Yamauchi, T. & Fujisawa, H. Regulation of bovine adrenal tyrosine 3- monooxygenase by phosphorylation-dephosphorylation reaction, catalyzed by adenosine 3':5'-monophosphate-dependent protein kinase and phosphoprotein phosphatase. J Biol Chem 254, 6408-13 (1979).

210. Haycock, J.W., Meligeni, J.A., Bennett, W.F. & Waymire, J.C. Phosphorylation and activation of tyrosine hydroxylase mediate the acetylcholine-induced increase in catecholamine biosynthesis in adrenal chromaffin cells. J Biol Chem 257, 12641-8 (1982).

211. Campbell, D.G., Hardie, D.G. & Vulliet, P.R. Identification of four phosphorylation sites in the N-terminal region of tyrosine hydroxylase. J Biol Chem 261, 10489-92 (1986).

212. Vulliet, P.R., Langan, T.A. & Weiner, N. Tyrosine hydroxylase: a substrate of cyclic AMP-dependent protein kinase. Proc Natl Acad Sci U S A 77, 92-6 (1980).

213. Vulliet, P.R., Woodgett, J.R. & Cohen, P. Phosphorylation of tyrosine hydroxylase by calmodulin-dependent multiprotein kinase. J Biol Chem 259, 13680-3 (1984).

214. Ahn, J.H., Kim, Y., Kim, H.S., Greengard, P. & Nairn, A.C. Protein kinase C- dependent dephosphorylation of tyrosine hydroxylase requires the B56delta heterotrimeric form of protein phosphatase 2A. PLoS One 6, e26292 (2011).

215. Roskoski, R., Jr., Vulliet, P.R. & Glass, D.B. Phosphorylation of tyrosine hydroxylase by cyclic GMP-dependent protein kinase. J Neurochem 48, 840-5 (1987).

216. Roskoski, R., Jr. & Roskoski, L.M. Activation of tyrosine hydroxylase in PC12 cells by the cyclic GMP and cyclic AMP second messenger systems. J Neurochem 48, 236- 42 (1987).

193

217. Funakoshi, H., Okuno, S. & Fujisawa, H. Different effects on activity caused by phosphorylation of tyrosine hydroxylase at serine 40 by three multifunctional protein kinases. J Biol Chem 266, 15614-20 (1991).

218. Harada, Wu, J., Haycock, J.W. & Goldstein, M. Regulation of L-DOPA biosynthesis by site-specific phosphorylation of tyrosine hydroxylase in AtT-20 cells expressing wild-type and serine 40-substituted enzyme. J Neurochem 67, 629-35 (1996).

219. Salvatore, M.F., Waymire, J.C. & Haycock, J.W. Depolarization-stimulated catecholamine biosynthesis: involvement of protein kinases and tyrosine hydroxylase phosphorylation sites in situ. J Neurochem 79, 349-60 (2001).

220. Bevilaqua, L.R., Graham, M.E., Dunkley, P.R., von Nagy-Felsobuki, E.I. & Dickson, P.W. Phosphorylation of Ser(19) alters the conformation of tyrosine hydroxylase to increase the rate of phosphorylation of Ser(40). J Biol Chem 276, 40411-6 (2001).

221. Bobrovskaya, L., Dunkley, P.R. & Dickson, P.W. Phosphorylation of Ser19 increases both Ser40 phosphorylation and enzyme activity of tyrosine hydroxylase in intact cells. J Neurochem 90, 857-64 (2004).

222. Ichimura, T., Isobe, T., Okuyama, T., Yamauchi, T. & Fujisawa, H. Brain 14-3-3 protein is an activator protein that activates tryptophan 5-monooxygenase and tyrosine 3-monooxygenase in the presence of Ca2+,calmodulin-dependent protein kinase II. FEBS Lett 219, 79-82 (1987).

223. Ichimura, T. et al. Molecular cloning of cDNA coding for brain-specific 14-3-3 protein, a protein kinase-dependent activator of tyrosine and tryptophan hydroxylases. Proc Natl Acad Sci U S A 85, 7084-8 (1988).

224. Itagaki, C. et al. Stimulus-coupled interaction of tyrosine hydroxylase with 14-3-3 proteins. Biochemistry 38, 15673-80 (1999).

225. Yamauchi, T. & Fujisawa, H. Tyrosine 3-monoxygenase is phosphorylated by Ca2+-, calmodulin-dependent protein kinase, followed by activation by activator protein. Biochem Biophys Res Commun 100, 807-13 (1981).

226. Yamauchi, T., Nakata, H. & Fujisawa, H. A new activator protein that activates tryptophan 5-monooxygenase and tyrosine 3-monooxygenase in the presence of Ca2+-, calmodulin-dependent protein kinase. Purification and characterization. J Biol Chem 256, 5404-9 (1981).

227. Edelman, A.M., Raese, J.D., Lazar, M.A. & Barchas, J.D. Tyrosine hydroxylase: studies on the phosphorylation of a purified preparation of the brain enzyme by the cyclic AMP-dependent protein kinase. J Pharmacol Exp Ther 216, 647-53 (1981).

228. Lazar, M.A., Truscott, R.J., Raese, J.D. & Barchas, J.D. Thermal denaturation of native striatal tyrosine hydroxylase: increased thermolability of the phosphorylated form of the enzyme. J Neurochem 36, 677-82 (1981).

194

229. McCulloch, R.I. & Fitzpatrick, P.F. Limited proteolysis of tyrosine hydroxylase identifies residues 33-50 as conformationally sensitive to phosphorylation state and dopamine binding. Arch Biochem Biophys 367, 143-5 (1999).

230. Bobrovskaya, L., Odell, A., Leal, R.B. & Dunkley, P.R. Tyrosine hydroxylase phosphorylation in bovine adrenal chromaffin cells: the role of MAPKs after angiotensin II stimulation. J Neurochem 78, 490-8 (2001).

231. Salvatore, M.F. ser31 Tyrosine hydroxylase phosphorylation parallels differences in dopamine recovery in nigrostriatal pathway following 6-OHDA lesion. J Neurochem 129, 548-58 (2014).

232. Salvatore, M.F., Pruett, B.S., Spann, S.L. & Dempsey, C. Aging reveals a role for nigral tyrosine hydroxylase ser31 phosphorylation in locomotor activity generation. PLoS One 4, e8466 (2009).

233. Moore, B.W. A soluble protein characteristic of the nervous system. Biochem Biophys Res Commun 19, 739-44 (1965).

234. Moore, B.W., Perez, V.J. & Gehring, M. Assay and regional distribution of a soluble protein characteristic of the nervous system. J Neurochem 15, 265-72 (1968).

235. Perez, R.G. et al. A role for alpha-synuclein in the regulation of dopamine biosynthesis. J Neurosci 22, 3090-9 (2002).

236. Aitken, A. et al. Post-translationally modified 14-3-3 isoforms and inhibition of protein kinase C. Mol Cell Biochem 149-150, 41-9 (1995).

237. Matto-Yelin, M., Aitken, A. & Ravid, S. 14-3-3 inhibits the Dictyostelium myosin II heavy-chain-specific protein kinase C activity by a direct interaction: identification of the 14-3-3 binding domain. Mol Biol Cell 8, 1889-99 (1997).

238. Meller, N. et al. Direct interaction between protein kinase C theta (PKC theta) and 14- 3-3 tau in T cells: 14-3-3 overexpression results in inhibition of PKC theta translocation and function. Mol Cell Biol 16, 5782-91 (1996).

239. Tzivion, G., Luo, Z. & Avruch, J. A dimeric 14-3-3 protein is an essential cofactor for Raf kinase activity. Nature 394, 88-92 (1998).

240. Yang, E. et al. Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death. Cell 80, 285-91 (1995).

241. Masters, S.C. & Fu, H. 14-3-3 proteins mediate an essential anti-apoptotic signal. J Biol Chem 276, 45193-200 (2001).

242. Chandra, S. et al. Double-knockout mice for alpha- and beta-synucleins: effect on synaptic functions. Proc Natl Acad Sci U S A 101, 14966-71 (2004).

195

243. Roth, D., Birkenfeld, J. & Betz, H. Dominant-negative alleles of 14-3-3 proteins cause defects in actin organization and vesicle targeting in the yeast Saccharomyces cerevisiae. FEBS Lett 460, 411-6 (1999).

244. Obsil, T., Ghirlando, R., Klein, D.C., Ganguly, S. & Dyda, F. Crystal structure of the 14-3-3zeta:serotonin N-acetyltransferase complex. a role for scaffolding in enzyme regulation. Cell 105, 257-67 (2001).

245. Martinez, A., Haavik, J., Flatmark, T., Arrondo, J.L. & Muga, A. Conformational properties and stability of tyrosine hydroxylase studied by infrared spectroscopy. Effect of iron/catecholamine binding and phosphorylation. J Biol Chem 271, 19737- 42 (1996).

246. Kleppe, R., Toska, K. & Haavik, J. Interaction of phosphorylated tyrosine hydroxylase with 14-3-3 proteins: evidence for a phosphoserine 40-dependent association. J Neurochem 77, 1097-107 (2001).

247. Obsilova, V. et al. The 14-3-3 protein affects the conformation of the regulatory domain of human tyrosine hydroxylase. Biochemistry 47, 1768-77 (2008).

248. Nelson, T.J. & Kaufman, S. Activation of rat caudate tyrosine hydroxylase phosphatase by tetrahydropterins. J Biol Chem 262, 16470-5 (1987).

249. Berresheim, U. & Kuhn, D.M. Dephosphorylation of tyrosine hydroxylase by brain protein phosphatases: a predominant role for type 2A. Brain Res 637, 273-6 (1994).

250. Haavik, J. et al. Identification of protein phosphatase 2A as the major tyrosine hydroxylase phosphatase in adrenal medulla and corpus striatum: evidence from the effects of okadaic acid. FEBS Lett 251, 36-42 (1989).

251. Leal, R.B., Sim, A.T., Goncalves, C.A. & Dunkley, P.R. Tyrosine hydroxylase dephosphorylation by protein phosphatase 2A in bovine adrenal chromaffin cells. Neurochem Res 27, 207-13 (2002).

252. Galindo, E., Zwiller, J., Bader, M.F. & Aunis, D. Chromostatin inhibits catecholamine secretion in adrenal chromaffin cells by activating a protein phosphatase. Proc Natl Acad Sci U S A 89, 7398-402 (1992).

253. Wu, Y.N. & Wagner, P.D. Effects of phosphatase inhibitors and a protein phosphatase on norepinephrine secretion by permeabilized bovine chromaffin cells. Biochim Biophys Acta 1092, 384-90 (1991).

254. Maroteaux, L., Campanelli, J.T. & Scheller, R.H. Synuclein: a neuron-specific protein localized to the nucleus and presynaptic nerve terminal. J Neurosci 8, 2804-15 (1988).

255. Ostrerova, N. et al. alpha-Synuclein shares physical and functional homology with 14- 3-3 proteins. J Neurosci 19, 5782-91 (1999).

196

256. Snead, D. & Eliezer, D. Alpha-synuclein function and dysfunction on cellular membranes. Exp Neurobiol 23, 292-313 (2014).

257. Recchia, A. et al. Alpha-synuclein and Parkinson's disease. FASEB J 18, 617-26 (2004).

258. Clayton, D.F. & George, J.M. Synucleins in synaptic plasticity and neurodegenerative disorders. J Neurosci Res 58, 120-9 (1999).

259. Iwai, A. et al. The precursor protein of non-A beta component of Alzheimer's disease amyloid is a presynaptic protein of the central nervous system. Neuron 14, 467-75 (1995).

260. Jensen, P.H., Nielsen, M.S., Jakes, R., Dotti, C.G. & Goedert, M. Binding of alpha- synuclein to brain vesicles is abolished by familial Parkinson's disease mutation. J Biol Chem 273, 26292-4 (1998).

261. Kahle, P.J. et al. Subcellular localization of wild-type and Parkinson's disease- associated mutant alpha -synuclein in human and transgenic mouse brain. J Neurosci 20, 6365-73 (2000).

262. Jenco, J.M., Rawlingson, A., Daniels, B. & Morris, A.J. Regulation of phospholipase D2: selective inhibition of mammalian phospholipase D isoenzymes by alpha- and beta-synucleins. Biochemistry 37, 4901-9 (1998).

263. Burre, J. et al. Alpha-synuclein promotes SNARE-complex assembly in vivo and in vitro. Science 329, 1663-7 (2010).

264. Choi, B.K. et al. Large alpha-synuclein oligomers inhibit neuronal SNARE-mediated vesicle docking. Proc Natl Acad Sci U S A 110, 4087-92 (2013).

265. Butler, B. et al. Dopamine Transporter Activity Is Modulated by alpha-Synuclein. J Biol Chem 290, 29542-54 (2015).

266. Sidhu, A., Wersinger, C. & Vernier, P. alpha-Synuclein regulation of the dopaminergic transporter: a possible role in the pathogenesis of Parkinson's disease. FEBS Lett 565, 1-5 (2004).

267. Swant, J. et al. alpha-Synuclein stimulates a dopamine transporter-dependent chloride current and modulates the activity of the transporter. J Biol Chem 286, 43933-43 (2011).

268. Wersinger, C., Prou, D., Vernier, P. & Sidhu, A. Modulation of dopamine transporter function by alpha-synuclein is altered by impairment of cell adhesion and by induction of oxidative stress. FASEB J 17, 2151-3 (2003).

269. Wersinger, C. & Sidhu, A. Attenuation of dopamine transporter activity by alpha- synuclein. Neurosci Lett 340, 189-92 (2003).

197

270. Nakamura, K. alpha-Synuclein and mitochondria: partners in crime? Neurotherapeutics 10, 391-9 (2013).

271. Nakamura, K. et al. Direct membrane association drives mitochondrial fission by the Parkinson disease-associated protein alpha-synuclein. J Biol Chem 286, 20710-26 (2011).

272. Devi, L., Raghavendran, V., Prabhu, B.M., Avadhani, N.G. & Anandatheerthavarada, H.K. Mitochondrial import and accumulation of alpha-synuclein impair complex I in human dopaminergic neuronal cultures and Parkinson disease brain. J Biol Chem 283, 9089-100 (2008).

273. Lin, M.T. & Beal, M.F. Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases. Nature 443, 787-95 (2006).

274. Zhu, M., Qin, Z.J., Hu, D., Munishkina, L.A. & Fink, A.L. Alpha-synuclein can function as an antioxidant preventing oxidation of unsaturated lipid in vesicles. Biochemistry 45, 8135-42 (2006).

275. Perez, R.G. & Hastings, T.G. Could a loss of alpha-synuclein function put dopaminergic neurons at risk? J Neurochem 89, 1318-24 (2004).

276. Liu, D. et al. Silencing alpha-synuclein gene expression enhances tyrosine hydroxylase activity in MN9D cells. Neurochem Res 33, 1401-9 (2008).

277. Alerte, T.N. et al. Alpha-synuclein aggregation alters tyrosine hydroxylase phosphorylation and immunoreactivity: lessons from viral transduction of knockout mice. Neurosci Lett 435, 24-9 (2008).

278. Xu, J. et al. Dopamine-dependent neurotoxicity of alpha-synuclein: a mechanism for selective neurodegeneration in Parkinson disease. Nat Med 8, 600-6 (2002).

279. Slavotinek, A.M. & Biesecker, L.G. Unfolding the role of chaperones and chaperonins in human disease. Trends Genet 17, 528-35 (2001).

280. Peng, X., Tehranian, R., Dietrich, P., Stefanis, L. & Perez, R.G. Alpha-synuclein activation of protein phosphatase 2A reduces tyrosine hydroxylase phosphorylation in dopaminergic cells. J Cell Sci 118, 3523-30 (2005).

281. Hua, G. et al. Protein phosphatase 2A is involved in the tyrosine hydroxylase phosphorylation regulated by alpha-synuclein. Neurochem Res 40, 428-37 (2015).

282. Farrell, K.F. et al. Non-motor parkinsonian pathology in aging A53T alpha-synuclein mice is associated with progressive synucleinopathy and altered enzymatic function. J Neurochem 128, 536-46 (2014).

198

283. Baptista, M.J. et al. Co-ordinate transcriptional regulation of dopamine synthesis genes by alpha-synuclein in human neuroblastoma cell lines. J Neurochem 85, 957-68 (2003).

284. Iversen, L.L. Role of transmitter uptake mechanisms in synaptic neurotransmission. Br J Pharmacol 41, 571-91 (1971).

285. Zahniser, N.R. & Doolen, S. Chronic and acute regulation of Na+/Cl- -dependent neurotransmitter transporters: drugs, substrates, presynaptic receptors, and signaling systems. Pharmacol Ther 92, 21-55 (2001).

286. Nirenberg, M.J. et al. The dopamine transporter: comparative ultrastructure of dopaminergic axons in limbic and motor compartments of the nucleus accumbens. J Neurosci 17, 6899-907 (1997).

287. Nirenberg, M.J., Vaughan, R.A., Uhl, G.R., Kuhar, M.J. & Pickel, V.M. The dopamine transporter is localized to dendritic and axonal plasma membranes of nigrostriatal dopaminergic neurons. J Neurosci 16, 436-47 (1996).

288. Maiya, R. & Mayfield, R.D. Dopamine transporter network and pathways. Int Rev Neurobiol 61, 79-96 (2004).

289. Ciliax, B.J. et al. The dopamine transporter: immunochemical characterization and localization in brain. J Neurosci 15, 1714-23 (1995).

290. Freed, C. et al. Dopamine transporter immunoreactivity in rat brain. J Comp Neurol 359, 340-9 (1995).

291. Hersch, S.M., Yi, H., Heilman, C.J., Edwards, R.H. & Levey, A.I. Subcellular localization and molecular topology of the dopamine transporter in the striatum and substantia nigra. J Comp Neurol 388, 211-27 (1997).

292. Qian, Y., Melikian, H.E., Rye, D.B., Levey, A.I. & Blakely, R.D. Identification and characterization of antidepressant-sensitive serotonin transporter proteins using site- specific antibodies. J Neurosci 15, 1261-74 (1995).

293. Schroeter, S. et al. Immunolocalization of the cocaine- and antidepressant-sensitive l- norepinephrine transporter. J Comp Neurol 420, 211-32 (2000).

294. Sur, C., Betz, H. & Schloss, P. Immunocytochemical detection of the serotonin transporter in rat brain. Neuroscience 73, 217-31 (1996).

295. Zhou, F.C., Tao-Cheng, J.H., Segu, L., Patel, T. & Wang, Y. Serotonin transporters are located on the axons beyond the synaptic junctions: anatomical and functional evidence. Brain Res 805, 241-54 (1998).

199

296. Keller, N.R. et al. Norepinephrine transporter-deficient mice exhibit excessive tachycardia and elevated blood pressure with wakefulness and activity. Circulation 110, 1191-6 (2004).

297. Ricu, M., Paredes, A., Greiner, M., Ojeda, S.R. & Lara, H.E. Functional development of the ovarian noradrenergic innervation. Endocrinology 149, 50-6 (2008).

298. Schroeder, C. & Jordan, J. Norepinephrine transporter function and human cardiovascular disease. Am J Physiol Heart Circ Physiol 303, H1273-82 (2012).

299. Sieber-Blum, M. & Ren, Z. Norepinephrine transporter expression and function in noradrenergic cell differentiation. Mol Cell Biochem 212, 61-70 (2000).

300. Zhou, J. Norepinephrine transporter inhibitors and their therapeutic potential. Drugs Future 29, 1235-1244 (2004).

301. Javitch, J.A. & Snyder, S.H. Uptake of MPP(+) by dopamine neurons explains selectivity of parkinsonism-inducing neurotoxin, MPTP. Eur J Pharmacol 106, 455-6 (1984).

302. Copeland, B.J., Vogelsberg, V., Neff, N.H. & Hadjiconstantinou, M. Protein kinase C activators decrease dopamine uptake into striatal synaptosomes. J Pharmacol Exp Ther 277, 1527-32 (1996).

303. Loder, M.K. & Melikian, H.E. The dopamine transporter constitutively internalizes and recycles in a protein kinase C-regulated manner in stably transfected PC12 cell lines. J Biol Chem 278, 22168-74 (2003).

304. Eriksen, J., Jorgensen, T.N. & Gether, U. Regulation of dopamine transporter function by protein-protein interactions: new discoveries and methodological challenges. J Neurochem 113, 27-41 (2010).

305. Maiya, R., Ponomarev, I., Linse, K.D., Harris, R.A. & Mayfield, R.D. Defining the dopamine transporter proteome by convergent biochemical and in silico analyses. Genes Brain Behav 6, 97-106 (2007).

306. Miranda, M., Sorkina, T., Grammatopoulos, T.N., Zawada, W.M. & Sorkin, A. Multiple molecular determinants in the carboxyl terminus regulate dopamine transporter export from endoplasmic reticulum. J Biol Chem 279, 30760-70 (2004).

307. Sorkina, T., Doolen, S., Galperin, E., Zahniser, N.R. & Sorkin, A. Oligomerization of dopamine transporters visualized in living cells by fluorescence resonance energy transfer microscopy. J Biol Chem 278, 28274-83 (2003).

308. Bjerggaard, C. et al. Surface targeting of the dopamine transporter involves discrete epitopes in the distal C terminus but does not require canonical PDZ domain interactions. J Neurosci 24, 7024-36 (2004).

200

309. Torres, G.E. et al. Oligomerization and trafficking of the human dopamine transporter. Mutational analysis identifies critical domains important for the functional expression of the transporter. J Biol Chem 278, 2731-9 (2003).

310. Torres, G.E. et al. Functional interaction between monoamine plasma membrane transporters and the synaptic PDZ domain-containing protein PICK1. Neuron 30, 121-34 (2001).

311. Hastrup, H., Karlin, A. & Javitch, J.A. Symmetrical dimer of the human dopamine transporter revealed by cross-linking Cys-306 at the extracellular end of the sixth transmembrane segment. Proc Natl Acad Sci U S A 98, 10055-60 (2001).

312. Jess, U., Betz, H. & Schloss, P. The membrane-bound rat serotonin transporter, SERT1, is an oligomeric protein. FEBS Lett 394, 44-6 (1996).

313. Milner, H.E., Beliveau, R. & Jarvis, S.M. The in situ size of the dopamine transporter is a tetramer as estimated by radiation inactivation. Biochim Biophys Acta 1190, 185-7 (1994).

314. Schmid, J.A. et al. Oligomerization of the human serotonin transporter and of the rat GABA transporter 1 visualized by fluorescence resonance energy transfer microscopy in living cells. J Biol Chem 276, 3805-10 (2001).

315. Melikian, H.E. Neurotransmitter transporter trafficking: endocytosis, recycling, and regulation. Pharmacol Ther 104, 17-27 (2004).

316. Mortensen, O.V. & Amara, S.G. Dynamic regulation of the dopamine transporter. Eur J Pharmacol 479, 159-70 (2003).

317. Vaughan, R.A. Phosphorylation and regulation of psychostimulant-sensitive neurotransmitter transporters. J Pharmacol Exp Ther 310, 1-7 (2004).

318. Furman, C.A. et al. Dopamine and amphetamine rapidly increase dopamine transporter trafficking to the surface: live-cell imaging using total internal reflection fluorescence microscopy. J Neurosci 29, 3328-36 (2009).

319. Pickel, V.M. & Chan, J. Ultrastructural localization of the serotonin transporter in limbic and motor compartments of the nucleus accumbens. J Neurosci 19, 7356-66 (1999).

320. Eriksen, J. et al. Visualization of dopamine transporter trafficking in live neurons by use of fluorescent cocaine analogs. J Neurosci 29, 6794-808 (2009).

321. Ferris, M.J. et al. Dopamine transporters govern diurnal variation in extracellular dopamine tone. Proc Natl Acad Sci U S A 111, E2751-9 (2014).

201

322. Dreher, J.C., Kohn, P., Kolachana, B., Weinberger, D.R. & Berman, K.F. Variation in dopamine genes influences responsivity of the human reward system. Proc Natl Acad Sci U S A 106, 617-22 (2009).

323. Heitland, I. et al. Genetic polymorphisms of the dopamine and serotonin systems modulate the neurophysiological response to feedback and risk taking in healthy humans. Cogn Affect Behav Neurosci 12, 678-91 (2012).

324. Dougherty, D.D. et al. Dopamine transporter density in patients with attention deficit hyperactivity disorder. Lancet 354, 2132-3 (1999).

325. Jeong, S.H. et al. Association between the dopamine transporter gene (DAT1) and attention deficit hyperactivity disorder-related traits in healthy adults. Psychiatr Genet 25, 119-26 (2015).

326. Xu, X. et al. Association study of promoter polymorphisms at the dopamine transporter gene in Attention Deficit Hyperactivity Disorder. BMC Psychiatry 9, 3 (2009).

327. Markota, M., Sin, J., Pantazopoulos, H., Jonilionis, R. & Berretta, S. Reduced dopamine transporter expression in the amygdala of subjects diagnosed with schizophrenia. Schizophr Bull 40, 984-91 (2014).

328. Boeve, B.F. REM sleep behavior disorder: Updated review of the core features, the REM sleep behavior disorder-neurodegenerative disease association, evolving concepts, controversies, and future directions. Ann N Y Acad Sci 1184, 15-54 (2010).

329. Stiasny-Kolster, K. et al. Combination of 'idiopathic' REM sleep behaviour disorder and olfactory dysfunction as possible indicator for alpha-synucleinopathy demonstrated by dopamine transporter FP-CIT-SPECT. Brain 128, 126-37 (2005).

330. Kim, Y.K. et al. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder. J Affect Disord 158, 127-32 (2014).

331. Park, S. et al. Possible effect of norepinephrine transporter polymorphisms on methylphenidate-induced changes in neuropsychological function in attention-deficit hyperactivity disorder. Behav Brain Funct 8, 22 (2012).

332. Ryu, S.H. et al. Association between norepinephrine transporter gene polymorphism and major depression. Neuropsychobiology 49, 174-7 (2004).

333. Pietrzak, R.H. et al. Association of posttraumatic stress disorder with reduced in vivo norepinephrine transporter availability in the locus coeruleus. JAMA Psychiatry 70, 1199-205 (2013).

202

334. Pietrzak, R.H. et al. Association of the rs2242446 polymorphism in the norepinephrine transporter gene SLC6A2 and anxious arousal symptoms of posttraumatic stress disorder. J Clin Psychiatry 76, e537-8 (2015).

335. Esler, M. et al. The neuronal noradrenaline transporter, anxiety and cardiovascular disease. J Psychopharmacol 20, 60-6 (2006).

336. Keller, N.R. et al. Norepinephrine transporter-deficient mice respond to anxiety producing and fearful environments with bradycardia and hypotension. Neuroscience 139, 931-46 (2006).

337. Beal, M.F. Experimental models of Parkinson's disease. Nat Rev Neurosci 2, 325-34 (2001).

338. Pringsheim, T., Jette, N., Frolkis, A. & Steeves, T.D. The prevalence of Parkinson's disease: a systematic review and meta-analysis. Mov Disord 29, 1583-90 (2014).

339. Wong, S.L., Gilmour, H. & Ramage-Morin, P.L. Parkinson's disease: Prevalence, diagnosis and impact. Health Rep 25, 10-4 (2014).

340. Deblieck, C. & Wu, A.D. Neuroimaging of nonmotor features of Parkinson's disease. Rev Neurol Dis 5, 125-33 (2008).

341. Hawkes, C.H. The prodromal phase of sporadic Parkinson's disease: does it exist and if so how long is it? Mov Disord 23, 1799-807 (2008).

342. Adler, C.H. Premotor symptoms and early diagnosis of Parkinson's disease. Int J Neurosci 121 Suppl 2, 3-8 (2011).

343. Goldman, J.G. & Postuma, R. Premotor and nonmotor features of Parkinson's disease. Curr Opin Neurol 27, 434-41 (2014).

344. Obeso, J.A. et al. Missing pieces in the Parkinson's disease puzzle. Nat Med 16, 653- 61 (2010).

345. Selikhova, M. et al. A clinico-pathological study of subtypes in Parkinson's disease. Brain 132, 2947-57 (2009).

346. Lozano, A.M., Dostrovsky, J., Chen, R. & Ashby, P. Deep brain stimulation for Parkinson's disease: disrupting the disruption. Lancet Neurol 1, 225-31 (2002).

347. Rodriguez-Oroz, M.C. et al. Bilateral deep brain stimulation in Parkinson's disease: a multicentre study with 4 years follow-up. Brain 128, 2240-9 (2005).

348. Kim, J.H. et al. Dopamine neurons derived from embryonic stem cells function in an animal model of Parkinson's disease. Nature 418, 50-6 (2002).

349. Lindvall, O., Kokaia, Z. & Martinez-Serrano, A. Stem cell therapy for human neurodegenerative disorders-how to make it work. Nat Med 10 Suppl, S42-50 (2004).

203

350. Srinageshwar, B., Maiti, P., Dunbar, G.L. & Rossignol, J. Role of Epigenetics in Stem Cell Proliferation and Differentiation: Implications for Treating Neurodegenerative Diseases. Int J Mol Sci 17 (2016).

351. Zeng, X. & Couture, L.A. Pluripotent stem cells for Parkinson's disease: progress and challenges. Stem Cell Res Ther 4, 25 (2013).

352. Nalls, M.A. et al. Large-scale meta-analysis of genome-wide association data identifies six new risk loci for Parkinson's disease. Nat Genet 46, 989-93 (2014).

353. Coppede, F. Genetics and epigenetics of Parkinson's disease. ScientificWorldJournal 2012, 489830 (2012).

354. Klein, C. & Schlossmacher, M.G. The genetics of Parkinson disease: Implications for neurological care. Nat Clin Pract Neurol 2, 136-46 (2006).

355. Lesage, S. & Brice, A. Parkinson's disease: from monogenic forms to genetic susceptibility factors. Hum Mol Genet 18, R48-59 (2009).

356. Bertoncini, C.W., Fernandez, C.O., Griesinger, C., Jovin, T.M. & Zweckstetter, M. Familial mutants of alpha-synuclein with increased neurotoxicity have a destabilized conformation. J Biol Chem 280, 30649-52 (2005).

357. Dick, F.D. et al. Environmental risk factors for Parkinson's disease and parkinsonism: the Geoparkinson study. Occup Environ Med 64, 666-72 (2007).

358. Giasson, B.I. & Lee, V.M. A new link between pesticides and Parkinson's disease. Nat Neurosci 3, 1227-8 (2000).

359. Priyadarshi, A., Khuder, S.A., Schaub, E.A. & Priyadarshi, S.S. Environmental risk factors and Parkinson's disease: a metaanalysis. Environ Res 86, 122-7 (2001).

360. Tanner, C.M. et al. Rotenone, paraquat, and Parkinson's disease. Environ Health Perspect 119, 866-72 (2011).

361. Betarbet, R. et al. Chronic systemic pesticide exposure reproduces features of Parkinson's disease. Nat Neurosci 3, 1301-6 (2000).

362. Cannon, J.R. et al. A highly reproducible rotenone model of Parkinson's disease. Neurobiol Dis 34, 279-90 (2009).

363. Henchcliffe, C. & Beal, M.F. Mitochondrial biology and oxidative stress in Parkinson disease pathogenesis. Nat Clin Pract Neurol 4, 600-9 (2008).

364. Uversky, V.N. Neurotoxicant-induced animal models of Parkinson's disease: understanding the role of rotenone, maneb and paraquat in neurodegeneration. Cell Tissue Res 318, 225-41 (2004).

204

365. Richardson, J.R., Quan, Y., Sherer, T.B., Greenamyre, J.T. & Miller, G.W. Paraquat neurotoxicity is distinct from that of MPTP and rotenone. Toxicol Sci 88, 193-201 (2005).

366. Jackson-Lewis, V. & Przedborski, S. Protocol for the MPTP mouse model of Parkinson's disease. Nat Protoc 2, 141-51 (2007).

367. Przedborski, S. et al. Oxidative post-translational modifications of alpha-synuclein in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinson's disease. J Neurochem 76, 637-40 (2001).

368. Przedborski, S., Tieu, K., Perier, C. & Vila, M. MPTP as a mitochondrial neurotoxic model of Parkinson's disease. J Bioenerg Biomembr 36, 375-9 (2004).

369. Masoud, S.T. et al. Increased expression of the dopamine transporter leads to loss of dopamine neurons, oxidative stress and l-DOPA reversible motor deficits. Neurobiol Dis 74, 66-75 (2015).

370. Rommelfanger, K.S., Weinshenker, D. & Miller, G.W. Reduced MPTP toxicity in noradrenaline transporter knockout mice. J Neurochem 91, 1116-24 (2004).

371. Bezard, E. et al. Absence of MPTP-induced neuronal death in mice lacking the dopamine transporter. Exp Neurol 155, 268-73 (1999).

372. Gainetdinov, R.R., Fumagalli, F., Jones, S.R. & Caron, M.G. Dopamine transporter is required for in vivo MPTP neurotoxicity: evidence from mice lacking the transporter. J Neurochem 69, 1322-5 (1997).

373. Marien, M., Briley, M. & Colpaert, F. Noradrenaline depletion exacerbates MPTP- induced striatal dopamine loss in mice. Eur J Pharmacol 236, 487-9 (1993).

374. Zhang, Y., Dawson, V.L. & Dawson, T.M. Oxidative stress and genetics in the pathogenesis of Parkinson's disease. Neurobiol Dis 7, 240-50 (2000).

375. Zhou, R.M. et al. Molecular interaction of alpha-synuclein with tubulin influences on the polymerization of microtubule in vitro and structure of microtubule in cells. Mol Biol Rep 37, 3183-92 (2010).

376. Volpicelli-Daley, L.A. et al. Exogenous alpha-synuclein fibrils induce Lewy body pathology leading to synaptic dysfunction and neuron death. Neuron 72, 57-71 (2011).

377. Luk, K.C. et al. Pathological alpha-synuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice. Science 338, 949-53 (2012).

378. Luk, K.C. et al. Intracerebral inoculation of pathological alpha-synuclein initiates a rapidly progressive neurodegenerative alpha-synucleinopathy in mice. J Exp Med 209, 975-86 (2012).

205

379. Paumier, K.L. et al. Intrastriatal injection of pre-formed mouse alpha-synuclein fibrils into rats triggers alpha-synuclein pathology and bilateral nigrostriatal degeneration. Neurobiol Dis 82, 185-99 (2015).

380. Alexander, G.E. Biology of Parkinson's disease: pathogenesis and pathophysiology of a multisystem neurodegenerative disorder. Dialogues Clin Neurosci 6, 259-80 (2004).

381. Bohnen, N.I. & Albin, R.L. The cholinergic system and Parkinson disease. Behav Brain Res 221, 564-73 (2011).

382. Ballanger, B. et al. Cerebral blood flow changes induced by pedunculopontine nucleus stimulation in patients with advanced Parkinson's disease: a [(15)O] H2O PET study. Hum Brain Mapp 30, 3901-9 (2009).

383. Garcia-Rill, E. et al. Pedunculopontine arousal system physiology - Deep brain stimulation (DBS). Sleep Sci 8, 153-61 (2015).

384. Pahapill, P.A. & Lozano, A.M. The pedunculopontine nucleus and Parkinson's disease. Brain 123 ( Pt 9), 1767-83 (2000).

385. Grace, K.P., Liu, H. & Horner, R.L. 5-HT1A receptor-responsive pedunculopontine tegmental neurons suppress REM sleep and respiratory motor activity. J Neurosci 32, 1622-33 (2012).

386. Del Tredici, K., Rub, U., De Vos, R.A., Bohl, J.R. & Braak, H. Where does parkinson disease pathology begin in the brain? J Neuropathol Exp Neurol 61, 413-26 (2002).

387. Delaville, C., Deurwaerdere, P.D. & Benazzouz, A. Noradrenaline and Parkinson's disease. Front Syst Neurosci 5, 31 (2011).

388. Pifl, C., Kish, S.J. & Hornykiewicz, O. Thalamic noradrenaline in Parkinson's disease: deficits suggest role in motor and non-motor symptoms. Mov Disord 27, 1618-24 (2012).

389. Shin, E., Rogers, J.T., Devoto, P., Bjorklund, A. & Carta, M. Noradrenaline neuron degeneration contributes to motor impairments and development of L-DOPA-induced dyskinesia in a rat model of Parkinson's disease. Exp Neurol 257, 25-38 (2014).

390. Taylor, T.N., Alter, S.P., Wang, M., Goldstein, D.S. & Miller, G.W. Reduced vesicular storage of catecholamines causes progressive degeneration in the locus ceruleus. Neuropharmacology 76 Pt A, 97-105 (2014).

391. Taylor, T.N. et al. Nonmotor symptoms of Parkinson's disease revealed in an animal model with reduced monoamine storage capacity. J Neurosci 29, 8103-13 (2009).

392. Paulus, W. & Jellinger, K. The neuropathologic basis of different clinical subgroups of Parkinson's disease. J Neuropathol Exp Neurol 50, 743-55 (1991).

206

393. Mavridis, M., Degryse, A.D., Lategan, A.J., Marien, M.R. & Colpaert, F.C. Effects of locus coeruleus lesions on parkinsonian signs, striatal dopamine and substantia nigra cell loss after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine in monkeys: a possible role for the locus coeruleus in the progression of Parkinson's disease. Neuroscience 41, 507-23 (1991).

394. Aston-Jones, G. & Bloom, F.E. Activity of norepinephrine-containing locus coeruleus neurons in behaving rats anticipates fluctuations in the sleep-waking cycle. J Neurosci 1, 876-86 (1981).

395. Amino, T. et al. Profound cardiac sympathetic denervation occurs in Parkinson disease. Brain Pathol 15, 29-34 (2005).

396. Goldstein, D.S. et al. Cardiac sympathetic denervation preceding motor signs in Parkinson disease. Clin Auton Res 17, 118-21 (2007).

397. Korchounov, A., Meyer, M.F. & Krasnianski, M. Postsynaptic nigrostriatal dopamine receptors and their role in movement regulation. J Neural Transm (Vienna) 117, 1359-69 (2010).

398. Peever, J., Luppi, P.H. & Montplaisir, J. Breakdown in REM sleep circuitry underlies REM sleep behavior disorder. Trends Neurosci 37, 279-88 (2014).

399. Swick, T.J. Parkinson's disease and sleep/wake disturbances. Parkinsons Dis 2012, 205471 (2012).

400. Postuma, R.B., Gagnon, J.F., Rompre, S. & Montplaisir, J.Y. Severity of REM atonia loss in idiopathic REM sleep behavior disorder predicts Parkinson disease. Neurology 74, 239-44 (2010).

401. Rodrigues Brazete, J. et al. Electroencephalogram slowing predicts neurodegeneration in rapid eye movement sleep behavior disorder. Neurobiol Aging 37, 74-81 (2016).

402. Garcia-Lorenzo, D. et al. The coeruleus/subcoeruleus complex in rapid eye movement sleep behaviour disorders in Parkinson's disease. Brain 136, 2120-9 (2013).

403. Hirsch, E., Graybiel, A.M. & Agid, Y.A. Melanized dopaminergic neurons are differentially susceptible to degeneration in Parkinson's disease. Nature 334, 345-8 (1988).

404. Jenner, P. Oxidative stress and Parkinson's disease. Handb Clin Neurol 83, 507-20 (2007).

405. Eisensehr, I. et al. Reduced striatal dopamine transporters in idiopathic rapid eye movement sleep behaviour disorder. Comparison with Parkinson's disease and controls. Brain 123 ( Pt 6), 1155-60 (2000).

207

406. Iranzo, A. et al. Decreased striatal dopamine transporter uptake and substantia nigra hyperechogenicity as risk markers of synucleinopathy in patients with idiopathic rapid-eye-movement sleep behaviour disorder: a prospective study [corrected]. Lancet Neurol 9, 1070-7.

407. Arnulf, I., Leu, S. & Oudiette, D. Abnormal sleep and sleepiness in Parkinson's disease. Curr Opin Neurol 21, 472-7 (2008).

408. Arnulf, I. & Leu-Semenescu, S. Sleepiness in Parkinson's disease. Parkinsonism Relat Disord 15 Suppl 3, S101-4 (2009).

409. Suzuki, K., Miyamoto, M., Miyamoto, T. & Hirata, K. Parkinson's disease and sleep/wake disturbances. Curr Neurol Neurosci Rep 15, 8 (2015).

410. Aston-Jones, G., Chen, S., Zhu, Y. & Oshinsky, M.L. A neural circuit for circadian regulation of arousal. Nat Neurosci 4, 732-8 (2001).

411. Haehner, A. et al. Prevalence of smell loss in Parkinson's disease--a multicenter study. Parkinsonism Relat Disord 15, 490-4 (2009).

412. Duncan, G.W. et al. Health-related quality of life in early Parkinson's disease: the impact of nonmotor symptoms. Mov Disord 29, 195-202 (2014).

413. Cilia, R. et al. Pathological gambling in patients with Parkinson's disease is associated with fronto-striatal disconnection: a path modeling analysis. Mov Disord 26, 225-33 (2011).

414. Cilia, R. et al. Reduced dopamine transporter density in the ventral striatum of patients with Parkinson's disease and pathological gambling. Neurobiol Dis 39, 98- 104 (2010).

415. Steeves, T.D. et al. Increased striatal dopamine release in Parkinsonian patients with pathological gambling: a [11C] raclopride PET study. Brain 132, 1376-85 (2009).

416. Dodd, M.L. et al. Pathological gambling caused by drugs used to treat Parkinson disease. Arch Neurol 62, 1377-81 (2005).

417. Drapier, D. et al. Pathological gambling secondary to dopaminergic therapy in Parkinson's disease. Psychiatry Res 144, 241-4 (2006).

418. Stamey, W. & Jankovic, J. Impulse control disorders and pathological gambling in patients with Parkinson disease. Neurologist 14, 89-99 (2008).

419. Dissanayaka, N.N. et al. Anxiety disorders in Parkinson's disease: prevalence and risk factors. Mov Disord 25, 838-45 (2010).

208

420. Henderson, R., Kurlan, R., Kersun, J.M. & Como, P. Preliminary examination of the comorbidity of anxiety and depression in Parkinson's disease. J Neuropsychiatry Clin Neurosci 4, 257-64 (1992).

421. Menza, M.A., Robertson-Hoffman, D.E. & Bonapace, A.S. Parkinson's disease and anxiety: comorbidity with depression. Biol Psychiatry 34, 465-70 (1993).

422. Broeders, M. et al. Evolution of mild cognitive impairment in Parkinson disease. Neurology 81, 346-52 (2013).

423. Picillo, M. et al. Evolution of mild cognitive impairment in Parkinson disease. Neurology 82, 1384 (2014).

424. Schmitt, F.A., Farlow, M.R., Meng, X., Tekin, S. & Olin, J.T. Efficacy of rivastigmine on executive function in patients with Parkinson's disease dementia. CNS Neurosci Ther 16, 330-6 (2010).

425. Firbank, M. et al. Neural correlates of attention-executive dysfunction in lewy body dementia and Alzheimer's disease. Hum Brain Mapp (2015).

426. Sauer, J., ffytche, D.H., Ballard, C., Brown, R.G. & Howard, R. Differences between Alzheimer's disease and dementia with Lewy bodies: an fMRI study of task-related brain activity. Brain 129, 1780-8 (2006).

427. Zaldivar, A. & Krichmar, J.L. Interactions between the neuromodulatory systems and the amygdala: exploratory survey using the Allen Mouse Brain Atlas. Brain Struct Funct 218, 1513-30 (2013).

428. Beal, M.F. Excitotoxicity and nitric oxide in Parkinson's disease pathogenesis. Ann Neurol 44, S110-4 (1998).

429. Moon, H.E. & Paek, S.H. Mitochondrial Dysfunction in Parkinson's Disease. Exp Neurobiol 24, 103-16 (2015).

430. Perier, C., Bove, J. & Vila, M. Mitochondria and programmed cell death in Parkinson's disease: apoptosis and beyond. Antioxid Redox Signal 16, 883-95 (2012).

431. Moon, H.E. et al. Mitochondrial dysfunction of immortalized human adipose tissue- derived mesenchymal stromal cells from patients with Parkinson's disease. Exp Neurobiol 22, 283-300 (2013).

432. Keeney, P.M., Xie, J., Capaldi, R.A. & Bennett, J.P., Jr. Parkinson's disease brain mitochondrial complex I has oxidatively damaged subunits and is functionally impaired and misassembled. J Neurosci 26, 5256-64 (2006).

433. Parker, W.D., Jr., Parks, J.K. & Swerdlow, R.H. Complex I deficiency in Parkinson's disease frontal cortex. Brain Res 1189, 215-8 (2008).

209

434. Schapira, A.H. Mitochondrial complex I deficiency in Parkinson's disease. Adv Neurol 60, 288-91 (1993).

435. Dexter, D.T. et al. Basal lipid peroxidation in substantia nigra is increased in Parkinson's disease. J Neurochem 52, 381-9 (1989).

436. Zhang, J. et al. Parkinson's disease is associated with oxidative damage to cytoplasmic DNA and RNA in substantia nigra neurons. Am J Pathol 154, 1423-9 (1999).

437. Fornai, F. et al. Parkinson-like syndrome induced by continuous MPTP infusion: convergent roles of the ubiquitin-proteasome system and alpha-synuclein. Proc Natl Acad Sci U S A 102, 3413-8 (2005).

438. Martin, L.J. et al. Parkinson's disease alpha-synuclein transgenic mice develop neuronal mitochondrial degeneration and cell death. J Neurosci 26, 41-50 (2006).

439. Song, D.D., Shults, C.W., Sisk, A., Rockenstein, E. & Masliah, E. Enhanced substantia nigra mitochondrial pathology in human alpha-synuclein transgenic mice after treatment with MPTP. Exp Neurol 186, 158-72 (2004).

440. Green, D.R. & Kroemer, G. The pathophysiology of mitochondrial cell death. Science 305, 626-9 (2004).

441. Charan, R.A., Johnson, B.N., Zaganelli, S., Nardozzi, J.D. & LaVoie, M.J. Inhibition of apoptotic Bax translocation to the mitochondria is a central function of parkin. Cell Death Dis 5, e1313 (2014).

442. Rivero-Rios, P., Gomez-Suaga, P., Fdez, E. & Hilfiker, S. Upstream deregulation of calcium signaling in Parkinson's disease. Front Mol Neurosci 7, 53 (2014).

443. Brautigam, C. et al. Biochemical hallmarks of tyrosine hydroxylase deficiency. Clin Chem 44, 1897-904 (1998).

444. Jenner, P. Oxidative stress in Parkinson's disease. Ann Neurol 53 Suppl 3, S26-36; discussion S36-8 (2003).

445. Jenner, P., Dexter, D.T., Sian, J., Schapira, A.H. & Marsden, C.D. Oxidative stress as a cause of nigral cell death in Parkinson's disease and incidental Lewy body disease. The Royal Kings and Queens Parkinson's Disease Research Group. Ann Neurol 32 Suppl, S82-7 (1992).

446. Spina, M.B. & Cohen, G. Dopamine turnover and glutathione oxidation: implications for Parkinson disease. Proc Natl Acad Sci U S A 86, 1398-400 (1989).

447. Cebrian, C., Loike, J.D. & Sulzer, D. Neuroinflammation in Parkinson's disease animal models: a cell stress response or a step in neurodegeneration? Curr Top Behav Neurosci 22, 237-70 (2015).

210

448. Hirsch, E.C. & Hunot, S. Pathophysiological involvement of neuroinflammation in various neurological disorders. J Neural Transm (Vienna) 117, 897-8 (2010).

449. Najjar, S. et al. Brain biopsy findings link major depressive disorder to neuroinflammation, oxidative stress, and neurovascular dysfunction: a case report. Biol Psychiatry 75, e23-6 (2014).

450. Tansey, M.G. & Goldberg, M.S. Neuroinflammation in Parkinson's disease: its role in neuronal death and implications for therapeutic intervention. Neurobiol Dis 37, 510-8 (2010).

451. Vroon, A. et al. Neuroinflammation in Parkinson's patients and MPTP-treated mice is not restricted to the nigrostriatal system: microgliosis and differential expression of interleukin-1 receptors in the olfactory bulb. Exp Gerontol 42, 762-71 (2007).

452. Perry, T.L. & Yong, V.W. Idiopathic Parkinson's disease, progressive supranuclear palsy and glutathione metabolism in the substantia nigra of patients. Neurosci Lett 67, 269-74 (1986).

453. Marshall, K.A., Daniel, S.E., Cairns, N., Jenner, P. & Halliwell, B. Upregulation of the anti-apoptotic protein Bcl-2 may be an early event in neurodegeneration: studies on Parkinson's and incidental Lewy body disease. Biochem Biophys Res Commun 240, 84-7 (1997).

454. Fahn, S. The history of dopamine and levodopa in the treatment of Parkinson's disease. Mov Disord 23 Suppl 3, S497-508 (2008).

455. Langston, J.W.a.T., J.W. (2010).

456. Dunnett, S.B. & Bjorklund, A. Prospects for new restorative and neuroprotective treatments in Parkinson's disease. Nature 399, A32-9 (1999).

457. Giasson, B.I. et al. Oxidative damage linked to neurodegeneration by selective alpha- synuclein nitration in synucleinopathy lesions. Science 290, 985-9 (2000).

458. Norris, E.H. & Giasson, B.I. Role of oxidative damage in protein aggregation associated with Parkinson's disease and related disorders. Antioxid Redox Signal 7, 672-84 (2005).

459. Hastings, T.G., Lewis, D.A. & Zigmond, M.J. Role of oxidation in the neurotoxic effects of intrastriatal dopamine injections. Proc Natl Acad Sci U S A 93, 1956-61 (1996).

460. Sulzer, D. & Zecca, L. Intraneuronal dopamine-quinone synthesis: a review. Neurotox Res 1, 181-95 (2000).

461. Caudle, W.M. et al. Reduced vesicular storage of dopamine causes progressive nigrostriatal neurodegeneration. J Neurosci 27, 8138-48 (2007).

211

462. Hirsch, E.C. & Hunot, S. Neuroinflammation in Parkinson's disease: a target for neuroprotection? Lancet Neurol 8, 382-97 (2009).

463. McGeer, P.L., Itagaki, S., Boyes, B.E. & McGeer, E.G. Reactive microglia are positive for HLA-DR in the substantia nigra of Parkinson's and Alzheimer's disease brains. Neurology 38, 1285-91 (1988).

464. Hirsch, E.C., Vyas, S. & Hunot, S. Neuroinflammation in Parkinson's disease. Parkinsonism Relat Disord 18 Suppl 1, S210-2 (2012).

465. Collins, L.M., Toulouse, A., Connor, T.J. & Nolan, Y.M. Contributions of central and systemic inflammation to the pathophysiology of Parkinson's disease. Neuropharmacology 62, 2154-68 (2012).

466. Czlonkowska, A., Kohutnicka, M., Kurkowska-Jastrzebska, I. & Czlonkowski, A. Microglial reaction in MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) induced Parkinson's disease mice model. Neurodegeneration 5, 137-43 (1996).

467. Lee, K.W. et al. Apoptosis signal-regulating kinase 1 mediates MPTP toxicity and regulates glial activation. PLoS One 7, e29935 (2012).

468. Wang, Q. et al. Endogenous dynorphin protects against neurotoxin-elicited nigrostriatal dopaminergic neuron damage and motor deficits in mice. J Neuroinflammation 9, 124 (2012).

469. Rojo, A.I. et al. Nrf2 regulates microglial dynamics and neuroinflammation in experimental Parkinson's disease. Glia 58, 588-98 (2010).

470. Russo, I., Bubacco, L. & Greggio, E. LRRK2 and neuroinflammation: partners in crime in Parkinson's disease? J Neuroinflammation 11, 52 (2014).

471. Sekiyama, K. et al. Neuroinflammation in Parkinson's Disease and Related Disorders: A Lesson from Genetically Manipulated Mouse Models of alpha-Synucleinopathies. Parkinsons Dis 2012, 271732 (2012).

472. Taylor, J.M., Main, B.S. & Crack, P.J. Neuroinflammation and oxidative stress: co- conspirators in the pathology of Parkinson's disease. Neurochem Int 62, 803-19 (2013).

473. Wilhelmus, M.M., Nijland, P.G., Drukarch, B., de Vries, H.E. & van Horssen, J. Involvement and interplay of Parkin, PINK1, and DJ1 in neurodegenerative and neuroinflammatory disorders. Free Radic Biol Med 53, 983-92 (2012).

474. Frank-Cannon, T.C., Alto, L.T., McAlpine, F.E. & Tansey, M.G. Does neuroinflammation fan the flame in neurodegenerative diseases? Mol Neurodegener 4, 47 (2009).

212

475. Frank-Cannon, T.C. et al. Parkin deficiency increases vulnerability to inflammation- related nigral degeneration. J Neurosci 28, 10825-34 (2008).

476. Tansey, M.G. et al. Neuroinflammation in Parkinson's disease: is there sufficient evidence for mechanism-based interventional therapy? Front Biosci 13, 709-17 (2008).

477. Hoban, D.B. et al. Further characterisation of the LPS model of Parkinson's disease: a comparison of intra-nigral and intra-striatal lipopolysaccharide administration on motor function, microgliosis and nigrostriatal neurodegeneration in the rat. Brain Behav Immun 27, 91-100 (2013).

478. Hirsch, E.C. et al. The role of glial reaction and inflammation in Parkinson's disease. Ann N Y Acad Sci 991, 214-28 (2003).

479. Jagmag, S.A., Tripathi, N., Shukla, S.D., Maiti, S. & Khurana, S. Evaluation of Models of Parkinson's Disease. Front Neurosci 9, 503 (2015).

480. Abeliovich, A. et al. Mice lacking alpha-synuclein display functional deficits in the nigrostriatal dopamine system. Neuron 25, 239-52 (2000).

481. Zarranz, J.J. et al. The new mutation, E46K, of alpha-synuclein causes Parkinson and Lewy body dementia. Ann Neurol 55, 164-73 (2004).

482. Chen, L., Xie, Z., Turkson, S. & Zhuang, X. A53T human alpha-synuclein overexpression in transgenic mice induces pervasive mitochondria macroautophagy defects preceding dopamine neuron degeneration. J Neurosci 35, 890-905 (2015).

483. Gispert, S. et al. Transgenic mice expressing mutant A53T human alpha-synuclein show neuronal dysfunction in the absence of aggregate formation. Mol Cell Neurosci 24, 419-29 (2003).

484. Kumar, S., Sarkar, A. & Sundar, D. Controlling aggregation propensity in A53T mutant of alpha-synuclein causing Parkinson's disease. Biochem Biophys Res Commun 387, 305-9 (2009).

485. Li, J., Uversky, V.N. & Fink, A.L. Effect of familial Parkinson's disease point mutations A30P and A53T on the structural properties, aggregation, and fibrillation of human alpha-synuclein. Biochemistry 40, 11604-13 (2001).

486. Zhang, S., Xiao, Q. & Le, W. Olfactory dysfunction and neurotransmitter disturbance in olfactory bulb of transgenic mice expressing human A53T mutant alpha-synuclein. PLoS One 10, e0119928 (2015).

487. Chesselet, M.F. et al. A progressive mouse model of Parkinson's disease: the Thy1- aSyn ("Line 61") mice. Neurotherapeutics 9, 297-314 (2012).

213

488. Magen, I. et al. Cognitive deficits in a mouse model of pre-manifest Parkinson's disease. Eur J Neurosci 35, 870-82 (2012).

489. Watson, M.B. et al. Regionally-specific microglial activation in young mice overexpressing human wildtype alpha-synuclein. Exp Neurol 237, 318-34 (2012).

490. Chou, J.S. et al. (G2019S) LRRK2 causes early-phase dysfunction of SNpc dopaminergic neurons and impairment of corticostriatal long-term depression in the PD transgenic mouse. Neurobiol Dis 68, 190-9 (2014).

491. Li, X. et al. Enhanced striatal dopamine transmission and motor performance with LRRK2 overexpression in mice is eliminated by familial Parkinson's disease mutation G2019S. J Neurosci 30, 1788-97 (2010).

492. Saez-Atienzar, S. et al. Bcl-xL-mediated antioxidant function abrogates the disruption of mitochondrial dynamics induced by LRRK2 inhibition. Biochim Biophys Acta 1862, 20-31 (2016).

493. Sweet, E.S., Saunier-Rebori, B., Yue, Z. & Blitzer, R.D. The Parkinson's Disease- Associated Mutation LRRK2-G2019S Impairs Synaptic Plasticity in Mouse Hippocampus. J Neurosci 35, 11190-5 (2015).

494. Li, Y. et al. Mutant LRRK2(R1441G) BAC transgenic mice recapitulate cardinal features of Parkinson's disease. Nat Neurosci 12, 826-8 (2009).

495. Zuo, L. & Motherwell, M.S. The impact of reactive oxygen species and genetic mitochondrial mutations in Parkinson's disease. Gene 532, 18-23 (2013).

496. Clark, I.E. et al. Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature 441, 1162-6 (2006).

497. Liu, W. et al. Pink1 regulates the oxidative phosphorylation machinery via mitochondrial fission. Proc Natl Acad Sci U S A 108, 12920-4 (2011).

498. Morais, V.A. et al. Parkinson's disease mutations in PINK1 result in decreased Complex I activity and deficient synaptic function. EMBO Mol Med 1, 99-111 (2009).

499. Lu, X.H. et al. Bacterial artificial chromosome transgenic mice expressing a truncated mutant parkin exhibit age-dependent hypokinetic motor deficits, dopaminergic neuron degeneration, and accumulation of proteinase K-resistant alpha-synuclein. J Neurosci 29, 1962-76 (2009).

500. Dauer, W. & Przedborski, S. Parkinson's disease: mechanisms and models. Neuron 39, 889-909 (2003).

501. Ramsey, C.P. & Tansey, M.G. A survey from 2012 of evidence for the role of neuroinflammation in neurotoxin animal models of Parkinson's disease and potential molecular targets. Exp Neurol 256, 126-32 (2014).

214

502. Mao, W., Iwai, C., Keng, P.C., Vulapalli, R. & Liang, C.S. Norepinephrine-induced oxidative stress causes PC-12 cell apoptosis by both endoplasmic reticulum stress and mitochondrial intrinsic pathway: inhibition of phosphatidylinositol 3-kinase survival pathway. Am J Physiol Cell Physiol 290, C1373-84 (2006).

503. Mao, W., Iwai, C., Qin, F. & Liang, C.S. Norepinephrine induces endoplasmic reticulum stress and downregulation of norepinephrine transporter density in PC12 cells via oxidative stress. Am J Physiol Heart Circ Physiol 288, H2381-9 (2005).

504. Vernon, A.C. Mice with reduced vesicular monoamine storage content display nonmotor features of Parkinson's disease. J Neurosci 29, 12842-4 (2009).

505. Cicchetti, F., Drouin-Ouellet, J. & Gross, R.E. Environmental toxins and Parkinson's disease: what have we learned from pesticide-induced animal models? Trends Pharmacol Sci 30, 475-83 (2009).

506. Chaves, R.S., Melo, T.Q., Martins, S.A. & Ferrari, M.F. Protein aggregation containing beta-amyloid, alpha-synuclein and hyperphosphorylated tau in cultured cells of hippocampus, substantia nigra and locus coeruleus after rotenone exposure. BMC Neurosci 11, 144 (2010).

507. Hoglinger, G.U. et al. Chronic systemic complex I inhibition induces a hypokinetic multisystem degeneration in rats. J Neurochem 84, 491-502 (2003).

508. Lin, C.H., Huang, J.Y., Ching, C.H. & Chuang, J.I. Melatonin reduces the neuronal loss, downregulation of dopamine transporter, and upregulation of D2 receptor in rotenone-induced parkinsonian rats. J Pineal Res 44, 205-13 (2008).

509. Alam, M. & Schmidt, W.J. L-DOPA reverses the hypokinetic behaviour and rigidity in rotenone-treated rats. Behav Brain Res 153, 439-46 (2004).

510. Coulom, H. & Birman, S. Chronic exposure to rotenone models sporadic Parkinson's disease in Drosophila melanogaster. J Neurosci 24, 10993-8 (2004).

511. Sherer, T.B. et al. Mechanism of toxicity in rotenone models of Parkinson's disease. J Neurosci 23, 10756-64 (2003).

512. Fleming, S.M. et al. Behavioral and immunohistochemical effects of chronic intravenous and subcutaneous infusions of varying doses of rotenone. Exp Neurol 187, 418-29 (2004).

513. Sian-Hulsmann, J., Mandel, S., Youdim, M.B. & Riederer, P. The relevance of iron in the pathogenesis of Parkinson's disease. J Neurochem 118, 939-57 (2011).

514. Zang, L.Y. & Misra, H.P. Generation of reactive oxygen species during the monoamine oxidase-catalyzed oxidation of the neurotoxicant, 1-methyl-4-phenyl- 1,2,3,6-tetrahydropyridine. J Biol Chem 268, 16504-12 (1993).

215

515. Chiba, K., Trevor, A. & Castagnoli, N., Jr. Metabolism of the neurotoxic tertiary amine, MPTP, by brain monoamine oxidase. Biochem Biophys Res Commun 120, 574-8 (1984).

516. Chiba, K., Trevor, A.J. & Castagnoli, N., Jr. Active uptake of MPP+, a metabolite of MPTP, by brain synaptosomes. Biochem Biophys Res Commun 128, 1228-32 (1985).

517. Smeyne, R.J. & Jackson-Lewis, V. The MPTP model of Parkinson's disease. Brain Res Mol Brain Res 134, 57-66 (2005).

518. Kalivendi, S.V. et al. Alpha-synuclein up-regulation and aggregation during MPP+- induced apoptosis in neuroblastoma cells: intermediacy of transferrin receptor iron and hydrogen peroxide. J Biol Chem 279, 15240-7 (2004).

519. Kalivendi, S.V. et al. 1-Methyl-4-phenylpyridinium (MPP+)-induced apoptosis and mitochondrial oxidant generation: role of transferrin-receptor-dependent iron and hydrogen peroxide. Biochem J 371, 151-64 (2003).

520. Gainetdinov, R.R. et al. Increased MPTP neurotoxicity in vesicular monoamine transporter 2 heterozygote knockout mice. J Neurochem 70, 1973-8 (1998).

521. Betarbet, R., Sherer, T.B. & Greenamyre, J.T. Ubiquitin-proteasome system and Parkinson's diseases. Exp Neurol 191 Suppl 1, S17-27 (2005).

522. Cook, C. & Petrucelli, L. A critical evaluation of the ubiquitin-proteasome system in Parkinson's disease. Biochim Biophys Acta 1792, 664-75 (2009).

523. Hasbani, D.M., Perez, F.A., Palmiter, R.D. & O'Malley, K.L. Dopamine depletion does not protect against acute 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine toxicity in vivo. J Neurosci 25, 9428-33 (2005).

524. Halliday, G. et al. No Lewy pathology in monkeys with over 10 years of severe MPTP Parkinsonism. Mov Disord 24, 1519-23 (2009).

525. Dryanovski, D.I. et al. Calcium entry and alpha-synuclein inclusions elevate dendritic mitochondrial oxidant stress in dopaminergic neurons. J Neurosci 33, 10154-64 (2013).

526. De La Cruz, C.P. et al. Oxidative inactivation of tyrosine hydroxylase in substantia nigra of aged rat. Free Radic Biol Med 20, 53-61 (1996).

527. Locke, C.J., Fox, S.A., Caldwell, G.A. & Caldwell, K.A. Acetaminophen attenuates dopamine neuron degeneration in animal models of Parkinson's disease. Neurosci Lett 439, 129-33 (2008).

528. Park, S.S., Schulz, E.M. & Lee, D. Disruption of dopamine homeostasis underlies selective neurodegeneration mediated by alpha-synuclein. Eur J Neurosci 26, 3104-12 (2007).

216

529. Stathakis, D.G. et al. The catecholamines up (Catsup) protein of Drosophila melanogaster functions as a negative regulator of tyrosine hydroxylase activity. Genetics 153, 361-82 (1999).

530. Casper, D., Yaparpalvi, U., Rempel, N. & Werner, P. Ibuprofen protects dopaminergic neurons against glutamate toxicity in vitro. Neurosci Lett 289, 201-4 (2000).

531. Hornykiewicz, O. Dopamine (3-hydroxytyramine) and brain function. Pharmacol Rev 18, 925-64 (1966).

532. Maharaj, D.S., Saravanan, K.S., Maharaj, H., Mohanakumar, K.P. & Daya, S. Acetaminophen and aspirin inhibit superoxide anion generation and lipid peroxidation, and protect against 1-methyl-4-phenyl pyridinium-induced dopaminergic neurotoxicity in rats. Neurochem Int 44, 355-60 (2004).

533. Salamone, J.D. & Correa, M. The mysterious motivational functions of mesolimbic dopamine. Neuron 76, 470-85 (2012).

534. Schultz, W. Multiple dopamine functions at different time courses. Annu Rev Neurosci 30, 259-88 (2007).

535. Melikian, H.E. & Buckley, K.M. Membrane trafficking regulates the activity of the human dopamine transporter. J Neurosci 19, 7699-710 (1999).

536. Lee, F.J., Liu, F., Pristupa, Z.B. & Niznik, H.B. Direct binding and functional coupling of alpha-synuclein to the dopamine transporters accelerate dopamine- induced apoptosis. FASEB J 15, 916-26 (2001).

537. Lee, K.H., Kim, M.Y., Kim, D.H. & Lee, Y.S. Syntaxin 1A and receptor for activated C kinase interact with the N-terminal region of human dopamine transporter. Neurochem Res 29, 1405-9 (2004).

538. Lee, S.H., Kang, S.S., Son, H. & Lee, Y.S. The region of dopamine transporter encompassing the 3rd transmembrane domain is crucial for function. Biochem Biophys Res Commun 246, 347-52 (1998).

539. Moron, J.A. et al. Mitogen-activated protein kinase regulates dopamine transporter surface expression and dopamine transport capacity. J Neurosci 23, 8480-8 (2003).

540. Moszczynska, A. et al. Parkin disrupts the alpha-synuclein/dopamine transporter interaction: consequences toward dopamine-induced toxicity. J Mol Neurosci 32, 217- 27 (2007).

541. Carneiro, A.M. et al. The multiple LIM domain-containing adaptor protein Hic-5 synaptically colocalizes and interacts with the dopamine transporter. J Neurosci 22, 7045-54 (2002).

217

542. Foster, J.D., Pananusorn, B. & Vaughan, R.A. Dopamine transporters are phosphorylated on N-terminal serines in rat striatum. J Biol Chem 277, 25178-86 (2002).

543. Vaughan, R.A., Huff, R.A., Uhl, G.R. & Kuhar, M.J. Protein kinase C-mediated phosphorylation and functional regulation of dopamine transporters in striatal synaptosomes. J Biol Chem 272, 15541-6 (1997).

544. Salahpour, A., Medvedev, I.O., Beaulieu, J.M., Gainetdinov, R.R. & Caron, M.G. Local knockdown of genes in the brain using small interfering RNA: a phenotypic comparison with knockout animals. Biol Psychiatry 61, 65-9 (2007).

545. Khoshbouei, H. et al. N-terminal phosphorylation of the dopamine transporter is required for amphetamine-induced efflux. PLoS Biol 2, E78 (2004).

546. Gong, S. & Yang, X.W. Modification of bacterial artificial chromosomes (BACs) and preparation of intact BAC DNA for generation of transgenic mice. Curr Protoc Neurosci Chapter 5, Unit 5 21 (2005).

547. Gong, S., Yang, X.W., Li, C. & Heintz, N. Highly efficient modification of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6Kgamma origin of replication. Genome Res 12, 1992-8 (2002).

548. Fahn, S. Description of Parkinson's disease as a clinical syndrome. Ann N Y Acad Sci 991, 1-14 (2003).

549. Miller, G.W., Gainetdinov, R.R., Levey, A.I. & Caron, M.G. Dopamine transporters and neuronal injury. Trends Pharmacol Sci 20, 424-9 (1999).

550. Miller, G.W. et al. Immunochemical analysis of dopamine transporter protein in Parkinson's disease. Ann Neurol 41, 530-9 (1997).

551. Haavik, J. L-DOPA is a substrate for tyrosine hydroxylase. J Neurochem 69, 1720-8 (1997).

552. Mori, F. et al. Relationship among alpha-synuclein accumulation, dopamine synthesis, and neurodegeneration in Parkinson disease substantia nigra. J Neuropathol Exp Neurol 65, 808-15 (2006).

553. Kaneda, N. et al. Tissue-specific and high-level expression of the human tyrosine hydroxylase gene in transgenic mice. Neuron 6, 583-94 (1991).

554. Vecchio, L.M., Bermejo, M.K., Beerepoot, P., Ramsey, A.J. & Salahpour, A. N- terminal tagging of the dopamine transporter impairs protein expression and trafficking in vivo. Mol Cell Neurosci 61, 123-32 (2014).

555. Gong, S., Kus, L. & Heintz, N. Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis. Nat Protoc 5, 1678-96 (2010).

218

556. Burkhart, C.A., Norris, M.D. & Haber, M. A simple method for the isolation of genomic DNA from mouse tail free of real-time PCR inhibitors. J Biochem Biophys Methods 52, 145-9 (2002).

557. Ballester, M., Castello, A., Ibanez, E., Sanchez, A. & Folch, J.M. Real-time quantitative PCR-based system for determining transgene copy number in transgenic animals. Biotechniques 37, 610-3 (2004).

558. D'Haene, B., Vandesompele, J. & Hellemans, J. Accurate and objective copy number profiling using real-time quantitative PCR. Methods 50, 262-70 (2010).

559. Shepherd, C.T., Moran Lauter, A.N. & Scott, M.P. Determination of transgene copy number by real-time quantitative PCR. Methods Mol Biol 526, 129-34 (2009).

560. Livak, K.J. & Schmittgen, T.D. Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-8 (2001).

561. Schmittgen, T.D. & Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3, 1101-8 (2008).

562. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT- PCR. Nucleic Acids Res 29, e45 (2001).

563. Hu, Y.F., Caron, M.G. & Sieber-Blum, M. Norepinephrine transport-mediated gene expression in noradrenergic neurogenesis. BMC Genomics 10, 151 (2009).

564. Javitch, J.A., D'Amato, R.J., Strittmatter, S.M. & Snyder, S.H. Parkinsonism-inducing neurotoxin, N-methyl-4-phenyl-1,2,3,6 -tetrahydropyridine: uptake of the metabolite N-methyl-4-phenylpyridine by dopamine neurons explains selective toxicity. Proc Natl Acad Sci U S A 82, 2173-7 (1985).

565. Zhuang, X. et al. Hyperactivity and impaired response habituation in hyperdopaminergic mice. Proc Natl Acad Sci U S A 98, 1982-7 (2001).

566. Moron, J.A., Perez, V., Pasto, M., Lizcano, J.M. & Unzeta, M. FA-70, a novel selective and irreversible monoamine oxidase-A inhibitor: effect on monoamine metabolism in mouse cerebral cortex. J Pharmacol Exp Ther 292, 788-94 (2000).

567. Aldini, G. et al. Lipoxidation-derived reactive carbonyl species as potential drug targets in preventing protein carbonylation and related cellular dysfunction. ChemMedChem 1, 1045-58 (2006).

568. Dalle-Donne, I., Rossi, R., Giustarini, D., Milzani, A. & Colombo, R. Protein carbonyl groups as biomarkers of oxidative stress. Clin Chim Acta 329, 23-38 (2003).

569. Mandillo, S. et al. Reliability, robustness, and reproducibility in mouse behavioral phenotyping: a cross-laboratory study. Physiol Genomics 34, 243-55 (2008).

219

570. Milenkovic, M., Mielnik, C.A. & Ramsey, A.J. NMDA receptor-deficient mice display sexual dimorphism in the onset and severity of behavioural abnormalities. Genes Brain Behav 13, 850-62 (2014).

571. Ben Abdallah, N.M. et al. The puzzle box as a simple and efficient behavioral test for exploring impairments of general cognition and executive functions in mouse models of schizophrenia. Exp Neurol 227, 42-52 (2011).

572. O'Connor, A.M., Burton, T.J., Leamey, C.A. & Sawatari, A. The use of the puzzle box as a means of assessing the efficacy of environmental enrichment. J Vis Exp (2014).

573. Fleming, S.M. et al. Behavioral effects of dopaminergic agonists in transgenic mice overexpressing human wildtype alpha-synuclein. Neuroscience 142, 1245-53 (2006).

574. Drucker-Colin, R. & Garcia-Hernandez, F. A new motor test sensitive to aging and dopaminergic function. J Neurosci Methods 39, 153-61 (1991).

575. Pietropaolo, S., Sluyter, F. & Crusio, W.E. in Cambridge Handbooks in Behavioural Genetics ; Volume 2 1 online resource (471 pages) (Cambridge University Press, Cambridge, England, 2014).

576. Solvang, H.K., Lingjaerde, O.C., Frigessi, A., Borresen-Dale, A.L. & Kristensen, V.N. Linear and non-linear dependencies between copy number aberrations and mRNA expression reveal distinct molecular pathways in breast cancer. BMC Bioinformatics 12, 197 (2011).

577. Gainetdinov, R.R. et al. Role of serotonin in the paradoxical calming effect of psychostimulants on hyperactivity. Science 283, 397-401 (1999).

578. Lindgren, N. et al. Regulation of tyrosine hydroxylase activity and phosphorylation at Ser(19) and Ser(40) via activation of glutamate NMDA receptors in rat striatum. J Neurochem 74, 2470-7 (2000).

579. Chandran, J.S. et al. Progressive behavioral deficits in DJ-1-deficient mice are associated with normal nigrostriatal function. Neurobiol Dis 29, 505-14 (2008).

580. George, S. et al. Alpha-synuclein transgenic mice exhibit reduced anxiety-like behaviour. Exp Neurol 210, 788-92 (2008).

581. Walf, A.A. & Frye, C.A. The use of the elevated plus maze as an assay of anxiety- related behavior in rodents. Nat Protoc 2, 322-8 (2007).

582. Ralph, R.J., Paulus, M.P., Fumagalli, F., Caron, M.G. & Geyer, M.A. Prepulse inhibition deficits and perseverative motor patterns in dopamine transporter knock-out mice: differential effects of D1 and D2 receptor antagonists. J Neurosci 21, 305-13 (2001).

220

583. Vuillermot, S., Feldon, J. & Meyer, U. Relationship between sensorimotor gating deficits and dopaminergic neuroanatomy in Nurr1-deficient mice. Exp Neurol 232, 22-32 (2011).

584. Yamashita, M. et al. Norepinephrine transporter blockade can normalize the prepulse inhibition deficits found in dopamine transporter knockout mice. Neuropsychopharmacology 31, 2132-9 (2006).

585. Chalermpalanupap, T. et al. Targeting norepinephrine in mild cognitive impairment and Alzheimer's disease. Alzheimers Res Ther 5, 21 (2013).

586. Chamberlain, S.R. & Robbins, T.W. Noradrenergic modulation of cognition: therapeutic implications. J Psychopharmacol 27, 694-718 (2013).

587. Vazey, E.M. & Aston-Jones, G. The emerging role of norepinephrine in cognitive dysfunctions of Parkinson's disease. Front Behav Neurosci 6, 48 (2012).

588. Csardi, G., Franks, A., Choi, D.S., Airoldi, E.M. & Drummond, D.A. Accounting for experimental noise reveals that mRNA levels, amplified by post-transcriptional processes, largely determine steady-state protein levels in yeast. PLoS Genet 11, e1005206 (2015).

589. Vogel, C. et al. Sequence signatures and mRNA concentration can explain two-thirds of protein abundance variation in a human cell line. Mol Syst Biol 6, 400 (2010).

590. Lundberg, E. et al. Defining the transcriptome and proteome in three functionally different human cell lines. Mol Syst Biol 6, 450 (2010).

591. Tillerson, J.L., Caudle, W.M., Reveron, M.E. & Miller, G.W. Detection of behavioral impairments correlated to neurochemical deficits in mice treated with moderate doses of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. Exp Neurol 178, 80-90 (2002).

592. Hastrup, H., Sen, N. & Javitch, J.A. The human dopamine transporter forms a tetramer in the plasma membrane: cross-linking of a cysteine in the fourth transmembrane segment is sensitive to cocaine analogs. J Biol Chem 278, 45045-8 (2003).

593. Rao, A., Richards, T.L., Simmons, D., Zahniser, N.R. & Sorkin, A. Epitope-tagged dopamine transporter knock-in mice reveal rapid endocytic trafficking and filopodia targeting of the transporter in dopaminergic axons. FASEB J 26, 1921-33 (2012).

594. Sorkina, T. et al. RNA interference screen reveals an essential role of Nedd4-2 in dopamine transporter ubiquitination and endocytosis. J Neurosci 26, 8195-205 (2006).

595. Sorkina, T., Richards, T.L., Rao, A., Zahniser, N.R. & Sorkin, A. Negative regulation of dopamine transporter endocytosis by membrane-proximal N-terminal residues. J Neurosci 29, 1361-74 (2009).

221

596. Rao, A., Sorkin, A. & Zahniser, N.R. Mice expressing markedly reduced striatal dopamine transporters exhibit increased locomotor activity, dopamine uptake turnover rate and cocaine responsiveness. Synapse (2013).

597. Foster, J.D., Cervinski, M.A., Gorentla, B.K. & Vaughan, R.A. Regulation of the dopamine transporter by phosphorylation. Handb Exp Pharmacol, 197-214 (2006).

598. Carvelli, L., Blakely, R.D. & DeFelice, L.J. Dopamine transporter/syntaxin 1A interactions regulate transporter channel activity and dopaminergic synaptic transmission. Proc Natl Acad Sci U S A 105, 14192-7 (2008).

599. Carvelli, L., McDonald, P.W., Blakely, R.D. & Defelice, L.J. Dopamine transporters depolarize neurons by a channel mechanism. Proc Natl Acad Sci U S A 101, 16046-51 (2004).

600. Cervinski, M.A., Foster, J.D. & Vaughan, R.A. Syntaxin 1A regulates dopamine transporter activity, phosphorylation and surface expression. Neuroscience 170, 408- 16 (2010).

601. Rickhag, M. et al. A C-terminal PDZ domain-binding sequence is required for striatal distribution of the dopamine transporter. Nat Commun 4, 1580 (2013).

602. Miranda, M., Dionne, K.R., Sorkina, T. & Sorkin, A. Three ubiquitin conjugation sites in the amino terminus of the dopamine transporter mediate protein kinase C- dependent endocytosis of the transporter. Mol Biol Cell 18, 313-23 (2007).

603. Sulzer, D. et al. Neuromelanin biosynthesis is driven by excess cytosolic catecholamines not accumulated by synaptic vesicles. Proc Natl Acad Sci U S A 97, 11869-74 (2000).

604. Goldberg, M.S. et al. Parkin-deficient mice exhibit nigrostriatal deficits but not loss of dopaminergic neurons. J Biol Chem 278, 43628-35 (2003).

605. Fleming, S.M., Ekhator, O.R. & Ghisays, V. Assessment of sensorimotor function in mouse models of Parkinson's disease. J Vis Exp (2013).

606. Fleming, S.M. et al. Early and progressive sensorimotor anomalies in mice overexpressing wild-type human alpha-synuclein. J Neurosci 24, 9434-40 (2004).

607. Coull, J.T. Pharmacological manipulations of the alpha 2-noradrenergic system. Effects on cognition. Drugs Aging 5, 116-26 (1994).

608. Del Tredici, K. & Braak, H. Dysfunction of the locus coeruleus-norepinephrine system and related circuitry in Parkinson's disease-related dementia. J Neurol Neurosurg Psychiatry 84, 774-83 (2013).

222

609. Harris, G.C. & Aston-Jones, G. Beta-adrenergic antagonists attenuate withdrawal anxiety in cocaine- and morphine-dependent rats. Psychopharmacology (Berl) 113, 131-6 (1993).

610. Leri, F., Flores, J., Rodaros, D. & Stewart, J. Blockade of stress-induced but not cocaine-induced reinstatement by infusion of noradrenergic antagonists into the bed nucleus of the stria terminalis or the central nucleus of the amygdala. J Neurosci 22, 5713-8 (2002).

611. Schank, J.R., Liles, L.C. & Weinshenker, D. Norepinephrine signaling through beta- adrenergic receptors is critical for expression of cocaine-induced anxiety. Biol Psychiatry 63, 1007-12 (2008).

612. Solari, N., Bonito-Oliva, A., Fisone, G. & Brambilla, R. Understanding cognitive deficits in Parkinson's disease: lessons from preclinical animal models. Learn Mem 20, 592-600 (2013).

613. Maingay, M., Romero-Ramos, M., Carta, M. & Kirik, D. Ventral tegmental area dopamine neurons are resistant to human mutant alpha-synuclein overexpression. Neurobiol Dis 23, 522-32 (2006).

614. Brichta, L. & Greengard, P. Molecular determinants of selective dopaminergic vulnerability in Parkinson's disease: an update. Front Neuroanat 8, 152 (2014).

615. Mosharov, E.V. et al. Interplay between cytosolic dopamine, calcium, and alpha- synuclein causes selective death of substantia nigra neurons. Neuron 62, 218-29 (2009).

616. Blanchard, V. et al. Differential expression of tyrosine hydroxylase and membrane dopamine transporter genes in subpopulations of dopaminergic neurons of the rat mesencephalon. Brain Res Mol Brain Res 22, 29-38 (1994).

617. Sanghera, M.K., Manaye, K., McMahon, A., Sonsalla, P.K. & German, D.C. Dopamine transporter mRNA levels are high in midbrain neurons vulnerable to MPTP. Neuroreport 8, 3327-31 (1997).

618. Sanghera, M.K. et al. Low dopamine transporter mRNA levels in midbrain regions containing calbindin. Neuroreport 5, 1641-4 (1994).

619. Pifl, C. et al. Is Parkinson's disease a vesicular dopamine storage disorder? Evidence from a study in isolated synaptic vesicles of human and nonhuman primate striatum. J Neurosci 34, 8210-8 (2014).

620. Alvarado, C. et al. Dietary supplementation with antioxidants improves functions and decreases oxidative stress of leukocytes from prematurely aging mice. Nutrition 22, 767-77 (2006).

223

621. Siedlak, S.L. et al. Chronic antioxidant therapy reduces oxidative stress in a mouse model of Alzheimer's disease. Free Radic Res 43, 156-64 (2009).

622. Brogden, R.N., Heel, R.C., Speight, T.M. & Avery, G.S. alpha-Methyl-p-tyrosine: a review of its pharmacology and clinical use. Drugs 21, 81-9 (1981).

623. Brown, J.M., Hanson, G.R. & Fleckenstein, A.E. Regulation of the vesicular monoamine transporter-2: a novel mechanism for cocaine and other psychostimulants. J Pharmacol Exp Ther 296, 762-7 (2001).

624. Cyr, M. et al. Sustained elevation of extracellular dopamine causes motor dysfunction and selective degeneration of striatal GABAergic neurons. Proc Natl Acad Sci U S A 100, 11035-40 (2003).

224

Appendix One Proteins Regulating the Dopamine Transporter Vecchio LM, Ramsey A and Salahpour A

Introduction

Dopamine is a catecholamine neurotransmitter involved in a wide variety of daily functions, such as cognition, voluntary movement, mood, sleep, learning, motivation and reward 1-3. As a result, the dysregulation of dopamine transmission is associated with numerous neurological and psychiatric conditions; among them are schizophrenia, bipolar disorder, Parkinson’s disease, ADHD, and drug addiction 1, 2, 4-6. One of the primary cellular mechanisms to control dopamine signalling and homeostasis is the clearance of dopamine from the extracellular space. The paradigm of monoaminergic 're-uptake' by presynaptic terminals was first introduced in 1961 to explain the cessation of noradrenergic neurotransmission 7, 8 and shortly thereafter, similar mechanisms were discovered for dopamine and serotonin. The dopamine transporter (DAT) is the primary presynaptic protein responsible for the clearance of extracellular dopamine and the termination of dopamine neurotransmission 6, 8-11. Recent studies have revealed that transporter activity can be modulated by a number of protein interactions. This review highlights the interactors that have been identified in a variety of biological systems, and discusses their impact in regulating DAT function.

DAT belongs to a family of protein transporters comprised of 12 transmembrane domains, including intracellular amino (N-) and carboxyl (C-) terminal domains, which are driven by Na+/Cl- exchange 8, 9, 12-14. Other members of this family of transporters include the noadrenaline (also known as norepinephrine) transporter (NET) and the serotonin transporter (SERT). The ion gradient generated by the plasma membrane Na+/K+ ATPase is believed to drive monoamine uptake by inducing conformational changes of the transporter that expose binding sites on the opposite site of the membrane; DAT functions by co-transporting two Na+ and one Cl- along with one dopamine molecule from the extracellular space back into the

225 cytosol of the presynaptic neurons (Figure 1). This model of monoamine exchange allows for the possibility of transporters to function in reverse in certain conditions as is the case with the binding of amphetamine, which reverses the transporter and releases massive quantities of dopamine into extracellular space. Importantly, transport via the DAT is not only critically involved regulating synaptic monoamine levels, controlling both the intensity and duration of neurotransmission, but also in maintaining intracellular stores of dopamine; once taken back in the presynaptic neuron, it can be repackaged into vesicles and recycled for subsequent release 8, 9, 12-14.

Protein Interactions

Over the past several decades, an increasing number of proteins interacting with DAT have been identified, and that these protein-protein interactions play a necessary role in the proper regulation and functioning of DAT is widely acknowledged 8, 15-18. Protein interactors are believed to be involved in the membrane distribution, targeting and trafficking, compartmentalization, and functioning of the membrane transporter. The transporter is also the target of many psychoactive drugs such as cocaine and amphetamine 19, 20. In a similar way, these drugs can affect the surface expression of DAT and consequently, the levels of extracellular dopamine. Thus far, the vast majority of these proteins have been identified and characterized using in vitro and ex vivo techniques. These include yeast-two-hybridization (Y2H) system, glutathione S-transferase (GST) fusion protein precipitations, immunoprecipitation (both from transfected cells and brain tissue), immunohistochemistry, and quantitative bioluminescence resonance energy transfer (BRET)/fluorescence resonance energy transfer (FRET) analyses. However, many have studied these interactions in transfected cells using heterologous lines which may not necessarily reflect the nature of the interaction or the likelihood of occurrence in an intact brain. The need to focus future research on neuronal preparations and endogenous systems using more developed ex- and in- vivo techniques is uncontested. Nonetheless, these past studies have shown that functioning DAT can be thought of as part of a protein complex, and have provided researchers with invaluable information on the nature of DAT and the critical importance of protein-protein interactions in its regulation. Here, we will discuss a number of important interactions that

226 affect three main aspects of DAT: expression at the plasma membrane, localization to neuronal terminals, and functioning of transporter. Importantly, some protein interactors have been implicated in more than one of these aspects of DAT regulation.

Regulation of DAT Expression at the Plasma Membrane and Transport to Terminals

DAT—PKC

Within the twelve transmembrane domains, DAT contains putative site of phosphorylation for a number of protein kinases including protein kinase A (PKA), protein kinase C (PKA) and Ca 2+/calmondulin-stimulated protein kinase II (CAMKII) 21. PKC has long been implicated in a variety of functional and regulatory roles that include surface trafficking and activity of the transporter, possibly through direct phosphorylation 22-28. It has also been suggested to be instrumental for amphetamine induced dopamine-efflux via DAT, as PKC activators mimic the effects of amphetamine and induce dopamine efflux in vitro 29, 30; moreover, general PKC inhibitors seem to block dopamine efflux in vitro and also diminished amphetamine-induced locomotion when injected directly into the nucleus accumbens of rats 31, 32. In addition, the deletion of 22 amino acids at the N-terminus of DAT — including the distal serines that are believed to be substrates sites of PKC — eliminates amphetamine- induced dopamine efflux from HEK293 cells transfected with human DAT (hDAT) 25, 33. While the N-terminus is believed to be the main site of DAT phosphorylation, site-directed mutagenesis studies have also suggested the C-terminus to contain amino of importance for DAT endocytosis and have identified distinct residues to be involved in basal endocytosis and PKC-stimulated endocytosis 28. Authors of these studies recognise that the N-terminus and C-terminus may be independently or synergistically involved in DAT-internalization 28. It is also possible that interactions on the C-terminus facilitate PKC-mediated phosphorylation on the N-terminus.

Previous studies have well established that in several heterologous cell and synaptosomal systems, PKC can down-regulate the activity of the DAT 23, 24, 28, 34, 35. Activation of PKC by

227

PMA (phorbol 12-myristrate 13-acetate) has been shown to decrease the maximum velocity of dopamine uptake (transporter Vmax), leading to the hypothesis that PKC modulates DAT activity by inducing the internalization of transporter and redistribution from the cell surface to intracellular compartments 23, 24, 26, 35. PKC has also been shown to increase the rate of internalization and decrease the rate of recycling in PC12 cells transfected with DAT 36, and studies have demonstrated that internalization may be followed by degradation of the transporter 24, 37-39. Based on the identification of consensus amino acid sequences for PKC phosphorylation on the DAT (as well as other monoaminergic transporters), it had been hypothesized that direct phosphorylation of the DAT protein was involved in its regulation by PKC 40. However, the development of PKC-null mutant hDAT in cell culture, where all putative PKC phosphorylation sites were eliminated, revealed that the replacement of serine/threonine residues with glycines had no functional effect on the activities of DAT. Moreover, confocal microscopy revealed that the activation of PKC by phorbol ester induced internalization in PKC null mutant hDAT in a similar way to wildtype, suggesting that the PKC-mediated regulation of DAT function is not a result of direct phosphorylation but rather achieved indirectly, such as via a mediator protein or activation of a clathrin-mediated pathway 40, 41. These results suggest that PKC-phosphorylation regulates DAT by mediating the amount of functional available on the plasma membrane, and that the PKC- phosphorylation of DAT-interacting proteins may be involved in this internalization 28, 40, 42. Syntaxin and PICK1 are two such proteins, both known to interact with DAT and believed to interact with PKC to regulate DAT surface expression 43. Some have questioned the involvement of these interactions on the basis that they are distant from loci traditionally believed to be important to phosphorylation; however, this does not remove the possibility that these or any number of as of yet unidentified DAT-interacting proteins facilitate DAT endocytosis in endogenous systems.

Despite previous findings in DAT transfected cells 40 and in striatal synaptosomes 22, 26, 44, the hypothesis that PKC may be involved in endocytosis of natively expressed DAT has been contended since the majority of past studies involved heterologous cell lines and results could not be replicated in neuronal cultures 45-48. Eriksen and colleagues (2009) were unable to detect any significant difference in cultured neurons, after PMA stimulation or inhibition of PKC with staurosoprine, as compared to controls 45. The authors do suggest, however, that

228 endocytosis of endogenously expressed DAT in a native environment could be mediated by a dynamin-dependent pathway, which has been previously suggested for DAT expressed in heterologous cell preparations 41, 45, 49, 50. This hypothesis is supported by recent studies that readily detect DAT internalization in response to PKC-activation in neuronal cultures and show that while constitutive DAT endocytosis is dynamin-independent, PKC-stimulated internalization is dependent on dynamin and arise from CTX-positive microdomains 37, 51. In addition to neuronal cultures, PKC-stimulated internalization was also demonstrated in intact neuronal slices that contacted multiple synaptic connections 37. Worth noting is that recent studies have also suggested that amphetamine- and PKC-regulated endocytosis can differentially target DAT to recycling or degradative pathways in dopamine neurons, which may allow for transient or sustained inhibition of neurotransmission 39.

DAT—syntaxin

Lee and colleagues originally identified an interaction between the first 65 residues of the amino terminus of DAT and syntaxin 1A , a protein part of the family of soluble N- ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins 43. The physical interaction between these two proteins and the N-terminus of DAT was further confirmed using pull-down assays with rat brain synaptosome lysates and His-tagged DAT N-terminal fragments, in addition to co-immunoprecipitation studies. The amino tail of DAT is the major site of phosphorylation and this phosphorylation is believed to mediate DAT trafficking 25, 27. Studies have suggested that the syntaxin 1A complex regulates DAT activity and surface expression, and has been suggested to faciliate phosphorylation of the N-terminus 52. Heterologous co-expression of syntaxin 1A led to reductions in DAT surface expression and Vmax, while treatment of striatal slices with the syntaxin protease Botulinum Neurotoxin 52 C resulted in reduced DAT phosophorylation and an elevated Vmax . It is worth noting that syntaxin has previously been shown to interact with both the GABA and the NET transporters, which share similar structures 53-56. Together, these results suggest a role for syntaxin in the regulation of DAT trafficking and activity, possibly by modulating PKC- induced internalization. Syntaxin has also been implicated in amphetamine-stimulated dopamine-efflux. The syntaxin-DAT interaction has been shown to be promoted by exposure

229 to amphetamine in both heterologous cells and striatal synaptosomes, and an enhanced efflux in response to amphetamine was measured in cells and dopamine neurons 57. Importantly, CaMKII was shown to be a critical component in both facilitating the interaction between syntaxin and DAT in response to amphetamine acitivation and in the associated dopamine efflux 57.

Over the past decade, the regulatory role of syntaxin has been investigated with relation to several aspects of DAT functioning including dopaminergic neurotransmission. Studies in Caenorhabditis elegans (C. elegans) have demonstrated that in addition to transporting monoamines, DAT is capable of generating dopamine-gated currents through single Cl- channel events that can influence neuronal excitability by depolarizing dopamine neurons 58. Other transport proteins — including those for serotonin, noradrenaline, glutamate and GABA — have also been shown to be capable of these channel events but like DAT, operate as channels only under special circumstances. In cultured neurons, it was observed that the addition of a green-fluorescent protein (GFP) on the N-terminus of DAT increased the frequency of these currents relative to wildtype as well as the average channel open-time, indicative of a disruption of the regulatory mechanisms that control the occupancy of the DAT channel state 58, 59. The importance of the N-terminus has been supported by immunoprecipitation studies, which demonstrated that the addition of GFP to the DAT N- terminus prevented the pull-down of the C. elegans homologue for syntaxin 1A, UNC-64 58. Together, results suggest that that dopamine stimulates DAT-channel activity and that this is mediated, and suppressed, by interaction between DAT and syntaxin 1A. Therefore, it is possible that syntaxin may be an important modulator of dopamine neuronal excitability and neurotransmission 58, 59.

DAT—Hic-5

In 2002, an interaction between DAT and the multiple Lin-11, Isl-1, and Mec-3 (LIM) domain-containing adaptor protein Hic-5, a focal adhesion adaptor protein, was identified using the Y2H system 60. An interaction with the amino-proximal portion of the C-terminus and the LIM domain of Hic-5 was identified with Y2H and confirmed with GST pull-down

230 and immunoprecipitation experiments. In cells co-expressing Hic-5 and DAT, DAT uptake activity was reduced 30% as compared to cells expressing DAT alone. Because no change was observed in the affinity of dopamine for DAT, authors suggested that the reduced activity in the presence of Hic-5 was a result of a decrease in the number of transporters at the membrane rather than changes in the intrinsic properties of DAT. To verify this hypothesis, biotinylation experiments were performed in HEK293 cells demonstrating that the level of DAT at the cell membrane was decreased by an average of 30% when it was co-expressed with Hic-5, while the total amount of the transporter remained unchanged. Immunostaining revealed that DAT and Hic-5 co-localized when they were co-expressed in HEK293 cells, but that they had unique distribution patterns when expressed on their own. Similar patterns were observed in cultured dopaminergic neurons. These results strongly suggest a role for this protein-protein interaction in the regulation of DAT expression at the plasma membrane, where Hic-5 may act as an adaptor protein in a larger DAT complex 60.

DAT—synuclein

Aggregation of alpha-synuclein in Lewy bodies is a characteristic pathological marker of Parkinson’s disease, and mutations and duplications in the gene encoding for this protein has been associated with familial forms of the disease 61-64. It has previously been established that the protein is normally expressed in the presynaptic terminals of neuronal cells 65, 66. Using the Y2H system, Lee et al. (2001) demonstrated that alpha-synuclein directly binds to the last 15 amino acids of the C-terminus of DAT, an interaction confirmed by co- immunoprecipitation and glutathione S-transferase (GST) pull-down experiments 67. Studies have suggested that increased alpha-synuclein deposits in the substantia nigra is inversely related to DAT functioning68, including the transporter's influence on dopamine transmission through current modulation 69. Patch-clamp recordings in neuronal and heterologous cells have demonstrated that intracellular alpha-synuclein induces a Na+ independent, Cl- sensitive inward current 68. These studies suggested that current modulations induced by an overexpression of alpha-synuclein can decrease DAT-mediated substrate uptake without a change in the number of transporters at the plasma membrane.

231

Although it has long been argued that a protein-protein interaction with alpha-synuclein may play a role in transporter trafficking, experiments have yielded conflicting results, lacking a clear consensus on whether this interaction acts to up-regulate or down-regulate transporter expression at the plasma membrane. Lee (2001) demonstrated that the binding of alpha- synuclein to DAT resulted in an increase of DAT clustering on the cell surface and also an increase in dopamine uptake. This study further suggests that co-expression of alpha- synuclein and hDAT in Ltk- mouse fibroblasts enhances that recruitment of hDAT to the cell surface 67, in line with previous studies done in HEK cells demonstrating that co-expression resulted in clustering on the cell surface 70. This was accompanied by an increase in cellular apoptosis. However, while another early study confirmed the interaction between alpha- synuclein and DAT by co-immunoprecipitation, it reported a decrease in DAT activity when they were co-expressed in transfected cells and that the disruption of the interaction enhanced transporter recruitment 71, 72. More recent studies demonstrate that knock-down of alpha- synuclein in human neuronal cell lines results in a 50% decrease in DAT activity 73, and further studies by the same group demonstrated a 60% reduction in surface DAT 74. It has been suggested that the discrepancies may result from differences in the magnitude of overexpression in the in vitro system, but nonetheless it seemed clear from cell studies that the interaction may play a role in the trafficking of the DAT to or from the cell surface 75.

Results yielded by alpha-synuclein knock-out and null mice showed both reduced DAT expression and functioning, paired with a significant increased in basal dopamine release 76. Recent experiments utilizing in situ visualization of protein-protein interaction demonstrated that insoluable aggregation of alpha-synuclein alters distribution of synaptic proteins in the striatal, impairs trafficking of DAT to synaptic sites, and reduces striatal dopamine levels 77. Overexpression of pathological C-terminally truncated alpha-synuclein did not inhibit an interaction with the transporter but results demonstrated a marked redistribution of the DAT/alpha-synuclein complexes, and co-localized of DAT with alpha-synuclein in intracellular inclusions 21, 77. The aggregation of alpha-synuclein could therefore impair the correct trafficking of DAT to synaptic sites. As it has been shown that alpha-synuclein is able to interact with microtubules as well as with the actin cytoskeleton 72, 78, 79, it is possible that disrupting these interactions may in turn disrupt the trafficking of DAT.

232

DAT—PICK 1

It is clear that the dynamic trafficking of DAT to and from the plasma membrane plays a crucial role in the regulation of extracellular dopamine, not only in clearing the synaptic cleft after a stimulus but also in maintaining basal levels of transmitter. However, an important part of this process is the targeting and delivery of transporters to axonal and perisynaptic locations. After identifying an interaction with the carboxyl tail of DAT using the Y2H system, Torres et al. (2001) showed that the scaffolding protein PICK1 (protein that interacts with C kinase) binds, clusters, and co-localizes with DAT in vitro and in vivo 80. Results of this study also demonstrated that overexpression of PICK1 resulted in increased activity of DAT, as well as increased expression at the cell surface in both cell and neuronal cultures. The interaction was shown to involve the PDZ motif of PICK1 and a PDZ-binding site on the extreme carboxyl terminus of DAT; a truncated transporter missing the last four residues of the carboxyl tail of DAT did not result in co-immunoprecipitation of DAT and PICK1, as was seen with the full-length transporter. Tagging truncated and full-length DAT with an HA epitope showed that mutant transporters lacking the PZD-binding site – and thus, a site of interaction with PICK1 – were unable to localize to neuronal processes, which led authors to suggest that a physical interaction with PICK1 may be important in the targeting and trafficking of DAT to axonal terminals 80. However, shortly after, this conclusion was opposed by a site-directed mutagenesis study by Bjerggaard and colleagues (2004). In transfected cells, authors showed that mutated hDAT lacking the PDZ interaction site was still efficiently inserted into the plasma membrane and targeted to neuronal terminals, a result that challenged whether the region was necessary and sufficient for the surface expression and translocation of DAT. In addition, other mutants possessed the PDZ domain but still had DAT retained in the endoplasmic recticulum 81. This study did confirm the importance of the extreme carboxyl terminal in maturation and surface targeting of transporter proteins, suggesting discrete epitopes in the distal terminus involving residues 615-617, but challenged the necessity of a PICK1 interaction per se in surface targeting. Authors suggest that PICK1 may instead play a modulatory role in trafficking and targeting of DAT in vivo. Alternatively, they propose that PICK1 is a PKC-binding protein, it may be involved in regulating the PKC- mediated internalization of DAT 81. Recently, DAT knock-in mice with disrupted PDZ domain-binding sequences were generated to investigate the significance of this C-terminal

233 domain in vivo 82. Importantly, results demonstrated a 80-90% reduction in transporter levels in the striatal terminals, without interference with folding or ER export — results that support the importance of the C-terminal in surface expression. Authors demonstrated that an AAA substitution in the domain sequence led to a significant increase in constitutive endocytosis of DAT and once internalized, DAT was shown to undergo rapid degradation. Interestingly, PICK1 knockout mice did not demonstrate the dramatic reduction in striatal DAT observed in mice with disrupted PZD domains 82. These results suggest that the PICK1-DAT interaction is not responsible for maintaining DAT levels in nerve terminals but that another PZD domain binding protein remains to be identified 82. Still, it is worth noting that the binding domain of PICK1 can bind both the C-terminus of DAT as well as the C-terminus of PKCα; therefore, it has been suggested that PICK1 retains the potential to modulate DAT internalization in so far that it can function as a scaffold protein, bringing PKC in close proximity with the N-terminus of DAT and promoting internalization 83.

Modulation of Transporter Functioning

DAT—CAMKII

Pyschoactive drugs such as amphetamine behave as DAT substrates and are transported into nerve terminal through transporter proteins, where they release dopamine from vesicles into the cytoplasm. This eventually causes a reversal of the transporter and flux of dopamine into the synapse, dramatically increasing extracellular concentrations. Traditionally, it was believed that amphetamines behaved by inducing conformational changes of DAT and in that way, increased the likelihood that dopamine is transported out by exchange 84, 85. However, more recent studies suggest that a DAT-interaction with certain kinases may mediate the amphetamine-induced dopamine efflux. Phosphorylation of serine residues at the distal N- terminus of DAT has previously been shown to promote dopamine efflux 33, which has also been shown to be regulated by isoforms of PKC 30, 85-87. However, a study by Fog et al (2006) provides evidence from both in vitro and in vivo experiments suggesting that Ca2+/calmodulin-dependent protein kinase α (CaMKIIα) also plays a key role in mediating

234 the ability of amphetamine to induce dopamine efflux through DAT. CaMKIIα was established as a direct-interaction partner of DAT using a Y2H screen with the C-terminus of DAT was confirmed to be the site of interactions by GST fusion pull-down experiments 85. CaMKIIα stimulated dopamine efflux via DAT in response to amphetamine in both heterologous cells and in dopaminergic neurons. In turn, inhibition of CaMKIIα reduced amphetamine-induced dopamine efflux via DAT in midbrain dopamine cultured neurons, in striatal brain slices, and also in the striatum of living mice 85. Using a combination of amperometry and patch-clamping, the binding of CaMKIIα to the C-terminus of DAT was shown to facilitate phosphorylation of serines in the distal N-terminus of the transporter, with the stimulatory effects of CaMKIIα were eliminated when these serines were mutated 85. Mutations of the DAT C-terminus that impaired CaMKIIα binding also impaired dopamine efflux in response to amphetamine 85. Complementary results were found in vivo, which have demonstrated reduced amphetamine-induced locomotor behaviour and dopamine efflux in animals administered with CaMKII inhibitors 85, 88, 89. A recent study investigated the role of the C-terminus — namely, the binding domains of CaMKII and PICK1 — showed that amphetamine-evoked 1-methyl-4-phenylpyridinium efflux was diminished in heterologous cells using cell-permeant dominant-negative peptides to block the CaMKIIα-DAT interaction. Administration of the peptide prior to amphetamine treatment also diminished dopamine-efflux in the striatum, demonstrated by chronoamperometric recordings, as well as reduced amphetamine-induced hyperactivity 83. Together, results from in vitro and in vivo studies supports the hypothesis that an interaction between CaMKIIα and the DAT C- terminus facilitates phosphorylation of the DAT N-terminus, in turn mediating amphetamine- induced dopamine efflux.

DAT—Parkin

Mutations of parkin, a protein-ubiquitin E3 ligase, have been linked to the degradation of dopaminergic neurons in the substania nigra and in turn, to the development of Parkinson’s disease. Wildtype parkin, but not the mutated versions implicated in neurodegenerative disease, has been shown to be capable of ubiquitinating unglycosylated DAT and accelerating degradation 90. Furthermore, in both HEK293 cells and the human dopaminergic

235 neuroblastoma cell line SH-SY5Y, parkin has been shown to increase dopamine uptake by increasing Vmax; a cocaine analog demonstrates that increased dopamine uptake is a result of enhanced cell surface expression of DAT 90. The binding of parkin and DAT were confirmed by co-immunoprecipitation in HEK293/DAT cells. By incubating HEK293/DAT cells with the protein glycosylation inhibitor, tunicamycin, Jiang et al (2003) showed that parkin increases DAT surface expression by ubiquinating misfolded DAT that might otherwise oligomerize with native DAT protein and interfere with their targeting or trafficking to the plasma membrane 90. Studies have also suggested that parkin may exert protective effects on dopaminergic cells by binding to the C-terminus and regulating the alpha-synuclein/DAT protein complex 91, and have also shown parkin to interact with number of other substrates, with disruptions implicated in neurodegeneration. For example, parkin has been shown to mediate the monoubiquitination of PICK1, which regulates the activity of acid-sensing ion channels 92. It has also been shown to be involved in the regulation of the function of excitatory glutamatergic synapses, and loss of this regulation has been suggested to result in excitotoxicity 93.

DAT—G-Coupled Receptors

Dopamine D2 dopamine receptors (D2R) are located both postsynaptically and presynaptically, where they serve an important role as autoreceptors, providing feedback information to the cell about extracellular neurotransmitter levels. In this way, stimulation of

D2R on synaptic terminals can inhibit dopamine synthesis and release, whereas stimulation of 94 D2R on presynaptic cell bodies can modulate activity by limiting cell firing . Using voltametry, increases in the rate of striatal dopamine clearance (Vmax) have been demonstrated with the addition of D2R/D3R agonists, while D2R antagonists have been shown 95 to decrease dopamine clearance in vitro and in vivo . A regulatory role of D2R on DAT was further suggested by experiments demonstrating that D2R null mice showed decreased DAT function but no apparent change in expression or in striatal dopamine release 96.

Functional regulation of DAT, as well as modulation of its surface expression, has previously been linked to extracellular signal-regulated kinases 1 and 2 (ERK 1/2) and to

236 phosphoinositide kinase (PI3K) 97, 98, which have been reported to increase transport capacity.

These signalling pathways have also been suggested as a mechanism by which D2R — in particular, the short splice variant located on presynaptic neurons (D2SR) — regulates DAT 94. Live imagine studies using the fluorescent DAT substrate 4-[4-(diethylamino)-styryl]-N- methylpyridinium iodide (ASP+) identified ERK1/2 and PI3K as possible pathways 94 mediating D2R regulation of DAT . In human embryonic kidney cells co-expressing human + DAT and D2sR, ASP accumulation increased with the addition of quinpirole, a D2R/D3R 94 agonist; the same was found using an alternate D2R/D3R agonist, PD128907 . D2SR activation increased phosphorylation of ERK1/2 and Akt, a major target of PI3K. Importantly, these studies also revealed that mitogen-activated protein kinase inhibitor 2-(2- amino-3-methoxyphenyl)-4H-1-benzopyran-4-one (PD98059) prevented the quinpirole- evoked increase in ASP+ accumulation, whereas inhibition of PI3K did not have a similar effect. These experiments also demonstrated a rapid increase in DAT cell-surface expression and substrate clearance in response to D2SR stimulation, using fluorescence flow cytometry and biotinylation techniques, and that the increase in DAT function is ERK1/2-dependent but PI3K-independent 94. Moreover, BRET and co-immunoprecipitation techniques were used to explore whether D2SR and DAT might be located in close proximity in cells co-expressing these two proteins. Results indicated that, under certain conditions, D2SR and DAT could form a complex 94. However, authors suggested that a coupling to intracellular signalling pathways, rather than a direct physical interaction between D2SR and DAT, is likely to 94 underlie the up-regulation of DAT induced by D2SR activity .

Cell surface localization of DAT has also been reported to be facilitated by a physical and 99 direct interaction between the transporter and D2R . Studies have reported a direct interaction involving the DAT N terminus and the third intracellular loop of D2R, leading to the recruitment of intracellular DAT to the plasma membrane; this, in turn, led to enhanced doapmine re-uptake. After the existence of a DAT-D2 complex was established by co- immunoprecipitation using rat striatal tissue, regions involved in the complex formation were identified using GST affinity purification assays; in vitro binding assays showed that the physical association between DAT and D2R was direct, and did not necessarily involved 99 accessory proteins . HEK293 cells that co-expressed DAT and D2R were treated with a peptide known to disrupt this interaction, TAT-DATNT1-1, and compared to cells expressing

237

DAT alone, showing that the treatment resulted in the impairment of cell surface expression 99 and dopamine uptake . Finally, the role of DAT- D2R interaction on surface expression was demonstrated in vivo: mice injected with peptides that disrupt the interaction exhibited decreased synaptosomal dopamine uptake and significantly increased locomotor activity, leading authors to draw similarities to phenotypes typically observed of DAT knockout mice 99.

It is worth noting that other dopamine receptors, such as the D3R, have also been implicated in the regulation of DAT. Fluorescent imaging techniques permitted real-time quantification of dopamine uptake in cells expressing DAT, again, by making use of DAT substrate, ASP+ 100 . In cells co-expressing DAT and D3R, quinpirole produced a rapid, concentration- dependent, and pertussis toxin-sensitive increase of ASP+ uptake. These results were corroborated by similar studies performed in HEK and Neuro2A cells 100. Studies revealed that D3R activity stimulated PI3K and MAPK pathways; moreover, inhibition of either pathway resulted in an abrogated effect of quinpirole 98, 100. Finally, biotinylation experiments revealed that the rapid increase of dopamine uptake was associated with increased cell surface and decreased intracellular expression of DAT, as well as an increase in dopamine transporter exocytosis; however, prolonged, or sustained, D3R stimulation decreases DAT function and cell surface expression 100.

DAT—synaptogyrin-3—VMAT2

The mating-based split ubiquitin Y2H was used to identify the synaptic vesicle protein synaptogyrin-3 as a DAT-interacting protein and pull-down GST assays determined that the N terminus of both DAT and synaptogyrin-3 were necessary for complex formation 101. Once identified, an interaction between DAT and synaptogyrin-3 was confirmed in multiple systems, including yeast, heterologous cells, mouse brain tissue, and live neurons in culture. Immunolabelling of mouse brain revealed that nearly 80% of DAT-labelled structures also were positively co-labelled for synaptogyrin-3 101. Importantly, FRET analyses validated the biochemical interaction in live neurons 101. Finally, the functional interaction was confirmed using both dopamine uptake assays and biotinylation experiments in cells, which

238 demonstrated an increase in DAT uptake activity but no change in surface expression of the transporter. Further investigation suggested that the change in DAT activity was likely not through a direct effect of the protein-protein interaction between DAT and synaptogyrin-3 101. However, the VMAT2 inhibitor, reserpine, was shown to both decrease DAT activity and prevent the functional effects of synaptogyrin-3. Further co-immunopreciptation experiments then revealed an interaction of DAT with VMAT2, which suggests the possibility of a biochemical complex between DAT, synaptogyrin-3, and VMAT2 that may provide a mechanistic link between the membrane transporter and the monoaminergic storage system 101. More studies are required to fully elucidate the possible physical and functional characteristics of this larger complex.

Modernizing Proteomics

The dopamine transporter has been shown to interact with proteins, kinases, and endogenous and exogenous substrates; all of these interactions have been shown to affect the regulation and function of the transporter. By conservation estimates, well over 20 interacting proteins have been found to interact with DAT to date. Some, but by no means all, interactions have been reviewed here as a means of discussing the wide number of proteins found to interact with DAT and the many ways in which they regulate its function. As previously discussed, many studies have employed in vitro techniques utilizing heterologous cell lines and synaptosomal preparations to identify and characterize the protein-protein interactions. However, there are obvious limitations to these approaches. While they are valuable in that they identify proteins that can interact with DAT and do affect the trafficking, surface expression and function of the transporter, they can only assert that the protein-protein complex forms and functions under the conditions put forth in their study (i.e. those utilized in vitro). While it is possible — and perhaps expected — that these same proteins would also regulate DAT in an intact system, it is necessary to study them in conditions as close to native as possible.

Maiya and Mayfield presented a study which utilized mass spectrometry (MS) to identify DAT-interacting proteins after immunoprecipitation of striatal brain tissue 102. They

239 identified numerous DAT-interactors, which they describe as high- and medium- probability, with diverse cellular functions including some that can be classified as trafficking proteins, cytoskeletal proteins, ion channels and extracellular matrix-associated proteins. Among them are diverse proteins such as synapsin 1b, actin, tubulin, dynamin I, Brca2, neurocan, and so on 102. However, there was little overlap between their results using mass spectrometry and those interacting proteins formerly identified by in vitro techniques such as Y2H. Another recent study also utilized similar ex vivo methods: initially the DAT protein was immunoprecipitated from striatal samples, and then its interacting proteins were identified using liquid chromatography tandem mass spectrometry (LC/MS/MS), by analyzing selected protein bands excised from an coomassie stained SDS-PAGE gel 103. From the analysis of the most abundant peptides, several proteins were identified, some of which have been identified using in vitro methods. In addition to DAT, proteins identified in this study included CaMKII β, CaMKII δ, PKC β, and PKC γ. The co-immunoprecipitation of several other proteins previously been shown to interact with DAT were again confirmed by Western blotting, although not identified by the MS 103.

The studies by Maiya and Mayfield 102, and Hadlock et al. 103, represent the early attempts to develop a proteomics-based ex vivo approach to identifying the proteins that interact with DAT. While in vitro techniques provided invaluable insight into the possible protein interactions regulating DAT, it is nonetheless an absolute necessity to identify and study these interactions in conditions that provide a more accurate representation of those in nature. When ex vivo proteomics approaches are further developed, results will help us achieve a clearer understanding of the relative role of protein interactions originally identified in vitro. Information regarding the regulation of transporter proteins such as DAT under normal conditions will provide a concrete foundation for understanding how monoaminergic dysregulation may occur, and its implications for addiction and disease.

240

1. Carlsson, A. Perspectives on the discovery of central monoaminergic neurotransmission. Annu Rev Neurosci 10, 19-40 (1987).

2. Greengard, P. The neurobiology of slow synaptic transmission. Science 294, 1024-30 (2001).

3. Bromberg-Martin, E.S., Matsumoto, M. & Hikosaka, O. Dopamine in motivational control: rewarding, aversive, and alerting. Neuron 68, 815-34.

4. Adinoff, B. Neurobiologic processes in drug reward and addiction. Harv Rev Psychiatry 12, 305-20 (2004).

5. Koob, G.F. & Le Moal, M. Drug abuse: hedonic homeostatic dysregulation. Science 278, 52-8 (1997).

6. Torres, G.E. The dopamine transporter proteome. J Neurochem 97 Suppl 1, 3-10 (2006).

7. Hertting, G. & Axelrod, J. Fate of tritiated noradrenaline at the sympathetic nerve- endings. Nature 192, 172-3 (1961).

8. Torres, G.E., Gainetdinov, R.R. & Caron, M.G. Plasma membrane monoamine transporters: structure, regulation and function. Nat Rev Neurosci 4, 13-25 (2003).

9. Gainetdinov, R.R. & Caron, M.G. Monoamine transporters: from genes to behavior. Annu Rev Pharmacol Toxicol 43, 261-84 (2003).

10. Gainetdinov, R.R., Jones, S.R., Fumagalli, F., Wightman, R.M. & Caron, M.G. Re- evaluation of the role of the dopamine transporter in dopamine system homeostasis. Brain Res Brain Res Rev 26, 148-53 (1998).

11. Nelson, N. The family of Na+/Cl- neurotransmitter transporters. J Neurochem 71, 1785-803 (1998).

12. Gu, H., Wall, S.C. & Rudnick, G. Stable expression of biogenic amine transporters reveals differences in inhibitor sensitivity, kinetics, and ion dependence. J Biol Chem 269, 7124-30 (1994).

13. Rudnick, G. & Clark, J. From synapse to vesicle: the reuptake and storage of biogenic amine neurotransmitters. Biochim Biophys Acta 1144, 249-63 (1993).

14. Masson, J., Sagne, C., Hamon, M. & El Mestikawy, S. Neurotransmitter transporters in the central nervous system. Pharmacol Rev 51, 439-64 (1999).

15. Melikian, H.E. Neurotransmitter transporter trafficking: endocytosis, recycling, and regulation. Pharmacol Ther 104, 17-27 (2004).

16. Mortensen, O.V. & Amara, S.G. Dynamic regulation of the dopamine transporter. Eur J Pharmacol 479, 159-70 (2003).

241

17. Vaughan, R.A. Phosphorylation and regulation of psychostimulant-sensitive neurotransmitter transporters. J Pharmacol Exp Ther 310, 1-7 (2004).

18. Zahniser, N.R. & Doolen, S. Chronic and acute regulation of Na+/Cl- -dependent neurotransmitter transporters: drugs, substrates, presynaptic receptors, and signaling systems. Pharmacol Ther 92, 21-55 (2001).

19. Furman, C.A. et al. Dopamine and amphetamine rapidly increase dopamine transporter trafficking to the surface: live-cell imaging using total internal reflection fluorescence microscopy. J Neurosci 29, 3328-36 (2009).

20. Cagniard, B., Sotnikova, T.D., Gainetdinov, R.R. & Zhuang, X. The dopamine transporter expression level differentially affects responses to cocaine and amphetamine. J Neurogenet 28, 112-21 (2014).

21. Vaughan, R.A. & Foster, J.D. Mechanisms of dopamine transporter regulation in normal and disease states. Trends Pharmacol Sci 34, 489-96 (2013).

22. Doolen, S. & Zahniser, N.R. Conventional protein kinase C isoforms regulate human dopamine transporter activity in Xenopus oocytes. FEBS Lett 516, 187-90 (2002).

23. Melikian, H.E. & Buckley, K.M. Membrane trafficking regulates the activity of the human dopamine transporter. J Neurosci 19, 7699-710 (1999).

24. Daniels, G.M. & Amara, S.G. Regulated trafficking of the human dopamine transporter. Clathrin-mediated internalization and lysosomal degradation in response to phorbol esters. J Biol Chem 274, 35794-801 (1999).

25. Foster, J.D., Pananusorn, B. & Vaughan, R.A. Dopamine transporters are phosphorylated on N-terminal serines in rat striatum. J Biol Chem 277, 25178-86 (2002).

26. Vaughan, R.A., Huff, R.A., Uhl, G.R. & Kuhar, M.J. Protein kinase C-mediated phosphorylation and functional regulation of dopamine transporters in striatal synaptosomes. J Biol Chem 272, 15541-6 (1997).

27. Foster, J.D., Cervinski, M.A., Gorentla, B.K. & Vaughan, R.A. Regulation of the dopamine transporter by phosphorylation. Handb Exp Pharmacol, 197-214 (2006).

28. Boudanova, E., Navaroli, D.M., Stevens, Z. & Melikian, H.E. Dopamine transporter endocytic determinants: carboxy terminal residues critical for basal and PKC- stimulated internalization. Mol Cell Neurosci 39, 211-7 (2008).

29. Cowell, R.M., Kantor, L., Hewlett, G.H., Frey, K.A. & Gnegy, M.E. Dopamine transporter antagonists block phorbol ester-induced dopamine release and dopamine transporter phosphorylation in striatal synaptosomes. Eur J Pharmacol 389, 59-65 (2000).

242

30. Johnson, L.A., Guptaroy, B., Lund, D., Shamban, S. & Gnegy, M.E. Regulation of amphetamine-stimulated dopamine efflux by protein kinase C beta. J Biol Chem 280, 10914-9 (2005).

31. Browman, K.E. et al. Injection of the protein kinase C inhibitor Ro31-8220 into the nucleus accumbens attenuates the acute response to amphetamine: tissue and behavioral studies. Brain Res 814, 112-9 (1998).

32. Kantor, L. & Gnegy, M.E. Protein kinase C inhibitors block amphetamine-mediated dopamine release in rat striatal slices. J Pharmacol Exp Ther 284, 592-8 (1998).

33. Khoshbouei, H. et al. N-terminal phosphorylation of the dopamine transporter is required for amphetamine-induced efflux. PLoS Biol 2, E78 (2004).

34. Zhu, S.J., Kavanaugh, M.P., Sonders, M.S., Amara, S.G. & Zahniser, N.R. Activation of protein kinase C inhibits uptake, currents and binding associated with the human dopamine transporter expressed in Xenopus oocytes. J Pharmacol Exp Ther 282, 1358-65 (1997).

35. Pristupa, Z.B. et al. Protein kinase-mediated bidirectional trafficking and functional regulation of the human dopamine transporter. Synapse 30, 79-87 (1998).

36. Loder, M.K. & Melikian, H.E. The dopamine transporter constitutively internalizes and recycles in a protein kinase C-regulated manner in stably transfected PC12 cell lines. J Biol Chem 278, 22168-74 (2003).

37. Gabriel, L.R. et al. Dopamine transporter endocytic trafficking in striatal dopaminergic neurons: differential dependence on dynamin and the actin cytoskeleton. J Neurosci 33, 17836-46 (2013).

38. Gorentla, B.K. & Vaughan, R.A. Differential effects of dopamine and psychoactive drugs on dopamine transporter phosphorylation and regulation. Neuropharmacology 49, 759-68 (2005).

39. Hong, W.C. & Amara, S.G. Differential targeting of the dopamine transporter to recycling or degradative pathways during amphetamine- or PKC-regulated endocytosis in dopamine neurons. FASEB J 27, 2995-3007 (2013).

40. Chang, M.Y. et al. Protein kinase C-mediated functional regulation of dopamine transporter is not achieved by direct phosphorylation of the dopamine transporter protein. J Neurochem 77, 754-61 (2001).

41. Sorkina, T., Hoover, B.R., Zahniser, N.R. & Sorkin, A. Constitutive and protein kinase C-induced internalization of the dopamine transporter is mediated by a clathrin-dependent mechanism. Traffic 6, 157-70 (2005).

243

42. Saunders, C. et al. Amphetamine-induced loss of human dopamine transporter activity: an internalization-dependent and cocaine-sensitive mechanism. Proc Natl Acad Sci U S A 97, 6850-5 (2000).

43. Lee, K.H., Kim, M.Y., Kim, D.H. & Lee, Y.S. Syntaxin 1A and receptor for activated C kinase interact with the N-terminal region of human dopamine transporter. Neurochem Res 29, 1405-9 (2004).

44. Copeland, B.J., Vogelsberg, V., Neff, N.H. & Hadjiconstantinou, M. Protein kinase C activators decrease dopamine uptake into striatal synaptosomes. J Pharmacol Exp Ther 277, 1527-32 (1996).

45. Eriksen, J. et al. Visualization of dopamine transporter trafficking in live neurons by use of fluorescent cocaine analogs. J Neurosci 29, 6794-808 (2009).

46. Rao, A., Richards, T.L., Simmons, D., Zahniser, N.R. & Sorkin, A. Epitope-tagged dopamine transporter knock-in mice reveal rapid endocytic trafficking and filopodia targeting of the transporter in dopaminergic axons. FASEB J 26, 1921-33 (2012).

47. Rao, A., Simmons, D. & Sorkin, A. Differential subcellular distribution of endosomal compartments and the dopamine transporter in dopaminergic neurons. Mol Cell Neurosci 46, 148-58 (2011).

48. Sorkina, T., Caltagarone, J. & Sorkin, A. Flotillins regulate membrane mobility of the dopamine transporter but are not required for its protein kinase C dependent endocytosis. Traffic 14, 709-24 (2013).

49. Lajoie, P. & Nabi, I.R. Regulation of raft-dependent endocytosis. J Cell Mol Med 11, 644-53 (2007).

50. Rappoport, J.Z. Focusing on clathrin-mediated endocytosis. Biochem J 412, 415-23 (2008).

51. Cremona, M.L. et al. Flotillin-1 is essential for PKC-triggered endocytosis and membrane microdomain localization of DAT. Nat Neurosci 14, 469-77 (2011).

52. Cervinski, M.A., Foster, J.D. & Vaughan, R.A. Syntaxin 1A regulates dopamine transporter activity, phosphorylation and surface expression. Neuroscience 170, 408- 16.

53. Beckman, M.L., Bernstein, E.M. & Quick, M.W. Protein kinase C regulates the interaction between a GABA transporter and syntaxin 1A. J Neurosci 18, 6103-12 (1998).

54. Deken, S.L., Beckman, M.L., Boos, L. & Quick, M.W. Transport rates of GABA transporters: regulation by the N-terminal domain and syntaxin 1A. Nat Neurosci 3, 998-1003 (2000).

244

55. Sung, U. et al. A regulated interaction of syntaxin 1A with the antidepressant- sensitive norepinephrine transporter establishes catecholamine clearance capacity. J Neurosci 23, 1697-709 (2003).

56. Dipace, C., Sung, U., Binda, F., Blakely, R.D. & Galli, A. Amphetamine induces a calcium/calmodulin-dependent protein kinase II-dependent reduction in norepinephrine transporter surface expression linked to changes in syntaxin 1A/transporter complexes. Mol Pharmacol 71, 230-9 (2007).

57. Binda, F. et al. Syntaxin 1A interaction with the dopamine transporter promotes amphetamine-induced dopamine efflux. Mol Pharmacol 74, 1101-8 (2008).

58. Carvelli, L., Blakely, R.D. & DeFelice, L.J. Dopamine transporter/syntaxin 1A interactions regulate transporter channel activity and dopaminergic synaptic transmission. Proc Natl Acad Sci U S A 105, 14192-7 (2008).

59. Carvelli, L., McDonald, P.W., Blakely, R.D. & Defelice, L.J. Dopamine transporters depolarize neurons by a channel mechanism. Proc Natl Acad Sci U S A 101, 16046-51 (2004).

60. Carneiro, A.M. et al. The multiple LIM domain-containing adaptor protein Hic-5 synaptically colocalizes and interacts with the dopamine transporter. J Neurosci 22, 7045-54 (2002).

61. Conway, K.A., Harper, J.D. & Lansbury, P.T. Accelerated in vitro fibril formation by a mutant alpha-synuclein linked to early-onset Parkinson disease. Nat Med 4, 1318-20 (1998).

62. Kruger, R. et al. Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson's disease. Nat Genet 18, 106-8 (1998).

63. Polymeropoulos, M.H. et al. Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 276, 2045-7 (1997).

64. Zarranz, J.J. et al. The new mutation, E46K, of alpha-synuclein causes Parkinson and Lewy body dementia. Ann Neurol 55, 164-73 (2004).

65. Hsu, L.J. et al. Expression pattern of synucleins (non-Abeta component of Alzheimer's disease amyloid precursor protein/alpha-synuclein) during murine brain development. J Neurochem 71, 338-44 (1998).

66. Galvin, J.E., Schuck, T.M., Lee, V.M. & Trojanowski, J.Q. Differential expression and distribution of alpha-, beta-, and gamma-synuclein in the developing human substantia nigra. Exp Neurol 168, 347-55 (2001).

67. Lee, F.J., Liu, F., Pristupa, Z.B. & Niznik, H.B. Direct binding and functional coupling of alpha-synuclein to the dopamine transporters accelerate dopamine- induced apoptosis. FASEB J 15, 916-26 (2001).

245

68. Kovacs, G.G., Milenkovic, I.J., Preusser, M. & Budka, H. Nigral burden of alpha- synuclein correlates with striatal dopamine deficit. Mov Disord 23, 1608-12 (2008).

69. Swant, J. et al. alpha-Synuclein stimulates a dopamine transporter-dependent chloride current and modulates the activity of the transporter. J Biol Chem 286, 43933-43 (2011).

70. Dunnett, S.B. & Bjorklund, A. Prospects for new restorative and neuroprotective treatments in Parkinson's disease. Nature 399, A32-9 (1999).

71. Wersinger, C. & Sidhu, A. Attenuation of dopamine transporter activity by alpha- synuclein. Neurosci Lett 340, 189-92 (2003).

72. Wersinger, C. & Sidhu, A. Disruption of the interaction of alpha-synuclein with microtubules enhances cell surface recruitment of the dopamine transporter. Biochemistry 44, 13612-24 (2005).

73. Fountaine, T.M. & Wade-Martins, R. RNA interference-mediated knockdown of alpha-synuclein protects human dopaminergic neuroblastoma cells from MPP(+) toxicity and reduces dopamine transport. J Neurosci Res 85, 351-63 (2007).

74. Fountaine, T.M. et al. The effect of alpha-synuclein knockdown on MPP+ toxicity in models of human neurons. Eur J Neurosci 28, 2459-73 (2008).

75. Eriksen, J., Jorgensen, T.N. & Gether, U. Regulation of dopamine transporter function by protein-protein interactions: new discoveries and methodological challenges. J Neurochem 113, 27-41.

76. Chadchankar, H., Ihalainen, J., Tanila, H. & Yavich, L. Decreased reuptake of dopamine in the dorsal striatum in the absence of alpha-synuclein. Brain Res 1382, 37-44 (2011).

77. Bellucci, A. et al. Redistribution of DAT/alpha-synuclein complexes visualized by "in situ" proximity ligation assay in transgenic mice modelling early Parkinson's disease. PLoS One 6, e27959 (2011).

78. Bellani, S. et al. The regulation of synaptic function by alpha-synuclein. Commun Integr Biol 3, 106-9 (2010).

79. Zhou, R.M. et al. Molecular interaction of alpha-synuclein with tubulin influences on the polymerization of microtubule in vitro and structure of microtubule in cells. Mol Biol Rep 37, 3183-92 (2010).

80. Torres, G.E. et al. Functional interaction between monoamine plasma membrane transporters and the synaptic PDZ domain-containing protein PICK1. Neuron 30, 121-34 (2001).

246

81. Bjerggaard, C. et al. Surface targeting of the dopamine transporter involves discrete epitopes in the distal C terminus but does not require canonical PDZ domain interactions. J Neurosci 24, 7024-36 (2004).

82. Rickhag, M. et al. A C-terminal PDZ domain-binding sequence is required for striatal distribution of the dopamine transporter. Nat Commun 4, 1580 (2013).

83. Rickhag, M. et al. Membrane-permeable C-terminal dopamine transporter peptides attenuate amphetamine-evoked dopamine release. J Biol Chem 288, 27534-44 (2013).

84. Fischer, J.F. & Cho, A.K. Chemical release of dopamine from striatal homogenates: evidence for an exchange diffusion model. J Pharmacol Exp Ther 208, 203-9 (1979).

85. Fog, J.U. et al. Calmodulin kinase II interacts with the dopamine transporter C terminus to regulate amphetamine-induced reverse transport. Neuron 51, 417-29 (2006).

86. Gnegy, M.E. et al. Intracellular Ca2+ regulates amphetamine-induced dopamine efflux and currents mediated by the human dopamine transporter. Mol Pharmacol 66, 137-43 (2004).

87. Gnegy, M.E. The effect of phosphorylation on amphetamine-mediated outward transport. Eur J Pharmacol 479, 83-91 (2003).

88. Kantor, L., Hewlett, G.H. & Gnegy, M.E. Enhanced amphetamine- and K+-mediated dopamine release in rat striatum after repeated amphetamine: differential requirements for Ca2+- and calmodulin-dependent phosphorylation and synaptic vesicles. J Neurosci 19, 3801-8 (1999).

89. Pierce, R.C. & Kalivas, P.W. Repeated cocaine modifies the mechanism by which amphetamine releases dopamine. J Neurosci 17, 3254-61 (1997).

90. Jiang, H., Jiang, Q. & Feng, J. Parkin increases dopamine uptake by enhancing the cell surface expression of dopamine transporter. J Biol Chem 279, 54380-6 (2004).

91. Moszczynska, A. et al. Parkin disrupts the alpha-synuclein/dopamine transporter interaction: consequences toward dopamine-induced toxicity. J Mol Neurosci 32, 217- 27 (2007).

92. Joch, M. et al. Parkin-mediated monoubiquitination of the PDZ protein PICK1 regulates the activity of acid-sensing ion channels. Mol Biol Cell 18, 3105-18 (2007).

93. Helton, T.D., Otsuka, T., Lee, M.C., Mu, Y. & Ehlers, M.D. Pruning and loss of excitatory synapses by the parkin ubiquitin ligase. Proc Natl Acad Sci U S A 105, 19492-7 (2008).

247

94. Bolan, E.A. et al. D2 receptors regulate dopamine transporter function via an extracellular signal-regulated kinases 1 and 2-dependent and phosphoinositide 3 kinase-independent mechanism. Mol Pharmacol 71, 1222-32 (2007).

95. Meiergerd, S.M., Patterson, T.A. & Schenk, J.O. D2 receptors may modulate the function of the striatal transporter for dopamine: kinetic evidence from studies in vitro and in vivo. J Neurochem 61, 764-7 (1993).

96. Dickinson, S.D. et al. Dopamine D2 receptor-deficient mice exhibit decreased dopamine transporter function but no changes in dopamine release in dorsal striatum. J Neurochem 72, 148-56 (1999).

97. Carvelli, L. et al. PI 3-kinase regulation of dopamine uptake. J Neurochem 81, 859-69 (2002).

98. Moron, J.A. et al. Mitogen-activated protein kinase regulates dopamine transporter surface expression and dopamine transport capacity. J Neurosci 23, 8480-8 (2003).

99. Lee, F.J. et al. Dopamine transporter cell surface localization facilitated by a direct interaction with the dopamine D2 receptor. EMBO J 26, 2127-36 (2007).

100. Zapata, A. et al. Regulation of dopamine transporter function and cell surface expression by D3 dopamine receptors. J Biol Chem 282, 35842-54 (2007).

101. Egana, L.A. et al. Physical and functional interaction between the dopamine transporter and the synaptic vesicle protein synaptogyrin-3. J Neurosci 29, 4592-604 (2009).

102. Maiya, R., Ponomarev, I., Linse, K.D., Harris, R.A. & Mayfield, R.D. Defining the dopamine transporter proteome by convergent biochemical and in silico analyses. Genes Brain Behav 6, 97-106 (2007).

103. Hadlock, G.C., Nelson, C.C., Baucum, A.J., 2nd, Hanson, G.R. & Fleckenstein, A.E. Ex vivo identification of protein-protein interactions involving the dopamine transporter. J Neurosci Methods 196, 303-7.

248

Appendix Two List of Publications 2009–2016

LM Vecchio, KM Bermejo, AJ Ramsey, M Hossain, J Richardson, GW Miller, A Salahpour (2016). The Physiological and Behavioural Consequences of Tyrosine Hydroxylase Over- Expression. in preparation (primary paper)

ST Masoud, LM Vecchio, Y Bergeron, MM Hossain, LT Nguyen, MK Bermejo, B Kile, TD Sotnikova, WB Siesser, RR Gainetdinov, RM Wightman, MG Caron, JR Richardson, GW Miller, AJ Ramsey, M Cyr, A Salahpour (2015). Increased Expression Of The Dopamine Transporter Leads To Loss Of Dopamine Neurons, Oxidative Stress And L-Dopa Reversible Motor Deficits. Neurobiology of Disease. 74:66-75

LM Vecchio, KM Bermejo, P Beerpoot, AJ Ramsey and A Salahpour (2014). N-Terminal Tagging Of The Dopamine Transporter Impairs Protein Expression And Trafficking In Vivo. Molecular and Cellular Neuroscience. 61: 123-32

KM Lohr, AI Bernstein, KA Stout, AR Dunn, CR Lazo, SP Alter, M Wang, Y Li, X Fan, EJ Hess, H Yi, LM Vecchio, DS Goldstein, TS Guillot, A Salahpour, GW Miller (2014). Increased Vesicular Monoamine Transporter Enhances Dopamine Release And Opposes Parkinson's Disease-Related Neurodegeneration In Vivo. PNAS. 111(27):9977-82

249

ELSEVIER LICENSE TERMS AND CONDITIONS

May 03, 2016

This is an Agreement between Laura M Vecchio ("You") and Elsevier ("Elsevier"). It consists of your order details, the terms and conditions provided by Elsevier, and the payment terms and conditions.

All payments must be made in full to CCC. For payment instructions, please see information listed at the bottom of this form.

Supplier

Elsevier Limited The Boulevard,Langford Lane Kidlington,Oxford,OX5 1GB,UK

Registered Company Number

1982084

Customer name Laura M Vecchio

Customer address King's College Circle, RM 4302 Toronto, ON M5S 1A8

License number 3860860853609

License date May 02, 2016

Licensed content publisher Elsevier

Licensed content publication Molecular and Cellular Neuroscience

Licensed content title N-terminal tagging of the dopamine transporter impairs protein expression and trafficking in vivo

Licensed content author Laura M. Vecchio, M. Kristel Bermejo, Pieter Beerepoot, Amy J. Ramsey, Ali Salahpour

Licensed content date July 2014

Licensed content volume number 61

Licensed content issue number n/a

Number of pages 10

Start Page 123

End Page 132

Type of Use reuse in a thesis/dissertation

250

Portion full article

Format both print and electronic

Are you the author of this Elsevier article? Yes

Will you be translating? No

Title of your thesis/dissertation Investigating Monoamine Regulation: The Transport of The Dopamine Transporter to Striatal Terminals and the Effects of Tyrosine Hydroxylase Overexpression on Dopaminergic and Noradrenergic-Related Phenotypes

Expected completion date June 2016

Estimated size (number of pages) 250

Elsevier VAT number GB 494 6272 12

Price 0.00 USD

VAT/Local Sales Tax 0.00 USD / 0.00 GBP

Total 0.00 USD

Terms and Conditions

INTRODUCTION

1. The publisher for this copyrighted material is Elsevier. By clicking "accept" in connection with completing this licensing transaction, you agree that the following terms and conditions apply to this transaction (along with the Billing and Payment terms and conditions established by Copyright Clearance Center, Inc. ("CCC"), at the time that you opened your Rightslink account and that are available at any time at http://myaccount.copyright.com).

GENERAL TERMS

2. Elsevier hereby grants you permission to reproduce the aforementioned material subject to the terms and conditions indicated.

3. Acknowledgement: If any part of the material to be used (for example, figures) has appeared in our publication with credit or acknowledgement to another source, permission must also be sought from that source. If such permission is not obtained then that material may not be included in your publication/copies. Suitable acknowledgement to the source must be made, either as a footnote or in a reference list at the end of your publication, as follows:

"Reprinted from Publication title, Vol /edition number, Author(s), Title of article / title of chapter, Pages No., Copyright (Year), with permission from Elsevier [OR APPLICABLE SOCIETY COPYRIGHT OWNER]." Also Lancet special credit - "Reprinted from The Lancet, Vol. number, Author(s), Title of article, Pages No., Copyright (Year), with permission from Elsevier."

4. Reproduction of this material is confined to the purpose and/or media for which permission is hereby given.

5. Altering/Modifying Material: Not Permitted. However figures and illustrations may be altered/adapted minimally to serve your work. Any other abbreviations, additions, deletions and/or any other alterations shall be made only with prior written authorization of Elsevier Ltd. (Please contact Elsevier at [email protected])

6. If the permission fee for the requested use of our material is waived in this instance, please be advised that your future requests for Elsevier materials may attract a fee.

251

7. Reservation of Rights: Publisher reserves all rights not specifically granted in the combination of (i) the license details provided by you and accepted in the course of this licensing transaction, (ii) these terms and conditions and (iii) CCC's Billing and Payment terms and conditions.

8. License Contingent Upon Payment: While you may exercise the rights licensed immediately upon issuance of the license at the end of the licensing process for the transaction, provided that you have disclosed complete and accurate details of your proposed use, no license is finally effective unless and until full payment is received from you (either by publisher or by CCC) as provided in CCC's Billing and Payment terms and conditions. If full payment is not received on a timely basis, then any license preliminarily granted shall be deemed automatically revoked and shall be void as if never granted. Further, in the event that you breach any of these terms and conditions or any of CCC's Billing and Payment terms and conditions, the license is automatically revoked and shall be void as if never granted. Use of materials as described in a revoked license, as well as any use of the materials beyond the scope of an unrevoked license, may constitute copyright infringement and publisher reserves the right to take any and all action to protect its copyright in the materials.

9. Warranties: Publisher makes no representations or warranties with respect to the licensed material.

10. Indemnity: You hereby indemnify and agree to hold harmless publisher and CCC, and their respective officers, directors, employees and agents, from and against any and all claims arising out of your use of the licensed material other than as specifically authorized pursuant to this license.

11. No Transfer of License: This license is personal to you and may not be sublicensed, assigned, or transferred by you to any other person without publisher's written permission.

12. No Amendment Except in Writing: This license may not be amended except in a writing signed by both parties (or, in the case of publisher, by CCC on publisher's behalf).

13. Objection to Contrary Terms: Publisher hereby objects to any terms contained in any purchase order, acknowledgment, check endorsement or other writing prepared by you, which terms are inconsistent with these terms and conditions or CCC's Billing and Payment terms and conditions. These terms and conditions, together with CCC's Billing and Payment terms and conditions (which are incorporated herein), comprise the entire agreement between you and publisher (and CCC) concerning this licensing transaction. In the event of any conflict between your obligations established by these terms and conditions and those established by CCC's Billing and Payment terms and conditions, these terms and conditions shall control.

14. Revocation: Elsevier or Copyright Clearance Center may deny the permissions described in this License at their sole discretion, for any reason or no reason, with a full refund payable to you. Notice of such denial will be made using the contact information provided by you. Failure to receive such notice will not alter or invalidate the denial. In no event will Elsevier or Copyright Clearance Center be responsible or liable for any costs, expenses or damage incurred by you as a result of a denial of your permission request, other than a refund of the amount(s) paid by you to Elsevier and/or Copyright Clearance Center for denied permissions.

LIMITED LICENSE

The following terms and conditions apply only to specific license types:

15. Translation: This permission is granted for non-exclusive world English rights only unless your license was granted for translation rights. If you licensed translation rights you may only translate this content into the languages you requested. A professional translator must perform all translations and reproduce the content word for word preserving the integrity of the article.

16. Posting licensed content on any Website: The following terms and conditions apply as follows: Licensing material from an Elsevier journal: All content posted to the web site must maintain the copyright information line on the bottom of each image; A hyper-text must be included to the Homepage of the journal from which you are licensing at http://www.sciencedirect.com/science/journal/xxxxx or the Elsevier homepage for books at http://www.elsevier.com; Central Storage: This license does not include permission for a scanned version of the material to be stored in a central repository such as that provided by Heron/XanEdu.

252

Licensing material from an Elsevier book: A hyper-text link must be included to the Elsevier homepage at http://www.elsevier.com . All content posted to the web site must maintain the copyright information line on the bottom of each image.

Posting licensed content on Electronic reserve: In addition to the above the following clauses are applicable: The web site must be password-protected and made available only to bona fide students registered on a relevant course. This permission is granted for 1 year only. You may obtain a new license for future website posting.

17. For journal authors: the following clauses are applicable in addition to the above:

Preprints:

A preprint is an author's own write-up of research results and analysis, it has not been peer-reviewed, nor has it had any other value added to it by a publisher (such as formatting, copyright, technical enhancement etc.).

Authors can share their preprints anywhere at any time. Preprints should not be added to or enhanced in any way in order to appear more like, or to substitute for, the final versions of articles however authors can update their preprints on arXiv or RePEc with their Accepted Author Manuscript (see below).

If accepted for publication, we encourage authors to link from the preprint to their formal publication via its DOI. Millions of researchers have access to the formal publications on ScienceDirect, and so links will help users to find, access, cite and use the best available version. Please note that Cell Press, The Lancet and some society- owned have different preprint policies. Information on these policies is available on the journal homepage.

Accepted Author Manuscripts: An accepted author manuscript is the manuscript of an article that has been accepted for publication and which typically includes author-incorporated changes suggested during submission, peer review and editor-author communications.

Authors can share their accepted author manuscript:

− immediately via their non-commercial person homepage or blog by updating a preprint in arXiv or RePEc with the accepted manuscript via their research institute or institutional repository for internal institutional uses or as part of an invitation-only research collaboration work-group directly by providing copies to their students or to research collaborators for their personal use for private scholarly sharing as part of an invitation-only work group on commercial sites with which Elsevier has an agreement

− after the embargo period via non-commercial hosting platforms such as their institutional repository via commercial sites with which Elsevier has an agreement

In all cases accepted manuscripts should:

− link to the formal publication via its DOI

− bear a CC-BY-NC-ND license - this is easy to do

253

− if aggregated with other manuscripts, for example in a repository or other site, be shared in alignment with our hosting policy not be added to or enhanced in any way to appear more like, or to substitute for, the published journal article.

Published journal article (JPA): A published journal article (PJA) is the definitive final record of published research that appears or will appear in the journal and embodies all value-adding publishing activities including peer review co-ordination, copy-editing, formatting, (if relevant) pagination and online enrichment.

Policies for sharing publishing journal articles differ for subscription and gold open access articles:

Subscription Articles: If you are an author, please share a link to your article rather than the full-text. Millions of researchers have access to the formal publications on ScienceDirect, and so links will help your users to find, access, cite, and use the best available version.

Theses and dissertations which contain embedded PJAs as part of the formal submission can be posted publicly by the awarding institution with DOI links back to the formal publications on ScienceDirect.

If you are affiliated with a library that subscribes to ScienceDirect you have additional private sharing rights for others' research accessed under that agreement. This includes use for classroom teaching and internal training at the institution (including use in course packs and courseware programs), and inclusion of the article for grant funding purposes.

Gold Open Access Articles: May be shared according to the author-selected end-user license and should contain a CrossMark logo, the end user license, and a DOI link to the formal publication on ScienceDirect.

Please refer to Elsevier's posting policy for further information.

18. For book authors the following clauses are applicable in addition to the above: Authors are permitted to place a brief summary of their work online only. You are not allowed to download and post the published electronic version of your chapter, nor may you scan the printed edition to create an electronic version. Posting to a repository: Authors are permitted to post a summary of their chapter only in their institution's repository.

19. Thesis/Dissertation: If your license is for use in a thesis/dissertation your thesis may be submitted to your institution in either print or electronic form. Should your thesis be published commercially, please reapply for permission. These requirements include permission for the Library and Archives of Canada to supply single copies, on demand, of the complete thesis and include permission for Proquest/UMI to supply single copies, on demand, of the complete thesis. Should your thesis be published commercially, please reapply for permission. Theses and dissertations which contain embedded PJAs as part of the formal submission can be posted publicly by the awarding institution with DOI links back to the formal publications on ScienceDirect.

Elsevier Open Access Terms and Conditions

You can publish open access with Elsevier in hundreds of open access journals or in nearly 2000 established subscription journals that support open access publishing. Permitted third party re-use of these open access articles is defined by the author's choice of Creative Commons user license. See our open access license policy for more information.

Terms & Conditions applicable to all Open Access articles published with Elsevier:

Any reuse of the article must not represent the author as endorsing the adaptation of the article nor should the article be modified in such a way as to damage the author's honour or reputation. If any changes have been made, such changes must be clearly indicated.

The author(s) must be appropriately credited and we ask that you include the end user license and a DOI link to the formal publication on ScienceDirect.

254

If any part of the material to be used (for example, figures) has appeared in our publication with credit or acknowledgement to another source it is the responsibility of the user to ensure their reuse complies with the terms and conditions determined by the rights holder.

Additional Terms & Conditions applicable to each Creative Commons user license:

CC BY: The CC-BY license allows users to copy, to create extracts, abstracts and new works from the Article, to alter and revise the Article and to make commercial use of the Article (including reuse and/or resale of the Article by commercial entities), provided the user gives appropriate credit (with a link to the formal publication through the relevant DOI), provides a link to the license, indicates if changes were made and the licensor is not represented as endorsing the use made of the work. The full details of the license are available at http://creativecommons.org/licenses/by/4.0.

CC BY NC SA: The CC BY-NC-SA license allows users to copy, to create extracts, abstracts and new works from the Article, to alter and revise the Article, provided this is not done for commercial purposes, and that the user gives appropriate credit (with a link to the formal publication through the relevant DOI), provides a link to the license, indicates if changes were made and the licensor is not represented as endorsing the use made of the work. Further, any new works must be made available on the same conditions. The full details of the license are available at http://creativecommons.org/licenses/by-nc-sa/4.0.

CC BY NC ND: The CC BY-NC-ND license allows users to copy and distribute the Article, provided this is not done for commercial purposes and further does not permit distribution of the Article if it is changed or edited in any way, and provided the user gives appropriate credit (with a link to the formal publication through the relevant DOI), provides a link to the license, and that the licensor is not represented as endorsing the use made of the work. The full details of the license are available athttp://creativecommons.org/licenses/by-nc-nd/4.0. Any commercial reuse of Open Access articles published with a CC BY NC SA or CC BY NC ND license requires permission from Elsevier and will be subject to a fee.

Commercial reuse includes:

− Associating advertising with the full text of the Article

− Charging fees for document delivery or access

− Article aggregation

− Systematic distribution via e-mail lists or share buttons

Posting or linking by commercial companies for use by customers of those companies.

20. Other Conditions:

v1.8

Questions? [email protected] or +1-855-239-3415 (toll free in the US) or +1-978-646-2777.

255

JOHN WILEY AND SONS LICENSE TERMS AND CONDITIONS

May 03, 2016

This Agreement between Laura M Vecchio ("You") and John Wiley and Sons ("John Wiley and Sons") consists of your license details and the terms and conditions provided by John Wiley and Sons and Copyright Clearance Center.

License Number 3860880814462

License date May 02, 2016

Licensed Content Publisher John Wiley and Sons

Licensed Content Publication Journal of Neurochemistry

Licensed Content Title The dopamine transporter proteome

Licensed Content Author Gonzalo E. Torres

Licensed Content Date Mar 3, 2006

Pages 8

Type of Use Dissertation/Thesis

Requestor type University/Academic

Format Print and electronic

Portion Figure/table

Number of figures/tables 1

Original Wiley figure/table number(s) Figure 1

Will you be translating? No

Title of your thesis / dissertation Investigating Monoamine Regulation: The Transport of The

256

Dopamine Transporter to Striatal Terminals and the Effects of Tyrosine Hydroxylase Overexpression on Dopaminergic and Noradrenergic-Related Phenotypes

Expected completion date June 2016

Expected size (number of pages) 250

Requestor Location Laura M Vecchio 1 King's College Circle, RM 4302 Medical Sciences Building University of Toronto Toronto, ON M5S 1A8 Canada Attn: Laura M Vecchio

Billing Type Invoice

Billing Address Laura M Vecchio 1 King's College Circle, RM 4302 Medical Sciences Building University of Toronto Toronto, ON M5S 1A8 Canada Attn: Laura M Vecchio

Total 0.00 USD

Terms and Conditions

TERMS AND CONDITIONS

This copyrighted material is owned by or exclusively licensed to John Wiley & Sons, Inc. or one of its group companies (each a"Wiley Company") or handled on behalf of a society with which a Wiley Company has exclusive publishing rights in relation to a particular work (collectively "WILEY"). By clicking "accept" in connection with completing this licensing transaction, you agree that the following terms and conditions apply to this transaction (along with the billing and payment terms and conditions established by the Copyright Clearance Center Inc., ("CCC's Billing and Payment terms and conditions"), at the time that you opened your RightsLink account (these are available at any time at http://myaccount.copyright.com).

Terms and Conditions

The materials you have requested permission to reproduce or reuse (the "Wiley Materials") are protected by copyright.

You are hereby granted a personal, non-exclusive, non-sub licensable (on a stand-alone basis), non- transferable, worldwide, limited license to reproduce the Wiley Materials for the purpose specified in the licensing process. This license, and any CONTENT (PDF or image file) purchased as part of your order, is for a one-time use only and limited to any maximum distribution number specified in the license. The first instance of republication or reuse granted by this license must be completed within two years of the date of the grant of this license (although copies prepared before the end date may be distributed thereafter). The Wiley Materials shall not be used in any other manner or for any other purpose, beyond what is granted in the license. Permission is granted subject to an appropriate acknowledgement given to the author, title of the material/book/journal and the publisher. You shall also duplicate the copyright notice that appears in the Wiley

257 publication in your use of the Wiley Material. Permission is also granted on the understanding that nowhere in the text is a previously published source acknowledged for all or part of this Wiley Material. Any third party content is expressly excluded from this permission.

With respect to the Wiley Materials, all rights are reserved. Except as expressly granted by the terms of the license, no part of the Wiley Materials may be copied, modified, adapted (except for minor reformatting required by the new Publication), translated, reproduced, transferred or distributed, in any form or by any means, and no derivative works may be made based on the Wiley Materials without the prior permission of the respective copyright owner.For STM Signatory Publishers clearing permission under the terms of the STM Permissions Guidelines only, the terms of the license are extended to include subsequent editions and for editions in other languages, provided such editions are for the work as a whole in situ and does not involve the separate exploitation of the permitted figures or extracts, You may not alter, remove or suppress in any manner any copyright, trademark or other notices displayed by the Wiley Materials. You may not license, rent, sell, loan, lease, pledge, offer as security, transfer or assign the Wiley Materials on a stand-alone basis, or any of the rights granted to you hereunder to any other person.

The Wiley Materials and all of the intellectual property rights therein shall at all times remain the exclusive property of John Wiley & Sons Inc, the Wiley Companies, or their respective licensors, and your interest therein is only that of having possession of and the right to reproduce the Wiley Materials pursuant to Section 2 herein during the continuance of this Agreement. You agree that you own no right, title or interest in or to the Wiley Materials or any of the intellectual property rights therein. You shall have no rights hereunder other than the license as provided for above in Section 2. No right, license or interest to any trademark, trade name, service mark or other branding ("Marks") of WILEY or its licensors is granted hereunder, and you agree that you shall not assert any such right, license or interest with respect thereto

NEITHER WILEY NOR ITS LICENSORS MAKES ANY WARRANTY OR REPRESENTATION OF ANY KIND TO YOU OR ANY THIRD PARTY, EXPRESS, IMPLIED OR STATUTORY, WITH RESPECT TO THE MATERIALS OR THE ACCURACY OF ANY INFORMATION CONTAINED IN THE MATERIALS, INCLUDING, WITHOUT LIMITATION, ANY IMPLIED WARRANTY OF MERCHANTABILITY, ACCURACY, SATISFACTORY QUALITY, FITNESS FOR A PARTICULAR PURPOSE, USABILITY, INTEGRATION OR NON-INFRINGEMENT AND ALL SUCH WARRANTIES ARE HEREBY EXCLUDED BY WILEY AND ITS LICENSORS AND WAIVED BY YOU.

WILEY shall have the right to terminate this Agreement immediately upon breach of this Agreement by you.

You shall indemnify, defend and hold harmless WILEY, its Licensors and their respective directors, officers, agents and employees, from and against any actual or threatened claims, demands, causes of action or proceedings arising from any breach of this Agreement by you.

IN NO EVENT SHALL WILEY OR ITS LICENSORS BE LIABLE TO YOU OR ANY OTHER PARTY OR ANY OTHER PERSON OR ENTITY FOR ANY SPECIAL, CONSEQUENTIAL, INCIDENTAL, INDIRECT, EXEMPLARY OR PUNITIVE DAMAGES, HOWEVER CAUSED, ARISING OUT OF OR IN CONNECTION WITH THE DOWNLOADING, PROVISIONING, VIEWING OR USE OF THE MATERIALS REGARDLESS OF THE FORM OF ACTION, WHETHER FOR BREACH OF CONTRACT, BREACH OF WARRANTY, TORT, NEGLIGENCE, INFRINGEMENT OR OTHERWISE (INCLUDING, WITHOUT LIMITATION, DAMAGES BASED ON LOSS OF PROFITS, DATA, FILES, USE, BUSINESS OPPORTUNITY OR CLAIMS OF THIRD PARTIES), AND WHETHER OR NOT THE PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. THIS LIMITATION SHALL APPLY NOTWITHSTANDING ANY FAILURE OF ESSENTIAL PURPOSE OF ANY LIMITED REMEDY PROVIDED HEREIN.

Should any provision of this Agreement be held by a court of competent jurisdiction to be illegal, invalid, or unenforceable, that provision shall be deemed amended to achieve as nearly as possible the same economic effect as the original provision, and the legality, validity and enforceability of the remaining provisions of this Agreement shall not be affected or impaired thereby.

The failure of either party to enforce any term or condition of this Agreement shall not constitute a waiver of either party's right to enforce each and every term and condition of this Agreement. No breach under this agreement shall be deemed waived or excused by either party unless such waiver or consent is in writing signed by the party granting such waiver or consent. The waiver by or consent of a party to a breach of any provision of this Agreement shall not operate or be construed as a waiver of or consent to any other or

258 subsequent breach by such other party.

This Agreement may not be assigned (including by operation of law or otherwise) by you without WILEY's prior written consent.

Any fee required for this permission shall be non-refundable after thirty (30) days from receipt by the CCC.

These terms and conditions together with CCC's Billing and Payment terms and conditions (which are incorporated herein) form the entire agreement between you and WILEY concerning this licensing transaction and (in the absence of fraud) supersedes all prior agreements and representations of the parties, oral or written. This Agreement may not be amended except in writing signed by both parties. This Agreement shall be binding upon and inure to the benefit of the parties' successors, legal representatives, and authorized assigns.

In the event of any conflict between your obligations established by these terms and conditions and those established by CCC's Billing and Payment terms and conditions, these terms and conditions shall prevail.

WILEY expressly reserves all rights not specifically granted in the combination of (i) the license details provided by you and accepted in the course of this licensing transaction, (ii) these terms and conditions and (iii) CCC's Billing and Payment terms and conditions.

This Agreement will be void if the Type of Use, Format, Circulation, or Requestor Type was misrepresented during the licensing process.

This Agreement shall be governed by and construed in accordance with the laws of the State of New York, USA, without regards to such state's conflict of law rules. Any legal action, suit or proceeding arising out of or relating to these Terms and Conditions or the breach thereof shall be instituted in a court of competent jurisdiction in New York County in the State of New York in the United States of America and each party hereby consents and submits to the personal jurisdiction of such court, waives any objection to venue in such court and consents to service of process by registered or certified mail, return receipt requested, at the last known address of such party.

WILEY OPEN ACCESS TERMS AND CONDITIONS

Wiley Publishes Open Access Articles in fully Open Access Journals and in Subscription journals offering Online Open. Although most of the fully Open Access journals publish open access articles under the terms of the Creative Commons Attribution (CC BY) License only, the subscription journals and a few of the Open Access Journals offer a choice of Creative Commons Licenses. The license type is clearly identified on the article.

The Creative Commons Attribution License

The Creative Commons Attribution License (CC-BY) allows users to copy, distribute and transmit an article, adapt the article and make commercial use of the article. The CC-BY license permits commercial and non-

Creative Commons Attribution Non-Commercial License

The Creative Commons Attribution Non-Commercial (CC-BY-NC)License permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.(see below)

Creative Commons Attribution-Non-Commercial-NoDerivs License

The Creative Commons Attribution Non-Commercial-NoDerivs License (CC-BY-NC-ND) permits use, distribution and reproduction in any medium, provided the original work is properly cited, is not used for commercial purposes and no modifications or adaptations are made. (see below)

Use by commercial "for-profit" organizations

259

Use of Wiley Open Access articles for commercial, promotional, or marketing purposes requires further explicit permission from Wiley and will be subject to a fee.

Further details can be found on Wiley Online Library http://olabout.wiley.com/WileyCDA/Section/id- 410895.html

Other Terms and Conditions:

v1.10 Last updated September 2015

Questions? [email protected] or +1-855-239-3415 (toll free in the US) or +1-978-646-2777.

260

SPRINGER LICENSE TERMS AND CONDITIONS

May 03, 2016

This Agreement between Laura M Vecchio ("You") and Springer ("Springer") consists of your license details and the terms and conditions provided by Springer and Copyright Clearance Center.

License Number 3860880346242

License date May 02, 2016

Licensed Content Publisher Springer

Licensed Content Publication Journal of Neural Transmission

Licensed Content Title Idiopathic Parkinson's disease: possible routes by which vulnerable neuronal types may be subject to neuroinvasion by an unknown pathogen

Licensed Content Author H. Braak

Licensed Content Date Jan 1, 2003

Licensed Content Volume Number 110

Licensed Content Issue Number 5

Type of Use Thesis/Dissertation

Portion Figures/tables/illustrations

Number of figures/tables/illustrations 1

Author of this Springer article No

Order reference number None

Original figure numbers Figure 1

Title of your thesis / dissertation Investigating Monoamine Regulation: The Transport of The Dopamine Transporter to Striatal Terminals and the Effects of Tyrosine Hydroxylase Overexpression on Dopaminergic and Noradrenergic-Related Phenotypes

Expected completion date June 2016

Estimated size(pages 250

Requestor Location Laura M Vecchio 1 King's College Circle, RM 4302 Medical Sciences Building University of Toronto

261

Toronto, ON M5S 1A8 Canada Attn: Laura M Vecchio

Billing Type Invoice

Billing Address Laura M Vecchio 1 King's College Circle, RM 4302 Medical Sciences Building University of Toronto Toronto, ON M5S 1A8 Canada Attn: Laura M Vecchio

Total 0.00 USD

Terms and Conditions

Introduction The publisher for this copyrighted material is Springer. By clicking "accept" in connection with completing this licensing transaction, you agree that the following terms and conditions apply to this transaction (along with the Billing and Payment terms and conditions established by Copyright Clearance Center, Inc. ("CCC"), at the time that you opened your Rightslink account and that are available at any time at http://myaccount.copyright.com).

Limited License With reference to your request to reuse material on which Springer controls the copyright, permission is granted for the use indicated in your enquiry under the following conditions:

- Licenses are for one-time use only with a maximum distribution equal to the number stated in your request.

- Springer material represents original material which does not carry references to other sources. If the material in question appears with a credit to another source, this permission is not valid and authorization has to be obtained from the original copyright holder.

- This permission • is non-exclusive • is only valid if no personal rights, trademarks, or competitive products are infringed. • explicitly excludes the right for derivatives.

- Springer does not supply original artwork or content.

- According to the format which you have selected, the following conditions apply accordingly: • Print and Electronic: This License include use in electronic form provided it is password protected, on intranet, or CD-Rom/DVD or E-book/E-journal. It may not be republished in electronic open access. • Print: This License excludes use in electronic form. • Electronic: This License only pertains to use in electronic form provided it is password protected, on intranet, or CD-Rom/DVD or E-book/E-journal. It may not be republished in electronic open access. For any electronic use not mentioned, please contact Springer at [email protected].

- Although Springer controls the copyright to the material and is entitled to negotiate on rights, this license is only valid subject to courtesy information to the author (address is given in the article/chapter).

- If you are an STM Signatory or your work will be published by an STM Signatory and you are requesting to reuse figures/tables/illustrations or single text extracts, permission is granted according to STM Permissions Guidelines: http://www.stm-assoc.org/permissions-guidelines/ For any electronic use not mentioned in the Guidelines, please contact Springer at permissions.springer@spi- global.com. If you request to reuse more content than stipulated in the STM Permissions Guidelines, you will be charged a permission fee for the excess content.

262

Permission is valid upon payment of the fee as indicated in the licensing process. If permission is granted free of charge on this occasion, that does not prejudice any rights we might have to charge for reproduction of our copyrighted material in the future.

-If your request is for reuse in a Thesis, permission is granted free of charge under the following conditions:

This license is valid for one-time use only for the purpose of defending your thesis and with a maximum of 100 extra copies in paper. If the thesis is going to be published, permission needs to be reobtained. - includes use in an electronic form, provided it is an author-created version of the thesis on his/her own website and his/her university’s repository, including UMI (according to the definition on the Sherpa website: http://www.sherpa.ac.uk/romeo/); - is subject to courtesy information to the co-author or corresponding author.

Geographic Rights: Scope Licenses may be exercised anywhere in the world.

Altering/Modifying Material: Not Permitted Figures, tables, and illustrations may be altered minimally to serve your work. You may not alter or modify text in any manner. Abbreviations, additions, deletions and/or any other alterations shall be made only with prior written authorization of the author(s).

Reservation of Rights Springer reserves all rights not specifically granted in the combination of (i) the license details provided by you and accepted in the course of this licensing transaction and (ii) these terms and conditions and (iii) CCC's Billing and Payment terms and conditions.

License Contingent on Payment While you may exercise the rights licensed immediately upon issuance of the license at the end of the licensing process for the transaction, provided that you have disclosed complete and accurate details of your proposed use, no license is finally effective unless and until full payment is received from you (either by Springer or by CCC) as provided in CCC's Billing and Payment terms and conditions. If full payment is not received by the date due, then any license preliminarily granted shall be deemed automatically revoked and shall be void as if never granted. Further, in the event that you breach any of these terms and conditions or any of CCC's Billing and Payment terms and conditions, the license is automatically revoked and shall be void as if never granted. Use of materials as described in a revoked license, as well as any use of the materials beyond the scope of an unrevoked license, may constitute copyright infringement and Springer reserves the right to take any and all action to protect its copyright in the materials.

Copyright Notice: Disclaimer You must include the following copyright and permission notice in connection with any reproduction of the licensed material: "Springer book/journal title, chapter/article title, volume, year of publication, page, name(s) of author(s), (original copyright notice as given in the publication in which the material was originally published) "With permission of Springer" In case of use of a graph or illustration, the caption of the graph or illustration must be included, as it is indicated in the original publication.

Warranties: None Springer makes no representations or warranties with respect to the licensed material and adopts on its own behalf the limitations and disclaimers established by CCC on its behalf in its Billing and Payment terms and conditions for this licensing transaction.

Indemnity You hereby indemnify and agree to hold harmless Springer and CCC, and their respective officers, directors, employees and agents, from and against any and all claims arising out of your use of the licensed material other than as specifically authorized pursuant to this license.

No Transfer of License This license is personal to you and may not be sublicensed, assigned, or transferred by you without Springer's written permission.

263

No Amendment Except in Writing This license may not be amended except in a writing signed by both parties (or, in the case of Springer, by CCC on Springer's behalf).

Objection to Contrary Terms Springer hereby objects to any terms contained in any purchase order, acknowledgment, check endorsement or other writing prepared by you, which terms are inconsistent with these terms and conditions or CCC's Billing and Payment terms and conditions. These terms and conditions, together with CCC's Billing and Payment terms and conditions (which are incorporated herein), comprise the entire agreement between you and Springer (and CCC) concerning this licensing transaction. In the event of any conflict between your obligations established by these terms and conditions and those established by CCC's Billing and Payment terms and conditions, these terms and conditions shall control.

Jurisdiction All disputes that may arise in connection with this present License, or the breach thereof, shall be settled exclusively by arbitration, to be held in the Federal Republic of Germany, in accordance with German law.

Other conditions:

V 12AUG2015

Questions? [email protected] or +1-855-239-3415 (toll free in the US) or +1-978-646-2777.