ii
Faculte de Medecine et des Sciences de la Sante
Departement d'anatomie et de biologie cellulaire
Les facteurs transcriptionnels CUXl et HNF4a sont impliques dans le renouvellement de
I'epithelium intestinal, les maladies inflammatoires intestinales et le cancer colorectal
Par
M. Mathieu Darsigny
Departement d'anatomie et de biologie cellulaire
These presentee a la Faculte de Medecine et des Sciences de la Sante
En vue de l'obtention du grade de
Philosophiae Doctor (Ph.D.) en Biologie Cellulaire
These evaluee par
Francois Boudreau (Universite de Sherbrooke)
Nathalie Rivard (Universite de Sherbrooke)
Raymund Wellinger (Universite de Sherbrooke)
Maxime Bouchard (Universite McGill) S£PTErA6££ 3.01G Library and Archives Bibliotheque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition
395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada
Your We Votre reference ISBN: 978-0-494-75079-7 Our file Notre reference ISBN: 978-0-494-75079-7
NOTICE: AVIS:
The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.
While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.
1+1 Canada Ill
A LA MEMOIRE DE CEUX QUI M'ONT QUITTE
AVANT QUE LA BIOMEDECINE PUISSE LES SAUVER
Ma marraine, HELENE
Mon grand-pere, GEORGES
Mon pere, BERNARD IV
MAIS SURTOUT, A CEUX DONT
LA QUALITE DE VIE PEUT ENCORE ETRE AMELIOREE
BRIGITTE (CD)
DIANNA (UC)
GABRIEL (CD)
KELLY (CD)
JONATHAN (IBS)
SIMON (CD)
VINCENT (UC) V
LE MEILLEUR MO YEN D'AVOIR UNE BONNE
IDEE EST D'EN AVOIR BEAUCOUP
(LINUS PAULING) vi
TABLE DES MATIERES
TABLE DES MATIERES vi
LlSTE DES FIGURES xii
LlSTE DES TABLEAUX xiv
LlSTE DES TRAVAUX XV
LlSTE DES ABREVIATIONS xvi
SOMMAIRE xix
INTRODUCTION 1 1. Le systeme digestif 2 1.1 L'organogenese du tube digestif 2 1.2 Le renouvellement de 1'epithelium intestinal 4 1.3 Former et maintenir les cryptes 7 1.4 La differenciation des cellules epitheliales intestinales 8
2. L'immunite mucosale intestinale 12 2.1 Les structures lymphoides associees a 1'intestin 13 2.2 L'immunite innee : role de l'epithelium 15 2.3 L'immunite innee : role des leucocytes 19 2.4 Les macrophages : Un statut particulier au sein de 1'intestin 21 2.5 L'immunite adaptative : education et tolerance 22
3. Les maladies inflammatoires intestinales 25 3.1 La maladie de Crohn et la colite ulcereuse 25 3.2 Etiologie 26 Vll
4. Le cancer colorectal 28 4.1 Cancers familiaux 29 4.2 Mutations somatiques 29 4.3 Le cancer associe a la colite 31
5. Les facteurs de transcription 32
6. Le facteur de transcription CUX1 34 6.1 Structure genetique et proteique 34 6.2 Modes transcriptionnels 36 6.3 Regulation de I'expression et regulation post-traductionnelle 36 6.4 L'identification des premiers genes cible 38 6.5 Regulation du cycle cellulaire 39 6.6 Regulation de l'inflammation 41 6.7 Regulation de la migration cellulaire 42
7. Le facteur de transcription HNF4a 43 7.1 Decouverte et caracteristiques 43 7.2 Caracteristiques de la proteine 44 7.3 Les isoformes d'HNF4a 44 7.4 Distribution de son expression durant le developpement et chez I'adulte 45 7.5 Regulation transcriptionnelle d 'HNF4A 47 7.6 Regulation post-traductionnelle 48 7.7 Cofacteurs 48 7.8 Ligands endogenes et exogenes 51 7.9 Les fonctions et genes cibles d'HNF4a 52 7.10 HNF4a et metabolisme 54
8. Hypotheses, objectifs et methodes 55 8.1 CUX1 56 8.2 HNF4a 57 viii
RESULTATS 59
MANUSCRIT 1 60
CUXL TRANSCRIPTION FACTOR IS INDUCED IN INFLAMMATORY BOWEL DISEASE AND PROTECTS
AGAINST EXPERIMENTAL COLITIS 60 1.1 Auteurs et affiliations 61 1.2 Contributions 61 1.3 Resume 62 1.4 Abstract 63 1.5 Introduction 65 1.6 Materials and methods 67 1.7 Results 72 1.8 Discussion 83 1.9 Acknowledgments 87 1.10 References 88
MANUSCRIT 2 95
HEPATOCYTE NUCLEAR FACTOR 4a CONTRIBUTES TO AN INTESTINAL EPITHELIAL PHENOTYPE
IN VITRO AND PLAYS A PARTIAL ROLE IN MOUSE INTESTINAL EPITHELIUM DIFFERENTIATION.. 95 2.1 Auteurs et affiliations 96 2.2 Contributions 96 2.3 Resume 97 2.4 Abstract 98 2.5 Introduction 99 2.6 Materials and methods 102 2.7 Results 107 2.8 Discussion 119 2.9 Acknowledgments 123 2.10 References 123 IX
MANUSCRIT3 131
LOSS OF HEPATOCYTE-NUCLEAR-FACTOR-40C AFFECTS COLONIC ION TRANSPORT AND CAUSES
CHRONIC INFLAMMATION RESEMBLING INFLAMMATORY BOWEL DISEASE IN MICE 131 3.1 Auteurs et affiliations 132 3.2 Contributions 132 3.3 Resume 134 3.4 Abstract 135 3.5 Introduction 136 3.6 Materials and methods 138 3.7 Results 143 3.8 Discussion 154 3.9 Acknowledgements 158 3.10 Supplementary data 159 3.11 References 174
MANUSCRIT4 179
HEPATOCYTE-NUCLEAR-FACTOR-40C PROMOTES NEOPLASIA IN MICE AND PROTECTS AGAINST
THE PRODUCTION OF REACTIVE OXYGEN SPECIES 179 4.1 Auteurs et affiliations 180 4.2 Contributions 180 4.3 Resume 182 4.4 Abstract 183 4.5 Introduction 184 4.6 Materials and methods 187 4.7 Results 191 4.8 Discussion 201 4.9 Acknowledgements 206 4.10 Supplementary data 207 4.11 References 217 X
DISCUSSION 227
1. CUX1 228 1.1 Observations initiales 228 1.2 Permeabilite epitheliale 229 1.3 Regulation de l'expression de CUX1 231 1.4 Migration cellulaire 233 1.5 Proliferation 235 1.6 Experiences futures 236
CONCLUSION GENERALE(CUXI) 238
2. HNF4a et la regulation de la cytodifferenciation intestinale 240 2.1 Le maintien du renouvellement epithelial a l'age adulte 240 2.2 Axe entero-insulaire 245 2.3 Ouverture 249
3 FfNF4a et la regulation de l'inflammation 250 3.1 Comparaison des modeles 250 3.2 Colite spontanee 250 3.3 Initiation de la colite spontanee 253 3.4 Metabolisme du butyrate 256 3.5 Aspect endocrinien et Mil 257 3.6 Regulation de l'expression d'HNF4a 257 3.7 Cancer associe a la colite 260
4. HNF4a dans le cancer colorectal 261 4.1 Retour sur l'hypothese 261 4.2 Interpretation des resultats 261 4.3 Le stress oxydatif. 263 4.4 HNF4a et TP53 dans le cancer colorectal 265 XI
4.5 Deregulation des promoteurs PI et P2 268 4.6 Hnf4a et p53 chez les animaux Hnf4aAIEC 269 4.7 Regulation du metabolisme durant le cancer 273 4.8 Chimioresistance et efflux des drogues 277 4.9 Experiences futures 278 4.10 Therapeutique 281 4.11 Modele propose 282 4.12 Ouverture 285
CONCLUSION GENERALE (HNF4 A) 286
REMERCIEMENTS 288
REFERENCES 291
ANNEXES 351 xii
LlSTE DES FIGURES
INTRODUCTION
Figure 1 4 Figure 2 6 Figure 3 6 Figure 4 11
MANUSCRITl 60
THE CUXl TRANSCRIPTION FACTOR IS INDUCED IN INFLAMMATORY BOWEL DISEASE AND
PROTECTS AGAINST EXPERIMENTAL COLITIS 60 Figure 1 73 Figure 2 75 Figure 3 77 Figure 4 78 Figure 5 79 Figure 6 80 Figure 7 82 Figure 8 83
MANUSCRIT2 95
HEPATOCYTE NUCLEAR FACTOR 4a CONTRIBUTES TO AN INTESTINAL EPITHELIAL PHENOTYPE
IN VITRO AND PLAYS A PARTIAL ROLE IN MOUSE INTESTINAL EPITHELIUM DIFFERENTIATION.. 95 Figure 1 109 Figure 2 110 Figure 3 112 Figure 4 115 Figure 5 117 Figure 6 118 xiii
MANUSCRIT3 131
LOSS OF HEPATOCYTE-NUCLEAR-FACTOR-4a AFFECTS COLONIC ION TRANSPORT AND CAUSES
CHRONIC INFLAMMATION RESEMBLING INFLAMMATORY BOWEL DISEASE IN MICE 131 Figure 1 143 Figure 2 145 Figure 3 146 Figure 4 148 Figure 5 150 Figure 6 151 Figure 7 153
MANUSCRIT4 179
HEPATOCYTE-NUCLEAR-FACTOR-4a PROMOTES NEOPLASIA IN MICE AND PROTECTS AGAINST
THE PRODUCTION OF REACTIVE OXYGEN SPECIES 179 Figure 1 192 Figure 2 194 Figure 3 195 Figure 4 196 Figure 5 198 Figure 6 199 Figure 7 200
DISCUSSION 227
Figure 5 239 Figure 6 284
ANNEXE 351
Figure 7 353 xiv
LiSTE DES TABLEAUX
INTRODUCTION Tableau 1 47 Tableau 2 50
MANUSCRIT 1
MANUSCRIT 2
MANUSCRIT 3
Tableau SI 159 Tableau S2 160 Tableau S3 170 Tableau S4 172
MANUSCRIT 4 Tableau SI 207 Tableau S2 214
DISCUSSION
ANNEXE Tableau 3 351 Tableau 4 352 XV
LlSTE DES TRAVAUX
MANUSCRIT 1
THE CUXl TRANSCRIPTION FACTOR IS INDUCED IN INFLAMMATORY BOWEL DISEASE AND
PROTECTS AGAINST EXPERIMENTAL COLITIS 60
MANUSCRIT 2
HEPATOCYTE NUCLEAR FACTOR 4a CONTRIBUTES TO AN INTESTINAL EPITHELIAL PHENOTYPE
IN VITRO AND PLAYS A PARTIAL ROLE IN MOUSE INTESTINAL EPITHELIUM DIFFERENTIATION.. 95
MANUSCRIT 3
LOSS OF HEPATOCYTE-NUCLEAR-FACTOR-4a AFFECTS COLONIC ION TRANSPORT AND CAUSES
CHRONIC INFLAMMATION RESEMBLING INFLAMMATORY BOWEL DISEASE IN MICE 131
MANUSCRIT 4
HEPATOCYTE-NUCLEAR-FACTOR-4a PROMOTES NEOPLASIA IN MICE AND PROTECTS AGAINST
THE PRODUCTION OF REACTIVE OXYGEN SPECIES 179 xvi
LiSTE DES ABREVIATIONS
ACF Abberant Crypt Foci AD Activation Domain ADN Acide DesoxyriboNucleique AF Activation Function A-P Antero-posterieur APC Adenomatous Polyposis Coli ARN Acide RiboNucleique ASC Actual Stem Cell ATP Adenosime Triphosphate BCR B-Cell Receptor BMP Bone Morphogenetic Protein CAC Cancer Associe a la Colite CBC Crypt Base Columnar cell CD Crohn's Disease ChIP Chromatin ImmunoPrecipitation ON Chromosomal Instability CMHII Complexe Majeur d'Histocompatibilite de classe II CR Cut Repeat DALM Dysplasia Associated Lesion or Mass DBD DNA Binding Domain DC Dendritic Cell DR Direct Repeat DSS Dextran Sulphate Sodium D-V Dorsal-Ventral E Embryonaire EMT Epithelial Mesenchymal Transition FAE Follicule Associated Epithelium FT Facteur de Transcription G Growth GALT Gut Associated Lympoid Tissues G-D Gauche-Droit GTF General Transcription Factor GWA Genome Wide Association HAT Histone Acetyl Transferase HD HomeoDomaine HDAC Histone DeACetylase HDL High Density Lipoprotein HEV High Endothelial Venule HNF Hepatocyte Nuclear Factor HNPCC Hereditary NonPolyposis Colorectal Cancer IBD Inflammatory Bowel Disease IBS Irritable Bowel Syndrome IEC Intestinal Epithelial Cell Ig ImmunoGlobuline IL InterLeukine ILF Isolated Lympoid Follicule
Isc Isoelectric Short-circuit Current JPS Juvenile Polyposis Syndrome LA Linoleic Acid LBD Ligand Binding Domain LCFA Long Chain Fatty Acid LP Lamina Propria LOH Loss Of Heterozygosity LPS LipoPolySaccharide M Mitose MDA MalonalDiAehyde Mil Maladies Inflammatoires Intestinales MLN Mesenteric Lymph Node MOD Y Maturity Onset Diabetes of the Young NICD Notch Intracellular Domain NK Natural Killer xviii
NLR Nod-Related Receptors PAMP Pattern-Associated Molecular Patterns PUFA Poly-Unsaturated Fatty Acid NRD Negative Regulatory Domain PAS Periodic Acid Schiff PCR Polymerase Chain Reaction PIC Pre-Initiation Complex PP Plaque de Peyer PRR Pattern Recognition Receptors PSC Potential Stem Cell RAD Radial ROS Reactive Oxygen Species UC Ulcerative colitis S Synthese SCFA Short-Chain Fatty Acids SLO Secondary Lymphoid Organ SNP Single Nucleotide Polymorphism TAF TBP Associated Factor TCR T-cell Receptor TER TransEpithelial Resistance Tg TransGenique TGF Transforming Growth Factor TH T-Helper TLO Tertiary Lymphoid Organ TLR Toll Like Receptor TNBS TriNitroBenzene Sulfonic acid TNM Tumor Nodes Metastasis TUNEL Terminal dUTP transferase Nick End Labeling USA Upstream Stimulatory Activity VLDL Very Low Density Lipoprotein
Les mots en italique sont en anglais xix
SOMMAIRE
HNF4a est un facteur de transcription de la famille des recepteurs nucleaires hormonaux dont le role dans I'organogenese et le maintien des fonctions hepatiques est de mieux en mieux decrit. Cependant, son role dans le developpement et le maintien des fonctions gastrointestinales est peu connu. II en va de meme pour le facteur de transcription
CUXl au sein de de la muqueuse intestinale. Nous avons ainsi decide d'utiliser l'invalidation conditionnelle &,Hnf4a (Hnf4a?/J*) dans I'epithelium intestinal grace a I'expression de la
Cre-recombinase sous le controle du promoteur de 12.4 kb de la Villine (12.4kb-F/7/m.Cre).
Les epithelia de l'intestin grele et du colon ont ete etudies au niveau de leur morphologie, de leur proliferation, de leur differenciation et de leur fonction a differents temps du developpement de la souris. Nous avons dans un premier temps constate que la morphogenese de ces tissus se deroule normalement. Nous avons cependant observe que
I'epithelium de l'intestin grele presentait une legere augmentation de la proliferation et une modification des populations differenciees au profit des cellules enteroendocrines et caliciformes. Nous avons egalement identifie une reduction de la conductance de
I'epithelium colique du a une deregulation des canaux, transporteurs et pores impliques dans la regulation du transport ionique. Des cibles directes d'Hnf4a, tel que la claudine-15, ont vu leur expression diminuer chez les animaux mutants ainsi que dans les maladies inflammatoires intestinales durant lesquelles HNF4a est reduit en expression. Cette modification dans le role crucial de la reabsorption des fluides auquel I'epithelium colique participe a eu pour effet d'entrainer une colite spontanee ressemblant a la colite ulcereuse chez l'humain. En effet, une augmentation de 1'inflammation, une augmentation du recrutement de leucocytes, une augmentation de la proliferation et une apparition de XX dysplasie epitheliale ont ete observees. Les epithelia du grele et du colon ont egalement presente une augmentation du stress oxydatif et de l'apoptose qui s'est averee etre protectrice contre la perte d'heterozygocite de l'allele Ape dans le modele murin de tumorigenese
ApcM,n/+. En effet, les animaux pour lesquels 1'invalidation de I'expression d,Hnf4a a ete effectuee par la Villine-Cre (ApcM,n/+; Hnf4aAIEC), ont montre une reduction de 70% du nombre de polypes dans I'intestin grele et une reduction de 90% du nombre de polypes dans le colon. L'analyse des genes impliques dans la reduction des especes reactives de l'oxygene a permis d'identifier la GSTKl comme une nouvelle cible directe d'Hnf4a tant dans l'epithelium de I'intestin grele que dans le cancer colorectal. En effet, I'expression d'HNF4a chez les patients atteints du cancer colorectal s'est averee augmentee chez 31 patients sur les
40 analyses. Ces augmentations oscillent entre 50 et 100% chez 22% des patients et de 100% et plus chez 40% des patients analyses (n = 40). Les animaux CuxlAHD ont quant a eux ete etudies au niveau de leur susceptibilite a un stress inflammatoire. Nous avons demontre que
I'expression de CUX1 est necessaire a la protection de 1'inflammation aigue et chronique et que les patients atteints des maladies inflammatoires intestinales repondent en augmentant
I'expression de ce facteur. Nous croyons que I'expression de CUX1 permet de temperer la reponse inflammatoire et permet aussi la migration et la proliferation de l'epithelium colique en reponse aux blessures causees par l'inflammation soutenue. Collectivement, ces etudes demontrent l'importance du reseau de regulation transcriptionnelle dans les voies gastrointestinales pour le maintien de l'homeostasie proliferative, fonctionnelle et inflammatoire de l'epithelium. La modulation de ces facteurs durant les pathologies suggere la possibilite d'intervenir therapeutiquement sur ces facteurs aiin de controler leurs cibles et ainsi contrer 1'apparition, la progression ou la chronicite de ces maladies. xxi
Mots cles : Facteur de transcription (FT), CUXl, HNF4a, dextran sulphate sodium (DSS), tractus gastrointestinales, differenciation epitheliale intestinale, MODYl, colite ulcereuse
(UC), maladie de Crohn (CD), syndrome du colon irritable (IBS), cancer colorectal (CCR) INTRODUCTION
Le tube digestif est un organe complexe et dynamique. Nous verrons que les muqueuses du tractus gastrointestinal possedent une surface de contact impressionnante, que le systeme immunitaire y residant doit posseder des caracteristiques le distinguant des autres systemes lymphatiques du corps humain, que le renouvellement de l'epithelium intestinal se fait a un rythme rapide et que, pour se faire, de nombreuses communications cellule-cellule doivent se maintenir, non seulement lors du developpement, mais aussi a l'age adulte afin de permettre le controle de ce renouvellement et de la differenciation des types cellulaires fonctionnels de l'epithelium. Les prochaines sections seront dediees a la caracterisation de ces differents aspects. L'organogenese du tube digestif sera d'abord presentee pour ensuite decrire les processus de renouvellement de la muqueuse a l'age adulte. II sera ensuite question du role que jouent les differents types de cellules differenciees de l'intestin au niveau de l'immunite mucosale intestinale. A cette population tres importante sera ajoutee la population leucocytaire y residant et participant activement au systeme de surveillance immunitaire. Finalement, il sera question des deux desordres les plus repandus pouvant frapper I'homeostasie de ce tissu, soit les maladies inflammatoires intestinales et le cancer colorectal. Dans une deuxieme section, les facteurs de transcription prendront l'avant plan pour tenter d'expliquer certaines voies moleculaires pouvant mener a ces desordres. Des generalites seront done presentees sur deux facteurs, soit CUX1 et HNF4a, a la suite de quoi les hypotheses et objectifs de travail concernant l'etude de ces facteurs seront presentes. 2
1. Le systeme digestif
1.1 L'organogenese du tube digestif
Le developpement embryonnaire est un processus complexe, mais relativement bien etudie chez la souris grace a une manipulation simplified par une embryogenese assez courte de 18.5 jours (abrege sous la forme El8.5). Comme I'etude de l'organogenese chez I'homme se fait plus lentement a cause d'evidents problemes ethiques, les temps decrits ci-dessous seront ceux de la souris d'abord, puis ceux de l'humain si disponibles.
Le tube digestif est un organe possedant 4 axes de symetrie: l'axe anteroposterieur (A-
P), dorsal-ventral (D-V), gauche-droit (G-D) et radial (RAD) (GRAPIN-BOTTON et MELTON,
2000). Lors de sa formation, ces differents axes seront etablis par l'echange de signaux extrinseques avec les autres structures primitives et plus tard entre 1'epithelium et le mesenchyme. L'organogenese du tube intestinal primitif debute tout juste apres la gastrulation (E7.5) (TAM et LOEBEL, 2007). Quelques heures plus tard, l'endoderme est un feuillet de quelques centaines de cellules possedant deja des differences selon l'axe A-P
(LAWSON et PEDERSEN, 1987). Grace aux instructions du mesoderme, c'est le debut de la regionalisation de l'endoderme defmitif qui se separe en territoires appeles foregut, midgut, et hindgut. A E8.5, le tube a proprement parler se forme par la combinaison de deux repliements : l'un partant de l'endoderme anterieur et 1'autre de l'endoderme posterieur
(LAWSON, et al., 1986). A ce moment, l'epithelium est encore pseudo-stratifie, non-differencie et prolifere activement (8 semaines chez l'humain) (GRAND, et al., 1976). Fait interessant, l'endoderme determine a former le tube digestif est egalement necessaire a la formation, par bourgeonnement, de la thyroi'de, des poumons, du pancreas et du foie. Celui-ci est egalement engage dans une relation de communication avec le mesoderme destine a former le coeur 3
(LOUGH et SUGI, 2000). A E9, le mesoderme de la plaque laterale splanchnique condense autour du tube primitif pour former le mesenchyme et les couches musculaires. A ce moment, une communication tres importante, la communication epithelio-mesenchymateuse, s'etablit et sera, durant le developpement et a l'age adulte, l'un des plus importants echanges entre deux couches tissulaires de I'intestin (KEDINGER, et al., 1986). Eventuellement, des cellules provenant de la crete neurale forment le systeme nerveux enterique (El0.5) (YOUNG, et al., 1999) et d'autres cellules du feuillet ectodermique permettent I'ouverture du tube en formant la bouche et le rectum (DE SANTA BARBARA, et al., 2003). La periode s'etendant de
E9.5 a E14.5 est caracterisee par la morphogenese de I'intestin en etablissant non seulement avec precision l'axe A-P, mais aussi D-V, G-D, et radial (STAINIER, 2005). Par exemple, le facteur de transcription Isll sera necessaire a l'etablissement de l'axe G-D de I'intestin en dictant la rotation de I'intestin dans un sens anti-horaire (KURPIOS, et al., 2008). C'est aussi durant cette periode que l'endoderme pseudo-stratifie evolue vers un epithelium columnaire simple {simple columnar epithelium) pour former vers E14.5 les premieres villosites immatures soutenues par le mesenchyme et ce autant dans I'intestin grele que dans le colon
(9-12 semaines chez I'humain) (GRAND, et al., 1976). A ce moment debutent egalement la cytodifferenciation et la formation de deux compartiments distincts : le compartiment differencie et le compartiment proliferatif. L'homeostase de ces deux populations est alors regie par un rythme de proliferation, de migration et d'apoptose controle. Ceci sera, a l'age adulte, a la base du renouvellement epithelial a tous les 3 jours dans I'intestin grele (5 jours chez I'humain) et a toutes les semaines dans le colon (GORDON, 1989; POTTEN, 1975).
Ces changements morphologiques vont s'etendre jusqu'a la naissance et se terminer vers la premiere semaine de vie chez la souris avec la formation d'unite cryptales bien 4 definies ou se trouvent les cellules souches a la base de ce renouvellement (10-12 semaines chez rhumain) (BRY, et al, 1994; CALVERT et POTHIER, 1990). Dans le colon, les villosites auront maintenant disparu pour laisser place a un epithelium plat (Figure 1). Pour terminer, ces unites cryptes passeront par une etape de fission ciyptale afin de completer la maturation du tube digestif; un processus repete dans diverses situations a l'age adulte (LEEDHAM, et al..
2005, ST CLAIR et OSBORNE, 1985).
Figure 1 | Aspect morphologique de l'intestin grele et du colon dans le tractus gastrointestinal. Modifie" de (NEISH, 2009; SANCHO, et al, 2004).
1.2 Le renouvellement de !' epithelium intestinal
Le renouvellement de l'epithelium intestinal est rendu possible par la proliferation des
cellules souches intestinales. Ces cellules pluripotentes sont par definition des cellules
possedant une tres longue duree de vie; duree de vie qui pour la majorite d'entre elles sera
aussi longue que celle de 1'organisme (MORRISON et SPRADL1NG. 2008). La notion de cellule
souche veritable de l'intestin (Actual stem cell; ASC) est encore objet de debat. mais. quoi
qu'il en soit, il y aurait vraisemblablement 2 populations de cellules souches au sein de
Pintestin ayant chacune un role selon les evenements; developpement renouvellement. 5 blessure et cancer par exemple. Une premiere population de cellules pluripotentes serait localisee en moyenne a la position 4 de la crypte {Label retaining celll; LRC) (CHENG et
LEBLOND, 1974; HENDRY, et al., 1992) et, une seconde, serait localisee a la base de la crypte intesitnale {Crypt base columnar cell; CBC) (HAEGEBARTH et CLEVERS, 2009) (voir Figure 2).
Selon les estimations, quatre cellules souches par jour entameraient une division de 24 heures afin de repeupler l'epithelium tous les 3-5 jours (AL-DEWACHI, et al., 1975; AL-
DEWACHI, et al., 1979; POTTEN, et al., 2002). A l'exclusion des cellules engagees vers la differentiation en cellule de Paneth, les cellules filles obtenues migrent vers le haut de la crypte a un rythme d'une position a l'heure ou elles seront considerees comme cellules progenitrices ou potentielles souches {Potential Stem Cell; PSC) jusqu'a la position 6 (en moyenne). Ceci porte a entre 30 et 40 le nombre de cellules retenant un potentiel souche. En d'autres termes, si toutes les ASC sont perdues lors d'une irradiation ou d'une blessure, les
PSC peuvent les remplacer (POTTEN, 2004). Ces cellules continuent de proliferer a un rythme d'un cycle par 12 heures jusqu'a la position 10 (AL-DEWACHI, et al., 1975). Les cellules filles de la crypte ont alors le choix entre les 4 types cellulaires majoritaires de l'intestin : la cellule absorbante, la cellule caliciforme et la cellule enteroendocrine (autrefois appelee enterochromaffine) (BJERKNES et CHENG, 1999). A celles-ci s'ajoute la cellule de Paneth qui elle effectue un retour a la base de la crypte (voir Figure 3). Marqueurs valides par Marqueurs valides par expression et expression seulement par tracage de la descendance
Musachi-1 DCAMKL1 o BMI1 p-p-Catemne CD133 WIP1 LGR5 Telomerase • ASCL2 OLFM4
+4LHC
0 IRC avec une forte representation en position 4 CBQ H Crypt base columnar cell (CBC) U Cellule progenitrice
Figure 2 | Resume des differents marqueurs des populations de cellules souches intestinales (LRC et CBC) et de leur position au sein de la crypte de l'intestin grele. Figure modifiee de (MONTGOMERY et SHIVDASANI, 2009). References : Msil (KAYAHARA, et al., 2003), p-AKT/p-PTEN (HE, et al., 2004), p-p-Catenine (HE, et al., 2007), Wipl (DEMIDOV, et al., 2007), Telomerase (BREAULT, et al., 2008), OLFM4 (VAN DER FLIER, et al., 2009), Bmil (SANGIORGI et CAPECCHl, 2008), CD 133 (SNIPPERT, et al, 2009), Lgr5 (BARKER, et al, 2007; BARKER, et al., 2009) et Ascl2 (VAN DER
Cellules epitheliales de l'intestin grete Cellules a mucus Cellules errteroendocrines
: 1: J:\
•/? t' -t-,, Cellules de Panath Cellules absorbantes «* *A ^ 1$ •^ 't •*' , 4 *& £r\ $ £&%$' m
Hgure 3 j Les 4 cellules principales differenciees de l'intestin grSie. Figuie modifiee de (VAN Dfc'R FLIER et CLE VFRS, 2009). 7
1.3 Former et maintenir les cryptes
La formation et le maintien du compartiment de la crypte (aussi appele glande) est en grande partie possible par Taction des morphogenes. Ces derniers sont des proteines pouvant influencer la destinee cellulaire {cell fate) des cellules environnantes en formant des gradients de concentration dans les tissus (LAWRENCE et STRUHL, 1996). Combines a leur effecteurs intracellulaires, ces reseaux, aussi appeles morphostats, seront impliques dans la formation de la microarchitecture d'un tissu durant le developpement, de la morphostase a
Tage adulte et seront responsables de la metaplasie dans la carcinogenese (SLACK, 1986;
TARIN, 1972). Les principaux morphostats necessaires au maintien de la crypte sont les molecules de la famille Hedgehog, les molecules de la famille BMP (Bone Morphogenetic
Proteins) ainsi que le facteur de croissance PDGF. Sonic et Indian heghog (SHHet IHH) sont des ligands secretes uniquement par T epithelium et pouvant influencer le mesenchyme exprimant leurs recepteurs Patched-1/2 (PTCH1/2) et leurs effecteurs intracellulaires GLI
(GLI1-3) (MADISON, et al., 2005). Un bel exemple du role des Hedgehogs provient de
Tobservation d'un modele transgenique (Jg-Hhip) exprimant le ligand Hhip inhibiteur de ceux-ci (MADISON, et al., 2005). Le blocage de Taction des Hedgehogs sur le mesenchyme resulte en une alteration de la localisation des myofibroblastes pericryptaux, des cellules qui sont importantes dans la formation de la crypte et dans Tinstruction des cellules epitheliales
(POWELL, et al., 1999). Ces souris montrent aussi une deficience dans le remodelage de
Tepithelium, dans la formation de la villosite et montrent des signes d'une differentiation incomplete des enterocytes. Ceci prouve a la fois Timportance de cette communication epithelio-mesenchymateuse, mais demontre aussi que celle-ci est bidirectionnelle. D'autres morphostats se comportent essentiellement de la meme facon, tel que le PDGF, qui, lui aussi, est secrete par Tepithelium (KARLSSON, et al., 2000). D'autres communications demarrent en 8 sens inverse. Par exemple, les BMPs, comme BMP2 et BMP4, sont eux secretes par le mesenchyme et leur recepteur, BMPR1 A, est lui, exprime par T epithelium (HARDWICK, et al.,
2008). L'expression de l'antagoniste Noggin chez une souris transgenique (Tg-Noggin) resulte en une multiplication des unites cryptales et demontre que cette voie est necessaire dans la regulation du nombre de cryptes. Noggin serait done normalement retrouve dans la region des cryptes afin de bloquer Taction des BMPs dans cette region (HARAMIS, et al., 2004).
La regulation de la proliferation de la crypte est quant a elle dependante en grande partie de la voie Wingless (Wnt). La signalisation des Wnt (WNT#) sur leurs recepteurs
Frizzled (FRZ#) permet I'activation intracellulaire et la liberation de la p-catenine; une molecule s'associant a des facteurs de transcription de la famille TCF/LEF. Ces TFs, tel que
TCF4, sont necessaires au maintien de la proliferation et du caractere souche des ASC. Par exemple, la souris Tcf4~'~ presente une absence de compartiment proliferatif et un epithelium entierement compose de cellules differenciees non-proliferatives (KORINEK, et al., 1998). A l'inverse, une mutation dans la proteine APC (Adenomatous Polyposis Coli; APC), impliquee dans la sequestration de la (3-catenine, conduit au syndrome FAP (Familial
Adenomatous Polyposis; FAP) (KINZLER, et al., 1991). Ce syndrome se caracterise par une formation de plusieurs adenomes colorectaux (HALF, et al., 2009). La voie Wnt s'autoregule afin de conserver et propager l'activite de cette voie au niveau de la crypte (GREGORIEFF, et al., 2005).
1.4 La differenciation des cellules epitheliales intestinales
La cellule fille migrant le long de la crypte ne pourra pas choisir seule la destinee qui lui est reservee (Voir Figure 4 pour un shema resume). En d'autres termes, la destinee 9 cellulaire des cellules epitheliales intestinales est non-autonome et devra done etre regulee par des signaux extrinseques (HERMISTON, et al., 1996). La voie de signalisation Notch engagee par le ligand Delta est une voie bien connue pour son role dans le principe d'inhibition laterale ou la signalisation a l'interieur d'un certain groupe de cellules amplifie la difference entre ces groupes afin de les conduire a deux destinees differentes. Cette voie est egalement necessaire a la formation de barrieres entre deux populations de cellules, ou encore dans la creation de deux lignees cellulaires ayant herite de maniere asymetrique differents regulateurs de cette voie (BRAY et FURRIOLS, 2001). Lorsque le ligand Delta se lie au recepteur Notch, ceci induit deux clivages du domaine intracellulaire du recepteur (Notch
Intracellular Domain; NICD) et produit NICD pouvant transloquer au noyau pour se lier au facteur transcriptionnel CSL (RBPJ), ainsi qu'a son co-activateur Mastermind (MAML#)
(WILSON et KOVALL, 2006). Cette liaison deplace le complexe de co-repression forme de
SMART, CtBP et SPEN (NCOR2, RBBP8, SPEN) et permet l'activation des genes cibles
(OSWALD, et al., 2005). Dans l'intestin, la voie Notch participe a la fois a la proliferation des cellules souches et dans la creation de deux lignees distinctes : les cellules de la lignee secretaire et la lignee des cellules absorbantes. Le modele actuel propose que lorsque Notch est active dans un precurseur de la crypte, le complexe NICD/MAML active l'expression du gene HES1. A son tour, HES1 serait un represseur du gene MATHJ, necessaire a la differentiation des cellules de la lignee secretaire. Ceci aurait pour effet de restreindre cette cellule a s'engager dans la lignee des cellules absorbantes. A l'inverse, une cellule exprimant le ligand Delta ne recevra pas de signal et pourra conserver l'expression de MATH1. La souris Mathl'1' est l'un des premiers phenotypes a avoir dresse ce modele (YANG, et al., 2001).
En effet, ces souris ont l'incapacite de produire des cellules de la lignee secretaire, alors que les cellules absorbantes sont toujours presentes. Ces informations ont plus tard ete 10 confirmees par l'utilisation d'un modele de deletion conditionnelle au niveau de l'intestin
(Mathl™**; Fabpl4XAT~ 752 Cre) (SHROYER, et al., 2007). La souris Hesl'" quant a elle presente le phenotype inverse (JENSEN, et al., 2000). Cette fois, Perithelium est compose d'un nombre eleve de cellules caliciformes et de cellules enteroendocrines montrant que Hesl est necessaire pour restreindre Pengagement vers la lignee secretaire. Toutefois, cette etude suggere que d'autres isoformes de la famille Hes (Hesl-5) puissent compenser la perte de
Hesl. Pour contourner ce probleme, I'equipe de Hans Clevers a plutot choisi d'invalider
Rbpj (CSL) grace a un systeme inductible a la p-naphtoflavone (Rbpfc/Jk; CyplA.Cre).
L'invalidation epitheliale de Rbpj a eu pour effet de transformer P ensemble de Paxe crypte- villosite en cellules caliciformes Mathl+ et d'y perdre presque toute proliferation dans le compartiment proliferatif. Les cellules de Paneth demeurent cependant dans un nombre stable, ce qui peut etre explique par leur duree de vie de 3-6 semaines (IRELAND, et al., 2005).
D'autre part, un resultat similaire a ete obtenu lorsque des souris ont ete traitees avec un inhibiteur de la protease responsable du premier clivage de la portion intracellulaire de
Notch : la y-secretase. Cet inhibiteur administre a des souris ApcM,n/+ demontre egalement que la voie Wnt et la voie Notch sont necessaires au maintien de la proliferation des progeniteurs cryptaux puisque malgre une activite constitutive de la P-catenine, une bonne proportion des adenomes ont ete transformes en cellules Mathl+ Pas+ Ki67", done non- proliferatives (VAN ES, et al., 2005). A I'inverse, une souris transgenique exprimant la portion active du recepteur Notch (Tg-Nicd) conduit a une absence des trois types de cellules de la lignee secretaire et a un allongement du compartiment proliferatif (FRE, et al., 2005). Fait interessant, la voie Wnt semble elle aussi impliquee dans la progression de ces decisions.
Une souris transgenique surexprimant Pantagoniste DKK1 (Jg-Dkkl) conduit a une diminution de la proliferation, une diminution de la localisation nucleaire de la P-catenine et 11 une absence complete des cellules de la lignee secretoire (PINTO, et al, 2003). Pris dans leur ensemble, ces resultats suggerent que ces deux voies sont necessaires tant a la proliferation des progeniteurs cryptaux qu"a leur destinee cellulaire.
Lign&e sicr6toir# Lignee absorbante
Figure 4 | Schema des differents lacteurs responsables des decisions prises lois de la difterenciation epitheliale tntesunale Shema modifie de (VAN DFR FLIER et CLEVERS, 2009) 12
2. L'immunite mucosale intestinale
Le systeme digestif a l'importante tache de digerer et d'absorber les nutriments, les mineraux et l'eau necessaires un bon fonctionnement de I'organisme. Afin de maximiser cette tache, la muqueuse intestinale a evolue afin atteindre l'impressionnante taille de 300 a
400 m2 et devenir la muqueuse la plus importante du corps humain (BRANDTZAEG, 1989).
Bien qu'essentielle, cette surface donne aussi une porte d'acces aux quelques 1013-1014 microorganismes vivant dans cette lumiere (WHITMAN, et al., 1998). Ce mutualisme existe depuis les debuts de la vie eucaryote, moment ou cette cellule gagna la phosphorylation oxydative par l'inclusion de l'a-proteobacterium pour former la mitochondrie (GRAY, et al.,
1999). Encore de nos jours, c'est, entre autre, pour une question d'energie que les mammiferes tirent profit de cette relation de symbiose. En effet, Ton tire de 5-15% de notre demande energetique des sels organiques, tels que les acides gras a courte chaine (Short-
Chain Fatty Acid; SCFA) comme le butyrate, le succinate et le proprionate, produits par la fermentation bacterienne des polysaccharides complexes comme la cellulose (BERGMAN,
1990; HOOPER, et al., 2002). Par exemple, une souris sans germe (germ free) consomme environ
30% plus de calories (BACKHED, et al., 2004).
Plus de 400 phylotypes bacteriens, protozoaires et champignons partagent le logement qu'est le tube digestif (ECKBURG, et al., 2005). Heureusement, le corps humain s'est dote de plusieurs moyens pour reguler cette frontiere. En effet, le systeme lymphoi'de associe a l'intestin (Gut Associated Lymphoid Tissues; GALT), en formant 70% du systeme immunitaire humain, est le plus imposant arsenal lymphatique. Ce systeme devra etre d'autant plus aiguise qu'il est maintenu en presence constante de corps etrangers, pour la plupart non-pathogenes, mais dans lesquels peuvent se retrouver a 1'occasion des 13 microorganismes enteroinvasifs contre lesquels il faudra reagir. Dans les prochaines sections, nous discuterons des particularites du GALT, ainsi que des pathologies qui touchent
Fhomeostasie inflammatoire du tissu intestinal.
2.1 Les structures lymphoides associees a l'intestin
Le systeme immunitaire associe a la muqueuse intestinale (GALT) se distingue du systeme lymphatique peripherique de par la separation anatomique de ses sites inducteurs et de ses sites effecteurs (BRANDTZAEG et PABST, 2004). Les sites d'induction, ou seront eduques les lymphocytes B et les lymphocytes T, sont composes de la plaque de Peyer (PP), des follicules lymphatiques isoles (Isolated Lymphoid Follicules; ILF), des nodules lymphatiques mesenteriques (Mesenteric Lymph Node; MLN) et dans une moindre partie la lamina proria (LP) (BRANDTZAEG, et al., 1998). Les sites effecteurs quant a eux sont composes de la lamina propria et de F epithelium (BRANDTZAEG, et al., 1999).
Le GALT se developpe et s'installe au cours de Fembryogenese, mais la maturation ne sera completee que dans la jeune enfance chez Fhumain et les premieres semaines de vie chez la souris (MARSH et CUMMINS, 1993). Le debut de la lymphangiogenese correspond au bourgeonnement de Fendothelium veineux autour du jour El2.5 et ce sous la regulation du gene Prox-1 (WIGLE et OLIVER, 1999). Peu de choses sont connues sur la suite du processus, mais, vers E14.5, le systeme lymphatique provenant des nodules lymphatiques mesenteriques et le systeme sanguin ont atteint la muqueuse intestinale. A ce stade, Fune des premieres cellules lymphoides a s'y rendre sera celle permettant la formation de la plaque de Peyer
(ADACHI, et al, 1997). Cette cellule hematopoi'etique souche CD4+CD3"CD45+, Fune des cellules hematopoietiques les plus precoces, est appelee cellule inductrice (YOSHIDA, et al., 14
1999). Elle ira rejoindre vers El7.5 la cellule organisatrice deja presente dans le stroma
(HONDA, et al., 2001). La deuxieme phase du developpement se produit au jour El 8.5, moment ou I'organe primitif devient adequatement vascularise. La plaque de Peyer, contrairement aux nodules lymphatiques secondaires, ne possede pas de reseau lymphatique afferent, mais possede cependant un reseau efferent vers les MLN. La colonisation de cet organe se fait done par les lymphocytes recirculants, captes par des molecules d'adhesion (adressines) lors de leur roulement sur les cellules endotheliales. Les veinules endotheliales (High Endothelial
Venules; HEV) sont des structures specialisees de l'appareil post-capillaire exprimant des molecules d'adhesion et formant un endroit privilegie pour le roulement, I'arret, I'adhesion solide et 1'entree par transmigration des leucocytes (BUTCHER et PICKER, 1996; KRAAL et
MEBIUS, 1997). En ce qui concerne la PP, elle sera mature des 4 jours apres la naissance. Chez l'humain, les PP sont bien formees des 15-20 semaines de grossesse (SPENCER, et al., 1986), mais vont maturer jusqu'a l'age de 14 ans et former entre 100 et 200 unites le long de l'intestin grele (CORNES, 1965). Les PPs augmentent en abondance vers la portion terminale de l'intestin grele (KRAEHENBUHL et NEUTRA, 2000) et se transforment dans le colon en follicules lymphoi'des isoles a l'apparence et a la structure tres similaire a la PP (CAMERON, et al., 2006; OWEN, et al., 1991). Ces structures, aussi appelees collectivement les organes lymphoi'des secondaires (Secondary Lymphoid Organ; SLO), peuvent changer en nombre et en densite au cours de la vie et se multiplier dans les maladies inflammatoires pour former ce qui est appele les organes lymphoi'des tertiaires (Tertiary Lymphoid Organ; TLO) (ALOISI et
PUJOL-BORRELL, 2006; NASCIMBENI, et al., 2005).
Une fois mature, la population leucocytaire de l'intestin se divise en deux grandes lignees : les myelocytes et les lymphocytes. Les myelocytes ont pour precurseur la cellule 15 souche myeloi'de et sont formes de 6 cellules differenciees : la cellule dendritique
(Dendritic cell; DC), le macrophage, le neutrophile, l'eosinophile, le mastocyte et le basophile. Pour terminer, trois grands types cellulaires sont retrouves au niveau des lymphocytes et ont pour precurseur la cellule souche lymphoi'de : la cellule tueur naturel
(Natural Killer; NK), le lymphocyte B et le lymphocyte T (CHAPLIN, 2003; PARKIN et COHEN,
2001). Ces differents leucocytes ont I'importante tache de controler I'entree, la proliferation et
1'invasion dans la circulation systemique des differents pathogenes qui pourraient eventuellement franchir la premiere barriere constitute de la monocouche de cellules epitheliales intestinales. Comme pour le reste du corps humain, les mecanismes immunitaires peuvent etre d'ordre inne ou acquis (CHAPLIN, 2003). La portion innee pourra impliquer les monocytes et granulocytes logeant dans la muqueuse, mais aussi les cellules epitheliales; jouant un role de plus en plus mis a I'avant plan (TURNER, 2009). La portion acquise quant a elle impliquera des populations particulieres de lymphocytes ou education et tolerance seront les mots d'ordre (SANSONETTI, 2004).
2.2 L'immunite innee : role de l'epithelium
La monocouche continue de cellules epitheliales intestinales constitue la premiere barriere contre l'invasion des pathogenes (MADARA, et al., 1990). L'etablissement polarise de cette monocouche est rendu possible grace au complexe apical de jonction compose de la jonction serree (VAN ITALLIE et ANDERSON, 2006) et de la jonction adherente (ZBAR, et al.,
2004). Cette cohesion entre les enterocytes, aidee des desmosomes (GREEN et GAUDRY, 2000), permet une separation physique entre la lumiere et la lamina propria sous-jacente. II est cependant important de realiser que cette barriere est dynamique. En effet, la jonction serree, ou zonula occudens, formee des 24 isoformes de claudines (LAL-NAG et MORIN, 2009), des 16
JAMs (junctional adhesion molecule) (MARTIN-PADURA, et al., 1998), du CAR (COHEN, et al.,
2001), de la tricelluline (IKENOUCHI, et al., 2005) et de I'occludine (FURUSE, et al., 1996), est une barriere a la fois etanche et permeable (TURNER, 2009). La permeabilite paracellulaire est une dimension tres importante de repithelium, car elle permet de regulariser de maniere selective le passage des fluides et des ions par diffusion passive. En effet, une distribution variee selon l'axe A-P et radial de l'intestin (HOLMES, et al., 2006), une variation selon differents stimuli
(inflammation, hormones, nourriture, bacteries) et une modulation de l'expression selon differentes pathologies intestinales (SCHMITZ, et al., 1999; ZEISSIG, et al., 2007) rend la selectivity du passage des ions par les claudines un domaine d'etude important pour la comprehension de la physiologie de Perithelium intesinal.
Grace aux cellules caliciformes (Figure 3), l'epithelium secrete le mucus capable de former une barriere physique entre les cellules et les microorganismes (DEPLANCKE et
GASKINS, 2001). Le mucus est une matiere viscoelastique formee de glycoproteines appelees mucines (au nombre de 21 chez l'homme) aux proprietes semblables a un polymere
(FORSTNER, et al., 1995; KUFE, 2009). Ces proteines sont secretees a la fois de maniere continue et via une stimulation inflammatoire, hormonale ou neuropeptidique (LABOISSE, et al., 1995;
LABOISSE, et al., 1996; PLAISANCIE, et al., 1998). L'action protectrice de la couche de mucus reside dans sa capacite a bloquer ou englober les microbes et done de reduire la rencontre des epitopes presents a la surface des cellules epitheliales auxquels ils peuvent se Her pour ainsi profiter, soit d'un transport actif, ou encore, traverser dans la lamina propria via une breche
(BELLEY, et al., 1999). Cependant, certaines bacteries pathogenes tel que H. pylori sont capable a la fois de mucolyse et d'inhibition de la secretion de mucus; ce qui leur permet d'atteindre l'epithelium (MORAN, 1996; WINDLE, et al., 2000). L'importance de ces mucines a ete bien 17 demontree jusqu'a present pour la mucine-2 et la mucine-3 chez des modeles animaux montrant leur necessite dans le maintien de Phomeostasie inflammatoire (HO, et al., 2006; VAN
DER SLUIS, et al., 2004).
Le deuxieme type cellulaire dont on doit discuter est la cellule enteroendocrine (Figure
3) (LOMAX, et al., 2006). Cette population est en realite composee d'au moins 14 types differents de cellules secretant chacune differents types d'hormones regulant les fonctions intestinales (RTNDI, et al., 2004). Certaines hormones, comme la serotonine (5-HT), ont d'importants roles a jouer sur la motilite du tube digestif en agissant sur les neurones enteriques necessaires a 1'innervation moteur des muscles de la musculeuse externe (READ et
GWEE, 1994). La serotonine (ATKINSON, et al., 2006) a d'ailleurs ete impliquee dans la maladie du colon irritable (irritable bowel syndrome; IBS), maladie souvent caracterisee par des problemes de diarrhee et de constipation (BORMAN, 2001).
Le troisieme type cellulaire mis a profit est la cellule de Paneth (Figure 3), une cellule s'apparentant aux granulocytes de par son stockage de granules de secretion contenant des peptides a action antimicrobienne (KESHAV, 2006; OTTE, et al., 2003). Mis a part le lysozyme contenu dans ces granules, deux autres classes de proteines sont produites par ces cellules : les cathelicidines et les defensines (GANZ, 2003; OUELLETTE, et al., 1994; ZANETTI, 2004). De facon generate, ces dernieres sont des enzymes lytiques, des ligands pour les recepteurs des microorganismes, ou encore de petits peptides cationiques (<100 a.a.) creant des pores dans la membrane des microorganismes (GRANDJEAN, et al., 1997; SHAI, 1999). La cellule de Paneth est l'unique type cellulaire se trouvant aux bases des cryptes et possede une duree de vie d'environ 20 jours contrairement a 3-5 pour les autres enterocytes (TROUGHTON et TRIER, 18
1969). A l'occasion, des cellules intermediaires, secretant a la fois du mucus et des defensines, sont retrouvees dans la villosite intestinale (CUNLIFFE, et al., 2001). La cellule de
Paneth augmente en presence selon l'axe A-P pour etre pratiquement absente dans le colon.
Cependant, lors de differentes conditions inflammatoires, des cellules de Paneth metaplasiques peuvent y etre retrouvees et possiblement aider a l'elimination de rinfiammation (CUNLIFFE, et al., 2001).
Le portrait de cet epithelium ne serait pas complet sans aborder le role que joue l'enterocyte dans la regulation de rinfiammation intestinale (Figure 3). En effet, afin de repondre rapidement a la presence des microorganismes, 1'immunite innee a su developper des recepteurs sentinelles donnant I'alerte d'une invasion bacterienne; et l'epithelium en etant directement en contact avec la lumiere exploite fierement ce systeme. Le principe repose sur la reconnaissance des patrons moleculaires retrouves chez les pathogenes (Pattern-
Associated Molecular Patterns; PAMPs) par des recepteurs (Mammalian Pattern Recognition
Receptors; PRRs) a la surface ou dans le cytoplasme des cellules. Les recepteurs membranaires sont appeles TLRs (Toll- Like Receptors; TLRs) (FUKATA, et al., 2009) alors que les recepteurs intracellulaires sont appeles NLRs (NOD-Related Receptors) (MARTINON, et al., 2009). Bien que ces recepteurs aient initialement ete identifies comme un moyen de detecter les infections dans les tissus, il devient de plus en plus evident que les TLRs retrouves a la surface des muqueuses jouent egalement un role dans l'homeostasie des epithelia (CARIO et PODOLSKY, 2005). L'exemple suivant est l'un des meilleurs exemples connus a ce jour, mis a part l'apport nutritionnel discute plus haut, de la contribution faite par les microorganismes dans ce mutualisme. En effet, les dernieres etudes realisees sur le recepteur TLR2 montrent que la signalisation de celui-ci aide a la polarisation des 19 enterocytes via la voie de signalisation PI3K/Akt, a la localisation de la ZO-1, apporte des signaux de survie et est necessaire a la protection de la colite experimentale par le DSS
(CARIO, et al., 2004; CARIO, 2008). D'autre part, la capacite d'une activation inflammatoire via
NF-KB chez les cellules epitheliales intestinales semble reduite durant I'homeostase. En effet, il a ete remarque que certains TLRs et leur co-recepteur sont peu exprimes dans un etat non-inflammatoire (ABREU, et al., 2001; CARIO, et al., 2000; OTTE, et al., 2004) ou encore sont considered hyporeactifs, entre autre par la presence de molecules de signalisation inhibitrices
(JANSSENS, et al., 2002; KOBAYASHI, et al., 2002; OHTA, et al., 2004; OTTE, et al., 2004).
2.3 L'immunite innee : role des leucocytes
Les neutrophiles forment 50-60% des leucocytes circulants et sont les premiers effecteurs de 1'inflammation (SMITH, 1994). Malgre leur haute concentration sanguine, les neutrophiles ne sont pas retrouves en grand nombre dans la lamina propria du tissu intestinal sain (CARLSON, et al., 2002). Par contre, des les premiers signes d'infection, ou lors des Mil comme la colite ulcereuse, les vaisseaux sanguins a proximite de Perithelium intestinal vont permettre 1'extravasation d'une quantite importante de ces granulocytes au site de l'infection; augmentant de 40 a 55 fois la presence de lipocalin, un marqueur d'inflammation chez le neutrophile (CARLSON, et al., 2002). Fait interessant, la presence de ceux-ci retourne a la normale durant les phases non-actives de la colite ulcereuse (LAMPINEN, et al., 2005).
Des donnees semblables sont retrouvees du cote de l'eosinophile. Encore une fois, la presence de cette cellule peut etre detectee dans la muqueuse normale et en fait seuls le systeme gastrointestinal, les nodules lymphatiques, le thymus et la rate demontrent une residence permanente de ce type cellulaire (KATO, et al., 1998). De la meme facon, 20 l'eosinophile CD66+ est 40 a 50 fois plus present dans les patients atteints de la colite ulcereuse durant la phase active de la maladie en comparaison avec la phase non-active et les sujets controles (LAMPINEN, et al., 2005). Contrairement au neutrophile, l'eosinophile exprime le recepteur aux IgE (RcERII) et reconnait done les pathogenes opsonises (PARKIN et COHEN,
2001).
Le mastocyte est le troisieme type cellulaire retrouve dans la lamina propria intestinale
(BISCHOFF, et al., 1996). Le mastocyte joue des roles au niveau du controle des nerfs enteriques avec la secretion d'histamine et de serotonine par exemple (NOLTE, et al., 1990). Chez les patients atteints de la colite ulcereuse, une augmentation de 3 a 6% des mastocytes marques pour la serotonine ou la substance P a ete observee (STOYANOVA et GULUBOVA, 2002). Les mastocytes sont aussi impliques dans les reactions allergiques, dont les allergies alimentaires
(BISCHOFF, 2009).
Notre prochaine population a couvrir est le basophile, le moins connu des granulocytes, et aussi le moins abondant (<0.3% dans le sang). Comme le mastocyte et l'eosinophile, le basophile est implique dans 1'elimination des parasites et les reactions d'allergie, fixant lui aussi les IgE (FcERI) a sa surface (VOEHRINGER, 2009). Bien que peu etudie, on lui reconnait un role dans les infections par les vers helminth et sa presence a pu etre detectee dans la lamina propria intestinale apres administration de N. brasiliensis (OHNMACHT et
VOEHRINGER, 2009).
La derniere cellule dont on doit traiter est la cellule NK. Celle-ci, contrairement aux autres, est issue de la lignee lymphoide; par contre elle appartient tout de meme a l'irrimunite 21
innee puisqu'elle ne possede pas de recepteur aux antigenes. Elle presente immediatement une reponse cytotoxique par secretion du granzyme B et de perforine lorsqu'elle n'est pas
inhibee par le MHC I et est done impliquee dans 1'elimination de tout corps etranger tels que
les bacteries ou les virus (MORETTA, et al., 2002). Une reconnaissance des immunoglobulines par son recepteur FcR induit le meme type de reponse. Son role dans l'immunite intestinale n'est pas tres bien decrit, mais elle serait impliquee dans la secretion d'interferon-y et sa
depletion reduirait la reponse inflammatoire dans un modele d'infection avec Salmonella
(HARRINGTON, et al., 2007). Deux types cellulaires, la cellule dendritique et le macrophage, n'ont pas encore ete abordes et le seront dans les prochaines sections.
2.4 Les macrophages : Un statut particulier au sein de l'intestin
Dans une muqueuse saine, les macrophages intestinaux forment 10% des leucocytes de
la LP et la majorite des macrophages du corps humain. On les retrouve dans une quantite croissante dans l'axe A-P avec done une concentration plus importante au niveau du colon
(BULL et BOOKMAN, 1977). Les macrophages sont normalement de bonnes cellules presentatrices d'antigenes, mais ceux de l'intestin ont la particularite de ne pas exprimer les molecules de co-stimulation CD40, CD80 (B7.1) et CD86 (B7.2) (RUGTVEIT, et al., 1997).
Quoi qu'il en soit, ces macrophages retiennent un potentiel bactericide et une facilite a la phagocytose. Plusieurs autres recepteurs ne sont pas exprimes par ceux-ci et ils sont insensibles a un eventail de cytokines pro-inflammatoires tel que 1'ILip, l'IL6, et le
TNFOL L'anergie de ces macrophages serait rendue possible par l'environnement anti- inflammatoire de l'intestin, tels que par la presence de TGFp et d'lLlO (SMYTHIES, et al.,
2005). 22
2.5 L'immunite adaptative : education et tolerance
L'immunite adaptative, aussi appelee acquise, est la particularite qu'ont les vertebres de reconnaitre specifiquement un antigene du non soi et de retenir cette reconnaissance au sein d'une cellule memoire (SAHA, et al., 2010). Cette reponse « adaptee » a un antigene etranger est rendue possible par des recepteurs immunitaires specifiques exprimes par les cellules B (B-Cell Receptor; BCR) et les cellules T (T-cell Receptor; TCR). La reponse peut ensuite etre cellulaire, avec la reponse T cytotoxique, operee par les cellules T CD8+
(LEFRANCOIS, et al., 1999), ou humorale, par les cellules B plasmocytes secretant les anticorps
(TOMASI, et al., 1965). Les cellules T CD4+ matures, ou cellule TH (T-helper; TH), vont elles soutenir l'une ou l'autre de ces reponses, THI OU TH2 respectivement, par la secretion de cytokines modifiant la maturation des cellules B immatures. La muqueuse intestinale est particuliere de par une reponse humorale tres orientee vers la secretion d'lgA et de par une production importante de cytokines anti-inflammatoires par les cellules TH- Cet environnement est qualifie de tolerogene; un concept introduit pour la premiere fois par
Burnet en 1949 (BURNET et FENNER, 1949). Ceci est egalement appele la « tolerance orale », signifiant que ce systeme lymphatique est appele a ignorer ou temperer sa reponse inflammatoire contre les antigenes alimentaires (STROBEL et MOW AT, 1998) ainsi que contre la microflore intestinale (MOWAT, 2003).
Les lymphocytes nai'fs de la muqueuse intestinale se trouvent pour la plupart dans les sites d'induction tels que la plaque de Peyer et les ILFs. Ces structures prennent contact avec la lumiere via un epithelium associe (Follicule Associated Epithelium; FAE) dans lequel se trouve un type cellulaire particulier appele la cellule «microfold» ou cellule M
(KRAEHENBUHL et NEUTRA, 2000). La cellule M, contrairement aux autres cellules 23 epitheliales, tente d'optimiser l'adherence et la capture des microbes (GIANNASCA, et al.,
1994). En effet, cette cellule est specialised dans le transport par endocytose des antigenes alimentaires et bacteriens vers le dome de la PP. Ce transport sera a la base de l'education de la population lymphoide de I'intestin se trouvant dans les follicules contenus dans ces structures. II a ete propose que la cellule M puisse etre retrouvee sur l'ensemble de la population epitheliale et non pas seulement dans le FAE de la PP (JANG, et al., 2004), mais le role et le fonctionnement de celles-ci n'ont pas ete detailles.
Une fois dans le dome, les microbes et proteines sont alors captes par phagocytose ou endocytose via les cellules presentatrices d'antigenes professionnelles. Ces cellules digerent et presentent les antigenes sur le complexe majeur d'histocompatibilite de classe II (CMH II) aux lymphocytes T (PARKIN et COHEN, 2001). II en existe quelques-unes capables de cette tache dans la muqueuse intestinale, soit les cellules epitheliales, les cellules dendritiques, les macrophages et les cellules B. La plus importante de ces cellules est sans doute la cellule dendritique (Dendritic Cell; DC) dont le sous-type CD8oc"CDllb+ est predominant dans la plaque de Peyer (IWASAKI et KELSALL, 1999). Sous l'influence de l'IL10 et du TGF0 secretes constitutivement par la muqueuse intestinale, ces DCs expriment l'IL-10 plutot que l'IL-12 comme les DCs retrouves dans les nodules lymphatiques peripheriques (WILLIAMSON, et al.,
2002) Cet environnement favorise a son tour la differenciation de cellules T CD4+ nai'ves en cellules effectrices T-helper 2 (TH2) secretant l'IL-10 et l'IL-4, deux facteurs favorisant la differenciation des cellules B en cellules secretrices d'IgA (IWASAKI et KELSALL, 1999;
IWASAKI et KELSALL, 2001; SPALDING et GRIFFIN, 1986). La presence combinee du TGFP et de l'acide retinoi'que permet aussi la differenciation d'une classe supplemental de cellules T
+ appelee TReg Foxp3 (SUN, et al., 2007). Cette derniere secrete elle aussi 1'ILIO et le TGF0 24 necessaire a la l'inhibition de la production des cellules TH1 et TH17 (LI, et al., 2007; ZHOU, et al., 2008).
Les cellules T et B activees dans les sites d'induction ont ensuite la capacite de se localiser dans la lamina propria ou dans 1'epithelium (IntraEpithehal Lymphocyte; IEL) par un principe de residence (homing) (CYSTER, 2003). Une fois a cet endroit, les cellules dendritiques, ayant la capacite de former des projections dans la lumiere et de capter les antigenes luminaux, vont permettre aux cellules B de rencontrer une derniere fois leur antigene avant de se differencier en cellule B effectrice productrice d'anticorps appelee plasmocyte (RESCIGNO, et al., 2001). Sous Taction des cytokines decrites precedemment, ces cellules B font un dernier changement de classe d'anticorps vers la production d'IgA. La secretion d'IgA, aussi appelee immunite secretaire, est centrale dans toutes les muqueuses du corps humain et forme a elle seule 80% des immunoglobulines produites. Dans l'intestin, environ 3-5 grammes d'IgAs sont secretes chaque jour dans la lumiere intestinale (CONLEY et
DELACROIX, 1987). Cette secretion est rendue possible grace au recaptage par les cellules epitheliales des IgAs produites par les cellules plasmatiques de la LP. Ces dernieres possedent un recepteur aux immunoglobulines polymeriques (plgR) du cote basolateral et par endocytose vont permettre de relarguer les anticorps du cote apical dans un complexe maintenant appele sIgA (ROJAS et APODACA, 2002). Ces sIgA pourront alors se fixer a differents microorganismes de la lumiere pour reduire leur adhesion, leur motilite ou encore neutraliser des toxines bacteriennes (FUBARA et FRETER, 1973). 25
3. Les maladies inflammatoires intestinales
3.1 La maladie de Crohn et la colite ulcereuse
II serait difficile a ce point-ci d'argumenter que la muqueuse de l'intestin ne met pas tout en oeuvre afin de conserver la bonne entente entre ses differents joueurs cellulaires et les microbes. Malheureusement, differentes pathologies peuvent se developper au cours de la vie d'un individu ayant pour effet de debalancer cet equilibre. Ces maladies sont coUectivement appelees maladies inflammatoires de l'intestin (Mil, ou Inflammatory Bowel Disease; IBD) et incluent entre autres la colite ulcereuse (Ulcerative Colitis; UC) et la maladie de Crohn
(Crohn's Colitis; CD). Ces maladies se ressemblent dans le fait qu'elles sont des maladies inflammatoires allant alterer la bonne fonction de l'organe et la sante de 1'individu pendant plusieurs annees (DANESE, et al., 2005). Elles sont done classifies comme maladies chroniques et vont se caracteriser par des phases de retour d'inflammation {relapsing) et des phases de recuperation {remitting) (PINETON DE CHAMBRUN, et al., 2010). Quelques differences pathophysiologiques les distinguent cependant assez bien (BAMIAS, et al., 2005). Par exemple, la colite ulcereuse debute dans le rectum pour s'etendre parfois a l'ensemble du colon. Cette maladie cause 1'ulceration de la muqueuse et est caracterisee par une infiltration de neutrophiles. La maladie de Crohn, elle, peut s'initier en n'importe quel endroit de l'intestin, mais debute le plus souvent dans l'ileon. Cette maladie ne cause pas d'ulceration, affecte toutes les couches de l'intestin et peut meme toucher a d'autres organes a proximite
(transmural). Ce sont surtout les macrophages qui forment les agregats ou granulomes dans ce cas-ci (XAVIER et PODOLSKY, 2007). 26
3.2 Etiologie
Jusqu'a maintenant, les causes de ces maladies ne sont pas parfaitement identifiees. Par contre, on parle souvent des facteurs environnementaux, telles les habitudes de vie, de la flore microbienne et de la dimension genetique de I'hote affectant la fonction barriere ou encore la fonction immunitaire comme des dimensions importantes dans la pathologie
(XAVIER et PODOLSKY, 2007). Les dernieres definitions s'avancent toutefois a postuler que les
Mil soient une deregulation de la reponse immunitaire aux antigenes derives de la microflore intestinale chez des individus susceptibles genetiquement a developper des problemes au niveau des fonctions immunitaires adaptatives ou innees, ce qui menerait a une reponse inflammatoire excessive des lymphocytes et a une exacerbation de 1'inflammation
(BLUMBERG, 2009).
Tel qu'il a ete explique precedemment, la permeabilite de la barriere epitheliale est cruciale dans la regulation de 1'inflammation et les etudes des dix dernieres annees etablissent celle-ci comme un facteur important dans la predisposition a ces maladies. En effet, une augmentation de la permeabilite epitheliale a ete observee dans la muqueuse des patients CD avec un lien genetique au sein des families atteintes (IRVINE et MARSHALL, 2000;
SODERHOLM, et al., 2002). L'origine de ces dysfonctions n'est pas etablie, mais les resultats obtenus chez les modeles animaux lors de 1'invalidation des TLR2, TLR4 et TLR5 montrent que leur signalisation est importante dans le maintien des jonctions serrees (CARIO, et al, 2004;
FUKATA, et al., 2005; VIJAY-KUMAR, et al., 2007). Des variants genetiques ont ete identifies chez les patients des Mil pour les TLR-1, -2, -4 et -6 (FRANCHIMONT, et al., 2004; PIERIK, et al.,
2006). De facon similaire, le recepteur intracellulaire au muramyl-dipeptide, (MDP) appele
NOD2, a ete l'un des premiers locus associe a cette maladie (IBD1) (WEHKAMP, et al., 2004). 27
II a ete remarque entre autre que la mutation chez les patients reduit la production d'alpha- defensine par les cellules de Paneth (WEHKAMP, et al., 2005). Bien que Finvalidation du gene chez la souris n'a pas permis de reproduire la maladie, le modele a toute de meme montre que l'inflammation etait exacerbee lors de 1'administration orale d'une souche de L. monocytogenes (KOBAYASHI, et al., 2005). Une souris transgenique ayant la mutation la plus commune chez rhumain a egalement suggere que cette mutation etait plutot une mutation
«gain de fonction» qui s'est montree susceptible aux modeles experimentaux d'inflammation par une augmentation de I'activite NF-KB (MAEDA, et al., 2005). Plusieurs locus sont en lice pour occuper cette liste de genes de susceptibilite, mais, pour la plupart, leur role reste encore a etre etabli (COONEY et JEWELL, 2009). D'autres modeles animaux proposent differentes avenues de recherche dans l'etablissement du role de l'epithelium dans ces pathologies. On pense entre autre aux modeles ou l'inflammation apparait spontanement chez l'animal tels que la souris Abcbl''' (Famille ABC transporteurs) (PANWALA, et al., 1998),
Mucl'' (Mucine secretee) (VAN DER SLUIS, et al., 2006), IKK/' (Kinase de la voie NF-KB)
(NENCI, et al., 2007), Tlr5~f~ (Reconnaissance de la flagelline) (VIJAY-KUMAR, et al., 2007) et
Slc9a3~'~ (Transporter sodium hydrogene) (LAUBITZ, et al., 2008).
Tel que brievement mentionne, le microbiote intestinal, un autre organe au sein de l'organe, est egalement important dans la regulation de l'homeostasie intestinale. C'est pourquoi la dimension « microbiome » de l'individu est de plus en plus importante lorsque l'on parle des MIL Des etudes commencent a montrer que les differentes phyla bacteriens
(Barteroidetes, Proteobacteria, Actinobacteria et Firmicutes) vont varier en abondance dans les patients atteints des Mil comparativement a des individus sains. Par exemple, les
Firmicutes semblent perdre en importance dans les patients la UC et de la CD (FRANK, et al., 28
2007). Autant les modeles animaux (PACKEY et SARTOR, 2009) que les probiotiques montrent que des changements dans la microflore peuvent ameliorer ou exaeerber
1'inflammation de la muqueuse (FEDORAK, 2008). D'ailleurs, le changement dans les habitudes d'hygiene chez les populations de l'ouest est egalement suggere comme une composante environnementale de la maladie (KOLOSKI, et al., 2008).
4. Le cancer colorectal
Le cancer colorectal (CCR) est une cause majeure de mortalite et de morbidite au sein de toutes les societes. Le CCR occupe le quatrieme rang aux Etats-Unis en 2008 avec 10% des nouveaux cas de cancer chez les hommes et chez les femmes (JEMAL, et al., 2008). Plus d'un million de personnes en ont ete diagnostiquees en 2002 (PARKIN, et al., 2005) a travers le monde et plus de 33% en mourront directement (WOLPIN et MAYER, 2008). Une etude realisee chez les jumeaux revele que 35% de la maladie est attribuable a la genetique (LICHTENSTEIN, et al., 2000). Pourtant, seulement 5% des CCRs sont classifies comme des syndromes familiaux associe a un gene unique (GEBOES, et al., 2005). Ceci illustre 1'importance de la recherche vers la comprehension de l'heritabilite de cette maladie.
Determiner Pevenement moleculaire a l'origine d'un cancer donne est pratiquement impossible. Les cancers sporadiques, formant 95% des CCRs, se developpent en de multiples etapes (multistage carcinogenesis) (MOOLGAVKAR et LUEBECK, 2003) et vont done mettre plusieurs annees a developper un carcinome colorectal (BOLAND et GOEL, 2005). Les cellules souehes intestinales et les progeniteurs engages a longevite elevee (long-lived committed progenitor cells) (BJERKNES et CHENG, 1999) seraient done consideres comme les seules cellules qui persistent suffisamment longtemps dans l'epithelium pour accumuler ces 29 differentes mutations somatiques. Cette hypothese represente ce qui est appele le concept de la cellule souche cancereuse (BARKER, et al., 2009).
4.1 Cancers familiaux
Les mutations germinales sont responsables de quelques syndromes familiaux hereditaires a I'origine de differents CCRs. Dans ces cancers « non-sporadiques », une mutation precise peut avoir ete I'evenement initiateur. Par exemple, le syndrome de Lynch
(Hereditary NonPolyposis Colorectal Cancer; HNPCC) est relie a des mutations dans les genes de reparation des mesappariements de l'ADN {MLHl, MSHl, MSH6) (CHUNG et
RUSTGI, 1995), le syndrome de Peutz Jeghers est relie au gene LKB1 (HEMMINKI, et al., 1998), le syndrome FAP est relie a des mutations du gene APC (HALF, et al., 2009), le syndrome de
Cowden est relie au gene PTEN (MARSH, et al., 1998) et le syndrome JPS (Juvenile Polyposis
Syndrome; JPS) est relie a des mutations dans le gene BMPR1A, SMAD4 et ENG (HOWE, et al., 1998; HOWE, et al., 2001; SWEET, et al., 2005). Le plus surprenant est que l'ensemble de ces genes, ou des voies moleculaires qu'ils concernent, sont egalement fortement modifies dans les cancers sporadiques (KONISHI, et al., 1996).
4.2 Mutations somatiques
La premiere modification histologique identifiable dans un CCR est le foyer de crypte aberrante (Aberrant Crypt Focus; ACF) (PRETLOW, et al, 1991). Cet ACF se manifeste avec ou sans differents niveaux d'anormalite de la muqueuse, aussi appelee dysplasie (dys, mauvais etplasie, forme). Sans dysplasie, l'ACF sera reconnaissable par une ou plusieurs cryptes plus larges, alors qu'avec dysplasie les cryptes peuvent etre deformees et les noyaux de forme 30 anormale (CHENG et LAI, 2003). Dans les deux cas, la position des glandes les unes par rapport aux autres change, la niche des cellules souches se deplace avec pour resultat la modification des gradients de morphogenes impliques dans le controle du rythme de proliferation, de la destinee cellulaire et de la differenciation. La plupart des cancers sporadiques debutent par une mutation du gene APC et finalement 90% des CCRs vont detenir une mutation qui affecte, a un point ouaun autre, le controle de la voie des Wnt
(THORSTENSEN, et al., 2005). Tel que vu precedemment, cette derniere est un morphostat tres important dans la regulation de la proliferation des cellules souches et les mutations inactivatrices d'APC menent a une activation constitutive de cette voie (KORINEK, et al., 1997;
VAN DE WETERING, et al., 2002). La mutation des deux alleles d'APC est suffisante a la formation de I'adenome et est vue comme la premiere etape de la carcinogenese intestinale
(LAMLUM, et al., 2000). D'autres ACF pourraient emprunter une voie qui commencerait par une mutation de KRAS. C'est ce type de mutation qui est retrouve dans les ACFs non- dysplasiques, mais ultimement il se pourrait que la mutation APC soit necessaire a la progression vers I'adenome (TAKAYAMA, et al., 2001). La transition adenome-carcinome peut ensuite se faire en gagnant davantage de mutations, tel qu'une mutation dans KRAS
(VOGELSTEIN, et al., 1988). L'augmentation de l'instabilite chromosomique (Chromosomal
INstability; CIN) semble etre la cause de la prochaine etape, soit la perte du bras long du chromosome 18 (18q) (VOGELSTEIN, et al., 1988). Bien que Ton considere que la perte de
SMAD4 (situe sur le 18q) soit le gene implique dans cette etape precise, certaines etudes invitent a la recherche de nouveaux marqueurs (ALAZZOUZI, et al., 2005). La derniere etape serait ensuite la mutation d'un premier allele ainsi que la perte du 17q ou se trouve le suppresseur de tumeur p53 (TP53) (BAKER, et al., 1989; BAKER, et al., 1990). Une voie alternative a l'instabilite chromosomique passerait plutot via l'instabilite des microsatellites 31
{microsatellite instability). Cette voie debuterait par une activation de la voie Wnt, puis par BRAF/KRAS, CDC4, TGFBR2, BAX et IGF2R. Contrairement a la premiere, celle-ci serait independante de TP53 (RAMPINO, et al., 1997).
4.3 Le cancer associe a la colite
Qu'un microenvironnement soumis a 1'inflammation puisse promouvoir la croissance rapide des cellules est un concept qui date d'aussi loin que 1863 (BALKWILL et MANTOVANI,
2001). Dans Pinflammation normale, les cellules immunitaires secretent des cytokines, chimiokines, facteurs de croissance, facteurs proangiogeniques et especes reactives de
I'oxygene et de I'azote utilises pour resoudre 1'inflammation et les blessures (COUSSENS et
WERB, 2002). Cependant, les maladies chroniques, telles que les Mil, soumettent les cellules souches a cette inflammation sur de nombreuses annees. Consequemment, ces personnes ont un risque de 20% a developper un CAC (Cancer associe a la Colite) lorsque la maladie dure plus de 20 ans (ITZKOWITZ et HARPAZ, 2004). Ces cancers sont causes par un changement du microenvironnement et le rend mutagene et pro-proliferatif. Par exemple, les especes reactives de I'oxygene et de I'azote forment ensemble le peroxynitrile, un agent mutagene
(MAEDA et AKAIKE, 1998). Autre exemple, les souris ApcM,n/+ auxquelles du DSS est administre vont developper des tumeurs qu'elles ne developperaient pas en absence d'inflammation de la muqueuse (COOPER, et al., 2000).
Les CACs presentent une cascade de carcinogenese un peu differente des cancers colorectaux sporadiques. Contrairement au CCR, APC sera rarement mute dans les premieres lesions d'un CAC (UMETANI, et al., 1999). C'est plutot TP53 dans ce cas-ci que Ton retrouve 32 mute dans 50 a 85% de ces cancers et cette mutation apparait tres tot dans revolution de la dysplasie (BURMER, et al., 1992; YIN, et al., 1993).
5. Les facteurs de transcription
II n'y a pas de doute a savoir que le controle de l'expression des genes joue un role essentiel dans la vie cellulaire. II est meme argumente que le raffinement de ces reseaux de controle ait ete capital dans l'apparition de la vie metazoaire (LEVINE et TJIAN, 2003).
Plusieurs etapes sont necessaires a cette homeostasie, mais la majeure partie s'effectue au niveau de la modification du taux de la transcription par les ARN polymerases via ce qui est appele la regulation transcriptionnelle. L'essence de ces reseaux complexes repose sur une classe d'environ 1400 proteines (VAQUERIZAS, et al., 2009), appelees facteurs de transcription
(FT), possedant un domaine de liaison a l'ADN (DNA binding domain; DBD) et demontrant une reconnaissance specifique vis-a-vis une sequence d'acide nucleiques. Pour la plupart, ces
FTs vont ensuite posseder un domaine d'activation (activation domain; AD) leur permettant de s'associer a des cofacteurs ou encore leur permettant de stabiliser le recrutement des facteurs de transcription generaux (General Transcription Factor; GTF). Ces derniers sont quant a eux representes par une quarantaine de proteines se retrouvant dans le complexe de pre-initiation (Pre-Initiation Complex; PIC) de la transcription. C'est cet enorme assemblage de 2 MDa qui reconnait le promoteur immediat (core promoter) forme, selon le modele classique, des sequences TATA et Inr en cis et de l'ARN polymerase II, de TBP et des 9 facteurs TFII en trans (MARTINEZ, 2002). Le role des FTs et cofacteurs sera done de modifier l'activite de base de ce complexe en etant recrutes sur le promoteur proximal (30-200 pb) et distal (200 pb et +) d'un gene et permettant, par le recrutement d'enzymes, de moduler
1'accessibility de ce complexe en modifiant l'etat de la chromatine (FEATHERSTONE, 2002). 33
Ces enzymes sont composees d'histone acetyltransferases (Histone AcetylTransferase;
HAT), permettant d'ouvrir la chromatine, alors appelee euchromatine, ou d'histone deacetylases (Histone DeACetylase; HDAC), permettant de refermer la chromatine, alors appelee heterochromatine (MARMORSTEIN, 2001).
Les facteurs de transcription se reclassifient a nouveau selon, soit leur fonction
(BRIVANLOU et DARNELL, 2002), ou encore leur structure (STEGMAIER, et al., 2004). Selon leur fonction on dira qu'ils sont constitutifs, ils seront alors presents dans n'importe quel type cellulaire, ou encore regules. Par exemple, le facteur Spl est un facteur de transcription ubiquitaire retrouve dans toutes les cellules (BRIGGS, et al., 1986). Lorsque regules, les facteurs peuvent etre impliques au niveau du developpement et apparaitre sequentiellement ou encore apparaitre lors d'une signalisation quelconque. Ces facteurs ne sont pas necessairement cellule specifique ou tissu specifique; c'est plutot la combinaison de plusieurs facteurs qui dirigera la destinee cellulaire et par la suite la differenciation terminale. Ces facteurs seront actifs immediatement, mais peuvent cependant etre modifies, par phosphorylation par exemple (HOLMBERG, et al., 2002), ou etre vehicules entre noyau et cytoplasme pour reguler leur activite. D'autres encore seront signaux dependants. Ces facteurs, contrairement aux facteurs developpementaux, sont synthetises sans etre actifs. Ils auront done besoin d'un ligand, comme pour les recepteurs aux steroi'des, d'un signal interne ou d'une activation engagee par un systeme ligand exterieur - recepteur de surface. Si un facteur est dependant des voies de signalisation, celui-ci peut etre restreint a certaines cellules ou tissus ou encore etre present dans toutes les cellules. Par contre, ils sont inactifs aussi longtemps qu'ils ne sont pas actives par le signal intra ou extra cellulaire approprie. Dans les deux prochaines 34 sections seront detailles deux TFs dont le role potentiel dans le maintien de l'homeostase au sein de l'epithelium intestinal invite a les connaitre davantage.
6. Le facteur de transcription CUX1
6.1 Structure genetique et proteique
Les proteines a homeodomaine (HD), de la superclasse helice-tour-helice (helix-turn- helix), forment une large famille de facteurs de liaison a l'ADN capables d'activation et de repression de la transcription (BANERJEE-BASU et BAXEVANIS, 2001). Une sous-classe atypique de cette famille inclus une proteine initialement identifiee chez Drosophila melanogaster que Ton reconnait au nom de « Cut», pour son phenotype « aile coupee »
(BLOCHLINGER, et al., 1988; JOHNSON et JUDD, 1979). La proteine Cut se distingue par son Cut homeodomaine et ses trois Cut Repeats (CRl, CR2, CR3) qui le precedent. D'autres proteines partagent la possession d'un HD et un ou plusieurs domaines CR, tel que SATB1
(DICKINSON, et al., 1997), SATB2 (FITZPATRICK, et al., 2003), ONECUT-1/HNF6 (LEMAIGRE et
ZARET, 2004), ONECUT-2 (JACQUEMIN, et al., 1999), ONECUT-3 (VANHORENBEECK, et al.,
2002) et CUX2; qui est un deuxieme orthologue de cut (GINGRAS, et al., 2005).
La proteine CUX1 dans sa forme complete possede une region helicale (Coiled Coil,
CC), un domaine d'autoinhibition en C-terminal et finalement 4 domaines de liaison a l'ADN (TRUSCOTT, et al., 2004). D'abord, trois regions repetees Cut (Cut Repeat; CR#) d'environ 70 acides amines et un HD (ANDRES, et al., 1994; BLOCHLINGER, et al., 1988;
NEUFELD, et al., 1992). Finalement, la region C-terminale possede deux domaines de 35 repression pouvant recruter la HDAC1 (LI, et al., 1999) et l'histone lysine methyltransferase
G9a (NISHIO et WALSH, 2004).
Le gene de CUX1 possede 33 exons et permet de generer plusieurs isoformes par l'utilisation de trois promoteurs differents, de 2 signaux de polyadenylation et de differents evenements d'epissage. L'isoforme la mieux caracterisee est celle de 1505 a.a. ayant un poids apparent de 200 kDa (p200CUXl) (NEUFELD, et al., 1992). La seconde, de 80 kDa, caracterisee en 1997, est une proteine qui partage uniquement la portion N-terminale de p200CUXl et qui ne possede aucun domaine de liaison a l'ADN (LIEVENS, et al., 1997). Cette proteine a ete nommee CASP et appartient a la famille des golgin; une famille de proteines impliquees dans le transport trans-golgien (GILLINGHAM, et al., 2002). Finalement, un troisieme variant identifie en 2002 possede un poids apparent de 75 kDa et est produit a partir d'un promoteur alternatif situe entre l'exon 20 et 21 dans le gene CUX1 humain
(GOULET, et al., 2002). En plus de ces 3 produits de gene, 4 autres isoformes peuvent etre obtenues par le clivage de p200CUXl, soit pl50CUXl, pi 10CUX1, p90CUXl et p80CUXl.
Les isoformes pllOCUXl et p90CUXl sont generees a partir du clivage proteique de p200CUXl par la cathepsine L (GOULET, et al., 2004; GOULET, et al., 2006) alors que p80CUXl est le resultat d'un clivage supplementaire en C-terminal de p90CUXl par une caspase apoptose independante (TRUSCOTT, et al., 2007). L'elastase du neutrophile est egalement en mesure de cliver la forme complete de CUX1 en une isoforme plus courte (GOULET, et al.,
2008). Finalement, pl50CUXl est une isoforme caracterisee dans la glande mammaire et serait vraisemblablement generee par une cysteine protease. Cette derniere ne semble pas avoir d'activite de liaison a l'ADN et agirait comme dominant negatif (MAITRA, et al., 2006).
Les autres isoformes vont egalement varier dans leur capacite de liaison a l'ADN. 36
L'isoforme p200CUXl presente une cinetique de liaison qui est rapide, mais instable
(MOON, et al., 2000), tandis que pi 10, p90, p80 et p75CUXl ont une liaison lente et stable a l'ADN (GOULET, et al., 2006; MOON, et al., 2001). En somme, 1'augmentation de la stabilite semble dependante du retrait du domaine d'autoinhibition et du domaine CR1 trouves en N- terminal.
6.2 Modes transcriptionnels
L'isoforme p200CUXl a ete jusqu'a maintenant associee uniquement a des modes de repression de la transcription s'operant par le recrutement d'enzymes de modification des histones (tel que decrit plus haut) ou encore par la repression passive (MAILLY, et al., 1996). La repression passive est observee lorsque CUXl occupe un site autrement disponible pour des activateurs de la transcription; par opposition aux represseurs capables du recrutement des enzymes de modification des histones (BARBERIS, et al., 1987). Ces modes de repression sont egalement retrouves chez les isoformes pllOCUXl, p90CUXl et p75CUXl possedant eux aussi les domaines de repression active en C-terminal. Cependant, ces dernieres isoformes semblent egalement capables d'activation de la transcription. Le mecanisme par lequel cette activation procede n'est pas encore resolu, mais de nombreux essais on pu demontrer la competence de ces facteurs dans l'activation de genes (HARADA, et al., 2008).
6.3 Regulation de ['expression et regulation post-traductionnelle
De maniere generate, Pactivite de liaison a l'ADN de CUXl semble surtout controlee par des modifications post-traductionnelles plutot que par l'expression de l'ARNm. Par exemple, l'activite de liaison de CUXl dans les cellules myeloi'des diminue en fonction de 37 l'etat de differentiation de ces cellules, mais reste constante en terme d'expression proteique (MARTIN-SOUDANT, et al., 2000). La variation de I'expression de I'ARNm n'a toutefois pas ete verifiee directement et 1'information sur I'expression de la proteine reste limitee. Cependant, il est reconnu que la demi-vie de CUXl est assez elevee (SANSREGRET et
NEPVEU, 2008). D'autres etudes rapportent que I'expression du messager de CUXl augmente au moment de la sortie de la phase de quiescence des cellules NIH3T3 (COQUERET, et al.,
1998; MOON, et al., 2001). Dans l'intestin grele adulte chez la souris, Cuxl est majoritairement retrouvee dans le noyau des cellules de la crypte, alors que sa localisation nucleaire est majoritairement au niveau de repithelium differencie de la muqueuse colique (BOUDREAU, et al., 2002). Cette variation inverse de I'expression de CUXl dans repithelium colique suggere que le mode de regulation de la proteine dans ce tissu serait different. Les etudes concernant la regulation directe du promoteur de CUXl sont assez limitees chez les mammiferes en comparaison avec D. melanogaster. Par exemple, il est connu que cut est controle negativement par atonal (ato; ATOHW) (BLOCHLINGER, et al., 1991; JARMAN et AHMED, 1998), positivement par caudal (cd; CDX#) (LIU et JACK, 1992), positivement par pox neural (poxn;
PAX3) (VERVOORT, et al., 1995), positivement par sparkling/shaven (sh; PAX2) (CANON et
BANERJEE, 2003; FU et NOLL, 1997), negativement par vestigial (vg; VGLL#) (SUDARSAN, et al.,
2001), et negativement par hindsight/pebble, un effecteur de la voie de Notch (peb; inconnu)
(SUN et DENG, 2005; SUN et DENG, 2007).
De nombreuses modifications post-traductionnelles ont deja ete identifiees pour CUXl, a commencer par la phosphorylation de differents domaines de liaison a l'ADN. La phosphorylation des facteurs de transcription possede un role crucial dans la regulation positive ou negative de leur activite (HUNTER, 2000). Cette modification post-traductionnelle 38 a la propriete de modifier la conformation de la proteine et/ou les forces de repulsion ou d'attraction (HURLEY, et al., 1990; KARIN, 1994; SPRANG, et al., 1988) modulant ultimement sa stabilite, sa localisation, ses interactions proteine-proteine et, dans le cas des facteurs de transcription, sa capacite de liaison a l'ADN (HOLMBERG, et al., 2002) La phosphorylation / dephosphorylation peut s'effectuer sur des residus threonine, serine ou tyrosine et ce, sur un seul site, comme sur des sites multiples. Les phosphorylations de CUXl identifiees a ce jour ont tous pour effet de reduire l'activite de liaison a l'ADN et sont effectuees par la proteine kinase C (PKC) a, -P et -y (COQUERET, et al., 1996), la caseine kinase II (CKII) (COQUERET, et al., 1998), la proteine kinase A (PKA) (MICHL, et al., 2006) et le complexe cycline A/CDK1
(SANTAGUIDA, et al., 2001). Une acetylation d'une lysine de l'HD par PCAF a egalement ete identifiee (LI, et al., 2000). A ceci s'ajoute, tel que decrit plus haut, une production de differentes isoformes par differentes proteases.
6.4 L'identification des premiers genes cible
La premiere activite de liaison a l'ADN d'un homologue Cut a ete decrite sur le promoteur de l'histone 2-B1 de l'oursin de mer avec l'observation d'une activite de deplacement de deux facteurs liant la boite CCAAT : CBF et OBF (BARBERIS, et al., 1987). La litterature des annees 1990 est done dirigee en grande partie sur cette activite et a permis de demontrer le role de « CDP », pour CCAAT displacement protein, dans la repression de la y-globine (SUPERTI-FURGA, et al., 1989), de la §p91phox chez les cellules myeloi'des (LIEVENS, et al., 1995; LUO et SKALNIK, 1996; SKALNIK, et al., 1991), de la lactoferrine, de la collagenase et de l'elastase chez le neutrophile (GOULET, et al., 2008; KHANNA-GUPTA, et al., 1997; LAWSON, et al., 1998) et de la sucrase isomaltase dans l'intestin (BOUDREAU, et al., 2002), pour nommer que ceux-ci (voir (NEPVEU, 2001) pour une liste exhaustive). Ces etudes ont pour la plupart permis 39 d'etablir CUX1 comme un represseur de la transcription sur ces genes et suggerent que l'isoforme p200CUXl etait impliquee dans ces cas-ci.
6.5 Regulation du cycle cellulaire
Les premiers exemples de ?ra«s-activation operes par CUX1 ont ete identifies par le groupe de G.S. Stein au cours de la phase de synthese (S) du cycle cellulaire. Le premier complexe identifie a ete celui forme par cyclinA/CDKl, pRB (pl05) et pllOCUXl (VAN
WIJNEN, et al., 1996). Ce complexe appele HiNF-D (HOLTHUIS, et al., 1990) a ete retrouve sur le promoteur des histones HI H2A/B, H3 et H4 (EL-HODIRI et PERRY, 1995; STEIN, et al., 1994;
VAN WIJNEN, et al., 1994). HiNF-D montre une activation de ces genes au debut de la phase S pour ensuite reprimer ces memes genes a la fin de cette meme phase, coordonnant ainsi
I'expression des histones durant la phase de synthese de l'ADN (GUPTA, et al., 2003). Vers la fin des annees 1990, il est suggere que CUX1 puisse reprimer le gene CDKN1A
(p21CIPl/WAF) a 1'entree de la phase S a la suite de sa propre activation via dephosphorylation de ses residus de la region CR3-HD par la phosphatase CDC25A
(COQUERET, et al., 1998); une phosphatase deja identified comme necessaire a la transition
Gl/S (HOFFMANN, et al., 1994). Comme p21 est un important regulateur de la progression
Gl/S du cycle, c'est cette etude qui positionne CUX1, au cours des annees 2000, en tant qu'important regulateur de la division cellulaire. En effet, il sera montre plus tard que p200CUXl est clive lors de l'entree en phase S par la cathepsine L (GOULET, et al., 2004;
MOON, et al., 2001) pour generer les isoformes p90 et pllOCUXl. Cette derniere peut etre transformee en p80CUXl en etant clivee une seconde fois par differentes caspases (-2, -3, -7,
-8, -9, -10) afin de retirer les domaines de repression en C-terminal et ce, de maniere apoptose-independante (TRUSCOTT, et al., 2007). Ces isoformes possedent a la fois une activite 40 de repression et d'activation au cours de la phase S en fonction du promoteur cible et de leurs partenaires. De maniere generate, une surexpression de pUOCUXl est reconnue pour accelerer 1'entree en phase S (SANSREGRET, et al., 2006) et quelques genes ont initialement ete identifies comme etant exprimes grace a pUOCUXl au debut de cette phase, soit l'ADN polymerase a (POLA1), la cycline A (CNNA2) et la dihydrofolate reductase (DHFR)
(TRUSCOTT, et al., 2003). Une etude recente de ChlP-Chip a permis de renforcir ce concept en determinant les differentes cibles de pi 10CUX1 au cours de la phase S (HARADA, et al., 2008).
Plusieurs genes de replication de l'ADN ont ete identifies tels que POLA, POLA2, POLD2 et
POLD3. D'autres, associes a la progression du cycle, comme CCNAl, CCNH, CCNG2 et
CDC25A/B/C, ont egalement ete retrouves. Finalement, des enzymes de reparation ou des proteines qui controle de 1'integrite du genome ont ete observees, tels que ATR, TP53,
RAD51, MLHl et MSH6. Autrement dit, pUOCUXl semble etre present sur le promoteur d'une bonne partie des genes necessaires au cycle cellulaire. Les auteurs ont teraiine leur etude en cherchant a connaitre le role transcriptionnel de CUX1 sur ces genes. CCNH et
CDKN1A ont ete les seuls genes testes ou une repression a ete observee plutot qu'une activation (HARADA, et al., 2008). Une etude parue par le meme groupe au cours de la meme annee suggere que pUOCUXl s'associe a E2F1 et, dans une moindre partie, E2F2, afin de travailler de facon synergique a l'activation des genes du cycle cellulaire dont CDC25A,
POLA, CCNA2 et DHFR (TRUSCOTT, et al., 2008). A ceux-ci se sont ajoutes d'autres genes dont 1'expression debute en phase S qui sont regules en cooperation avec E2F1, tels que
ECT2, MgcRacGAP et MKLP1. Ces genes codent pour des proteines impliquees dans la cytokinese au moment de la transition G2/M (SEGUIN, et al., 2009). 41
6.6 Regulation de 1'inflammation
Quelques etudes suggerent un role pour CUX1 dans la regulation de 1'inflammation.
Tout d'abord, en relation avec son role tres bien decrit dans la division cellulaire, le modele hypomorphique murin QuximD,AHD suggere que CUX1 puisse jouer un role dans la proliferation des lymphocytes B et des lymphocytes T. En effet, une reduction de 2-3 fois de la population des cellules B et une reduction de 5 fois des cellules T a ete observee
(SINCLAIR, et al., 2001). Les auteurs ont suggere a ce sujet qu'une forte expression de TNFa chez ces animaux ait pu expliquer l'apoptose des progeniteurs lymphatiques. Cependant, ceci n'a pas ete investigue davantage.
Les chimiokines CCL3, CCL4 et CXCL1 seraient regulees negativement par CUX1
(JING, et al., 2004; NIRODI, et al., 2001). A ceux-ci s'ajoutent des ligands/recepteurs de la meme famille que CXCL1, soit CXCL2, CXCL8 et CXCR2, qui ont ete identifies lors d'une seconde etude par ce dernier groupe. Selon le mecanisme propose, en surexprimant la forme complete de CUX1 dans les Hs294T, CUX1 interagirait directement avec PCAF du complexe
PCAF/p300 et empecherait l'arrivee du dimere p65/p50 (NF-KB) lors d'une stimulation au
TNFa (UEDA, et al., 2007). II etait deja connu que CUX1 peut etre acetyle sur lysine par PCAF, tout comme a besoin de l'etre RelA/p65 pour son retour au cytoplasme (KIERNAN, et al., 2003;
LI, et al., 2000).
Les recepteurs PAR2, recepteurs couples aux proteines G, sont autoactives par un domaine extracellulaire du recepteur lorsque clives par une serine protease (e.g. trypsine)
(NYSTEDT, et al., 1994). Ces recepteurs sont impliques dans de nombreux procedes dont
1'inflammation en general, ainsi que les Mil tel que le colon irritable et la colite (CENAC, et 42 al., 2002; CENAC, et al., 2007). II a ete montre que la capacite de liaison a l'ADN de CUX1 augmente rapidement lorsque les NIH3T3 sont mis en presence de trypsine. Les genes
COX2,116, VEGF, ILla et MMP10 ont ete confirmed comme etant des cibles de pi 10CUX1 activees en aval de PAR2 (WILSON, et al., 2009).
6.7 Regulation de la migration cellulaire
La premiere evidence de 1'implication de CUX1 dans la migration cellulaire est assez recente (MICHL, et al., 2005). Une approche par librairie d'ARNs interferents a identifie CUX1 comme un modulateur de la migration des cellules NIH3T3. II a ainsi ete montre que CUX1 promouvoit, la migration grace a des essais in vitro et, l'invasion par des essais de colonisation in vivo. Les auteurs sont aussi parvenus a demontrer que l'expression de CUX1 augmente lors d'une stimulation au TGFp i via une signalisation impliquant la p38 MAPK et
SMAD4. Des experiences ont aussi montre que l'induction de la migration par le TGFpi passe par l'activite transcriptionnelle de CUX1. Enfin, l'expression de CUX1 semble correler avec les grades des cancers du sein etudies (GOULET, et al., 2002). Cette premiere etude semblait faire abstraction des differentes isoformes de CUX1. Le groupe de Nepveu a done verifie l'effet d'une surexpression de p200CUXl et pi 10CUX1 dans des cellules epitheliales mammaires (NMuMG-NYPD) afin de verifier l'effet obtenu sur la migration. Leurs experimentations ont permis de demontrer que l'expression de p200CUXl n'augmente pas significativement la migration contrairement a pllOCUXl qui y parvient. L'effet semble passer principalement par cette derniere isoforme puisqu'un traitement avec la cathepsine L a pu potentialiser ce phenomene. Le groupe s'est par la suite affere a determiner les cibles de pllOCUXl dans ce contexte pour decouvrir que les cibles classiques de l'EMT (Epithelial
Mesenchymal Transition; EMT), tel que la E-cadherine et la vimentine, semblaient etre 43 reprimees et activees respectivement par CUX1. Les mediateurs de l'EMT Snail et Slug se sont averes sous le controle de pi 10CUX1 et une cooperativite a ensuite pu etre demontree entre ces facteurs et pi 10CUX1 (KEDINGER, et al., 2009).
7. Le facteur de transcription HNF4a
7.1 Decouverte et caracteristiques
Les facteurs de transcription HNF (Hepatocyte Nuclear Factor; HNF) ont initialement ete caracterises dans I'espoir de mieux comprendre le programme transcriptionnel d'un hepatocyte. Quels facteurs specifiques au foie expliquent la regulation specifique des genes hepatocytaires ? Aujourd'hui, une telle question genere une reponse extremement complexe, mais les efforts initiaux ont pu identifier 4 families de proteines « enrichies » dans le foie et dont le nom a pour certains ete retenu par la suite pour designer leur gene (CEREGHINI, 1996).
Le facteur FTNF4a, d'abord identifie sur le promoteur de la transthyretin, s'est ensuite revele etre un recepteur nucleaire aux hormones {nuclear hormone receptor) dont le ligand a mis un certain temps a etre connu (COSTA, et al., 1989; EVANS, 1988). HNF4a possede deux doigts de zinc a motif de 4 cysteines (Cys4) et fait done partie de cette superclasse de facteurs de transcription (SLADEK, 1993). Une caracterisation plus approfondie a permis de determiner qu'HNF4a se lie a l'ADN en tant qu'homodimere seulement (JIANG, et al., 1995) sur une sequence AGGTCA directement repetee (Direct Repeat; DR) espacee de 1 ou 2 nucleotides
(DR1/DR2) (FRASER, et al., 1998; SLADEK, et al., 1990). La dimerisation est possible grace a des residus charges de l'helice 6 du LBD (EECKHOUTE, et al., 2003). Le gene d'HNF4a, HNF4A, est localise sur le 20ql2-13.1 (ARGYROKASTRITIS, et al., 1997), possede 3 promoteurs
(THOMAS, et al., 2001) et plusieurs variants d'epissage (DREWES, et al., 1996) pour un total connu 44 de 12 isoformes (HUANG, et al., 2009). Ces isoformes numerotees de al a al2 vont varier de
seulement quelques acides amines les uns des autres, mais ces variations auront cependant
d'importantes consequences sur les domaines fonctionnels de la proteine. L'isoforme la plus
longue, cxi, a un messager de 3239 pb et genere une proteine de 474 a.a. dont le poids apparent est de 54 kDa (CHARTIER, et al., 1994). HNF4a a aussi ete decrit chez C. elegans, le ver a soie, I'anophele, le poisson zebre et la drosophile (CHENG, et al., 2006; KAPITSKAYA, et
al., 1998; ROBINSON-RECHAVI, et al., 2005; SWEVERS et IATROU, 1998; ZHONG, et al., 1993).
7.2 Caracteristiques de la proteine
HNF4a possede 5 domaines fonctionnels : le domaine A/B qui contient le domaine d'activation 1 (Activation Function-1; AF-1), le domaine C qui contient le domaine de
liaison a l'ADN forme des 2 doigts de zinc (DNA Binding Domain; DBD), le domaine D qui est une region charniere permettant d'accommoder differents espacements entre les sequences directement repetees accueillant l'homodimere, le domaine E qui contient le domaine de liaison au ligand (Ligand Binding Domain; LBD) et le deuxieme domaine d'activation (Activation Function-2; AF-2), puis le domaine F riche en proline qui serait un domaine regulateur negatif (Negative Regulatory Domain; NRD) (HADZOPOULOU-
CLADARAS, et al., 1997). De plus, l'helice 7 du LBD fait office d'interface de dimerisation du facteur (AGGELIDOU, et al., 2004; AGGELIDOU, et al., 2006).
7.3 Les isoformes d'HNF4a
Les differentes isoformes d'FTNF4a permettent de substituer differents domaines fonctionnels de la proteine. Parmi les isoformes generees a partir du promoteur PI, les 45 isoformes al a a3 (et de facon parallele a4/a6, a7/a9 et al0/al2) vont varier en activite selon la longueur du domaine inhibiteur F. L'isoforme al possede I'activite d'AF-2 la plus faible, alors que l'insertion de 10 a.a. dans le domaine F d'a2 confere une activite plus elevee a l'AF-2 (SLADEK, et al., 1999). L'isoforme a3 de son cote possede un domaine F completement different et beaucoup plus court, ce qui lui donne I'activite la meilleure parmi les trois (KRITIS, et al., 1996; SUAUD, et al., 1999). Les isoformes a4 a a6 different de al a a3 par une insertion de 30 a.a. dans le domaine A/B (DREWES, et al., 1996). Les isoformes a7 a a9, generees a partir du promoteur P2, apportent l'utilisation d'un exon 1 (ID) alternatif et permet de remplacer une partie du domaine A/B pour generer des isoformes ne contenant pas de domaine AF-1 (TORRES-PADILLA, et al., 2002). Les isoformes alO a al2 quant a eux sont obtenues a partir de P2, mais permettent l'insertion d'un exon supplemental (IE) apres ID
(HUANG, et al., 2009). L'impact sur I'activite de ces isoformes reste a etre evalue.
7.4 Distribution de son expression durant le developpement et chez l'adulte
Chez la souris, Hnfa est exprime dans l'endoderme visceral a partir du stade E4.5 jusqu'au stade E8.5. Parallelement, une deletion totale &Hnf4a entraine une mort embryonnaire a E6.5 due a un defaut de la gastrulation qui doit normalement survenir a E7.5
(CHEN, et al., 1994). Comme une complementation tetraploi'de de l'endoderme visceral chez l'embryon Hnf4a~'~ permet de passer ce point restrictif, ceci indique l'importance d'Hnf4a au niveau de l'expression extra-embryonnaire de facteurs diffusibles necessaires a la gastrulation chez l'embryon (DUNCAN, et al., 1997). La premiere expression dans les tissus de l'embryon s'effectue elle a E8.75 dans le diverticule du foie et dans le hindgut. A E9.5, le foie exprime maintenant fortement Hnf4a et le midgut, incluant le pancreas primitif, l'expriment maintenant moderement. Du stade E10.5 au stade El 1.5, son expression gagne 46 l'estomac, le pancreas et les tubules mesonephrotiques. Puis, finalement, I'expression augmente a El3.5 dans le midgut et le hindgut; periode correspondant au debut de la cytodifferenciation dans l'intestin (DUNCAN, et al., 1994). Chez le rat adulte et l'humain,
I'expression d'Hnf4a est conservee dans les hepatocytes du foie, dans les cellules (3 du pancreas, dans les tubules proximaux du rein, dans les cellules epitheliales de l'intestin grele et du colon (DREWES, et al., 1996; JIANG, et al., 2003).
L'expression selon le promoteur PI et P2 varie selon l'organe et selon le stade de developpement. L'expression dans le foie est majoritairement tiree du promoteur PI en tout point du developpement (facteur de 10 a 1100 fois). Cependant, l'expression peut etre derivee du promoteur P2 a partir du stade E12.5 via l'activation par les facteurs HNF6
(ONECUT1) et OC-2 (ONECUT2). Cette expression chute ensuite de E12.5 a E17.5 au moment ou les isoformes tirees du promoteur PI gagnent en expression et repriment le promoteur P2 (BRIANCON, et al., 2004). L'expression dans le foie et le rein adulte est par la suite derivee entierement du promoteur PI (EECKHOUTE, et al., 2003); exception faite des cellules ovales du foie qui exprimeraient Fisoforme al (LI, et al., 2006). Dans le pancreas, l'expression est effectuee via les deux promoteurs durant le developpement, mais seulement via P2 a l'age adulte chez l'humain (HARRIES, et al., 2008). Chez la souris, des informations contradictoires indiquent que les deux promoteurs seraient utilises (HUANG, et al., 2008).
L'estomac et le colon quant a eux peuvent exprimer HNF4a via les deux promoteurs durant le developpement et a l'age adulte, tandis que l'intestin grele exprimerait uniquement les isoformes P2 (HARRIES, et al., 2008). Cependant, l'expression est non detectable par immunohistochimie dans l'estomac adulte sain (TANAKA, et al., 2006). En general, l'expression 47 chez la souris dans les differents organes est superieure a celle retrouvee chez I'humain
(HARRIES, et al., 2009).
7.5 Regulation transcriptionnelle d 'HNF4A
Hnf4cc ne fonctionne pas exactement comme les autres recepteurs nucleaires puisqu'il n'a pas absolument besoin d'un ligand pour etre actif. Son gene doit done entre autre etre regule au niveau transcriptionnel. Le resume des differents moyens de controle de l'expression d,HNF4A se retrouvent au Tableau 1.
Tableau 1 Regulation transcriptionelle d'HNF4A Stimuli Regulation Litterature
PKA Negative (VIOLLET, et al, 1997, YOU, et al, 2002) Acide retinoique Negative (MAGEE, et al, 1998) BMPs Positive (COUCOUVANIS et MARTIN, 1999) MAPK Negative (REDDY, etal,1999) Hormone de croissance Positive (RASTEGAR, et al, 2000) AMPK Negative (HONG, et al, 2003, LECLERC, et al, 2001) Hypoxie Negative (MAZURE, etal,2001)
As203 Positive (YU, etal,2001) Acides bihaires Negative (YANG, et al, 2002) Vitamine A Positive (GHOSHAL, et al, 2003) TNF Negative (KAMIYA et GONZALEZ, 2004) Acide retinoique Positive (OGURA, et al, 2005) TGF3 Les deux (ISHIKAWA, et al, 2008, TORRES-PADILLA, et al, 2001) Facteurs transcnptionnels
HNF3a/p Positive (LEVINSON-DUSHNIK et BENVENISTY, 1997) GATA6 Positive (HATZIS et TALIANIDIS, 2001, MORRISEY, et al, 1998) HNF6 Positive (HATZIS et TALIANIDIS, 2001, LANDRY, et al, 1997) HNF1a/(? Positive (HATZIS et TALIANIDIS, 2001, ZHONG, et al, 1994) RXRa Positive (HATZIS et TALIANIDIS, 2001, QIAN, et al, 2000) Sp1 Positive (HATZIS et TALIANIDIS, 2001) FTF Positive (PARE, etal, 2001) FXR + Acides bilhaires Negative (ZHANG et CHIANG, 2001) FOXA3 Positive (SHEN, etal, 2001) HNF4a Positive (MAGENHEIM, et al, 2005) TP53 Negative (MAEDA, et al, 2006) WT1 Negative (BERASAIN, et al, 2003) SNAIL Negative (CICCHINI, et al, 2006, CICCHINI, et al, 2008) c/EBPa Positive (HATZIS, et al, 2006) ZFP202 Negative (PATTERSON, et al, 2008) COUP-TFII Positive (PERILHOU, et al, 2008) SREBP2 Negative (XIE, et al, 2009) 48
7.6 Regulation post-traductionnelle
La regulation post-traductionnelle d'HNF4a se fait surtout par phosphorylation (JIANG, et al., 1997; KTISTAKI, et al., 1995). Certaines, comme la phosphorylation de la Serine (Ser) 304 du LBD, empeche la dimerisation d'HNF4a et done sa liaison a l'ADN. Cette phosphorylation est operee par I'AMPK (HONG, et al., 2003). In vitro, les MAPKs de la famille
JNK, Erkl/2 et p38 sont capables de phosphoryler HNF4a et des essais de mutagenese ont permis d'identifier la Ser158 comme etant la cible de p38 MAPK (GUO, et al., 2006).
Contrairement a la phosphorylation par I'AMPK, cette phosphorylation est impliquee dans une augmentation de I'activite sur le promoteur d'iNOS en reponse a une stimulation au peroxyde d'hydrogene et d'lLip (GUO, et al., 2003). Cette phosphorylation serait responsable du recrutement de PC4 (GUO, et al., 2007). HNF4a peut egalement etre conduit au proteasome.
Ceci s'effectue via une phosphorylation de la Ser par la PKC, ce qui induit sa translocation au cytoplasme pour sa degradation (SUN, et al., 2007). Le TGF|3 et 1'ILlp ont egalement ete proposes pour mener a ce meme effet (KRAJEWSKI, et al., 2007; LUCAS SD, et al., 2004). II a egalement ete propose que l'oxyde nitrique (NO) apporte une nitrosylation des residus cysteines et une perte de liaison a l'ADN (LUCAS SD, et al., 2004).
7.7 Cofacteurs
Le domaine AF-1 permet le recrutement de nombreux facteurs. Certains, comme
TFIIB, TFIID, TFIIH-p62 et TBP (GREEN, et al., 1998; KISTANOVA, et al., 2001; MALIK et
KARATHANASIS, 1996), font partie des facteurs de transcription generaux du complexe d'initiation de la transcription, alors que d'autres, comme CBP, vont permettre le recrutement d'enzymes de modification de l'ADN tel que p300 (GREEN, et al., 1998). De surcroit, HNF4a s'associe a plusieurs proteines faisant partie des coactivateurs generaux, tels que MED1 du complexe mediateur (MAEDA, et al., 2002), PC4 de la famille USA (Upstream 49
Stimulatory Activity; USA) (KAISER et MEISTERERNST, 1996) et TAFII31, TAFII80 de la famille des TAFs (TBP Associated Factors; TAFs) (GREEN, et al., 1998). II a egalement ete montre que par sa stabilisation des facteurs de transcription generaux, FfNF4a peut substituer a TBP sur les promoteurs ne possedant pas de boite TATA (JANNE et HAMMOND, 1998).
HNF4a est done capable d'activation vraie en plus d'induire des changements de la chromatine. Plusieurs autres cofacteurs, autant represseurs qu'activateurs, ont ete caracterises au fil des annees. Le Tableau 2 resume ces derniers. Fait important, le recrutement des cofacteurs est hautement dependant de l'absence/presence de l'AF-1 chez les differentes isoformes. Cependant, differents exemples montrent que l'AF-2, commun a toutes les isoformes, est la plupart du temps lui aussi en mesure de participer. Par exemple, SMRT peut etre recrute autant via l'AF-1 que l'AF-2 (TORRES-PADILLA, et al., 2002).
Plusieurs exemples d'activation synergique entre HNF4a et l'un de ses partenaires ont ete decrits. Par exemple, FTNF4a et COUP-TFII agissent en synergie sur le promoteur du gene HNF1A, synergie qui est abolie par la mutation E276Q retrouvee dans une forme de
MODY1 (Maturity Onset Diabetes of the Young) (BULMAN, et al., 1997; SUAUD, et al., 1999).
Cette meme mutation permet egalement d'illustrer 1'importance des coactivaeurs, tel que
CBP/p300, etant lui aussi incapable d'interagir avec le mutant E276Q, et ayant pour resultat une reduction de l'activite sur le promoteur d'HNFIA (EECKHOUTE, et al., 2001). Tableau 2 Cofacteurs d'HNF4g Cofacteurs generaux
IFRD1/PC4 (GREEN, etal, 1998) MED1 (MAEDA, et al, 2002) MED14 (MALIK, et al, 2002) TAFII31 (GREEN, etal, 1998) TAFII80 (GREEN, etal, 1998)
Coactivateurs
CBP (YOSHIDA, etal, 1997) COUP-TFI (CAIRNS, et al, 1996) GRIP1 (WANG, etal, 1998) NCOA1/SRC-1 (WANG, etal, 1998) COUP-TFII (CRESTANI, et al, 1998) PGCIoc (YOON, etal, 2001) TRIP3 (IWAHASHI, et al, 2002) EWSR1/EWS (ARAYA, et al, 2003) NCOA3/SRC-3 (IORDANIDOU, et al, 2005) CITED2 (QU, et al, 2007) NCOA6 (SURAPUREDDI, et al, 2008) SMAD3 (CHOU, et al, 2003) SMAD4 (CHOU, et al, 2003)
Corepresseurs
SHP (OGATA, et al, 2002) NCOR2/SMART (RUSE, et al, 2002) DAX1 (NEDUMARAN, et al, 2009) SMILE (XIE, et al, 2009) GPS2 (SANYAL, et al, 2007) TP53 (MAEDA, et al, 2002) Interaction physique avec d'autres TFs
DBI/ACBP (PETRESCU, et al, 2003) SREBP-1a (YAMAMOTO, et al, 2004) SREBP-lc (YAMAMOTO, et al, 2004) PROX1 (SONG, et al, 2006) GATA4 (SUMI, etal, 2007) SMAD3 (LI et CHIANG, 2007) VDR (HAN et CHIANG, 2008) (HWANG-VERSLUES et SLADEK, SP1 2008) (HWANG-VERSLUES et SLADEK, MYC 2008) HNF1a (LU, et al, 2008) FOX01 (GANJAM, et al , 2009) 51
7.8 Ligands endogenes et exogenes
HNF4a est un facteur de transcription de type recepteur nucleaire hormonal dont le domaine de liaison a longtemps suscite la controverse. Premierement, il s'est revele que contrairement aux autres recepteurs de cette famille, HNF4a possede plusieurs ligands differents, en plus de posseder deux poches de liaison. Une approche d'isolation et de spectrometrie de masse de la proteine complete a permis en 2009 de proposer l'acide linoleique (18 :2co6, Linoleique Acid; LA) comme etant le ligand principal et endogene d'FINF4a dans le foie murin. Cette liaison serait egalement reversible et confirme done, tel qu'il avait ete demontre auparavant, que ce ligand peut etre echange durant I'activite cellulaire ou lors de I'ajout d'un ligand artificiel. Bien que I'activite transcriptionnelle d'FINF4a peut etre modulee en fonction du ligand en question, ces memes auteurs ont propose qu'HNF4a conserve une activite malgre I'absence de LA. lis ont egalement demontre que lors d'un jeun, HNF4a ne possede pas de ligand lorsqu'extrait des hepatocytes
(YUAN, et al., 2009). D'autres ont montre que des ligands peuvent augmenter ou reduire
I'activite d'HNF4a. Par exemple, les acyl-CoA a longue chaine (Long Chain Fatty Acid;
LCFA) de 14 ou 16 carbones peuvent augmenter son activite, alors que les acides gras polyinsatures-CoA (Poly-Unsaturated Fatty Acid; PUFA) de type oo-3 (e.g C20:5co3,
C21:6co3) la reduisent (HERTZ, et al., 1998). D'autres composes totalement artificiels, tels que des derives du 7- methoxy-2-nitronaphtho[2,l-b]furan peuvent augmenter son activite (LE
GUEVEL, et al., 2009), alors que le medica-16-CoA peut la reduire (PETRESCU, et al., 2002). Une deuxieme poche de liaison situee entre le domaine E et F serait en realite l'endroit ou sont lies les acyl-CoA avant d'etre esterifies par une activite thioesterase intrinseque a HNF4a
(HERTZ, et al., 2005). L'acide gras libre pourrait alors etre capte par la poche de liaison du LBD ou encore etre responsable de l'autoacylation d'HNF4a ou de l'un de ses partenaires. Cette 52 decouverte est venue eclairer les differents modes d'inhibition de son activite. Par exemple, le Medica-16-CoA est non hydrolysable et empeche done le transfert de l'acide gras libre du site d'esterification au site de liaison du LBD.
7.9 Les fonctions et genes cibles d'HNF4a
De nombreuses cibles transcriptionnelles ont ete associees au facteur de transcription
HNF4a durant les premieres annees de son etude in vitro au courant des annees 1990 (Pour un resume des cibles, voir (ELLROTT, et al., 2002)). La mortalite embryormaire du knockout classique d,Hnf4a a retarde son etude in vivo, mais deja il etait possible d'entrevoir un role important de ce facteur dans la differenciation des hepatocytes lorsque la recombinaison tetraploide fut utilisee (LI, et al., 2000). Mis a part son role evident dans le developpement
(CHEN, et al., 1994), l'etude par la deletion conditionnelle d,Hnf4a a permis de lui attribuer une participation dans la regulation de differentes fonctions au niveau de la differenciation et du metabolisme dont la plupart ont ete etudies dans le foie et le pancreas. L'invalidation d,Hnf4a au niveau hepatique par l'equipe de Gonzalez (Alb.Cre; Hnf4c^/fx) a d'abord permis de confirmer son importance dans le metabolisme (e.g. ApoAI et ApoB) et le transport (e.g.
APO-CIII, MTTP) des lipides (HAYHURST, et al., 2001); une fonction qui semble etre conservee chez le zebra fish (CHENG, et al., 2006). Ces defauts resultent en une augmentation de la taille du foie, due a une deposition de lipides et de glycogene, en une augmentation importante des acides biliaires sanguins, en une reduction des VLDL dependants des apolipoproteines (e.g. ApoB) et de la MTP, en une reduction des HDL contenant le cholesterol et en la secretion reduite des triglycerides sanguins. Les animaux demontrent egalement une perte de poids et une mortalite elevee apres 8 semaines. II a ete plus tard demontre que ces memes animaux ont une augmentation de l'ammoniac et de 1'uree 53 sanguine causee par une deficience dans le cycle de l'uree due a une regulation directe de l'ornithine transcarbamylase (OTC) par Hnf4a. L'ammoniac sanguin pourrait ainsi expliquer la mortalite observee plus tot (INOUE, et al., 2002). L'augmentation des acides biliaires sanguins pourrait aussi etre en cause et il a ete detaille qu'Hnf4a est necessaire a leur conjugaison (INOUE, et al., 2004), leur transport (HAYHURST, et al., 2001) et leur p-oxydation par les cytochromes CYP7A1, CYP7B1 et CYP8B1 directement regules par Hnf4a (INOUE, et al.,
2006). Ce meme modele animal a egalement permis de confirmer les etudes in vitro ayant montre l'importance d'HNF4a dans l'expression des facteurs de coagulation secretes par le foie (INOUE, et al., 2006).
L'equipe de Duncan s'est quant a elle interessee au role d'Hnf4a dans le developpement du foie en utilisant leur propre modele de deletion conditionnelle prenant avantage du promoteur de l'albumine combine a Yenhancer de l'alpha-fetoproteine
(Alfp.Cre; Hnf4c^/Jk) qui s'exprime avant El5.5 (PARVIZ, et al., 2002). Ce modele a permis de s'apercevoir de l'importance d'Hnf4a dans l'expression des jonctions cellulaires durant cette periode de morphogenese (PARVIZ, et al., 2003), un concept recemment mis a l'epreuve par la competence des cellules bipotentielles hepatiques Hnf4a negatives isolees de foies foetaux a la polarisation in vitro (HAYHURST, et al., 2008).
Pour consulter de nombreuses autres cibles et fonctions dans le foie, le colon et le pancreas, on peut se referer a 1'etude de micropuce sur ChIP (ChlP-Chip) effectuee sur le foie et le pancreas (ODOM, et al., 2004), a la micropuce effectuee sur les cellules P en culture
(INS-1) (THOMAS, et al., 2004), sur le modele in vivo de deletion conditionnelle dans les cellules P du pancreas (/w.Cre; Hnf4afx/Jk) (GUPTA, et al., 2007), a l'etude de ChlP-Chip sur les 54 cellules HepG2 (cellule de foie) (BOLOTIN, et al., 2009) ou encore a l'etude effectuee dans le colon grace au modele Foxa3.Crc; Hnf4a!*/fi' (GARRISON, et al., 2006).
7.10 HNF4a et metabolisme
Le controle transcriptionnel au niveau du metabolisme du glucose auquel participe
HNF4a dans le foie est un point important a considerer. La balance entre production
(anabolisme) et consommation de glucose (catabolisme) dans le foie est regie en grande partie par les etapes limitantes de la neoglucogenese et de la glycolyse qui sont la glucose-6- phosphatase (G6PC) et la glucokinase (GCK) respectivement. HNF4ot intervient dans la regulation de ces deux enzymes cles (HIROTA, et al., 2005; RHEE, et al., 2003; ROTH, et al., 2002) en partenariat avec FOXOl, un facteur dont I'activite est regulee par phosphorylation via la voie PI3K/AKT en reponse a l'insuline (TANG, et al., 1999). En situation de jeun, le glycogene hepatique est mis a profit pour la production de glucose ou alors HNF4a et FOXOl agissent en synergie pour l'activation de la G6PC (HIROTA, et al., 2008). De l'autre cote FOXOl agit comme corepresseur d'HNF4a (HIROTA, et al., 2003) sur le gene de GCK pour limiter son expression. Par contre, lorsque la concentration sanguine de glucose augmente, la phosphorylation de FOXOl par AKT l'exclue du noyau. HNF4a se retrouve seul et l'expression de la G6PC s'en trouve diminuee au profit de la GCK qui peut maintenant etre activee par FTNF4a. La glucokinase, a l'exception du pancreas, n'est pas exprimee au niveau des autres organes et est remplacee par les hexokinases de haute affinite (Km faible) I, II et II
(SMITH, 2000).
La PEPCK (PCK1) quant a elle est une enzyme qui convertit l'oxaloacetate en phosphoenolpyruvate et est une seconde etape limitante de la neoglucogenese. Durant le 55 jeun, HNF4a participe a sa regulation directe en collaboration avec le cofacteur PGCla, tout comme pour le promoteur de la G6PC (RHEE, et al., 2003; YOON, et al., 2001). Cependant, en reponse a I'insuline (postprandial), PGCla est deplace par SREBP-1 (SREBFl) pour reduire l'expression de ce gene (YAMAMOTO, et al., 2004). HNF4a est lui-meme regule negativement au niveau transcriptionnel par SREBP-2 (SREBFl) a ce moment (XIE, et al.,
2009). Similairement a SREBP-1, la stimulation a I'insuline permet aussi la competition par le corepresseur DAXl (NEDUMARAN, et al., 2009). Quant a eux, les acides biliaires permettent le deplacement de PGCla par le co-represseur SHP (YAMAGATA, et al., 2004). L'activation de l'AMPK est egalement impliquee dans 1'augmentation de SHP et ainsi a la repression des genes impliques dans la neoglucogenese (KIM, et al., 2008). L'AMPK, en phosphorylant directement la Ser304 d'HNF4a empeche egalement sa dimerisation et reduit sa stabilite
(HONG, et al., 2003; LECLERC, et al., 2001).
8. Hypotheses, objectifs et methodes
Les FTs sont activement impliques dans 1'execution des programmes de developpement embryonnaire en executant ou bloquant les differents programmes de determination, puis de differentiation cellulaire (MANNERVIK, et al., 1999; ZEITLINGER et
STARK, 2009; ZEITLINGER et STARK, 2010). Les differentes combinaisons de leur presence sont a la base de l'expression specifique des genes dans les differents types cellulaires; sans quoi chacune des milliards de cellules se comporteraient de maniere identique au niveau transcriptionnel. De plus, les FTs seraient responsables du tiers des anomalies developpementales et seraient impliques dans de nombreuses maladies, tel que le cancer, ou
Ton retrouve une quantite appreciable de FTs reconnus comme oncogenes (BOYADJIEV et
JABS, 2000; FURNEY, et al., 2006). Etudier ces facteurs permet de definir les modifications au 56 niveau de la transcription des cellules cancereuses et laisse place a d'importantes avancees therapeutiques. En effet, cibler un facteur de transcription oncogenique permet de reduire
1'expression de plusieurs autres effecteurs oncogeniques en aval de celui-ci (DARNELL, 2002).
Consequemment, la caracterisation des reseaux de regulation auxquels participent chacun de ces facteurs de transcription permet d'acquerir de precieuses informations concernant la regulation du developpement, du maintien du tissu adulte et des pathologies.
L'approche de deletion des genes codant pour ces FTs permet entre autre de verifier
l'impact sur l'homeostasie du tissu etudie et de potentiellement relier les phenotypes a une
signature correspondant a une pathologie connue. L'objet de ce travail a done ete de caracteriser deux facteurs de transcription potentiellement impliques dans la regulation de
I'homeostase de la muqueuse digestive. Pour y arriver, les approches de deletion conditionnelle ou de deletion classique ont ete employees dans les etudes presentees ici.
8.1 CUX1
Le facteur de transcription Cuxl presente ci-haut a pu etre etudie au niveau de l'intestin grace au modele hypomorphique CuxlAHD/AHD (Cuxl AHD) (SINCLAIR, et al., 2001). Ce modele produit une proteine non fonctionnelle tronquee a partir du domaine CR3 de la proteine. Ces animaux presentent une mortalite perinatale importante due a une mauvaise differentiation de Perithelium pulmonaire, mais survivent assez bien durant les mois suivant le sevrage.
Une caracterisation preliminaire indique qu'aucun phenotype majeur n'est present au niveau intestinal. Neanmoins, les roles connus de Cuxl au niveau du cycle cellulaire (HARADA, et al.,
2008), de la migration (KEDINGER, et al., 2009; KEDINGER, et al., 2009; MICHL, et al., 2005) et de sa competition avec NF-KB sur certains genes inflammatoires (UEDA, et al., 1998) a permis de 57 s'interroger sur les roles de cette proteine dans certains contextes particuliers. Nous avons d'abord pose l'hypothese que Cuxl puisse etre essentiel a la regulation de la phase d'inflammation et de restitution lors d'une insulte epitheliale colique. Pour se faire, nous avons choisi d'utiliser le modele de colite experimentale au DSS comme moyen de recreer une situation inflammatoire semblable a la colite ulcereuse au niveau du colon de ces animaux (BOISMENU et CHEN, 2000; COOPER, et al., 1993). Ce modele murin, ainsi que
Putilisation de la colite experimentale nous a permis de fixer differents objectifs dont le principal a ete de determiner si un epithelium depourvu du controle transcriptionnel de Cuxl allait developper une colite plus ou moins severe que les controles lors du traitement au DSS.
8.2 HNF4a
Le facteur de transcription Hnf4a a deja ete implique dans un certain nombre de maladies humaines. La maladie d'hemophilie B Leyden ou des mutations en cis du facteur de coagulation IX empeche la regulation transcriptionnelle d'HNF4a (REIJNEN, et al., 1992) et le diabete de type MODY1 ou des mutations dans le gene d' HNF4a induisent un diabete de type 1 (YAMAGATA, et al., 1996). Au niveau intestinal, il a ete rapporte que I'expression du gene HNF4oc est reduite chez les patients atteints des Mil et que le gene Hnf4a est protecteur dans le cadre d'une colite experimentale au DSS (AHN, et al., 2008). De plus, des mutations dans le gene d'HNF4a ont ete identifiees chez les patients atteints d'une Mil lors d'une etude genomique (Genome Wide Association; GWA) (BARRETT, et al., 2009). HNF4a joue un role important dans la definition de l'endoderme visceral, dans la gastrulation (CHEN, et al., 1994) et dans le maintien du foie (HAYHURST, et al., 2001), du pancreas (GUPTA, et al., 2005) et du colon
(GARRISON, et al., 2006) en controlant la morphogenese ainsi que la differenciation cellulaire a l'interieur de ces organes. Sachant l'importance d'Hnf4a dans la differenciation des 58 hepatocytes, nous avons pose l'hypothese que 1'invalidation d'Hnf4a au niveau intestinal aurait d'importantes consequences sur la differenciation des cellules epitheliales intestinales du grele et que 1'homeostasie des cellules epitheliales coliques pourrait etre a long terme affectee par 1'absence du role transcriptionnel d'Hnf4a dans un muqueuse deja susceptible aux modeles d' inflammation.
Pour y arriver, nous avons utilise un modele d'invalidation conditionnelle a l'aide de la
Cre recombinase sous le controle du promoteur de 12.4kb de la Villine (12.4kb-Fi7/m.Cre)
(MADISON, et al., 2002), chez les souris Hnf4a floxees (Hnf4aLoxP/LoxP) de l'equipe de Gonzalez
(PARVIZ, et al., 2002). Ce modele, ou 1'invalidation d'Hnf4a s'opere dans l'epithelium intestinal uniquement, nous permet de fixer l'objectif de caracteriser la differenciation intestinale chez ces animaux grace a une analyse morphologique, cytologique et fonctionnelle de la muqueuse; de verifier 1'homeostasie inflammatoire au cours de la vie des animaux grace a l'observation de l'aspect de la muqueuse et, si necessaire, de l'expression de differents marqueurs d'inflammation et; de finalement s'interroger sur le role potentiel d'Hnf4oc dans la carcinogenese intestinale en utilisant le modele ApcMm/+ (MOSER, et al., 1992) comme modele genetique de tumorigenese intestinale. Sur ce point de vue, nous avons pose l'hypothese que l'absence de la regulation transcriptionnelle d'Hnf4a aurait pour consequence d'accelerer l'initiation et la croissance des polypes formes chez le modele 59
RESULTATS
MANUSCRIT 1
CUXl TRANSCRIPTION FACTOR IS INDUCED IN INFLAMMATORY BOWEL DISEASE AND PROTECTS
AGAINST EXPERIMENTAL COLITIS
Darsigny, M., St-Jean, S. et Boudreau, F. (2010). Inflamm Bowel Pis, souspresse.
MANUSCRIT 2
HEPATOCYTE NUCLEAR FACTOR 4a CONTRIBUTES TO AN INTESTINAL EPITHELIAL PHENOTYPE
IN VITRO AND PLAYS A PARTIAL ROLE IN MOUSE INTESTINAL EPITHELIUM DIFFERENTIATION
Babeu, J. P., Darsigny, M., Lussier, C.R., and Boudreau, F. (2009). Am J Physiol Gastrointest Liver Physiol, 297(1): G124-34.
MANUSCRIT 3
LOSS OF HEPATOCYTE-NUCLEAR-FACTOR-4a AFFECTS COLONIC ION TRANSPORT AND CAUSES
CHRONIC INFLAMMATION RESEMBLING INFLAMMATORY BOWEL DISEASE IN MICE
Darsigny, M., Babeu, J.P., Dupuis, A.A., Furth, E.E., Seidman, E.G., Levy, E., Verdu, E.F., Gendron, F.P. et Boudreau, F. (2009). PLoS One, 4(10): e7609.
MANUSCRIT 4
HEPATOCYTE-NUCLEAR-FACTOR-4a PROMOTES NEOPLASIA IN MICE AND PROTECTS AGAINST
THE PRODUCTION OF REACTIVE OXYGEN SPECIES
Darsigny, M., Babeu, J.P., Carrier, J., Seidman, E.G., Gendron, F.P., Levy, E., Perreault, N. et Boudreau, F. (2010). Cancer Res., en revision. 60
MANUSCRIT 1
CUXl TRANSCRIPTION FACTOR IS INDUCED IN INFLAMMATORY BOWEL
DISEASE AND PROTECTS AGAINST EXPERIMENTAL COLITIS
MATHIEU DARSIGNY, STEPHANIE ST-JEAN ET FRANCOIS BOUDREAU
2010
INFLAMMATORY BOWEL DISEASE, SOUSPRESSE. 61
1.1 Auteurs et affiliations
Mathieu Darsigny1, Stephanie St-Jean1 and Fran?ois Boudreau1
'Departement d'Anatomie et Biologie Cellulaire, Faculte de Medecine et des Sciences de la
Sante, Universite de Sherbrooke, Sherbrooke, Quebec, Canada, J1H 5N4.
i.z. ^oniriDuiiuns
Mathieu Darsigny
Mathieu a realise toutes les experiences de ce manuscrit et prepare l'ensemble des figures. II a egalement redige une partie du manuscrit et participe a son edition.
Stephanie St-Jean
Stephanie participe au projet en tant que stagiaire. Ses resultats n'ont pas ete inclus dans ce manuscrit.
Francois Boudreau
Francois est I'investigateur principal sur ce projet. II a redige, soumis et corrige le manuscrit. 62
1.3 Resume
Historique
Cuxl est un facteur transcriptionnel ubiquitaire capable de repression active et d'activation transcriptionnelle. Ses roles ont ete associes a la proliferation cellulaire, la migration,
Pinvasion et la differentiation. Cuxl est un effecteur de la voie TGFp, de la signalisation
PAR2 et est implique dans la migration cellulaire; des mecanismes intimement lies a des troubles inflammatoires intestinaux.
Methodes
Des souris CDl traitees avec du dextran sodium sulphate (DSS) dans Peau de boisson et des cellules epitheliales intestinales en culture ont ete utilisees pour determiner I'expression de
Cuxl dans des conditions inflammatoires. Une banque d'ADNc commerciale a ete utilisee pour suivre I'expression de CUXl dans les maladies humaines inflammatoires de l'intestin
(Mil). Finalement, le modele hypomorphique CuxlAHDI mD (CuxlAHD) a ete traite avec le
DSS dans Peau de boisson et la severite de la maladie a ete comparee aux souris controles.
Resultats
L'expression de Cuxl s'est vue augmentee dans les cellules epitheliales intestinales en culture lorsque stimulees avec le TNFa, dans l'epithelium intestinal durant la colite experimental chez la souris et dans les echantillons de patients atteints d'une MIL La colite induite au DSS chez les souris CuxlAHD a ete considerablement plus severe selon les observations cliniques telles que la perte de poids, la longueur du colon et du saignement rectal. Les observations histologiques ont confirme une augmentation marquee de
F ulceration et de Pinfiltration des leucocytes dans la muqueuse des souris CuxlAHD par rapport aux controles. Un nombre accru de cellules pSer276-RelA positives et des niveaux 63 plus eleves d'expression de cytokines pro-inflammatoires ont egalement ete mesures dans le colon des animaux CuxlAHD malades. Des taux plus eleves de Cxcll ont ete mesures avant et apres le traitement DSS et une plus grande infiltration de neutrophiles a ete quantifiee chez les souris mutantes. Enfin, la guerison de l'ulceration des muqueuses a ete significativement reduite chez les souris CuxlAHD lors de la remission de la colite au DSS.
Conclusions
CUXl est augmentee en reponse au stress inflammatoire, ainsi que dans les maladies inflammatoires intestinales humaines et son expression nucleaire est cruciale pour la regulation de 1'inflammation ainsi que la phase de guerison des muqueuses.
Mots cles
Facteur de transcription, Cuxl, colite ulcereuse, Mil, CXCL1
1.4 Abstract
Background
Cuxl is an ubiquitous transcriptional factor capable of active repression and activation. Its roles have been associated with cell proliferation, migration, invasion and differentiation.
Cuxl is also an effector of the TGF|3 pathway, PAR.2 receptor signalling and cellular migration, all mechanisms intimately related to intestinal inflammatory disorders
Methods
CD1 mice treated with dextran sulfate sodium (DSS) in drinking water and intestinal epithelial cells in culture were used to determine Cuxl expression under inflammatory conditions. A commercial cDNA library was used to monitor CUXl expression in human 64 inflammatory bowel disease (IBD) patients. Finally, the Cuxl*"01 AHD hypomorphic mouse model (CuxlAHD) treated with DSS in drinking water was used and the disease severity assessed in comparison to control DSS treated mice.
Results
Cuxl expression increased in cultured intestinal epithelial cells stimulated with TNFa, in the mouse intestinal epithelium during experimental colitis and in human IBD patient samples.
DSS-induced colitis in CuxlAHD mice was drastically more severe according to clinical observations such as weight loss, colon length and rectal bleeding. Histological observations confirmed a marked increased of IBD-related morphological changes including ulceration and mucosal infiltration of leukocytes in CuxlAHD mice as compared to controls. An increased number of pSer276-RelA-positive cells and higher expression levels of proinflammatory cytokines were also measured in the colon of CuxlAHD diseased animals.
Elevated levels of Cxcll were measured before and after DSS-treatment and a greater neutrophilic infiltration was quantified in DSS-treated CuxlAHD mice. Finally, mucosal healing was significantly impaired in CuxlAHD mice during recovery from DSS-treatment.
Conclusions
CUX1 is increased in response to inflammatory stress as well as in human IBD and its nuclear expression is crucial to protect against DSS-induced colitis and subsequent mucosal healing
Key words
Transcription factor, Cuxl, colitis, IBD, Cxcll. 65
1.5 Introduction
Ulcerative colitis (UC) and Crohn's Disease (CD) are two complex disorders classified under inflammatory bowel diseases (IBD). The outcome of IBD is complex and involves a dysfunction in the balance among the interactions of multiple cellular entities that collectively control adequate response of the organism to luminal threats. Environmental factors including the gut microbiota as well as genetics are now recognized as important facets that can influence innate and adaptive immunity as well as the barrier function of the single layer of polarized intestinal epithelial cells.1 The intestinal epithelium plays a major role in protecting the body against these putative environmental challenges and is actively participating in the signalling of molecules involved in bringing protection and, in extreme cases, regeneration of the mucosal properties following a damaging assault.
Modification of gene expression caused by the deregulation of transcriptional regulators is associated with a number of human diseases.2 It is now becoming evident that epithelial transcriptional regulation is important in sensing and orchestrating inflammatory response with the recruitment of immune effectors cells.3 Transcriptional activators such as the nuclear factor kappa B (NF-KB) and signal transducers and activators of transcription
(STATs) has been thoroughly studied in this context and their role in IBD pathogenesis is also recognized.4'5 STAT-6, for example is currently associated with the IBD locus 2
(IBD2).6 On the other hand, transcriptional repressors like the PPAR-y and Twist have been proposed to play a role in IBD.7"9 Thus, it is reasonable to speculate that a better understanding of mucosal immune regulation through transcription factors could lead to potential therapeutic avenues in targeting specific deregulated gene networks. 66
CUX1, the drosophila Cut mammalian homologue, is a widely expressed transcription factor involved in development, cell proliferation, transformation, motility and invasion.10' H CUX1 consists of several isoforms, each displaying different DNA-binding affinity and transcriptional activity making them either repressors (e.g. p200CUXl) or under certain circumstances activators (e.g. pllOCUXl) depending on the isoforms, post- traductional modifications and gene context.11 Cuxl transcriptional activity has already been linked to the regulation of inflammation. For example, Cuxl is a regulator of CXCL1, a potent neutrophil chemoattractant12'13, and of CCL3/CCL4, two leukocytes chemoattractants secreted by dendritic cells.14 It also represses genes associated with terminal differentiation of neutrophils such as lactoferrin, cytochrome b-245 oxidase, neutrophil collagenase, neutrophil gelatinase and neutrophil elastase.15"18 Mice deficient for Cuxl display up- regulated levels of TNFa in many organs, a feature associated with lymphocyte apoptosis throughout their development.19 Moreover, Cuxl binding activity was proposed to be modulated from PGE2 signalling and to be an effector of the TGFP pathway as well as of the
PAR.2 receptor.14'20'21 Cuxl is expressed throughout the intestinal epithelium, is found mainly as a p200Cuxl isoform and increases in expression along both the proximo-distal and the crypt-surface epithelium axes of the colon.22'23 Since CUX1 appears to be implicated in immunoregulation at multiple levels, we hypothesized that this transcription factor could be involved in the control of colonic epithelial homeostasis during local inflammation. Here, we show that Cuxl can respond to inflammatory stimuli and that CUX1 gene expression is increased in human IBD patients. We also show that loss of Cuxl transcriptional activity during DSS-induced colitis leads to a severe increase of colonic inflammation. 67
1.6 Materials and methods
Cell culture
The IEC-6 cell line was grown to confluence in DMEM supplemented with 5% fetal bovine serum (FBS, Wisent), 4,5g/liter D-glucose, 2 mM L-alanyl-L-glutamine (GlutaMAX,
Gibco), 25 mM HEPES, 0.1 U/ml insulin, 50 U/ml penicillin and 50 (xg/ml streptomycin.
Cells were serum deprived (0.5% FBS, no insulin) for 18 hours and stimulation with rat
TNFa (Cell Science) at 10 ng/ml was done in 0.5% FBS at different time points. Total protein extracts were then obtained by homogenization in lysis buffer (50 mM Tris-Cl pH
7.5, 150 mM NaCl, 1% Nonidet P40, 0,5% Na-deoxycholate) containing 50 mM NaF, 0.2 mM Na3~V04 and protease inhibitor cocktail (Sigma).
Human IBD RNA samples
TissueScan Real-Time colitis disease panels were purchased from Origene
Technologies. Each panel was composed of total isolated RNA from 6 non-IBD related patients, 21 Crohn's disease (CD) patients and 21 ulcerative colitis (UC) samples collected from different individuals. After resuspension of lyophilised cDNA, quantitative RT-PCR was performed as described above. One CD patient and two UC patients cDNA were removed from the analysis based on their very low reference gene expression and non- detected CUX1 transcript.
Animals
The C57BL/6J CuxlmD/AHD mutant mouse model19 was backcrossed for at least 10 generations with CD-I wild type mice obtained from Charles River laboratories and was kept in a pathogen free (tested negative for helicobacter, pasteurella and murine norovirus) 68
facility. Genotyping was performed by PCR as described elsewhere.19 Animal
experimentation was approved by the Institutional Animal Research Review Committee of
the Universite de Sherbrooke.
Induction and assessment of DSS-induced colitis
Colitis was induced as described previously by feeding wild-type CD1 mice (Charles
River) with 5% (w/v) DSS (MW 35,000-50,000, MP Biomedicals) in drinking water for 7
days. A piece of tissue from the distal colon was removed for RNA extraction and the
remaining tissue was used to recover epithelial cells and isolate nuclear extracts as described
before.26'27 These samples were used to measure Cuxl mRNA and protein expression during
acute colitis. Also, five independent experimental groups (for a total of 20 Cuxl+/+ and 20
CuxlAHD/AHD mutants) of lineage, sex and age matched mice were fed with 2.5% (w/v) DSS
in drinking water for 7 days. Additionally, five independent groups of CuxlAHD/AHD mutant mice (n = 17) compared to control mice (n = 18) were used as a water-only group. Mice were
sacrificed on day 7 and were assessed for disease activity on a 0-4 scale using criteria modified from Cooper et a/.28 Scoring was as follow: weight loss (0 - no change or positive
change, 1 - 1-5%, 2 - 6-10%, 3 - 11-20%, 4 - 21% or more), stool consistency (0 - solid, 2
- loose and adhering to anus, 4 - severe diarrhea, often with emptied colon), fecal blood (0 - none, 2 - lightly coloured, 4 - heavily coloured), rectal bleeding (0 - none, 2 - moderate, 4 -
gross bleeding), and colon length compared to non-treated mice (0 - 100-96%, 1 - 95-86%,
2 - 85-76%, 3 - 75-66%, 4 - less than 66%). Disease activity index (DAI) represented the total of all measured criteria divided by 5. 69
Histological grading of acute colitis
Histological scoring was compiled blindly by two individuals on high field pictures taken blindly with a Leica DC300 camera on a DMLB2 microscope (Leica Microsystem
Canada, ON). Scoring, as validated by Dieleman et al. was as follow: inflammation severity (0 - none, 1 - mild, 2 - moderate, 3 - severe), inflammation extent (0 - none, 1 - mucosa, 2 - mucosa and submucosa, 3 - transmural), crypt damage (0 - none, 1 - first 1/3 of crypt base, 2 - 2/3 of crypt base, 3 - only surface epithelium is remaining, 4 - no epithelium remaining). All scores were added to represent the histological colitis score with a maximum of 10 points.
Restitution experiments
Initial injury with 2.0% DSS was performed for 10 days in controls (n = 14) and 6 days in mutants (n = 14) to obtain a comparable level of epithelial damage. Six animals from each group were used to evaluate the epithelial damage using the same criteria established in the acute DSS treatments. Eight animals from each group were then switched to water to allow for epithelial restitution and for evaluation of the disease activity and histological damage scores after 14 days of recovery.
Tissue preparation, histological stains, immunohistochemistry and immunofluorescence
After macroscopic observations, colons were fixed in a swiss-roll orientation in 4% formaldehyde in PBS (pH 7.0) overnight at 4°C followed by circulation and paraffin embedding. 4 um tissue sections were deposed on Superfrost (Fisher) glass slides and H&E and Alcian blue stains were performed as described elsewhere.30 Immunohistochemical staining and immunofluorescences were done exactly as described recently. Antibodies 70 were used under the following conditions: anti-Cuxl (#13024, 1:15) from Santa Cruz, anti-E-Cadherin-FITC (#612131) from BD Biosciences, anti-MPO (#RB-373, 1:100) from
Neomarkers, anti-phospho-Ser276-RelA (#3037) from Cell Signalling. Number of positive cells per swiss roll were counted using ImageJ software.
Immunoblotting
SDS-PAGE of total (20 ug) or nuclear protein extracts (5 ug) were performed on 4-
12% Bis-Tris gels (Invitrogen). Proteins were subsequently transferred on PVDF membrane
(Roche) and blocked for 1 hour at room temperature in 5% non-fat dry milk in PBS-Tween
0.1%. Then, the following primary antibodies were added with overnight incubation at 4°C : anti-Cuxl (#13024, 1:1400), anti-p-actin (#1615, 1:10000) and anti-histone-Hl (#10806,
1:1000) from Santa Cruz and anti-IicBa (#9242, 1:1000), anti-p-Ser32-lKBa (#2859, 1:1000), anti-NF-KB p65 (#3034, 1:1000), anti-p-Ser536-p65 (#3033, 1:1000) from Cell Signalling.
Quantitative RT-PCR
Mice were sacrificed and tissues were harvested for RNA extraction with the use of the
Ambion RNA extraction kit (Ambion) as described elsewhere.24 Briefly, 10 ng of cDNA were added to 20 \il reactions using ready to use SYBR Green I reagent (QuantiTect SYBR
Green PCR Kit). Quantitative PCR was then performed on a LigthCycler PCR apparatus
V2.0 (Roche Diagnostics) and relative mRNA expression were measured using LightCycler software 4.0 (Roche Diagnostics) using the Tata-box Binding Protein (TBP) mRNA expression as a reference. Primers that were hybridized at 59°C were as follows : ATCB
Up/5'-CAGCCATGTACGTTGCTATCCAGG-3', ATCB Dw/5'- 71
AGGTCCAGACGCAGGATGGCATG-3', Cuxl Up/5'-
GATGGATATGAAGCGGATGG, Cuxl Dw/5'-GGTTTTTGGTGATGGGTATGG-3\
CUX1 Up/5'- AGCAGGCCATAGAGGTGCT-3', CUX1 Dw/5'-
TCTTCCAGTTGTTTGAGTGTGC-3', Cxcll Up/5'-ACCCAAACCGAAGTCATAGC-3\
Cxcll Dw/5'-GTCAGAAGCCAGCGTTCAC-3\ Ifng Up/5'-
GCTTTGCAGCTCTTCCTCAT-3', Ifng Dw/5'-GTCACCATCCTTTTGCCAGT-3\ Tbp
Up/5'-AGCCCTCCACCTTATGCTCA-3', Tbp Dw/5'-TGTGTGGGTTGCTGAGATGT-3\
Tnf Up/5'-CCACCACGCTCTTCTGTCTACT-3\ Tnf Dw/5'-
GATGATCTGAGTGTGAGGGTCTG-3'.
Statistical analysis
Groups were compared with unpaired Student's Mest, unless otherwise noted, with P <
0.05 considered significant (GraphPad Prism 5, GraphPad Software). Data were expressed as mean ± SEM. 72
1.7 Results
Cuxl is upregulated in IECs during inflammatory conditions as well as in IBD patients
We first explored whether Cuxl could be modulated in the intestinal epithelium in response to an inflammatory stimulus. The IEC-6 normal cell line was used as an intestinal epithelial cell model since it was well known to respond to various inflammatory mediators.32'33 IEC-6 cells were supplemented with TNFa and total protein extracts isolated at various time points following the treatment. Cuxl was increased after 60 min of TNFa stimulation (Figure 1A). Different Cuxl isoforms were detected in IEC-6 cells with the p200Cuxl being the most predominant under these conditions. Induction of the NF-KB pathway following the inflammatory stimulation was confirmed by immunoblotting against both total and Ser -phosphorylated p65 subunit of NF-KB as well as total and Ser - phosphorylated form of IKBO, (Figure 1A). Acute inflammation was next triggered in the colonic mucosa of mice by using a well accepted DSS-induced model of colitis. After treating wild-type CDl mice with 5% DSS, colonic epithelial cells were recovered and nuclear extracts isolated. Western blot analysis showed that Cuxl was increased in colonic epithelial cells following the induction of acute colitis in mice (Figure IB). Cuxl gene transcript was up-regulated as determined by qRT-PCR under the same experimental conditions (Figure 1C). TNF gene transcript was also measured to confirm that acute inflammation was taking place during the DSS treatment (Figure ID). Since Cuxl was observed to be modulated with elevated inflammatory stress, we next verified CUX1 expression in intestinal samples from IBD patients. CUX1 mRNA expression was shown to be increased by 4.25 fold in Crohn's disease (4.25 ± 1.01,/? < .01) and 3.76 fold in ulcerative colitis (3.76 ± 1.04, p < .05) patients relative to non-IBD related intestinal samples (1.00 ±
0.25) (Figure IE). 73
FIGURE 1 | Uprcgulated Cuxl expression in response
to in-vitro and in-vivo inflammatory conditions. (A)
Western blot analysis of total protein extracts from IEC-6
cells treated with 10 ng/'ml of rat-recombinant TNFa for TNFa
0 30" 60' 120" 240' 480* 24 hr 0-24 hours with the use of a Cuxl polyclonal antibody. Arrow is showing the predominant p200 Cuxl isoform. 214 kDa- **** • «*» m$$ mm «* «•* * ~«p200 cuxi 160 kOa- The induction status of the NF-KB pathway was 107 kBa- monitored with antibodies against p-Ser536-p65 (and total
32 p65) and p-Ser -lKBot (and total IKBOC) as a confirmation p-Acta
and incubated with a p-actin polyclonal antibody to
76kDa- monitor for protein integrity. This panel is representative pes of three independent experiments. (B) Immunoblot of
nuc ear 38kDa- %&»**; >***«** ^*»«w -AMM?^ p-Ser^-kBa ' protein extracts from isolated epithelial cells of the distal colon of CD1 wild-type mice fed with 5% DSS ; t 38kOa- *nm <*" imm<0m0&$lfi feBa ad libitum for 7 days to assess Cuxl protein expression.
Histone HI was used as nuclear protein loading control. 8 Water DSS This is representative of three independent experiments. 214kDa~ mi§f- #^-« p200 Cuxl (B) Quantitative PCR to monitor induction of Cuxl 160 kOa- 107kDa- mRNA in the whole distal colon of 5% DSS-treated
3BkDa- animals (n = 3) relative to non-treated controls (n = 3). •mbssm.wm mamem (C) TNFa was used as a control of acute inflammation D THFa from these samples. Values were normalized with the I «• 2.0- «1 TBP housekeeping gene. Data represent mean values ± 1.8- 1 19 1 9 1 ' ' # > SEM; * P < 0.05f ** P < 0.01. (D) Quantitative PCR of s- t CUXI mRNA on total RNA extracts from 6 control I ill CTW.SD UC patients, 20 Crohn's disease (CD) patients and 19 WMK CSS ulcerative colitis (UC) patients. CUXI expression
was normalized using ACTB reference gene. Data
represent mean values + SEM; Unpaired t test with
Welch's correction, *P<0.05, ** P < 0.01. 74
Cuxl mutant mice are highly susceptible to DSS-induced colitis
To determine whether modulations in Cuxl expression could be of consequence during colonic inflammation, we next used the previously described Cuxl hypomorphic mouse model.19 These mutants produce a truncated version of Cuxl that no longer possesses the homeodomain (HD) and the C-terminal end of the protein necessary for transcriptional activity and nuclear localization {CuxlAHD)^5 CuxlAHD mice are smaller than control littermates with some lethality during the first postnatal week but survive well following the suckling-weaning transition throughout adulthood. Evaluation of CuxlAHD mice at the level of gastrointestinal tract morphological features did not show any local inflammatory hallmarks at any stage of their postnatal development.
In order to investigate the consequences of abrogating Cuxl induction of expression during inflammation, CuxlAHD and control adult mice were subjected to DSS induced colitis. To first determine the concentration of DSS that would give the most appropriate epithelial challenge, CuxlAHD and control mice were exposed to either a 2.5% DSS or a 5%
DSS supplementation in drinking water. At 5%, clinical findings appeared as early as the third day of treatment in CuxlAHD mice while controls remained healthy at this period of time (data not shown). By day 6, one of the three mutants had died and the remaining two individuals were strongly weakened by the challenge. The use of a 2.5% DSS treatment for a period of 7 days was thus preferred to induce a mild colitis under the CD1 mouse background. We first confirmed that the induction of an inflammatory stress in CuxlAHD mice did not lead to the nuclear accumulation of the Cuxl truncated protein.
Immunofluorescence experiments showed that the Cuxl truncated protein was restricted to the cytoplasm of epithelial cells in CuxlAHD mice as opposed to nuclear detection in control 75
A Water-only 2.5% DSS B CuxV* cux1MDaHD Cuxl*1* cuxl*"0""10
FIGURE 2 | Increased experimental-colitis sensitivity in CuxlAHD mice. (A) Immunofluorescence
showing subcellular localization of Cuxl in CuxlAHD mutants relative to controls in water-only and DSS-
treated animals. E-Cadherin immunodetection (Rhodamine) was used to visualize the epithelial layer, while
DAPI was used to visualize the nucleus. Merged images of Cuxl and DAPI are found on the bottom row of
the panel. (B) Weight loss in % of initial weight during the course of a 7 days 2.5% DSS treatment. (C)
Reduction of colon length in % of initial length. Initial length represents the mean of measured colon length
in non-treated wild-type and CuxlAHD mice. (D) Disease activity index (DAI) representing the mean of
different clinical parameters (colon length, stool consistency, fecal blood and rectal bleeding scores)
observed upon sacrifice after 7 days of treatment. Data represent mean values + SEM of 20 mice for each
group; * P < 0.05, ** P < 0.01, *** P < 0.001.
mice (Figure 2A, left panels). Administration of 2.5% DSS during 7 days did not influence cellular distribution of the truncated Cuxl protein in CuxlAHD mice (Figure 2A, right 76 panels). Weight loss was next recorded each day during the course of a 2.5% DSS treatment and this analysis revealed a significant weight loss increase in CuxlAHD mice as compared to control mice after 7 days of treatment (Figure 2B). Colon length reduction was also more severe in CuxlAHD mice (Figure 2C) and disease activity index (DAI) summarizing all measured clinical signs of the DSS-colitis (colon length, rectal bleeding, fecal blood and stool consistency) was drastically increased in the CuxlAHD mutants (Figure
2D). Concurrently, control and CuxlAHD mice from the water-only group did not show weight loss, rectal bleeding or diarrhea (data not shown).
The severity of mucosal injury caused by the DSS-induced colitis was next evaluated.
While the water-only group did not show any sign of inflammation (Figure 3A), 2.5% DSS administration in CuxlAHD mutant mice induced extensive epithelial damage with large segments of complete epithelial loss and abundant inflammatory infiltrates (Figure 3A).
Mucus cell depletion, a consequence of sustained mucosal inflammation , was also markedly more frequent in CuxlAHD mutants (Figure 3B). Consequently, the histological score (crypt damage, inflammation severity, inflammation extent) was significantly higher in the CuxlAHD mice (Figure 3C). 1 FIGURE 3 | Severe mucosal inflammation A CUX1* * Qux1AH0f&HD and cytological signs of colitis in CuxlAHD
mice during experimental DSS-tnduced
colitis. (A) Representative H&E stained
sections from wild-type and CuxlAHD mice
of the water-only and 2.5% DSS-treated
groups. (B) Representative Alcian blue
stained sections from wild-type and
DSS-treated groups. Scale bars, 100 urn. (C)
Histological damage assessment of the B Cuxf* cuxiMmm> experimental-colitis by addition of different
grading parameters (crypt damage,
inflammation severity and inflammation
extent). A maximal histological score of 10
points can be obtained. Data represent mean
values ± SEM of 12 mice for each group;
**/><0.01.
WT AMD 78
FIGURE 4 | Increased RelA nuclear
translocation in CuxlAHD mice during
experimental DSS-induced colitis. (A)
Representative immunohistochenustry
against pSer76-RelA in wild-type and
B CuxlAHD mice. Scale bars, 100 jam. (B) 1 1501 Quantification of pSer276-RelA~ nucleus
CuxlAHD mice Data repiesent mean
50 values ± SEM of 4 mice for each group,
5 Mann-Whitney (/test, *P < 0 05 I o WT AHD
Enhanced NF-KB activation and cytokine production in CuxlAHD mice under experimental colitis
Histological assessment of colitis severity among mutant and control mice suggested a significant increase of mucosal inflammatory state in the CuxlAHD mice after induction of the experimental colitis. NF-KB is a well known regulator of the innate and adaptive immune response.?/ Translocation of the phosphorylated RelA subunit to the nucleus regulates many gene targets involved in the progression of inflammation. Immunohistochemistry against p-
27f) Ser -RelA in CuxlAHD DSS-treated mice revealed frequent nuclear localisation of NF-KB in epithelial remaining cells as compared to DSS-treated control mice (Figure 4). To verify if the increase on NF-KB translocation impacted on the expression of proinflammatory mediators involved in the initiation and progression of chemically-induced colitis, we next 79 measured expression of TNFa and IFNy in RNA samples from the water-only and DSS- treated groups. Although no significant difference was found in the expression of both cytokines between CuxlAHD and control mice prior to DSS treatment (Figure 5A-B),
CuxlAHD mice displayed a more severe profile of cytokine expression with a significant
2.3-fold increase in TNFa (Figure 5A) and a significant 3.0-fold increase in IFNy expression
(Figure 5B) on top of the induced expression levels of TNFa and IFNy found in control mice that were subjected to DSS administration.
A TNFa B IFNy
§ 4(H § 16-. h^H 1 35 H I 1 8 14 fc. 30H *- 12 a. '* © 25H a> 10- Z 20- 115 ns Y E 6- a> 10 1 5H J 2H © * ^ * <*• o Q: o "T WT AHD WT AHD WT AHD WT AHD Water DSS Water DSS
FIGURE 5 | Increased expression of pro-inflammatory mediators in CuxlAHD mice during
experimental DSS-induced colitis. Quantitative RT-PCR measurements were done on total RNA
extracted from colonic tissue harvested following sacrifice. (A) TNFa mRNA expression in water-only
and 2.5% DSS-treated groups. (B) IFNy mRNA expression in water-only and 2.5% DSS-treated groups.
Data represent mean values ± SEM; *P < 0.05. 80
High severity of MPO+ cells infiltration correlates with high levels of CXCL1 expression in CuxlAHD mice
Cuxl is a known regulator of CXCL1 expression in melanoma cells13 and is able to repress CXCL1 gene transcription. This chemokine is known to be a very potent chemoattractant for neutrophils in mice via CXCRl or CXCR2 receptors.38 It has also been reported that neutrophils depletion can ameliorate wound healing and that CXCRl'' mice exhibit reduced DSS-induced colitis severity.39'40 Measurement of Cxcll expression in the water-only group revealed a significant increase in CuxlAHD mice (1.88 ± 0.35) compared
B Cxcll Cuxr c 1000.0- 1 1 = 6000-1 T 2 <0 t 100.0- m 1 % 4000- I 10.0- h-^H A tt m E | 2000H 1.0- 1 ** • (0 o 3OJ U.l " 0. WT AHD WT AHD WT AHD Water DSS
FIGURE 6 | Increased Cxcll expression and leukocytic recruitment in CuxlAHD mice during
experimental DSS-induced colitis. (A) Cxcll mRNA expression in water-only and 2.5% DSS-treated
groups (Logarithmic scale. Mean ± SEM). (B) Representative immunofluorescence against MPO+ cells in
sections from wild-type and CuxlAHD mice in 2.5% DSS-treated groups. Scale bars, 100 urn. (C)
Quantification of average MPO+ positive cells per swiss roll sections. Data represent mean values ± SEM
of 4 mice for each group; Mann-Whitney t/test, * P < 0.05. 81 to controls (1.00 ± 0.12), although this magnitude of Cxcll expression was almost negligible when compared to the inflammatory state (Figure 6A). Indeed, induction of colitis significantly increased Cxcll expression in control mice (48± 12) with a much more amplified effect in CuxlAHD mice (165 ± 55) (Figure 6A). Since Cxcll acts as a granulocyte chemoattractant, immunofluorescence was performed against the myeloperoxidase (MPO) enzyme found mainly in neutrophils. As expected, H&E and anti-MPO observations revealed no sign of aberrant granulocytic infiltration recruitment in non-treated animals (data not shown). This was consistent with the low level of Cxcll expression under these conditions.
In contrast, immunofluorescence (Figure 6B) and quantification of MPO+ cells in the DSS- treated group showed a drastic increase of infiltration in CuxlAHD mice (Figure 6C).
CuxlAHD mice are defective in mucosal healing following DSS-induced colitis
Cuxl is transcriptionally involved during the activation of cell migration.20'41 An experiment was next designed to monitor whether the lack of transcriptionally effective
Cuxl could impact on mucosal restitution following DSS-induced epithelial injuries. Since
CuxlAHD mice were more susceptible to DSS-induced colitis than control littermates,
CuxlAHD mice were treated with 2% DSS for 6 days as opposed to 10 days for control mice. These mice were then returned to normal drinking water to allow a 14 days period of mucosal recovery (Figure 7A). From the start of the recovery procedure (R0), both
CuxlAHD and control DSS-treated mice displayed comparable DAI (Figure 7B). After 14 days of recovery (R14), CuxlAHD mice displayed a significant elevated DAI that had completely vanished in control mice (Figure 7C). In addition, CuxlAHD mice failed to recover normal colon length (Figure 7D) and displayed significant more elevated levels of
TNFa expression in comparison to controls (Figure 7E). Both control and CuxlAHD mice 82 displayed identical histological colitis scores at the beginning of the recovery procedure
(Figure 8A and B). As expected, the R14 period led to a significant 1.8-fold reduction of the averaged histological colitis scores of control mice whereas no significant reduction (1.1- fold, P = 0.601) was observed during the recuperation phase in CuxlAHD mice (Figure 8A andB).
R7 R14 FIGURE 7 | Impaired recovery to DSS 14 days • Water in CuxlAHD mice. (A) Initial injury with 14 days • 2.0% DSS 2.0% DSS was performed for 10 days in
wild-types (n = 14) and for 6 days in
mutants (n = 14) to obtain similar epithelial
damage. Two groups (n = 8, each) were
then switched at day 0 of recovery (RO) to
water for 14 days (R14). (B) Disease
activity index (DAI) at the beginning of the
recovery phase (RO) and at the end of the
14 days of the recovery phase (R14). (C)
Colon length at RO and R14 expressed as
percent of initial length. (D) Quantitative
RT-PCR measurements of TNFa mRNA
expression in water-only, RO and R14
groups. Data represent mean values ±
WT AHD WT AHD WT AHD SEM; *P < 0.05, **P < 0.01, ***P < Water RO R14 0.001. 83
FIGURE 8 | Impaired mucosal healing in
CuxlAHD mice after 14 days of DSS-
treatment recovery. (A) Histological
I"" "'"i • • 'I * ' t assessment of the re-epithelialization according WT AHD WT AHD RO R14 to grading parameters (crypt damage, O Inflammation severity inflammation severity, inflammation extent) A Inflammation extent
cuxr CuxfMOfAHD obtained. Data represent mean values ± SEM of B • 1 t 6 mice for RO and 8 mice for RI4, for each
•'a S> » , IS" . ,. group; *P < 0.05, **P < 0.01. (B)
Representative H&E stained sections from ,-.—1 wild-types and CuxlAHD mice from the RO and R14 groups. Scale bars, 100 um.
1.8 Discussion
IBDs are highly complex, multifactorial pathologies, for which aetiology is mostly unknown. A better understanding of the molecular mechanisms underlying the profound modification of the normal gastrointestinal physiology is paramount for disease management.
How transcriptional regulatory mechanisms might influence intestinal epithelium basal functions represents a fundamental question for which answers could lead to developing new 84 therapeutic interventions toward these specific regulatory cascades. Our findings identify for the first time a colonic transcriptional repressor, CUXl, as being crucial for adequate gut inflammatory homeostasis following epithelial insult. In addition, our study reports significant up-regulation of CUXl under inflammatory conditions including those observed in IBD patients.
Cuxl belongs to the regulatory class of transcription factors.42 Its activity is known to be modulated by cell surface receptor activation, internal signalling, phosphorylation, dephosphorylation, acetylation and proteolytic processing.11 pllOCuxl is a proteolytic product of the p200Cuxl form that can either activate or repress transcription.11 pllOCuxl was identified as a transcriptional activator of the interleukin-1 alpha, matrix metalloproteinase-10 and cyclo-oxygenase-2 genes through the modulation of inflammatory- related proteinase-activated receptors.21 In addition, pllOCuxl was recently shown to stimulate cell migration in part through the transcriptional repression of E-cadherin and occludin, both crucial components of cell to cell epithelial junctions.41 In some situations, such as stimulation of TGF0 signalling or exit from proliferative quiescence, Cuxl gene expression is rapidly up-modulated.20'43 Here, we show that p200Cuxl is inducible in intestinal epithelial cells following inflammatory stimulation both in the in vitro and in vivo context. Although p200Cuxl was the most prominent intestinal epithelial form detected in our assays, one could not exclude the functional implication of pllOCuxl under these conditions. Indeed, being a direct proteolytic product of p200Cuxl, pllOCuxl ability to influence transcription is also restricted by the lack of the c-terminal region of the protein in the context of the CuxlAHD mouse model. Our observations coupled to the recent findings 85 that Cuxl is modulated by various inflammatory mediators support an emerging and broad role for this regulator in the control of inflammatory-related genes.
Our results show important acceleration of mucosal injury during the chemically- induced colitis when Cuxl transcriptional activity is loss. The severity of the inflammatory response depends on inflammatory stress mediators such as TNFa and IFNy and their role as been well established in UC and CD.44 These mediators were also previously reported to be up-regulated during DSS-induced colitis.45'46 Colitis in CuxlAHD was accompanied with higher increases of TNFa, IFNy and Cxll expression in the inflamed mucosa as compared to
DSS-treated controls. This was accompanied with an increase of NF-KB transcription factor nuclear localization in CuxlAHD mice relative to their DSS-treated counterparts. NF-KB
(RelA) is a broad inflammation responsive transcription factor that regulates transcription of several inflammatory mediators including TNFa47'48, IFNy4 and Cxcll50. Cuxl can repress
CXCL1 gene transcription and has been recently suggested to inhibit NF-KB regulated activation of chemokine transcription following cytokine induction of inflammation.13 The main mechanism that was proposed for Cuxl action implied sequestration of histone acetyl
13 transferases including PCAF and CBP that are important for NF-KB transcriptional activity.
These observations lead us to propose one possible mechanism for increasing Cuxl during inflammation and then limiting, with time, exacerbation of the inflammatory response during experimental colitis: In basal conditions, without the manifestation of an inflammatory stress to the gut, NF-KB transcriptional activity is not significantly modulated and the fact that
Cuxl is transcriptionally impaired does not impact on the overall gut inflammatory homeostasis. During the induction of an inflammatory challenge, NF-KB is activated and the absence of Cuxl transcriptional potency impacts on the failure to moderate Cxcll 86 expression. This leads to an exacerbation of the local inflammation by the continuous recruitment of neutrophils and the amplified release of TNFa and IFNy. Thus, Cuxl is not critical to maintain mucosal immunity in absence of injurious stimuli but impacts on the protection against acute colonic damage where its action is to put a brake on the exacerbation of inflammatory response as it was reported for other crucial regulators of inflammation including cyclooxygenase-1 and cyclooxygenase-251 as well as toll-like receptors52. Another possible mechanism by which induction of Cuxl could control exacerbation of the inflammatory response is through its transcriptional potential in stimulating epithelial restitution. Indeed, we observed that CuxlAHD mice were seriously impaired in their capacity to mucosal healing during recovery of DSS-induced acute colitis. A strong argument for Cuxl implication in epithelial restitution in this particular context comes from the recent finding that Cuxl is able to repress cell-cell and cell-matrix interaction molecules known to be functionally involved in cell motility.41
The Cuxl hypomorphic mice have been already described to display lymphoproliferative disorders.19 However, the response to the acute nature of the DSS treatment is not likely to be dependant of lymphoid cells population because DSS-induced colitis was not impaired in severe combined immunodeficient mice.4 The myeloid cells population being augmented in the Cuxl mutant mice19 we do not exclude that this could contribute to the progression of the experimental colitis. Macrophages and neutrophils are known to participate in the DSS-induced colitis model. ' Although our study clearly identified Cuxl intestinal epithelial expression to be modulated following inflammatory challenges, the putative implication of other colonic cellular counterparts that could be dependent on Cuxl expression represents a future perspective to investigate in the context of 87 the progression of IBD. Indeed, it remains plausible that the induction of Cuxl expression from the IBD patient samples cohort could not be only restricted to the epithelial counterpart.
Does CUX1 represent a crucial mediator of intestinal inflammation with therapeutically application? Some nuclear factors have been identified for their central role in the regulation of inflammatory transcriptional responses and their potential for clinical use. NF-KB is one of the best characterized transcriptional factors for this action54'55 and PPAR-y still represents a promising druggable candidate.8'56 Our results identified CUX1 as a novel transcriptional regulator to be induced during intestinal inflammation. Because CUX1 was found to be induced in IBD and inflammatory conditions and that a lack of Cuxl transcriptional potential was deleterious during experimental acute colitis, we conclude that induction of Cuxl would represent an important step in balancing inflammatory mediators during the acute phase of the epithelial assault as well as activating mechanisms involved in mucosal healing. The future challenge will remain to determine whether increased expression of CUX1 during IBD represents a marker of good prognosis and a putative remission factor to be exploited for reducing disease chronicity.
1.9 Acknowledgments
We thank the QTRN/CToDE intestinal phenotyping platform from University of Sherbrooke for tissues paraffin embedding and sectioning. This work was supported by a grant from the
Crohn's & Colitis Foundation of Canada (CCFC). 88
1.10 References
1. Xavier RJ, Podolsky DK. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 2007;448:427-434
2. Vaquerizas JM, Kummerfeld SK, Teichmann SA, et al. A census of human transcription factors: function, expression and evolution. Nature reviews. 2009;10:252-263
3. Karrasch T, Jobin C. NF-kappaB and the intestine: friend or foe? Inflammatory bowel diseases. 2008;14:114-124
4. Mudter J, Weigmann B, Bartsch B, et al. Activation partem of signal transducers and activators of transcription (STAT) factors in inflammatory bowel diseases. Am J
Gastroenterol. 2005;100:64-72
5. Spehlmann ME, Eckmann L. Nuclear factor-kappa B in intestinal protection and destruction. Curr Opin Gastroenterol. 2009;25:92-99
6. Xia B, Crusius JB, Wu J, et al. Signal transducer and activator of transcription 6 gene
G2964A polymorphism and inflammatory bowel disease. Clin Exp Immunol. 2003;131:446-
450
7. Sosic D, Richardson JA, Yu K, et al. Twist regulates cytokine gene expression through a negative feedback loop that represses NF-kappaB activity. Cell. 2003; 112:169-180
8. Dubuquoy L, Jansson EA, Deeb S, et al. Impaired expression of peroxisome proliferator-activated receptor gamma in ulcerative colitis. Gastroenterology.
2003;124:1265-1276
9. Niesner U, Albrecht I, Janke M, et al. Autoregulation of Thl -mediated inflammation by twist 1. J Exp Med. 2008;205:1889-1901
10. Nepveu A. Role of the multifunctional CDP/Cut/Cux homeodomain transcription factor in regulating differentiation, cell growth and development. Gene. 2001;270:1-15 89
11. Sansregret L, Nepveu A. The multiple roles of CUX1: insights from mouse models and cell-based assays. Gene. 2008;412:84-94
12. Nirodi C, Hart J, Dhawan P, et al. The role of CDP in the negative regulation of
CXCL1 gene expression. The Journal of biological chemistry. 2001;276:26122-26131
13. Ueda Y, Su Y, Richmond A. CCAAT displacement protein regulates nuclear factor- kappa beta-mediated chemokine transcription in melanoma cells. Melanoma research.
2007;17:91-103
14. Jing H, Yen JH, Ganea D. A novel signaling pathway mediates the inhibition of
CCL3/4 expression by prostaglandin E2. The Journal of biological chemistry.
2004;279:55176-55186
15. Khanna-Gupta A, Zibello T, Kolla S, et al. CCAAT displacement protein (CDP/cut) recognizes a silencer element within the lactoferrin gene promoter. Blood. 1997;90:2784-
2795
16. Luo W, Skalnik DG. CCAAT displacement protein competes with multiple transcriptional activators for binding to four sites in the proximal gp91phox promoter. The
Journal of biological chemistry. 1996;271:18203-18210
17. Lawson ND, Khanna-Gupta A, Berliner N. Isolation and characterization of the cDNA for mouse neutrophil collagenase: demonstration of shared negative regulatory pathways for neutrophil secondary granule protein gene expression. Blood. 1998;91:2517-
2524
18. Goulet B, Markovic Y, Leduy L, et al. Proteolytic processing of cut homeobox 1 by neutrophil elastase in the MV4;11 myeloid leukemia cell line. Mol Cancer Res. 2008;6:644-
653 90
19. Sinclair AM, Lee JA, Goldstein A, et al. Lymphoid apoptosis and myeloid hyperplasia in CCAAT displacement protein mutant mice. Blood. 2001;98:3658-3667
20. Michl P, Ramjaun AR, Pardo OE, et al. CUTL1 is a target of TGF(beta) signaling that enhances cancer cell motility and invasiveness. Cancer Cell. 2005;7:521-532
21. Wilson BJ, Harada R, LeDuy L, et al. CUX1 transcription factor is a downstream effector of the proteinase-activated receptor 2 (PAR2). J Biol Chem. 2009;284:36-45
22. Fang R, Olds LC, Sibley E. Spatio-temporal patterns of intestine-specific transcription factor expression during postnatal mouse gut development. Gene Expr Patterns.
2006;6:426-432
23. Boudreau F, Rings EH, Swain GP, et al. A novel colonic repressor element regulates intestinal gene expression by interacting with Cux/CDP. Mol Cell Biol. 2002;22:5467-5478
24. Babeu JP, Darsigny M, Lussier CR, et al. Hepatocyte nuclear factor 4alpha contributes to an intestinal epithelial phenotype in vitro and plays a partial role in mouse intestinal epithelium differentiation. Am J Physiol Gastrointest Liver Physiol.
2009;297:G124-134
25. Okayasu I, Hatakeyama S, Yamada M, et al. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology.
1990;98:694-702
26. Boudreau F, Rings EH, van Wering HM, et al. Hepatocyte nuclear factor-1 alpha,
GATA-4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription. Implication for the developmental regulation of the sucrase- isomaltase gene. The Journal of biological chemistry. 2002;277:31909-31917 91
27. Perreault N, Herring-Gillam FE, Desloges N, et al. Epithelial vs mesenchymal contribution to the extracellular matrix in the human intestine. Biochem Biophys Res
Commun. 1998;248:121-126
28. Cooper HS, Murthy SN, Shah RS, et al. Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Lab Invest. 1993;69:238-249
29. Dieleman LA, Elson CO, Tennyson GS, et al. Kinetics of cytokine expression during healing of acute colitis in mice. Am J Physiol. 1996;271:G130-136
30. Lee CS, Perreault N, Brestelli JE, et al. Neurogenin 3 is essential for the proper specification of gastric enteroendocrine cells and the maintenance of gastric epithelial cell identity. Genes Dev. 2002;16:1488-1497
31. Rasband WS. Bethesda, Maryland, USA: U. S. National Institutes of Health; 1997-
2009
32. Dignass AU, Podolsky DK. Cytokine modulation of intestinal epithelial cell restitution: central role of transforming growth factor beta. Gastroenterology.
1993;105:1323-1332
33. McGee DW, Bamberg T, Vitkus SJ, et al. A synergistic relationship between TNF- alpha, IL-1 beta, and TGF-beta 1 on IL-6 secretion by the IEC-6 intestinal epithelial cell line.
Immunology. 1995;86:6-11
34. Mailly F, Berube G, Harada R, et al. The human cut homeodomain protein can repress gene expression by two distinct mechanisms: active repression and competition for binding site occupancy. Mol Cell Biol. 1996;16:5346-5357
35. Li S, Moy L, Pittman N, et al. Transcriptional repression of the cystic fibrosis transmembrane conductance regulator gene, mediated by CCAAT displacement protein/cut 92 homolog, is associated with histone deacetylation. The Journal of biological chemistry.
1999;274:7803-7815
36. Theodossi A, Spiegelhalter DJ, Jass J, et al. Observer variation and discriminatory value of biopsy features in inflammatory bowel disease. Gut. 1994;35:961-968
37. Li Q, Verma IM. NF-kappaB regulation in the immune system. Nat Rev Immunol.
2002;2:725-734
38. Richmond A. Nf-kappa B, chemokine gene transcription and tumour growth. Nat Rev
Immunol. 2002;2:664-674
39. Dovi JV, He LK, DiPietro LA. Accelerated wound closure in neutrophil-depleted mice. J Leukoc Biol. 2003;73:448-455
40. Buanne P, Di Carlo E, Caputi L, et al. Crucial pathophysiological role of CXCR2 in experimental ulcerative colitis in mice. J Leukoc Biol. 2007;82:1239-1246
41. Kedinger V, Sansregret L, Harada R, et al. pi 10 CUX1 homeodomain protein stimulates cell migration and invasion in part through a regulatory cascade culminating in the repression of E-cadherin and occludin. The Journal of biological chemistry. 2009;284:27701-
27711
42. Brivanlou AH, Darnell JE, Jr. Signal transduction and the control of gene expression.
Science. 2002;295:813-818
43. Coqueret O, Berube G, Nepveu A. The mammalian Cut homeodomain protein functions as a cell-cycle-dependent transcriptional repressor which downmodulates p21WAFl/CIPl/SDIl in S phase. Embo J. 1998;17:4680-4694
44. Papadakis KA, Targan SR. Role of cytokines in the pathogenesis of inflammatory bowel disease. Annu Rev Med. 2000;51:289-298 93
45. Egger B, Bajaj-Elliott M, MacDonald TT, et al. Characterisation of acute murine dextran sodium sulphate colitis: cytokine profile and dose dependency. Digestion.
2000;62:240-248
46. Dieleman LA, Ridwan BU, Tennyson GS, et al. Dextran sulfate sodium-induced colitis occurs in severe combined immunodeficient mice. Gastroenterology. 1994; 107:1643-
1652
47. Collart MA, Baeuerle P, Vassalli P. Regulation of tumor necrosis factor alpha transcription in macrophages: involvement of four kappa B-like motifs and of constitutive and inducible forms of NF-kappa B. Mol Cell Biol. 1990;10:1498-1506
48. Drouet C, Shakhov AN, Jongeneel CV. Enhancers and transcription factors controlling the inducibility of the tumor necrosis factor-alpha promoter in primary macrophages. J Immunol. 1991;147:1694-1700
49. Sica A, Tan TH, Rice N, et al. The c-rel protooncogene product c-Rel but not NF- kappa B binds to the intronic region of the human interferon-gamma gene at a site related to an interferon-stimulable response element. Proc Natl Acad Sci USA. 1992;89:1740-1744
50. Anisowicz A, Messineo M, Lee SW, et al. An NF-kappa B-like transcription factor mediates IL-1/TNF-alpha induction of gro in human fibroblasts. J Immunol. 1991;147:520-
527
51. Morteau O, Morham SG, Sellon R, et al. Impaired mucosal defense to acute colonic injury in mice lacking cyclooxygenase-1 or cyclooxygenase-2. J Clin Invest. 2000;105:469-
478
52. Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, et al. Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell. 2004; 118:229-
241 94
53. Quails JE, Kaplan AM, van Rooijen N, et al. Suppression of experimental colitis by intestinal mononuclear phagocytes. J Leukoc Biol. 2006
54. Clevers H. At the crossroads of inflammation and cancer. Cell. 2004; 118:671-674
55. Sarkar FH, Li Y, Wang Z, et al. NF-kappaB signaling pathway and its therapeutic implications in human diseases. International reviews of immunology. 2008;27:293-319
56. Wu GD. Nuclear hormone receptors and intestinal inflammation. Gastroenterology.
2007;133:1068 MANUSCRIT 2
HEPATOCYTE NUCLEAR FACTOR 4a CONTRIBUTES TO AN INTESTINAL
EPITHELIAL PHENOTYPE IN VITRO AND PLAYS A PARTIAL ROLE IN
MOUSE INTESTINAL EPITHELIUM DIFFERENTIATION
BABEU, J. P., DARSIGNY, M., LUSSIER, C.R. ET BOUDREAU, F.
2009
AM J PHYSIOL GASTROINTEST LIVER PHYSIOL, 297(1): G124-34. 96
2.1 Auteurs et affiliations
Jean-Philippe Babeu1, Mathieu Darsigny1, Carine R. Lussier1 and Fran9ois Boudreau1
'Departement d'Anatomie et Biologie Cellulaire, Faculte de Medecine et des Sciences de la
Sante, Universite de Sherbrooke, Sherbrooke, Quebec, Canada, J1H 5N4.
2.2 Contributions
Jean-Philippe Babeu Jean-Philippe a realise toutes les experiences cellulaires et une bonne partie des experiences animales. Jean-Philippe a participe a la revision du manuscrit.
Mathieu Darsigny Mathieu a realise les croisements et analyses des embryons, les immunohistochimies et les PCR quantitatifs. Mathieu a participe a la revision du manuscrit.
Carine R. Lussier Carine a verifie l'expression de l'allele Hnf4a chez les animaux de bas age.
Francois Boudreau Francois est I'investigateur principal sur ce manuscrit. II a prepare toutes les figures et ecrit, soumis et revise le manuscrit. 97
2.3 Resume
Historique
Le facteur nucleaire hepatocytaire-4oc (HNF4a) est un regulateur transcriptionnel de la transcription pancreatique et hepatocytaire. La deletion du gene Hnf4a est lethale au developpement embryonnaire chez la souris avec de graves defauts dans la formation de l'endoderme visceral. II a ete conclu par le passe que le role d'Hnf4a dans le developpement embryonnaire du colon est beaucoup moins predominant que dans le foie. Toutefois, le role precis d' HNF4a dans l'homeostasie de repithelium de l'intestin grele reste incertain. Notre but etait d'evaluer le potentiel d'Hnf4a pour soutenir la differenciation de l'epithelium intestinal.
Methodes et resultats
Tout d'abord, le potentiel porte par Hnf4a de dieter ce phenotype epithelial intestinal a ete evalue dans une lignee non-intestinale in vitro. L'expression forcee d'Hnf4a dans les fibroblastes a montre une induction de caracteristiques normalement reservees a l'epithelium intestinal. L'expression combinee d'Hnf4a avec d'autres regulateurs specifiques de l'intestin a conduit a 1'induction de genes epitheliaux intestinaux. Deuxiemement, l'importance d'Hnf4a au maintien de l'homeostasie de l'epithelium intestinal a ete etudiee chez la souris.
Des souris conditionnellement deficientes pour l'expression epithelial e intestinale d'Hnf4a se sont developpees normalement jusqu'a atteindre l'age adulte avec un epithelium dont la morphologie et la fonction subbissent une alteration mineure. Des differences legeres, mais statistiques, ont ete observees dans la proliferation et dans les niveaux de cytodifferenciation.
Les souris mutantes pour Hnf4a ont montre une augmentation du nombre de cellules caliciformes et enteroendocrines par rapport aux souris controles. 98
Conclusion
Compte tenu du role fondamental de ce facteur de transcription dans les autres tissus, ces resultats contestent le role crucial de ce regulateur dans le maintien de l'epithelium intestinal et de sa fonction lors d'une invalidation qui s'opere apres le debut de la cytodifferenciation.
Ces resultats suggerent tout de meme un role dans 1'instruction du devenir epithelial intestinal.
Mots cles
Differenciation; epithelium de l'intestin grele; modele murin d'invalidation conditionnelle
2.4 Abstract
Hepatocyte nuclear factor 4a (HNF4a) is a regulator of hepatocyte and pancreatic transcription. Hnf4a deletion in the mouse is embryonically lethal with severe defects in visceral endoderm formation. It has been concluded in the past that the role of Hnf4a in the developing colon was much less important than in the liver. However, the precise role of
Hnf4a in the homeostasis of the small intestinal epithelium remains unclear. Our aim was to evaluate the potential of Hnf4a to support an intestinal epithelial phenotype. First, Hnf4a potential to dictate this phenotype was assessed in non-intestinal cell lines in vitro. Forced expression of Hnf4a in fibroblasts showed an induction of features normally restricted to epithelial cells. Combinatory expression of Hnf4a with specific transcriptional regulators of the intestine resulted in the induction of intestinal epithelial genes in this context. Second, the importance of Hnf4a in maintaining the homeostasis of the intestinal epithelium was investigated in mice. Mice conditionally deficient for intestinal Hnf4oc developed normally throughout adulthood with an epithelium displaying normal morphological and functional structures with minor alterations. Subtle but statistical differences were observed at the 99 proliferation and the cytodifferentiation levels. Hnf4a mutant mice displayed an increase in the number of goblet and enteroendocrine cells as compared to controls. Given the fundamental role of this transcription factor in other tissues, these findings dispute the crucial role for this regulator in the maintenance of intestinal epithelial cell function at a period of time that follows cytodifferentiation but may suggest a functional role in instructing cells to become specific to the intestinal epithelium. Keywords: Hnf4a, differentiation, small intestinal epithelium, conditional mouse KO
2.5 Introduction
Establishment of the functional adult intestinal epithelium is the result of several steps beginning with the gross morphogenesis of the digestive tract, followed by cytodifferentiation of the epithelium and induction of intestine-specific genes (32). The intestinal epithelium is composed of enterocytes, enteroendocrine cells, Paneth cells and goblet cells organized in a compartmentalized architecture, with cellular proliferation limited to the crypt region and terminally differentiated cells present on the villi (39). The integrity of the intestinal epithelium is accomplished by a dynamic system of renewal dependent on the equilibrium between cellular proliferation, differentiation and apoptosis that is maintained throughout life. During their lifespan, differentiated epithelial cells ensure important functions related to barrier protection (25), nutrient absorption and transport (42) as well as lipid metabolism (29, 42). Differential molecular mechanisms along both the vertical and horizontal axes of the intestine account for the tight control of these intestinal epithelial cell functions. However, the precise coordinated action of the transcriptional regulators responsible for maintaining intestine specific gene networks still remains to be determined. 100
Hepatocyte nuclear factor 4a (HNF4a) is a member of the nuclear receptor family
of transcription factors and is expressed primarily in the liver, gut, kidney and pancreas (13,
52). HNF4a can activate gene transcription in the absence of exogenous ligands (44, 45)
although fatty acyl-CoA thioesters exhibit a potential to influence its transcriptional activity
(21). Hnf4a deletion is embryonically lethal with defects in visceral endoderm formation
(10). Conditional knockout of Hnf4a in the early liver results in the disorganization of
morphological and functional differentiation in the hepatic epithelium (36). The disruption of
HNF4a later in the adult liver results in impaired lipid metabolism and gluconeogenesis (20).
HNF4a is considered to be a crucial regulator of transcription for several hepatocyte and
pancreatic genes (17) (18). Maturity-onset diabetes of the young (MODY) as well as late-
onset type 2 diabetes metabolic disorders are genetically linked to FTNF4a function (19).
FINF4a function in the intestinal epithelium is poorly documented.
Hnf4a is detected in the differentiated mouse intestinal epithelium (40) and regulates the expression of genes that are up-regulated during epithelial cell differentiation such as
apolipoprotein IV (Apo-AIV) (3) and intestinal alkaline phosphatase (35). FINF4a has been
shown in vitro to interfere with transcriptional regulation of lipid metabolism related genes
such as apolipoprotein Al/CIII (23, 38), apolipoprotein B (2), liver fatty acid binding protein
1 (FABP1) (38), intestinal fatty acid binding protein (24) as well as guanylyl cyclase C (50).
Bioinformatic analyses have suggested that Hnf4a can act as a central regulator of gene
expression during enterocyte differentiation (48). This suggestion has been recently
confirmed in vitro with the demonstration that Hnf4a was able to promote differentiation of
intestinal epithelial cells in culture (30). Hnf4a was shown to be essential for the normal
early development of the colonic epithelium in embryonic conditional mutant mice (15). 101
Although this study identified direct colonic molecular targets of Hnf4a at embryonic day 18.5, the strategy utilized to conditionally delete Hnf4a did not affect its expression in the small intestinal mucosa and resulted in post-natal mouse death probably due to liver and pancreatic insufficiencies (15, 36). Deletion of Hnf4a along the entire intestinal tract was recently achieved with the findings that this loss exacerbates experimental colitis (1).
However, the exact role of Hnf4a in regulating small intestinal epithelium integrity has not been yet carefully analyzed and the current hypothesis is that Hnf4a could play a role in maintaining integrity of adult small intestinal epithelial cell functions.
In order to gain further insights for Hnf4a requirement in exhibiting intestinal epithelial specific functions, two complementary experimental approaches were designed. First, forced expression of Hnf4a was achieved in a non-intestinal epithelial cell context. This resulted in the activation of genes normally detectable in the intestinal epithelium as well as partial morphological changes normally restricted to epithelial cells. Second, Hnf4a was specifically deleted in the small intestine following a Cre-/oxP conditional knockout strategy with the use of a Villin-Cre transgene (31). This resulted in efficient deletion of Hnf4a in post-natal intestinal epithelium with minor consequences on intestinal homeostasis during post-natal life. These results suggest that Hnf4a is potent to instruct cells to express intestinal epithelial features but may be dispensable or compensated in the post-embryonic stages for the maintenance of the small intestinal epithelium integrity. 102
2.6 Materials and methods
Plasmid construction and generation of stable cell lines
The pBabepuro-HNF4a retroviral construct was described previously (30). The MT-
Cdx2 construct that consisted of the murine Cdx2 cDNA subcloned in the pMT-
CB6+/neomycin which contains the promoter of the sheep metallothionin I gene was described elsewhere (49). The MT-GATA-4 construct was generated in two steps. First, the murine GATA-4 cDNA was subcloned in the EcoRI site of the pcDNA3.1/Zeo plasmid
(Invitrogen, CA). The CMV promoter was then released by Nrul and Nhel and replaced by a
943-bp EcoRI blunted fragment of the MT-1 sheep promoter. Stable NIH/3T3 MT-Cdx2 clones were generated with the transfection of MT-Cdx2 using lipofectamine 2000
(Invitrogen, CA). NIH/3T3 cells that had integrated the MT-Cdx2 construct or the MT control vector were selected with G418 and individual resistant clones were further characterized for inducible Cdx2 expression with the addition of 100 uM of ZnS04 (Fisher
Scientific, ON). Some of the most tightly regulated clones were further transfected with the
MT-GATA-4 construct and selected with Zeocin. pBabepuro-HNF4a or pBabepuro (control) and 30 ug of retroviral packaging DNA (pAMPHO) were co-transfected into 293T cells using Lipofectamine 2000 (Invitrogen, CA) in Opti-MEM medium for 4 hours. The medium was then changed to Dulbecco's modified Eagle's medium (DMEM) supplemented with
10% fetal bovine serum, 100 U/ml penicillin, 100 ug/ml streptomycin, 10 mM HEPES buffer and 2 mM L-Glutamine in 5% CO2. The medium containing the retrovirus was collected after 48 hours and kept frozen at -80°C. Human pancreatic carcinoma MIA PaCa-2 and mouse embryonic fibroblast NIH/3T3 cell lines were obtained from the American Type
Culture Collection (ATTC, VA) (catalog no. CRL-1658 and CRL-1420, respectively) and maintained as described above. The human adenocarcinoma Caco-2/15 cell line (5) was 103 obtained from Dr. Jean-Francois Beaulieu (Universite de Sherbrooke, QC). MIA PaCa-2,
NIH/3T3 and NIH/3T3 MT-Cdx2 and MT-GATA-4 cell lines were incubated in 35 mm Petri dishes at 50% confluence with 700 ul of HNF4a or control retrovirus for 48 hours. Cells were then redistributed to 100 mm dishes for puromycin selection (5ug/ml) for 1 week.
Selected cells were kept at confluence for 8 to 10 days before RNA and protein isolation and electron microscopy procedures. For coculture experiments, selected cells were plated on human primary mesenchymal cells exactly as described previously (30).
Animals
12.4KbVilCre transgenic mice (31) were bred with homozygous Hnf4atmlGonz (Jackson
Laboratory, Cat#004665) (20) mice to obtain \2AYlbN\\CxdHnf4a!oxP/+. These mice were then mated with homozygous Hnf4atmIGonz mice to obtain \2AKbVi\Cre/Hnf4aloxP-loxP mutant mice. Tail DNA isolation was performed with the Spin Doctor Genomic DNA isolation kit
(Gerard Biotech, OH). PCR genotyping of the Hnf4atmlGonz allele was performed as previously described (20). Mice were treated in accordance with a protocol approved by the
Institutional Animal Research Review Committee of the Universite de Sherbrooke in conformity with the Canadian Council on Animal Care (CCAC). Mice were anesthetised with ketamine/xylazine (300mg/kg; 40mg/kg) before sacrifice. For proliferation assays, mice were injected intraperitoneally with 10 ml/kg of BrdU labelling reagent (Zymed
Laboratories, CA) one hour before sacrifice.
Western blot analysis
Total protein extracts were harvested from cultured cells as described previously (9).
Mice were sacrificed and the intestine separated in sections of proximal jejunum, distal 104 jejunum, ileum and colon. The intestine was opened longitudinally and rinsed in cold
PBS. The tissues were then homogenized in a buffer containing protease inhibitors, centrifuged, and the protein collected was quantified by spectrophotometry using the Bio-
Rad Protein assay (Bio-Rad Laboratories, Hercules, CA). 40 |j.g of total protein was analyzed by 4%-12% Bis-Tris NuPAGE (Invitrogen, CA) electrophoresis and transferred to a PVDF membrane (Roche Applied Sciences, QC). The membrane was blocked overnight in 5% nonfat dry milk in PBS-Tween 0.1%. The following antibodies from Santa Cruz
Biotechnology (Santa Cruz, CA) were used: affinity purified polyclonal goat anti-HNF4a antibody (sc-6556), anti-GATA-4 antibody (sc-1237) and anti-actin antibody (sc-1615). A rabbit polyclonal antibody raised against CDX2/3 was kindly provided by Dr. Rivard
(CDX2/3-NR). Secondary anti-goat or anti-rabbit antibodies coupled to horseradish peroxidase were used with the ECL-Plus western blotting kit (GE Healthcare Bio-Sciences
Corp., NJ) to reveal the signals.
RNA isolation and RT-PCR
Total RNA from tissue or cultured cell samples was isolated using the Totally RNA kit
(Ambion, TX). 1 p.g of total RNA was used for reverse-transcriptase (RT) mediated synthesis of cDNA using 20 U of RT AMV (Roche Applied Sciences, QC) in a 20 ul reaction. Typical semi-quantitative PCR was performed using lul of RT reaction, 0.6 U of
Taq DNA polymerase (New England Biolabs, ON), 0.2 mM dNTPs and 30 ng of each specific primer. Primers used for cDNA amplification of either human or mouse HNF4a,
ApoA-IV, Villin, p2-microglobulin, TFF3, Fabp2, ApoAI, Muc2 and HPRT transcripts are available upon request. Quantitative RT-PCR (qRT-PCR) was performed using a
LightCycler apparatus V2.0 (Roche Diagnostics, QC). Experiments were run and analyzed 105
with the LightCycler software 4.0 according to manufacturer's recommendations (Roche
Diagnostics, QC). Synthesis of double stranded DNA during PCR was monitored using
SYBR Green I accordingly to the manufacturer's recommendations (QuantiTect SYBR
Green PCR Kit; Qiagen, ON). Target expression was quantified relative to hypoxanthine-
guanine phosphoribosyl transferase (HPRT) expression. For this purpose, a standard
calibration curve was prepared for each gene using serial dilutions of the calibrator sample
and crossing point values were plotted versus the log of the relative concentration of each
dilution. This standard curve was used to correct for differences in efficiencies of the PCR reactions.
Immunofluorescence and Immunohistochemistry
Tissues were fixed in 4% paraformaldehyde and embedded in paraffin as previously
described (8). 5 uM slide sections were re-hydrated in a graded ethanol series (xylene, 100%,
95%, 80%, 70%) and boiled for 6 min in 5 mM citric acid for antigen retrieval. After blocking with BSA 2% in PBS/Triton 0.2% during 30 min, sections were incubated 2 hours at room temperature with affinity-purified antibodies as follows: goat anti-HNF4ot (sc-6556;
Santa Cruz, CA); 1:150, mouse anti-bromodeoxyuridine (Roche Applied Science, QC);
1:200, rabbit Chromogranin A (20085; Immunostar, WI); 1:1000, rabbit Lysozyme (A0099;
Dako, CA); prediluted and rabbit Ki67 (RM9106-R7; Thermo Scientific, CA); prediluted and further diluted 1:2. Primary antibodies were visualized with a fluorescein-coupled secondary antibody (Vector Laboratories, CA) incubated at 37°C for 45 min (anti-HNF4a and anti- bromodeoxyuridine) or with the DakoCytomation EnVision+System-HRP (DAB) incubated at RT for 30 min. The samples were mounted with Vectashield Hard Set mounting medium 106 with DAPI (Vector Laboratories, CA) and observed with a Leica DM LB2 (Leica
Microsystem Canada, ON) fluorescence microscope.
Electron microscopy
Cell cultures were prepared exactly as reported before (7). Thin sections were prepared using an ultramicrotome, contrasted with lead citrate and uranyl acetate, and observed on a
Jeol 100 CX transmission electron microscope. All reagents were purchased from Electron
Microscopy Sciences (Cedarlane, Hornby, Ontario).
Quantification and Statistical Analysis
All counts were performed in a blind manner on an average of 10 independent fields
(200X magnification) per animal. Villus, crypt and submucosae morphometry was determined using the MetaMorph software (Universal Imaging Corporation, CA). Data were expressed as mean ± SEM. Statistical analysis was performed using the two-sample
Student's t test. Differences were considered significant with ap value of <0.05. 107
2.7 Results
Forced-expression of HNF4a induces intestinal epithelial gene expression and morphogenesis in non-intestinal cultured cells
FTNF4a has been suggested to act as an important regulator of intestinal epithelial gene transcription and to induce intestinal epithelial cell differentiation in culture (3, 30, 40, 48).
Moreover, Hnf4a is able to partially instruct cultured fibroblasts to express adhesion molecules normally restricted to epithelial cells (36). To measure whether this transcription factor is capable of initiating intestinal epithelial gene expression, an in vitro strategy was designed to ectopically express Hnf4a in a non-intestinal epithelial context. NIH/3T3 (mouse embryonic fibroblasts) and MIA PaCa-2 (human pancreatic adenocarcinoma) cell populations were generated with the stable introduction of retroviral Hnf4a or empty constructs. A Western blot confirmed that expression of Hnf4a protein was sustained in populations of cells that had stably integrated the Hnf4a construct (Fig. 1A). RT-PCR analyses were then performed to monitor the expression of some intestinal epithelial genes in the population of cells expressing or not expressing Hnf4a. Both ApoA-IV and Villin genes were induced in the cell lines positive for Hnf4a expression (Fig. IB). The expression of intestinal epithelial restricted gene transcripts including sucrase-isomaltase (SI), lactase- phlorizin hydrolase (LPH) or intestinal fatty acid binding protein (Fabp2) was not detected under these conditions (data not illustrated). Because intestinal epithelial genes are regulated with the combinatory action of several transcription factors including Cdx2 and GATA-4 (9,
14, 53), fibroblastic cell lines were next engineered with the conditional expression of both
Cdx2 and GATA-4 under the control of the zinc-inducible metallothionein promoter (see
MATERIALS AND METHODS). The induction of Cdx2 and GATA-4 protein level was observed in two independent fibroblastic cell lines but not in a control fibroblastic cell line 108 that had integrated both MT-neomycin and MT-zeocin empty vectors (Fig. IC). Stable introduction of Hnf4a in these cell lines did not endogenously induce the expression of Cdx2 and GATA-4 nor influenced the zinc-responsiveness of the genome-integrated constructs
(Fig. IC) but reproducibly affected cellular proliferation to result in a complete growth arrest following few passages in culture (data not illustrated). RT-PCR was next performed to monitor the expression of several gene transcripts normally detectable in intestinal epithelial cells. Fibroblastic cell lines that did not express Hnf4a or induced levels of Cdx2 and
GATA-4 were negative for all the gene transcripts tested except for Hprt that was used as a control for RNA integrity (Fig. ID, lane 3). The induction of Cdx2 and GATA-4 in this context did not change the pattern of gene transcript expression that was observed without induction (Fig. ID, lane 4). Trefoil factor 3 (Tff3), ApoA-IV, and villin gene transcripts became detectable when Hnf4a alone was expressed in these cell lines (Fig. ID, lane 5). The combination of HNF4a, Cdx2 and GATA-4 expression in the fibroblastic cell lines resulted in a specific and reproducible induction of the Fabp2 gene transcript that is normally solely expressed in the intestinal epithelium (Fig. ID, lane 6). Other intestinal epithelial specific gene transcripts such as mucin 2 (Muc2) or SI were not detectable under these conditions.
These observations suggested that Hnf4a was able to initiate an intestinal epithelial gene network in a non-intestinal cellular context. FIGURE 1 | Forced expression of HNF4a induces intestinal epithelial gene expression in cultured non- intestinal cells. (A) Stable cell lines were established with retroviral introduction of pBabepuro-HNF4a (HNF4a) or empty pBabepuro (pbabe). Total extracts prepared from NIH/3T3 and MIA PaCa stable cell populations were analyzed by Western blot with the use of an HNF4a polyclonal antibody. The blots were stripped and incubated with an actin polyclonal antibody to monitor for protein integrity. (B) Total RNA was isolated and RT-PCR was performed with specific oligonucleotides for ApoA-IV and Villin mRNA. The P2-microglobulin (P2mic) mRNA level was monitored to control for equal input of cDNAs in each reaction. (C) Stable NIH-3T3 cell lines were sstab'ished with zirx tndaeible MT~Cdx2 and MT-GATA-4 or MT-empty vectors. These stable cell lines were further infected with retroviral pBabepuro-HNF4a (lanes 2 and 4) or empty pBabepuro (lanes 1 and 3). These cell lines were supplemented (lanes 3 and 4) or not (lanes 1 and 2) with 100 uM of ZnS04. Total extracts were prepared and analyzed by Western blot with the use of HNF4a, Cdx2, GATA-4 and actin polyclonal antibodies.
(D) Total RNA and protein was isolated from stable NIH-3T3 MT-Cdx2 and MT-GATA-4 cells that were infected with retroviral pBabepuro-HNF4a (lanes 5 and 6) or empty pBabepuro (lanes 3 and 4) and supplemented (lanes 4 and 6) or not (lanes 3 and 5) with 100 uM of ZnS04. RT-PCR was performed with specific oligonucleotides for various intestinal epithelial gene transcript targets. Positive control (mouse intestinal cDNA; lane 1) and negative control (no cDNA; lane 2) were included in each RT-PCR. Western blot were done as described in C. 110
A B
FIGURE 2 | Forced expression of Hnf4a induces morphological features of intestinal epithelial cells.
Electron microscopy was performed on NIH-3T3 fibroblastic clones that were cocultured on mesenchymal
cells. Morphological characteristics are displayed for MT-empty NIH-3T3 cells supplemented with 100 uM
of ZnS04 (A), MT-Cdx2/MT-GATA-4 NIH-3T3 cells infected with empty pBabepuro (B), MT-empty NIH-
3T3 cells infected with pBabepuro-HNF4a (C), MT-Cdx2/MT-GATA-4 NIH-3T3 cells supplemented with
100 uM of ZnS04 (D) and MT-Cdx2/MT-GATA-4 NIH-3T3 cells infected with pBabepuro-HNF4a and
supplemented with 100 uM of ZnS04 (E, F, G). Arrows in C, D and F are indicating the presence of
microvilli. Arrows in G are indicating the presence of junctional complexes.
The morphological aspect of these cell lines was next assessed by electron microscopy.
The sustained expression of Cdx2, GATA-4 and Hnf4a in fibroblastic cell lines resulted in minor consequences on the overall cellular morphology (data not illustrated). Because intestinal epithelial cells can be induced to polarize and differentiate under specific co- culture conditions (30), these fibroblastic cell lines were then directly deposited on freshly isolated mesenchymal cells. Cell lines that were not induced to express Cdx2, GATA-4 or
Hnf4a presented a typical fibroblastic cell shape under these conditions (Fig. 2A-B).
Introduction of Hnf4a alone led to changes in cell shape, apical microvillus formation and appearance of dense ultrastructures (Fig. 2C). The induction of Cdx2 and GATA-4 led to Ill similar changes under these culture conditions (Fig. 2D). When Cdx2, GATA-4 and
Hnf4a were simultaneously expressed, some fibroblastic cells appeared more polarized with rounded shaped nucleus (Fig. 2E-F) and the formation of junctional complexes (Fig. 2G).
This phenomenon was heterogeneous and not observed for each individual cell of the populations. Overall, these observations suggested that Hnf4a was potent to participate in the initiation of an intestinal epithelial phenotype.
Generation of an efficient conditional mouse model for Hnf4a disruption in the intestinal epithelium
The suggestion that Hnf4a is a regulator of intestinal epithelial genes prompted us to investigate its function in the in vivo context. A mouse breeding strategy was undertaken to generate an Hnf4a intestinal epithelial conditional knockout with the use of previously characterized Hnf4a floxed allele mice (20) in combination with the Villin-Cre transgenic mice that express Cre exclusively in the intestinal epithelium (31). Mice hemizygous for both
Hnf4t\oxed and the Villin-Cre transgene were bred with Hnf4ct/7/-/? to produce mutant Hnf4a
(ViUinCKE+; Hnf4a/7/y7) and three groups of control mice (Hnf4o/7/-/7, VilIinCKE+; Hnf4(//+ and Hnf4a+/+) according to a statistical Mendelian fashion. Mice with a genotype of HnPlct^ were further referred to as control, VillinCRE+; Hnf4(//+ as heterozygous and VillinCKE+;
Hnf4ct/7/-/7 as mutant mice. A quantitative RT-PCR analysis was next performed to monitor the efficiency of Cre dependant recombination of the floxed Hnf4a alleles. Since the conditional removal of Hnf4a exons 4 and 5 could result in the production of a functional mRNA, a strategy was also deployed to evaluate whether these mice could produce significant amount of Hnf4a mRNA that 112
FIGURE 3 I Prodtacttionn off fatesiMral Wmf4a comidMnomal mill nuke. (A-B)Total RNA was isolated and q R.T PCR perfomied with spec*/ c oligonucleotides for the detection of the exon 3 region of Haf4a
(A) and the 5' region of Hnf4a rniRNA (B). (C) Total extracts prepared from the jejunum were analyzed by Western blot with the use of an HNF4a polyclonal antibody. The blots were stripped and incubated with an actio polyclonal antibody to monitor for protein integrity (D-l) Immunofluorescence was peitormed to detect HNF4a on sections from control (D) and mutant (F) embryos al post-coitus day
13 5 Close-up of intestinal cross-sections from control embryos (E) or mutant embryos (G) are displayed Sections from the jejunum at postnatal days 1 of control (H) and mutant (I) were also used.
The nuclear green labelling indicates the presence of HNF4a signal Original magnifications, 400X (E,
G, H. 1) and 40X (D, F) 113 would be able to be translated in a functional truncated Hnf4a protein. qRT-PCR analysis of the recombined Hnf4a mRNA with primers designed to specifically amplify a portion of exons 4 and 5 restricted between the two lox? recombination sites confirmed that Cre- dependent recombination was efficient at more than 95% at all times during adulthood (Fig.
3 A). The quantification of a non-recombined portion of the Hnf4a gene transcript (exons 1 and 2) indicated a reduction of 80% of produced transcript in mutant mice as compared to controls suggesting either a decrease in stability of the produced truncated transcript or an impairment of Hnf4a gene transcription following the Cre recombination event (Fig. 3B). A western blot confirmed that production of the Hnf4a protein was impaired in the jejunum of mutant mice as compared to control mice (Fig. 3C). Indirect immunofluorescence studies were next undertaken to evaluate the expression status of Hnf4a in the intestinal epithelium of mutant mice. At embryonic day 13.5, a period that coincides with the onset of intestinal cytodifferentiation, Hnf4a was detected in the nucleus of both mutant and control intestinal epithelial cells (Fig 3D-G). At post-natal day 1, Hnf4a was undetectable in mutants as compared to controls (Fig. 4H-I), a phenomenon that remained constant even at one year of adult age (data not shown). On very rare occasions, crypt-to-villus regions were partially positive for Hnf4a suggesting that Hnf4afloxed alleles rarely escaped Cre recombinase activity (data not shown). Overall, these observations confirmed that Hnf4a was deleted with high efficiency during post-natal and adult life in F/7/mCre+;Hnf4ct/7/"/7 mice. 114
Hnf4a conditional deletion results in modest consequences on cellular proliferation and differentiation as well as overall architecture of the intestinal epithelium
We first monitored the weight of a cohort of control and Hnf4a mutant mice during post- natal development. We found no statistical difference in the weight of control and mutant mice starting 1 week after birth until 12 weeks of post-natal life (Fig. 4A). Intestinal morphology was next carefully compared among tissue sections prepared from control and mutant mice at different periods of time during post-natal development until one year of adult age. A modest but significant 4% decrease of jejunum villi length was observed in
Hnf4a mutant mice (n = 4 mice, 124 villi) as compared to control mice (n = 4 mice, 119 villi) (Fig. 4B). Consequently, jejunum crypts length was significantly increased by 8.8% in
Hnf4a mutant mice (n = 4 mice, 123 crypts) as compared to control mice (n = 4 mice, 108 crypts) (Fig. 4C). The thickness of the submucosae was also increased by 9% (p = 0.004) in
Hnf4a mutant mice (n = 4 mice, 93 regions) as compared to control mice (n = 4 mice, 83 regions) (Fig. 4D). Electron microscopy analyses confirmed the similarities in epithelial cell maturation with the presence of a well formed terminal web and abundance of microvilli at the cell apical surface in both control and mutant mice (Fig. 4E). A minor but significant increase of the index of epithelial cell proliferation (1.25 fold, p<0.0002; Fig. 4F) was observed in the jejunum of mutant mice as determined by BrdU incorporation (Fig. 4G).
However, this weak tendency did not impact on the number of Ki67 positive cells in Hnf4a mutant mice (12.22 ± 0.32 cells per crypt, n = 4 mice, 58 crypts) as compared to control mice
(12.49 ± 0.56 cells per crypt, n = 4 mice, 41 crypts). 115
1 2 3 6 12
Age (weeks)
CoatroU Mutants
FIGURE 4 | Hnf4a conditional mutant mice display minor modifications in their intestine mucosal structure. (A) Control (white bars) and mutant (black bars) mice were weighted between 1 and 12 weeks after birth (n= 4-6 mice per groups). The length of villi (B), crypts (C) and submucosae
(D) was determined using H&E-stained micrographs of jejunum and MetaMorph software. (E) Electron microscopy showed similar ultrastructures between control and mutant mice. (F) Animals were injected with BrdU 1 h prior to sacrifice to label only cells in S-phase. The number of positive cells was cumulated from 3 different mice of each genotype for a total of 45-50 crypts per genotype. The index of proliferation was expressed as the number of BrdU positive cells per crypt. (G) Example of an immunofluorescence for BrdU performed on sections of jejunum of both control and Hnf4a null mice.
DAPI staining (in blue) highlights cell nuclei of intestinal cell populations. Original magnifications,
40X. 116
The number of Paneth cells was next compared between Hnf4a mutant and control mice. Although lysozyme staining of the Paneth cells was consistently reduced in Hnf4a mutant crypts, no significant change was observed in the number of this population of cells
(Fig. 5A). The number of chromogranin A positive enteroendocrine cells was significantly increased by 29% in the jejunum of Hnf4a mutant mice (n = 4 mice, 207 villi) as compared to control mice (n = 4, 184 villi) (Fig. 5B). Goblet cells were significantly increased by 65% in the crypts of Hnf4a mutant mice (n = 4 mice, 134 crypts) as compared to control mice (n
= 4, 133 crypts) and by 48% in the villi of Hnf4a mutant mice (n = 4 mice, 157 villi) as compared to control mice (n = 4,136 villi) (Fig. 5C).
Since our in vitro observations supported that Hnf4a could represent an important regulator of intestinal gene expression, we next looked for modifications in the expression of classical markers for intestinal epithelial cell differentiation in these mice. Surprisingly, qRT-
PCR analyses failed to detect any significant reduction of Apo-AIV mRNA levels in the jejunum of mutant mice as compared to control mice (Fig. 6A). The expression of several other intestinal epithelial gene transcripts was further assessed. The specific goblet cell markers Muc2 and Tff3 were not significantly affected at the gene transcript level in adult mutant mice (Fig. 6B). SI enterocyte specific marker was decreased only by 25% (p<0.05) at the gene transcript level in the mutant mice (Fig. 6D). Lysozyme, a specific marker for
Paneth cells, was reduced more than 2 fold (p<0.05) at the mRNA level (Fig. 6B), consistent with the reduction of lysozyme staining as depicted in Fig. 5A. Fabpl, an important component in lipid metabolism, was reduced more than 5 117
control mutant B control mutant *m x ^ ^> f^ % %^r* 11! i
Lys>ozyme Chromogranin A J(K *>=>ese2
Control* Mutant* Contrci* Mutant*
control mutant 1 » . < Gobkt cells
* -i .•: .« 10- Crypt* Villi 1' f-ikWH | -—fr. •• * 1 as i * 0- 1 r1 'I -si *-* comrot * 9MU M i c«rtw(» Mutant*
FIGliRE 5 | Hnf4a conditional mutant mice display changes in secretory cell fate.
Immunohistochemistry was performed to detect lysozyme (A) and chromogranin A (B) on sections
from the lejunum among control and mutant adult mice PAS staining was pei formed to detect goblet
cells (C) Original magnifications, 200X fold (p<0.05) at the transcript level in the jejunum of mutant mice whereas Fabp2 was not significantly modulated in the mutant mice (Fig. 6D). The expression of miciosomal tiiglyceride transfer protein (Mttp). a crucial regulator of lipid transport also reported to be 118 regulated by Hnf4 A Apohpoorotoin A-l JL. 1 I sttoT-tb 3 Twmtiis B Gene controls mutants Fabpl I.DO -A-0.28 0.20 +•- 0.02 * 57 I 00 r;- 0,06 0.76 H- 0.05 * \fuc2 1.00 i '.- 0 29 0 95 \<-UM TffB 1.00 «-/- 0.04 i.01 -'.o.Ot> £ir 1.00 •»-/- 0.27 0.41 +'-0.04* Map 1.00 -'-0.15 0.79 -,'- 0.06 Fubp2 1.00-/-0.13 0 95+'-0.0? Hnf4g 1,00 t-'-O.II 0 70 t.-0.04* Chga 1.00 +/- 0 04 1.28-{'-0.23 FIGURE 6 | Hnf4a conditional mutant mice display minor alterations in intestinal epithelial gene transcript expression. Total RNA was isolated and qRT-PCR performed with specific oligonucleotides for the detection of ApoA-IV at various time points during adult life (A). The expression of specific gene transcripts associated with differentiation was also compared between adult control and mutant mice (B). Results were individually calibrated with HPRT or GAPDH values (mean ± S.E.M.). n= 3-6 mice; *P < 0.05. 119 2.8 Discussion Several indications from the literature have supported a critical role for the HNF4a transcriptional regulator during development in different organisms as well as during the progression of human pathologies. Its roles have been mainly uncovered in both liver and pancreatic tissues for which HNF4a contributes to the regulation of the liver and pancreatic islet transcriptomes by binding directly to a strong proportion of actively transcribed genes (34). In accordance with these observations, deregulation of HNF4a expression can contribute to type 2 diabetes (19). Differentiated epithelial cells of the small intestine share several metabolic characteristics with the mature hepatocyte. Fat absorption, transport and lipid metabolism take place in enterocytes (28, 29, 37). These cells are crucial contributors to apolipoprotein component synthesis as well as chylomicrons, very low density sized particles (VLDL) and high density lipoproteins (HDL) (28, 47). A previous analysis emphasized the possible relationship between Hnf4a and regulation of intestinal epithelial differentiation with the suggestion that this transcription factor could influence the small intestinal villus metabolome by regulating genes that are involved in lipid metabolism as well as chylomicron formation (48). This assumption was recently demonstrated with the demonstration that Hnf4a can induce intestinal epithelial differentiation in vitro (30). FTNF4a was also suggested to regulate the expression of genes that are up-regulated during epithelial cell differentiation such as Apo-AIV (40) and intestinal alkaline phosphatase (35). Based on these findings and the demonstrated crucial role for this transcription factor during hepatocyte differentiation in vivo, we assumed that specific knockout of Hnf4a in the small intestinal epithelium would impair the function of differentiated enterocytes. Our findings demonstrated that Hnf4a is dispensable for basal intestinal epithelial maintenance in mice. These are in accordance with a recent report from Ahn et al. (1) in which Hnf4a intestinal 120 conditional knockout was generated with no noticeable defect in broad intestinal morphology. The Drosophila homologue to mouse Hnf4a was reported to be involved in the onset of intestinal development in vivo (54). Inactivation of Hnf4a in the mouse endoderm demonstrated its crucial role during embryonic development of the colon (15). However, this approach was not efficient in the removal of Hnf4a in the developing small intestine. Several explanations could account for the lack of major intestinal deficiencies due to Hnf4a knockout during our analysis. 1) The window of time for which intestinal Hnf4a was invalidated in our mouse model stands after El 3.5, a crucial period for the onset of intestinal epithelial monolayer formation, villi establishment and cytodifferentiation. The Villin-Cre transgene was reported to be efficient at a period following the onset of intestinal cytodifferentiation (31). Indeed, our results confirmed that Hnf4a was still expressed at this crucial developmental transition. Since no other intestinal epithelial-specific Cre expressing lines are yet available to investigate the loss of Hnf4a function before this transition, we speculate that Hnf4a invalidation could have developmental implications during the small intestinal epithelium formation in a similar manner to the colonic epithelium. The Foxai-Cre transgene utilized to demonstrate a role for Hnf4a in colon development was able to efficiently invalidate Hnf4a at embryonic day 7.0 in the hingut without targeting the midgut region (15). However, it is clear from our studies that Hnf4a loss no longer interferes with epithelial homeostasis after cell determination has occurred during intestinal development. A similar parallel was documented for this transcription factor during mouse liver development when the use of an early liver-specific Cre expressing line resulted in the impairment of epithelial structure and lethality of the mutants (36) whereas another liver-specific Cre line 121 led to post-natal survival and delayed morphological alterations (20). The intestinal epithelial conditional knockout of the c-Myc regulator is another example in which deletion in a specific developmental window of time can result in variable consequences on intestinal homeostasis (6, 33). 2) The loss of Hnf4a activity could be compensated by other nuclear receptor family related members. Hnf4y displays a very high level of amino acid sequence similarity with Hnf4al in the DNA binding domain (51) and can interact with common DNA elements as reported for the ApoAIV gene promoter (40). Hnf4y mouse knockout does not result in gross phenotypic changes although some modifications were reported for total body weight and energy expenditure (16). Interestingly, Hnf4y gene transcript was still detectable in Hnf4a mutant mice. As a convincing demonstration of this hypothesis, the individual genetic ablation of the family-related transcription factors Foxa \-a?> did not significantly impact on liver development (22, 27, 43). However, double knockout of Foxal and Foxa.2 confirmed their concerted role for the initiation of hepatic specification (26). A similar strategy to conditionally delete both intestinal Hnf4a and Hnf4y could verify this possibility. 3) Other transcriptional regulators that conjointly interact with Hnf4a might compensate for its loss. HNF4a is part of a regulatory loop that involves HNFla and HNF6 both in hepatocyte and islet transcription (34). Hnfloc physically interacts with GATA-4 and Cdx2 to regulate several intestinal epithelial specific genes (9, 53). The loss of apparently redundant Hnf4a activity within the intestinal epithelial cell transcriptome could be of little transcriptional importance during adult intestinal maintenance mainly due to the compensated action of co-interacting transcriptional partners. We hypothesise that inactivation of Hnf4a late following embryonic development occurs after the targeted chromatin regions have been primed by Hnf4a thus becoming insensitive to the subsequent loss of its activity. 122 Hnf4a was recently shown to act as a morphogen to trigger microvillus formation in mouse F9 embryonal carcinoma cells (12). Hnf4a is crucial for hepatocyte polarization both in vitro and in vivo (36, 46). Specific genes encoding cell junction molecules, including occludin, E-cadherin and several members of the claudin superfamily (4, 11, 36, 46), depend on Hnf4a expression. Hnf4a is a potent activator of intestinal epithelial cell polarization and differentiation in culture (30) Our observations supports a crucial role for Hnf4a to instruct non-intestinal cells to display features normally restricted to intestinal epithelial cells. These observations, coupled with the fact that Hnf4a can induce the expression of intestinal epithelial genes in the NIH/3T3 and Mia PaCa-2 cell lines, strongly support an important role for this factor in instructing cells to epithelialize in culture. However, our results clearly demonstrate that Hnf4a is dispensable for intestinal epithelial cell polarization and microvillus formation in vivo at a period of time when this epithelium has already undergone cellular determination. This supports the notion that Hnf4a could act as a morphogen early during embryonic development rather than being constantly involved in the maintenance of intestinal epithelial cell polarization during the perpetual renewal process of this tissue. We conclude that Hnf4a is an important component in instructing the intestinal epithelial cell phenotype but is not essential in maintaining intestinal epithelial functions after epithelial monolayer formation and cytodifferentiation have occurred. One of the future challenges will be to developing models that can delete Hnf4a before this developmental time frame and to explore the possibility of compensation from other transcriptional regulators that are part of the intestinal epithelial specific transcriptional network, a process that is currently under investigation in our laboratory. 123 2.9 Acknowledgments The authors thank Dr. Deborah L. Gumucio (University of Michigan Medical School, Ann Arbor, Michigan) for providing the 12.4KbVilCre transgenic mouse model, Peter G. Traber (Baylor College of Medicine, Houston) for providing the MT-Cdx2 inducible construct and Denis Martel and Charles Bertrand for assistance in electron microscopy procedures. The authors also thank Elizabeth Herring for the critical reading of the manuscript. This work was supported by CIHR (MOP- 89770). J.P.B., M.D. and C.R.L. were all supported by the Natural Sciences and Engineering Research Council of Canada (NSERC). F.B. is also a scholar from the « Fonds de la Recherche en Sante du Quebec » and member of the FRSQ-funded "Centre de Recherche Clinique Etienne LeBel". 2.10 References 1. Ahn SH, Shah YM, Inoue J, Morimura K, Kim I, Yim S, Lambert G, Kurotani R, Nagashima K, Gonzalez FJ, and Inoue Y. Hepatocyte nuclear factor 4alpha in the intestinal epithelial cells protects against inflammatory bowel disease. Inflammatory bowel diseases 14: 908-920, 2008. 2. Antes TJ and Levy-Wilson B. HNF-3 beta, C/EBP beta, and HNF-4 act in synergy to enhance transcription of the human apolipoprotein B gene in intestinal cells. DNA Cell Biol 20: 67-74, 2001. 3. Archer A, Sauvaget D, Chauffeton V, Bouchet PE, Chambaz J, Pincon- Raymond M, Cardot P, Ribeiro A, and Lacasa M. Intestinal apolipoprotein A-IV gene transcription is controlled by two hormone-responsive elements: a role for hepatic nuclear factor-4 isoforms. Mol Endocrinol 19: 2320-2334, 2005. 124 4. Battle MA, Konopka G, Parviz F, Gaggl AL, Yang C, Sladek FM, and Duncan SA. Hepatocyte nuclear factor 4alpha orchestrates expression of cell adhesion proteins during the epithelial transformation of the developing liver. Proc Natl Acad Sci US A 103:8419-8424,2006. 5. Beaulieu JF and Quaroni A. Clonal analysis of sucrase-isomaltase expression in the human colon adenocarcinoma Caco-2 cells. Biochem J 2S0 ( Pt 3): 599-608, 1991. 6. Bettess MD, Dubois N, Murphy MJ, Dubey C, Roger C, Robine S, and Trumpp A. c-Myc is required for the formation of intestinal crypts but dispensable for homeostasis of the adult intestinal epithelium. Molecular and cellular biology 25: 7868-7878, 2005. 7. Boudreau F, Lussier CR, Mongrain S, Darsigny M, Drouin JL, Doyon G, Suh ER, Beaulieu JF, Rivard N, and Perreault N. Loss of cathepsin L activity promotes claudin-1 overexpression and intestinal neoplasia. Faseb J21: 3853-3865, 2007. 8. Boudreau F, Rings EH, Swain GP, Sinclair AM, Suh ER, Silberg DG, Scheuermann RH, and Traber PG. A novel colonic repressor element regulates intestinal gene expression by interacting with Cux/CDP. Molecular and cellular biology 22: 5467- 5478, 2002. 9. Boudreau F, Rings EH, van Wering HM, Kim RK, Swain GP, Krasinski SD, Moffett J, Grand RJ, Suh ER, and Traber PG. Hepatocyte nuclear factor-1 alpha, GATA- 4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription. Implication for the developmental regulation of the sucrase-isomaltase gene. J Biol Chem 277: 31909-31917, 2002. 10. Chen WS, Manova K, Weinstein DC, Duncan SA, Plump AS, Prezioso VR, Bachvarova RF, and Darnell JE, Jr. Disruption of the HNF-4 gene, expressed in visceral 125 endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes & development 8: 2466-2477, 1994. 11. Chiba H, Gotoh T, Kojima T, Satohisa S, Kikuchi K, Osanai M, and Sawada N. Hepatocyte nuclear factor (HNF)-4alpha triggers formation of functional tight junctions and establishment of polarized epithelial morphology in F9 embryonal carcinoma cells. Exp Cell Res 286: 288-297, 2003. 12. Chiba H, Sakai N, Murata M, Osanai M, Ninomiya T, Kojima T, and Sawada N. The nuclear receptor hepatocyte nuclear factor 4alpha acts as a morphogen to induce the formation of microvilli. J Cell Biol 175: 971-980, 2006. 13. Duncan SA, Manova K, Chen WS, Hoodless P, Weinstein DC, Bachvarova RF, and Darnell JE, Jr. Expression of transcription factor HNF-4 in the extraembryonic endoderm, gut, and nephrogenic tissue of the developing mouse embryo: HNF-4 is a marker for primary endoderm in the implanting blastocyst. Proc Natl Acad Sci USA 91: 7598-7602, 1994. 14. Escaffit F, Boudreau F, and Beaulieu JF. Differential expression of claudin-2 along the human intestine: Implication of GATA-4 in the maintenance of claudin-2 in differentiating cells. Journal of cellular physiology 203: 15-26, 2005. 15. Garrison WD, Battle MA, Yang C, Kaestner KH, Sladek FM, and Duncan SA. Hepatocyte nuclear factor 4alpha is essential for embryonic development of the mouse colon. Gastroenterology 130: 1207-1220, 2006. 16. Gerdin AK, Surve W, Jonsson M, Bjursell M, Bjorkman M, Edenro A, Schuelke M, Saad A, Bjurstrom S, Lundgren EJ, Snaith M, Fransson-Steen R, Tornell J, Berg AL, and Bohlooly YM. Phenotypic screening of hepatocyte nuclear factor (HNF) 4- gamma receptor knockout mice. Biochem Biophys Res Commun 349: 825-832, 2006. 126 17. Gonzalez FJ. Regulation of hepatocyte nuclear factor 4 alpha-mediated transcription. Drug metabolism and pharmacokinetics 23: 2-7, 2008. 18. Gupta RK, Gao N, Gorski RK, White P, Hardy OT, Rafiq K, Brestelli JE, Chen G, Stoeckert CJ, Jr., and Kaestner KH. Expansion of adult beta-cell mass in response to increased metabolic demand is dependent on HNF-4alpha. Genes & development 21: 756- 769, 2007. 19. Gupta RK and Kaestner KH. HNF-4alpha: from MODY to late-onset type 2 diabetes. Trends MolMed 10: 521-524, 2004. 20. Hayhurst GP, Lee YH, Lambert G, Ward JM, and Gonzalez FJ. Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Molecular and cellular biology 21: 1393-1403, 2001. 21. Hertz R, Magenheim J, Berman I, and Bar-Tana J. Fatty acyl-CoA thioesters are ligands of hepatic nuclear factor-4alpha. Nature 392: 512-516, 1998. 22. Kaestner KH, Katz J, Liu Y, Drucker DJ, and Schutz G. Inactivation of the winged helix transcription factor HNF3 alpha affects glucose homeostasis and islet glucagon gene expression in vivo. Genes & development 13: 495-504, 1999. 23. Kan HY, Georgopoulos S, Zanni M, Shkodrani A, Tzatsos A, Xie HX, and Zannis VI. Contribution of the hormone-response elements of the proximal ApoA-I promoter, ApoCIII enhancer, and C/EBP binding site of the proximal ApoA-I promoter to the hepatic and intestinal expression of the ApoA-I and ApoCIII genes in transgenic mice. Biochemistry A3: 5084-5093, 2004. 24. Klapper M, Bohme M, Nitz I, and Doring F. The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4alpha. Biochem Biophys Res Commun, 2007. 127 25. Laukoetter MG, Bruewer M, and Nusrat A. Regulation of the intestinal epithelial barrier by the apical junctional complex. Curr Opin Gastroenterol 22: 85-89, 2006. 26. Lee CS, Friedman JR, Fulmer JT, and Kaestner KH. The initiation of liver development is dependent on Foxa transcription factors. Nature 435: 944-947, 2005. 27. Lee CS, Sund NJ, Behr R, Herrera PL, and Kaestner KH. Foxa2 is required for the differentiation of pancreatic alpha-cells. Dev Biol 278: 484-495, 2005. 28. Levy E, Beaulieu JF, Delvin E, Seidman E, Yotov W, Basque JR, and Menard D. Human crypt intestinal epithelial cells are capable of lipid production, apolipoprotein synthesis, and lipoprotein assembly. Journal of lipid research 41: 12-22, 2000. 29. Levy E and Menard D. Developmental aspects of lipid and lipoprotein synthesis and secretion in human gut. Microsc Res Tech 49: 363-373, 2000. 30. Lussier CR, Babeu JP, Auclair BA, Perreault N, and Boudreau F. Hepatocyte nuclear factor-4alpha promotes differentiation of intestinal epithelial cells in a coculture system. American journal of physiology 294: G418-428, 2008. 31. Madison BB, Dunbar L, Qiao XT, Braunstein K, Braunstein E, and Gumucio DL. Cis elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. J Biol Chem 277: 33275- 33283, 2002. 32. Menard D, Beaulieu JF, Boudreau F, Perreault N, Rivard N, and Vachon PH. Gastrointestinal tract. In: Cell signaling and growth factors in development: from molecules to organogenesis, edited by Unsicker K and Krieglstein K: Wiley-VCH, 2006, p. 755-790. 33. Muncan V, Sansom OJ, Tertoolen L, Phesse TJ, Begthel H, Sancho E, Cole AM, Gregorieff A, de Alboran IM, Clevers H, and Clarke AR. Rapid loss of intestinal crypts 128 upon conditional deletion of the Wnt/Tcf-4 target gene c-Myc. Molecular and cellular biology 26: 8418-8426, 2006. 34. Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, Murray HL, Volkert TL, Schreiber J, Rolfe PA, Gifford DK, Fraenkel E, Bell GI, and Young RA. Control of pancreas and liver gene expression by FTNF transcription factors. Science 303: 1378-1381,2004. 35. Olsen L, Bressendorff S, Troelsen JT, and Olsen J. Differentiation-dependent activation of the human intestinal alkaline phosphatase promoter by FfNF-4 in intestinal cells. American journal of physiology 289: G220-226, 2005. 36. Parviz F, Matullo C, Garrison WD, Savatski L, Adamson JW, Ning G, Kaestner KH, Rossi JM, Zaret KS, and Duncan SA. Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat Genet 34: 292-296, 2003. 37. Phan CT and Tso P. Intestinal lipid absorption and transport. Front Biosci 6: D299- 319,2001. 38. Rowley CW, Staloch LJ, Divine JK, McCaul SP, and Simon TC. Mechanisms of mutual functional interactions between HNF-4alpha and FTNF-1 alpha revealed by mutations that cause maturity onset diabetes of the young. American journal of physiology 290: G466- 475, 2006. 39. Sancho E, Batlle E, and Clevers H. Signaling pathways in intestinal development and cancer. Annu Rev Cell Dev Biol 20: 695-723, 2004. 40. Sauvaget D, Chauffeton V, Citadelle D, Chatelet FP, Cywiner-Golenzer C, Chambaz J, Pincon-Raymond M, Cardot P, Le Beyec J, and Ribeiro A. Restriction of apolipoprotein A-IV gene expression to the intestine villus depends on a hormone-responsive 129 element and parallels differential expression of the hepatic nuclear factor 4alpha and gamma isoforms. J Biol Chem 277: 34540-34548, 2002. 41. Sheena V, Hertz R, Nousbeck J, Berman I, Magenheim J, and Bar-Tana J. Transcriptional regulation of human microsomal triglyceride transfer protein by hepatocyte nuclear factor-4alpha. Journal of lipid research 46: 328-341, 2005. 42. Shen H, Howies P, and Tso P. From interaction of lipidic vehicles with intestinal epithelial cell membranes to the formation and secretion of chylomicrons. Adv Drug Deliv Rev 50 Suppl 1: S103-125, 2001. 43. Shen W, Scearce LM, Brestelli JE, Sund NJ, and Kaestner KH. Foxa3 (hepatocyte nuclear factor 3 gamma ) is required for the regulation of hepatic GLUT2 expression and the maintenance of glucose homeostasis during a prolonged fast. J Biol Chem 276:42812-42817,2001. 44. Sladek FM, Ruse MD, Jr., Nepomuceno L, Huang SM, and Stallcup MR. Modulation of transcriptional activation and coactivator interaction by a splicing variation in the F domain of nuclear receptor hepatocyte nuclear factor 4alphal. Molecular and cellular biology 19: 6509-6522, 1999. 45. Sladek FM, Zhong WM, Lai E, and Darnell JE, Jr. Liver-enriched transcription factor FTNF-4 is a novel member of the steroid hormone receptor superfamily. Genes & development A: 2353-2365, 1990. 46. Spath GF and Weiss MC. Hepatocyte nuclear factor 4 provokes expression of epithelial marker genes, acting as a morphogen in dedifferentiated hepatoma cells. J Cell Biol 140: 935-946, 1998. 47. Stan S, Delvin E, Lambert M, Seidman E, and Levy E. Apo A-IV: an update on regulation and physiologic functions. Biochim Biophys Acta 1631: 177-187, 2003. 130 48. Stegmann A, Hansen M, Wang Y, Larsen JB, Lund LR, Ritie L, Nicholson JK, Quistorff B, Simon-Assmann P, Troelsen JT, and Olsen J. Metabolome, transcriptome and bioinformatic cis-element analyses point to HNF-4 as a central regulator of gene expression during enterocyte differentiation. Physiol Genomics, 2006. 49. Suh E and Traber PG. An intestine-specific homeobox gene regulates proliferation and differentiation. Molecular and cellular biology 16: 619-625, 1996. 50. Swenson ES, Mann EA, Jump ML, and Giannella RA. Hepatocyte nuclear factor- 4 regulates intestinal expression of the guanylin/heat-stable toxin receptor. Am J Physiol 276: G728-736, 1999. 51. Taraviras S, Mantamadiotis T, Dong-Si T, Mincheva A, Lichter P, Drewes T, Ryffel GU, Monaghan AP, and Schutz G. Primary structure, chromosomal mapping, expression and transcriptional activity of murine hepatocyte nuclear factor 4gamma. Biochim BiophysActa 1490: 21-32, 2000. 52. Taraviras S, Monaghan AP, Schutz G, and Kelsey G. Characterization of the mouse HNF-4 gene and its expression during mouse embryogenesis. Mech Dev 48: 67-79, 1994. 53. van Wering HM, Bosse T, Musters A, de Jong E, de Jong N, Hogen Esch CE, Boudreau F, Swain GP, Dowling LN, Montgomery RK, Grand RJ, and Krasinski SD. Complex regulation of the lactase-phlorizin hydrolase promoter by GATA-4. American journal of physiology 287: G899-909, 2004. 54. Zhong W, Sladek FM, and Darnell JE, Jr. The expression pattern of a Drosophila homolog to the mouse transcription factor HNF-4 suggests a determinative role in gut formation. Embo J12: 537-544, 1993. MANUSCRIT 3 LOSS OF HEPATOCYTE-NUCLEAR-FACTOR-40C AFFECTS COLONIC ION TRANSPORT AND CAUSES CHRONIC INFLAMMATION RESEMBLING INFLAMMATORY BOWEL DISEASE IN MICE MATHIEU DARSIGNY, JEAN-PHILIPPE BABEU, ANDREE-ANNE DUPUIS, EMMA E. FURTH, ERNEST G. SEIDMAN, EMILE LEVY, ELENA F. VERDU, FERNAND-PIERRE GENDRONET FRANCOIS BOUDREAU 2010 PLoS ONE, 4(10): E7609. 132 3.1 Auteurs et affiliations Mathieu Darsigny1'2, Jean-Philippe Babeu1'2, Andree-Anne Dupuis1'2, Emma E. Furth3, Ernest G. Seidman1'4, Emile Levy1'5, Elena F. Verdu6, Fernand-Pierre Gendron1'2 and Francois Boudreau1'2* 'CIHR Team on Digestive Epithelium. 2Departement d'anatomie et biologie cellulaire, Faculte de Medecine et des Sciences de la Sante, Universite de Sherbrooke, Sherbrooke, QC, CANADA, department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA, USA. 4Research Institute, McGill University Health Center, Montreal, QC, CANADA, department of Nutrition, CHU Ste-Justine, Universite de Montreal, QC, CANADA. 6Division of Gastroenterology, McMaster University, Hamilton, ON, CANADA. 1 3.2 Contributions Mathieu Darsigny Mathieu a realise la majorite des experiences a 1'exception de la mesure des cytokines et chimiokines et de 1'evaluation de la propriete electrique de la muqueuse colique. II a prepare toutes les figures, legendes et redige le materiel et methodes. II a participe a l'ecriture du manuscrit en apportant des corrections et des suggestions. 133 Jean-Philippe Babeu Jean-Philippe a effectue les premiers croisements et recolte les premiers echantillons animaux. Andree-Anne Dupuis Andree-Anne a realise la mesure des cytokines et chimiokines. Emma E. Furth Emma a collabore a la confirmation du phenotype. Ernest G. Seidman Ernest a participe a I'ecriture du manuscrit en apportant corrections et suggestions. Emile Levy Emile a participe a I'ecriture du manuscrit en y apportant des corrections et suggestions. Elena F. Verdu Elena a rendu possible l'etude des proprietes electriques de la muqueuse colique. Fernand-Pierre Gendron Fernand-Pierre a participe a I'ecriture du manuscrit en apportant corrections et suggestions. Francois Boudreau Francois est I'investigateur principal sur ce manuscrit. II a redige, soumis et corrige le manuscrit. 134 3.3 Resume Historique Hnf4a, un facteur de transcription specifique de I'epithelium intestinal, est reduit dans les maladies inflammatoires intestinales humaines et permet de proteger contre une colite induite par un agent chimique chez la souris. Cependant, le role precis de ce facteur dans le maintien de l'homeostasie de I'epithelium normal demeure moins bien connu. Le but fixe pour cette etude etait done d'evaluer le role individuel d'Hnf4a dans le maintien de Pequilibre inflammatoire de la muqueuse intestinale chez la souris. Methodes et resultats Nous montrons ici que la deletion specifique d'Hnf4a chez la souris cause une inflammation intestinale chronique spontanee qui mene a des endroits d'ulceration de la muqueuse, une relache de cytokines et de chimiokines augmentee, une infiltration de cellules immunitaires et une hyperplasie epitheliale. Une analyse de profilage genique dans le colon malade des animaux Hnf4a mutants a revele une augmentation de la mort cellulaire et changements proliferatifs relies au cancer. Parmi les genes impliques dans la fonction immunitaire de la barriere epitheliale, nous avons identifie le transporteur ionique claudin-15 comme etant reduit dans le colon des animaux Hnf4a mutants. Cette modification coincide avec une perte significative de transport ionique sans affecter la permeabilite chez les jeunes animaux non malades. Nous avons confirme que la claudine-15 est une cible directe d'Hnf4a dans I'epithelium intestinal et que cette cible correle avec la perte d'Hnf4a dans les maladies inflammatoires de l'intestin. 135 Conclusion Nos resultats mettent en evidence le role critique d'Hnf4a dans le maintien de Phomeostasie inflammatoire durant la vie de la souris adulte et revelent un nouveau role pour Hnf4a dans la regulation de 1'expression de la claudine-15. Ceci etablit Hnf4a comme un mediateur du transport ionique, un processus important dans le maintien de l'equilibre dans Finfiammation intestinale. 3.4 Abstract Background and Aims Hnf4a, an epithelial specific transcriptional regulator, is decreased in inflammatory bowel disease and protects against chemically-induced colitis in mice. However, the precise role of this factor in maintaining normal inflammatory homeostasis of the intestine remains unclear. The aim of this study was to evaluate the sole role of epithelial Hnf4a in the maintenance of gut inflammatory homeostasis in mice Methodology/Principal findings We show here that specific epithelial deletion of Hnf4a in mice causes spontaneous chronic intestinal inflammation leading to focal areas of crypt dropout, increased cytokines and chemokines secretion, immune cell infiltrates and crypt hyperplasia. A gene profiling analysis in diseased Hnf4a null colon confirms profound genetic changes in cell death and proliferative behaviour related to cancer. Among the genes involved in the immune protection through epithelial barrier function, we identify the ion transporter claudin-15 to be down-modulated early in the colon of Hnf4a mutants. This coincides with a significant decrease of mucosal ion transport but not of barrier permeability in young animals prior to 136 the manifestation of the disease. We confirm that claudin-15 is a direct Hnf4a gene target in the intestinal epithelial context and is down-modulated in mouse experimental colitis and inflammatory bowel disease. Conclusion Our results highlight the critical role of Hnf4a to maintain intestinal inflammatory homeostasis during mouse adult life and uncover a novel function for Hnf4a in the regulation of claudin-15 expression. This establishes Hnf4a as a mediator of ion epithelial transport, an important process for the maintenance of gut inflammatory homeostasis. 3.5 Introduction Hepatocyte-nuclear-factor-4a (Hnf4a) was originally identified as an endoderm specific transcriptional regulator detectable in the liver, pancreas and intestine, essential for embryonic development [1]. Conditional genetic removal of Hnf4a function in the liver results in impaired lipid metabolism and gluconeogenesis [2] and disorganization of morphological and functional differentiation in the hepatic epithelium [3]. One critical set of gene products found to be disrupted in hepatocytes that have lost Hnf4a is related to epithelial cell adhesion and junction formation [4]. Thus, Hnf4a represents a potent transcriptional regulator with a strong impact on endodermal development and metabolism related pathophysiology. HNF4a has recently emerged as being a potential regulator of intestinal epithelial function. In vitro studies suggest that it stimulates intestinal epithelial cell differentiation, resulting in the formation of a tight epithelial barrier [5]. These features are central to the 137 differentiated epithelium to ensure nutrient metabolism [6] and barrier protection against pathogens [7]. Another fundamental characteristic of the epithelial barrier is to regulate appropriate ion selectivity, for which impairment contributes to the manifestation of inflammatory bowel disease (IBD) [8] [9]. Hnf4a is important during early embryonic colon development and regulation of genes related to epithelial functions [10]. The intestinal epithelial role of Hnf4a is of less importance when disrupted during post-embryonic development of the gut [11]. Hnf4a is required to protect the epithelium during experimental colitis in young adult mice and is reduced in IBD [12]. However, no inflammatory defect was reported to occur in animals that were not chemically induced to develop colitis leaving questionable whether Hnf4a was functionally important to maintain appropriate inflammatory homeostasis during adult life. Herein, we aimed to investigate whether epithelial Hnf4a was solely involved in the control of intestinal inflammatory homeostasis and to explore the nature of the mechanisms implicated. Our results show that Hnf4a deletion spontaneously triggered chronic inflammatory response in the colon characterized by disrupted crypt architecture, proliferative changes, apoptosis, increased inflammatory mediator secretion and increased immune cell infiltration. We propose that the loss of mucosal homeostasis is initiated by an early reduction of mucosal ion transport, which was not associated with a significant change of barrier permeability. Claudin-15, a paracellular ion transporter, was confirmed to be a novel and direct gene target for Hnf4a. These findings identify Hnf4a as a transcriptional regulator of ion transport and support a novel functional role for this transcriptional regulator in colonic inflammatory homeostasis. 138 3.6 Materials and methods Animals and Ethics statement 12.4K.bVi\CrdHnf4aloxP'!oxP mutant mice were obtained exactly as described previously [11]. Mice were kept under pathogen free conditions and were tested negative for helicobacter, pasteurella and murine norovirus. Mice were treated in accordance with a protocol approved by the Institutional Animal Research Review Committee of the Universite de Sherbrooke. RNA isolation and quantitative PCR Tissue samples were harvested, total RNA was isolated and quantitative RT-PCR was performed as described previously [13]. Target expressions were normalized using either hypoxanthine-guanine phosphoribosyl transferase (HPRT) or TATA binding protein (TBP) expression depending on target mRNA abundance. All primer sequences and cycling conditions are available upon request. Microarray screening and data analysis Probes for microarray analysis were generated from RNA isolated from the proximal colon of 3 control and 3 Hnf4a mutant mice at 12 months of age. Affymetrix GeneChip® Mouse Genome 430 2.0 arrays were screened with six generated probes via the microarray platform of McGill University and Genome Quebec Innovation Center as previously described [14] (data are accessible through GEO series accession number GSE11759). To test for statistically significant changes in signal intensity (p values of < 0.05; SAM test), compiled data (RMA analysis) were screened using FlexArray 1.1 (Genome Quebec). Data were also analyzed through the use of Ingenuity Pathways Analysis (IPA) to generate 139 networks of genes associated with biological functions and/or diseases (Ingenuity Systems, www.ingenuity.com). Immunoblots Total protein extracts were obtained and separated by protein electrophoresis as described previously [13]. The following antibodies were used and incubated at 4°C 0/N: anti-P-actin (#scl615, 10 ng/ml) and anti-HNF4a (#sc6556, 100 ng/ml) from Santa Cruz; anti-cleaved caspase-3 (#9664, 1:500), anti-IicBa (#9242, 1:1000), anti-phospho- IKBOC (Ser32) (#2859, 1:1000) from Cell Signalling and anti-claudin-4 (#36-4800, 500 ng/ml), anti- claudin-8 (#40-0700Z, 32 ng/ml), anti-claudin-15 (#38-9200, 250 ng/ml) and anti-E-cadherin (#33-400, 30 ng/ml) from Zymed. Electronic microscopy Tissues intended for electronic microscopy analysis were fixed with 2.5% glutaraldehyde in 0.1 M cacodylate buffer and processed as described previously [13]. Immunohistochemistry, immunofluorescence and cytological stains For histological analysis, tissues were fixed in a swiss roll position using 10% neutral buffered formalin and paraffin embedded. Antigen retrieval was performed using lOmM citrate buffer, pH 6.0 and the DAKO EnVision+ System-HRP according to the manufacturer's instructions (DakoCytomation). Antibodies were used under the following conditions: anti-MPO (#RB-373, 1:100) and anti-Ki67 (#RB-1510-R7) (Neomarkers). For HNF4a indirect immunofluorescence, anti-HNF4a (1 mg/ml) was used. For claudin immunodetection, 5 urn thick OCT cryosections were fixed in 100% methanol for 10 140 minutes at - 20°C followed by incubation with anti-claudin-4 (1 ug/ml), anti-claudin-8 (0.2 ug/ml) and anti-claudin-15 (1 ug/ml). Primary antibodies were visualized with the appropriate FITC-coupled secondary antibody (Vector Laboratories) and samples were mounted with Vectashield Hard Set mounting medium with DAPI (Vector Laboratories). Alcian blue staining was done as described elsewhere [15]. All images were captured on a Leica DMLB2 microscope using a Leica DFC300 FX camera. Cytokine array and ELISA Cytokine production by colonic tissues of normal and Hnf4a null mice was determined using the RayBio® Mouse Cytokine Antibody Array G series 1000 (RayBiotech, Norcross, GA). Colons of 1 year old mice were harvested and protein lysates prepared as previously described [16]. The cytokine antibody array was performed with 40 ug of protein and scanned in the Cy3 channel using a ScanArray Express dual-color confocal laser scanner (Perkin Elmer). Results were normalized and analyzed as recommended by the manufacturer [17]. CXCL1 expression was quantified using the R&D Systems duoSet ELISA development kit for mouse CXC chemokine KC (R&D Systems). ELISA assays were performed using 30 ug of whole colon protein extract per well following the manufacturer's recommendation. DSS samples and UC samples 2.5% DSS mild treatment was given to CD1 mice for a period of 10 days and the colon was harvested. TissueScan Real-Time colitis disease panels were purchased from Origene Technologies. Each panel was composed of total isolated RNA from 6 control samples and 21 UC samples collected all from different individuals. Lyophilised cDNAs were 141 resuspended and qRT-PCR was performed as described above and normalized against p- actin. PCR conditions and primers used are available upon request. EMSA and Chromatin immunoprecipitation EMS A were performed exactly as described previously [18]. For chromatin immunoprecipitation, whole colon was removed, fixed in 1% formaldehyde and the epithelial cells harvested with a cell recovery solution (BD bioscience). Cells were then sonicated and ChIP performed with Ez-Chip as described by the manufacturer (Millipore). Cell culture Full length claudin-15 (NM021719.3, 1..1846) was amplified from mouse cDNA with iproof polymerase (Bio-Rad) and cloned in plenti6/V5 vector. Lentiviruses were produced and infection of T84 and IEC6 epithelial cell lines (obtained from the American Type Culture Collection, catalog no. CCL-248 and CRL-1592) was performed as described previously [13]. Stable T84 cell populations were seeded on Corning Transwell permeable supports and electrical resistance was measured each day following the reach of confluency with EVOM instrument (World Precision Instrument). Ion transport and permeability measurement Two sections of colon from each mouse were used for epithelial ion transport and permeability measurements [19]. Each colonic segment was opened along the mesenteric border, rinsed, and mounted in an Ussing chamber. Tissues were bathed in oxygenated Krebs buffer containing 10 mM glucose (serosal side) or 10 nM mannitol (luminal side) at 37°C, and net active transport across the epithelium was measured via a short circuit current (7SC; 142 uA) injected through the tissue under voltage-clamp conditions. After a 15-min 2 equilibration period, baseline 7SC (uA/cm ) was recorded. Colon paracellular permeability was measured using recovery of 51-chromium-ethylenediaminetetraacetic acid (51Cr-EDTA). Briefly, 6 uCi of 51 Cr-EDTA/ml was added to the luminal side of tissues. 100 ul samples were taken from the serosal side at 0, 30, 60, 90 and 120 min and compared to 100 ul of the radioactive sample (100%) obtained from the luminal side at time 0 [20]. Statistical analyses All data were expressed as mean ± SEM. Groups were compared with student t test unless otherwise noted (GraphPad Prism 5, GraphPad Software, SD). Statistical significance was defined as P <.05. FIGURE I | Epithelial specific loss of Hnf4ffi leads to various sigms off chromic colon omlfilaraiimaMoiiL (A) qRT-PCR of Hnf4a mRNA at 7 days, 1 month and 12 months in mutants (open bars) relative to controls (black bars). Expression levels are shown as mean values (± SEM) relative to controls for each time point control and null mice. Scale bars, 50 pm. (C) H&E staining of a healthy mucosa in mutants. (D) Mucosa with signs of crypt distortion and crypt loss. (E) Increased crypt length and cell infiltrates. (F) Polyp formation. These photographs are representative of eight 12 month-old individuals all showing these morphological features. The formation of polyps was only observed in 2 independent Hnf4a colon null mice. All scale bars are 100 jim except for panel F that is 200 um. 144 A mouse Hnf4a intestinal epithelial conditional knockout colony was generated exactly as described recently [11]. Total RNA isolated from the colon and subjected to qRT- PCR showed that mutant mice did not produce significant levels of wild-type Hnf4a mRNA (Figure 1A). Indirect immunofluorescence confirmed that production of the Hnf4a protein was abolished in the colon of mutant mice as compared to control mice (Figure IB). Intestinal morphology was then compared in tissue sections prepared from control and mutant mice. No significant alteration of the intestinal mucosa was observed in young adult mice. Mild colonic crypt distortion was detected in 3 month old mutant mice. This phenotype worsened over time, becoming severe and fully penetrant for each 6 to 12 months old mutant mouse analysed (Figure 1). Histological analysis of colon sections from these mice revealed healthy crypt regions (Figure 1C) surrounded with abundant focal regions of colonic mucosa with signs of acute inflammation and epithelial destruction (Figure ID), crypt hyperplasia associated with increased submucosal immune cell infiltrates (Figure IE) and in rare occasion, early signs of neoplasia that was never observed in age-matched control mice (Figure IF). Goblet cells in the colonic mucosa were stained with Alcian blue and no significant differences were observed between control (Figure 2A) and non-inflamed regions of the adult mutant mice (Figure 2B). Electron microscopy confirmed the similarities in goblet cell maturity between control (Figure 2C) and mutant mice (Figure 2D). However, the size of goblet cells was reduced in enlarged crypts (Figure 2E) and decreased in number in the more severely distorted crypts of the Hnf4a mutant mice (Figure 2F). Relative mRNA levels of Muc2, a specific marker of goblet cells, remained stable during the first 3 months but significantly declined in older Hnf4a mutant animals (Figure 2G). The expression of the Muc3 gene decreased early during post-natal life (Figure 2H). Consistent with the similarity to the histopathology seen in patients with IBD, some of the Hnf4a mutant mice displayed a 145 out iID wug leun imiautea coion mucosa. (A) ; Alcian blue staining of control mice aged of 12 months. (B) Healthy colon region of 12 month-old s» mutant mice showing normal size and number of goblet cells (Scale bar, 100 pm). Electron microscopy shows a similar maturation level of goblet cells in control (C) and mutant mice (D) (Scale bar, 2 um). (E) Small size goblet cells in (f2! ; (± SEM) relative to controls and were normalized 1.8 4 n GOO 0,8 i r rt I n with the Hprt gene. **P < 0.01 and ***/" < 0 001. ao- ~~\r~ n e IH e a li^m HBSO «KS 74pa im> D2KS characteristic pheootype with relapsing episodes of hematochezia and rectal prolapse (data not illustrated). To further assess the expression of modulators of the immune response, a cytokine antibody array assay was performed on Hnf4a colon null and control total protein extracts (Table SI). This analysis identified several cytokines and chemokines to be significantly up-regulated in the Hnj4a colon mutant mice (Figure 3 A). An EL ISA confirmed that the epithelial chemokine C-X-C ligand 1 (CXCL1) was significantly elevated in these samples (Figure 3B). This up-regulation was further correlated to the increased 146 detection of the myeloperoxidase (MPO) signal associated with leukocytes that are recruited following the chemoattractant properties of CXCLl released at inflammation site demonstrated that the loss of Hnf4a results in spontaneous chronic inflammation resembling inflammatory bowel disease. B Controls Mutants Fold increase P-valu® GM-CSF 125,50 ±51,70 527,75 ± 74,37 4,21 0,0113 CXCL1 IL-6 85,17 ±30,13 304,13 ± 61,91 3,57 0,0335 $WM !L12p40p7 22,17 * 14,15 268,75 ± 66,67 12,12 0,0363 IL13 223,67 ± 59,93 755,13 ± 104,07 3,38 0,0115 CXCL11 209,33 ± 64,92 724,38 ± 140,34 3,46 0,0291 CXCL1 78,83 ± 19,96 354,50 ± 65,08 4,50 0,0271 aft n J. 4 <&o An J9 AR n nice. I 3.0 • 1- 1.0- 95- !S 00 •iCTRL MUiT FIGURE 3 | Increased cytokine and chemokine secretion associated with the inflammatory state of Hnj4a colon null mice. (A) Summarized results (means J SEM. at least 3 individuals aged of 12 months) of the semi-quantitative cytokine/themokine array shown in Table SI. (B) FLISA performed on total piotein lysates (means J- SLM, n=6 per group). (C) Labelling of granulocytic cells by MPO lmmunohistochemistry was negative in controls as opposed to (D) mutants Scale bars, 100 um (E) Western blot of accumulated phospho-kBa relative to total IKBCE and relative quantification (mean *- SEM), *P 10.05. 147 Expression of cell death, cancer and gastrointestinal diseases related genes is altered in the colon of Hnf4a mutant mice Gene expression profiling was performed to clarify the gene network associated with the loss of Hnf4a and the long term morphological changes observed in colonic crypts. A statistical analysis (p < .05) predicted 485 unique mouse transcripts to be modulated between control and mutant animals (differential ratio > 2.0, Table S2). To gain insight into how these modifications relate to colonic function, IPA software was utilized to categorize these modified genes by biological function and to extrapolate interaction networks among them. This analysis identified cell death and cell cycle as being the most important cellular processes predicted to be affected in the Hnf4a null colon (Figure SI). Of interest, the most significant diseases and disorders that were predicted to occur based on modifications in gene transcripts expression was cancer and gastrointestinal diseases. Identification of these specific molecular-physiological networks led us to show that specific cleavage of caspase-3, a critical executioner during cell apoptosis, was significantly increased in the colon of mutant Hnf4a mice (Figure 4A and B). However, the cleavage of caspase-3 was not significantly altered in young adult mice (data not shown). The expression of the E2f2 transcript, a marker for both cell proliferation and apoptosis [21], remained stable in early postnatal life but became significantly increased in the colon of 12 months old mice (Figure 4C). The expression of the aurora kinase A (AurkA) transcript, a regulator of mitosis that is up-regulated in patients with ulcerative colitis [22], was also significantly up-regulated in the long term in colon of Hnf4a mutant mice (Figure 4C). These observations were consistent with the long term significant increase in colon crypt length observed in 12 months old Hnf4a mutant mice (Figure 4D) and the drastic increase in Ki67 labeling in 148 elongated crypts of Hnf4a colon null mice as compared to controls (Figure 4E). Thus, apoptosis and cell proliferation was increased in the long term in colon disease of Hnf4a mutant mice probably as a consequence to the inflammatory response. A CMC M M 20kDa-^-rf. *a# *jt^ ^jjifc—Caspase-3 p19 •* HP- Caspase-3 p 17 ""'"• ni -i nil •Him IBWI " r-""" p-Actin B Cleaved and active Caspase-3 (17/19 kDa) E2f2 AurkA e I 30 § 40 § 25 i 20 S 25 I 30 X xa 1 S 20 • 15-] Z 2 00 - z NS I 1-5 NS NS 1 1 10 n i Fi 1 °iniAi a 0 5- a oo ™U™ U^'i' <* oo ™'J^ 'I'^'I • 3§ 00 •u j; M C M _C M_ _C M C M _C M_ CTRL MUT 7 dpn 1 mo 12 mo 7 dpn 1 mo 12 mo D id- ? Crypt length W? 12-i * 4 10- A. 3 8- • **£*/ / s *'* * ''% t < f Of * >• 6- A W: " i ! -O - '*•* "5": i# •', ^ , 4- 5? 51 2- 1* )U' V FIGURE 4 | The apoptotic pathway is overly active and the proliferative dynamic is altered in regenerative epithelium. (A) Increased abundance of cleaved and active forms of caspase-3 in 12 month-old mutants (Open bar) relative to controls (Black bar) (B) Quantification of band intensities of cleaved and active caspase-3 combined (n=4) normalized to P-actin (Black bars, controls, open bars, mutants) Represented as means ± SEM, * P < 05 (C) E2f2 and AurkA modulations seen in microarray data were verified at various time points in mutants (Open bars) relative to controls (Black bars) Expression levels are shown as mean values (± SEM) relative to controls for each time point (3-14 mice per group) and were normalized with the Tbp housekeeping gene (D) Measurements (n=4 per group) of crypt length (E) Ki67 immunochemistry of 12 month-old control mice compared to a hyperplasic area seen in mutants of same age *P < 0 05 **P<0 01 and***P<0 001 149 Ion channel/transporters are modulated early in Hnf4a colon mutant mice Hnf4a induces epithelial polarity and barrier function in intestinal epithelial cells in vitro [5] and is a crucial regulator of multiple genes involved in tight and adherent junctions in hepatocytes [4]. We thus looked for transcript variation in components of cell-to-cell junctional complexes to monitor whether loss of Hnf4a could affect these transcriptional targets. Surprisingly, this analysis identified very few modifications in the expression of these classes of genes except for the down modulation of claudin-15 transcript and a probable indirect induction of claudin-4 and -8 gene transcripts (Table S3). Gene transcript quantification for each of these claudins confirmed an induction of claudin-4 and claudin-8 and a reduction of claudin-15 in Hnf4a colon null mice (Figure 5A). These changes were observed as early as postnatal day 7, a period that preceded detection of crypt distortion and inflammation. Western blot analysis confirmed that these variations were of consequence on the respective protein level in the colon of adult mice (Figure 5B, C). Immunolocalization of both claudin-4 and claudin-8 showed a stronger signal on the colon epithelial surface of Hnf4a colon null mice as compared to controls (Figure 5D). Although claudin-15 protein was localized throughout the colonic crypt in control mice, its distribution changed drastically in the Hnf4a colon null mice with the upper half of the crypt being devoid of claudin-15 (Figure 5D and E). Because claudin-15 was reported to be crucial in maintaining ion transport but not mucosal permeability in the gut [23,24], mucosal barrier assays were next performed. Young adult mutant mice did not show significant alteration in colon mucosal permeability to 51Cr-EDTA as compared to controls (Figure 5F). This observation coincided with the fact that a limited subset of tight and adherens junction related genes were modulated in the Hnf4a colon null mice (Table S3). However, baseline 7SC was significantly decreased in the colon of young adult Hnf4a null mice as compared to controls 150 A OaucHrt* § 28 n s i A n h $ m • i i. ..1 CM '- M 30 *D.i- --> irtr «*? **« Claudin-4 20KD»- -s«*» ••-* Claudln-S I tvw> - ift -•• Claudin-15 m m m HNF4* ilii %i E-Cadherin c M e a e a cu cu cut Ita&Bffl J1U "JUL :• o CM cm MUT CTRL MUT FIGURE 5 | Claudin-15 and ion transport are modulated in Hnf4a colon null mutants. (A) qRT-PCR of claudin-4, -8 and -15 at various time points in mutants (Open bars) relative to controls (Black bars). Expression levels are shown as mean values (± SEM) relative to controls at each time point (3-14 mice per group) and were normalized with the Tbp housekeeping gene. (B) Immunohlotting confirmed modulated protein levels of claudin-4. -8 and -15 at 12 months in mutants (n-3, open bars) and relative controls (n-3. black bars) normalized to stable expression of E-Cadherin (Cdhl). (C) Quantification of band intensities of each claudm (means + SEM: n=3 or 4 foi each group) relalrve to Cdhl. (D) Indirect immunofluorescence (FITC) of claudin-4. -8 and -15 in 3 month-old animals in proximal colon (representative of 4 pairs). Nuclei were counterstained with DAP1 (blue) and merged with FII'C (green). Scale bars. 50 urn. (E) Claudin-15 expression is lost in the upper half of the colon epithelium in mutants (Open bar) relative to controls (Black bar). (F) Colonic permeability to MCr-EDTA measured in colon tissues from 2 month-old mice (5 mice per group). (G) Baseline short circuit current (Isc) measured in colon tissues from 2 month-old mice (5 mice per group). Represented as mean values i- SEM, *P < 0.05. **P < 0.01, ***!> < 0.001. 151 demonstrating that a decrease in active epithelial ion transport in absence of Hnf4a was takina nlace before the onset of the disease (Fisure 5G). In addition to claudin-15 beins; iranspou runction were pieuictea 10 oe sigiiuiumuy reuuceu in aiseaseu unj-ta coiou nun mice (Table S4). FIGURE 6 | The claudin-15 gene is a direct A s target of Hnf4«. (A) EMSA of 4 Hnf4a binding -4 88-3 BS-2 BS-1 APOC3m APOC3 sites found in the 1 kb mouse claudin-15 promoter performed with 293T cells transfected f^" • . •ifr~l^ : :^t§ with pBabe Hnf4al vector and 293T nuclear gkfi PTf V'?* {$.', ;-«a ChlP assays of the 4 putative sites peiformed on C J 4-, Claudin-15 epithelial cells from adult mouse colon. (C) qRT- 3 PCR of claudin-15 on 1EC6 cells infected with I I $ 2 pBabe Hnf4a as compared to control vector ':& % BS3H i $ 1 pBabe (n=4). (D) Western blot of 3 stable T84 % JJmpm—l_,—L. *•*• 4 mtmmm? BS1 cell populations expiessing mouse claudm-15 (E) pBabe HNHal D (Controls O Claudin-15 Conductance measured for three consecutive days T84 % mo- after the i each of confluence on three populations ptenti ^fP pisntt ^yg of 184 cells expiessing mouse claudin-15 or JK^il.?} en 5 -fr/ ft?'•<*•? %*"_'"'??»% control plenti eGFP vector Repievented as mean «T^i#?J#l''?»s|^1 p-Actin 111 values -i SEM.*+*P< 0 001 Bay 1 Say 2 Das $ 152 Claudin-15 is a direct gene target for Hnf4a and increases paracellular conductance in polarized T84 colonic epithelial cells Since Claudin-15 (Cldnl5) was one of the earliest modified transcripts in Hnf4a colon null mice, we verified its status as a direct gene target for Hnf4a. Analysis of the first lkb of the mouse Cldnl5 gene promoter with the TRANSFAC database predicted 4 putative Hnf4a binding sites (Figure 6A). The ability of Hnf4a to interact with these sites was monitored by EMSA. Nuclear extracts from 293T cells expressing exogenous Hnf4a led to a specific shift complex for two of the predicted sites (BS-1 and BS-4) in a comparable manner to a previously validated Hnf4a site within the Apod gene promoter [10] (Figure 6A). This shift complex was specific for Hnf4a interaction as demonstrated with the formation of a supershift complex when Hnf4a antibodies were included in the binding reaction but not when substituted with control antibodies (Figure 6A). ChIP assays were next performed on isolated mouse colonocytes. Immunoprecipitations of the chromatin with Hnf4a antibodies followed by PCR amplifications of different Cldnl5 regions were performed. Hnf4a consistently pulled down the BS-1 and BS-4 containing genomic regions of Cldnl5 in contrast to the BS-2 region, negative for Hnf4a interaction by EMSA and not immunoprecipitated under these conditions (Figure 6B). Forced expression of Hnf4a in cultured intestinal epithelial cells resulted in a significant increase of Cldnl5 gene transcript (Figure 6C). Exogenous expression of Cldnl5 in the T84 colon cell line was next achieved to monitor the function of Cldnl5 on ion conductance in the context of colonic epithelial cells (Figure 6D). Controls and Cldnl5 T84 cell monolayers were seeded onto semipermeable filters and conductance was monitored after each cell populations had reached confluence. A significant increase in ion conductance was maintained for several days in T84/Cldnl5 as compared to T84 control cell populations (Figure 6E). These results indicated that Hnf4a 153 was able to activate Cldnl5 expression probably via direct transcriptional mechanisms and confirmed that Cldnl5 was potent to increase ion conductance in the context of a colonic epithelial cell monolayer. Down-modulation of HNF4A correlates with decreased expression of CLDN15 in experimental colitis and IBD HNF4oc was reported to be decreased during experimental colitis and IBD [12]. The expression status of CLDN15 in the disease was assessed by qRT-PCR in comparison to HNF4A. DSS-induced colitis led to a significant Cldnl5 reduction in the colon similarly to Hnf4a levels (Figure 7A). The expression of both HNF4A (Figure 7B) and CLDN15 (Figure 7C) gene transcripts were significantly reduced in intestinal biopsies from IBD patients as compared to controls. These observations further supported a close relationship between Hnf4a and Cldnl5 expression during intestinal inflammatory diseases. A B HNF4A C CLDN15 5 1-5"HWaterD2.5'*DSS o15" 20 'tIo 1 (A I 1.5- >r 1.0 Si 1.0 x < < a -T- z z a. O. i 1.0- -t- ' £ 0.5 E 0.5- • . 1§ 0.5-1 1 ». * "^ a. o.O n |n i «*&•••• a o.O Hnf4I','« CldnlTU S K o.O Control UC Control UC FIGURE 7 | HNF4A expression is reduced in IBD patient samples in association with Claudin-15. (A) qRT-PCR of Hnf4a and claudin-15 expression following 10 days of 2.5% DSS mild treatment in the distal colon of CD1 mice relative to water treated mice. HNF4A expression was retained at 22% (B) and claudin- 15 was retained at 37% (C) in ulcerative colitis (UC) patient samples (n=21) as compared to healthy patient samples (CTRL) (n=6). Represented as mean values ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001. 154 3.8 Discussion HNF4a transcriptional regulator is critical during the ontogeny and normal development of certain organs as well as in the pathogenesis of human disorders. Its roles have been ascertained for homeostasis of liver and pancreatic function and have been functionally linked to diabetes [25]. HNF4a is crucial to the polarization of cultured intestinal epithelial cells and to the initiation of their morphological and genetic differentiation in vitro [5]. Hnf4a is also essential to colonic epithelial cell differentiation during early mouse embryonic development [10]. However, small intestine deletion of Hnf4a following embryonic development results in minor defects on epithelial differentiation [11]. Here, our findings identify HNF4a as an important regulator of gut mucosal ion transport rather than mucosal permeability. In addition, a long term and chronic inflammatory consequence arising from the colonic epithelial loss of this transcriptional regulator was observed. The delayed manifestation of the clinical symptoms related to the colonic disease indicates that loss of Hnf4a involves complex mechanistically interactions that ultimately lead to the development of the disease. The pathogenesis of IBD is complex and involves susceptibility genes, the epithelial barrier function, innate and adaptive immunity and environmental factors including bacteria [26]. The only premature defect we were able to identify in the colon of Hnf4a null mice was a decline in ion transport. We propose that rapid down-modulation of Hnf4a-dependent transcriptional targets such as Cldnl5 can cause defects in epithelial ion transport ultimately leading to histopathological changes resembling those seen in patients with IBD. Hnf4a was recently reported to be required in colon epithelial cells to protect against dextran sodium sulphate (DSS), a commonly used model of acute intestinal injury that does 155 not result in chronic inflammatory disease [12]. The Muc3 gene, a transcriptional target of Hnf4a [10], was reported to be down-modulated in young adult Hnf4a colon null mice and was proposed to account for the Hnf4a protective effect. This specific transmembrane mucin is localized both in absorptive and goblet cells [27] and can reduce mucosal ulceration and apoptosis in experimental acute colitis [28]. Thus reduction in Muc3 could be partly involved in the long term spontaneous disease of Hnf4a colon null mice. However and in contrast to Ahn et al. [12], we observed that goblet cell maturation was not significantly altered in young adult Hnf4a colon mutant mice and that the Muc2 gene transcript was only decreased in later stages, in association with the depletion of goblet cells in hyperplasic crypts. The results suggest the latter is not a primary event in the initiation of the disease but rather a consequence of progression of colonic inflammation. Colonic goblet cell maturation was reported to be altered in embryonic Hnf4a colon mutant mice with the use of another mouse conditional knockout system [10]. The precise window of time in which intestinal Hnf4a was altered differs in our study, as compared to what had been previously reported [10]. The FoxaJ-Cre transgene utilized in the latter study efficiently removed Hnf4a at embryonic day 7.0, a period that precedes the onset of intestinal epithelial monolayer formation and cytodifferentiation. The Villin-Cre transgene has been reported to be active at a period following the onset of intestinal cytodifferentiation [11]. We conclude that the presence of Hnf4a no longer interferes with cell epithelial differentiation or goblet cell maturation after determination has occurred during early intestinal ontogeny. Increased mucosal permeability was also reported to occur in adult Hnf4a colon null mice when administrated with DSS for several days [12]. Although the exact mechanism by which DSS induces acute colitis are still not well described, there are suggestions that epithelial cells might become sensitive to this chemical to result in a loss of epithelial integrity. We did not 156 observe any change in paracellular permeability as measured by 51Cr-EDTA flux in adult Hnf4a colon null mice suggesting that spontaneous inflammatory disorder in this mouse model was not due to initial defects in tight junction dysfunction. In support of this, it was recently demonstrated that intestinal barrier loss in transgenic mice can accelerate the onset and severity of experimental colitis but is insufficient to lead in spontaneous inflammatory disease [29]. Our findings support the important conclusion that the solely loss of intestinal Hnf4a can initiate, by itself, epithelial defects that are resulting in spontaneous inflammatory disease. A detailed gene profiling of Hnf4a colon null mice identified important classes of molecules with known functions in cell death, ion transport and cell cycle regulation. Our data indicate that three claudin family members (claudin-4, -8 and -15), crucial components of epithelial tight junctions, are deregulated long before the histopathological manifestations of the disease. Hnf4a colon null mice displayed a significant increase in the expression of claudin-4 and claudin-8 without any suggestion of relocalization in the mucosa, as studied by immunofluorescence. As expected, these modulations did not have an impact on mucosal permeability. Cldnl5 was recently demonstrated to function as a paracellular ion transport without interfering in tight junction barrier function [23]. This function was confirmed in the mouse intestine by the generation of a claudin-15 knockout model that led to intestinal epithelial cell alterations, including enhanced proliferation and decreased electrical conductance without noticeable impact on mucosal permeability [24]. These findings are consistent with reduced claudin-15 expression in the upper half of the colonic mucosa in relation to the reduction of ion transport but not permeability that we observed in the Hnf4a colon null mice. There is growing evidence that specific defects in ion transport can lead to 157 altered water movements and contribute to symptom generation and diarhea in IBD and spontaneous colitis in mice [30,31]. Such defects can result in the alteration of acidic pH of the intestinal surface and favour bacterial adhesion to further facilitate microbial-epithelial interactions and translocation contributing to the inflammatory change. Functional variants of SLC22A4 and SLC22A5 ion transporter genes that alter their transcription and transporter functions are associated with the Crohn's disease IBD5 locus [32]. Our observations are suggestive of a cascade effect of several ion transporters being altered in the Hnf4a colon null mice and to become important contributors to the long term onset of the disease in this context. The detection of increased cleaved effector forms of caspase-3 as well as sporadic crypt hyperplasic regions in the colonic mucosa of Hnf4a mutant mice are consistent with the alterations predicted by the specific gene networks identified from the gene profiling analysis. Evidence is accumulating indicating that a defect in apoptosis is involved in the pathogenesis of IBD [33,34]. In addition, E2F family members are recognized as important modulators of both cell division and apoptosis within developing tumors [35]. The long term observation of rare polyp initiation in some of the Hnf4a mutant mice could suggest that cumulated defects associated with colonic crypt distortion could eventually lead to tumor initiation under specific circumstances. Hnf4a down-regulates cell proliferation through the transcriptional activation of the cyclin-dependent-kinase inhibitor p21/CIPl/WAFl [36]. However, the proliferation index of colonic epithelial cells in young adult mice was comparable between control and Hnf4a mutant mice (data not shown) and was consistent to what has been reported in the colonic embryonic situation [10]. Thus, the specific hyperplasic regions that develop in the absence of Hnf4a are probably the consequence of 158 early molecular defects that influence the establishment of this phenotype. In accordance with this reasoning, IBD patients manifest an increased risk of developing colon cancer because persistent inflammation will lead to increased cellular turnover with selection pressures may result in the emergence of cells that are at high risk for malignant transformation [37]. We conclude that Hnf4a integrity is crucial to maintaining the fundamental properties of the colonic mucosa in protecting the host against luminal components that are likely to be disruptive, in the long term, to mucosal, immune homeostasis, potentially leading to episodes of colonic inflammation as observed in human IBD. HNF4A transcriptional regulator along with ion transport related target genes that include CLDN15 represent promising candidates to dissect at the molecular level the delayed manifestation of IBD and might help to better define the predicting risk of IBD susceptibility among human populations. 3.9 Acknowledgements The authors thank Elizabeth Herring for critical reading of the manuscript, Dr. D.L Gumucio for providing the 12.4KbVilCre transgenic line, Denis Martel and Charles Bertrand for assistance in electron microscopy procedures, and the Microarray Platform Lab from McGill University and Genome Quebec Innovation Centre for generation of the cDNA arrays. We thank Ms. Jennifer Jury for her technical expertise in intestinal permeability measurements. 159 3.10 Supplementary data Supplementary Table 1 | Inflammatory mediator profile in diseased Hnf4a null colon Gene Controls Mutants Ratio p-value (Mean ± SD) (Mean ± SD) CD30L 35,5 ± 25,03 455,75 ±161,71 12,8380 0,0826 Eotaxin(CCL11) 4186,00 ±1908,09 4503,75 ±1141,51 1,0759 0,8954 Eotaxin-2 (CCL24) 794,33 ±119,19 1402, 75 ±372,83 1,7659 0,2179 Fas 27,17 ±14,04 870,13 ±735,74 32,0291 0,5351 Fractalkine(CX3CL1) 564,67 ±150,97 752,00 ±214,64 1,3318 0,5147 GCSF 447,3 ± 95,02 320,13 ±38,08 0,7156 0,3399 GM-CSF 125,50 ±51,70 527,75 ± 74,37 4,2052 0,0113 IFN-g 300,00 ± 84,07 1593,25 ±1180,64 5,3108 0,3545 IL-1 alpha 597,33 ±175,06 2546,13 ±798,45 4,2625 0,0973 IL-lbeta 135,33 ±20,69 453,38 ±112,83 3,3501 0,0694 IL-2 1528,83 ±1208,96 2455,75 ± 895,63 1,6063 0,5814 IL-3 181,67 ±25,07 374,25 ± 90,72 2,0601 0,1333 IL-4 1455,67 ±1176,55 370,00 ± 53,06 0,2542 0,4539 IL-6 85,17 ±30,13 304,13 ±61,91 3,5709 0,0335 IL-10 567,67 ±493,32 827,38 ± 236,38 1,4575 0,6817 IL-12p40p70 22,17± 14,15 268,75 ± 66,67 12,1241 0,0363 IL-12p70 346,33 ±183,79 543,13 ±120,06 1,5682 0,4361 IL-13 223,67 ± 59,93 755,13 ±104,07 3,3761 0,0115 IL-17 209,67 ± 86,24 1823,13 ±625,41 8,6953 0,0835 l-TAC(CXCL11) 209,33 ± 64,92 724,38 + 140,34 3,4604 0,0291 KC(CXCL1) 78,83 ±19,96 354,50 ±65,08 4,4968 0,0271 Leptin 123,33 ±45,46 477,38 ±108,03 3,8706 0,0567 LIX (CXCL5) 196,33 ±96,98 873,0 ±169,00 4,4465 0,0255 Lymphotactin(XCLI) 306,00 ± 143,93 935,13 ±198,08 3,0560 0,0620 MCP-1 (CCL2) 109,50 ±14,00 218,63 ±43,10 1,9966 0,0952 MCSF 100,17±41,16 592,50 ±189,41 5,9151 0,0847 MIG (CXCL9) 122,00 ±27,27 393,25 ± 76,99 3,2234 0,0450 MIP-1 alpha (CCL3) 108,67 ±30,49 281,13 ±51,70 2,5870 0,0453 MIP-1 gamma (CCL9) 21774,17 ±2083,51 24224,50 ± 7639,58 1,1125 0,7772 RANTES (CCL5) 552,83 ± 280,78 1835,75 ±709,21 3,3206 0,1912 SDF-1 (CXCL12) 905,67 ±618,64 2757,13 ±1125,30 3,0443 0,2228 TCA-3(CCL1) 192,83 ±44,76 1724,63 ±566,30 8,9436 0,0740 TECK (CCL25) 90,17 ±46,23 378,25 ± 28,60 4,1950 0,0131 TIMP-1 876,83 ± 294,83 1372,38 ±181,07 1,5651 0,2475 TIMP-2 189,17 ±43,73 654,25 ±126,62 3,4586 0,0403 TNF-alpha 239,67 ± 8,01 611,50 ±73,02 2,5515 0,0149 STNF-RI 8162,17 ±879,65 8909,88 ± 2228,39 1,0916 0,7754 STNF-RII 1891,50 ±271,02 2923,50 ±838,30 1,5456 0,3260 ' Ratio of 3 to 4 Hnf4alpha mutants/3 to 4 controls, measurements done in duplicate 2 unpaired t test Welch's corrected Supplementary Table 2 | Genes modulated by > 2.0 in diseased Hnf4a null colon Unigene Gene name Gene Colon symbol p-value Mm 24547 arylacetamide deacetylase (esterase) Aadac 0,0363 0,0002 Mm 259315 4-aminobutyrate aminotransferase Abat 0,2757 0,0025 Mm 160386 ABO blood group (transferase A, alpha 1-3-N- Abo 5,2518 0,0002 acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase) Mm 213898 amilonde binding protein 1 (amine oxidase, copper- Abp1 0,2602 0,0026 containing) Mm 379402 acetyl-Coenzyme A acyltransferase 1B Acaalb 0,2431 0,0091 Mm 388 adenosine deaminase Ada 2,0648 0,0478 Mm 89943 a disintegnn and metallopeptidase domain 18 Adam18 2,2714 0,0028 Mm 65867 a disintegnn-like and metallopeptidase (reprolysin Adamts15 2,1696 0,0032 type) with thrombospondin type 1 motif, 15 Mm 331690 ADAMTS-like 1 AdamtsU 0,4924 0,0404 Mm 40740 adenosine A2b receptor /// similar to Adenosine Adora2b 2,6877 0,0044 A2b receptor Mm 33438 1-acylglycerol-3-phosphate O-acyltransferase 7 Agpat7 2,7382 0,0001 (lysophosphatidic acid acyltransferase, eta) Mm 35062 angiotensin II receptor, type 1a Agtrla 0,3374 0,0452 Mm 29368 angiotensin receptor-like 1 Agtrll 0,3370 0,0294 Mm 284102 expressed sequence AI467606 AI467606 0,4421 0,0236 Mm 440040 expressed sequence AI747448 AI747448 5,1175 0,0487 Mm 441718 expressed sequence AI843639 AI843639 2,3550 0,0291 Mm 5378 aldo-keto reductase family 1, member B8 Akr1b8 3,1599 0,0001 Mm 26838 aldo-keto reductase family 1, member C14 Akr1c14 0,4345 0,0080 Mm 290578 aminolevulinic acid synthase 1 Alasl 2,2094 0,0083 Mm 140988 aldehyde dehydrogenase family 1, subfamily A3 Aldh1a3 5,6204 0,0000 Mm 266843 aldehyde dehydrogenase 3 family, member B2 Aldh3b2 5,1437 0,0008 Mm 218862 aldolase 2, B isoform Aldob 0,0437 0,0000 Mm 58068 alkaline phosphatase, intestinal Alpi 0,2547 0,0129 Mm 2197 alpha 1 microglobuhn/bikunin Ambp 2,2946 0,0145 Mm 197639 amnionless Amn 0,1162 0,0001 Mm 343899 angiogenin, nbonuclease A family, member 4 Ang4 0,1965 0,0283 Mm 220242 ankynn 2, brain Ank2 0,4806 0,0138 Mm 24790 ankynn repeat and KH domain containing 1 Ankhdl 0,4288 0,0009 Mm 183030 ankynn repeat domain 22 Ankrd22 5,2870 0,0001 Mm 39732 ankynn repeat domain 35 Ankrd35 3,9917 0,0002 Mm 334517 ankynn repeat domain 37 Ankrd37 0,4236 0,0003 Mm 248360 annexm A1 Anxal 3,1842 0,0001 Mm 237985 annexm A13 Anxa13 0,4570 0,0090 Mm 7214 annexm A3 Anxa3 3,0563 0,0380 Mm 3267 annexm A8 Anxa8 4,7948 0,0003 Mm 426783 adaptor-related protein complex 1, sigma 2 subunit Ap1s2 0,4169 0,0304 Mm 32409 adaptor-related protein complex AP-1, sigma 3 Ap1s3 3,5003 0,0001 Mm 435539 apolipoprotein B Apob 0,1202 0,0008 Mm 28394 apolipoprotein C-ll Apoc2 0,3746 0,0228 Mm 34043 aquaponn 3 Aqp3 5,9930 0,0067 Mm 298599 aquaponn 4 Aqp4 10,8986 0,0012 Mm 25405 activity regulated cytoskeletal-associated protein Arc 4,0562 0,0030 Mm 8039 amphiregulin Areg 11,1373 0,0004 Mm 3506 arginase type II Arg2 0,2993 0,0178 Mm 383216 asponn Aspn 0,2821 0,0390 Mm 275744 autophagy related 16 like 2 (S cerevisiae) Atg16l2 0,4059 0,0075 Mm 207432 ATPase, Na+/K+ transporting, alpha 2 polypeptide Atp1a2 0,3681 0,0406 Mm 458098 ATPase, H+ transporting, lysosomal V0 subunit E2 Atp6v0e2 0,4798 0,0005 Mm 249363 aurora kinase A Aurka 2,0406 0,0048 Mm 3488 aurora kinase B Aurkb 2,0708 0,0116 Mm 154783 UDP-Gal betaGlcNAc beta 1,3- B3galt5 2,4297 0,0397 galactosyltransferase, polypeptide 5 Mm 290837 UDP-GlcNAc betaGal beta-1,3-N- B3gnt3 2,1152 0,0205 acetylglucosaminyltransferase 3 Mm 398181 UDP-Gal betaGlcNAc beta 1,4- B4galt6 /// LOC675709 2,7210 0,0022 galactosyltransferase, polypeptide 6 /// similar to Beta-1,4-galactosyltransferase 6 (Beta-1,4- GalTase 6) (Beta4Gal-T6) (b4Gal-T6) (UDP- galactose beta-N-acetylglucosamme beta-1,4- galactosyltransferase 6) (UDP-Gal beta-GlcNAc beta-1,4-galactosyltransferase 6) Mm 443387 cDNA sequence BC015286 BC015286 0,1730 0,0004 Mm 315382 cDNA sequence BC040758 BC040758 0,4424 0,0066 Mm 256058 cDNA sequence BC055107 BC055107 0,4212 0,0154 Mm 34420 cDNA sequence BC067047 BC067047 2,3867 0,0001 Mm 24210 branched chain aminotransferase 2, mitochondrial Bcat2 2,7073 0,0028 — expressed sequence BE136769 BE136769 0,3494 0,0147 Mm 267006 Bcl2-interacting killer Bik 2,1680 0,0008 Mm 428950 bone morphogenetic protein 5 Bmp5 0,4959 0,0385 Mm 331209 BCL2/adenovirus E1B 19kD interacting protein like Bnipl 4,9837 0,0002 Mm 244975 breast cancer 1 Brcal 2,0022 0,0025 Mm 2024 betacellulin, epidermal growth factor family Btc 2,4038 0,0003 member Mm 280211 RIKEN cDNAC130090K23 gene C130090K23Rik 2,9577 0,0020 Mm 441405 Hypothetical protein C130094E24 C130094E24 0,4856 0,0239 Mm 280158 C1q and tumor necrosis factor related protein 3 C1qtnf3 0,2966 0,0126 Mm 259334 RIKEN cDNA C630028N24 gene C630028N24Rik 0,4163 0,0050 Mm 458591 RIKEN CDNAC730049O14 gene C730049O14Rik 0,4469 0,0017 Mm 457970 histocompatibility 2, T region locus 23 /// RIKEN C920025E04Rik /// H2- 0,4542 0,0025 cDNA C920025E04 gene /// similar to MHC class T23///LOC100046736 lb antigen Qa-1c Mm 40717 Cdk5 and Abl enzyme substrate 1 Cablesl 0,4549 0,0004 Mm 178322 cell adhesion molecule 4 Cadm4 5,2758 0,0018 Mm 18626 capping protein (actin filament), gelsohn-like Capg 4,5676 0,0029 Mm 326847 calpain 5 Capn5 2,3431 0,0011 Mm 1641 carbonic anhydrase 4 Car4 0,1553 0,0001 Mm 4215 catalase Cat 0,4812 0,0056 Mm 28278 caveolin, caveolae protein 1 Cav1 0,4449 0,0367 Mm 21454 carbonyl reductase 2 Cbr2 9,1602 0,0005 Mm 4512 carbonyl reductase 3 Cbr3 2,3320 0,0175 Mm 206417 cystathionine beta-synthase Cbs 2,5928 0,0031 Mm 102168 coiled-coil domain containing 122 Ccdc122 2,0297 0,0365 Mm 338284 coiled coil domain containing 88A Ccdc88a 0,4967 0,0465 Mm 7275 chemokine (C-C motif) ligand 25 Ccl25 0,2451 0,0001 Mm 260114 cychn B1, related sequence 1 /// cyclin B1 /// Ccnbl ///Ccnb1-rs1 /// 2,0200 0,0300 predicted gene, EG434175 /// similar to cyclin B1 EG434175/// LOC667005 Mm 247595 cyclin J-like Ccnjl 3,1108 0,0032 Mm 245851 Cd200 antigen Cd200 0,4165 0,0135 Mm 227281 CD302 antigen Cd302 0,3845 0,0050 Mm 18628 CD36 antigen Cd36 0,4109 0,0044 Mm 1738 CD48 antigen Cd48 0,4831 0,0019 Mm 24130 CD52 antigen Cd52 0,4470 0,0183 Mm 316861 CD53 antigen Cd53 0,4688 0,0291 Mm 15819 CD68 antigen Cd68 2,4315 0,0068 Mm 334648 CD97 antigen Cd97 0,4855 0,0249 Mm 38444 cell division cycle 25 homolog B (S pombe) Cdc25b 2,0501 0,0046 Mm 195932 CDC42 effector protein (Rho GTPase binding) 2 Cdc42ep2 2 2735 0 0010 Mm 20912 cell division cycle 6 homolog (S cerevisiae) Cdc6 2,0436 0,0003 Mm 1571 cadhenn 11 Cdh11 0,4559 0,0314 Mm 168789 cyclin-dependent kinase inhibitor 1C (P57) Cdknlc 0,3960 0,0031 Mm 98097 CEA-related cell adhesion molecule 20 /// similar to Ceacam20 /// 0,1319 0,0016 CEA-related cell adhesion molecule 20 LOC100047640 Mm 9916 centrosomal protein 55 Cep55 2,2107 0,0079 Mm 425547 carboxylesterase 2 /// similar to Carboxylesterase 2 Ces2 /// LOC667754 0,4910 0,0013 Mm 441134 carboxylesterase 5 Ces5 0,1277 0,0004 Mm 212983 carboxylesterase 6 Ces6 0,0207 0,0001 Mm 653 complement factor B Cfb 0,2904 0,0004 Mm 259916 choline dehydrogenase Chdh 0,4224 0,0012 Mm 288897 choline phosphotransferase 1 Chptl 0,3625 0,0146 Mm 454553 chloride channel calcium activated 1 Clcal 2,3214 0,0068 Mm 20897 chloride channel calcium activated 2 Clca2 7,4728 0,0000 Mm 33483 chloride channel calcium activated 3 Clca3 0,3268 0,0085 Mm 290600 chloride channel calcium activated 4 Clca4 4,9690 0,0001 Mm 177761 chloride channel 2 Clcn2 0,4984 0,0002 Mm 7339 claudin 4 Cldn4 4,4752 0,0018 Mm 25836 claudin 8 Cldn8 3,0559 0,0059 Mm 280563 C-type lectin domain family 14, member a Clec14a 0,3477 0,0007 Mm 30870 C-type lectin domain family 2, member e Clec2e 0,4849 0,0165 Mm 257765 chloride intracellular channel 4 (mitochondrial) Chc4 0,4028 0,0278 Mm 8396 cytidine monophospho-N-acetylneuramimc acid Cmah 2,9860 0,0463 hydroxylase Mm 22847 cordon-bleu Cobl 0,3276 0,0004 Mm 154093 procollagen, type XXIII, alpha 1 Col23a1 0,4138 0,0408 Mm 393405 coactosin-hke 1 (Dictyostehum) CotH 2,2283 0,0054 Mm 343942 carbamoyl-phosphate synthetase 1 Cps1 0,1949 0,0152 Mm 304143 Ig kappa chain Cr1 0,1052 0,0449 Mm 272368 cysteine-nch protein 1 (intestinal) Cnp1 0,4671 0,0011 Mm 300592 cystatin A Csta 169,4288 0,0000 Mm 393058 connective tissue growth factor Ctgf 0,2947 0,0153 Mm 230249 cathepsin E Ctse 4,9273 0,0004 Mm 313915 cubilm (intrinsic factor-cobalamin receptor) Cubn 0,2381 0,0002 Mm 6522 chemokme (C-X-C motif) receptor 7 Cxcr7 0,3998 0,0483 Mm 200362 cytochrome b-245, beta polypeptide Cybb 0,4332 0,0266 Mm 174372 cytochrome P450, family 2, subfamily d, Cyp2d10 0,1168 0,0013 polypeptide 10 Mm 157435 cytochrome P450, family 2, subfamily d, Cyp2d22 0,3926 0,0127 polypeptide 22 Mm 439931 cytochrome P450, family 2, subfamily d, Cyp2d26 0,0779 0,0005 polypeptide 26 Mm 436843 cytochrome P450, family 2, subfamily d, Cyp2d34 0,1181 0,0021 polypeptide 34 Mm 4515 cytochrome P450, family 2, subfamily f, Cyp2f2 11,3547 0,0001 polypeptide 2 Mm 98200 cytochrome P450, family 2, subfamily j, polypeptide Cyp2j6 2,0199 0,0187 6 Mm 275188 cytochrome P450, family 2, subfamily s, Cyp2s1 0,4155 0,0071 polypeptide 1 Mm 289886 cytochrome P450, family 3, subfamily a, Cyp3a13 0,4206 0,0244 polypeptide 13 Mm 1840 cytochrome P450, family 4, subfamily b, Cyp4b1 0,0787 0,0001 polypeptide 1 Mm 426027 cytochrome P450, family 4, subfamily f, Cyp4f14 0,1741 0,0017 polypeptide 14 Mm 245297 cytochrome P450, family 4, subfamily v, Cyp4v3 0,4174 0,0005 polypeptide 3 Mm 426874 RIKEN cDNA D030011010 gene D030011O10Rik 0,2862 0,0001 Mm 392520 RIKEN cDNA D230012E17 gene D230012E17Rik 3,0296 0,0011 Mm 133704 DNA segment, Chr 7, ERATO Doi 715, expressed D7Ertd715e 0,4169 0,0060 Mm 325522 RIKEN cDNA D930028F11 gene D930028F11Rik 5,0242 0,0007 Mm 26361 doublecortin-hke kinase 3 Dclk3 0,4992 0,0002 Mm 56769 deconn Den 0,4210 0,0400 Mm 231091 dicarbonyl L-xylulose reductase Dcxr 2,0256 0,0111 Mm 302938 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y- Ddx3y 29,6356 0,0000 hnked Mm 180189 diacylglycerol O-acyltransferase 2 Dgat2 3,1223 0,0032 Mm 148342 deiodinase, lodothyronine, type I Dio1 0,4840 0,0022 Mm 30138 dermokine Dmkn 5,5990 0,0005 Mm 133473 dedicator of cytokinesis 10 Dock10 0,4708 0,0463 Mm 20388 dipeptidase 1 (renal) Dpepl 0,2800 0,0014 Mm 27907 dihydropynmidine dehydrogenase Dpyd 0,0295 0,0000 Mm 16479 dual specificity phosphatase 9 Dusp9 4,7142 0,0013 Mm 220982 dysferlin /// fer-1-hke 3, myoferlm (C elegans) Dysf///Fer1l3 2,6275 0,0001 Mm 323386 RIKEN cDNA E030018N11 gene E030018N11Rik 0,4686 0,0116 Mm 307932 E2F transcription factor 2 E2f2 2,6280 0,0019 Mm 28649 RIKEN cDNA E430002G05 gene E430002G05Rik 0,4695 0,0102 Mm 213009 predicted gene, EG433023 EG433023 0,4568 0,0049 Mm 305097 immunoglobulin kappa chain variable 28 (V28) /// EG637227///lgk-V19-14 0,2313 0,0355 immunoglobulin kappa chain variable 8 (V8) /// /// lgk-V21 /// lgk-V21-4 immunoglobulin kappa chain variable 21 (V21)-4 /// /// lgk-V28 /// lgk-V8 /// predicted gene, EG637227 /// immunoglobulin LOC100047628/// kappa chain vanable 19 (V19)-14 /// V(kappa) gene LOC672450 /// product /// similar to Ig kappa chain V-V region LOC676175 MPC11 precursor/// immunoglobulin kappa chain variable 21 (V21) /// similar to Chain L, Structural Basis Of Antigen Mimicry In A Clinically Relevant Melanoma Antigen System Mm 439676 histocompatibility 2, blastocyst /// predicted gene, EG667977 /// 3,4707 0,0191 ENSMUSG00000073403 /// similar to MHC class I ENSMUSG00000073403 antigen precursor /// similar to RT1 class I /// H2-BI /// LOC547349 histocompatibility antigen, AA alpha chain /// LOC637146 /// precursor /// similar to HLA-G protein /// predicted LOC667782 /// gene, EG667977 /// similar to RT1 class la, locus LOC674137/// A1 /// similar to RT1 class lb gene, H2-TL-hke, grc LOC675328 /// region (N3) LOC676837 Mm 250909 eukaryotic translation initiation factor 2, subunit 3, Eif2s3y 32,9188 0,0000 structural gene Y-hnked Mm 3913 enolase 2, gamma neuronal Eno2 0,4361 0,0061 Mm 1193 glutamyl aminopeptidase Enpep 0,1714 0,0033 Mm 412928 predicted gene, ENSMUSG00000073738 ENS M USG00000073738 4,3369 0,0003 Mm 131135 erythrocyte protein band 4 1-like 3 Epb4 1l3 0,2655 0,0013 Mm 2581 Eph receptor A2 Epha2 2,9792 0,0015 Mm 248620 epsin 3 Epn3 3,2346 0,0005 Mm 267131 endoplasmic reticulum metallopeptidase 1 Ermpl 2,3037 0,0001 Mm 292415 E26 avian leukemia oncogene 1, 5' domain Ets1 0,4019 0,0185 Mm 293683 envoplakin Evpl 2,0086 0,0024 Mm 282719 eyes absent 2 homolog (Drosophila) Eya2 6,3168 0,0000 Mm 22126 fatty acid binding protein 1, liver Fabpl 0,4235 0,0435 Mm 28398 fatty acid binding protein 2, intestinal Fabp2 0,1802 0,0012 Mm 582 fatty acid binding protein 4, adipocyte Fabp4 0,4183 0,0081 Mm 423078 fructose bisphosphatase 1 Fbp1 0,4121 0,0018 Mm 292042 F-box protein 32 Fbxo32 0,3712 0,0005 Mm 7996 fibroblast growth factor 12 Fgf12 6,3662 0,0002 Mm 7995 fibroblast growth factor 13 Fgf13 0,3562 0,0161 Mm 292100 fibnnogen-like protein 2 Fgl2 0,4600 0,0009 Mm 3126 four and a half LIM domains 1 Fhl1 0,2906 0,0126 Mm 236114 fidgetin-like 1 FignM 2,1876 0,0006 Mm 258908 Friend leukemia integration 1 Fh1 0,4800 0,0182 Mm 385180 flavin containing monooxygenase 5 /// similar to Fmo5///LOC100046051 0,3090 0,0011 Flavin containing monooxygenase 5 Mm 4913 folhstatin Fst 0,4624 0,0439 Mm 347430 glucose-6-phosphate dehydrogenase 2 /// glucose- G6pd2 /// G6pdx 2,0525 0,0089 6-phosphate dehydrogenase X-hnked Mm 14638 gamma-aminobutyric acid (GABA(A)) receptor- GabarapH 0,4986 0,0017 associated protein-like 1 Mm 99989 gamma-aminobutyric acid (GABA-A) receptor, pi Gabrp 3,0205 0,0003 Mm 443129 galactose-3-O-sulfotransferase 2 Gal3st2 0,2405 0,0049 Mm 40681 UDP-N-acetyl-alpha-D-galactosamine polypeptide Galntl2 0,3563 0,0041 N-acetylgalactosaminyltransferase-like 2 Mm 45494 glucagon Gcg 0,2630 0,0031 Mm 10651 GTP cyclohydrolase 1 Gch1 2,3006 0,0028 Mm 314757 glucosaminyl (N-acetyl) transferase 2, l-branchmg Gcnt2 0,4035 0,0064 enzyme Mm 247486 GTP binding protein (gene overexpressed in Gem 0,4480 0,0306 skeletal muscle) Mm 356653 gametogenetm binding protein 2 Ggnbp2 0,4686 0,0096 Mm 390369 gap junction membrane channel protein alpha 7 Gja7 0,3416 0,0307 Mm 173790 GLI pathogenesis-related 1 (glioma) Ghpr1 0,3425 0,0256 Mm 279756 glyoxalase domain containing 5 Glod5 0,3981 0,0028 Mm 41737 guanine nucleotide binding protein (G protein), Gng2 0,4476 0,0051 gamma 2 subumt Mm 392184 G protein-coupled receptor 39 Gpr39 2,3850 0,0023 Mm 213016 G protein-coupled receptor 64 Gpr64 2,5879 0,0008 Mm 23575 G protein-coupled receptor, family C, group 5, Gprc5a 2,7010 0,0136 member A Mm 138080 GPRIN family member 3 Gpnn3 0,4453 0,0005 Mm 30130 glutamic pyruvic transaminase 1, soluble Gpt1 0,3816 0,0018 Mm 394874 gene regulated by estrogen in breast cancer Grebl /// 2,2198 0,0067 protein /// similar to Grebl protein LOC100045413 Mm 263068 grainyhead-like 1 (Drosophila) /// similar to GrhH Grhl1///LOC100043996 5,7357 0,0009 protein Mm 331972 grainyhead-like 3 (Drosophila) Grhl3 16,0755 0,0001 Mm 20298 gastrin releasing peptide Grp 0,2786 0,0038 Mm 20826 G1 to S phase transition 2 Gspt2 2,5261 0,0023 Mm 422778 glutathione S-transferase, alpha 1 (Ya) /// Gstal /// Gsta2 /// 0,3524 0,0022 glutathione S-transferase, alpha 2 (Yc2) /// similar LOC100042295 to Glutathione S-transferase, alpha 1 (Ya) Mm 2662 glutathione S-transferase, alpha 4 Gsta4 2,5493 0,0024 Mm 458154 glutathione S-transferase, mu 6 Gstm6 4,3891 0,0010 Mm 458189 glutathione S-transferase, mu 7 Gstm7 2,0676 0,0025 Mm 143831 guanylate cyclase 1, soluble, alpha 3 Gucy1a3 0,2728 0,0292 Mm 9445 guanylate cyclase 1, soluble, beta 3 Gucy1b3 0,4387 0,0336 Mm 235338 histocompatibility 2, class II antigen A, alpha H2-Aa 0,2818 0,0368 Mm 289681 heparm-binding EGF-like growth factor Hbegf 2,5250 0,0113 Mm 310551 histone deacetylase 9 Hdac9 2,0261 0,0011 Mm 35551 heme binding protein 2 Hebp2 3,0047 0,0002 Mm 57223 helicase, lymphoid specific Hells 2,3483 0,0007 Mm 46218 histidine triad nucleotide binding protein 3 Hint3 2,0722 0,0014 Mm 255848 hexokinase 2 /// hypothetical protein Hk2///LOC100043412 2,7775 0,0003 LOC100043412 /// hypothetical protein ///LOC100047934 LOC100047934 Mm 213213 hexokinase domain containing 1 Hkdd 0,2881 0,0003 Mm 202383 hepatic nuclear factor 4, alpha Hnf4a 0,2314 0,0000 Mm 228 homer homolog 2 (Drosophila) Homer2 0,4498 0,0221 Mm 270641 hippocalcin-like 4 HpcaW 2,4753 0,0011 Mm 284944 hydroxysteroid (17-beta) dehydrogenase 13 Hsd17b13 0,1215 0,0018 Mm 285710 hydroxysteroid (17-beta) dehydrogenase 14 Hsd17b14 2,4711 0,0042 Mm 75856 heat shock transcription factor 2 binding protein Hsf2bp 2,0786 0,0007 Mm 13849 heat shock protein 1 Hspbl 0,3242 0,0457 Mm 46181 heat shock protein family, member 7 Hspb7 0,4723 0,0160 (cardiovascular) Mm 25613 immediate early response 3 Ier3 2,4242 0,0020 Mm 458430 interferon activated gene 203 Ifi203 0,4897 0,0345 Mm 261270 interferon activated gene 203 Ifl203 /// Ifi204 /// Ifi205 0,4467 0 0187 Mm 29254 insulin-like growth factor binding protein 3 Igfbp3 0,2761 0,0245 Mm 342177 immunoglobulin heavy chain 6 (heavy chain of lgh-6 0,3202 0,0045 IgM) Mm 1192 immunoglobulin joining chain igj 0,2356 0,0286 Mm 333139 immunoglobulin kappa chain variable 28 (V28) lgk-V21///lgk-V21-4/// 0,2741 0,0103 lgk-V28 /// lgk-V8 /// Mm 326349 immunoglobulin lambda chain, variable 1 lgl-V1 0,0645 0,0060 Mm 1410 interleukin 18 1118 2,0161 0,0047 Mm 882 interleukin 1 receptor antagonist 111m 8,4427 0,0004 Mm 392 mdoleamine-pyrrole 2,3 dioxygenase Indo 2,2417 0,0148 Mm 4677 interferon regulatory factor 4 Irf4 0,4508 0,0084 Mm 208286 itchy, E3 ubiquitin protein ligase Itch 0,3903 0,0193 Mm 227 integrm alpha V Itgav 2,0548 0,0103 Mm 1137 integrm beta 2 Itgb2 0,4865 0,0356 Mm 313876 inter-alpha (globulin) inhibitor H5 Itih5 0,3604 0,0001 Mm 247426 intelectin 1 (galactofuranose binding) /// similar to Itlnl /// LOC640587 0,2220 0,0453 lntelectin-1a precursor (Intestinal lactoferrm receptor) (Galactofuranose binding lectin) Mm 262676 jumonji, AT rich interactive domain 1D (Rbp2 like) Jandid 24,8036 0,0000 Mm 4489 potassium voltage-gated channel, subfamily H KcnM 2,1895 0,0035 (eag-related), member 1 Mm 224306 kelch-hke 13 (Drosophila) KIM13 0,4353 0,0276 Mm 282807 kelch-hke 22 (Drosophila) KIM22 0,4755 0,0007 Mm 440055 keratin 80 Krt80 2,0373 0,0054 Mm 44546 La nbonucleoprotein domain family, member 6 Larp6 0,4904 0,0287 Mm 29733 LIM domain binding 3 Ldb3 0,3737 0,0153 Mm 20973 lectin, galactose binding, soluble 7 Lgals7 0,4476 0,0315 Mm 299647 lipase, endothelial Lipg 3,2709 0,0081 similar to Leucine rich repeat containing 8 family, LOC100044683 3,0566 0,0003 member E Mm 25479 leucine rich repeat containing 8 family, member E LOC100044683/// 2,9331 0,0003 /// similar to Leucine rich repeat containing 8 family, Lrrc8e member E similar to Grebl protein LOC100045413 2,3017 0,0041 Mm 4502 minichromosome maintenance deficient 3 (S LOC100045677///Mcm3 2,1165 0,0010 cerevisiae) /// similar to DNA replication licensing factor MCM3 (DNA polymerase alpha holoenzyme- associated protein P1) (P1-MCM3) LOC100046051 0,3845 0,0026 similar to Flavin containing monooxygenase 5 LOC 100046959/// 0,3755 0,0011 Mm 126649 zinc finger protein 533 /// similar to zinc finger Zfp533 protein 533 LOC100047324/// 0,3196 0,0039 Mm 139418 sestnn 1 /// similar to Sesnl protein Sesnl Mm 275549 avian musculoaponeurotic fibrosarcoma (v-maf) LOC100047419///Maf 0,2318 0,0084 AS42 oncogene homolog /// similar to c-Maf long form Mm 23032 transmembrane emp24 protein transport domain LOC100047810/// 2,5520 0,0002 containing 6 /// similar to transmembrane emp24 Tmed6 protein transport domain containing 6 Mm 26159 solute carrier family 35, member F2 /// similar to LOC 100048307/// 0,4925 0,0190 Solute carrier family 35, member F2 Slc35f2 Mm 326911 ubiquitin specific peptidase 18 /// similar to ubiquitin LOC100048346/// 2,7722 0,0088 specific protease UBP43 Usp18 similar to histocompatibility 2, T region locus 3 LOC633417 4,1150 0,0494 Mm 424974 MARCKS-like 1 /// similar to MARCKS-like protein LOC668321 /// MarcksM 2,3523 0,0005 — similar to Beta-1,4-galactosyltransferase 6 (Beta- LOC675709 2,0977 0,0104 1,4-GalTase 6) (Beta4Gal-T6) (b4Gal-T6) (UDP- galactose beta-N-acetylglucosamine beta-1,4- galactosyltransferase 6) (UDP-Gal beta-GlcNAc beta-1,4-galactosyltransferase 6) hypothetical LOC73899 LOC73899 0,3388 0,0067 Mm 277958 lysophosphatidylglycerol acyltransferase 1 Lpgatl 2,0810 0,0024 Mm 33921 lecithin-retinol acyltransferase Lrat 0,2271 0,0012 (phosphatidylcholme-retinol-O-acyltransferase) Mm 271854 low density lipoprotein receptor-related protein 1 Lrp1 0,2800 0,0189 Mm 26760 leucine rich repeat containing 19 Lrrc19 0,0862 0,0002 Mm 26760 leucine rich repeat containing 19 Lrrc19 0,1524 0,0001 Mm 425949 lymphocyte antigen 6 complex, locus A Ly6a 2,8676 0,0029 Mm 215096 lymphocyte antigen 6 complex, locus G6C Ly6g6c 2,8128 0,0089 Mm 250491 lymphocyte antigen 6 complex, locus G6E Ly6g6e 3,6221 0,0006 Mm 275549 avian musculoaponeurotic fibrosarcoma (v-maf) Maf 0,4623 0,0438 AS42 oncogene homolog Mm 330745 v-maf musculoaponeurotic fibrosarcoma oncogene Mafb 0,4879 0,0475 family, protein B (avian) Mm 241656 monoamine oxidase B Maob 0,4608 0 0009 Mm 424974 MARCKS-like 1 Marcksll 2,8770 0,0003 166 Mm 89682 membrane bound O-acyltransferase domain Mboatl 2,7175 0,0030 containing 1 Mm 275003 melanoma cell adhesion molecule Mcam 0,4757 0,0435 Mm 5346 meprin 1 alpha Mepla 0,3271 0,0027 Mm 2682 meprin 1 beta Meplb 0,0183 0,0001 Mm 239655 c-mer proto-oncogene tyrosine kinase Mertk 0,4095 0,0002 Mm 23242 microfibrillar-associated protein 3-hke Mfap3l 2,0392 0,0396 Mm 331842 major facilitator superfamily domain containing 2 Mfsd2 2,1343 0,0221 Mm 29429 Midi interacting protein 1 (gastrulation specific Mid1ip1 2,1283 0,0001 G12-hke (zebrafish)) Mm 288898 myeloid/lymphoid or mixed lineage-leukemia Mllt3 2,0016 0,0019 translocation to 3 homolog (Drosophila) Mm 458933 male sterility domain containing 1 Mlstdl 0,3750 0,0002 Mm 247566 myeloid ecotropic viral integration site-related gene Mrg1 0,3802 0,0499 1 Mrgprf 0,4741 0,0130 Mm 215151 MAS-related GPR, member F Msn 0,3573 0,0480 Mm 138876 moesin Mt2 0,1553 0,0004 Mm 147226 metallothionem 2 Mtap2 2,7998 0,0112 Mm 256966 microtubule-associated protein 2 Mthfr 2,3172 0,0004 Mm 89959 5,10-methylenetetrahydrofolate reductase Muc16 6,3991 0,0211 Mm 159052 mucin 16 Muc4 2,4814 0,0068 Mm 214599 mucin 4 Mustnl 0,4616 0,0144 Mm 220895 musculoskeletal, embryonic nuclear protein 1 Myl7 2,9093 0,0484 Mm 46514 myosin, light polypeptide 7, regulatory Mylk 0,3459 0,0356 Mm 33360 myosin, light polypeptide kinase Myoml 0,4904 0,0194 Mm 4103 myomesin 1 Naaladll 0,1596 0,0005 Mm 359041 N-acetylated alpha-linked acidic dipeptidase-like 1 Nags 0,4488 0,0008 Mm 31686 N-acetylglutamate synthase Naip5 0,4862 0,0164 Mm 290476 NLR family, apoptosis inhibitory protein 5 Mm 9404 neuroblastoma, suppression of tumongenicity 1 NbM 0,3551 0,0184 0,4324 Mm 29846 N-myc downstream regulated gene 4 Ndrg4 0,0361 Mm 143818 NIMA (never in mitosis gene a)-related expressed Nek6 2,1196 0,0005 kinase 6 Nmu 0,4493 0,0135 Mm 154879 neuromedin U Notch3 2,5708 0,0006 Mm 439741 Notch gene homolog 3 (Drosophila) Nqo1 2,1549 0,0021 Mm 252 NAD(P)H dehydrogenase, qumone 1 Nts 0,1503 0,0008 Mm 64201 neurotensin Nucb2 2,8396 0,0001 Mm 9901 nucleobmdin 2 Nudt5 2,0255 0,0063 Mm 251904 nudix (nucleoside diphosphate linked moiety X)- type motif 5 Oat 0,4644 0,0086 Mm 13694 ornithine aminotransferase Ogn 0,2571 0,0294 Mm 4258 osteoglycin Mm 293626 oxidized low density lipoprotein (lectin-like) Olr1 5,4215 0,0083 receptor 1 Osta 0,0445 0,0003 Mm 98775 organic solute transporter alpha Ostb 0,1548 0,0001 Mm 335247 organic solute transporter beta Otc 0,0483 0,0000 Mm 2611 ornithine transcarbamylase Mm 203916 3'-phosphoadenosine 5'-phosphosulfate synthase Papss2 2,3748 0,0097 2 Paqr8 2,6835 0,0011 Mm 40780 progestin and adipoQ receptor family member VIII Parp12 0,4713 0,0008 Mm 268462 poly (ADP-nbose) polymerase family, member 12 Pbld 0,3506 0,0061 Mm 261389 phenazine biosynthesis-like protein domain containing Pcdh17 0,1782 0,0007 Mm 153643 protocadhenn 17 Pcp4l1 0,4241 0,0420 Mm 273087 Purkmje cell protein 4-hke 1 Pdgfc 0,4532 0,0300 Mm 331089 platelet-derived growth factor, C polypeptide Pdzd3 0,2660 0,0009 Mm 29872 PDZ domain containing 3 Pdzk1ip1 2,3076 0,0076 Mm 30181 PDZK1 interacting protein 1 Peg3 0,4687 0,0084 Mm 389800 paternally expressed 3 Phldal 2,4836 0,0007 Mm 3117 pleckstrin homology-like domain, family A, member 1 Pik3ip1 0,4702 0,0047 Mm 390323 phosphoinositide-3-kmase interacting protein 1 Pkib 2,6198 00117 Mm 262135 protein kinase inhibitor beta, cAMP dependent, testis specific Mm 4214 phosphohpase A2, group X Pla2g10 2,0160 0,0005 Mm 100476 phosphohpase A2, group III Pla2g3 8,1150 0,0019 Mm 1359 plasminogen activator, urokinase receptor Plaur 2,9795 0,0010 Mm 160067 phosphohpase B1 Plb1 2,6495 0,0006 Mm 264743 phosphohpase C, delta 3 Plcd3 2,6847 0,0017 Mm 458147 pleckstrin homology domain containing, family O Plekhol 0,4620 0,0417 member 1 Mm 55289 phospholipid scramblase 4 Plscr4 0,3147 0,0011 Mm 271878 phorbol-12-mynstate-13-acetate-induced protein 1 Pmaipl 0,4074 0,0005 Mm 212333 pancreatic hpase-related protein 2 Pnhprp2 0,1367 0,0292 Mm 1923 polymerase (DNA directed), alpha 1 Polal 2,0109 0,0009 Mm 897 POL) domain, class 2, associating factor 1 Pou2af1 0,1749 0,0123 Mm 212789 peroxisome proliferator activated receptor alpha Ppara 0,4957 0,0005 Mm 441196 peroxisome proliferative activated receptor, Ppargda 0,4432 0,0192 gamma, coactivator 1 alpha Mm 379204 protein phosphatase U Ppmlj 2,0280 0,0141 Mm 439707 prohne-nch acidic protein 1 Prapl 0,1907 0,0002 0,0491 Mm 306163 protein kinase, cAMP dependent regulatory, type I Prkarib 0,4626 beta Prkcdbp 2,6878 0,0081 Mm 3124 protein kinase C, delta binding protein Prkg2 0,4591 0,0289 Mm 263002 protein kinase, cGMP-dependent, type II Prlr 0,4366 0,0005 Mm 10516 prolactin receptor Procr 0,4917 0,0285 Mm 3243 protein C receptor, endothelial Prph 0,4499 0,0098 Mm 2477 peripherm Prss23 0,2257 0,0099 Mm 250438 protease, serine, 23 Prss8 2,2973 0,0006 Mm 5875 protease, serine, 8 (prostasin) PsapH 2,4261 0,0116 Mm 44242 prosaposm-like 1 0,0194 Mm 273905 pleckstrin homology, Sec7 and coiled-coil domains, Pscdbp 0,3875 binding protein Pstpip2 Mm 57174 proline-senne-threonine phosphatase-interacting 0,4935 0,0125 protein 2 Mm 4497 PTK6 protein tyrosine kinase 6 Ptk6 0,3886 0,0078 Mm 391573 protein tyrosine phosphatase, receptor type, C Ptprc 0,4201 0,0079 Mm 336316 protein tyrosine phosphatase, receptor type, R Ptprr 0,4303 0,0012 Mm 263414 poliovirus receptor-related 4 Pvrl4 2,0626 0,0022 Mm 393282 quaking Qk 0,4595 0,0452 Mm 279780 RAB17, member RAS oncogene family Rab17 0,3788 0,0006 Mm 273804 Rac GTPase-activating protein 1 Racgapl 2,0303 0,0107 Mm 3655 RAD54 like (S cerevisiae) Rad54l 2,0946 0,0004 Mm 440985 RAN binding protein 17 Ranbp17 2,7695 0,0006 Mm 196153 Rap guanine nucleotide exchange factor (GEF) 4 Rapgef4 0,4769 0,0006 Mm 259318 retinoic acid receptor, beta Rarb 2,2870 0,0136 Mm 273214 RNA binding motif protein 11 Rbm11 2,5626 0,0005 Mm 1741 avian reticuloendotheliosis viral (v-rel) oncogene Relb 0,3866 0,0001 related B Mm 442441 RALBP1 associated Eps domain containing protein Reps2 0,3852 0,0004 2 Mm 103701 regulator of G-protein signaling 1 Rgs1 0,4211 0,0206 Mm 18635 regulator of G-protein signalling 10 Rgs10 0,4152 0,0406 Mm 38271 regulator of G-protein signaling 13 Rgs13 0,3984 0,0292 Mm 28262 regulator of G-protein signaling 2 Rgs2 0,4564 0,0350 Mm 41642 regulator of G-protein signaling 4 Rgs4 0,4409 0,0018 Mm 20954 regulator of G-protein signaling 5 Rgs5 0,2752 0,0413 Mm 103777 Rhesus blood group-associated B glycoprotein Rhbg 2,0988 0,0108 Mm 27467 ras homolog gene family, member J Rhoj 0,3118 0,0484 Mm 60061 regulating synaptic membrane exocytosis 1 Rimsl 0,3720 0,0467 Mm 46612 receptor-interacting serine-threonine kinase 3 Ripk3 2,1647 0,0050 Mm 45980 ring finger protein 125 Rnf125 0,4414 0,0005 Mm 24777 ring finger protein 208 Rnf208 2,2533 0,0036 Mm 280038 S100 calcium binding protein A11 (calgizzann) S100a11 3,6299 0,0000 Mm 24006 S100 calcium binding protein A14 S100a14 6,6217 0,0002 Mm 331185 S100 calcium binding protein A16 S100a16 2,3604 0,0004 Mm 6891 S100 calcium binding protein G S100g 2,9709 0,0156 Mm 148800 serum amyloid A 1 Saa1 0,1633 0,0003 Mm 200941 serum amyloid A 2 Saa2 0,3366 0,0039 Mm 442455 sterile alpha motif domain containing 12 Samd12 4,5777 0,0000 Mm 311655 special AT-nch sequence binding protein 1 Satbl 0,2950 0,0484 Mm 30119 sterol-C4-methyl oxidase-hke Sc4mol 2,0006 0,0045 Mm 193096 stearoyl-Coenzyme A desaturase 2 Scd2 2,4232 0,0075 Mm 5038 secretogranin II Scg2 0,3073 0,0198 Mm 2416 scindenn Scin 0,3055 0,0019 Mm 7709 sodium channel, nonvoltage-gated 1 beta Scnnlb 2,6805 0,0039 Mm 40447 signal peptide, CUB domain, EGF-like 2 Scube2 0,4680 0,0209 Mm 398690 serum deprivation response Sdpr 0,3493 0,0216 Mm 392203 selenoprotein P, plasma, 1 Seppl 0,3256 0,0004 Mm 281691 secreted frizzled-related protein 1 Sfrpl 0,3793 0,0280 Mm 274058 solute carrier family 13 (sodium-dependent Slc13a2 0,1274 0,0028 dicarboxylate transporter), member 2 Mm 33832 solute carrier family 14 (urea transporter), member Slc14a1 2,2281 0,0034 1 Mm 457995 solute carrier family 20, member 1 Slc20a1 2,4550 0,0465 Mm 274590 solute carrier family 22 (organic cation transporter), Slc22a4 0,4525 0,0206 member 4 Mm 68157 solute carrier family 23 (nucleobase transporters), Slc23a3 0,4714 0,0072 member 3 Mm 298622 solute carrier family 25, member 35 Slc25a35 2,8006 0,0006 Mm 440571 solute carrier family 26 (sulfate transporter), Slc26a1 4,0071 0,0072 member 1 Mm 290044 solute carrier family 27 (fatty acid transporter), Slc27a2 0,1712 0,0141 member 2 Mm 233889 solute carrier family 39 (zinc transporter), member Slc39a10 2,3294 0,0008 10 Mm 276829 solute carrier family 39 (zinc transporter), member Slc39a4 2,0832 0,0122 4 Mm 22983 solute carrier family 39 (metal ion transporter), Slc39a5 0,2566 0,0017 member 5 Mm 227176 solute carrier family 3, member 1 Slc3a1 0,0735 0,0001 Mm 28756 solute carrier family 40 (iron-regulated transporter), Slc40a1 0,1735 0,0133 member 1 Mm 148425 solute carrier family 44, member 2 Slc44a2 2,1333 0,0061 Mm 200307 solute carrier family 45, member 3 Slc45a3 2,6037 0,0062 Mm 244549 solute carrier family 6 (neurotransmitter Slc6a9 2,1192 0,0004 transporter, glycine), member 9 Mm 260988 solute carrier family 7 (cationic amino acid Slc7a11 4,2060 0,0002 transporter, y+ system), member 11 Mm 45874 solute carrier family 7 (cationic amino acid Slc7a9 0,2991 0,0013 transporter, y+ system), member 9 Mm 261564 solute carrier family 9 (sodium/hydrogen Slc9a3 0,4844 0,0290 exchanger), member 3 Mm 136586 spermine oxidase Smox 2,4354 0,0004 Mm 272969 SPC25, NDC80 kinetochore complex component, Spc25 2,1795 0,0074 homolog (S cerevisiae) Mm 331191 small prolme-nch protein 1A Sprrla 9,2904 0,0084 Mm 10693 small prolme-nch protein 2H Sprr2h 24,9164 0,0002 Mm 30 splA/ryanodine receptor domain and SOCS box Spsbl 0,4049 0,0050 containing 1 Mm 236401 SLIT-ROBO Rho GTPase activating protein 3 Srgap3 2,2581 0,0080 Mm 338790 serglycin Srgn 0,3456 0,0156 Mm 2453 somatostatin Sst 0,4099 0,0332 Mm 275973 ST3 beta-galactoside alpha-2,3-sialyltransferase 4 St3gal4 0,1420 0,0038 Mm 212742 ST3 beta-galactoside alpha-2,3-sialyltransferase 6 St3gal6 0,2550 0,0219 Mm 306228 ST8 alpha-N-acetyl-neuramimde alpha-2,8- St8sia4 0,4206 0,0337 sialyltransferase 4 Mm 29580 stathmin-like 2 Stmn2 0,4327 0,0141 Mm 271634 sulfotransferase family, cytosolic, 2B, member 1 Sult2b1 0,2116 0,0022 Mm 375031 spleen tyrosine kinase Syk 2,7971 0,0007 Mm 213002 synaptotagmin VIII Syt8 3,7469 0,0004 Mm 25660 synaptotagmin-hke 1 SytH 2,0636 0,0015 Mm 308452 transforming, acidic coiled-coil containing protein 1 Tacd 0,3805 0,0329 Mm 439913 tumor-associated calcium signal transducer 2 Tacstd2 3,5940 0,0070 Mm 287052 T-box 2 Tbx2 0,4843 0,0324 Mm 280624 testis expressed gene 15 Tex15 4,6211 0,0002 Mm 1825 trefoil factor 2 (spasmolytic protein 1) Tff2 2,2943 0,0012 Mm 124316 tissue factor pathway inhibitor Tfpi 0,4246 0,0189 Mm 14455 transforming growth factor, beta induced Tgfbi 0,1955 0,0291 Mm 4871 tissue inhibitor of metalloproteinase 3 Timp3 0,4677 0,0333 Mm 23199 tubulointerstitial nephritis antigen Tinag 0,3394 0,0003 Mm 46325 transmembrane 4 L six family member 20 Tm4sf20 0,4804 0,0023 Mm 37974 transmembrane 6 superfamily member 2 Tm6sf2 0,2219 0,0002 Mm 297197 transmembrane protein 47 Tmem47 0,4054 0,0417 Mm 25138 transmembrane and immunoglobulin domain Tmigdl 0,2829 0,0003 containing 1 Mm 142568 transmembrane protease, serine 8 (intestinal) Tmprss8 0,2334 0,0057 Mm 265915 tumor necrosis factor receptor superfamily, Tnfrsf13b 0,3894 0,0122 member 13b Mm 12935 tumor necrosis factor receptor superfamily, Tnfrsf17 0,4501 0,0125 member 17 Mm 235328 tumor necrosis factor receptor superfamily, Tnfrsflb 2,0597 0,0002 member 1b Mm 290780 tumor necrosis factor receptor superfamily, Tnfrsf23 2,7944 0,0004 member 23 Mm 273277 tripartite motif protein 29 Tnm29 10,8875 0,0002 Mm 393018 transformation related protein 53 inducible nuclear Trp53inp1 0,4660 0,0002 protein 1 Mm 296889 transient receptor potential cation channel, Trpv6 3,7432 0,0176 subfamily V, member 6 Mm 332756 testis specific 10 Tsga10 2,0446 0,0078 Mm 28484 tetraspamn 3 Tspan3 0,4715 0,0035 Mm 187793 tubulin tyrosine ligase-hke family, member 7 Ttll7 0,4090 0,0448 Mm 2108 transthyretin Ttr 0,1316 0,0208 Mm 306021 UDP galactosyltransferase 8A Ugt8a 4,7785 0,0095 UTP14, U3 small nucleolar nbonucleoprotein, Utp14b 2,1834 0,0459 homolog B (yeast) Mm 20477 ubiquitously transcribed tetratncopeptide repeat Uty 7,9179 0,0000 gene, Y chromosome Mm 268000 vimentin Vim 0,4123 0,0117 Mm 4141 very low density lipoprotein receptor Vldlr 2,4015 0,0146 Mm 27154 vanin 1 Vnn1 0,4286 0,0077 Mm 27478 V-set and immunoglobulin domain containing 2 Vsig2 2,4430 0,0018 Mm 27289 WAP four-disulfide core domain 2 Wfdc2 4,5472 0,0012 Mm 11223 xanthine dehydrogenase Xdh 0,2758 0,0005 inactive X specific transcripts Xist 0,0049 0,0000 Mm 440867 X transporter protein 3 similar 1 gene Xtrp3s1 0,2086 0,0015 Mm 140055 zinc finger CCCH type containing 12D Zc3h12d 0,3895 0,0010 Mm 1161 zinc finger protein 185 Zfp185 2,0219 0,0005 Mm 386934 zinc finger protein 187 Zfp187 0,4227 0,0273 Mm 38948 zinc finger protein 7 Zfp7 2,0620 0,0032 Mm 59257 zinc finger, FYVE domain containing 1 Zfyvel 0,4917 0,0073 Mm 390497 zinc finger, FYVE domain containing 21 Zfyve21 0,4279 0,0007 Mm 227484 zinc finger, MIZ-type containing 1 Zmizl 0,4462 0,0378 ' Ratio of 3 Hnf4alpha mutants/3 controls 2 SAM test Supplementary Table 3 | Junction forming genes in diseased Hnf4a null colon Unigene Gene name Gene Colon symbol Ratio1 p-value2 Tight junctional proteins Mm 289441 claudin 1 Cldnl 0,9709 0,7569 Mm 117068 claudin 2 Cldn2 1,3195 0,5340 Mm 158662 claudin 3 Cldn3 0,9333 0,3071 Mm 158662 claudin 3 Cldn3 0,9125 0,1477 Mm 7339 claudin 4 Cldn4 4,4752 0,0018 Mm 22768 claudin 5 Cldn5 0,7500 0,1404 Mm 86421 claudin 6 Cldn6 1,0554 0,4526 Mm 281896 claudin 7 Cldn7 1,0468 0,5488 Mm 25836 claudin 8 Cldn8 3,0559 0,0059 Mm 103738 claudin 9 Cldn9 0,9879 0,9170 Mm 390755 claudin 10 Cldn10 1,1029 0,2792 Mm 4425 claudin 11 Cldnl 1 1,0616 0,3656 Mm 40132 claudin 12 Cldn12 0,8587 0,1275 Mm 86652 claudin 13 Cldn13 1,0980 0,3148 Mm 328716 claudin 14 Cldn14 0,9772 0,7484 Mm 87202 claudin 15 Cldnl 5 0,5342 0,0010 Mm 275205 claudin 16 Cldn16 1,1313 0,4168 Mm 386784 claudin 18 Cldn18 1,0284 0,8382 Mm 386784 claudin 18 Cldn18 0,9929 0,9297 Mm 130701 claudin 19 Cldn19 0,9366 0,3791 — claudin 22 Cldn22 1,0036 0,9496 Mm 37817 claudin 23 Cldn23 1,0457 0,6894 Mm 284594 tight junction associated protein 1 Tjapl 0,9760 0,7298 Mm 4342 tight junction protein 1 Tjp1 1,2027 0,1233 Mm 104744 tight junction protein 2 TJP2 1,2740 0,0679 Mm 27984 tight junction protein 3 Tjp3 0,9938 0,9527 Mm 318874 adherens junction associated protein 1 Ajapl 1,0726 0,5858 Mm 294882 F11 receptor F11r 1,1023 0,2097 171 Mm 41758 junction adhesion molecule 2 Jam2 0,9468 0,4589 Mm 28770 junction adhesion molecule 3 Jam3 0,9486 0,6455 Adherens junctions Mm 35605 cadherm 1 Cdh1 1,1791 0,0135 Mm 257437 cadhenn 2 Cdh2 0,5246 0,0396 Mm 4658 cadherm 3 Cdh3 1,0513 0,6302 Mm 382094 cadhenn 4 Cdh4 0,9962 0,9646 Mm 21767 cadherm 5 Cdh5 0,5335 0,0659 Mm 57048 cadhenn 6 Cdh6 1,0497 0,5004 Mm 213407 cadhenn 7, type 2 Cdh7 1,1132 0,3380 Mm 441131 cadhenn 8 Cdh8 1,0844 0,3574 Mm 439758 cadhenn 9 Cdh9 1,1272 0,0396 Mm 446240 cadhenn 10 Cdh10 1,0284 0,6249 Mm 1571 cadherm 11 Cdh11 0,4559 0,0314 Mm 334841 cadhenn 13 Cdh13 0,7324 0,0515 Mm 1976 cadhenn 15 Cdh15 1,0151 0,8757 Mm 19423 cadhenn 16 Cdh16 1,2486 0,0262 Mm 33402 cadhenn 17 Cdh17 1,4015 0,0379 Mm 241965 cadhenn 18 Cdh18 1,0574 0,4957 Mm 103640 cadhenn 20 Cdh20 1,0070 0,9304 Mm 440327 cadhenn 23 (otocadhenn) Cdh23 1,2121 0,0723 Mm 440327 cadhenn 23 (otocadhenn) Cdh23 1,1093 0,3700 Mm 330860 cadhenn-like 26 Cdh26 0,9899 0,8996 Gap junctions Mm 378921 gap junction membrane channel protein alpha 1 Gja1 0,2784 0,1022 Mm 57207 gap junction membrane channel protein alpha 3 Gja3 1,0186 0,8786 Mm 24615 gap junction membrane channel protein alpha 4 Gja4 0,9483 0,7651 Mm 444963 gap junction membrane channel protein alpha 5 Gja5 1,1361 0,2541 Mm 390369 gap junction membrane channel protein alpha 7 Gja7 0,4771 0,0086 Mm 461093 gap junction membrane channel protein alpha 8 Gja8 1,0378 0,7925 Mm 389394 gap junction membrane channel protein alpha 9 Gja9 1,1875 0,0425 Mm 377084 gap junction membrane channel protein alpha 10 Gja10 1,0973 0,4386 Mm 40016 gap junction membrane channel protein alpha 12 Gja12 1,0191 0,8210 Mm 21198 gap junction membrane channel protein beta 1 Gjb1 1,3577 0,0482 Mm 390683 gap junction membrane channel protein beta 2 Gjb2 1,8381 0,0327 Mm 90003 gap junction membrane channel protein beta 3 Gjb3 0,8098 0,4104 Mm 56906 gap junction membrane channel protein beta 4 Gjb4 1,0515 0,6291 Mm 26859 gap junction membrane channel protein beta 5 Gjb5 1,0705 0,7196 Mm 25652 gap junction membrane channel protein beta 6 Gjb6 1,0682 0,2907 Mm 208268 1 Gap junction membrane channel protein epsilon 1 Gje1 1,0048 0,9656 ' Ratio of 3 Hnf4alpha mutants/3 controls 2 SAM test Supplementary Table 4 | Ion transport associated genes Unigene Gene name Gene Colon symbol Ratio1 p-value2 Chloride Mm 454553 chloride channel calcium activated 1 Clcal 2,3214 0,0068 Mm 20897 chloride channel calcium activated 2 Clca2 7,4728 0,0000 Mm 33483 chloride channel calcium activated 3 Clca3 0,5229 0,0067 Mm 290600 chloride channel calcium activated 4 Clca4 4,9690 0,0001 Mm 386757 chloride channel 1 Clcnl 1,2474 0,0483 Mm 177761 chloride channel 2 Clcn2 0,4984 0,0002 Mm 29524 chloride intracellular channel 1 did 1,5144 0,0003 Mm 44194 chloride intracellular channel 3 Chc3 1,5763 0,0502 Mm 257765 chloride intracellular channel 4 (mitochondrial) Clic4 0,4028 0,0278 Mm 37666 chloride intracellular channel 5 Clic5 0,7062 0,0059 Mm 15621 cystic fibrosis transmembrane conductance regulator homolog Cftr 1,2501 0,0276 Potassium Mm 207432 ATPase, Na+/K+ transporting, alpha 2 polypeptide Atp1a2 0,3875 0,0473 Mm 4550 ATPase, Na+/K+ transporting, beta 1 polypeptide Atp1b1 0,7398 0,0045 Mm 235204 ATPase, Na+/K+ transporting, beta 2 polypeptide Atp1b2 0,6687 0,0560 Mm 273271 ATPase, H+/K+ transporting, nongastric, alpha polypeptide Atp12a 0,5938 0,0409 potassium voltage-gated channel, shaker-related subfamily, Mm 222831 member 5 Kcna5 0,5694 0,0022 Mm 10800 potassium channel, subfamily K, member 1 Kcnkl 1,6210 0,0003 potassium voltage gated channel, Shab-related subfamily, Mm 387390 member 1 Kcnbl 0,5970 0,0252 potassium voltage gated channel, Shaw-related subfamily, Mm 249386 member 1 Kcnd 0,7142 0,0095 Mm 40173 potassium voltage-gated channel, subfamily F, member 1 Kcnfl 0,6781 0,0457 Mm 6217 K+ voltage-gated channel, subfamily S, 1 Kcnsl 1,2239 0,0293 Mm 71045 K+ voltage-gated channel, subfamily S, 2 Kcns2 1,2225 0,0110 Mm 239498 potassium channel tetramensation domain containing 11 Kctd11 1,3166 0,0140 Mm 246466 potassium channel tetramensation domain containing 12 Kctd12 0,5465 0,0492 Mm 271572 potassium channel tetramensation domain containing 12b Kctd12b 0,6591 0,0087 Mm 28171 potassium channel tetramensation domain containing 5 Kctd5 1,4390 0,0083 Mm 292712 potassium channel tetramensation domain containing 6 Kctd6 0,7294 0,0079 Mm 55812 potassium channel tetramensation domain containing 7 Kctd7 1,4641 0,0148 solute carrier family 24 (sodium/potassium/calcium exchanger), Mm 217171 member 3 Slc24a3 0,3355 0,0687 Sodium Mm 207432 ATPase, Na+/K+ transporting, alpha 2 polypeptide Atp1a2 0,3875 0,0473 Mm 4550 ATPase, Na+/K+ transporting, beta 1 polypeptide Atp1b1 0,7398 0,0045 Mm 235204 ATPase, Na+/K+ transporting, beta 2 polypeptide Atp1b2 0,6687 0,0560 Mm 38127 sodium channel, voltage-gated, type VII, alpha Scn7a 0,4202 0,1242 Mm 144114 sodium channel, nonvoltage-gated, type I, alpha Scnnla 1,4725 0,0419 Mm 7709 sodium channel, nonvoltage-gated 1 beta Scnnlb 2,6805 0,0039 Mm 247042 sodium channel, voltage-gated, type X, alpha Scn10a 1,3243 0,0353 Mm 4312 solute carrier family 9 (sodium/hydrogen exchanger), member 1 Slc9a1 1,3121 0,0099 Mm 256414 solute carrier family 9 (sodium/hydrogen exchanger), member 2 Slc9a2 0,6061 0,0085 Mm 261564 solute carrier family 9 (sodium/hydrogen exchanger), member 3 Slc9a3 0,4844 0,0290 Mm 19299 solute carrier family 13 (sodium/sulphate symporters), member 1 Slc13a1 0,4337 0,1129 solute carrier family 13 (sodium-dependent dicarboxylate Mm 274058 transporter), member 2 Slc13a2 0,1274 0,0028 solute carrier family 7 (cationic amino acid transporter, y+ Mm 276831 system), member 8 Slc7a8 0,7934 0,0525 solute carrier family 7 (cationic amino acid transporter, y+ Mm 45874 system), member 9 Slc7a9 0,2991 0,0013 solute carrier family 10 (sodium/bile acid cotransporter family), Mm 253661 member 4 Slc10a4 0,5810 0,0066 solute carrier family 10 (sodium/bile acid cotransporter family), Mm 7446 member 6 Slc10a6 0,7408 0,0157 solute carrier family 24 (sodium/potassium/calcium exchanger), Mm 217171 member 3 Slc24a3 0,3355 0,0687 Mm 284891 solute carrier family 34 (sodium phosphate), member 2 Slc34a2 0,6480 0,0389 Mm 241147 solute carrier family 8 (sodium/calcium exchanger), member 2 Slc8a2 1,2478 0,0347 Mm 4312 solute carrier family 9 (sodium/hydrogen exchanger), member 1 Slc9a1 1,3121 0,0099 Mm 256414 solute carrier family 9 (sodium/hydrogen exchanger), member 2 Slc9a2 0,6061 0,0085 Mm 261564 solute carrier family 9 (sodium/hydrogen exchanger), member 3 Slc9a3 0,4844 0,0290 Mm 17815 solute carrier family 9 (sodium/hydrogen exchanger), isoform 6 Slc9a6 1,3449 0,0175 Mm 278924 solute carrier family 9 (sodium/hydrogen exchanger), member 8 Slc9a8 1,4510 0,0578 Water transport Mm 18625 aquaponn 1 Aqp1 0,5358 0,0474 Mm 34043 aquaponn 3 Aqp3 5,9930 0,0067 Mm 250786 aquaponn 4 Aqp4 6,1518 0,0009 ' Ratio of 3 Hnf4alpha mutants/3 controls 2 SAM test 174 3.11 References 1. Chen WS, Manova K, Weinstein DC, Duncan SA, Plump AS, et al. (1994) Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev 8: 2466-2477. 2. Hayhurst GP, Lee YH, Lambert G, Ward JM, Gonzalez FJ (2001) Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 21: 1393-1403. 3. Parviz F, Matullo C, Garrison WD, Savatski L, Adamson JW, et al. (2003) Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat Genet 34: 292-296. 4. Battle MA, Konopka G, Parviz F, Gaggl AL, Yang C, et al. (2006) Hepatocyte nuclear factor 4alpha orchestrates expression of cell adhesion proteins during the epithelial transformation of the developing liver. Proc Natl Acad Sci U S A 103: 8419-8424. 5. Lussier CR, Babeu JP, Auclair BA, Perreault N, Boudreau F (2008) Hepatocyte nuclear factor-4alpha promotes differentiation of intestinal epithelial cells in a coculture system. Am J Physiol Gastrointest Liver Physiol 294: G418-428. 6. Black DD (2007) Development and physiological regulation of intestinal lipid absorption. I. Development of intestinal lipid absorption: cellular events in chylomicron assembly and secretion. Am J Physiol Gastrointest Liver Physiol 293: G519-524. 7. Laukoetter MG, Bruewer M, Nusrat A (2006) Regulation of the intestinal epithelial barrier by the apical junctional complex. Curr Opin Gastroenterol 22: 85-89. 8. Resta-Lenert SC, Barrett KE (2009) Modulation of intestinal barrier properties by probiotics: role in reversing colitis. Ann N Y Acad Sci 1165: 175-182. 175 9. Montrose MH, Keely SJ, Barrett KE (2003) Electrolyte secretion and absorption: small intestine and colon. In: Yamada T, editor. Textbook of Gastroenterology. Philadelphia: Lippincott Williams and Wilkins. pp. 308-339. 10. Garrison WD, Battle MA, Yang C, Kaestner KH, Sladek FM, et al. (2006) Hepatocyte nuclear factor 4alpha is essential for embryonic development of the mouse colon. Gastroenterology 130: 1207-1220. 11. Babeu JP, Darsigny M, Lussier CR, Boudreau F (2009) Hepatocyte nuclear factor 4{alpha} contributes to an intestinal epithelial phenotype in vitro and plays a partial role in mouse intestinal epithelium differentiation. Am J Physiol Gastrointest Liver Physiol 297: G124-134. 12. Ahn SH, Shah YM, Inoue J, Morimura K, Kim I, et al. (2008) Hepatocyte nuclear factor 4alpha in the intestinal epithelial cells protects against inflammatory bowel disease. Inflamm Bowel Dis 14: 908-920. 13. Boudreau F, Lussier CR, Mongrain S, Darsigny M, Drouin JL, et al. (2007) Loss of cathepsin L activity promotes claudin-1 overexpression and intestinal neoplasia. Faseb J. 14. Novak JP, Sladek R, Hudson TJ (2002) Characterization of variability in large-scale gene expression data: implications for study design. Genomics 79: 104-113. 15. Auclair BA, Benoit YD, Rivard N, Mishina Y, Perreault N (2007) Bone morphogenetic protein signaling is essential for terminal differentiation of the intestinal secretory cell lineage. Gastroenterology 133: 887-896. 16. Grbic DM, Degagne E, Langlois C, Dupuis AA, Gendron FP (2008) Intestinal inflammation increases the expression of the P2 Y6 receptor on epithelial cells and the release of CXC chemokine ligand 8 by UDP. J Immunol 180: 2659-2668. 176 17. Huang RP, Yang W, Yang D, Flowers L, Horowitz IR, et al. (2005) The promise of cytokine antibody arrays in the drug discovery process. Expert Opin Ther Targets 9: 601- 615. 18. Boudreau F, Rings EH, van Wering HM, Kim RK, Swain GP, et al. (2002) Hepatocyte nuclear factor-1 alpha, GATA-4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription. Implication for the developmental regulation of the sucrase-isomaltase gene. J Biol Chem 277: 31909-31917. 19. Verdu EF, Huang X, Natividad J, Lu J, Blennerhassett PA, et al. (2008) Gliadin- dependent neuromuscular and epithelial secretory responses in gluten-sensitive HLA-DQ8 transgenic mice. Am J Physiol Gastrointest Liver Physiol 294: G217-225. 20. Varghese AK, Verdu EF, Bercik P, Khan WI, Blennerhassett PA, et al. (2006) Antidepressants attenuate increased susceptibility to colitis in a murine model of depression. Gastroenterology 130: 1743-1753. 21. Iaquinta PJ, Lees JA (2007) Life and death decisions by the E2F transcription factors. Curr Opin Cell Biol 19: 649-657. 22. Burum-Auensen E, Deangelis PM, Schjolberg AR, Roislien J, Andersen SN, et al. (2007) Spindle proteins Aurora A and BUB IB, but not Mad2, are aberrantly expressed in dysplastic mucosa of patients with longstanding ulcerative colitis. J Clin Pathol 60: 1403-1408. 23. Bagnat M, Cheung ID, Mostov KE, Stainier DY (2007) Genetic control of single lumen formation in the zebrafish gut. Nat Cell Biol 9: 954-960. 24. Tamura A, Kitano Y, Hata M, Katsuno T, Moriwaki K, et al. (2008) Megaintestine in claudin-15-deficientmice. Gastroenterology 134: 523-534. 25. Gupta RK, Kaestner KH (2004) HNF-4alpha: from MODY to late-onset type 2 diabetes. Trends Mol Med 10: 521-524. 177 26. Xavier RJ, Podolsky DK (2007) Unravelling the pathogenesis of inflammatory bowel disease. Nature 448: 427-434. 27. Caux C, Massacrier C, Vanbervliet B, Dubois B, Van Kooten C, et al. (1994) Activation of human dendritic cells through CD40 cross-linking. J Exp Med 180: 1263-1272. 28. Ho SB, Dvorak LA, Moor RE, Jacobson AC, Frey MR, et al. (2006) Cysteine-rich domains of muc3 intestinal mucin promote cell migration, inhibit apoptosis, and accelerate wound healing. Gastroenterology 131: 1501-1517. 29. Su L, Shen L, Clayburgh DR, Nalle SC, Sullivan EA, et al. (2009) Targeted epithelial tight junction dysfunction causes immune activation and contributes to development of experimental colitis. Gastroenterology 136: 551-563. 30. Schultheis PJ, Clarke LL, Meneton P, Miller ML, Soleimani M, et al. (1998) Renal and intestinal absorptive defects in mice lacking the NHE3 Na+/H+ exchanger. Nat Genet 19: 282-285. 31. Laubitz D, Larmonier CB, Bai A, Midura-Kiela MT, Lipko MA, et al. (2008) Colonic gene expression profile in NHE3-deficient mice: evidence for spontaneous distal colitis. Am J Physiol Gastrointest Liver Physiol 295: G63-G77. 32. Peltekova VD, Wintle RF, Rubin LA, Amos CI, Huang Q, et al. (2004) Functional variants of OCTN cation transporter genes are associated with Crohn disease. Nat Genet 36: 471-475. 33. Ruemmele FM, Seidman EG, Lentze MJ (2002) Regulation of intestinal epithelial cell apoptosis and the pathogenesis of inflammatory bowel disorders. J Pediatr Gastroenterol Nutr 34: 254-260. 34. Edelblum KL, Yan F, Yamaoka T, Polk DB (2006) Regulation of apoptosis during homeostasis and disease in the intestinal epithelium. Inflamm Bowel Dis 12: 413-424. 178 35. Pan H, Yin C, Dyson NJ, Harlow E, Yamasaki L, et al. (1998) Key roles for E2F1 in signaling p53-dependent apoptosis and in cell division within developing tumors. Mol Cell 2: 283-292. 36. Chiba H, Itoh T, Satohisa S, Sakai N, Noguchi H, et al. (2005) Activation of p21CIPl/WAFl gene expression and inhibition of cell proliferation by overexpression of hepatocyte nuclear factor-4alpha. Exp Cell Res 302: 11-21. 37. Moss SF, Blaser MJ (2005) Mechanisms of disease: Inflammation and the origins of cancer. Nat Clin Pract Oncol 2: 90-97; quiz 91 p following 113. 179 MANUSCRIT 4 HEPAT0CYTE-NUCLEAR-FACT0R-4a PROMOTES NEOPLASIA IN MICE AND PROTECTS AGAINST THE PRODUCTION OF REACTIVE OXYGEN SPECIES MATHIEU DARSIGNY, JEAN-PHILIPPE BABEU, ERNEST G. SEIDMAN, FERNAND-PIERRE GENDRON EMILE LEVY, JULIE CARRIER, NATHALIE PERREAULTET FRANCOIS BOUDREAU 20xx CANCER RESEARCH, EN REVISION 180 4.1 Auteurs et affiliations Mathieu Darsigny1, Jean-Philippe Babeu1, Ernest G. Seidman2, Fernand-Pierre Gendron1 Emile Levy3, Julie Carrier1, Nathalie Perreault1 and Francois Boudreau1* 1,2'3CIHR Team on Digestive Epithelium, Departement d'anatomie et biologie cellulaire, Faculte de Medecine et des Sciences de la Sante, Universite de Sherbrooke, Sherbrooke, QC, CANADA. 2Research Institute, McGill University Health Center, Montreal, QC, CANADA. department of Nutrition, CHU Ste-Justine, Universite de Montreal, QC, CANADA. 4.2 Contributions Mathieu Darsigny Mathieu a realise la majorite des experiences a l'exception de la micropuce a ADN sur les echantillons animaux et de la mesure des niveaux de malonaldehyde. II a prepare toutes les figures, legendes et redige le materiel et methodes. II a participe a I'ecriture du manuscrit en apportant des corrections et des suggestions. Jean-Philippe Babeu Jean-Philippe a effectue les premiers croisements, recolte les premiers echantillons animaux et a participe a la realisation de la micropuce d'ADN. 181 Ernest G. Seidman Ernest a participe a l'ecriture du manuscrit en y apportant des corrections. Fernand-Pierre Gendron Fernand-Pierre a participe a l'ecriture du manuscrit en apportant corrections et suggestions. Emile Levy Emile a rendu possible la mesure du malonaldehyde dans les echantillons epitheliaux. Julie Carrier Julie dirige la banque de tissus provenant des patients atteints du cancer colorectal. Elle a egalement participe a l'ecriture du manuscrit en apportant corrections et suggestions. Nathalie Perreault Nathalie a procure son expertise dans l'experience genetique avec les souris ApcMin/+, ainsi que lors du decompte macroscopique des adenomes. Elle a egalement participe a l'ecriture du manuscrit en apportant corrections et suggestions. Francois Boudreau Francois est l'investigateur principal sur ce manuscrit. II a redige, soumis et corrige le manuscrit. 182 4.3 Resume Historique Hepatocyte-nuclear-factor-4a (Hnf4a) est un facteur transcriptionnel qui controle la polarite et la maturation epitheliale durant l'embryogenese. La deletion conditionnelle &,Hnf4a durant le developpement post-natal resulte en une alteration mineure de 1'epithelium et promeut l'activite de la voie Wnt/Ji-catenine sans causer de tumorigenese. Methodes et resultats Ici, nous montrons qu'Hnf4a n'agit pas en tant que suppresseur de tumeur, mais est crucial dans la promotion de la tumorigenese intestinale chez la souris. La multiplicite des polypes retrouves chez les souris ApcMm ou Hnf4a a ete delete au niveau de 1'epithelium intestinal (Hnf4aAIEC) est reduite par rapport aux souris controles ApcMm. L'analyse d'une micropuce de profil d'expression genique a partir d'animaux Hnf4aAIEC a permis d'identifier de nouvelles fonctions de ce facteur transcriptionnel dans la regulation de l'expression de genes impliques dans la detoxification des especes reactives de l'oxygene (ROS) produites par une cellule. Ce role est supporte par Fobservation qu'Hnf4a est fonctionnellement capable de reduire la formation de ROS chez la cellule cancereuse en culture, ainsi que les ROS produites lorsqu'on ajoute I'agent chimiotherapeutique 5-Fluorouracil (5-FU) sur ces cellules. L'analyse d'une cohorte de patients atteints du cancer colorectal etablit qu'FFNF4a est significativement regule a la hausse dans les tissus cancereux en comparaison avec la muqueuse normale d'une resection chirurgicale. Quelques genes impliques dans la neutralisation des ROS sont egalement augmentes en correlation avec les niveaux d'FTNF4a 183 Conclusions En somme, ces resultats identifient le recepteur nucleaire HNF4a comme une cible therapeutique potentielle dans le cancer colorectal pour empecher la resistance a l'apoptose induite par les ROS durant la tumorigenese. Mots cles HNF4a, ROS, apoptose, cancer colorectal, ApcMm 4.4 Abstract Hepatocyte-nuclear-factor-4a (Hnf4a) is a transcription factor that controls epithelial cell polarity and maturation during embryogenesis. Hnf4a conditional deletion during post natal development results in minor consequences on intestinal epithelium integrity but promotes activation of the Wnt/p-catenin pathway without causing tumorigenesis. Here we show that Hnf4a does not act as a tumor suppressor gene but is crucial in promoting gut tumorigenesis in mice. Polyp multiplicity in ApcMm mice lacking Hnf4a is suppressed in comparison to littermate ApcMm controls. Analysis of microarray gene expression profiles from mice lacking Hnf4a in the intestinal epithelium identifies novel functions of this transcription factor in regulating expression of detoxifying genes relative to reactive oxygen species (ROS). This role is supported with the demonstration that HNF4a is functionally involved in the protection against spontaneous and 5-fluorouracil chemotherapy-induced production of ROS in colorectal cancer cell lines. The analysis of a colorectal cancer patient cohort establishes that HNF4a is significantly up-regulated in comparison to adjacent normal epithelial resections. Several genes involved in ROS neutralization are also induced in correlation with HNF4a expression. All together, the findings point to the nuclear receptor 184 HNF4a as a potential therapeutic target to eradicate aberrant epithelial cell resistance to ROS production during intestinal tumorigenesis. Key words: HNF4a, ROS, apoptosis, colorectal cancer, ApcMm 4.5 Introduction Hepatocyte nuclear factor-4a (FTNF4a) is an orphan nuclear receptor expressed in the liver, kidney, pancreas, stomach, small intestine and colon (1, 2). This receptor is able to modulate transcriptional activities of various target genes without activating ligands. The nature and possible roles of endogenous ligands for FTNF4a has been a matter of controversies (3-6). However, recent experimental evidences have led to the identification of linoleic acid as an endogenous and reversible HNF4a ligand, reinforcing the concept that this nuclear receptor could be considered as a nutritional and druggable target (7). The strategy of targeting HNF4a has gained in interest because many links have been established between HNF4A integrity and human diseases. Indeed, a number of mutations identified within the HNF4A gene are considered to represent the causes of several forms of maturity-onset diabetes of the young (MODY) (8). Polymorphisms within the HNF4A promoter region are associated with an increased risk of type 2 diabetes (8, 9). Moreover, genome-wide association studies have recently identified the HNF4A region as a novel ulcerative colitis susceptibility locus (10). Over the last two decades, the exploration of the transcriptional relevance of this nuclear receptor in the control of tissue specific genes has been the subject of many efforts, more specifically in the liver and pancreas context (11-14). 185 One powerful way for defining the functional relevance of a specific transcriptional regulator during organogenesis as well as maintenance of a given tissue is through the use of conditional gene deletion. This was particularly important for Hnf4a for which classical gene deletion in the mouse resulted in severe gastrulation defects with early embryonic lethality (15). Conditional deletion of Hnf4a in beta cells of the mouse pancreas resulted in hyperinsulinemia with impaired glucose tolerance (16). It was further demonstrated that expansion of adult pancreatic beta-cell mass in response to metabolic demand is dependent upon a specific Hnf4a dependent transcription network (14). Conditional genetic removal of Hnf4a in the mouse liver consolidated previous in vitro observations in relation to significant defects in lipid/lipoprotein metabolism and gluconeogenesis (17), as well as the disruption of the integrity and functional differentiation process relative to hepatic epithelium (18). The specific role of Hnf4a in controlling intestinal epithelial functions has emerged recently. Hnf4a can polarize intestinal epithelial cells in culture (19) and is potent for the epithelialisation of different types of cells (18, 20, 21). In the in vivo situation, maturation of colonic epithelial cells was shown to be dependent on Hnf4a when conditionally removed during early embryonic colonic development (22). This effect was specifically dependent on the early phases of embryonic development since colonic epithelial deletion at later stages did not severely impaired epithelial functions but led to long term chronic inflammatory defects resembling human inflammatory bowel diseases (23). Hnf4a conditional deletion in the small intestine led to minor consequences on the overall integrity of the epithelium structure with the exception of a misbalance in the production of secretory epithelial cells and subtle promoting effects on crypt epithelial cell proliferation (21, 24). The use of an inducible tamoxifen-dependent Cre recombination system led to similar conclusions with the additional observation that loss of Hnf4a was contributing to the activation of the Wnt/p- 186 catenin without causing polyposis (25). This led to the suggestion that HNF4a could act as a tumor suppressor gene. Intestinal cancer is mostly initiated from mutations that activate the Wnt pathway (26). This pathway is responsible to maintain nuclear activated status of the transcriptional regulatory p-catenin/Tcf-4 complex and contributes to the maintenance of the crypt stem cell/progenitor phenotype (27). Adenomatous polyposis coli (APC) gene mutations lead to the up-regulation of the Wnt signalling that results in the stabilization of the p-catenin/Tcf-4 complex and activation of gene targets important in the control of cell proliferation and the initiation of intestinal tumorigenesis (28). Recent evidence has described the intestinal cancer as a stem cell disease with the demonstration that the stem-cell-specific loss of Ape was the major source of intestinal neoplasia growth (29). With the use of the ApcMm mouse model, we tested the hypothesis that Hnf4a could act as an intestinal suppressor of tumors. Surprisingly, we found that loss of Hnf4a suppressed polyposis in this specific genetic context. We identified HNF4a as a crucial positive regulator of reactive oxygen species (ROS) detoxifying genes and established a functional link between HNF4a expression and ROS production in human colon cancer cells. These observations support a novel and unsuspected role for FTNF4a in facilitating intestinal cancer initiation as well as intracellular protection against cancer-related ROS production. 187 4.6 Materials and methods Cell culture and treatments HT29 (ATCC) were grown in McCoy's growth medium supplemented with 10% fetal bovine serum (FBS, Wisent), 4,5g/liter D-glucose, 2 mM L-alanyl-L-glutamine (GlutaMAX, Gibco), 25 mM HEPES, 50 U/ml penicillin and 50 ug/ml streptomycin. Cells were seeded the day preceding infection and were infected at 80% confluence as described before (60) with the pLKO.l-puro lentiviral vector (Sigma) containing a shRNA against all HNF4a isoforms (5'-CCACATGTACTCCTGCAGATT-3') and a Non-target shRNA control vector used as control (5'-CAACAAGATGAAGAGCACCAA-3'). Five days post-infection, the CM-DCF-DA ROS probe (Molecular Probes) was added at 2.5 uM for 30 minutes at 37°C and visualized on a Zeiss Axiovert 200M inverted microscope equipped with a Zeiss AxioCam HR camera. HCT116 (ATCC) were grown in the same growing medium as HT29 cells. Stable populations of HCT-116 cells expressing pBabe Hnf4al or empty vector were generated as described elsewhere (21). Cells were seeded at 16,000 cells per cm2 and cultured for 2 days before treatment with 5-FU (Sigma) at a concentration of 12.5 uM. ROS generation was measured 18 hours later using CM-DCF-DA probe. Number of positive cells per field were counted using ImageJ 1.41 software (National Institute of Health, USA). Mice and adenoma counts ApcMin mice on a C57BL/6J background were used to collect RNA and tissue samples as described elsewhere (21). 12.4KbVilCre transgenic mice (61) and Hnf4a,mlGonz (Jackson Laboratory, Cat#004665) (17) were used to produce ApcMw;Hnf4a+,+(control) and ^cM";12.4KbVilCre/Hnf4a6(/6' (Hnf4aA1EC) mice on a pure C57BL/6J background. These mice were sacrificed at 90 to 120 days of age for macroadenoma counts and 60 days for 188 microadenoma counts. Polyp counts were carried as described previously (60) and microadenomas were identified with incorporation of BrdU reagent (Zymed) at 10 ul/g of animal weight followed by direct immunofluorescence against BrdU as described elsewhere (62). Immunodetections Immunoblotting, immufluorescence and immunohistochemistry were conducted as described elsewhere (21, 23). Anti-p-actin (#1615) and anti-HNF4a that recognizes both PI and P2 (#6556) from Santa Cruz were used for immublotting. Active-Caspase-3 (#9664) from Cell Signalling and anti-BrdU-FITC (11202693001) from Roche were used in immunofluorescence. RNA extraction, microarray and quantitative PCR RNA was extracted and quantitative RT-PCR was conducted using LightCycler 2.0 instrument as previously described (21). Primer sequences are available upon request. For microarray analysis, Affymetrix GeneChip Mouse Genome 430 2.0 arrays were used to compare three Hnf4aAIEC mice and appropriate controls. FlexArray 1.3 was used for data analysis (www.genomequebec.mcgill.ca). Data are available at GEO (Gene Expression Omnibus, accession number GSE20968). Epithelial cell isolation and MDA measurement Hnf4a mutant and control mice were fasted overnight, sacrificed and epithelial cells from the jejunum were isolated by the MatriSperse (Collaborative Biomedical, Becton Dickinson, ON) technique as described previously (63). Centrifuged epithelial cells were 189 then collected and kept frozen at -80°C. Free MDA levels were determined as reported previously (64). Briefly, proteins were first precipitated with a 10% NaWC>4 as described elsewhere (65). Protein-free supernatant was then reacted with an isovolume of 0.5% thiobarbituric acid solution at 95 °C for 30 min. After cooling to room temperature, the pink chromogene was extracted with rc-butanol and dried over a stream of nitrogen at 37 °C. The dry extract was then resuspended in the KPkPCVmethanol (70:30) mobile phase before MDA detection by high-performance liquid chromatography. Tumor collection Samples of colon cancer and paired normal colon tissues (at least 10 cm from the tumor) have been obtained from 40 patients undergoing surgical resection. Patients did not receive neoadjuvant therapy. Tissues were obtained after patient's written informed consent, according to the protocol approved by the Institutional Human Subject Review Board of the Centre Hospitalier Universitaire de Sherbrooke. All tissues were frozen in liquid nitrogen within 15 min from resection as recommended by the Canadian Tumor Repository Network (). Tissues were embedded, cryosectioned and immunostained as described before (21). Paired tissues were lysed in Triton sample buffer (100 mM NaCl, 5 mM EDTA (pH 8.0), 50 mM Tris-HCl (pH 7.5), 1% Triton X-100, 5% glycerol, 1 mM PMSF, 0.2 mM orthovanadate, 40 mM ^-glycerophosphate, 50 mM NaF, and 2% protease inhibitor cocktail (P 8340, (Sigma-Aldrich)). Chromatin Immunoprecipitation and quantitative PCR T84 were used at a concentration of 2 x 106 cells per assay. Cells were sonicated and ChIP performed with EZ-Chip as described by the manufacturer (Millipore). HNF4a was 190 immunoprecipitated with 4 ug of anti-HNF4a (#6556) from Santa Cruz, RNA pol II was immunoprecipitated with 1 \ig of anti-RNA pol II (# 05-623) from Millipore and background was evaluated with 4 (j,g of normal goat IgG (#2028) from Santa Cruz. Final DNA was purified with High Pure PCR Cleanup (Roche) and was eluted in 80 ul of elution buffer. Quantitative PCR was realized with a LightCycler apparatus V2.0 (Roche Diagnostics) on 2 ul of precipitated DNA in each reaction. Primers were as follows: GSTK1 (1) -1004 Up : 5'- TTCTTTTGAGAGGGAGTCTTGC-3', GSTK1 (1) -762 Dw: 5'-CTGAGGTGGGTGGATCACTT- 3', GSTK1 (2) -781 Up: 5'-AAGTGATCCACCCACCTCAG-3\ GSTK1 (2) -558 Dw: 5'- ACTCCACCTGGACCAGTGAC-3', GSTK1 (3) -577 Up: 5'-GTCACTGGTCCAGGTGGAGT-3', GSTK1 (3) -322 Dw: 5'-AGCCCTTCCCCAAACTAAAC-3\ GSTK1 (4) -342 Up: 5'- GGTTTAGTTTGGGGAAGGGCT-3', GSTK1 (4) -43 Dw: 5'-CTGGTAGAGGTCCACCTCCG-3\ GSTK1 (5) -62 Up: 5'-CGGAGGTGGACCTCTACCAG-3', GSTK1 (5) +138 Dw: 5'- TAGGGGGACAGCACGTCATA-3', GSTK1 (6) +119 Up: 5'-TATGACGTGCTGTCCCCCTA-3', GSTK1 (6) +366 Dw: 5'-GTCGGGATATAAAGGCTCGG-3'. Each quantification was compared to 1% input DNA after immunoglobulin control was subtracted. Statistical analysis Groups were compared with unpaired Student's Mest except for tumor collection where paired Student's Mest was used for comparisons. Correlation test were conducted with Spearman test. P < 0.05 was considered significant (GraphPad Prism 5, GraphPad Software) and data were expressed as mean ± SEM. 191 4.7 Results Hnf4a does not act as a tumor suppressor gene but is a novel modifier of intestinal adenoma formation Hnf4a physically interacts with Tcf-4 and reduces (3-catenin/TCF/LEF transcriptional activity in cultured colon cancer epithelial cells (25). The Wnt/p-catenin pathway is mostly active in the crypt stem cell/progenitors and Hnf4a is induced during intestinal epithelial cell differentiation in culture (19). To explore the apparent opposite relationship between Hnf4a expression and sustained p-catenin activity, we monitored the expression level of Hnf4a along the intestinal crypt-villus axis as well as in intestinal ApcMm polyps well characterized by harbouring sustained activation of the Wnt/p-catenin pathway (30). Immunofluorescence detection revealed an increasing gradient of Hnf4a expression with stronger signal being detected in upper crypt and villus intestinal epithelial cells (Fig. 1A). Hnf4a gene transcript expression was significantly less elevated in ApcMm polyps of the jejunum, ileum and colon when compared to adjacent normal intestinal biopsies (Fig. IB). Immunofluorescence experiments confirmed this tendency with Hnf4a protein being weakly detected in polyp epithelial cells of the jejunum (Fig. 1C), ileum (Fig. ID) and colon (Fig. IE) as compared to the surrounding epithelial cells. These observations supported a close relationship between low Hnf4a expression level and elevated P-catenin activity in intestinal epithelial cells. 192 Figure 1 | Hnf4a is weakly expressed in Wnt/p- Hnf4a catenin activated cells. (A) Immunofluorescence on small intestinal tissue using an antibody against Y Hnf4a showing low Hnf4a expression in progenitor/stem cells and Paneth cells zone (delimitated with the white doted lines). (B) M P M P M P Jejunum (sum Colon Quantitative PCR of Hnf4a mRNA in enriched Margin Potyp 1 Polyp 2 polyp tissue versus intestinal margin of C57BL/6J- APCy'm animals (n = 6 polyps (P) per segments compared to 3 margin biopsies (M) per segment). The Tbp housekeeping gene was used to normalize expression data. Data represents mean ± SEM; *P < 0.05, **P < 0.01. (C) Representative immunofluorescences against Hnf4a showing expression in polyps found in jejunal, ileal and colonic epithelium of CSlBL/eJ-APC*'''" animals (n = 4). All scale bars, 100 um. It was recently suggested that intestinal polyps could originate from stem cells (29). Hnf4a was weakly detected in epithelial cells of the bottom crypt (Fig 1A). This led us to postulate that low level of Hnf4a expression within ApcMm polyps could either be functionally related to polyp formation or only be reflective of the nature of the disorganized founder stem cells that contribute to polyp formation and growth. To genetically test whether reducing Hnf4a expression could enhance intestinal tumorigenesis, we generated mice specifically lacking intestinal epithelial Hnf4a PI and P2 transcripts into a C57BL/6J ApcM,fl background. Mice carrying loxP-flanked Hnf4a alleles were crossed with Villin-Cre and Apcxt"1 compound mice. The conditional deletion oillnfla fourth and fifth exons led to a 97.6% reduction (P < 193 0.001) of PI and P2 transcripts in the small intestine (data not shown) (21). ApcMm; Hnf4aAlEC and ApcMm\ Hnf4a control littermate mice were sacrificed at 4 months and the number of polyps was assessed in each individual along the rostro-caudal axis of the gut. A major effect on intestinal tumor initiation was observed in ApcMm; Hnf4a®EC mice as compared to ApcMm; Hnf4a control mice (Fig. 2A). Surprisingly, the multiplicity of intestinal polyps with Hnf4a epithelial loss was dramatically reduced in the jejunum (7.8 ± 2.9 polyps vs 26.1 ± 4.7 polyps in controls; P = 0.0084), ileum (4.2 ± 1.4 vs 14.9 ± 2.4; P = 0 .0034) and colon (0.16 ± 0.16 vs 1.6 ± 0.3; P = 0.0024). Overall, the complete loss of Hnf4a in the intestinal epithelium led to a drastic 68.1 % reduction of the polyp load under ApcMm background (n = 6-7, P = 0.0017). Of interest, the average diameter size of remaining polyps under the ApcMm; Hnf4aA1EC mice was not significantly different when compared to the polyps of ApcMm; Hnf4a control mice (Fig. 2B). In addition, intestinal adenomas microcount as determined by BrdU immunofluorescence staining in younger animals showed a comparable 79.1 % reduction of the number of polyp in^c^"; Hnf4aMEC mice as compared to ApcMm; Hnf4a control mice (n = 3, P = 0.002) (Fig. 2C-D). Overall, these observations led to the unexpected conclusion that abrogation of intestinal epithelial Hnf4a expression did not promote intestinal tumorigenesis or polyp growth but rather limited the initiation of intestinal neoplasia under the ApcMm background. 194 A 40- O Duodenum | Ileum "|D Duodenum | Ileum •g O Jejunum I Colon • Jejunum j Colon I 30 I Figure 2 | Reduced polyp multiplicity in Hnf4aAIEC mice on a C51^Lm-AP(f"n background. (A) Polyp macrocount and (B) polyp size of Apcf4'"; Hnf4afSIEC (M, n = 6) and ApcMin; Hnf4a control littermate mice (C, n = 7) at 3-4 months of age in each different intestinal segment. (C) Polyp microcount in Ap^"n; Hnf4aA1EC (M, n = 3) and Ape?""; Hnf4a control littermate mice (C, n = 3) at 2 months (D) Representative immunofluorescence of BrdU incorporated cells in Ape?4'"; Hnf4a control and Apd4'"; Hnf4c^EC mice. Scale bars, 100 um. Mean ± SEM; *P < 0.05, **P < 0.01. Conditional loss of Hnf4a in the mouse small intestinal epithelium is associated with an oxidative stress gene expression signature Conditional deletion of Hnf4a in the adult small intestinal epithelium led to a minor increase in epithelial cell proliferation and only partially affected cell differentiation and barrier function of this epithelium (21, 25). Hnf4a promoting effect during gut tumorigenesis led us to explore novel physiological role for this transcriptional regulator in controlling jejunum epithelial functions. In order to clarify the nature of overall gene expression changes 195 Figure 3 | Hnf4 reactive oxygen species control. (A) The expression of 6 representative genes involved in oxidoreductive functions found by microarray analysis of Hnf4o^EC mice was monitored by quantitative PCR on total RNA extracted from adult jejunum tissue (n = 3 for each group). Gapdh housekeeping gene was used to normalize expression data. Mean ± SEM, *P < 0.05, **P < 0.01, ***/>< 0.001. associated with the loss of Hnf4a gene integrity in intestinal epithelial cells, a gene expression profiling was next performed. This analysis was done in biological triplicate with RNA isolated from the jejunum of control and conditionally deleted Hnf4a adult mice (Hnf4aA1EC). These mice were previously validated for their efficient abrogation of Hnf4a expression along the entire crypt-villus axis (21). The GeneChip® Mouse Genome 230 2.0 Arrays (Affymetrix) that contains more than 30,000 transcripts from the mouse genome was utilized to screen for mRNA expression variations. A statistical analysis (P value < 0.05) predicted 285 unique mouse transcripts being significantly modulated between control and Hnf4aAIEC mice (differential ratio > 2.0; Supplementary Table 1). To gain insight into how these modifications could be classified as biological meaning, we used the Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resources tool (31, 32). This analysis identified specific systems, such as the oxidoreductase component as well as the immune and cellular lipid metabolic processes as the most predicted significant biological pathways to be affected in the jejunum of Hnf4a&lEC mice. One particular set of oxidoreductase related genes that retained our attention was class of cytochrome p450 and 196 reactive oxygen species detoxifying enzymes that were predicted to be down modulated in absence of Hnf4a (Supplementary Table 2). A qRT-PCR analysis confinned that Cyp2bl0. Cyp2d26, Catalase, NAD(P)H dehydrogenase quinone 1 (Nqol). glutathione-S- transferase (Gst) A4 and GstKl gene transcript were significantly reduced in the small intestine of adult Hnf4ailEL mice when compared to control mice (Fig. 3). Consequently, the lipid peroxidation end product malondialdehyde (MDA), a typical marker for oxidative stress, was significantly elevated in intestinal epithelial cells harvested from Hnf4aAIEC mice as compared to control mice (1.5 fold; P < 0.05, n = 9). This observation coincided with a significant higher index of intestinal epithelial cell apoptosis in the small intestine of Hnf4aAIEC mice as monitored by immunofluorescence detection of cleaved-caspase 3 (Fig. 4A-B). Thus, the loss of intestinal epithelial Hnf4ct led to a reduction in the expression of several ROS detoxifying genes, along with a modest but significant increase of intestinal epithelial oxidative stress and a higher rate of epithelial apoptosis. Control Hnf4a>KC Figure 4 | Hnf4cfEC mice display a higher apoptotic index. (A) Cleaved- caspase-3 immunofluorescence in Hnf4aA'L'~ and control mice (n = 3, for each group). (B) Quantification of eleaved-caspase-3 positive cells per crypt-vilius units. Mean ± SEM: ***/> < 0.001. CTRL AIEC 197 HNF4a protects against the accumulation of ROS in colorectal cancer cells To further establish whether HNF4a could have a direct role in protecting against intracellular accumulation of ROS, its expression was modulated within two independent colorectal cancer cell lines. Hnf4a expression was efficiently neutralized in HT-29 cells with the stable integration of a specific HNF4a targeted shRNA lentivirus (Fig. 5 A). ROS positive cells were visualized with the use of a CM-DCF-DA fluorescent labelling probe (Fig. 5B) and the total number of ROS labelled cells was increased by more than 2.37-fold (P < 0.001) in HT-29 cells made deficient for HNF4a expression as compared to genome integrated control non-target shRNA lentivirus (Fig. 5C). On the contrary, stable retroviral integration of Hnf4a in the HCT116 cell line (Fig. 5D) led to a significant and spontaneous 51.1 %(P< 0.001) in reduction of the number of ROS positive cells as compared to empty control HCT116 cells (Fig. 5E-F). Because HCT116 cells, as opposed to HT-29 cells, do not harbour mutation within the TP53 gene and thus retain the capacity to produce important amount of ROS following chemotherapeutic treatments (33), we next evaluated whether ROS deleterious production in response to 5-fluorouracil (5-FU), an agent used in clinic as an adjuvant therapy for colon cancer, could be altered in the presence of Hnf4a. While treatment of control HCT116 cells with 5-FU led to an efficient production of intracellular ROS, HCT116 cell lines that overexpressed Hnf4a displayed a significant 55.3 % (P < 0.001) of reduction in the number of ROS producing cells following 5-FU treatment (Fig. 5G-H). These observations indicated that Hnf4a was potent to protect against the spontaneous and chemotherapy-induced production of intracellular ROS in colorectal cancer cell lines. 198 Figure 5 | HNF4a protects against the production of reactive oxygen species. (A) Immunoblot of HNF4a in HT29 cells infected with pLKO.l-puro shHNF4a or sh non-target (NT) shRNA control (Representative of 3 independent populations of cells). (B) ROS positive cells in shHNF4a and shNT infected cells as monitored by incubation with the CM-DCF-DA ROS probe. (C) Quantification of ROS positive cells per high field (20x original magnification) (« = 3). (D) Immunoblot of Hnf4a in HCT116 cells after infection with pBabe Hnf4al (Representative of 3 independent populations of cells). (E) ROS positive cells in empty vectoi or Hnf4al populations of cells after incubation with the CM-DCF-DA ROS probe. (F) Quantification of ROS positive ceils per high field (20x original magnification) (w = 3). (G) ROS positive cells in empty vector or Hnf4al populations of cells at 18 houis post-treatment with 12,5 uM 5-FU after the incubation of CM-DCF-DA ROS probe. (H) Quantification of ROS positive cells per high field (20x original magnification) less 2% DMSO vehiculeat 18 hours post-treatment with 12.5 uM 5-FU (// = 3). Mean ± SEM: ***r<* 0.001. 199 HNF4a and oxydoreductase related genes are overly expressed in colorectal cancer The expression of HNF4a was next assessed in human colorectal cancer (CRC) samples. HNF4A was increased by 2.19 fold {P = 0.002) at the gene transcript levels in tumor samples when compared to paired margin resections in 31 patients out of 40 (Fig. 6A). A similar analysis at the protein level indicated a significant 2.73-fold induction (P = 0.004) B MTMTMTMTMT HNF4a HNF4A 8 10 ** HNF4a '. + . *T ^fc *' ** *»*~? j£ - -J^H^-52 kDa 6 9 I """ -38 kDa «# S 4- 9-i 1 3 •»ir p-aciiri »>INWM«I '*** HSte **a#i*j»-mr =~H I ? M • qWB O.St 3.16 1.96 158 §• n=16 qPCR 1.16 S.04 3.83 4.75 3.11 fj = 20 Relation to TP53 1 3^ » 1 2 ft=15 n=9 i jSfP*11 n=40 - • - + *-F*I qPCR qWB Figure 6 | HNF4a is up-regulated in colorectal cancer in association with TPS3 mutated status. (A) Quantitative PCR (qPCR) of HNF4A gene transcripts in tumor versus margin tissues of 40 patients with colorectal cancer. B2M housekeeping gene was used to normalize expression data. (B) Five representative immunoblots against HNF4a within 20 patients with colorectal cancer were performed. Densitometry of matched samples expressed as fold change in expression is indicated bellow for WB and paired quantitative PCR expression. (C) Densitometry of matched samples in WB (n = 20) expressed as fold change in expression. (D) Immunofluorescence against HNF4a in corresponding tissue samples (in B) and immunohistochemistry of TP53 to diagnose TP53 mutated status Strong immunoreactivity translates in accumulated TP53 mutated protein and is thus classified as positive (+). rP53 status m other samples is either wild-type or silently mutated and thus classified as negative (-) (D) Non-significant overexpression of HNF4a in non TP53-mutated tumors in opposition to significant overexpression in TP53-mutated tumors. Data presented as mean ^ SEM; **/> < 0.01, ***P <- 0.001 (paired /-test) 200 of HNF4a protein in a subset of human cancer samples when individually compared to their paired margin resection (Fig. 6B-C). The status of TP53 was next assessed in these CRC samples since the mutation of TP53, often characterized by the accumulation of the protein, is a well described event that occurs during late phases of CRC (34). FINF4a expression was only significantly more elevated in tumors that scored positive for the immunodetection of mutated TP53 (Fig. 6D-E). E? 8n 6-i £ 7 6 I 5'.: T 2 4 r-JL-i 3 2 1 0 -r EL -I 1 1 1 1 1 to •<- Q O a. to >- >- z o a Position relative to TSS O of GSTK1 RHNF4,I 0 776 0 44210 464 0 422 P-value 0 0001 0 023| 0 017 0.028 Figure 7 | HNF4a. occupies the transcriptionally active ROS detoxifying GSTKl gene in CRC. (A) Quantitative PCR of 4 genes suspected to be under HNF4ct control in CRC patients (Mean ± SEM, 20 patients). Bellow is indicated the correlation factor with HNF4A mRNA expression and y-value according to Spearman correlation test. (B) Chromatin immunoprecipitation (ChIP) of HNF4a on regions of the GSTKl promoter (indicated, from -1004 to +366). Results are presented as percentage of input ChIP DNA for each factor minus IgG control (n = 3). Data presented as mean ± SEM; *P < 0.05, **P < 0.01, ***P < 0.001. To further validate the relationship between HNF4A expression and ROS detoxifying genes expression status in CRC, we next monitored expression of specific gene targets that were validated to be decreased in the intestine of Hnf4aAlEC mice (Fig. 3). This analysis revealed significant increases in the expression of CYP'2B6 (4.38-fold; P = 0.048), CYP2D6 (2.60-fold; P < 0.0001), NQOl (3.80-fold; P < 0.0001) and GSTKl (1.51-fold; P = 0.002) 201 genes transcript when comparing the ratio of tumor/margin from CRC patient samples (Fig. 7A). These modulations were significantly correlated with the induced level of HNF4A when a correlation coefficient was calculated (Fig. 7A). The CYP2B6 and CYP2D6 genes were already reported to contain functional HNF4a interacting sites within their respective promoters (35, 36). We further investigated whether HNF4a was able to be recruited on transcriptionally active GSTKl gene promoter. ChlP-QPCR experiments were performed using HNF4a and RNA polymerase II (RNAP II) antibodies to pull down chromatin from cultured colorectal cancer cells. Specific primer sets spanning the first 1 kb region of the GSTKl gene promoter showed that FTNF4a was mostly recruited in the proximal region of the GSTKl promoter transcriptional start site, a specific region that coincided with the recruitment of RNAP II (Fig. 7B). HNF4a was also able to pull down transcriptionally active NQOl chromatin under similar conditions (data not shown). Taken together, these observations support a strong relationship between increased levels of HNF4a, high expression of HNF4a targeted ROS neutralizing genes and increased protection against ROS production in CRC. 4.8 Discussion It has been concluded that Hnf4a plays major roles in epithelial cell polarization by targeting specific genes encoding cell junction molecules in various tissues including the intestine (18, 19, 23, 25, 37). Moreover, Hnf4a acts as a morphogen with its capacity to trigger microvillus formation in non-epithelial cell lines (20, 21). Evidence for a role of Hnf4a in governing the pattern of tissue development came from early conditional deletion of this transcriptional regulator during mouse liver (18) and colon embryonic development (22). Hnf4a gene deletion approaches that aimed to investigate the specific role of this 202 regulator on adult tissue maintenance have revealed lesser consequences on the liver maintenance (17) and intestinal tissue integrity (21, 23), supporting again the true nature of Hnf4a as an embryonic morphogen. The recent findings that Wnt/p-catenin pathway can interact with Hnf4a in intestinal epithelial cells (25) and hepatocytes (38) propped up on the premise that Hnf4a could act as a tumor suppressor gene. Our findings dismiss the beneficial role of activating Hnf4a to suppress intestinal tumorigenesis but rather support a therapeutically approach to transiently neutralize HNF4a transcriptional activity during intestinal cancer. This perspective would seem reasonable based on the reported observations that loss of Hnf4a does not severely impact on adult intestinal epithelium integrity, at least on a short term range (21, 24). ROS are chemically reactive molecules that display essential roles in biological functions such as cell growth, differentiation and inflammation (39). Excessive production of ROS can lead to oxidative damage to intracellular constituents including lipids, protein and DNA (40). ROS intracellular levels are controlled with their balanced elimination from ROS- scavenging systems such as the superoxide dismutases, glutathione peroxidase and catalase (39). Although chronic increases in ROS may contribute to cancer by amplifying genomic instability, it is well described that many cancer cells develop paradoxical enhancement of their ROS detoxifying capacities to become adapted to exogenous pressure and oxidative stress and then more resistant to chemotherapy-induced cell death (41). Strategies designed to further induce oxidant stress by decreasing oxidant detoxifying activities present conceptual advantages in targeting specific malignant cells with a significant misbalance of their antioxidant system as opposed to normal cells. 203 The finding that HNF4 How does Hnf4a contribute to the tumor multiplicity in the ApcMm context? Our observations have supported a relationship between increased levels of Wnt/p-catenin activity and reduced levels for Hnf4a in both normal and pathological crypt cells in the mouse intestine. This correlation was expected because of the reported anti-proliferative role of this factor in the context of normal epithelial biology (25, 46, 47). Proliferating progenitor/stem cells are the origin entities required for polyp initiation and growth (29) and already display weaker expression of Hnf4a than their differentiated counterparts. Thus, it remains plausible that further reduction of Hnf4a in epithelial progenitor cells could not be influencing the proliferative events that lead to polyp growth. The observation that polyp size was not influenced by the loss of Hnf4a in ApcMm mice strongly supports this idea. The major finding of our study is that Hnf4a loss resulted on a drastic reduction of the number of polyps in ApcMm mice. Nearly 100% of polyps that develop in the small intestine of ApcMm mice occur by somatic recombinations, which results in loss of heterozygosity (LOH) for the ApcMm mutation (48-50). We provide two possible explanations for the reduction of polyp number in mice deficient for intestinal epithelial Hnf4a. First, a significant decrease of 204 somatic recombination could occur in the absence of epithelial Hnf4a expression. This could be affected by either cell autonomous mechanisms or by local environmental effects. Second, a decrease in epithelial crypt cell survival following LOH manifestation could represent an early cell autonomous mechanism leading to premature clearance of nascent polyp initiation in absence of Hnf4a. Our data provide mechanistic clues as why the second possibility would represent a reasonable explanation in this case. Loss of Hnf4a transcriptional activity resulted in increased intestinal epithelial apoptosis in the small intestine, a feature that was also recently observed in the mouse colonic epithelium (23) as well as cultured CRC cell lines (45). The molecular link between Hnf4a and the control of intestinal epithelial apoptosis was not elucidated. Gene clustering analysis of jejunum gene transcript profiling among Hnf4aA,EC and control mice identified oxidoreductase activities as the most significant biological functions predicted to be challenged within these mutant animals. In support of this analysis, we found modest but significant levels of ROS- dependent MDA production in non-environmentally challenged Hnf4aAIEC animals and we showed that ROS production in CRC cell lines was dependent on HNF4a expression. We established that GSTK1 ROS detoxifying gene was a direct transcriptional target of HNF4a and several other putative gene targets with similar functions were found to be down- modulated in Hnf4aAlEC mice. ApcMm polyp formation is associated with higher production of oxidative stress (51) as well as changes in the expression of genes involved in ROS (52) correlating with the observation that polyp epithelial cells are expressing lower Hnf4a levels. We thus rationalize that a complete loss of Hnf4a in a biological situation that constantly exerts oxidative stress pressure would further promote the increase of intracellular ROS production and, without being efficiently neutralized, would reach a threshold becoming deleterious for epithelial cell survival. The recent identification of a candidate gene for the 205 modifier of Min 2 locus supports this rationale (53). Indeed, Atp5al, a gene required for oxidative metabolism, was found to be mutated in this locus providing a novel link between dysfunction of mitochondrial respiratory chain, lethal overproduction of intracellular ROS and polyp suppression in ApcMm mice (53). TP53 is a regulator of metabolism and oxidative stress, activities that appear to be central for its function as a tumor suppressor (54). Several studies have suggested a correlation between inactivation of TP53 function to induce apoptosis and resistance to CRC chemotherapy treatment (55-57). Global assessment of gene expression pattern in CRC cells deficient or not for TP53 has indicated a crucial role for TP53-dependent generation of ROS in the process of CRC sensitivity to 5-FU treatment (33). Interestingly, TP53 was reported to block Hnf4a activity and this, by two distinct mechanisms. TP53 is able to physically interact with the ligand binding domain of Hnf4a and repress its transcriptional activity (58) and to down-regulate HNF4A PI promoter activity in cultured hepatocytes (59). HNF4a expression level was found to be significantly elevated in CRC patient samples that harboured TP53 mutations, with the consequence of maintaining higher expression levels of ROS detoxifying genes. TP53 and HNF4a putative connection in controlling intestinal epithelial cell metabolism and programmed cell death both in normal and pathological conditions remains a promising biological and pathological perspective to be investigated in the future. In conclusion, our results indicated that Hnf4a was crucial to facilitate tumorigenesis in ApcMm mice. Hnf4a was found to be a critical transcriptional regulator of ROS detoxifying gene expression. The modulation of FTNF4a expression in CRC cell lines also confirmed its 206 crucial role in regulating ROS production. Finally, a significant correlation was found between elevated expression of HNF4a and high expression of ROS detoxifying genes in CRC biopsies. With the growing interest in the development of antagonists for blocking HNF4a functions as a therapeutic approach (12), our observations point out to the promising exploration of such strategies in a program designed to reduce antioxidant activities and promote the efficiency of CRC chemotherapies. 4.9 Acknowledgements The authors thank the Microarray Platform Lab from McGill University and Genome Quebec Innovation Centre for generation of the cDNA arrays and the QTRN/CHIR Team on Digestive Epithelium phenotyping platform from University of Sherbrooke for tissue processing. Special thanks go for Dr. Deborah L. Gumucio (University of Michigan Medical School, Ann Arbor, Michigan) for providing the 12.4KbVilCre transgenic mouse model, Evelyne Roy and Virginie Dozias for technical assistance and Gerald Bernatchez for human colorectal tumors processing. This work was supported by the Canadian Institute of Health Research (CIHR) (MOP-89770 to F.B.) and a CIHR team grant (CTP-82942). F.B. and J.C. are scholars from the "Fonds de la Recherche en Sante du Quebec". F.B., N.P., F.P.G. and J.C. are members of the FRSQ-funded "Centre de Recherche Clinique Etienne Lebel". E.S. is a recipient of a Canadian Research Chair in Immune-Mediated Gastrointestinal Disorders. E.L. is the recipient of a J.A. deSeve Endowed Chair in Nutrition. M.D. and J.P.B. are recipients of NSERC fellowships. 207 4.10 Supplementary data Supplementary Table 1 | Genes modulated by 2-folds or more in Hnf4aAIEC animals relative to controls Gene Title Gene Symbol Fold P-value 1422257_s_at cytochrome P450, family 2, subfamily b, polypeptide 10 Cyp2b10 0,033199 0,000004 1425645_s_at cytochrome P450, family 2, subfamily b, polypeptide 10 Cyp2b10 0,037588 0,000007 1448813_at arylacetamide deacetylase (esterase) Aadac 0,049547 0,000027 1438980_x_at RIKEN cDNA 4732466D17 gene 4732466D17Rik 0,058409 0,000002 1451787_at cytochrome P450, family 2, subfamily b, polypeptide 10 Cyp2b10 0,067430 0,000020 1426876_at RIKEN cDNA 4732466D17 gene 4732466D17Rik 0,073035 0,000011 1416645_a_at alpha fetoprotein Afp 0,088996 0,000330 1422217_a_at cytochrome P450, family 1, subfamily a, polypeptide 1 Cyp1a1 0,095346 0,012685 1421983_s_at hepatic nuclear factor 4, alpha Hnf4a 0,119870 0,000104 1448723_at retinol dehydrogenase 7 Rdh7 0,128724 0,000049 0 day neonate lung cDNA, RIKEN full-length enriched 1443137_at library, clone E030034L15 product unclassifiable, full 0,137447 0,000182 insert sequence 1427000_at hepatic nuclear factor 4, alpha Hnf4a 0,160003 0,000093 1427001_s_at hepatic nuclear factor 4, alpha Hnf4a 0,170048 0,000089 1454608_x_at transthyretin Ttr 0,175072 0,000022 1426990_at cubilin (intrinsic factor-cobalamm receptor) Cubn 0,181700 0,001885 1418094_s_at carbonic anhydrase 4 Car4 0,188943 0,000035 1448470_at fructose bisphosphatase 1 Fbp1 0,191263 0,000060 1448949_at carbonic anhydrase 4 Car4 0,196603 0,000064 1456169_at predicted gene, EG226654 EG226654 0,203772 0,000009 1417777_at leukotnene B4 12-hydroxydehydrogenase Ltb4dh 0,204033 0,000124 1452270_s_at cubilin (intrinsic factor-cobalamm receptor) Cubn 0,205704 0,001534 1459737_s_at transthyretin Ttr 0,209837 0,000018 1455913_x_at transthyretin Ttr 0,211208 0,000029 1418979_at aldo-keto reductase family 1, member C14 Akr1c14 0,220346 0,000038 1455454_at aldo-keto reductase family 1, member C19 Akr1c19 0,231055 0,000499 1418174_at D site albumin promoter binding protein Dbp 0,232822 0,004767 1417976_at adenosine deaminase Ada 0,235056 0,000745 1427221_at X transporter protein 3 similar 1 gene Xtrp3s1 0,258663 0,000211 1425392_a_at nuclear receptor subfamily 1, group I, member 3 Nr1i3 0,260987 0,000284 1437360_at protocadhenn 19 Pcdh19 0,261807 0,001029 1452678_a_at cysteine conjugate-beta lyase 1 CcbH 0,269051 0,001020 1449908_at gastric inhibitory polypeptide Gip 0,269151 0,000016 1436879_x_at alpha fetoprotein Afp 0,277733 0,009519 1452354_at RIKEN CDNA2810459M11 gene 2810459M11Rik 0,284144 0,000082 1455561_at carnosine dipeptidase 1 (metallopeptidase M20 family) Cndpl 0,294859 0,000426 1427214_at agmatine ureohydrolase (agmatinase) Agmat 0,300946 0,000237 1425057_at phenazine biosynthesis-like protein domain containing Pbld 0,309157 0,003820 1431705_a_at mucohpin 2 Mcoln2 0,309878 0,000044 LOC100040591 /// 1456418_at similar to inward rectifier potassium channel Kir7 1 0,322686 0,002539 LOC100045137 1422070_at alcohol dehydrogenase 4 (class II), pi polypeptide Adh4 0,326067 0,001328 1438211_s_at D site albumin promoter binding protein Dbp 0,328395 0,027749 1417556_at fatty acid binding protein 1, liver Fabpl 0,329125 0,001614 1416646_at alpha fetoprotein Afp 0,338347 0,001122 1428151_x_at cysteine conjugate-beta lyase 1 CcbM 0,344502 0,001911 1418849_x_at aquaponn 7 Aqp7 0,345038 0,003905 1456538_at serologically defined colon cancer antigen 8 Sdccag8 0,352018 0,000071 1421637_at solute carrier family 5, member 4a Slc5a4a 0,356575 0,018814 1424266_s_at expressed sequence AU018778 AU018778 0,358597 0,005271 1418395_at solute carrier family 47, member 1 Slc47a1 0,360158 0,000353 1430666_at phospholipase B1 Plb1 0,374129 0,013122 1427474_s_at glutathione S-transferase, mu 3 Gstm3 0,375610 0,005390 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and 1427377_x_at Hsd3b3 0,382093 0,002031 steroid delta-isomerase 3 1428393_at neuntin 1 Nrn1 0,383199 0,012053 1424451_at acetyl-Coenzyme A acyltransferase 1B Acaalb 0,385860 0,045222 cytochrome P450, family 2, subfamily c, polypeptide Cyp2c68 0,388329 0,000040 1423244_at 688 1426399_at von Willebrand factor A domain containing 1 Vwa1 0,390758 0,008483 glutathione S-transferase, mu 3 /// similar to Gstm3 /// 1427473_at Glutathione S-transferase Mu 3 (GST class-mu 3) 0,392241 0,012670 LOC667824 (Glutathione S-transferase GT9 3) 1424811_at camello-like 5 Cml5 0,395378 0,001155 1427480_at liver-expressed antimicrobial peptide 2 Leap2 0,395380 0,016375 1455466_at G protein-coupled receptor 133 Gpr133 0,396162 0,001787 1449150_at KRAB-A domain containing 1 Krbal 0,397467 0,003592 1426672_at transmembrane protein 16K Tmem16k 0,398891 0,000193 1418547_at tissue factor pathway inhibitor 2 Tfpi2 0,399937 0,000348 1452384_at ectonucleotide pyrophosphatase/phosphodiesterase 3 Enpp3 0,400858 0,003685 solute carrier family 5 (sodium-dependent vitamin Slc5a6 0,402266 0,000450 1435860_at transporter), member 6 14, 17 days embryo head cDNA, RIKEN full-length enriched library, clone 3222402J19 0,402298 0,002490 1455145_at product unclassifiable, full insert sequence solute carrier family 22 (organic cation transporter), Slc22a1 0,402363 0,000931 1418118_at member 1 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone A630052I23 0,403560 0,006769 1441467_at product hypothetical protein, full insert sequence solute carrier family 23 (nucleobase transporters), Slc23a1 0,403776 0,001909 1421912_at member 1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and Hsd3b2 /// Hsd3b3 1460232_s_at 0,405400 0,005344 steroid delta-isomerase 2 /// Hsd3b6 1419456_at dicarbonyl L-xylulose reductase Dcxr 0,413318 0,001869 1425382_a_at aquaponn 4 Aqp4 0,413991 0,000239 1446038_at Chemokine (C-C motif) receptor 9 Ccr9 0,415983 0,005541 1426883_at solute carrier family 25, member 45 Slc25a45 0,417027 0,000350 1418219_at interleukm 15 1115 0,417756 0,002211 1416203_at aquaponn 1 Aqp1 0,418392 0,005120 1449453_at bone marrow stromal cell antigen 1 Bst1 0,419227 0,000120 1419133_at envoplakin Evpl 0,421269 0,000304 1449887_at similar to chromatin modifying protein 4C LOC100044854 0,421792 0,008927 1419510_at esterase 22 Es22 0,422178 0,001062 1458504_at zinc finger CCCH type containing 12D Zc3h12d 0,422749 0,000228 1427797_s_at cathepsin E Ctse 0,425215 0,002703 1448764 a at fatty acid binding protein 1, liver Fabpl 0,425745 0,001745 1416046_a_at fucosidase, alpha-L- 2, plasma Fuca2 0,426044 0,000073 solute carrier family 7 (cationic amino acid transporter, 1417929_at Slc7a8 0,427468 0,003450 y+ system), member 8 1427339_at solute carrier family 30 (zinc transporter), member 2 Slc30a2 0,428980 0,000146 1424175_at thyrotroph embryonic factor Tef 0,429897 0,003071 1419040_at cytochrome P450, family 2, subfamily d, polypeptide 22 Cyp2d22 0,431336 0,000051 1448485_at gamma-glutamyltransferase 1 Ggt1 0,432767 0,000142 1445128_at CDNA clone IMAGE 30463708 — 0,434162 0,012129 1457837_at phospholipase B1 Plb1 0,435017 0,034803 ATP-binding cassette, sub-family C (CFTR/MRP), 1450109_s_at Abcc2 0,435394 0,000461 member 2 1448539_a_at aspartoacylase (ammoacylase) 3 Acy3 0,436148 0,002384 1419572_a_at ATP-binding cassette, sub-family D (ALD), member 4 Abcd4 0,436727 0,000131 1434449_at aquaporm 4 Aqp4 0,438483 0,001645 1418672_at aldo-keto reductase family 1, member C13 Akr1c13 0,440126 0,001865 1419039_at cytochrome P450, family 2, subfamily d, polypeptide 22 Cyp2d22 0,440313 0,000067 1437893_at phospholipase B1 Plb1 0,441624 0,039477 1460244_at ureidopropionase, beta Upb1 0,441738 0,000246 1429882_at RIKEN cDNA 6820431F20 gene 6820431 F20Rik 0,442637 0,021177 1417393_a_at C1q domain containing 2 C1qdc2 0,443422 0,000641 1450447_at hepatic nuclear factor 4, alpha Hnf4a 0,443771 0,000829 1440739_at vascular endothelial growth factor C Vegfc 0,444151 0,000576 1439260_a_at ectonucleotide pyrophosphatase/phosphodiesterase 3 Enpp3 0,445401 0,006255 cytochrome P450, family 3, subfamily a, polypeptide 25 Cyp3a25 /// 1424973_at 0,445863 0,004233 /// similar to cytochrome P450IIIA25 LOC100044443 1454904_at X-linked myotubular myopathy gene 1 Mtm1 0,447949 0,000069 1422860_at neurotensin Nts 0,448149 0,000113 1417590_at cytochrome P450, family 27, subfamily a, polypeptide 1 Cyp27a1 0,448470 0,004583 1424502_at oncoprotein induced transcript 1 Oit1 0,449509 0,003310 1426787_at Sfi1 homolog, spindle assembly associated (yeast) Sfi1 0,451696 0,000554 1425329_a_at cytochrome b5 reductase 3 Cyb5r3 0,453196 0,002665 1434354_at monoamine oxidase B Maob 0,454992 0,005155 1443327_at RIKEN cDNA D130043K22 gene D130043K22Rik 0,457938 0,000472 1416809_at cytochrome P450, family 3, subfamily a, polypeptide 11 Cyp3a11 0,458657 0,004887 Cbp/p300-mteracting transactivator, with Glu/Asp-nch 1452207_at Cited2 0,459356 0,000086 carboxy-terminal domain, 2 1450201_at protein Z, vitamin K-dependent plasma glycoprotein Proz 0,459845 0,013326 aldo-keto reductase family 1, member C13 /// aldo-keto Akr1c12/// 1450455_s_at 0,460274 0,001042 reductase family 1, member C12 Akr1c13 1449206_at synaptophysin-like 2 Sypl2 0,462150 0,002018 1422072_a_at glutathione S-transferase, mu 6 Gstm6 0,462265 0,025721 1421430_at RAD51-hke 1 (S cerevisiae) Rad51l1 0,462944 0,008818 solute carrier family 22 (organic cation transporter), 1417639_at Slc22a4 0,465012 0,000672 member 4 1422869_at c-mer proto-oncogene tyrosine kinase Mertk 0,465091 0,004794 1418095_at small muscle protein, X-linked Smpx 0,467106 0,013397 solute carrier family 6 (neurotransmitter transporter), 1455442_at Slc6a19 0,467285 0,000137 member 19 1419395_at acyl-CoA thioesterase 12 Acot12 0,467619 0,014166 U49454_at bone marrow stromal cell antigen 1 Bst1 0,468085 0,003175 1440922_at RIKEN cDNA 9130208D14 gene 9130208D14Rik 0,470037 0,012503 Adult male aorta and vein cDNA, RIKEN full-length 1439521 at enriched library, clone A530001O10 0,472125 0,002685 product unclassifiable, full insert sequence dehydrogenase/reductase (SDR family) member 7B /// Dhrs7b /// 1424869_at 0,475124 0,000075 similar to Dehydrogenase/reductase (SDR family) LOC100045214 member 7B 1448687_at C1q domain containing 2 C1qdc2 0,475295 0,000710 1434906_at RIKEN cDNA 0610005C13 gene 0610005C13Rik 0,475825 0,030938 1424592_a_at deoxynbonuclease I Dnasel 0,475872 0,011552 1416368_at glutathione S-transferase, alpha 4 Gsta4 0,476149 0,000557 solute carrier family 25 (mitochondrial carrier, adenine 1449481_at Slc25a13 0,477370 0,000765 nucleotide translocator), member 13 endothelial differentiation, lysophosphatidic acid G- 1418723_at Edg7 0,478567 0,000539 protem-coupled receptor 7 1418847_at arginase type II Arg2 0,478935 0,003763 1460192_at oxysterol binding protein-like 1A OsbpMa 0,479429 0,002796 1451814_a_at HIV-1 tat interactive protein 2, homolog (human) Htatip2 0,480400 0,026071 1446281_at -- 0,481607 0,018135 1458415_at C-type lectin domain family 2, member e Clec2e 0,481862 0,003563 1422000_at aldo-keto reductase family 1, member C12 Akr1c12 0,482635 0,002459 1423679_at RIKEN cDNA 2810432L12 gene 2810432L12Rik 0,485167 0,000603 0 day neonate lung cDNA, RIKEN full-length enriched 1439678_at library, clone E030027D23 product unclassifiable, full — 0,487192 0,017925 insert sequence 1451681_at cDNA sequence BC089597 BC089597 0,487279 0,017911 1452997_at RIKEN cDNA 6820431F20 gene 6820431 F20Rik 0,487986 0,009512 1456940_at solute carrier family 43, member 2 Slc43a2 0,491851 0,010373 1417169_at ubiquitin specific peptidase 2 Usp2 0,492008 0,025299 1450251_a_at ligand of numb-protein X 1 Lnx1 0,493010 0,000266 solute carrier family 5 (sodium/glucose cotransporter), 1426634_at Slc5a9 0,493181 0,000047 member 9 1448028_at TBC1 domain family, member 24 Tbc1d24 0,493745 0,002357 1442325_at TBC1 domain family, member 24 Tbc1d24 0,493933 0,004605 1421840_at ATP-binding cassette, sub-family A (ABC1), member 1 Abcal 0,494300 0,003381 Gm131 /// 1457271_at gene model 131, (NCBI) /// similar to prochymosin 0,496881 0,002945 LOC634449 1438073_at sprouty homolog 3 (Drosophila) Spry3 0,498350 0,004685 1452823_at glutathione S-transferase kappa 1 Gstkl 0,499906 0,008678 1450133_at UDP glucuronosyltransferase 2 family, polypeptide A3 Ugt2a3 0,499949 0,000687 solute carrier family 2 (facilitated glucose transporter), 1434773_a_at Slc2a1 2,008633 0,006020 member 1 1424958_at carbonic anhydrase 8 Car8 2,010264 0,001040 1438855_x_at tumor necrosis factor, alpha-induced protein 2 Tnfaip2 2,024895 0,003947 1451963_at Immunoglobulin heavy variable V6-6 lghv6-6 2,025680 0,010692 1425396_a_at lymphocyte protein tyrosine kinase Lck 2,026890 0,015220 1432026_a_at hect domain and RLD 5 Herc5 2,029547 0,047246 serine (or cysteine) peptidase inhibitor, clade B, 1421752 a at Serpinb5 2,029823 0,001472 member 5 2610204M08Rik 1436216_s_at RIKEN cDNA 2610204M08 gene /// similar to INF2 2,044738 0,010295 ///LOC100047142 1447918_x_at Immunoglobulin lambda chain, variable 1 lgl-V1 2,044801 0,027443 1438035_at expressed sequence AW061290 AW061290 2,045990 0,000772 1418374_at FXYD domain-containing ion transport regulator 3 Fxyd3 2,062335 0,000111 1416432_at 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 Pfkfb3 2,064230 0,000364 1415837_at kalhkrein 1 Klk1 2,070160 0,017769 1450034_at signal transducer and activator of transcription 1 Statl 2,070498 0,012455 1425084_at GTPase, IMAP family member 7 Gimap7 2,077192 0,018614 1453851_a_at growth arrest and DNA-damage-inducible 45 gamma Gadd45g 2,087882 0,008357 1449907_at beta-carotene 15,15'-monooxygenase Bcmol 2,106115 0,001315 1425145_at interleukin 1 receptor-like 1 Il1rl1 2,122830 0,039470 211 RIKEN cDNA 3930401B19 gene /// RIKEN cDNA 1453238_s_at A130040M12 gene /// RIKEN cDNA E430024C06 gene 3930401 B19Rik 2,134676 0,035195 /// similar to gag protein 1423555_a_at interferon-induced protein 44 Ifi44 2,138760 0,004772 mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N- 1421178_at Mgat4c 2,140232 0,019594 acetylglucosaminyltransferase, isozyme C (putative) ST8 alpha-N-acetyl-neuraminide alpha-2,8- 1456440_s_at St8sia6 2,140837 0,001171 sialyltransferase 6 proteasome (prosome, macropain) subunit, beta type 9 1450696_at Psmb9 2,143623 0,019208 (large multifunctional peptidase 2) 1425216_at free fatty acid receptor 2 Ffar2 2,146228 0,000286 1416953_at connective tissue growth factor Ctgf 2,150640 0,045109 1423100_at FBJ osteosarcoma oncogene Fos 2,161273 0,003089 1418283_at claudin 4 Cldn4 2,169813 0,003106 1454866_s_at chloride intracellular channel 6 Clic6 2,180581 0,000222 1455019_x_at cytoskeleton-associated protein 4 Ckap4 2,184509 0,000109 1441971_at Transcribed locus — 2,189764 0,026064 1416129_at ERBB receptor feedback inhibitor 1 Errfil 2,211921 0,030315 1428775_at RIKEN CDNA1110008L16 gene 1110008L16Rik 2,217253 0,000031 interferon-induced protein with tetrafncopeptide repeats 1450783_at Ifitl 2,222229 0,013616 1 1416002_x_at coactosin-like 1 (Dictyostehum) CotH 2,224808 0,000550 1418580_at receptor transporter protein 4 Rtp4 2,242461 0,009242 1418240_at guanylate nucleotide binding protein 2 Gbp2 2,249801 0,015248 chemokine (C-C motif) ligand 8 /// similar to monocyte Ccl8 /// 1419684_at 2,264519 0,001479 chemoattractant protein-2 (MCP-2) LOC100048554 1418825_at immunity-related GTPase family, M Irgm 2,289146 0,009574 1426371_at male sterility domain containing 2 Mlstd2 2,290169 0,000721 1437226_x_at MARCKS-hke 1 MarcksH 2,290245 0,000410 1424775_at 2'-5' oligoadenylate synthetase 1A Oasla 2,309700 0,008412 UTP14, U3 small nucleolar nbonucleoprotein, homolog 1438579_at Utp14b 2,314025 0,001106 B (yeast) 1435906_x_at guanylate nucleotide binding protein 2 Gbp2 2,316877 0,007175 1452815_at punnergic receptor P2Y, G-protem coupled 10 P2ry10 2,325115 0,030987 1438037_at hect domain and RLD 5 Herc5 2,330873 0,022348 1431591_s_at ISG15 ubiquitm-like modifier Isg15 2,338829 0,007377 1425233_at RIKEN cDNA 2210407C18 gene 2210407C18Rik 2,344220 0,000432 1456907_at chemokine (C-X-C motif) ligand 9 Cxcl9 2,365760 0,002825 1449071_at myosin, light polypeptide 7, regulatory Myl7 2,377552 0,000466 1453196_a_at 2'-5' oligoadenylate synthetase-hke 2 Oasl2 2,381303 0,007663 1450033_a_at signal transducer and activator of transcription 1 Statl 2,395217 0,031392 1419414_at guanine nucleotide binding protein 13, gamma Gng13 2,401175 0,000608 similar to [Human Ig rearranged gamma chain mRNA, 1425871_a_at LOC100046973 2,414330 0,019264 V-J-C region and complete cds ], gene product 1451502_at phospholipase A2, group X Pla2g10 2,417213 0,000078 1418349_at hepann-binding EGF-like growth factor Hbegf 2,440008 0,009071 guanylate binding protein 6 /// similar to Gbp6 /// 1434380_at 2,456159 0,002093 LysophosphohpaseI LOC100047881 1426501_a_at Traf2 binding protein T2bp 2,476157 0,016508 1444632_at cDNA sequence BC064078 BC064078 2,477052 0,003991 1419060_at granzyme B Gzmb 2,482007 0,043789 hexokinase 2 /// hypothetical protein LOC100043412 /// 1422612_at Hk2 2,494161 0,024619 hypothetical protein LOC100047934 1429947_a_at Z-DNA binding protein 1 Zbp1 2,499900 0,014594 hemoglobin, beta adult major chain /// hemoglobin, 1417184 s at Hbb-b1 /// Hbb-b2 2,516045 0,036550 beta adult minor chain serine (or cysteine) peptidase inhibitor, clade B, 1438856_x_at Serpinb5 2,539448 0,011326 member 5 1417851_at chemokine (C-X-C motif) ligand 13 Cxcl13 2,559409 0,007120 1418350_at hepann-binding EGF-like growth factor Hbegf 2,563462 0,005982 nudix (nucleoside diphosphate linked moiety X)-type Nudt5 2,588528 0,013712 1448651_at motif 5 1441912_x_at complement component 2 (within H-2S) C2 2,591951 0,000053 1435069_at cDNA sequence BC064078 BC064078 2,607313 0,000299 1418162_at toll-like receptor 4 Tlr4 2,672068 0,006040 1424631_a_at Immunoglobulin heavy chain (gamma polypeptide) ighg 2,689555 0,005115 1418652_at chemokine (C-X-C motif) ligand 9 Cxcl9 2,699863 0,013847 ST8 alpha-N-acetyl-neuraminide alpha-2,8- 1456147_at St8sia6 2,700155 0,000404 sialyltransferase 6 1419042_at interferon inducible GTPase 1 ligpl 2,740221 0,005776 1447621_s_at transmembrane protein 173 Tmem173 2,741377 0,006042 1422557_s_at metallothionein 1 Mt1 2,759498 0,000424 serine (or cysteine) peptidase inhibitor, clade B, 1441941_x_at Serpinb5 2,779937 0,002055 member 5 1451683_x_at histocompatibility 2, D region locus 1 H2-D1 2,783222 0,012843 T-cell specific GTPase /// hypothetical protein LOC100039796/// 1449009_at 2,803917 0,005308 LOC100039796 Tgtp 1418638_at histocompatibility 2, class II, locus Mb1 H2-DMb1 2,805273 0,039945 serine (or cysteine) peptidase inhibitor, clade B, 1424623_at Serpinb5 2,825602 0,001676 member 5 1452431_s_at histocompatibility 2, class II antigen A, alpha H2-Aa 2,837143 0,018898 serine (or cysteine) peptidase inhibitor, clade A, 1424923_at Serpina3g 2,837779 0,005357 member 3G 1418126_at chemokine (C-C motif) ligand 5 Ccl5 2,841179 0,019574 1423858_a_at 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 Hmgcs2 2,860811 0,010501 1417292_at interferon gamma inducible protein 47 Ifi47 2,900408 0,003887 1415905_at regenerating islet-derived 1 Reg1 2,905340 0,016242 1417130_s_at angiopoietin-like 4 Angptl4 2,921190 0,001927 carbonic anhydrase 8 /// similar to Carbonic anhydrase- Car8 /// 1427482_a_at 2,965511 0,000084 related protein (CARP) (CA-VIII) LOC676792 1417074_at CEA-related cell adhesion molecule 10 CeacamlO 3,037321 0,005829 1428720_s_at RIKEN cDNA 2010309G21 gene 2010309G21Rik 3,043403 0,009069 1417793_at interferon inducible GTPase 2 hgp2 3,063260 0,008619 1416051_at complement component 2 (within H-2S) C2 3,078169 0,000220 1419043_a_at interferon inducible GTPase 1 hgpl 3,082911 0,005157 1419604_at Z-DNA binding protein 1 Zbp1 3,121630 0,008732 1437176_at expressed sequence AI451557 AI451557 3,130867 0,011350 1448964_at S100 calcium binding protein G S100g 3,152703 0,000443 macrophage activation 2 like /// macrophage activation LOC626578 /// 1447927_at 3,248264 0,002175 2 like LOC626578 Mpa2l 1448573_a_at CEA-related cell adhesion molecule 10 CeacamlO 3,289276 0,004357 hemoglobin alpha, adult chain 1 /// hemoglobin alpha, 1428361_x_at Hba-a1 /// Hba-a2 3,346245 0,008193 adult chain 2 1423856_at popeye domain containing 3 Popdc3 3,349373 0,000188 hemoglobin alpha, adult chain 1 /// hemoglobin alpha, 1417714_x_at Hba-a1 ///Hba-a2 3,361574 0,013169 adult chain 2 hemoglobin alpha, adult chain 1 /// hemoglobin alpha, 1452757_s_at Hba-a1 ///Hba-a2 3,408920 0,008612 adult chain 2 1457664_x_at Complement component 2 (within H-2S) C2 3,442291 0,000153 1420400_at seminal vesicle antigen-like 1 Svall 3,521920 0,000419 1423233_at CCAAT/enhancer binding protein (C/EBP), delta Cebpd 3,550001 0,009288 1439489_at G protein-coupled receptor 120 Gpr120 3,582069 0,003131 1460431_at glucosammyl (N-acetyl) transferase 1, core 2 Gcntl 3,624905 0,000752 1452318 a at heat shock protein 1B Hspalb 3,731585 0,018439 213 1421134_at amphireguhn Areg 3,740124 0,000909 1438676_at macrophage activation 2 like Mpa2l 3,799759 0,006616 1451593_at Histocompatibility 2, D region locus 1 H2-D1 3,844782 0,030166 ubiquitin specific peptidase 18 /// similar to ubiquitin LOC100048346/// 1418191_at 3,849381 0,002042 specific protease UBP43 Usp18 1450245_at solute carrier family 10, member 2 Slc10a2 3,885871 0,022840 1449166_at S100 calcium binding protein A14 S100a14 3,945866 0,021938 1427127_x_at heat shock protein 1B Hspalb 4,051025 0,016603 small proline-rich protein 2A /// similar to nbosomal 1437258_at Sprr2a 4,315655 0,000288 protein L21 1427126_at heat shock protein 1B Hspalb 4,339550 0,021193 1417141_at interferon gamma induced GTPase igtp 4,634974 0,008647 membrane bound O-acyltransferase domain containing Mboatl 4,654816 0,012574 1435323_a_at 1 1419294_at RIKEN cDNA 1700011H14 gene 1700011H14Rik 4,764431 0,000295 H2-T18/// histocompatibility 2, T region locus 18 /// similar to 1452547_s_at LOC633417/// 6,307158 0,035860 histocompatibility 2, T region locus 3 LOC674370 1449133_at small proline-rich protein 1A Sprrla 6,711061 0,023350 1450682_at fatty acid binding protein 6, ileal (gastrotropm) Fabp6 10,573460 0,022608 1446368_at RIKEN cDNA 9130221J18 gene 9130221J18Rik 11,666950 0,002142 1419762_at ubiquitin D Ubd 13,120090 0,021326 1427726_at similar to histocompatibility 2, T region locus 3 LOC633417 17,328830 0,022563 1447260_at histocompatibility 2, blastocyst EG667977 19,963170 0,027488 1418368_at resistin like beta Retnlb 42,970830 0,000042 Defcr21 /// defensin related cryptdin 21 /// defensin related cryptdin 1436857 at Defcr22 /// 106,412800 0,023058 22 /// hypothetical protein LOC100044291 LOC100044291 214 Supplementary Table 2 | Clusters given by DAVID with genes modulated by 1.5-fold or more Functional Group 1 Median 3 596814901252471E-10 Category Term GO 0016614~oxidoreductase activity, acting on CH-OH group of GOTERM MF ALL donors GO 0016616~oxidoreductase activity, acting on the CH-OH group of GOTERM_MF_ALL donors, NAD or NADP as acceptor SP PIR KEYWORDS NAD Functional Group 2 Median 1 4104964169156598E-4 Category Term SP_PIR_KEYWORDS oxidoreductase GOTERM_MF_ALL GO 0016491 -oxidoreductase activity GOTERM_BP_ALL GO 0006118~electron transport GOTERM BP ALL GO 0006091 ~generation of precursor metabolites and energy Functional Group 3 Median 9 186644631622739E-5 Category Term SP_PIR_KEYWORDS fad SP_PIR_KEYWORDS flavoprotein GOTERM_MF_ALL GO 0048037-cofactor binding GOTERM_MF_ALL GO 0050662-coenzyme binding GOTERM_MF_ALL GO 0051287-NAD binding GOTERM_MF_ALL GO 0050660-FAD binding Functional Group 4 Median 1 053678269523429E-4 Category Term GOTERM_BP_ALL GO 0044255-cellular lipid metabolic process GOTERM_BP_ALL GO 0006629-lipid metabolic process GOTERM_BP_ALL GO 0008610-lipid biosynthetic process Functional Group 5 Median 0 006391398122329146 Category Term GOTERM_BP_ALL GO 0019752-carboxylic acid metabolic process GOTERM_BP_ALL GO 0006082-organic acid metabolic process GOTERM_BP_ALL GO 0032787-monocarboxyhc acid metabolic process GOTERM_BP_ALL GO 0044271-nitrogen compound biosynthetic process GOTERM_BP_ALL GO 0009069~senne family amino acid metabolic process GOTERM_BP_ALL GO 0006631-fatty acid metabolic process SP_PIR_KEYWORDS Fatty acid metabolism GOTERM_BP_ALL GO 0006519~amino acid and derivative metabolic process GOTERM_BP_ALL GO 0009309-amine biosynthetic process GOTERM_BP_ALL GO 0006807-nitrogen compound metabolic process SP_PIR_KEYWORDS lipid metabolism GOTERM_BP_ALL GO 0006520-amino acid metabolic process GOTERM_BP_ALL GO 0008652-amino acid biosynthetic process GOTERM_BP_ALL GO 0009308-amine metabolic process GOTERM_BP_ALL GO 0009070-senne family amino acid biosynthetic process SP PIR KEYWORDS ammo-acid biosynthesis Functional Group 6 Median 0 06118710024235075 Category Term GOTERM_CC_ALL GO 0005615~extracellular space SP_PIR_KEYWORDS glycoprotein GOTERM_CC_ALL GO 0044421 ~extracellular region part SP_PIR_KEYWORDS signal GOTERM_CC_ALL GO 0005576-extracellular region SP_PIR_KEYWORDS Secreted SP_PIR_KEYWORDS membrane UP_SEQ_FEATURE glycosylation site N-linked (GlcNAc ) GOTERM_CC_ALL GO 0016020-membrane UP_SEQ_FEATURE topological domain Extracellular UP_SEQ_FEATURE signal peptide UP_SEQ_FEATURE transmembrane region UP_SEQ_FEATURE disulfide bond UP_SEQ_FEATURE topological domain Cytoplasmic SP_PIR_KEYWORDS transmembrane GOTERM_CC_ALL GO 0016021-integral to membrane GOTERM_CC_ALL GO 0031224-intnnsic to membrane GOTERM CC ALL GO 0044425-membrane part Functional Group 7 Median 0 002617528524990884 Category Term GOTERM_BP_ALL GO 0006954~inflammatory response SP_PIR_KEYWORDS inflammatory response GOTERM_BP_ALL GO 0009611-response to wounding GOTERM_BP_ALL GO 0009605-response to external stimulus GOTERM_BP_ALL GO 0006950-response to stress GOTERM BP ALL GO 0006952-defense response Functional Group 8 Median 0 007592629126564022 Category Term SP_PIR_KEYWORDS metalloprotein SP_PIR_KEYWORDS chromoprotein GO 0016705-oxidoreductase activity, acting on paired donors, with GOTERM_MF_ALL incorporation or reduction of molecular oxygen SP_PIR_KEYWORDS microsome GOTERM_MF_ALL GO 0004497~monooxygenase activity SP_PIR_KEYWORDS monooxygenase GOTERM_CC_ALL GO 0042598-vesicular fraction GOTERM_CC_ALL GO 0005792-microsome GOTERM_MF_ALL GO 0050381-unspecific monooxygenase activity INTERPRO IPR002401 Cytochrome P450, E-class, group I SP_PIR_KEYWORDS iron GOTERM_MF_ALL GO 0005506-iron ion binding SP_PIR_KEYWORDS heme KEGG_PATHWAY mmu00980 Metabolism of xenobiotics by cytochrome P450 UP_SEQ_FEATURE metal ion-binding site Iron (heme axial ligand) GOTERM CC ALL GO 0000267-cell fraction GO 0016712-oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or GOTERM MF ALL flavoprotein as one donor, and incorporation of one atom of oxygen GOTERM_CC_ALL GO:0005624~membrane fraction GOTERM_MF_ALL GO:0046906~tetrapyrrole binding GOTERM_MF_ALL GO:0020037~heme binding INTERPRO IPR001128:Cytochrome P450 PIR SUPERFAMILY PIRSF000045:cytochrome P450 CYP2D6 SP PIR KEYWORDS electron transfer Functional Group 9 Median: 0.0042357576624649 Category Term GOTERM_MF_ALL GO:0008289~lipid binding GOTERM_MF_ALL GO:0005543~phospholipid binding GOTERM_MF_ALL GO:0035091 ~phosphoinositide binding SP_PIR_KEYWORDS gpi-anchor GOTERM_MF_ALL GO:0048503~GPI anchor binding UP_SEQ_FEATURE lipid moiety-binding region:GPI-anchor amidated serine Functional Group 10 Median: 0.00929403712376814 Category Term SP_PIR_KEYWORDS serine esterase INTERPRO IPR002018:Carboxylesterase, type B PIR_SUPERFAMILY PIRSF005676:esterase, acetylcholinesterase type GOTERM_MF_ALL GO:0004091 ~carboxylesterase activity UP SEQ FEATURE active site:Acyl-ester intermediate 217 4.11 References 1. Sladek, F.M., Zhong, W.M., Lai, E., and Darnell, J.E., Jr. 1990. Liver-enriched transcription factor FfNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev 4:2353-2365. 2. Duncan, S.A., Manova, K., Chen, W.S., Hoodless, P., Weinstein, D.C., Bachvarova, R.F., and Darnell, J.E., Jr. 1994. Expression of transcription factor HNF-4 in the extraembryonic endoderm, gut, and nephrogenic tissue of the developing mouse embryo: HNF-4 is a marker for primary endoderm in the implanting blastocyst. Proc Natl Acad Sci USA 91:7598-7602. 3. Dhe-Paganon, S., Duda, K., Iwamoto, M., Chi, Y.I., and Shoelson, S.E. 2002. Crystal structure of the HNF4 alpha ligand binding domain in complex with endogenous fatty acid ligand. J Biol Chem 277:37973-37976. 4. Wisely, G.B., Miller, A.B., Davis, R.G., Thornquest, A.D., Jr., Johnson, R., Spitzer, T., Sefler, A., Shearer, B., Moore, J.T., Miller, A.B., et al. 2002. Hepatocyte nuclear factor 4 is a transcription factor that constitutively binds fatty acids. Structure 10:1225-1234. 5. Hertz, R., Magenheim, J., Berman, I., and Bar-Tana, J. 1998. Fatty acyl-CoA thioesters are ligands of hepatic nuclear factor-4alpha. Nature 392:512-516. 6. Bogan, A.A., Dallas-Yang, Q., Ruse, M.D., Jr., Maeda, Y., Jiang, G., Nepomuceno, L., Scanlan, T.S., Cohen, F.E., and Sladek, F.M. 2000. Analysis of protein dimerization and ligand binding of orphan receptor HNF4alpha. J Mol Biol 302:831- 851. 218 7. Yuan, X., Ta, T.C., Lin, M., Evans, J.R., Dong, Y., Bolotin, E., Sherman, M.A., Forman, B.M., and Sladek, F.M. 2009. Identification of an endogenous ligand bound to a native orphan nuclear receptor. PLoS One 4:e5609. 8. Gupta, R.K., and Kaestner, K.H. 2004. HNF-4alpha: from MODY to late-onset type 2 diabetes. Trends MolMed 10:521-524. 9. Love-Gregory, L., and Permutt, M.A. 2007. FINF4A genetic variants: role in diabetes. Curr Opin Clin Nutr Metab Care 10:397-402. 10. Barrett, J.C., Lee, J.C., Lees, C.W., Prescott, N.J., Anderson, C.A., Phillips, A., Wesley, E., Parnell, K., Zhang, H., Drummond, H., et al. 2009. Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. Nat Genet 41:1330-1334. 11. Gonzalez, F.J. 2008. Regulation of hepatocyte nuclear factor 4 alpha-mediated transcription. Drug Metab Pharmacokinet 23:2-7. 12. Kaestner, K.H. Making the liver what it is: the many targets of the transcriptional regulator HNF4alpha. Hepatology 51:376-377. 13. Bolotin, E., Liao, H., Ta, T.C., Yang, C, Hwang-Verslues, W., Evans, J.R., Jiang, T., and Sladek, F.M. Integrated approach for the identification of human hepatocyte nuclear factor 4alpha target genes using protein binding microarrays. Hepatology 51:642-653. 14. Gupta, R.K., Gao, N., Gorski, R.K., White, P., Hardy, O.T., Rafiq, K., Brestelli, J.E., Chen, G., Stoeckert, C.J., Jr., and Kaestner, K.H. 2007. Expansion of adult beta-cell mass in response to increased metabolic demand is dependent on HNF-4alpha. Genes Dev 21:756-769. 219 15. Chen, W.S., Manova, K., Weinstein, D.C., Duncan, S.A., Plump, A.S., Prezioso, V.R., Bachvarova, R.F., and Darnell, J.E., Jr. 1994. Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev 8:2466-2477. 16. Gupta, R.K., Vatamaniuk, M.Z., Lee, C.S., Flaschen, R.C., Fulmer, J.T., Matschinsky, F.M., Duncan, S.A., and Kaestner, K.H. 2005. The MODY1 gene FfNF-4alpha regulates selected genes involved in insulin secretion. J Clin Invest 115:1006-1015. 17. Hayhurst, G.P., Lee, Y.H., Lambert, G., Ward, J.M., and Gonzalez, F.J. 2001. Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 21:1393-1403. 18. Parviz, F., Matullo, C, Garrison, W.D., Savatski, L., Adamson, J.W., Ning, G., Kaestner, K.H., Rossi, J.M., Zaret, K.S., and Duncan, S.A. 2003. Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat Genet 34:292-296. 19. Lussier, C.R., Babeu, J.P., Auclair, B.A., Perreault, N., and Boudreau, F. 2008. Hepatocyte nuclear factor-4alpha promotes differentiation of intestinal epithelial cells in a coculture system. Am J Physiol Gastrointest Liver Physiol 294:G418-428. 20. Chiba, H., Sakai, N., Murata, M., Osanai, M., Ninomiya, T., Kojima, T., and Sawada, N. 2006. The nuclear receptor hepatocyte nuclear factor 4alpha acts as a morphogen to induce the formation of microvilli. J Cell Biol 175:971-980. 21. Babeu, J.P., Darsigny, M., Lussier, C.R., and Boudreau, F. 2009. Hepatocyte nuclear factor 4alpha contributes to an intestinal epithelial phenotype in vitro and plays a 220 partial role in mouse intestinal epithelium differentiation. Am J Physiol Gastrointest Liver Physiol 297:G124-134. 22. Garrison, W.D., Battle, M.A., Yang, C, Kaestner, K.H., Sladek, F.M., and Duncan, S.A. 2006. Hepatocyte nuclear factor 4alpha is essential for embryonic development of the mouse colon. Gastroenterology 130:1207-1220. 23. Darsigny, M., Babeu, J.P., Dupuis, A.A., Furth, E.E., Seidman, E.G., Levy, E., Verdu, E.F., Gendron, F.P., and Boudreau, F. 2009. Loss of hepatocyte-nuclear- factor-4alpha affects colonic ion transport and causes chronic inflammation resembling inflammatory bowel disease in mice. PLoS One 4:e7609. 24. Ahn, S.H., Shah, Y.M., Inoue, J., Morimura, K., Kim, I., Yim, S., Lambert, G., Kurotani, R., Nagashima, K., Gonzalez, F.J., et al. 2008. Hepatocyte nuclear factor 4alpha in the intestinal epithelial cells protects against inflammatory bowel disease. Injlamm Bowel Dis 14:908-920. 25. Cattin, A.L., Le Beyec, J., Barreau, F., Saint-Just, S., Houllier, A., Gonzalez, F.J., Robine, S., Pincon-Raymond, M., Cardot, P., Lacasa, M., et al. 2009. Hepatocyte nuclear factor 4alpha, a key factor for homeostasis, cell architecture, and barrier function of the adult intestinal epithelium. Mol Cell Biol 29:6294-6308. 26. Clevers, H. 2006. Wnt/beta-catenin signaling in development and disease. Cell 127:469-480. 27. Pinto, D., and Clevers, H. 2005. Wnt control of stem cells and differentiation in the intestinal epithelium. Exp Cell Res 306:357-363. 28. Sancho, E., Batlle, E., and Clevers, H. 2004. Signaling pathways in intestinal development and cancer. Annu Rev Cell Dev Biol 20:695-723. 221 29. Barker, N., Ridgway, R.A., van Es, J.H., van de Wetering, M., Begthel, H., van den Born, M., Danenberg, E., Clarke, A.R., Sansom, O.J., and Clevers, H. 2009. Crypt stem cells as the cells-of-origin of intestinal cancer. Nature 457:608-611. 30. Kongkanuntn, R., Bubb, V.J., Sansom, O.J., Wyllie, A.H., Harrison, D.J., and Clarke, A.R. 1999. Dysregulated expression of beta-catenin marks early neoplastic change in Ape mutant mice, but not all lesions arising in Msh2 deficient mice. Oncogene 18:7219-7225. 31. Dennis, G., Jr., Sherman, B.T., Hosack, D.A., Yang, J., Gao, W., Lane, H.C., and Lempicki, R.A. 2003. DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol 4:P3. 32. Huang da, W., Sherman, B.T., and Lempicki, R.A. 2009. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4:44- 57. 33. Hwang, P.M., Bunz, F., Yu, J., Rago, C, Chan, T.A., Murphy, M.P., Kelso, G.F., Smith, R.A., Kinzler, K.W., and Vogelstein, B. 2001. Ferredoxin reductase affects p53-dependent, 5-fluorouracil-induced apoptosis in colorectal cancer cells. Nat Med 7:1111-1117. 34. Baker, S.J., Preisinger, A.C., Jessup, J.M., Paraskeva, C, Markowitz, S., Willson, J.K., Hamilton, S., and Vogelstein, B. 1990. p53 gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res 50:7717-7722. 35. Cairns, W., Smith, C.A., McLaren, A.W., and Wolf, C.R. 1996. Characterization of the human cytochrome P4502D6 promoter. A potential role for antagonistic 222 interactions between members of the nuclear receptor family. J Biol Chem 271:25269-25276. 36. Inoue, K., and Negishi, M. 2008. Nuclear receptor CAR requires early growth response 1 to activate the human cytochrome P450 2B6 gene. J Biol Chem 283:10425-10432. 37. Spath, G.F., and Weiss, M.C. 1998. Hepatocyte nuclear factor 4 provokes expression of epithelial marker genes, acting as a morphogen in dedifferentiated hepatoma cells. J Cell Biol 140:935-946. 38. Colletti, M, Cicchini, C, Conigliaro, A., Santangelo, L., Alonzi, T., Pasquini, E., Tripodi, M., and Amicone, L. 2009. Convergence of Wnt signaling on the HNF4alpha-driven transcription in controlling liver zonation. Gastroenterology Ul-.660-612. 39. Trachootham, D., Alexandre, J., and Huang, P. 2009. Targeting cancer cells by ROS- mediated mechanisms: a radical therapeutic approach? Nat Rev Drug Discov 8:579- 591. 40. Perry, G., Raina, A.K., Nunomura, A., Wataya, T., Sayre, L.M., and Smith, M.A. 2000. How important is oxidative damage? Lessons from Alzheimer's disease. Free Radic Biol Med 28:831 -834. 41. Schumacker, P.T. 2006. Reactive oxygen species in cancer cells: live by the sword, die by the sword. Cancer Cell 10:175-176. 42. Xu, L., Hui, L., Wang, S., Gong, J., Jin, Y., Wang, Y., Ji, Y., Wu, X., Han, Z., and Hu, G. 2001. Expression profiling suggested a regulatory role of liver-enriched transcription factors in human hepatocellular carcinoma. Cancer Res 61:3176-3181. 223 43. Kojima, K., Kishimoto, T., Nagai, Y., Tanizawa, T., Nakatani, Y., Miyazaki, M., and Ishikura, H. 2006. The expression of hepatocyte nuclear factor-4alpha, a developmental regulator of visceral endoderm, correlates with the intestinal phenotype of gastric adenocarcinomas. Pathology 38:548-554. 44. Sugai, ML, Umezu, H., Yamamoto, T., Jiang, S., Iwanari, H., Tanaka, T., Hamakubo, T., Kodama, T., and Naito, M. 2008. Expression of hepatocyte nuclear factor 4 alpha in primary ovarian mucinous tumors. Pathol Int 58:681-686. 45. Schwartz, B., Algamas-Dimantov, A., Hertz, R., Nataf, J., Kerman, A., Peri, I., and Bar-Tana, J. 2009. Inhibition of colorectal cancer by targeting hepatocyte nuclear factor-4alpha. Int J Cancer 124:1081-1089. 46. Lucas, B., Grigo, K., Erdmann, S., Lausen, J., Klein-Hitpass, L., and Ryffel, G.U. 2005. HNF4alpha reduces proliferation of kidney cells and affects genes deregulated in renal cell carcinoma. Oncogene 24:6418-6431. 47. Chiba, H., Itoh, T., Satohisa, S., Sakai, N., Noguchi, H., Osanai, M., Kojima, T., and Sawada, N. 2005. Activation of p21CIPl/WAFl gene expression and inhibition of cell proliferation by overexpression of hepatocyte nuclear factor-4alpha. Exp Cell Res 302:11-21. 48. Shoemaker, A.R., Moser, A.R., Midgley, C.A., Clipson, L., Newton, M.A., and Dove, W.F. 1998. A resistant genetic background leading to incomplete penetrance of intestinal neoplasia and reduced loss of heterozygosity in ApcMin/+ mice. Proc Natl AcadSci USA 95:10826-10831. 49. Haigis, K.M., and Dove, W.F. 2003. A Robertsonian translocation suppresses a somatic recombination pathway to loss of heterozygosity. Nat Genet 33:33-39. 224 50. Haigis, K.M., Hoff, P.D., White, A., Shoemaker, A.R., Halberg, R.B., and Dove, W.F. 2004. Tumor regionality in the mouse intestine reflects the mechanism of loss of Ape function. Proc Natl Acad Sci USA 101:9769-9773. 51. Mabley, J.G., Pacher, P., Bai, P., Wallace, R., Goonesekera, S., Virag, L., Southan, G.J., and Szabo, C. 2004. Suppression of intestinal polyposis in Apcmin/+ mice by targeting the nitric oxide or poly(ADP-ribose) pathways. Mutat Res 548:107-116. 52. Leclerc, D., Deng, L., Trasler, J., and Rozen, R. 2004. ApcMin/+ mouse model of colon cancer: gene expression profiling in tumors. J Cell Biochem 93:1242-1254. 53. Baran, A.A., Silverman, K.A., Zeskand, J., Koratkar, R., Palmer, A., McCullen, K., Curran, W.J., Jr., Edmonston, T.B., Siracusa, L.D., and Buchberg, A.M. 2007. The modifier of Min 2 (Mom2) locus: embryonic lethality of a mutation in the Atp5al gene suggests a novel mechanism of polyp suppression. Genome Res 17:566-576. 54. Bensaad, K., and Vousden, K.H. 2007. p53: new roles in metabolism. Trends Cell 5zo/17:286-291. 55. Lowe, S.W., Bodis, S., McClatchey, A., Remington, L., Ruley, H.E., Fisher, D.E., Housman, D.E., and Jacks, T. 1994. p53 status and the efficacy of cancer therapy in vivo. Science 266:807-810. 56. Bunz, F., Hwang, P.M., Torrance, C, Waldman, T., Zhang, Y., Dillehay, L., Williams, J., Lengauer, C, Kinzler, K.W., and Vogelstein, B. 1999. Disruption of p53 in human cancer cells alters the responses to therapeutic agents. J Clin Invest 104:263-269. 57. Munro, A.J., Lain, S., and Lane, D.P. 2005. P53 abnormalities and outcomes in colorectal cancer: a systematic review. Br J Cancer 92:434-444. 225 58. Maeda, Y., Seidel, S.D., Wei, G., Liu, X., and Sladek, F.M. 2002. Repression of hepatocyte nuclear factor 4alpha tumor suppressor p53: involvement of the ligand- binding domain and histone deacetylase activity. Mol Endocrinol 16:402-410. 59. Maeda, Y., Hwang-Verslues, W.W., Wei, G., Fukazawa, T., Durbin, M.L., Owen, L.B., Liu, X., and Sladek, F.M. 2006. Tumour suppressor p53 down-regulates the expression of the human hepatocyte nuclear factor 4alpha (HNF4alpha) gene. Biochem J 400:303-313. 60. Boudreau, F., Lussier, C.R., Mongrain, S., Darsigny, M., Drouin, J.L., Doyon, G., Suh, E.R., Beaulieu, J.F., Rivard, N., and Perreault, N. 2007. Loss of cathepsin L activity promotes claudin-1 overexpression and intestinal neoplasia. Faseb J 21:3853-3865. 61. Madison, B.B., Dunbar, L., Qiao, X.T., Braunstein, K., Braunstein, E., and Gumucio, D.L. 2002. Cis elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. J Biol Chem 277:33275-33283. 62. Perreault, N., Sackett, S.D., Katz, J.P., Furth, E.E., and Kaestner, K.H. 2005. Foxll is a mesenchymal Modifier of Min in carcinogenesis of stomach and colon. Genes Dev 19:311-315. 63. Boudreau, F., Rings, E.H., van Wering, H.M., Kim, R.K., Swain, G.P., Krasinski, S.D., Moffett, J., Grand, R.J., Suh, E.R., and Traber, P.G. 2002. Hepatocyte nuclear factor-1 alpha, GATA-4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription. Implication for the developmental regulation of the sucrase-isomaltase gene. J Biol Chem 277:31909- 31917. 226 64. Brunet, S., Thibault, L., Lepage, G., Seidman, E.G., Dube, N., and Levy, E. 2000. Modulation of endoplasmic reticulum-bound cholesterol regulatory enzymes by iron/ascorbate-mediated lipid peroxidation. Free Radic Biol Med28:46-54. 65. Lepage, G., Munoz, G., Champagne, J., and Roy, C.C. 1991. Preparative steps necessary for the accurate measurement of malondialdehyde by high-performance liquid chromatography. Anal Biochem 197:277-283. 227 DISCUSSION Le tractus gastrointestinal est un organe ou la preservation de l'homeostasie est complexe. Etant un tissu a renouvellement rapide, celui-ci est d'abord constamment soumis au risque de generer des cellules ayant acquis suffisamment de mutations pour initier une tumorigenese. Le cancer colorectal prend actuellement la quatrieme position au rang des cancers les plus meurtriers au Canada et affecte la qualite de vie de milliers de personnes. L'autre dimension particuliere du tube digestif est celle d'etre colonisee par une flore commensale de microorganismes et d'etre constamment en presence de proteines etrangeres fragmentees, ou entieres, parfaitement immunogenes contre lesquelles le systeme de surveillance immunitaire associe a l'intestin devra se montrer tolerant. Le systeme immunitaire intestinal forme la seconde population cellulaire qui sera la plus soumise aux composantes genetiques ou environnementales pouvant entrainer un dereglement pathologique qui menera aux maladies inflammatoires intestinales ou encore a des allergies alimentaires. En addition de sa culpabilite dans l'apparition du cancer, la composante epitheliale du tractus gastrointestinal se voit de plus en plus attribuer un role important dans le developpement de ces maladies inflammatoires. Nous avons pu apprecier, grace a notre etude des facteurs de transcription CUX1 et HNF4a, 1'importance du programme transcriptionnel epithelial dans le maintien de l'homeostase inflammatoire et proliferative de l'intestin. 228 1. CUX1 1.1 Observations initiates L'interet pour le facteur de transcription CUX1 en regard des maladies inflammatoires intestinales s'est developpe a partir d'une observation ayant ete effectuee lors de I'etude phenotypique intestinale des animaux CuxlAHD par Boudreau et al. (BOUDREAU, et al., 2001). En effet, il avait ete observe que ces animaux developpent a long terme des organes lymphoi'des tertiaires coliques; possiblement dus a une situation d'inflammation soutenue. Ce type de structure aberrante se developpe dans le cadre de plusieurs maladies d' inflammation chronique (ALOISI et PUJOL-BORRELL, 2006), dont les Mil (CARLSEN, et al., 2002). Cette observation n'a eventuellement pas ete repetee sous la lignee genetique murine CD1 aux divers temps de developpement observes et des lors, rinflammation ne semblait pas etre presente de maniere spontanee chez ces animaux. II est important de savoir que la facilite animaliere dans laquelle les experimentations se sont ensuite deroulees pour I'etude publiee ici (Manuscrit-1), est une facilite dite depourvue d'une certaine liste de pathogenes murins (e.g. Helicobacter, pasteurella et norovirus murin). II n'est done pas exclu que differentes conditions environnementales, alors retrouvees dans la facilite animaliere au cours des observations initiales, aient pu apporter l'element initiateur de ce phenomene inflammatoire observe. En effet, il est de plus en plus argumente que certaines souches bacteriennes peuvent declencher ou ameliorer un debalancement au niveau des mediateurs inflammatoires dans les muqueuses intestinales (ISAACS et HERFARTH, 2008; TAKAISHI, et al., 2008). Ainsi, on pourrait s'attendre a ce que l'utilisation d'un modele d'administration de bacteries enterotoxigeniques tel que Bacteroides fragilis reproduise a la fois la colite qui a ete 229 observee avec le DSS, mais aussi la formation de ces structures a long terme (RHEE, et al., 2009). 1.2 Permeabilite epitheliale Malgre l'absence de signe clinique majeur dans la muqueuse colique de ces animaux, differents parametres connus pour modifier la susceptibilite a l'inflammation ont ete verifies et n'ont pas ete inclus dans notre publication sur le sujet (Manuscrit-1). Avec l'importance de la regulation de la permeabilite epitheliale dans les maladies inflammatoires intestinales (HOLLANDER, 1999), verifier les proprietes physiques de Perithelium des mutants CuxlAHD a ete une experience importante dans le cadre de ce projet. Deux approches ont ete utilisees. Dans un premier temps, un petit traceur moleculaire, le sulfo-NHS-biotin a ete injecte dans le colon des animaux. Ce traceur de 443 Da a ete montre capable de traverser les jonctions chez des animaux susceptibles (GUTTMAN, et al., 2006). Chez les mutants CuxlAHD, comme chez les controles, la biotine a ete conservee du cote luminal (resultat non montre). L'autre approche, effectuee en collaboration avec la Dre Elena Verdu, a permis de mesurer la conductivite electrique de la muqueuse et confirmer sa permeabilite. Les deux parametres n'ont pas revele de difference entre mutants et controles (resultat non montre). Malgre cette propriete barriere en toute apparence normale, l'expression des jonctions cellulaires principales de l'intestin a tout de meme ete verifiee dans le colon de ces animaux. L'immunobuvardage de l'occludine (Oclri) revele une augmentation significative de l'expression de cette molecule dans le colon (resultat non montre). Ceci est tres interessant etant donne la recente demonstration de la repression de l'occludine par pi 10CUX1 dans les cellules normales de la glande mammaire (NMuMG-NYPD) (KEDINGER, et al., 2009). L'occludine a ete identifiee comme une proteine de la jonction serree etant fortement reduite 230 dans la muqueuse des patients atteint de la maladie de Crohn (ZEISSIG, et al., 2007) ou de la colite ulcereuse (KUCHARZIK, et al., 2001). Bien que les animaux Oclri'~ n'aient revele aucun defaut de permeabilite et de conductivite epitheliale, le role de VOCLN dans les Mil reste encore a etre determine. Sachant I'augmentation de I'expression de CUXl dans les Mil, il serait possible que la repression de VOCLN soit mediee par CUXl. L'utilisation d'une interference a TARN sur CUXl ou de surexpressions de CUXl dans une lignee cellulaire epitheliale intestinale pouvant exprimer I'occludine a confluence, tel que les T84, permettrait de verifier ce lien moleculaire. Une correlation pourrait aussi etre effectuee entre les donnees d'expression de CUXl et de l'OCZJVchez les patients atteints des MIL N'ayant trouve aucun defaut fonctionnel de permeabilite et de resistance transepitheliale, une analyse plus exhaustive s'est imposee. Pour ce faire, une analyse de micropuce a ADN (GeneChip® Mouse Genome 430 2.0 Array) a ete effectuee sur trois extraits d'ARNm total du colon de trois animaux controles et trois animaux mutants CuxlAHD. Parmi ces genes, le recepteur TLR2 semblait etre reduit de 1,6 fois chez les animaux CuxlAHD. Cependant, l'analyse par PCR en temps reel et par immunobuvardage n'a pas confirme cette modulation chez les animaux. Bien que l'effet sur ce gene semble trop variable pour etre significatif chez les animaux, le lien possible entre CUXl et TLR2 vaut tout de meme que l'on s'y attarde davantage. Les experiences conduites chez les animaux Tlr2'A ont bien demontre le role protecteur de ce recepteur durant 1'inflammation causee par le DSS et pourrait done contribuer au role protecteur de CUXl dans 1'inflammation (CARIO, 2008). 231 1.3 Regulation de I'expression de CUXl Les changements d'activite de CUXl sont de mieux en mieux connus et Ton reconnait maintenant divers stimuli pouvant mener a une augmentation de la capacite de liaison a l'ADN de ce facteur (SANSREGRET et NEPVEU, 2008). Cependant, les mecanismes de regulation de I'expression de CUXl restent relativement peu etudies. Pour le moment, seuls le TGFpi et son effecteur SMAD4 ont ete caracterises comme des regulateurs positifs de I'expression de I'ARNm de CUXl (MICHL, et al., 2005). II a ete montre que le TNFa, dans un contexte epithelial intestinal, etait capable d'induire I'expression de la proteine Cuxl en absence de serum (i.e 0.5% FBS) (Manuscrit-1, Fig. 1.4). Le choix du retrait de serum se voulait une facon de ne pas induire I'expression de Cuxl lors de I'ajout de la cytokine dans un milieu de culture frais. L'expression en ARNm de Cuxl n'a toutefois pas ete verifiee dans ces conditions. L'augmentation observee seulement vers 60 minutes supporte la possibility d'une synthese de novo. Bloquer l'activation de p65/RelA avec 10 uM de Ncc-p-Tosyl-L- lysine chloromethyl ketone (TLCK; Sigma) serait un bon point de depart afin de verifier si Cuxl est un cible transcriptionnelle de la voie NF-KB. Une experience d'immunoprecipitation de la chromatine (ChIP) du facteur p65/RelA sur le promoteur de Cuxl apres stimulation au TNFa serait egalement une bonne approche. D'autre part, il est possible que Cuxl soit egalement regule au niveau de la stabilite de la proteine ou encore via un microARN. Une augmentation du messager de CUXl a egalement ete observee dans le cas des maladies inflammatoires intestinales (Manuscrit-1, Fig.l£). Malheureusement, une banque complete de patients n'est pas a notre disposition pour le moment et une evaluation des niveaux proteiques ainsi que la localisation de cette expression n'a pu etre realisee. II sera 232 interessant dans le futur de viser une etude elargie dans laquelle les trois methodes de mesure du gene seraient utilisees : ARN, proteine et immunofluorescence. Ceci permettra entre autre de determiner si 1'augmentation observee est attribuable au compartiment epithelial ou alors aux cellules immunitaires contenues dans la biopsie. Une augmentation de la cohorte permettra egalement de correler les niveaux de CUX1 au sexe, a l'age, ainsi qu'au stade de la maladie. Certains effets sexe-dependants ont justement ete observes chez le modele mutant Cuxl AHD (SINCLAIR, et al., 2001). Des changements d'isoformes sont egalement a prevoir. Les experiences menees jusqu'a present suggerent que risoforme p200Cuxl soit la forme majoritaire au niveau de Perithelium de surface de la muqueuse colique (Manuscrit-1, Fig.IB et Fig.2^). Cependant, il est bien connu que differents stimuli peuvent mener a une accumulation de formes processees de Cuxl (SANSREGRET et NEPVEU, 2008). Un resultat preliminaire d'immunobuvardage realise sur des isolats epitheliaux de souris traitees 5 jours avec 5% de DSS ont permis d'entrevoir que des formes d'entre 80 et 110 kDa seraient accumulees dans ce type de traitement. Quelles isoformes et quels roles pourraient avoir CUX1 dans ce contexte inflammatoire ? Le modele de restitution aussi utilise sur le modele murin Cuxl AHD suggere que Cuxl puisse etre implique autant durant la phase aigiie que durant la phase de retour de la maladie (Manuscrit-1, Fig.7 et 8). Un aspect tres important de la recuperation face a une injure est la capacite de refermer la blessure, or il a ete suggere recemment que CUX1 soit implique dans la migration de diverses lignees cellulaires cancereuses en culture (HT1080, U87-MG, MDA-MB-231, NIH-3T3 et PANC1) (MICHL, et al., 2005) et que pllOCUXl plus precisement soit implique dans la migration des cellules fibroblastiques NIH3T3 (KEDINGER, et al., 2009). CUX1 ciblerait la repression de FE- 233 cadherine (CDH1) et de l'occludine (OCLN) ainsi que l'expression de la N-Cadherine (CDH2) et de la vimentine (VIM); des modifications importantes dans les processus de migration des cellules epitheliales. Ceci se ferait en cooperation avec les facteurs de transcription Snail et Slug directement actives par CUXl. Ces deux TFs sont bien connus pour leur role dans le processus de transition epithelium mesenchyme necessaire a la restitution d'une blessure (NIETO, 2002; THIERY et SLEEMAN, 2006). 1.4 Migration cellulaire La signalisation par le TGFP est bien reconnue pour son role dans l'arret de proliferation (SUEMORI, et al., 1991) et dans la reparation d'une blessure chez les cellules epitheliales (CIACCI, et al., 1993). Son role dans l'EMT et dans l'activation de Snail et de Slug est bien comprise (ZAVADIL et BOTTINGER, 2005). Comme explique plus haut, CUXl est egalement active par le TGFP (MICHL et DOWNWARD, 2006). Les niveaux de TGFp sont connus pour etre augmentes autant chez les patients UC que CD durant la phase active de la maladie (BABYATSKY, et al., 1996). Bien que ceci devrait etre associe a une repression de 1'inflammation, une caracterisation plus approfondie a par la suite permis de s'apercevoir qu'une augmentation de SMAD7, un variant qui interfere avec la phosphorylation de SMAD2/3, conduit a une reduction de la forme phosphorylee de SMAD3 (p-SMAD3) chez ces patients (MONTELEONE, et al., 2001). Comment alors seraient augmentes les niveaux de CUXl via la voie du TGFP chez les patients des Mil ? II est connu que l'EMT puisse etre promue via l'activation de la p38 MAPK en reponse a une stimulation au TGFp (BAKIN, et al., 2002). Michl et al. sont parvenus a demontrer que la p38 MAPK, et non pas seulement SMAD4, est impliquee dans l'augmentation de l'expression de CUXl (MICHL, et al., 2005). Cependant, un regulateur transcriptionnel n'a pas ete avance dans ce cas precis. Les facteurs 234 ATF2, STAT1 et Max/Myc seraient potentialises en aval de p38 MAPK et pourraient done etre impliques dans la regulation de CUXl (SCHETT, et al., 2008). A noter, p38 MAPK est aussi placee en aval de PAR2 (KANKE, et al., 2001), un recepteur dont le role a ete montre dans l'augmentation de l'activite transcriptionnelle de CUXl (WILSON, et al., 2009). Fait interessant, il a ete montre que l'activite de p38 en reponse au TGFP est potentialisee par le TNFa (BATES et MERCURIO, 2003). Puisque nous avons deja demontre I'inductibilite de CUXl face au TNFa, il serait approprie de tester l'effet d'un traitement combine de ces deux cytokines dans le modele IEC6. Des resultats preliminaries reproduisent deja I'inductibilite de CUXl par le TGFP dans ce meme modele et l'on pourrait ainsi s'attendre a un effet additif lors d'un traitement combine de TNFa et de TGFp. L'utilisation d'un inhibiteur de p38 tel que le SB-239063 (C20H21N4O2F, Sigma) permettrait de determiner la signalisation impliquee. Finalement, l'utilisation d'ARN interference permettrait de determiner le facteur transcriptionnel responsable de l'induction de CUXl (e.g. STAT1). A ne pas oublier, p38 MAPK semble jouer des roles tres differents durant 1'inflammation en fonction du type cellulaire. II a ete montre que la deletion de p38 dans les cellules myeloi'des ameliore la colite experimentale alors que sa deletion dans Perithelium colique mene a une situation opposee (OTSUKA, et al., 2010). Le role de p38 n'entre done pas en conflit avec l'hypothese selon laquelle une augmentation de CUXl dans Perithelium aurait un effet benefique sur le resultat de l'inflammation, alors que sa deletion dans les cellules inflammatoires pourrait avoir un impact tout a fait different. II serait d'ailleurs interessant de le verifier avec la generation d'un modele de deletion conditionnelle de Cuxl (Cuxlfi/fi). Ceci permettrait non seulement de confirmer l'effet protecteur de Cuxl dans la colite experimentale au niveau de 1'epithelium, mais permettrait egalement de verifier cette 235 hypothese au niveau des cellules myeloi'des. A noter qu'il a ete demontre recemment que Cuxl participe a la proliferation des lymphocytes de la lignee Kit 225 (SEGUIN, et al., 2009). 1.5 Proliferation CUX1 pourrait-il etre implique dans la proliferation des cellules en reponse a la blessure ? La reparation d'une blessure passe normalement par 3 phases. Une phase de regeneration impliquant la proliferation, une phase de restitution impliquant la migration des cellules et une phase de remodelage permettant de recreer la morphologie du tissu (YAMAGUCHI et YOSHIKAWA, 2001). Fait interessant, il a ete montre que la phase de restitution peut aussi bien preceder la regeneration et combler des dommages sur de longues distances dans un laps de temps court (NUSRAT, et al., 1994). En addition du role recemment decrit de CUX1 dans l'EMT, CUX1 est depuis longtemps connu comme un facteur accelerant la progression du cycle cellulaire par son role durant la progression en phase S (SANSREGRET et NEPVEU, 2008). Par exemple, les fibroblastes isoles des souris mutantes Cuxlz/z ont un temps de generation caracterise par une phase Gi plus longue. De plus, les fibroblastes Cuxlz/z infectes avec H-RasV12 vont generer de plus petites tumeurs que les controles (Cuxl+/+; H-RasV12) lorsqu'injectes chez les souris nues (SANSREGRET, et al., 2006). En opposition avec ces roles, aucun defaut proliferatif severe n'a ete observe dans l'epithelium normal des animaux CuxlAHD. Ceci suggere que le role de CUX1 dans Perithelium colique normal soit different de celui observe dans la lignee fibroblastique NIH- 3T3. Contrairement a d'autres types cellulaires, CUX1 semble etre retrouve en plus grande concentration dans les cellules differenciees que dans les cellules proliferatives de la crypte colique. Ce type de relation inverse est apparente a celle du TGFJ3 (MASSAGUE, 2000). En effet, ce dernier induit la proliferation chez les NIH-3T3 plutot que leur arret de proliferation 236 comme chez les cellules epitheliales (KUROKOWA, et al., 1987). De maniere interessante, les animaux CuxlAHD apres 2 semaines de recuperation n'ont pas seulement ete incapables de reparer les blessures et freiner 1'inflammation, mais semblent egalement presenter davantage de cryptes aberrantes (ACF). II est possible qu'en reponse a I'ulceration la muqueuse secrete des facteurs de croissance qui, en absence du role regulateur de CUXl dans le cycle cellulaire, soit menee a proliferer de maniere incontrolee. Ceci n'est pas en contradiction avec son role de regulateur positif dans la phase S du cycle cellulaire et indique que CUXl pourrait etre tout aussi necessaire a 1'arret du cycle comme le propose sa localisation dans l'epithelium colique. 1.6 Experiences futures Le modele murin utilise lors de nos travaux affiche peu de phenotypes contrairement a ce qui serait attendu si Ton se rapporte aux nombreux roles developpementaux qui lui sont reconnus chez la Drosophile. En effet, Cut intervient dans plusieurs voies bien connues pour etre importantes dans le developpement chez les mammiferes, tel que la voie de Notch (CANON et BANERJEE, 2003; SUN et DENG, 2005; SUN et DENG, 2007) et la voie Wnt (SUDARSAN, et al., 2001). Developper un modele conditionnel de deletion de Cuxl aurait beaucoup d'avantages. D'abord, il permettrait d'etudier le role embryonnaire de l'homologue Cuxl dans differents tissus. De plus, il serait tres utile a la suite de 1'etude du role de Cuxl dans l'intestin; dans la morphogenese intestinale d'une part, mais aussi a l'approfondissement des connaissances sur le role de Cuxl dans 1'inflammation intestinale. En effet, la version hypomorphique semble retenir une certaine quantite de fonctions et affecte le phenotype observe chez les souris CuxlAHD. La possibility de pratiquer la deletion du gene dans un type cellulaire a la fois permettrait egalement de determiner hors de tout doute que la 237 susceptibilite a 1'inflammation intestinale provient d'abord de l'epithelium et non des populations leucocytaires. La deletion au sein de celles-ci permettrait de determiner si le role de ces cellules est different ou le meme qu'au sein de l'epithelium. Finalement, les travaux preliminaires effectues sur le role de Cuxl dans la differenciation epitheliale intestinale pourraient etre poursuivies avec beaucoup plus de facilite. 238 CONCLUSION GENERALE (Cuxl) Les travaux effectues sur le role de CUXl dans 1'inflammation intestinale ont permis d'etablir un premier role in vivo de CUXl dans la regulation des processus inflammatoires (Figure 5). Nous avons pu avancer que I'expression de CUXl dans I'epithelium sain a peu d'impacts sur sa morphostase ou sur la regulation de Pinflammation en absence de stimulation inflammatoire. Cependant, la modulation de son expression au cours des pathologies, telles que les maladies inflammatoires intestinales, et possiblement dans le cancer associe a la colite ou le cancer colorectal, serait importante dans la resolution de ces etats anormaux. Les resultats obtenus lors des traitements de recuperation ont permis d'avancer que le controle approprie des genes cibles de CUXl dans la maladie de Crohn et dans la colite ulcereuse serait important dans la resolution de 1'inflammation, tant au niveau des genes impliques dans 1'inflammation que ceux impliques dans la proliferation, la differentiation et la migration cellulaire. Nous esperons que ces resultats seront les precedents d'etudes plus approfondies du role de ce facteur dans les pathologies humaines et esperons un jour voir cette cible sur la table des traitements therapeutiques visant la resolution des etats pathologiques de l'intestin. Epithelium sain Pro-inflammatoire (TNFu) ,*»« Wii.x c Cux1 Cux1' ^Z~>^ {Darsigny, et af, 301Oh i Antunflammatoire (TGF(3) ,«JiSM *&IL. E-Cad Cuxlt \ t (MOW, Btal, 2005) p110Cux1 (Kedinger, stat, 2009) Figure 6 | Role propose pour CUXl dans les processus inflammatoires de I'intestin. Selon les Etudes realisees avec le modele mutant CuxlAHD (Manuscrit-1), Cuxl ne serait pas essentiel au maintien de l'hom^ostase du tissu adulte en absence de stimulation inflammatoire. Cependant, Cuxl augmenterait en reponse a une stimulation comme le TNF afin de moduler la reponse inflammatoire Cuxl a egalement ete montre" pour Stre augmente en reponse au TGF|3 (MICHL, et al, 2005) et paiticiperait a la reparation des blessures en etant un effecteur de la transition epithelium mesenchyme (EMT) (KEDINGER, et al., 2009). Ceci permettrait alors a la muqueuse de revenir a un etat normal. 240 2. HNF4a et la regulation de la cytodifferenciation intestinale 2.1 Le maintien du renouvellement epithelial a l'age adulte Etant donne les effets majeurs sur la differenciation des hepatocytes observes lors de la deletion conditionnelle d'Hnf4a au niveau du foie (Alfp.Cre, Hnf4o!*/J*), il etait attendu que la deletion &Hnf4a dans repithelium de I'intestin grele (Villin.Cre, Hnf4a!*/J:x) allait modifier drastiquement la differenciation et la polarisation des cellules epitheliales intestinales. II a done ete etonnant de ne pas retrouver un phenomene aussi drastique lors de notre etude (Manuscrit-2, Fig.4), surtout considerant le resultat obtenu lors de l'invalidation dans le colon murin (Foxa3.Cre, Hnf4oP/jk) (GARRISON, et al., 2006). Tel qu'illustre (Manuscrit-2, FigD-G), l'invalidation par la Cre sous le controle du promoteur \2.4kb-Villme ne parvient pas a deleter le gene Hnf4a avant ou durant la periode de morphogenese s'operant de E9.0 a E13.5. En effet, cette construction serait active a partir de E14.5 (MADISON, et al., 2002) et surviendrait done plus tard en comparaison avec l'utilisation de la construction Foxa3.Cre active a partir de E8.5 dans le hindgut (LEE, et al., 2005). Les effets observes sur la differenciation des cellules epitheliales de I'intestin grele suggerent toutefois un role interessant au niveau de la cytodifferenciation de differentes lignees cellulaires. L'augmentation d'environ 50% du nombre de cellules caliciformes colorees a l'acide periodique de Schiff (Periodic Acid Schiff; PAS) (Manuscrit-2, Fig.5Q et 1'augmentation d'environ 30% du nombre de cellules marquees par la chromogranine A (Chga+) (Manuscrit-2, Fig.55), tout en ayant une villosite d'une taille legerement reduite (Manuscrit-2, Fig.45), laisse presumer une augmentation des cellules de la lignee secretaire aux depends de la lignee absorbante. L'une des premieres decisions dans la destinee 241 cellulaire des cellules absorbantes versus les cellules de la lignee secretaire est la necessite de I'expression de Mathl (SHROYER, et al., 2007). Une legere augmentation de I'expression de ce facteur est detectable dans le jejunum de ces animaux (Annexe, Tableau 3) et pourrait favoriser ce debalancement (YANG, et al., 2001). L'augmentation moins importante des cellules enteroendocrines par rapport aux cellules caliciformes pourrait s'expliquer par le fait que la plupart, mais non pas toutes les cellules enteroendocrines sont Chromogranine A+ (Chga+) (RINDI, et al., 2004). Le nombre apparemment inchange des cellules de Paneth (Manuscrit-2, Fig.5^4) suggere que le role d'Hnf4a sur ces decisions s'opere a un moment ou le nombre de ces precurseurs est deja fixe. Cependant, la reduction de I'expression du lysozyme, un marqueur de differentiation de ces cellules, laisse presager qu'Hnf4a puisse etre un regulateur positif de ce gene. Fait tres interessant, d'autres marqueurs des Paneth sont totalement a I'inverse de ce premier. En effet, la metalloprotease de la matrice-7 (MmpT) et certaines molecules de la famille des defensines (Defcr21, Dejbl et Defcr-rslO) sont fortement augmentes (1.5 a 106 fois) dans l'intestin grele des souris //w/^a^^0 selon la micropuce (Manuscrit-4, GSE20968). II a ete demontre que differents membres de cette derniere famille de peptides antimicrobiens sont sous le controle du facteur de transcription Tcf4 (VAN ES, et al., 2005). De plus, des etudes recentes suggerent une interaction directe entre Hnf4a et Tcf/Lef (CATTIN, et al., 2009) sur le promoteur de differents genes (COLLETTI, et al., 2009). Certains promoteurs, tel que le promoteur Cyplal, sont reprimes en presence d'Hnf4a alors qu'ils sont exprimes lors de la presence combinee d'Hnf4a et Tcf/Lef. II est possible qu'Hnf4a soit necessaire a une reduction de I'expression de ces genes enumeres ci-haut dans les cellules de Paneth et que ceci laisse une place plus importante a Tcf/Lef dans le cas des animaux Hnf4a nuls. Comme seules les cellules de Paneth conservent la stimulation par les Wnt, ceci justifierait un effet sur ces genes qui serait reserve a ces cellules. Une 242 augmentation de 50% de Sox9 (Annexe, Tableau 3), implique dans la differenciation des cellules de Paneth (MORI-AKIYAMA, et al., 2007), pourrait aussi contribuer a 1'augmentation de certains de ces marqueurs tout en n'alterant pas leur nombre. Sox9 est egalement exprime par les cellules enteroendocrines post-mitotiques (FORMEISTER, et al., 2009). Comment expliquer le nombre plus eleve de cellules caliciformes et enteroendocrines ? Plusieurs etudes de la derniere decennie ont permis de decouvrir un ensemble de facteurs de transcription essentiels a la differenciation de ces 2 lignees. Le facteur Neurogenin-3 (Neurog3) est necessaire a la differenciation de l'ensemble de cellules enteroendocrines sans affecter les autres cellules de la lignee secretoire (JENNY, et al., 2002) et ce, malgre que son expression semble debuter des 1'apparition des precurseurs Mathl+ de tous les types cellulaires secretaires (SCHONHOFF, et al., 2004). De plus, l'expression forcee de Neurogenin-3 (Tg-12Akb-Villin-Neurog3) montre que le nombre total de cellules de la lignee secretoire reste stable, mais que les cellules enteroendocrines sont plutot augmentees aux depends des cellules caliciformes (LOPEZ-DIAZ, et al., 2007). Ainsi, les animaux Hnf4aSEC n'ont pas de variation de Neurog3 et demeurent en parfait accord avec 1'augmentation combinee de ces deux lignees (Annexe, Tableau 3). De maniere presque inverse, la deletion de Gfil apporte une augmentation des cellules enteroendocrines, une diminution de 30% des cellules caliciformes et une perte complete des cellules de Paneth (SHROYER, et al., 2005). L'expression de Gfil augmente de 30% dans les souris Hnf4aMEC ce qui pourrait contribuer a l'augmentation du nombre de cellules caliciformes (Annexe, Tableau 3). Un autre facteur implique dans la differenciation des cellules caliciformes, Elf3, avec une augmentation de 50%, pourrait s'ajouter a cet effet (Annexe, Tableau 3). Les souris Elf3~'' ont une reduction d'environ 50% de ces cellules dans la portion proximale de l'intestin (NG, et al., 2002). 243 Finalement, la plus recente addition au reseau transcriptionnel necessaire a la destinee cellulaire des cellules de la voie secretoire est la combinaison des facteurs Foxal/a2 (YE et KAESTNER, 2009). Les souris portant la double deletion Foxal/a2''' ont moins de cellules caliciformes, moins de cellules Sst+, moins de cellules Chga+ et aucune cellule Glp-1+/Glp2+ et Pyy+. Les cellules Cck+, Sct+, Sst+, Gip+ et Vip+ demeurent quant a elles inchangees. L'expression de Pax6 et Isll est diminuee egalement chez ces mutants, suggerant que ces facteurs sont en amont de ces derniers. Fait important, les souris Hnf4aAlEC ont une augmentation de 40% des facteurs Foxal et Foxa2 (Annexe, Tableau 3). Ceci pourrait contribuer a 1'augmentation des cellules caliciformes et fait interessant l'expression du pre- proglucagon (Gcg) augmente elle aussi de 35% chez les animaux Hnf4aAIEC. L'expression de Pyy et de Sst reste cependant stable chez les mutants. Le facteur Foxa2 (HNF3|3) est reconnu pour entrer en synergie avec Hnf4a pour l'activation du gene ApoAI (HARNISH, et al., 1996). La premiere hypothese serait done que malgre l'augmentation de Foxal/a2, l'absence d'Hnf4a sur le promoteur de ces genes normaliserait l'expression des genes ci-haut nommes. L'autre hypothese provient de l'observation voulant que Hnfip est capable de reprimer Hnf4a dans la lignee cellulaire INS-1 (WANG, et al., 2002). On pourrait alors imaginer que dans les decisions normales de la determination de ces cellules, Hnf3(3 sert a reprimer Hnf4a afin de permettre la differenciation des cellules D (Sst+). Consequemment, la deletion d'Hnf4a n'empeche en rien le deroulement de la differenciation de cette cellule. Le decompte de ces cellules permettra de preciser l'hypothese a privilegier. Si le nombre de cellule D augmente, alors ceci pointera vers la premiere hypothese. Si le nombre de cellules D reste stable, alors ceci pointera vers la seconde. 244 Mis a part les facteurs necessaries a la destinee du progeniteur commun des cellules enteroendocrines, d'autres facteurs vont affecter specifiquement certains des 14 types de ces cellules. Par exemple, le facteur neurogenique 1 {Neurodl) a ete montre essentiel aux cellules Sct+ (Secretin; Set) et Cck+ (Cholecystokinin; Cck) (NAYA, et al., 1997). II n'y a pas de variation mesuree dans le gene Neurodl et consequemment, l'ARNm de Set semble stable. Cependant, le messager de Cck est lui augmente de 80%. Le facteur Insml semble affecter une grande proportion des cellules enteroendocrines sans toucher aux autres types cellulaires. Les mutants Insml''' perdent completement les cellules Chga+, Tacl+, Nts+ et environ 50% des cellules Pyy+, Cck+ et Sst+ (GIERL, et al., 2006). Les souris Hnf4aAIEC ont une legere augmentation de l'expression de Insml. Le facteur Nkx2.2 a lui aussi demontre sa necessite dans la formation de certains types de cellules enteroendocrines. De fait, les cellules Gcg+ (Glucagon; Gcg), Cck+, Gip+ (Gastric inhibitory peptide; Gip) et 5HT+ (Serotonin) sont reduites chez l'animal Nkx2.2~/~ (DESAI, et al., 2008). Par contre, les cellules Ghrl+ (Ghrelin; Ghrl) sont elles augmentees. L'expression de tous les facteurs de la famille Nkx ne varie pas dans le jejunum des animaux Hnf4aMEC (Annexe, Tableau 3). Lorsqu'il y a deletion de Pax4, le duodenum contient une quantite fortement reduite de cellules 5HT+, Cck+, Gip+, Pyy+ et Sct+ alors que lorsqu'il y a deletion de Pax6, seules les cellules Gip+ et Pyy+ sont en nombre moins important (LARSSON, et al., 1998). Ni l'un, ni l'autre de ces facteurs n'est affecte dans les souris Hnf4aMEC (Annexe, Tableau 3). Par contre, l'expression de Gip dans ces souris est fortement reduite. Finalement, sans affecter le nombre de cellules de la lignee secretaire, la deletion conditionnelle de Pdxl dans l'intestin affecte de maniere importante l'expression de Gip et Sst dans le duodenum de ces animaux (CHEN, et al., 2009). 245 2.2 Axe entero-insulaire La decision des destinees cellulaires des cellules exocrines versus endocrines du pancreas ressemblent fortement aux decisions des lignees absorbante versus secretoire. Tout comme dans l'intestin, la lignee endocrine necessite une protection de l'activation de Hesl par I'expression de Delta (JENSEN, et al., 2000). Le precurseur des cellules a, P et 8 et PP est ensuite dependant de Neurog3 (ANG et ROSSANT, 1994), puis Neurodl (NAYA, et al., 1997), avant de former les cellules a secretant le glucagon, des cellules p secretant l'insuline et des cellules 8 secretant de la somatostatine. Ces differentes lignees sont dependantes de Pax6 pour la lignee a (ST-ONGE, et al., 1997), de Pax4, Nkx2.2 et Pdxl pour la lignee P (AHLGREN, et al., 1998; SOSA-PINEDA, et al., 1997; SUSSEL, et al., 1998) et de Pax4 et Pdxl pour la lignee 8 (SOSA-PINEDA, et al., 1997). Les mutations retrouvees dans HNF4a chez l'humain causent une deficience dans la secretion de l'insuline par les cellules P (LOVE-GREGORY et PERMUTT, 2007). Jusqu'a maintenant, les repercussions intestinales des mutations retrouvees chez les patients atteints du diabete de type MODY1 n'ont pas ete etudiees. Si effectivement Hnf4a est implique dans la differenciation des cellules enteroendocrines, ceci pourrait ouvrir d'importantes avenues dans la comprehension de ces desordres. En effet, la secretion de l'insuline apres un repas est dependante a 50% d'hormones secretees par l'intestin (NAUCK, et al., 1986). Cette communication entre les ilots de Langerhans et l'intestin est aussi appelee l'axe entero- insulaire (UNGER et EISENTRAUT, 1969). Les hormones impliquees dans cet axe, aussi appelees hormones incretines, sont le glucagon-like peptide 1 (GLP-1) genere a partir du pre- proglucagon (Gcg) et le gastric inhibitory peptide (Gip) secretes par les cellules enteroendocrine L de l'intestin (MORTENSEN, et al., 2003; REIMANN, et al., 2008). 246 II est connu que chez certains patients atteints du diabete de type MODY1, le defaut de secretion d'insuline serait cause par la perte de I'expression du gene Kir6.2 {Kcnjll) sous le controle de HNF4a. Kir6.2 fait partie d'un complexe octamerique forme de 4 unites formant le pore (Kir6.1 ou Kir6.2) et 4 unites de regulation (Surl ou Sur2) qui ensemble forment un canal potassique sensible a l'ATP (ATP-sensitive K (KATP) channel) (BABENKO, et al., 1998). De maniere interessante, bien que Kir6.2 {Kcnjll) ne soit pas module chez les animaux mutants, son equivalent Kir6.1 {KcnjS) et I'unite regulatrice Surl {Abcc9) sont respectivement reduits de 55 et 65 % dans le colon des animaux Hnf4aMEC (Manuscrit-3, GSE11759). Kir6.2 est exprime par les cellules a, P, 8 et PP du pancreas, mais seulement par les cellules enteroendocrine L de l'intestin (GLPl/2+) (REIMANN, et al., 2008; SUZUKI, et al., 1997). Dans les cellules {3 du pancreas, l'augmentation du glucose et 1'augmentation d'ATP qui l'accompagne a pour effet de fermer ce canal potassique sensible a l'ATP et d'induire une depolarisation qui ultimement permet l'augmentation du calcium intracellulaire [Ca ], permettant fmalement I'exocytose des granules d'insuline (ASHCROFT, 2000). De facon similaire, les cellules L de l'intestin secretent le GLP-1 qui stimule ensuite la relache d'insuline par les cellules P du pancreas (HOLST, 2007). Ces cellules repondraient a une augmentation des nutriments, dont le glucose, par un mecanisme utilisant le meme le canal potassique sensible a l'ATP (REIMANN et GRIBBLE, 2002). Tel que decrit plus haut, I'expression du pre-proglucagon {Gcg) est augmentee dans le jejunum des animaux Hnf4amc. Par contre, cette expression est reduite de 75% dans le colon par rapport aux animaux controles (Annexe, Tableau 4). II faut aussi savoir que la quantite de cellules L et I'expression du pro-glucagon augmente selon l'axe A-P de l'intestin (REIMANN, et al., 2008). Etant donne ces differents parametres et les effets inverses obtenus sur I'expression du pre- proglucagon dans le jejunum et le colon, il sera important de quantifier les niveaux sanguins 247 des formes matures et circulantes du GLP-1. Un autre indice en faveur d'une reduction globale des hormones incretines est la reduction de 75% de l'expression de la Gip dans le jejunum (Annexe, Tableau 4). Les souris Gipr'1' ont des taux sanguins de glucose plus eleves due a une reduction de la secretion d'insuline apres un gavage (MIYAWAKI, et al., 1999). Une reduction combinee du Glp-1 et du Gip produirait un effet maximal puisqu'il a ete rapporte qu'il puisse y avoir des compensations entre ces deux incretines (PEDERSON, et al., 1998). Fait interessant, la preparation d'un vaccin contre le GIP pourrait etre efficace dans la lutte a l'obesite chez l'humain (FULURIJA, et al., 2008). Des resultats preliminaires utilisant un test de tolerance au glucose suggerent que ces memes animaux seraient hyperglycemiques sur les 2 heures suivant le gavage de glucose lorsque les animaux sont a jeun. Ceci permet d'avancer que les taux circulants des incretines originaires de l'intestin seraient globalement reduits lors d'un repas et seraient consequemment responsables d'une moins forte secretion d'insuline. Une etude plus approfondie devra etre poursuivie pour preciser la regulation du glucose sanguin postprandial grace a l'axe entero-insulaire. Entre autre, comme l'absorption par les enterocytes risque d'entrer en jeu durant ce test, les conclusions pourront etre precisees par l'utilisation d'un test d'injection intra-peritoneal du glucose afin de determiner la capacite de reponse des cellules P lors d'une hausse directe du glucose sanguin. Globalement, ces tests de tolerance au glucose permettront d'extrapoler si une mutation dans le gene HNF4a au niveau intestinal pourrait jouer un role dans le diabete. Fait interessant, il est reconnu que les jeunes patients portant des mutations MODY1 sont hypoglycemiques a la naissance, meme s'ils deviennent hyperglycemiques plus tard (PEARSON, et al., 2007). Parallelement, les souris Hnf4af*/fx; Ins.Cre 248 sont elles aussi hypoglycemiques, meme si elles sont intolerantes au glucose (GUPTA, et al., 2005). Un autre test preliminaire indique que les animaux Hnf4aAIEC sont hypoglycemiques si nourris ad libitum. Ceci laisse suggerer que globalement les animaux Hnf4aAI laisses a eux memes se nourriraient moins. En ligne avec cette hypothese, d'autres resultats indiquent que le poids des animaux de plus de 2 mois est reduit significativement chez les mutants Hnf4aMEC (resultat non montre). Encore une fois, l'intestin joue un role direct dans la regulation de la prise de nourriture. Cette fois, ce sont les hormones orexigenes, ce qui veut dire « dormant l'appetit», qui y participent. L'exemple connu au niveau intestinal est la ghreline (Ghrf) (NAKAZATO, et al., 2001). A Finverse, des hormones de la satiete sont aussi secretees par l'intestin, ce sont les hormones Cck, Ppy, Pyy, Glp-1 et l'oxyntomodulin (WREN et BLOOM, 2007); cette derniere etant elle aussi generee a partir du pre-proglucagon (BATAILLE, et al., 1981). Selon les expressions en ARNm, les hormones Cck et Pyy seraient augmentees de pres de 90% dans le jejunum des animaux Hnf4aAIEC (Annexe, Tableau 4). Tel que mentionne plus tot, la ghreline est augmentee de 2 fois dans le jejunum des animaux. Cette augmentation peut sembler s'opposer a l'augmentation des hormones de satiete. Cependant, il faut savoir que le messager de la ghreline donne un propeptide generant deux hormones (ZHANG, et al., 2005). La ghreline, orexigene, et Pobestatine qui diminue l'appetit (COHEN, et al., 2003). De plus, la ghreline doit etre sous forme octanoylee pour etre active (KOJIMA, et al., 1999). Cette hormone est egalement connue pour activer une autre hormone orexigenique au niveau du cerveau, soit le neuropeptide Y (Npy) (CHEN, et al., 2004). Le Npy est egalement exprime par les cellules enteroendocrines de l'intestin (KEAST, et al., 1987). Or le neuropeptide Y est reduit de 20% dans le jejunum des mutants Hnf4a. Ceci donne l'indice 249 que la ghreline n'est pas necessairement active dans ce systeme et laisserait place plutot a I'obestatine. Encore une fois, des experiences ciblees et des dosages sanguins de ces hormones pourront seulement preciser le role exact d'Hnf4a dans ces contextes. II sera egalement interessant de mesurer, chez les animaux ou la difference de poids est notable (e.g. 1 an), la difference dans les differents depots adipeux pour verifier si les mutants Hnf4a ont une reduction de Paccumulation de reserves. La coloration du glycogene hepatique serait aussi une mesure interessante des reserves energetiques disponibles. Finalement, une collaboration avec la Dre Verdu permettrait de mesurer la prise de nourriture grace a des cages metaboliques. 2.3 Ouverture En somme, il sera particulierement interessant de poursuivre la caracterisation de 1'aspect endocrinien de 1'epithelium Hnf4a negatif, car ceci pourrait apporter d'importantes reponses a l'etiologie des diabetes hereditaires de type MODY1. En effet, les repercussions des mutations dans le gene HNF4A n'ont pas ete etudiees au niveau du systeme digestif. Vue 1'importance que semble avoir HNF4a dans le controle de populations enteroendocrines ceci pourrait representer une dimension importante de l'axe entero-insulaire. De plus, ces hormones sont connues pour reguler de nombreuses autres fonctions intestinales et pourraient contribuer aux maladies inflammatoires et au cancer colorectal (BALDWIN et WHITEHEAD, 1994; GROSS et POTHOULAKIS, 2007). 250 3 HNF4tt et la regulation de l'inflammation 3.1 Comparaison des modeles Le resultat de la deletion d'Hnf4a au niveau du colon (Foxa3.Cre; Hnf4c^/;lk) durant la periode de morphogenese intestinale (E8.5) conduit a une mauvaise formation des cryptes et consequemment en une reduction importante de la proliferation et du nombre de cellules differenciees, dont les cellules caliciformes (GARRISON, et al., 2006). La deletion d'Hnf4a dans une fenetre qui precede le debut des communications epithelio-mesenchymateuses permet de speculer qu'Hnf4a est important dans l'expression epitheliale de facteurs necessaires dans cette communication. Les auteurs ont verifie l'expression de quelques morphogenes importants, dont Bmp4 et Ihh, et confirme leur expression inchangee, mais n'ont pas pousse l'analyse davantage et n'ont finalement pas determine l'origine du dereglement De plus, du a la deletion concomitante au niveau hepatique, la mortalite embryonnaire entrainee par l'absence d'Hnf4a dans cet organe empeche l'analyse du role d'Hnf4a dans le tissu adulte. Notre approche utilisant le promoteur 12Akb-Villine nous a permis de placer la deletion d'Hnf4a (voir discussion precedente) a un moment qui ne semble pas critique pour Fetablissement de ces communications et a permis d'analyser le maintien de Perithelium adulte dans le colon. En effet, la morphologie et la cytologic du tissu colique n'ont pas semble alterees dans ce modele. En particulier, les cellules caliciformes semblent tout a fait normales chez le jeune animal adulte (Manuscrit 3, ¥ig.2A-D). 3.2 Colite spontanee Contrairement aux observations realisees sur les animaux CuxlAHD (Manuscrit-1), des indices d'inflammation chronique sont apparus au fil de la vie des animaux mutants Hnf4a. 251 En effet, 1'observation physiopathologique de coupes de colon a permis de reconnaitre des signes de dysplasie epitheliale a partir de 3 mois d'age chez les animaux (Manuscrit-3, Fig.lC-F). L'etude a ensuite porte sur la description de la pathologie identifiee chez les animaux les plus avances dans leur maladie, soit les animaux d'environ 12 mois d'age. D'une part, il a ete observe que les mutants Hnf4amc developpent d'importants changements dans I'expression de cytokines et chemokines pro-inflammatoires. Par exemple, plusieurs chemokines de type CXC-ligand (CXCL#) portant le motif ELR (HAYASHI, et al., 1999) et impliquees dans le recrutement des granulocytes (AHUJA et MURPHY, 1996), etaient augmentes de 3 a 5 fois (Manuscrit-3, Fig.3^4). Ces secretions ont ete accompagnees d'une augmentation de 1'infiltration des neutrophiles (Manuscrit-3, Fig.3C-D). II n'a pas ete determine cependant si cette expression provient de l'epithelium ou de ces cellules inflammatoires elles-memes. II serait interessant de determiner si Hnf4a intervient directement sur I'expression de ces genes au niveau de l'epithelium ou si cet environnement inflammatoire s'installe au cours de la colite de 1'animal. Quelques indices laissent tout de meme croire qu'Hnf4a n'intervient pas directement sur I'expression de la majorite de ces genes. En effet, la micropuce d'ADN realisee sur les extraits d'ARN provenant des animaux malades indique une expression relativement stable des molecules ci-haut nominees (Manuscrit-3, GSE11759). De plus, 1'analyse de differents marqueurs reserves ou absents des GALTs (Ccl20, Pigr, etc) (PAPPO et OWEN, 1988; TANAKA, et al., 1999) ont ete analyses pour s'assurer que les extraits des mutants ne comportaient pas plus ou moins de structure lymphoi'des organisees que les controles (Manuscrit-3, GSE 11759). Un marqueur general des populations de lymphocytes matures, le couple CD40/CD154 (SCHONBECK et LIBBY, 2001), montre egalement une expression inchangee (Manuscrit-3, GSE 11759). Comment expliquer une stabilite de I'expression de ces genes et une detection accrue de ces mediateurs dans les 252 extraits proteiques ? D'abord, les neutrophiles sont connus pour secreter une variete de cytokines et chemokines, dont plusieurs chemokines ELR+ (SCAPINI, et al., 2000). Ces neutrophiles possedent divers types de granules de secretion dont certains sont deja formes lors de leur arrivee au site d'inflammation (BORREGAARD, et al., 2007). II est possible que ces mediateurs proviennent de cette population transitoire de l'intestin et qu'une proportion de ces mediateurs soient deja contenus dans leurs granules lors de leur extravasation au site de recrutement. Une reduction de la quantite de cellules caliciformes et de l'expression de la mucine-2 associee a cette population, a egalement ete observee dans les cryptes dysplasiques (Manuscrit-3, Fig.2E-F). La mucine-2 est importante dans la protection de l'epithelium contre les pathogenes potentiels en reduisant leur acces a la surface epitheliale (VAN DER SLUIS, et al., 2006; VELCICH, et al., 2002) et il est reconnu que les cellules a mucus sont reduites en nombre durant les episodes d'inflammation (THEODOSSI, et al., 1994). La disparition locale de la couche de mucus est nefaste puisque ceci conduit en une meilleure chance d'acces a la flore commensale dans un endroit ou l'ulceration risque d'etre la plus severe et ou 1'inflammation deja presente sera amplifiee par la signalisation des PAMPs sur les recepteurs PPRs. D'autres, comme la mucine-3, sont exprimees par les cellules epitheliales en general (HO, et al., 1996). Contrairement a la mucine-2 dont l'expression semblait stable dans les premiers mois de vie chez les animaux Hnf4aAIEC il a ete observe que la mucine-3 perd en expression tres rapidement et ce des la maturation complete du tube digestif a 7 jours apres la naissance (Manuscrit-3, Fig.2H). Cette observation replique assez fidelement les observations de l'equipe de Duncan qui en ont egalement profite pour confirmer la regulation directe de ce gene par Hnf4a (GARRISON, et al., 2006). II a ete montre que la mucine-3, par son 253 motif semblable a l'EGF, est impliquee dans la migration, la reparation des blessures et la protection contre I'apoptose dans Fepithelium intestinal. Ceci pourrait avoir contribue a 1'amplification de 1'inflammation chronique (HO, et al., 2006). 3.3 Initiation de la colite spontanee Identifier le role exact que joue la perte d'Hnf4oc dans la pathologie qui se developpe dans la muqueuse colique de ces animaux est une tache difficile. Notre analyse a tout de meme permis d'avancer un mecanisme prometteur et coherent avec la physiopathologie retrouvee chez la colite ulcereuse humaine. En effet, un important debalancement dans les genes associes au transport des electrolytes a ete identifie dans la muqueuse malade des animaux Hnf4aMEC (Manuscrit-3, Tableau S4). De ceux-ci, nous avons demontre qu'Hnf4a avait la capacite d'activer directement l'expression de la claudine-15 (Manuscrit-3, Fig.6,4- C) et d'ainsi augmenter la conductance ou reduire la resistance transepitheliale (TransEpithelial Resistance; TER) d'un epithelium in vitro (Manuscrit-3, Fig.6£). Parallelement, Fepithelium des animaux Hnf4aAIEC s'est revele appauvri en Claudine-15 et consequemment moins permissif au passage ionique, tel que represente par la mesure de 1TSC (Isoelectric Short-circuit Current; Isc) (Manuscrit-3, Fig.5G). Toutefois, il est important de remarquer que le passage des non-electrolytes ou macromolecules, aussi appele permeabilite, est demeuree inchangee (Manuscrit-3, Fig.5F). L'epithelium de Fintestin grele a pour principale fonction de digerer et absorber les nutriments. Pour sa part, la principale fonction de Fepithelium colique n'est pas d'absorber les nutriments, mais plutot de recuperer Feau et les electrolytes necessaires eux aussi au bon fonctionnement de Forganisme (DAWSON, 1991). En effet, le colon humain absorbe entre 1,5 254 et 1,8 litres d'eau riche en electrolytes par jour (DEBONGNIE et PHILLIPS, 1978). La facon dont cette reabsorption procede est particulierement complexe et peut etre davantage appreciee par la lecture d'une revue detaillee (KUNZELMANN et MALL, 2002). La regulation directe de la claudine-15 a permis d'envisager un role majeur pour Hnf4a dans le controle de l'expression des canaux, pompes et transporteurs necessaires a cette fonction de 1'epithelium colique et a sa dysfonction dans les MIL Les claudines sont de petites proteines de 20 a 27 kDa, a 4 passages transmembranaires, possedant 2 boucles extracellulaires et sont en general reconnues pour controler la route paracellulaire du passage des ions et solutes. Elle participent aussi a la segregation basolaterale ou apicale d'autres proteines impliquees dans le transport transcellulaire (TSUKITA, et al., 2001). La claudine-4 et -8 sont reconnues pour augmenter la TER d'un epithelium en reduisant le passage des ions cationiques (VAN ITALLIE, et al., 2001; YU, et al., 2003). De leur cote, les claudine-2 et -15 sont reconnues pour reduire la TER d'un epithelium en augmentant le passage des ions cationiques (AMASHEH, et al., 2002; COLEGIO, et al., 2002; FURUSE, et al., 2001; VAN ITALLIE, et al., 2003). Globalement, les changements qui ont ete observes chez les animaux Hnf4aAIEC pointent vers une reduction du passage transcellulaire des ions cationiques (e.g. Na+) et expliquent ainsi la diminution de FISC (Manuscrit-3, Fig.5A-D). Comme une profonde modification des differentes composantes de ces transports a ete relevee (Manuscrit-3, Table S4), il est difficile de predire le resultat final au niveau physiologique. De ceux-ci, il a ete confirme que le gene Slc9a3, aussi appele NHE3 est reduit chez les animaux Hnf4amc (resultat non montre). NHE3 a ete implique dans le developpement d'une colite spontanee chez la souris qui est fort semblable a celle observee chez les animaux Hnf4amc (LAUBITZ, et al., 2008; SILVERBERG, 2006). Quoi qu'il en soit, un dosage de la concentration des differents electrolytes perdus dans les feces 255 permettrait de determiner si ces changements ont un impact net sur l'absorption des electrolytes. Les diarrhees frequentes sont un signe clinique majeur des Mil (BINDER, 2009). II est reconnu que les patients atteints de la colite ulcereuse ont entre autre un probleme dans la reabsorption electrogenique du sodium (SANDLE, et al., 1986; SANDLE, et al., 1990). L'absorption du Na+ et du CI" etant la force motrice de la reabsorption de l'eau, il est normal que ces maladies soient caracterisees par une perte de fluides. Un indice de la difficulte que semble avoir l'epithelium des animaux Hnf4aMEC a recuperer les fluides est 1'augmentation d'environ 6 fois de l'expression des aquaporine-3 et -4 (Aqp3, Aqp4) (Manuscrit-3, Table S4). Ces pores permettent le passage selectif de l'eau a travers les membranes et les Aqp3 et Aqp4 en particulier sont retrouvees du cote basolateral des colonocytes (BENGA, 2009; TAKATA, et al., 2004). Quelles consequences sur l'equilibre inflammatoire ont pu decouler de ce debalancement du transport ionique ? La regulation de la force osmotique est essentielle a la vie de la cellule etant donne la permeabilite des membranes a differentes proteines et ions (HOFFMANN, et al., 2009). II est connu que la force osmotique change durant les Mil (SCHILLI, et al., 1982; VERNIA, et al., 1988) et une deregulation des processus de regulation de Posmolarite peut conduire a l'apoptose de la cellule (BORTNER et CIDLOWSKI, 1996). D'ailleurs, les changements volumetriques de la cellule peuvent preceder l'apoptose dans certains processus apoptotiques (MAENO, et al., 2000; OKADA et MAENO, 2001). L'augmentation de l'apoptose mesuree chez les animaux Hnf4aAIEC durant leur maladie (Manuscrit-3, Fig.4A-B) pourrait done etre la consequence d'un changement de force osmotique sur les cellules epitheliales, 256 elles-memes responsable de ce desequilibre. Cette mortalite epitheliale pourrait ainsi entrainer Pinflammation par la penetration des microorganismes dans la muqueuse. 3.4 Metabolisme du butyrate Une reduction de plus de 50% du gene Slc22a4 dans l'intestin grele et dans le colon des animaux Hnf4aAIEC a ete confirmee avant 1'apparition de la maladie (resultat non montre). Aussi appele OCTN1, ce gene est de plus en plus associe a la maladie de Crohn et porte actuellement le titre de 5e locus associe aux Mil (IBD5) avec quelques autre genes (SILVERBERG, 2006; WALLER, et al., 2006). Ce transporteur est localise au niveau de la mitochondrie et permet 1'importation mitochondriale de la L-carnithine un petit zwitterion qui, lorsque couple aux acyl gras, permet leur transport et leur P-oxydation dans la mitochondrie (LAMHONWAH et TEIN, 2006). Si Ton considere que jusqu'a 80% de l'energie des colonocytes est tiree des petits acides gras (e.g. butyrate) produits par les bacteries et du role energetique de la P-oxydation en general, une deficience dans le transporteur de la L- carnithine peut avoir un impact considerable sur la cellule (ROEDIGER, 1982). Pour le colonocyte, le butyrate surpasserait la quantite d'ATP generee par l'acetate, le proprionate et le glucose (CLAUSEN et MORTENSEN, 1995). II a ete dispute que les patients atteints des Mil ont une deficience dans la quantite de butyrate et dans son transport (THIBAULT, et al., 2010) et dormer de la L-carnithine aux patients des Mil ameliore leur maladie (FORTIN, et al., 2009). OCTN2 (OHASHI, et al., 2002), apparente a OCTN1, apporte une colite spontanee chez la souris lorsqu'invalide (Octn2_/~) (SHEKHAWAT, etal., 2007). 257 3.5 Aspect endocrinien et Mil Le debalancement hormonal que semblent presenter les animaux Hnf4aMEC n'est pas sans avoir son lot de consequences sur I'aspect immunitaire de l'intestin. Par exemple, la diminution de 55% et 85% dans le jejunum et le colon respectivement de la neurotensine (Nts) pourrait avoir d'importantes repercussions. La neurotensine est reconnue pour son role anti-inflammatoire, antioxydant et antiapoptotique durant 1'inflammation causee par le TNBS (AKCAN, et al., 2008). La neurotensine est egalement connue pour influencer positivement la motilite intestinale (THOR et ROSELL, 1986) et de reduire la croissance des cellules tumorales LoVo (IWASE, et al., 1996). Ceci pourrait done etre implique dans les diarrhees et chez les patients atteints du syndrome du colon irritable chez Phumain. 3.6 Regulation de l'expression d'HNF4a Une question importante issue de ce projet est de s'interesser a la facon dont HNF4a est reduit en expression durant les episodes d'inflammation chronique cause par le DSS et durant les Mil (Manuscrit-3, Fig.7A-B et Ahn et al.) (AHN, et al., 2008). Quelques donnees issues d'etudes effectuees sur des modeles hepatiques in vivo et in vitro apportent des reponses. D'abord, il a ete rapporte que Pinjection de LPS a 1 mg/kg i.p. pour une heure chez le rat a pour effet de diminuer de 53% la capacite de liaison a PADN d'HNF4a, alors que les niveaux nucleaires sont reduits de 87% (CHENG, et al., 2003). En plus de confirmer ce resultat chez le rat (LPS a 5 mg/kg i.p.), d'autres ont avance que Pinterleukine-ip secretee en reponse au LPS serait responsable d'induire la degradation d'HNF4a par le proteasome. Ceci a ete demontre dans les cellules HepG2 en traitant avec PIL-lp (10 ng/ml) et en renversant la perte d'HNF4a en traitant au MG132. De plus, la these de la regulation au niveau proteique a ete confirmee en demontrant une expression stable de PARNm (WANG, et al., 2001). Cette 258 degradation ou perte de liaison a l'ADN en reponse a l'IL-ip pourrait etre en fait mediee par la phosphorylation via JNK1; mais pas par ERK ou p38 MAPK (JAHAN et CHIANG, 2005). Un melange de cytokines (TNFa, IL-lp et IL-6) pourrait travailler de facon similaire via JAK2 et encore une fois reduire sa capacite de transactivation via la phosphorylation (LI, et al., 2002; WANG et BURKE, 2007). Pour terminer, le TNFa, via p65-RelA, pourrait faire competition a HNF4a sur certains de ses genes cibles durant I'inflammation en deplacant les coactivateurs CBP, SRC3 et PGC-la (NIKOLAIDOU-NEOKOSMIDOU, et al., 2006). Globalement, ces etudes montrent une reduction proteique d'HNF4a en reponse a diverses cytokines pro-inflammatoires (IL-lp\ IL-6, TNFa) et permettent de speculer sur la reduction rapide d'HNF4a rapportee par Ahn et al. au tout debut d'un traitement DSS (AHN, et al., 2008). Une autre observation interessante pourrait expliquer l'ulceration rapide chez les animaux mutants Hnf4a lors d'un traitement au DSS observee par Ahn et al. II est reconnu qu'un traitement comme celui-ci est cytotoxique pour les cellules epitheliales qui entrent alors en apoptose et forme les breches dans la muqueuse qui vont ensuite demarrer la cascade inflammatoire des jours suivants (NI, et al., 1996; VETUSCHI, et al., 2002). Les HepG2, ou HNF4a est reduit via l'utilisation d'un ARN interferent, entrent en apoptose plus rapidement que les controles exprimant HNF4a lorsqu'elles sont traitees avec du TNFa (ZHOU, et al., 2007). Ainsi, 1'epithelium negatif pour Hnf4a serait done plus susceptible aux signaux d'apoptose et pourrait done accelerer l'ulceration. De plus, le TNFa est lui-meme induit lors du DSS et durant les maladies inflammatoires intestinales chez l'humain (PAPADAKIS et TARGAN, 2000). Nous avons nous-memes montre que la muqueuse colique malade des animaux Hnf4oAIEC presente une augmentation de l'apoptose (Manuscrit-3, Fig.4A-B) et ceci a ete repete au niveau de l'intestin grele adulte chez le meme modele (Manuscrit-4, Fig.4). 259 Quant aux Mil, un mecanisme similaire pourrait etre responsable de la reduction d'HNF4a. Cependant, il semble que I'ARNm d'HNF4a soit reduit au meme titre que la proteine (Manuscrit-3, Fig.SA-B et Ann et al.) (AHN, et al., 2008). Dans ce cas, la reduction de differents regulateurs transcriptionnels du gene HNF4A pourrait expliquer sa regulation. Par exemple, il a ete montre que le facteur HNFla est lui aussi reduit dans le foie des rats traites aux LPS (CHENG, et al., 2003). HNFla est un regulateur connu du promoteur PI et P2 d'HNF4a (ZHONG, et al., 1994). P53 peut aussi reprimer HNF4a directement et est susceptible d'etre implique dans sa regulation durant 1'inflammation (voir discussion du 4e manuscrit) (MAEDA, et al., 2006). II a egalement ete montre que SNAIL est un represseur du gene HNF4A (CICCHINI, et al., 2006; CICCHINI, et al., 2008). Similairement, le TGF0 peut apporter une reduction d'HNF4a via le proteasome (LUCAS SD, et al., 2004). II a egalement ete remarque que l'activite de liaison d'HNF4a est reduite en reponse a un modele de blessure (BURKE, et al., 1994). Etant donne 1'importance de ces mecanismes dans la restitution epitheliale, il est possible d'imaginer que ceux-ci profitent d'une diminution d'HNF4a afin de permettre la reduction des jonctions cellulaires necessaire a la migration des cellules (ISHIKAWA, et al., 2008). L'etude a grande echelle des polymorphismes (Single Nucleotide Polymorphism; SNP) dans les Mil a recemment revele des SNPs dans le gene d,HNF4A et il est possible que differentes mutations soient responsables d'une susceptibilite a une reduction de son expression au cours de la maladie (BARRETT, et al., 2009). Preciser les mecanismes de regulation d,HNF4A dans ces maladies sera crucial a l'etablissement d'interventions therapeutiques pour renverser cette reduction et d'ainsi reintroduce les fonctions normales de ce facteur. Dans cette optique, l'utilisation de lipides activateurs tel que le methoxy-2- nitronaphtho[2,l-b]furan pourrait amplifier son activite residuelle (LE GUEVEL, et al., 2009). 260 3.7 Cancer associe a la colite Parmi les classes les plus fortement representees dans l'analyse informatique des genes modules sur la micropuce a ADN du colon malade des animaux Hnf4aAIEC sont retrouves la proliferation cellulaire, la mort cellulaire et le cancer (Manuscrit-3, Tableau supplementaire SI). Cet aspect de la colite spontanee observee chez les mutants a ete caracterisee par une augmentation de l'indice de proliferation dans les cryptes hyperplasiques (Manuscrit-3, Fig.4£), une augmentation globale de I'apoptose dans la muqueuse (Fig.4A-B) et par une formation de lesions neoplasiques coliques chez certains animaux de la cohorte (Fig. IF). Ces neoplasmes sont plutot appeles « DALM » pour Dysplasia Associated Lesion or Mass chez les patients (BLACKSTONE, et al., 1981). L'apparition du cancer colorectal chez les patients atteints de Mil se produit chez 2% des patients apres 10 ans, 8% des patients apres 20 ans et 18% des patients apres 30 ans (EADEN, et al., 2001). Le risque par rapport au reste de la population est ainsi 19 fois plus eleve (GYDE, et al., 1988). Sachant l'important role d'Hnf4a dans la regulation des genes associes a la differentiation cellulaire des hepatocytes (BATTLE, et al., 2006), des cellules (3 du pancreas (GUPTA, et al., 2005) et des colonocytes (GARRISON, et al., 2006), la facilitation de la tumorigenese dans le colon de ces animaux n'etait pas une surprise. II est connu egalement qu'Hnf4a est diminue dans les tumeurs hepatiques chez la souris (KALKUHL, et al., 1996; LAZAREVICH, et al., 2004) et dans les cancers des cellules renales chez 1'humain (SEL, et al., 1996). C'est aussi cette observation qui nous aura pousse a determiner le role d'Hnf4a dans la tumorigenese intestinale le 4e manuscrit de cette these. 261 4. HNF4a dans le cancer colorectal 4.1 Retour sur Phypothese Notre hypothese de depart stipulait qu'HNF4a devait etre perdu durant la carcinogenese d'un organe afin de laisser place a la proliferation et la dedifferenciation cellulaire (LAZAREVICH et FLEISHMAN, 2008). Cette hypothese se basait sur Fimportant role que joue ce facteur dans la differentiation des hepatocytes (BATTLE, et al., 2006; PAR VIZ, et al., 2002), sur la reduction de I'expression d'HNF4a dans les cancers hepatocellulaires ou renaux et sur la capacite de suppression de la proliferation des cellules issues de ces cancers lors d'une reintroduction d'HNF4a (LAZAREVICH, et al., 2004; LUCAS, et al., 2005). D'importants resultats preliminaries presentes plus haut supportaient aussi cette hypothese, tel que l'apparition de DALM dans la muqueuse colique. D'un autre cote, le role important d'FTNF4a dans la glycolyse et dans le metabolisme des lipides suggerait aussi qu'il puisse aider a differents aspects de la proliferation d'une cellule cancereuse. Le meilleure moyen de tester experimentalement le role d'Hnf4a dans l'initiation de la tumorigenese intestinale etait done d'utiliser le modele genetique ApcM,n/+ ou la proteine Ape mutee, tronquee a partir du codon 850 (Ape*850), mene a la formation d'une centaine de polypes au cours de la vie de l'animal lorsqu'il y a perte d'heterozygocite du deuxieme allele (MOSER, et al., 1990; MOSER, et al., 1992). 4.2 Interpretation des resultats L'activation constitutive de la voie Wnt est l'un des premiers evenements, sinon la plupart du temps le premier evenement de la carcinogenese colorectale (LAMLUM, et al., 2000). Cette notion est supportee par 1'invalidation conditionnelle d'Apc chez un modele murin 262 (Villin.Cre; Apc^) ou cette deletion seule induit la formation de polypes a l'interieur de 4 semaines (SHIBATA, et al., 1997). Les resultats obtenus chez les animaux ApcMln/+; Hnf4aAIEC ont clairement demontre le role positif que jouerait Hnf4a dans l'initiation du cancer colorectal. En effet, contrairement a notre hypothese de depart, 1'invalidation epitheliale d'Hnf4a a permis de reduire de plus de 70% la formation de polypes dans l'intestin grele et d'environ 90% dans le colon de ces animaux par rapport aux animaux controles ApcM,n/+ (Manuscrit-4, Fig. \A). Fait interessant, la taille des polypes n'est pas alteree chez les souris ApcM,n/+; Hnf4amc (Manuscrit-4, Fig. 15). De plus, une observation des ACFs apres 2 mois a permis d'ecarter la possibilite que les polypes manquants chez les mutants Hnf4a soient en realite des polypes dont la taille echappe au decompte macroscopique effectue a 4 mois. En effet, une tendance similaire a ete relevee lors de ce decompte (Manuscrit-4, Fig.lC-D). Si la perte d'Hnf4a est protectrice dans l'initiation de la tumorigenese chez la souris, qu'allions nous retrouver au niveau des patients atteints du cancer colorectal ? II etait deja connu dans la litterature que I'expression des differents promoteurs PI et P2 d'HNF4a est alteree chez ces patients. En effet, il a ete demontre que I'expression des isoformes al-a6 est reduite par rapport a I'expression des isoformes a.l-a.9. Cependant, I'expression globale des isoformes n'avait pas ete mesuree (OSHIMA, et al., 2007; TANAKA, et al., 2006). A cette question, nous fumes surpris de constater que contrairement a notre conception de depart, HNF4a etait significativement augmente lors de la quantification de PARNm, lors de l'immunobuvardage de la proteine et lors de 1' immunofluorescence conduite chez les echantillons de patients (Manuscrit-4, Fig.6A-E). Pour le moment, aucune association entre le statut TNM (Tumor, Nodes, Metastasis) (COMPTON et GREENE, 2004) et cette induction n'a pu etre relevee. Une analyse a plus grande echelle sera necessaire afin de determiner a quel stade cette 263 augmentation peut etre observee. Fait interessant, une recherche plus approfondie a permis de realiser que d'autres investigateurs ont egalement releve une augmentation de I'expression d'HNF4a, notamment dans le cancer hepatique chez l'humain (XU, et al., 2001). De plus, d'autres cancers, ou I'expression dans le tissu normal est relativement basse ou absente, gagnent I'expression d'HNF4a, tels que les cancers mucineux de I'ovaire (SUGAI, et al., 2008) et les cancers gastriques (KOJIMA, et al., 2006; TAKAHASHI, et al., 2009). 4.3 Le stress oxydatif La table etait done mise pour attaquer une question beaucoup plus complexe : Quel role joue HNF4a dans l'initiation et la progression du cancer colorectal ? Pour y repondre, une micropuce a ADN a ete realisee sur l'intestin grele d'animaux Hnf4aAIEC adultes afin d'identifier les genes qui pourraient etre sous le controle de ce facteur transcriptionnel. L'analyse des genes modules d'au moins 50% et atteignant un niveau de confiance d'au moins 95% (p < 0,05) par un logiciel de classification de genes (DAVID) (DENNIS, et al., 2003; HUANG DA, et al., 2009) a permis d'identifier l'oxydoreduction et le metabolisme des lipides comme des fonctions fortement alterees chez ces animaux (Manuscrit-4, Tableau Supplemental 2). L'analyse des lipides membranaires de Perithelium des animaux Hnf4a61EC a montre des changements dans la proportion de differents lipides (non montre). Cette meme analyse a egalement permis de mesurer une augmentation d'environ 50% du malonaldehyde (MDA), un petit derive organique produit par les especes reactives de l'oxygene (Reactive Oxygen Species; ROS) lorsqu'elles attaquent les lipides polyinsatures (PRYOR et STANLEY, 1975) (Manuscrit-4). II est admis que le MDA est un marqueur de stress oxydatif (DEL RIO, et al., 2005) et correlait ainsi avec la modulation importante des genes impliques dans le controle des especes reactives de l'oxygene. La suite des experimentations 264 utilisant des modeles cellulaires a permis de confirmer le role protecteur d'HNF4a dans le stress oxydatif (Manuscrit-4, Fig.5). II a ete avance que cette augmentation du stress oxydatif ait pu contribuer a 1'elimination par apoptose des cellules gagnant la seconde mutation d'Apc. II est important de noter que les ROS en general sont considerees, a cerrtaines doses, comme des suppresseurs de tumeur (PANI, et al., 2010). Pour appuyer l'idee que les mutants Hnf4aAIEC sont plus susceptibles au stress oxydatif, une comparaison des donnees de la micropuce avec deux modeles murins (DQ 12hr et SW/"A), ou le stress oxydatif dans I'epithelium intestinal est reconnu pour etre augmente, a permis de relever differents genes etant modules selon les memes tendances (Figure 4 en Annexe). L'un de ces modeles emploie le diquat (DQ) affectant la chaine de phosphorylation oxydative (DODGE et HARRIS, 1970) et induit un stress oxydatif lorsqu'administre oralement chez le rat (25 mg/kg) (ANTON, et al., 1998). II serait interessant de verifier comment se comportent les animaux Hnf4aAIECpar rapport aux controles lors d'un traitement comme celui-ci donne par gavage. II serait alors possible de comparer les niveaux de lipides peroxydes, 1'expression des differentes cibles antioxydatives precedemment detaillees (Cyp2d26, Gstkl, Nqol, Cat, etc), et verifier le niveau d'apoptose par essai TUNEL sur les tissus intestinaux recoltes. Ceci permettrait de prouver que physiologiquement les changements dans l'equilibre oxydatif chez ces animaux a un impact direct lors d'une situation de stress oxydatif. Fait important, le role d'HNF4a dans ce controle pourrait egalement etre important dans la progression des Mil etant donne 1'importance de ce stress chez ces pathologies. En effet, il est reconnu que le stress oxydatif, principalement dans la colite ulcereuse, joue un role predominant dans l'augmentation de rinflammation et dans l'apparition des CAC (PAVLICK, et al., 2002; PRAVDA, 2005; ROESSNER, et al., 2008). 265 4.4 HNF4a et TP53 dans le cancer colorectal La reputation de p53 (TP53) comme suppresseur de tumeur n'est plus a faire et son inactivation a ete identifiee comme une etape importante de la carcinogenese intestinale (BAKER, et al., 1989). Cette proteine fait I'objet d'intenses recherches et la variete des roles et modes d'action de celle-ci ne cesse de se complexifier (VOUSDEN et PRIVES, 2009). Par contre, la position qu'occupe p53 dans le controle du stress oxydatif est a ce jour bien detaillee. Selon le modele actuel, p53 aurait deux modes d'action vis-a-vis ce controle (BENSAAD et VOUSDEN, 2005). En situation normale, p53 est exprime constitutivement, mais faiblement, puis aurait pour effet d'activer certains genes dont le role est de diminuer la quantite de ROS intracellulaire (SABLINA, et al., 2005). Par contre, lorsqu'il y a activation de p53 apres un stress genotoxique severe, p53 serait alors plutot responsable de 1'expression des genes impliques dans la generation d'especes pro-oxidantes et pro-apoptotiques conduisant a la mort cellulaire (POLYAK, et al., 1997). II a ete demontre que p53 est capable d'interagir avec HNF4a via PAF-2 du LBD afin d'agir comme corepresseur (MAEDA, et al., 2002). II a egalement ete montre que p53 peut directement reprimer le gene HNF4a en recrutant les HDACs et en deplacant HNF6 du promoteur PI (MAEDA, et al., 2006). En appui a ces etudes, l'expression plus elevee d'HNF4a dans le cancer colorectal semble etre associee a la mutation de p53 (Manuscrit-4, Fig.6D-E). Des resultats preliminaries impliquant la surexpression de p53 de type sauvage dans les lignees cancereuses colorectales en culture ont suggere qu'il etait possible de reduire l'expression d'HNF4a via p53 dans les lignees epitheliales intestinales. 266 Quelle serait la raison de cette relation entre p53 et HNF4ot ? Tel que mentionne plus haut, la cellule normale exprime faiblement p53 tout en etant dependante de ce dernier pour maintenir un niveau acceptable de ROS. II est possible d'imaginer que dans la cellule epitheliale differenciee, exprimant fortement HNF4a, p53 joue un role negligeable sur l'expression du gene HNF4A. Par contre, ces derniers pourraient tres bien cooperer sur certaines cibles dont le role est de proteger la cellule contre les ROS. La sestrin-1 (Sesnl), par exemple, est une proteine impliquee dans cette protection qui est sous le controle de p53 (BUDANOV, et al., 2004; BUDANOV et KARIN, 2008). La Sesnl est reduite de 30% et 65% chez les animaux Hnf4aMEC dans l'intestin grele et dans le colon respectivement. Sachant l'interaction physique possible entre HNF4a et p53, HNF4a pourrait etre associe a une transactivation cooperative avec p53. De plus, il n'est pas impossible qu'HNF4a augmente l'activite transcriptionnelle de p53 sans etre lui-meme associe a l'ADN. II a deja ete demontre qu'HNF4a peut agir de cette facon en interagissant avec HNFla (EECKHOUTE, et al., 2004). Selon ce modele, on pourrait s'attendre a ce que d'autres cibles, ou HNF4a agirait comme cofacteur de p53, soient diminuees dans les animaux Hnf4a negatifs. Le role represseur de p53 sur le gene HNF4A aurait cependant beaucoup plus d'importance lors de son activation en reponse a un dommage irreparable a l'ADN. Dans ce cas, p53 cherche a augmenter le niveau de ROS pour induire l'apoptose de la cellule. C'est a ce moment qu'il serait profitable pour p53 de reprimer FINF4a etant donne le role de ce dernier dans la reduction des ROS. Parallelement, p53 pourrait devenir un co-represseur d'FTNF4a sur les cibles antioxydantes qu'il controle normalement. II serait interessant de choisir quelques genes pro et antioxydants dont la regulation par p53 ou par HNF4a est bien connue et de verifier ces concepts par l'utilisation de la technique de gene rapporteur luciferase. 267 La situation se complique lorsque Ton considere l'aspect du cancer. D'abord, il faut savoir qu'entre 30 et 55% des cancers ont des mutations dans TP53. Aussi, plus de 80% des mutations dans p53 sont des mutations faux-sens causant I'accumulation de p53 dans la cellule (SOUSSI et BEROUD, 2001); une mutation qui est combinee a une perte d'heterozygocite via la deletion du 17q (BAKER, et al., 1989). La majorite de ces mutations sont situees dans le domaine de liaison a 1'ADN et agissent en dominant negatif (DN) pour l'heterodimere forme avec la proteine sauvage issue de l'allele non-mutee ou encore avec les isoformes p63 et p73 (LANG, et al., 2004). Les gains de fonction apportes par les mutations frequentes R175H et R273H presentes chez I'humain ont ete mises en evidence dans les modeles murins (OLIVE, et al., 2004). Dans ces modeles, la tumorigenese chez les animaux heterozygotes mutants p53 exprimant un variant DN (Tg-p53R172H °" R270H; p53+/') replique le phenotype de l'homozygote mutant (p53'/") et lorsque les homozygotes mutants expriment l'un des deux DN il y a apparition de carcinomes non retrouves chez les controles p53'A. Ces versions DN de p53 pourraient avoir d'importants impacts sur l'expression d'HNF4cc dans le cancer. D'un cote, HNF4a perdrait sa regulation via p53, mais d'un autre pourrait agir differemment au niveau de ses genes cibles si les versions mutees de p53, hautement accumulees dans la cellule cancereuse, retiennent la capacite de Her HNF4a. Une experience de co- immunoprecipitation permettrait de repondre a cette question en regardant la capacite de liaison de p53 sauvage comparativement aux differents DN p53 (R175H et R273H) chez des cellules exprimant FINF4a (e.g. Caco2). Cette meme experience pourrait possiblement etre effectuee sur des biopsies de patients atteints du cancer. II est toutefois evident que le jeu d'expression d'FTNF4a dans le cancer n'est pas uniquement dependant de p53. 268 4.5 Deregulation des promoteurs PI et P2 II a ete suggere que le promoteur P2 d,HNF4A est reprime par les isoformes issues du promoteur PI dans le foie (BRIANCON, et al., 2004). Le gain d'expression a partir du promoteur P2 dans le cancer colorectal pourrait etre cause justement par la perte d'expression des isoformes PI et ainsi d'une levee de cette repression. II serait interessant d'evaluer l'expression des autres facteurs impliques dans la regulation du promoteur P2 tels que HNFla, HNFlp, HNF6 et IPF-1 (THOMAS, et al., 2001). Fait important, HNF6 et HNFla sont connus pour etre eux-memes regules positivement par HNF4a et toute modification de ce dernier et susceptible d'influencer leur expression (BULLA, 1997; LAHUNA, et al., 2000). Ceci est particulierement interessant puisqu'une petite analyse preliminaire indique qu'HNFla pourrait etre augmente dans le cancer colorectal. La perte de l'expression du promoteur PI pourrait elle etre causee par une reduction de regulateurs positifs de ce promoteur (voir Tableau 1). Une hypothese interessante a tester serait que 1'activation constitutive du Wnt ait un effet negatif sur l'expression du promoteur PI. Les lignees HCT116, SW480 et DLD-1 ont des mutations dans l'une des composantes de la voie Wnt rendant cette voie constitutivement active chez ces cellules (MORIN, et al., 1997). Ces lignees sont celles qui expriment le plus faiblement HNF4a parmi les lignees testees (Caco2/15, T84, HT29, LoVo, DLD-1, SW480 et HCT116; resultat non montre) et l'expression residuelle est entierement issue du promoteur P2 (OSHIMA, et al., 2007). Autre point interessant, les HCT116 expriment le p53 sauvage (HWANG, et al., 2001) et la lignee SW480 retient certaines fonctions malgre que les trois copies de p53 detenues par cette lignee possedent des mutations (ROCHETTE, et al., 2005). De plus, l'etude de l'expression d'Hnf4a dans les polypes des animaux ApcMin/+ indique qu'il y a reduction importante d'Hnf4a en ARNm et en immunofluorescence en comparaison avec la marge de la polype (Manuscrit 4, Fig.l). II serait interessant d'utiliser 269 des amorces specifiques aux differentes isoformes et d'analyser le changement de I'expression via les deux promoteurs dans le contexte de cette activation constitutive de la voie Wnt. Finalement, des experiences cellulaires dans les Caco2/15 exprimant autant le promoteur PI que P2 (OSHIMA, et al., 2007) pourraient etre conduites afin de preciser ce concept. Pour ce faire, il s'agirait de traiter les cellules avec un agoniste de la voie WNT, tel que le (2-amino-4-(3,4-(methylenedioxy) benzyl-amino]-6-(3-methoxyphenyl)pyrimidine) (Calbiochem) et de verifier l'impact sur I'expression d,HNF4a. A l'inverse, l'utilisation d'un inhibiteur du complexe (3-catenine/TCF, tel que le PKF115-584 (SUKHDEO, et al., 2007), permettrait de traiter differentes cellules dont I'expression PI a ete perdue et de verifier si le blocage de la voie Wnt reintroduit l'activite de ce promoteur. 4.6 Hnf4a et p53 chez les animaux Hnf4a/UEC Est-ce que ce mecanisme de regulation qu'il semble y avoir entre HNF4a et p53 peut etre implique dans les observations chez les souris ApcM,n/+ ? L'une des activites de regulation transcriptionnelle prototypique commune a FINF4a et p53 est 1'activation de p21 (CDKN1A) (CHIBA, et al., 2005; EL-DEIRY, et al., 1993). Sachant le role important de p21 dans l'arret du cycle cellulaire (XIONG, et al., 1993) et l'augmentation de la proliferation chez les animaux Hnf4aAIEC (Manuscrit-2, Fig.4F-G), il aurait ete attendu que Cdknla soit reduit dans la muqueuse des animaux Hnf4aAIEC. Or, Cdknla est augmente de pres de 2 fois dans l'intestin grele de ces animaux. Cette observation a permis de s'interroger sur l'activite de p53 dans la muqueuse des animaux mutants. Bien que I'expression de p53 (ARNm et proteine) ait ete montree stable dans la muqueuse des animaux mutants (resultat non montre), la question demeure a savoir si l'activite de p53 est augmentee en absence d'FTNF4a. En effet, il est bien connu que l'activite p53 est fortement regulee par phosphorylation, 270 acetylation, ubiquitinylation, sumoylation, neddylation et methylation (HOLLSTEIN et HAINAUT); des modifications ayant pour consequence une diversification des roles pouvant etre joues par p53 (VOUSDEN et PRIVES, 2009). En somme, il serait necessaire de determiner le niveau de p53 actif chez ces animaux en ciblant differentes modifications cles telles que la phosphorylation sur la Ser46 par la HIPK2, conduisant a I'apoptose (HOFMANN, et al., 2002), et l'acetylation en position K320 par PCAF, induisant l'activation de p21 et l'arret du cycle cellulaire (KNIGHTS, et al., 2006). D'autres cibles de p53 connues pour freiner la progression du cycle cellulaire sont egalement augmentees chez les animaux Hnf4aMEC. En effet, 14-3-3a (SFN), augmente de 63% et 80% dans le jejunum et le colon respectivement, est active par p53 en reponse a un stress genotoxique et bloque la progression G2/M en sequestrant la cycline B au cytoplasme (HERMEKING, et al., 1997). A son tour 14-3-3o" est implique dans 1'augmentation de l'activite de p53 en bloquant Paction du regulateur negatif MDM2 (YANG, et al., 2003). Comment expliquer une augmentation possible de l'activite p53 dans la cellule epitheliale intestinale en absence d'HNF4a ? Plusieurs possibilites demeurent, mais la reduction de l'expression de l'ubiquitine ligase Usp2 est une piste prometteuse. En effet, cette cible, reduite de 51% et 33%) dans le jejunum et le colon des animaux Hnf4aAIEC respectivement, est impliquee dans la de-ubiquitinylation specifique de Mdm2 et consequemment dans sa stabilisation (STEVENSON, et al., 2007). Ainsi, une reduction de son expression a pour consequence de destabiliser Mdm2 dont le role est de supporter la degradation de p53 via son activite E3 -ligase permettant de diriger p53 au proteasome (HAUPT, et al., 1997; HONDA, et al., 1997). De plus, lorsqu'Hnf4a est surexprime dans les 271 HCT116 a l'aide d'une infection retrovirale, USP2 a ete confirme comme augmente de 30% (resultat non montre). L'augmentation de I'expression de p21 mentionnee plus haut est elle-meme interessante. L'induction de p21 peut etre p53-dependante, mais aussi p53-independante, tel que durant le developpement ou l'induction de la differenciation (MACLEOD, et al., 1995). Par exemple, HNF4a est necessaire a son expression pour la differenciation des hepatocytes (CHIBA, et al., 2005). Lorsqu'induit par p53, p21 est implique dans I'arret du cycle cellulaire et dans Finhibition de l'apoptose promue par p53; laissant ainsi la place a la reparation de l'ADN (GATZ et WIESMULLER, 2006; WALDMAN, et al., 1995). Par contre, lorsque les dommages sont trop importants, p21 serait egalement implique dans I'arret irreversible du cycle cellulaire appelee senescence (BROWN, et al., 1997). La senescence est un processus de mort cellulaire qui ne passe pas par l'apoptose et peut done eliminer les cellules cancereuses, ou dans notre cas des cellules portant la double mutation Min, sans 1'activation des caspases ou de la fragmentation de l'ADN. Elle est par contre associee a des changements d'expression tels que, I'expression de la P-galactosidase associee a la senescence (SA-^-gal), des cytokines, facteurs de croissance et metalloproteinases (CAMPISI, 2001). En quoi ces changements pourraient-ils etre responsables de la protection de Perithelium negatif pour Hnf4a contre l'initiation de la tumorigenese ? Les resultats obtenus ecartent la possibility qu'Hnf4a puisse jouer sur la croissance de l'adenome et place plutot l'aspect avantageux de 1'invalidation du gene Hnf4a au niveau d'une protection de la perte du deuxieme allele d'Apc (Loss Of Heterozygosity; LOH) ou encore dans l'apoptose immediate des cellules ayant acquis cette mutation. Avec les indices d'activite de p53 et de 272 p21 chez les animaux Hnf4aAIEC, il est possible d'imaginer que les cellules gagnant une double invalidation d'Apc aient plus de chance d'entrer en apoptose au moment de la reconnaissance de cette modification genomique. En support de cette hypothese, I'apoptose a l'interieur de l'epithelium negatif pour Hnf4a est augmentee de 43% (Manuscrit-4, Fig.4^4- B). Des auteurs ont egalement rapporte que la reintroduction de HNFla ou FINF4a dans des cellules hepatiques negatives pour ces facteurs les protege de I'apoptose induite par le LPS (BULLA, etal., 2001). Une alternative a l'hypothese de I'apoptose induite concerne la possibilite que le retrait d'Hnf4a ait un effet positif sur la protection du genome. II est connu que la perte du second allele d'Apc se produit par recombinaison somatique homologue et non par mutation somatique du deuxieme allele (HAIGIS et DOVE, 2003). II est fort interessant de speculer sur le role que pourrait ainsi jouer HNF4a sur l'instabilite chromosomique acquise au cours de la carcinogenese colorectale puisqu'il s'agit d'un mecanisme bien reconnu de progression des premieres lesions neoplasiques (JALLEPALLI et LENGAUER, 2001; SHIH, et al., 2001). Le point de controle G2/M ainsi que le bon deroulement de la phase de mitose sont egalement d'importants aspects de la stabilite genomique. L'une des pistes interessantes a ce sujet est l'augmentation de 53% et 98%, dans le jejunum et le colon respectivement, de Plk3 chez les animaux Hnf4aAIEC. Les Polo-kinases sont des kinases impliquees dans la formation des fuseaux mitotiques, dans la segregation des chromosomes, dans la maturation des centrosomes durant la prophase, dans la regulation de 1'anaphase et dans la cytokinese (TAKAI, et al., 2005). PLK3 se localise aux centrosomes et aux fuseaux mitotiques durant la phase G2/M et une surexpression induit 1'arret mitotique, un defaut de cytokinese et 1'entree en apoptose due a une disorganisation des microtubules (JIANG, et al., 2006; WANG, et al., 2002). 273 PLK3, contrairement aux autres kinases de la famille, est stablement exprimee au cours du cycle cellulaire (DAI, 2004). Par contre, son activite kinase est regulee par phosphorylation et est maximale de la phase G2 tardive a la phase M, pour ensuite etre dephosphorylee a sa sortie (CHASE, et al., 1998; OUYANG, et al., 1997). De plus, l'activite de PLK3 semble augmentee en reponse a l'hypoxie (WANG, et al., 2008), en reponse a stress genotoxique induit par l'UV, ainsi que durant le stress oxydatif (XIE, et al., 2001). Son role durant ce stress serait de phosphoryler la Ser20 de p53 necessaire a son activation durant le stress oxydatif (XIE, et al., 2001). A cet egard, PLKl joue un role completement oppose en interagissant et inhibant p53 (ANDO, et al., 2004). Alors que PLKl est surexprimee dans le cancer colorectal (TAKAHASHI, et al., 2003), PLK3 quant a elle est perdue dans les tumeurs colorectales chez le rat (DAI, et al., 2002). 4.7 Regulation du metabolisme durant le cancer Les cellules cancereuses ont besoin de generer beaucoup d'ATP pour soutenir leur croissance rapide. L'ATP peut etre tiree de plusieurs sources, proteines, lipides, sucres, dont les divers metabolites peuvent joindre la glycolyse ou le cycle du citrate a partir de differentes etapes. Cependant, la cellule cancereuse est en quete constante de macromolecules telles que les lipides, proteines et acides nucleiques afin de generer les cellules filles. Les sources energetiques et les voies metaboliques utilisees chez les cellules quiescentes ou differenciees sont done tres differentes des cellules proliferatives ou cancereuses (DEBERARDINIS, et al., 2008). Chez ces dernieres, le glucose devient une source energetique majeure et l'utilisation du glucose se fait, elle aussi, de facon particuliere (BOS, et al., 2002). Pour les cellules normales, la formation de pyruvate par la glycolyse est profitable puisqu'exploitee par le cycle du citrate (synonymes : cycle de Krebs, cycle des acides 274 tricarboxyliques, voie anaplerotique) permettant, grace a la phosphorylation oxydative, de produire une quantite importante d'ATP. Pourtant, il a ete remarque des les annees 1920 par Warburg que les cellules cancereuses consomment d'importantes quantites de glucose tout en choisissant d'excreter le lactate plutot que de tirer profit de l'oxydation du pyruvate, une obesrvation qui est maintenant appele l'effet Warburg (GATENBY et GILLIES, 2004). II a depuis ete demontre que ce choix n'appartient pas a une deficience dans la phosphorylation oxydative mitochondriale (MORENO-SANCHEZ, et al., 2007) ou encore dans une deficience en oxygene (QUENNET, et al., 2006), mais plutot l'avantage d'une generation plus rapide de 1'ATP via la glycolyse que par le cycle de Krebs (PFEIFFER, et al., 2001). De plus, les intermediaries de la glycolyse sont mis a profit dans l'anabolisme des differents «materiaux de construction ». Par exemple, le 3-phosphoglycerate peut etre utilise pour la formation des nucleotides, le pyruvate permet la synthese des acides amines non-essentiels et le citrate permet la formation des lipides. Tel qu'illustre par les roles joues par HNF4a au niveau hepatique (voir introduction), ce facteur semble etre fortement implique dans le metabolisme cellulaire au niveau du foie. Etant donne les importants changements qui occurrent chez la cellule cancereuse, il est imperatif de s'interesser aux differents points de controle que pourrait exercer HNF4a dans les enzymes cles de ces voies cataboliques et anaboliques. L'hexokinase II est une enzyme cle de la glycolyse puisqu'elle permet la production de glucose-6-phosphate a partir du glucose sanguin. Son expression et son activite est connue pour etre augmentee dans les cancers, dont le cancer colorectal (BURT, et al., 2001; YASUDA, et al., 2004). Etant donne le role d'HNF4a dans le controle de l'hexokinase IV hepatique (glucokinase), il aurait ete interessant de voir une diminution de l'expression des glucokinases tissulaires Hkl et Hk2 275 chez les animaux Hnf4aAIEC. Etonnamment, Hkl et Hk2 sont augmente de 50% et 100% chez ces animaux tant au niveau de l'intestin grele que du colon. Parallelement, Slc2al (GLUT-1), aussi tres important dans les cancers colorectaux pour l'entree du glucose (BURT, et al., 2001), est augmente de 100% dans l'intestin grele de ces mutants. Ces effets sont-ils directement lies a HNF4a ? Un facteur important dans 1'expression de ces derniers genes est le facteur HIFla (POON, et al., 2009; SEMENZA, 1998; YASUDA, et al., 2004). Hifla est effectivement augmente de 85% dans l'intestin grele et le colon des animaux Hnf4aAIEC et pourrait done logiquement etre responsable de ces augmentations. L'expression d'HIFIA est controlee negativement par p53 (BLAGOSKLONNY, et al., 1998) ainsi que par une interaction directe entre p53 et HIFla qui l'empeche de recruter p300 (SCHMID, et al., 2004). L'expression seule d'HIFla ne permet pas de determiner si le tissu Hnf4amc est victime d'hypoxie, mais determiner cet aspect pourrait etre interessant. D'ailleurs, l'hypoxie peut etre responsable de l'apoptose via une voie p53-dependante (CARMELIET, et al., 1998). Fait a noter, il a ete montre que HIFla et HIFlp (ARNT) sont capable d'interaction avec HNF4a sur le promoteur de rerythropoietine (ZHANG, et al., 1999). Plusieurs enzymes du cycle du citrate sont reduites de 20 a 40% dans l'intestin grele des mutants. Ces reductions pourraient etre associees a une diminution de la fonction mitochondriale chez ces animaux. En effet, HNF4a est bien connu pour travailler avec le cofacteur PGCloc (Ppargcla) sur un ensemble de genes impliques dans le metabolisme du glucose et des acides gras (RHEE, et al., 2003; RHEE, et al., 2006). De plus, PCGla est un facteur implique directement dans la biogenese des mitochondries et de ses differentes composantes (WU, et al., 1999). Ppargcla est reduit de 40% dans l'intestin grele et le colon des animaux Hnf4aAIEC. De plus, comme la mitochondrie est la source la plus importante de ROS dans une 276 cellule, une mauvaise expression de differentes composantes de la chaine de phosphorylation oxydative ou de regulation des especes reactives de I'oxygene, comme Sodl, pourrait expliquer 1'augmentation du stress oxydatif en absence d'Hnf4a (LENAZ, et al., 2002). II a egalement ete montre que la deletion du gene Atp5al du complexe Fi de phosphorylation oxydative reduit la formation de polypes chez le modele ApcM,n/+ (BARAN, et al., 2007). PPARa est un autre facteur transcriptionnel important dans la fonction mitochondriale, mais cette fois au niveau de la P-oxydation des lipides en condition de jeun (ALAYNICK, 2008). II avait ete montre par le passe que PPARa s'oppose a HNF4a dans I'expression de la HMG-CoA synthase (HMGCS2) et de I'acyl-CoA thioesterase I (ACOTl) durant le jeun (DONGOL, et al., 2007; RODRIGUEZ, et al., 1998); et ce meme si PPARa est controle positivement par HNF4a (PINEDA TORRA, et al., 2002). Dans un papier recent, il a ete detaille qu'HNF4a s'associe a HES6 sur les promoteurs de ACOTl et HMGCS2 durant les repas pour appliquer une repression de ces genes impliques dans la P-oxydation des acides gras et dans la generation des corps cetoniques respectivement (MARTINEZ-JIMENEZ, et al., 2010). HES6 agirait pour bloquer le recrutement de CBP/p300 par HNF4a et il a ete montre que I'expression de HES6 est diminuee lors du jeun, ce qui a pour effet de deplacer HNF4a/HES6 et de laisser place a PPARa. L'expression de Ppara chez les animaux Hnf4aMEC est reduite de 40 a 50% dans l'intestin grele et le colon, et ce des le jeune age (resultat non montre). De plus, il semble y avoir une levee de la repression des genes Acotl et Hmgcs2 puisqu'il y a augmentation de 80 et 100% respectivement de ces genes. 277 4.8 Chimioresistance et efflux des drogues HNF4a est un facteur important dans l'expression des cytochromes P450 (JOVER, et al., 2001) et des transporters de la famille ABC (ABC transporters) (KAMIYAMA, et al, 2007) tel qu'il a pu etre demontre par de nombreuses etudes de promoteur. Les P450 sont impliques dans la modification de plusieurs xenobiotiques, dont les molecules chimiotherapeutiques utilises dans le traitement du cancer. Certains P450 sont utiles a I'activation de ces drogues alors que d'autres les inactivent. Par exemple, CYP3A4 est implique dans I'activation de la cyclophosphamide et de l'ifosphamide, mais est aussi responsable de l'inactivation des taxanes, du paclitaxel et du docetaxel (OZEKI, et al., 2001). Cependant, certains P450 cytochromes vont generer des especes oxydatives en biais de leur activite (e.g. CYP2E1) (ZANGAR, et al., 2004). Ce stress est normalement compense par I'activation de genes pouvant controler ce stress, tels que la catalase (CAT), la y-glutamyl cysteine synthetase (GCLM) et les GST-transferases (BAI et CEDERBAUM, 2001; CEDERBAUM, 2006) En accord avec ceci, nous avons observe une augmentation de 2 fois de Cyp2el dans l'intestin grele et une deficience en Catalase et en GST-transferases pouvant gerer ce stress chez les animaux Hnf4aAIEC (Manuscrit-4, Fig.3). Mis a part les P450 cytochrome, HNF4a pourrait aussi etre implique dans la regulation de differentes enzymes dont l'activite reduit 1'efficacite de differentes drogues. Par exemple, 1'efficacite du 5-fluorouracil (5-FU) est diminuee par la dihydropyrimidine dehydrogenase (DPYD) (SPECTOR et CAO), un gene qui semble directement regule par FTNF4a etant donne la reduction de son expression de l'ordre de 98% dans le colon (40% dans l'intestin grele) des animaux Hnf4aAIEC. Les ABC transporters quant a eux, tel que ABCB1, peuvent etre impliques dans l'efflux en dehors de la cellule de composes toxiques, de drogues et d'hormones (AMBUDKAR, et al., 2003). Les souris ABCB1 negatives (Abcbla/b''') sont protegees de la tumorigenese dans le modele ApcM,n/+ et ABCB1 278 est augmente dans le cancer colorectal a la suite de la mutation de TP53 (FUKUSHIMA, et al., 1999). Abcbla est reduit de 43% dans l'intestin grele des souris Hnf4aAIECet est augmente de 50% lorsqu'Hnf4a est introduit dans les HCT116 (resultat non montre). A ce sujet, il serait interessant de determiner la resistance aux differentes drogues utilisees dans le cancer colorectal sur des modeles cellulaires ou il y aurait reintroduction des differents isoformes d'HNF4a (e.g. HCT116, SW480, DLD1) ou encore reduction a l'aide du shARN contre HNF4a (e.g. Caco2/15, LoVo, Colo205). Chez les cellules ou HNF4a serait surexprime, les differentes cibles potentielles de la famille P450, GST transferases, ABC transporteurs ou autres pourraient par la suite etre reduites par ARN interference dans les lignees protegees d'une drogue en particulier afin de tester la reintroduction de la sensibilite. Ces tests pourraient etre acceleres par I'utilisation de librairie d'ARN interferents qui pourraient identifier des cibles potentielles a grande echelle (BERNS, et al., 2004). 4.9 Experiences futures Quelques experiences pourraient etre conduites dans le futur afin de preciser l'intervention d'Hnf4a dans la neoplasie intestinale. La premiere implique I'utilisation de l'un des deux modeles inductibles de deletion de Pallele Ape (Apc/*^) genere par deux equipes independantes (Tyler Jacks et Alan Clarke) (CHEUNG, et al., 2009; CHEUNG, et al., 2010; SANSOM, et al., 2004). Lorsque croisees avec le modele de Cre-recombinase inductible a la 0- naphtoflavone (Apc**/fi; Ah.Cre), ces souris developpent des ACF a l'interieur de 5 jours (SANSOM, et al., 2004). Si ce modele etait combine aux alleles floxes ^Hnf4a (Apc**^; Hnf4c£x/fx\ Ah.Cve), la perte simultanee d'Apc et d'Hnf4a comparee a la perte d'Apc seule rendrait possible l'etude des mecanismes se produisant au moment de l'activation 279 constitutive de la voie Wnt. II serait alors possible de verifier si l'absence d'Hnf4a permet Papoptose des cellules Ape mutees. De facon similaire, une deuxieme experience permettrait de confirmer les allegations faites sur I'independance de la croissance de l'adenome a Hnf4a. Cette fois, le modele ApcMin/+ serait croise au modele de Cre inductible afin de genere les animaux ApcM,n/+; Hnf4olx/^\ Ah.Cre. A une periode ou les adenomes sont bien inities, tel qu'a l'age de 2 mois, il s'agirait alors d'inactiver Hnf4a par l'administration orale de P-naphtoflavone. Apres 1 mois supplemental, la taille des polypes des animaux ApcM"l/+; Hnf4c/k/fi; Ah.Cre serait comparee aux animaux controles ApcM,n/+; Hnf4a+/+; Ah.Cre. La troisieme alternative serait I'utilisation de l'expression mosaique de la Cre recombinase sous le controle du promoteur Fabpl (Fabp ' .Cre) (SAAM et GORDON, 1999). Cette expression mosaique permettrait de determiner si 1'inhibition de la formation d'adenome est autonome ou non-autonome. En d'autres termes, ceci permettrait de savoir si, par exemple, des facteurs diffusibles secretes par l'epithelium Hnf4a negatif seraient responsables de la suppression de la tumorigenese. La quatrieme experience permettrait de determiner si l'effet protecteur est du a la perte des isoformes du promoteur PI, du promoteur P2 ou des deux promoteurs. En effet, le modele utilise dans notre etude est un modele ou toutes les isoformes de la proteine sont perdues grace a la deletion des exons 4 et 5 communs a toutes celles-ci (HAYHURST, et al., 2001). Les modeles ou l'exon unique aux isoformes du promoteur PI est remplace par l'exon unique aux isoformes du promoteur P2 et vice-versa ont ete developpes par le passe (BRIANCON, et al., 2004). Ces modeles sont viables et fertiles, montrant d'ailleurs la redondance de ces isoformes, et permettraient d'etudier facilement le role des isoformes P2 (Pl-seul) ou des isoformes PI (P2-seul) dans l'initiation de la tumorigenese dans le modele ApcM"l/+. 280 La derniere approche pourrait proceder a l'inverse. Dans ce cas, il s'agirait de generer differentes souris transgeniques surexprimant les differentes isoformes sous le controle du promoteur 12.4 kb-Villin. Ces constructions reproduisent 1'expression spatio- temporelle deja decrite pour le modele 12.4 kb-Villin.Cre (CHEN, et al., 2009). Cependant, afin d'eviter la potentielle letalite d'une telle surexpression, le promoteur 12.4 kb-Villin ou une sequence rtTA2-M2 (reverse tetracycline transactivator) inductible a la tetracycline (Tet-On) a ete ajoutee en amont serait preferable (ROTH, et al., 2009). Ceci permettrait egalement de choisir le moment et le niveau d'expression du transgene. Par exemple, HNF4a pourrait etre surexprime a la naissance pour determiner son role dans l'initiation ou a 2 mois afin de verifier I'impact sur les polypes deja formes. Cette derniere experience est particulierement importante puisqu'elle permettrait de reellement verifier si 1'augmentation de 1'expression d'HNF4a mesuree chez les patients atteints du cancer colorectal est un indice de bon ou de mauvais pronostique et permettrait de preciser si FTNF4a est reellement un oncogene. De telles experiences pourraient etre effectuees sur des animaux ApcM,n/+; Hnf4aAIEC afin d'etudier specifiquement le role de l'isoforme surexprimee. Ces modeles pourraient aussi simplifier 1'etude de differentes approches therapeutiques permettant de reduire l'activite d'FTNF4a. C'est pourquoi les isoformes humaines d'HNF4a seraient privilegiees pour la generation des transgeniques. Une discussion sur les approches therapeutiques sera presentee a la toute fin. Tel que mentionne plus haut, le modele Apc^50^ est un modele ou la perte d'heterozygocite se fait a 100% via une recombinaison homologue somatique (HAIGIS et DOVE, 2003). Un autre modele d'invalidation exploite l'inactivation par mutation somatique du second allele d'Apc. II s'agit du modele Apc'638NI+ dont la formation de polype est tres 281 lente, mais acceleree si Ton decouvre un gene potentialisateur des mutations somatiques (HAIGIS, et al., 2004). II serait alors possible de determiner si le stress oxydatif occasionne par la perte Hnf4a cause ou non des mutations dans differents genes impliques dans la cascade de carcinogenese intestinale, dont Ape. Plusieurs autres modeles de mutations dans Ape sont disponibles au besoin (MCCART, et al., 2008). 4.10 Therapeutique Cibler l'activation ou Pinhibition des facteurs de transcription intestinaux est deja un domaine dont la promesse de potentiel therapeutique pour le cancer colorectal suscite Pinteret (KARAMOUZIS, et al., 2002) II a ete demontre que Pactivite transcriptionnelle d'HNF4a peut etre modulee via Pexposition a differents lipides xenobiotiques. Par exemple, les derives du 7- methoxy-2-nitronaphtho[2,l-b]furan peuvent augmenter son activite (LE GUEVEL, et al., 2009), alors que le Medica-16-CoA peut la reduire (PETRESCU, et al., 2002). Ce dernier s'apparente aux co-3 PUFA-CoA reconnus pour etre protecteurs pour le developpement du cancer du colon (WHELAN et MCENTEE, 2004). L'etude menee par Pequipe de Bar-Tana a pu demontrer que Putilisation du Medica-16-CoA est en mesure de reduire le potentiel tumoral des cellules HT-29 dans un modele de souris nue; un effet possiblement dependant de Papoptose induite par ce traitement in vitro (SCHWARTZ, et al., 2009). II a ete rapporte que les lipides de la serie MEDICA sont capables d'activer PAMPK, ce qui suggere que leur role ne se transmet pas uniquement par Pinhibition de Pactivite transcriptionnelle, mais aussi par la degradation par le proteasome qui suit la phosphorylation d'FINF4 PAMPK (HONG, et al., 2003). Cette etude montre le potentiel therapeutique de tels composes et demontre qu'il serait possible de reduire Pexpression et Pactivite d'HNF4a dans le cancer colorectal. Nos etudes ayant demontre que la deletion complete d'HNF4a au niveau de 282 l'epithelium a peu de consequences a court terme, ceci supporte la possibility qu'un tel traitement soit un jour possible. Parallelement, les composes activateurs pourraient etre profitables au traitement des maladies inflammatoires ou I'expression d'HNF4a est diminuee. Soutenir I'activite residuelle d'HNF4a permettrait a la fois de retablir l'activation de ses genes cibles, mais aussi l'autoactivation de son propre promoteur pourrait meme etre en mesure de retablir les niveaux normaux d'HNF4a. 4.11 Modele propose Les experiences qui ont ete menees jusqu'a present permettent d'affirmer avec confiance qu'un polype developpe chez le modele ApcMl + etant negatif pour toutes les isoformes d'Hnf4a n'aura pas un potentiel de croissance plus eleve que le polype controle. Nous avons emis I'hypothese qu'une induction facilitee de I'apoptose chez les cellules Hnf4a negatives gagnant la double mutation Min serait a l'origine de la diminution des ACF et qu'Hnf4a apporterait done un effet protecteur sur 1'initiation de l'adenome. Cette apoptose generalisee serait une consequence d'une reduction du controle du stress oxydatif. Nous n'avons pas exclu que les cellules epitheliales des animaux Hnf4aAIEC sont protegees de Pinstabilite chromosomique et done de la recombinaison homologue somatique a l'origine de la double mutation Min. II est largement accepte que la premiere modification des cellules souches epitheliales intestinales se produit au niveau de la voie Wnt (APC ou autre composante). L'experience telle que nous l'avons planifiee a permis de tester l'initiation de la tumorigenese dans un epithelium deja modifie pour I'expression d'Hnf4a. Pour accelerer l'inactivation du controle de cette voie par mutation somatique dans la carcinogenese humaine, il faudrait qu'FTNF4a soit augmente (ou reduit) avant l'apparition de ces mutations. Or, il est peu probable que ceci 283 soit le cas. En effet, la protection contre le stress oxydatif apportee par HNF4a aurait plus de chance d'etre protectrice contre l'acquisition de mutations ponctuelles supplementaires. Les observations faites sur les polypes des animaux ApcMm nous indiquent que 1'expression d'Hnf4a est reduite a la suite de la formation de I'adenome (Manusrcit 4, Fig.l). Mon hypothese est que la reduction d'HNF4a dans I'adenome precoce aurait pour effet de diminuer le controle du stress oxydatif et que ceci favoriserait la mutation des differents suppresseurs de tumeurs impliques dans la progression de I'adenome (Voir figure 4). L'augmentation de l'apoptose qui est observee dans un epithelium reduit ou negatif pour Hnf4a n'aurait que tres peu d'impact sur le maintien de I'adenome lui-meme. L'apoptose au sein d'un polype est d'ailleurs augmentee (observation personnelle). Ce modele est d'autant plus interessant qu'il permet de reconcilier Pobservation de DALM dans le colon des animaux Hnf4amc aux prises avec l'inflammation. De plus, ceci expliquerait les differents marqueurs d'apoptose, d'aberrance mitotique et de proliferation cellulaire qui ont ete observes dans les colons malades. II est aussi connu que contrairement au cancer colorectal, le cancer associe a la colite se developpe suite a une mutation dans TP53 tot dans l'initiation de ce cancer. J'avance l'hypothese que l'expression d'FTNF4a serait reintroduce autant dans le CAC que dans le CCR par une augmentation de l'activite du promoteur P2 (ou PI) au moment de 1'apparition de la mutation de p53 et de la progression vers le carcinome invasif (BAKER, et al., 1990). Cette variation d'expression pour HNF4a, la modification des isoformes, la perte/gain de partenaires aurait potentiellement un impact sur la reprogrammation metabolique du carcinome, sur la protection du stess oxydatif et sur l'augmentation de l'instabilite chromosomique (DEBERARDINIS, et al., 2008; JALLEPALLI et LENGAUER, 2001). En particulier, l'augmentation de la capacite antioxydative de la cellule serait nefaste lors de 284 1" utilisation des agents chimiotherapeutiques qui exploitent normalement 1'augmentation des ROS pour l'induction de l'apoptose. HNF4a . HNF4a , HNF4a , HNF4a ChMatherapla Chlmrathiirapia Ch!mtoth4rapra Chimiothirapie Figure 6 | R61e propose d'HNF4a dans la progression du cancer colorectal. La production de ROS chez la cellule souche atteint un equilibre {A) grace a une production relativement faible de ces especes. Un niveau approprie de ROS devient alors stabilisant pour le genome et done suppresseur de tumeur. Au moment de la differentiation, la cellule utilise majoritairement la phosphorylation oxydative (PhosOX) ce qui a pour effet d'augmenter la production de ROS. Cependant, HNF4a est eleve et pourrait contribuer a 1'expression d'enzymes augmentant la capacite antioxydative de la cellule (Antiox). Lors de la formation de l'adenome precoce, ('expression d'HNF4a serait semblable a celle reirouvee dans les cellules souches. A ce moment, la la combinaison d'une reduction de la capacite antioxydative de la cellule et d'une augmentation de la pioduction de ROS participerait a 1'introduction de nouvelles mutations; permettant evcntuellement la progression vers le carcinome Par un mecanisme non elucide, 1'expression d'HNMa sciait leintroduite dans le carcinome et participerait a 1"augmentation de la capacite anttoxj dative de la cellule. Maigre la production elevee de ROS par la cellule cancereuse, cctte capacite de regulation des ROS prolegerait la cellule de l'apoptose et serait aussi impliquee dans la resistance a l'apoptose parlbis observe* lois certains traitements chimiotherapeutiques Ref.: (CHEN, et al.. 2010, KENSLFR et WAKABAYASHI, 2010; LI et MARBAN. 2010; PAN1. et al, 2009; PAN1. et al., 2010: SATTLER et MUbLLKR-KLlESER, 200°. WANG et YI, 2008) 285 4.12 Ouverture A Tissue de toutes les modifications relevees dans I'epithelium intestinal negatif pour Hnf4a, il devient difficile de reellement saisir si HNF4a est un suppresseur de tumeur ou un oncogene. Consequemment, HNF4a est un facteur transcriptionnel dont la fonction durant l'oncogenese est de toute evidence encore a definir. Ses abondantes cibles transcriptionnelles, ses differents isoformes et ses nombreux partenaires nous conduisent inexorablement a conclure qu'il faudra plusieurs annees de recherche pour definir son role durant les differentes phases de la carcinogenese intestinale. Nos travaux ont tout de meme fait progresser rapidement notre conception d'FTNF4a dans ce contexte. Nous sommes partis d'une hypothese qui suggerait que la deletion d'Hnf4a allait accelerer la formation et la croissance de l'adenome pour enfin s'apercevoir du potentiel oncogenique de ce facteur. L'histoire de la recherche biomedicale nous apprend a etre prudent sur les conclusions que nous tirons de differentes observations « initiales » et certainement que les certains roles potentiels identifies ici pourront un jour etre integres dans les modeles actuels et futurs de la comprehension du cancer. Globalement, I'etat metabolique de I'epithelium Hnf4a negatif semble fortement modifie et determiner si le stress oxydatif est la cause ou l'effet de ces modifications est pour le moment difficile a determiner. Cependant, tous ces indices combines au resultat obtenu par le modele ApcM,n/+ nous permettent d'entrevoir un role important pour le facteur HNF4a dans les differentes etapes de la carcinogenese intestinale. 286 CONCLUSION GENERALE (HNF4A) L'approche de deletion conditionnelle $Hnf4a dans les epithelia du grele et du colon a permis de cerner pour la premiere fois le role de ce facteur transcriptionnel dans le maintien des muqueuses du systeme digestif adulte. Malgre les etudes precedentes qui avancaient un role crucial pour Hnf4a dans I'etablissement de la cellule intestinale differenciee (LUSSIER, et al., 2008; ODOM, et al., 2004), nous nous sommes apercus que son retrait n'avait pas de severes consequences sur l'homeostasie du tissu a court terme. Ce resultat suggere un certain niveau de redondance avec d'autres facteurs tels que HNF4y ou HNFla et montre a quel point ces facteurs sont importants pour le programme transcriptionnel epithelial. II n'en demeure pas moins que la profonde modification genique qui a ete relevee par les deux analyses sur micropuce soutient un role transcriptionnel important pour HNF4a lui-meme. De plus, nous avons pu demontrer que ces modifications avaient d'importantes repercussions sur 1'aspect fonctionnel du tissu a long terme. D'abord nous avons montre qu'HNF4a participe a la cytodifferenciation intestinale en controlant les differentes populations residant dans 1'epithelium. Les modifications relevees au niveau des cellules enteroendocrines laissent entrevoir d'importantes repercussions suite a la modification de l'expression d'HNF4a dans les pathologies telles que le MODY1, les Mil et le cancer colorectal. Nous avons aussi decouvert qu'HNF4a etait perdu dans les Mil et prouve que la modification de la regulation des electrolytes dans un colon ou Hnf4cc a ete invalide pouvait contribuer a 1'initiation chez la souris d'une pathologie qui s'apparente aux MIL Finalement, nous avons pour la premiere fois identifie HNF4a comme un facteur pouvant sensibiliser un epithelium a la perte d'heterozygocite de l'allele Ape chez un animal susceptible. Nos experiences ont pu demontrer qu'HNF4a pouvait proteger du stress oxydatif en agissant au niveau de la 287 transcription de cibles impliquees dans le controle de ce stress. L'augmentation d'HNF4a qui a ete relevee dans le cancer colorectal nous invite a s'interoger sur le role de ce facteur sur la protection contre le stress oxydatif, mais aussi sur de nombreux autres aspects qui sont sous le controle d'HNF4a et qui pourraient apporter un avantage de survie aux cellules cancereuses du CCR. En somme, HNF4a n'est pas a l'abri des principales pathologies intestinales et semble implique dans le maintien de I'homeostase du tissu, tant durant son bon fonctionnement, que durant l'initiation, la progression ou la chronicite des maladies. 288 REMERCIEMENTS J'aimerais d'abord remercier les membres de mon jury pour le temps qu'ils ont bien voulu accorder a 1'evaluation de cette these. Je remercie done sincerement Pr Maxime Bouchard (evaluateur externe) de I'Universite McGill, Pr Raymund Wellinger (evaluateur interne) de I'Universite de Sherbrooke, Pre Nathalie Rivard (evaluatrice au programme de Biologie Cellulaire) de I'Universite de Sherbrooke et Francois Boudreau (directeur des travaux) de I'Universite de Sherbrooke. Merci egalement aux membres de mon comite devaluation pre-doctorale qui m'ont permis de preciser les differents objectifs de l'un de mes projets. Je remercie done Pr Maxime Bouchard (evaluateur externe) de I'Universite McGill, Pre Nathalie Perreault (evaluatatrice interne) de I'Universite de Sherbrooke, Pre Nathalie Rivard (directrice du programme de Biologie Cellulaire) de I'Universite de Sherbrooke et Pr Francois Boudreau (directeur des travaux) de I'Universite de Sherbrooke. Merci aux membres du departement d'anatomie et de biologie cellulaire pour leur implication dans les cours d'etudes graduees, ainsi que des evaluations durant les seminaires. A ce sujet, un merci tout special a Pre Marie-Josee Boucher, Dre Julie Carrier, Pr Fernand- Pierre Gendron, Pre Nathalie Perreault et Pre Nathalie Rivard qui m'ont donne de precieux commentaires sur mes exposes scientifiques. Merci aux membres presents et passes du laboratoire du Pr Francois Boudreau avec qui j'ai passe de beaux moments pendant, comme apres les heures de travail. Je pense a Carine, Christine, Francois, Genevieve, Isabelle, Jean-Philippe, Sebastien et Stephanie. Parmis mes 289 collegues, un merci tout special a Benoit Auclair, Charles Bertrand, Carine Lussier, Denis Martel, Evelyne Roy et Sebastien Mongrain qui m'ont apporte de l'aide technique au cours de mes annees d'etude. Un autre merci tout special a Carine Lussier, Etienne Lemieux, Francois Brial et Jean-Philippe Babeu pour les discussions scientifiques. Finalement, je veux souligner la valeur indefinissable de mon interaction avec mon directeur de recherche Pr Francois Boudreau. La passion que Francois a pour la science s'est transmise des le premier entretien. Celle-ci a su etre maintenue et cultivee tout au long de ces annees et me permet aujourd'hui d'attribuer a Francois une enorme responsabilite dans celle que je conserve aujourd'hui. II a aussi ete d'une importance inestimable au developpement de ma confiance et de mon estime personnelle, de mes connaissances scientifiques et de mes capacites de communication. Francois dirige ses etudiants de maniere a laisser cours a leur developpement technique et intellectuel. II est ouvert, a l'ecoute et motivateur positif; des qualites qui sont essentielles au maintien du moral d'un scientifique durant les aleas particulierement demoralisateurs de cette profession. Les souvenirs que je garde de cette etape cruciale de ma carriere sauront pour la vie me rappeler l'enorme chance que j'ai eu de le rencontrer. Pour une derniere fois, Francois, merci. Dans une classe a part je dois souligner la contribution non-scientifique de ma famille et mes amis qui m'ont soutenu de differentes facons durant les difficultes auxquelles nous sommes confronte en recherche. Un merci tout particulier a Vincent, Nicholas, Bertrand, Justin, Pascal, Pierre, Amelie, Francois, Etienne, Michel, Suzanne, Cecile, Yvon, Georges, Leonie, Veronique et Louisette pour les bons moments passes ensemble. A ma mere Louisette, mon pere Bernard et ma soeur Veronique, merci de votre amour et votre soutien sans borne. 290 LA SOURIS EST UN ANIMAL QUI, TUE EN QUANTITE SUFFISANTE ET DANS DES CONDITIONS CONTROLEES, PRODUIT UNE THESE DE DOCTORAT (WOODY ALLEN) 291 REFERENCES Abreu, M. T., Vora, P., Faure, E., Thomas, L. S., Arnold, E. T. et Arditi, M. (2001) Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopoly saccharide. J Immunol, 167(3), 1609-1616. Adachi, S., Yoshida, H., Kataoka, H. et Nishikawa, S. (1997) Three distinctive steps in Peyer's patch formation of murine embryo. Int Immunol, 9(4), 507-514. Aggelidou, E., Iordanidou, P., Tsantili, P., Papadopoulos, G. et Hadzopoulou-Cladaras, M. (2004) Critical role of residues defining the ligand binding pocket in hepatocyte nuclear factor-4alpha. J Biol Chem, 279(29), 30680-30688. Aggelidou, E., Iordanidou, P., Demetriades, C, Piltsi, O. et Hadzopoulou-Cladaras, M. (2006) Functional characterization of hepatocyte nuclear factor-4 alpha dimerization interface mutants. The FEBSjournal, 273(9), 1948-1958. Ahlgren, U., Jonsson, J., Jonsson, L., Simu, K. et Edlund, H. (1998) beta-cell-specific inactivation of the mouse Ipfl/Pdxl gene results in loss of the beta-cell phenotype and maturity onset diabetes. Genes Dev, 12(12), 1763-1768. Ahn, S. H., Shah, Y. M., Inoue, J., Morimura, K., Kim, I., Yim, S., Lambert, G., Kurotani, R., Nagashima, K., Gonzalez, F. J. et Inoue, Y. (2008) Hepatocyte nuclear factor 4alpha in the intestinal epithelial cells protects against inflammatory bowel disease. Inflamm Bowel Dis, 14(7), 908-920. Ahuja, S. K. et Murphy, P. M. (1996) The CXC chemokines growth-regulated oncogene (GRO) alpha, GRObeta, GROgamma, neutrophil-activating peptide-2, and epithelial cell- derived neutrophil-activating peptide-78 are potent agonists for the type B, but not the type A, human interleukin-8 receptor. J Biol Chem, 271(34), 20545-20550. Akcan, A., Muhtaroglu, S., Akgun, H., Akyildiz, H., Kucuk, C, Sozuer, E., Yurci, A. et Yilmaz, N. (2008) Ameliorative effects of bombesin and neurotensin on trinitrobenzene sulphonic acid-induced colitis, oxidative damage and apoptosis in rats. World J Gastroenterol, 14(8), 1222-1230. Al-Dewachi, H. S., Wright, N. A., Appleton, D. R. et Watson, A. J. (1975) Cell population kinetics in the mouse jejunal crypt. Virchows Arch B Cell Pathol, 18(3), 225-242. Al-Dewachi, H. S., Appleton, D. R., Watson, A. J. et Wright, N. A. (1979) Variation in the cell cycle time in the crypts of Lieberkuhn of the mouse. Virchows Archiv, 31(1), 37-44. 292 Alaynick, W. A. (2008) Nuclear receptors, mitochondria and lipid metabolism. Mitochondrion, 8(4), 329-337. Alazzouzi, H., Alhopuro, P., Salovaara, R., Sammalkorpi, H., Jarvinen, H., Mecklin, J. P., Hemminki, A., Schwartz, S., Jr., Aaltonen, L. A. et Arango, D. (2005) SMAD4 as a prognostic marker in colorectal cancer. Clin Cancer Res, 11(7), 2606-2611. Aloisi, F. et Pujol-Borrell, R. (2006) Lymphoid neogenesis in chronic inflammatory diseases. Nat Rev Immunol, 6(3), 205-217. Amasheh, S., Meiri, N., Gitter, A. H., Schoneberg, T., Mankertz, J., Schulzke, J. D. et Fromm, M. (2002) Claudin-2 expression induces cation-selective channels in tight junctions of epithelial cells. J Cell Sci, 115(Pt 24), 4969-4976. Ambudkar, S. V., Kimchi-Sarfaty, C, Sauna, Z. E. et Gottesman, M. M. (2003) P- glycoprotein: from genomics to mechanism. Oncogene, 22(47), 7468-7485. Ando, K., Ozaki, T., Yamamoto, H., Furuya, K., Hosoda, M., Hayashi, S., Fukuzawa, M. et Nakagawara, A. (2004) Polo-like kinase 1 (Plkl) inhibits p53 function by physical interaction and phosphorylation. J Biol Chem, 279(24), 25549-25561. Andres, V., Chiara, M. D. et Mahdavi, V. (1994) A new bipartite DNA-binding domain: cooperative interaction between the cut repeat and homeo domain of the cut homeo proteins. Genes Dev, 8(2), 245-257. Ang, S. L. et Rossant, J. (1994) HNF-3 beta is essential for node and notochord formation in mouse development. Cell, 78(4), 561-574. Anton, P., Theodorou, V., Fioramonti, J. et Bueno, L. (1998) Low-level exposure to diquat induces a neurally mediated intestinal hypersecretion in rats: involvement of nitric oxide and mast cells. Toxicology and applied pharmacology, 152(1), 77-82. Araya, N., Hirota, K., Shimamoto, Y., Miyagishi, M., Yoshida, E., Ishida, J., Kaneko, S., Kaneko, M., Nakajima, T. et Fukamizu, A. (2003) Cooperative interaction of EWS with CREB-binding protein selectively activates hepatocyte nuclear factor 4-mediated transcription. J Biol Chem, 278(7), 5427-5432. Argyrokastritis, A., Kamakari, S., Kapsetaki, M., Kritis, A., Talianidis, I. et Moschonas, N. K. (1997) Human hepatocyte nuclear factor-4 (hHNF-4) gene maps to 20ql2-ql3.1 between PLCG1 and D20S17. Human genetics, 99(2), 233-236. Ashcroft, S. J. (2000) The beta-cell K(ATP) channel. JMembr Biol, 176(3), 187-206. Atkinson, W., Lockhart, S., Whorwell, P. J., Keevil, B. et Houghton, L. A. (2006) Altered 5- hydroxytryptamine signaling in patients with constipation- and diarrhea-predominant irritable bowel syndrome. Gastroenterology, 130(1), 34-43. 293 Babenko, A. P., Aguilar-Bryan, L. et Bryan, J. (1998) A view of sur/KIR6.X, KATP channels. Annu Rev Physiol, 60, 667-687. Babyatsky, M. W., Rossiter, G. et Podolsky, D. K. (1996) Expression of transforming growth factors alpha and beta in colonic mucosa in inflammatory bowel disease. Gastroenterology, 110(4), 975-984. Backhed, F., Ding, H., Wang, T., Hooper, L. V., Koh, G. Y., Nagy, A., Semenkovich, C. F. et Gordon, J. I. (2004) The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci USA, 101(44), 15718-15723. Bai, J. et Cederbaum, A. I. (2001) Adenovirus-mediated overexpression of catalase in the cytosolic or mitochondrial compartment protects against cytochrome P450 2E1-dependent toxicity in HepG2 cells. J Biol Chem, 276(6), 4315-4321. Baker, S. J., Fearon, E. R., Nigro, J. M., Hamilton, S. R., Preisinger, A. C, Jessup, J. M, vanTuinen, P., Ledbetter, D. H., Barker, D. F., Nakamura, Y., White, R. et Vogelstein, B. (1989) Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science, 244(4901), 217-221. Baker, S. J., Preisinger, A. C, Jessup, J. M., Paraskeva, C., Markowitz, S., Willson, J. K., Hamilton, S. et Vogelstein, B. (1990) p53 gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res, 50(23), 11 \1-1122. Bakin, A. V., Rinehart, C, Tomlinson, A. K. et Arteaga, C. L. (2002) p38 mitogen-activated protein kinase is required for TGFbeta-mediated fibroblastic transdifferentiation and cell migration. J Cell Sci, 115(Pt 15), 3193-3206. Baldwin, G. S. et Whitehead, R. H. (1994) Gut hormones, growth and malignancy. Bailliere's clinical endocrinology and metabolism, 8(1), 185-214. Balkwill, F. et Mantovani, A. (2001) Inflammation and cancer: back to Virchow? Lancet, 357(9255), 539-545. Bamias, G., Nyce, M. R., De La Rue, S. A. et Cominelli, F. (2005) New concepts in the pathophysiology of inflammatory bowel disease. Ann Intern Med, 143(12), 895-904. Banerjee-Basu, S. et Baxevanis, A. D. (2001) Molecular evolution of the homeodomain family of transcription factors. Nucleic Acids Res, 29(15), 3258-3269. Baran, A. A., Silverman, K. A., Zeskand, J., Koratkar, R., Palmer, A., McCullen, K., Curran, W. J., Jr., Edmonston, T. B., Siracusa, L. D. et Buchberg, A. M. (2007) The modifier of Min 2 (Mom2) locus: embryonic lethality of a mutation in the Atp5al gene suggests a novel mechanism of polyp suppression. Genome Res, 17(5), 566-576. Barberis, A., Superti-Furga, G. et Busslinger, M. (1987) Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter. Cell, 50(3), 347-359. 294 Barker, N., van Es, J. H., Kuipers, J., Kujala, P., van den Born, M., Cozijnsen, M, Haegebarth, A., Korving, J., Begthel, H., Peters, P. J. et Clevers, H. (2007) Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature, 449(7165), 1003-1007. Barker, N., Ridgway, R. A., van Es, J. H., van de Wetering, M., Begthel, H., van den Born, M., Danenberg, E., Clarke, A. R., Sansom, O. J. et Clevers, H. (2009) Crypt stem cells as the cells-of-origin of intestinal cancer. Nature, 457(7229), 608-611. Barrett, J. C, Lee, J. C, Lees, C. W., Prescott, N. J., Anderson, C. A., Phillips, A., Wesley, E., Parnell, K., Zhang, H., Drummond, H., Nimmo, E. R., Massey, D., Blaszczyk, K., Elliott, T., Cotterill, L., Dallal, H., Lobo, A. J., Mowat, C, Sanderson, J. D., Jewell, D. P., Newman, W. G., Edwards, C, Ahmad, T., Mansfield, J. C, Satsangi, J., Parkes, M., Mathew, C. G., Donnelly, P., Peltonen, L., Blackwell, J. M., Bramon, E., Brown, M. A., Casas, J. P., Corvin, A., Craddock, N., Deloukas, P., Duncanson, A., Jankowski, J., Markus, H. S., McCarthy, M. I., Palmer, C. N., Plomin, R., Rautanen, A., Sawcer, S. J., Samani, N., Trembath, R. C, Viswanathan, A. C, Wood, N., Spencer, C. C, Barrett, J. C, Bellenguez, C, Davison, D., Freeman, C, Strange, A., Langford, C, Hunt, S. E., Edkins, S., Gwilliam, R., Blackburn, H., Bumpstead, S. J., Dronov, S., Gillman, M., Gray, E., Hammond, N., Jayakumar, A., McCann, O. T., Liddle, J., Perez, M. L., Potter, S. C, Ravindrarajah, R., Ricketts, M., Waller, M., Weston, P., Widaa, S., Whittaker, P., Attwood, A. P., Stephens, J., Sambrook, J., Ouwehand, W. H., McArdle, W. L., Ring, S. M. et Strachan, D. P. (2009) Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. Nat Genet, 41(12), 1330-1334. Bataille, D., Gespach, C, Coudray, A. M. et Rosselin, G. (1981) "Enterolglucagon': a specific effect on gastric glands isolated from the rat fundus. Evidence for an "oxyntomodulin' action. Biosci Rep, 1(2), 151-155. Bates, R. C. et Mercurio, A. M. (2003) Tumor necrosis factor-alpha stimulates the epithelial- to-mesenchymal transition of human colonic organoids. Mol Biol Cell, 14(5), 1790-1800. Battle, M. A., Konopka, G., Parviz, F., Gaggl, A. L., Yang, C, Sladek, F. M. et Duncan, S. A. (2006) Hepatocyte nuclear factor 4alpha orchestrates expression of cell adhesion proteins during the epithelial transformation of the developing liver. Proc Natl Acad Sci USA, 103(22), 8419-8424. Belley, A., Keller, K., Gottke, M. et Chadee, K. (1999) Intestinal mucins in colonization and host defense against pathogens. Am J Trop MedHyg, 60(4 Suppl), 10-15. Benga, G. (2009) Water channel proteins (later called aquaporins) and relatives: past, present, and future. IUBMB life, 61(2), 112-133. Bensaad, K. et Vousden, K. H. (2005) Savior and slayer: the two faces of p53. Nat Med, 11(12), 1278-1279. 295 Berasain, C, Herrero, J. I., Garcia-Trevijano, E. R., Avila, M. A., Esteban, J. I., Mato, J. M. et Prieto, J. (2003) Expression of Wilms' tumor suppressor in the liver with cirrhosis: relation to hepatocyte nuclear factor 4 and hepatocellular function. Hepatology, 38(1), 148- 157. Bergman, E. N. (1990) Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol Rev, 70(2), 567-590. Berns, K., Hijmans, E. M., Mullenders, J., Brummelkamp, T. R., Velds, A., Heimerikx, M., Kerkhoven, R. M., Madiredjo, M., Nijkamp, W., Weigelt, B., Agami, R., Ge, W., Cavet, G., Linsley, P. S., Beijersbergen, R. L. et Bernards, R. (2004) A large-scale RNAi screen in human cells identifies new components of the p53 pathway. Nature, 428(6981), 431-437. Binder, H. J. (2009) Mechanisms of diarrhea in inflammatory bowel diseases. Ann N Y Acad Sci, 1165,285-293. Bischoff, S. C, Wedemeyer, J., Herrmann, A., Meier, P. N., Trautwein, C, Cetin, Y., Maschek, H., Stolte, M., Gebel, M. et Manns, M. P. (1996) Quantitative assessment of intestinal eosinophils and mast cells in inflammatory bowel disease. Histopathology, 28(1), 1-13. Bischoff, S. C. (2009) Physiological and pathophysiological functions of intestinal mast cells. Seminars in immunopathology, 31(2), 185-205. Bjerknes, M. et Cheng, H. (1999) Clonal analysis of mouse intestinal epithelial progenitors. Gastroenterology, 116(1), 7-14. Blackstone, M. O., Riddell, R. H., Rogers, B. H. et Levin, B. (1981) Dysplasia-associated lesion or mass (DALM) detected by colonoscopy in long-standing ulcerative colitis: an indication for colectomy. Gastroenterology, 80(2), 366-374. Blagosklonny, M. V., An, W. G., Romanova, L. Y., Trepel, J., Fojo, T. etNeckers, L. (1998) p53 inhibits hypoxia-inducible factor-stimulated transcription. J Biol Chem, 273(20), 11995- 11998. Blochlinger, K., Bodmer, R., Jack, J., Jan, L. Y. et Jan, Y. N. (1988) Primary structure and expression of a product from cut, a locus involved in specifying sensory organ identity in Drosophila. Nature, 333(6174), 629-635. Blochlinger, K., Jan, L. Y. et Jan, Y. N. (1991) Transformation of sensory organ identity by ectopic expression of Cut in Drosophila. Genes Dev, 5(7), 1124-1135. Blumberg, R. S. (2009) Inflammation in the intestinal tract: pathogenesis and treatment. Digestive diseases, 27(4), 455-464. Boismenu, R. et Chen, Y. (2000) Insights from mouse models of colitis. J Leukoc Biol, 67(3), 267-278. 296 Boland, C. R. et Goel, A. (2005) Somatic evolution of cancer cells. Seminars in cancer biology, 15(6), 436-450. Bolotin, E., Liao, H., Ta, T. C, Yang, C, Hwang-Verslues, W., Evans, J. R., Jiang, T. et Sladek, F. M. (2010) Integrated approach for the identification of human hepatocyte nuclear factor 4alpha target genes using protein binding microarrays. Hepatology, 51(2), 642-653. Borman, R. (2001) Serotonergic modulation and irritable bowel syndrome. Expert opinion on emerging drugs, 6(1), 57-68. Borregaard, N., Sorensen, O. E. et Theilgaard-Monch, K. (2007) Neutrophil granules: a library of innate immunity proteins. Trends Immunol, 28(8), 340-345. Bortner, C. D. et Cidlowski, J. A. (1996) Absence of volume regulatory mechanisms contributes to the rapid activation of apoptosis in thymocytes. Am J Physiol, 271(3 Pt 1), C950-961. Bos, R., van Der Hoeven, J. J., van Der Wall, E., van Der Groep, P., van Diest, P. J., Comans, E. F., Joshi, U., Semenza, G. L., Hoekstra, O. S., Lammertsma, A. A. et Molthoff, C. F. (2002) Biologic correlates of (18)fluorodeoxyglucose uptake in human breast cancer measured by positron emission tomography. J Clin Oncol, 20(2), 379-387. Boudreau, F., Zhu, Y. et Traber, P. G. (2001) Sucrase-isomaltase gene transcription requires the hepatocyte nuclear factor-1 (HNF-1) regulatory element and is regulated by the ratio of HNF-1 alpha to HNF-1 beta. J Biol Chem, 276(34), 32122-32128. Boudreau, F., Rings, E. H., Swain, G. P., Sinclair, A. M., Suh, E. R., Silberg, D. G., Scheuermann, R. H. et Traber, P. G. (2002) A novel colonic repressor element regulates intestinal gene expression by interacting with Cux/CDP. Mol Cell Biol, 22(15), 5467-5478. Boyadjiev, S. A. et Jabs, E. W. (2000) Online Mendelian Inheritance in Man (OMIM) as a knowledgebase for human developmental disorders. Clin Genet, 57(4), 253-266. Brandtzaeg, P. (1989) Overview of the mucosal immune system. Curr Top Microbiol Immunol, 146, 13-25. Brandtzaeg, P., Farstad, I. N., Haraldsen, G. et Jahnsen, F. L. (1998) Cellular and molecular mechanisms for induction of mucosal immunity. Dev Biol Stand, 92, 93-108. Brandtzaeg, P., Farstad, I. N. et Haraldsen, G. (1999) Regional specialization in the mucosal immune system: primed cells do not always home along the same track. Immunol Today, 20(6), 267-277. Brandtzaeg, P. et Pabst, R. (2004) Let's go mucosal: communication on slippery ground. Trends Immunol, 25(11), 570-577. Bray, S. et Furriols, M. (2001) Notch pathway: making sense of suppressor of hairless. Curr Biol, 11(6), R217-221. 297 Breault, D. T., Min, I. M., Carlone, D. L., Farilla, L. G., Ambruzs, D. M, Henderson, D. E., Algra, S., Montgomery, R. K., Wagers, A. J. et Hole, N. (2008) Generation of mTert-GFP mice as a model to identify and study tissue progenitor cells. Proc Natl Acad Sci USA, 105(30), 10420-10425. Briancon, N., Bailly, A., Clotman, F., Jacquemin, P., Lemaigre, F. P. et Weiss, M. C. (2004) Expression of the alpha7 isoform of hepatocyte nuclear factor (HNF) 4 is activated by HNF6/OC-2 and HNF1 and repressed by HNF4alphal in the liver. J Biol Chem, 279(32), 33398-33408. Briggs, M. R., Kadonaga, J. T., Bell, S. P. et Tjian, R. (1986) Purification and biochemical characterization of the promoter-specific transcription factor, Spl. Science, 234(4772), 47- 52. Brivanlou, A. H. et Darnell, J. E., Jr. (2002) Signal transduction and the control of gene expression. Science, 295(5556), 813-818. Brown, J. P., Wei, W. et Sedivy, J. M. (1997) Bypass of senescence after disruption of p21CIPl/WAFl gene in normal diploid human fibroblasts. Science, 277(5327), 831-834. Bry, L., Falk, P., Huttner, K., Ouellette, A., Midtvedt, T. et Gordon, J. I. (1994) Paneth cell differentiation in the developing intestine of normal and transgenic mice. Proc Natl Acad Sci USA, 91(22), 10335-10339. Budanov, A. V., Sablina, A. A., Feinstein, E., Koonin, E. V. et Chumakov, P. M. (2004) Regeneration of peroxiredoxins by p5 3-regulated sestrins, homologs of bacterial AhpD. Science, 304(5670), 596-600. Budanov, A. V. et Karin, M. (2008) p53 target genes sestrinl and sestrin2 connect genotoxic stress and mTOR signaling. Cell, 134(3), 451-460. Bull, D. M. et Bookman, M. A. (1977) Isolation and functional characterization of human intestinal mucosal lymphoid cells. J Clin Invest, 59(5), 966-974. Bulla, G. A. (1997) Hepatocyte nuclear factor-4 prevents silencing of hepatocyte nuclear factor-1 expression in hepatoma x fibroblast cell hybrids. Nucleic Acids Res, 25(12), 2501- 2508. Bulla, G. A., Givens, E., Brown, S., Oladiran, B. et Kraus, D. (2001) A common regulatory locus affects both HNF4/HNF1 alpha pathway activation and sensitivity to LPS-mediated apoptosis in rat hepatoma cells. J Cell Sci, 114(Pt 6), 1205-1212. Bulman, M. P., Dronsfield, M. J., Frayling, T., Appleton, M., Bain, S. C, Ellard, S. et Hattersley, A. T. (1997) A missense mutation in the hepatocyte nuclear factor 4 alpha gene in a UK pedigree with maturity-onset diabetes of the young. Diabetologia, 40(7), 859-862. 298 Burke, P. A., Drotar, M, Luo, M, Yaffe, M. et Forse, R. A. (1994) Rapid modulation of liver-specific transcription factors after injury. Surgery, 116(2), 285-292; discussion 292- 283. Burmer, G. C, Rabinovitch, P. S., Haggitt, R. C, Crispin, D. A., Brentnall, T. A., Kolli, V. R., Stevens, A. C. et Rubin, C. E. (1992) Neoplastic progression in ulcerative colitis: histology, DNA content, and loss of a p53 allele. Gastroenterology, 103(5), 1602-1610. Burnet, F. M. et Fenner, F., The production of antibodies, Macmillian, Melbourne, 1949. Burt, B. M., Humm, J. L., Kooby, D. A., Squire, O. D., Mastorides, S., Larson, S. M. et Fong, Y. (2001) Using positron emission tomography with [(18)F]FDG to predict tumor behavior in experimental colorectal cancer. Neoplasia, 3(3), 189-195. Butcher, E. C. et Picker, L. J. (1996) Lymphocyte homing and homeostasis. Science, 272(5258), 60-66. Cairns, W., Smith, C. A., McLaren, A. W. et Wolf, C. R. (1996) Characterization of the human cytochrome P4502D6 promoter. A potential role for antagonistic interactions between members of the nuclear receptor family. J Biol Chem, 271(41), 25269-25276. Calvert, R. et Pothier, P. (1990) Migration of fetal intestinal intervillous cells in neonatal mice. Anat Rec, 227(2), 199-206. Cameron, I. L., Kent, J. E., Philo, R., Barnes, C. J. et Hardman, W. E. (2006) Numerical distribution of lymphoid nodules in the human sigmoid colon, rectosigmoidal junction, rectum, and anal canal. Clin Anat, 19(2), 164-170. Campisi, J. (2001) Cellular senescence as a tumor-suppressor mechanism. Trends Cell Biol, 11(11), S27-31. Canon, J. et Banerjee, U. (2003) In vivo analysis of a developmental circuit for direct transcriptional activation and repression in the same cell by a Runx protein. Genes Dev, 17(7), 838-843. Cario, E., Rosenberg, I. M., Brandwein, S. L., Beck, P. L., Reinecker, H. C. et Podolsky, D. K. (2000) Lipopolysaccharide activates distinct signaling pathways in intestinal epithelial cell lines expressing Toll-like receptors. J Immunol, 164(2), 966-972. Cario, E., Gerken, G. et Podolsky, D. K. (2004) Toll-like receptor 2 enhances ZO-1- associated intestinal epithelial barrier integrity via protein kinase C. Gastroenterology, 127(1), 224-238. Cario, E. et Podolsky, D. K. (2005) Intestinal epithelial TOLLerance versus inTOLLerance of commensals. Mol Immunol, 42(8), 887-893. Cario, E. (2008) Barrier-protective function of intestinal epithelial Toll-like receptor 2. Mucosal immunology, 1 Suppl 1, S62-66. 299 Carlsen, H. S., Baekkevold, E. S., Johansen, F. E., Haraldsen, G. et Brandtzaeg, P. (2002) B cell attracting chemokine 1 (CXCL13) and its receptor CXCR5 are expressed in normal and aberrant gut associated lymphoid tissue. Gut, 51(3), 364-371. Carlson, M., Raab, Y., Seveus, L., Xu, S., Hallgren, R. et Venge, P. (2002) Human neutrophil lipocalin is a unique marker of neutrophil inflammation in ulcerative colitis and proctitis. Gut, 50(4), 501-506. Carmeliet, P., Dor, Y., Herbert, J. M, Fukumura, D., Brusselmans, K., Dewerchin, M., Neeman, M., Bono, F., Abramovitch, R., Maxwell, P., Koch, C. J., Ratcliffe, P., Moons, L., Jain, R. K., Collen, D. et Keshert, E. (1998) Role of HIF-lalpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature, 394(6692), 485-490. Cattin, A. L., Le Beyec, J., Barreau, F., Saint-Just, S., Houllier, A., Gonzalez, F. J., Robine, S., Pincon-Raymond, M., Cardot, P., Lacasa, M. et Ribeiro, A. (2009) Hepatocyte nuclear factor 4alpha, a key factor for homeostasis, cell architecture, and barrier function of the adult intestinal epithelium. Mol Cell Biol, 29(23), 6294-6308. Cederbaum, A. I. (2006) Cytochrome P450 2E1-dependent oxidant stress and upregulation of anti-oxidant defense in liver cells. J Gastroenterol Hepatol, 21 Suppl 3, S22-25. Cenac, N., Coelho, A. M., Nguyen, C, Compton, S., Andrade-Gordon, P., MacNaughton, W. K., Wallace, J. L., Hollenberg, M. D., Bunnett, N. W., Garcia-Villar, R., Bueno, L. et Vergnolle, N. (2002) Induction of intestinal inflammation in mouse by activation of proteinase-activated receptor-2. ,4m J Pathol, 161(5), 1903-1915. Cenac, N., Andrews, C. N., Holzhausen, M., Chapman, K., Cottrell, G., Andrade-Gordon, P., Steinhoff, M., Barbara, G., Beck, P., Bunnett, N. W., Sharkey, K. A., Ferraz, J. G., Shaffer, E. et Vergnolle, N. (2007) Role for protease activity in visceral pain in irritable bowel syndrome. J Clin Invest, 117(3), 636-647. Cereghini, S. (1996) Liver-enriched transcription factors and hepatocyte differentiation. Faseb J, 10(2), 267-282. Chaplin, D. D. (2003) 1. Overview of the immune response. J Allergy Clin Immunol, 111(2 Suppl), S442-459. Chartier, F. L., Bossu, J. P., Laudet, V., Fruchart, J. C. et Laine, B. (1994) Cloning and sequencing of cDNAs encoding the human hepatocyte nuclear factor 4 indicate the presence of two isoforms in human liver. Gene, 147(2), 269-272. Chase, D., Feng, Y., Hanshew, B., Winkles, J. A., Longo, D. L. et Ferris, D. K. (1998) Expression and phosphorylation of fibroblast-growth-factor-inducible kinase (Fnk) during cell-cycle progression. Biochem J, 333 ( Pt 3), 655-660. 300 Chen, C, Fang, R., Davis, C, Maravelias, C. et Sibley, E. (2009) Pdxl inactivation restricted to the intestinal epithelium in mice alters duodenal gene expression in enterocytes and enteroendocrine cells. Am J Physiol Gastrointest Liver Physiol, 297(6), Gl 126-1137. Chen, C. L., Mehta, V. B., Zhang, H. Y., Wu, D., Otabor, I., Radulescu, A., El-Assal, O. N., Feng, J., Chen, Y. et Besner, G. E. (2009) Intestinal phenotype in mice overexpressing a heparin-binding EGF-like growth factor transgene in enterocytes. Growth factors, 28(2), 82- 97. Chen, C. T., Hsu, S. H. et Wei, Y. H. (2010) Upregulation of mitochondrial function and antioxidant defense in the differentiation of stem cells. Biochim Biophys Acta, 1800(3), 257- 263. Chen, H. Y., Trumbauer, M. E., Chen, A. S., Weingarth, D. T., Adams, J. R., Frazier, E. G., Shen, Z., Marsh, D. J., Feighner, S. D., Guan, X. M, Ye, Z., Nargund, R. P., Smith, R. G., Van der Ploeg, L. H., Howard, A. D., MacNeil, D. J. et Qian, S. (2004) Orexigenic action of peripheral ghrelin is mediated by neuropeptide Y and agouti-related protein. Endocrinology, 145(6), 2607-2612. Chen, W. S., Manova, K., Weinstein, D. C, Duncan, S. A., Plump, A. S., Prezioso, V. R., Bachvarova, R. F. et Darnell, J. E., Jr. (1994) Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev, 8(20), 2466-2477. Cheng, H. et Leblond, C. P. (1974) Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. V. Unitarian Theory of the origin of the four epithelial cell types. Am J Anat, 141(4), 537-561. Cheng, L. et Lai, M. D. (2003) Aberrant crypt foci as microscopic precursors of colorectal cancer. World J Gastroenterol, 9(12), 2642-2649. Cheng, P. Y., Wang, M. et Morgan, E. T. (2003) Rapid transcriptional suppression of rat cytochrome P450 genes by endotoxin treatment and its inhibition by curcumin. The Journal of pharmacology and experimental therapeutics, 307(3), 1205-1212. Cheng, W., Guo, L., Zhang, Z., Soo, H. M., Wen, C, Wu, W. et Peng, J. (2006) HNF factors form a network to regulate liver-enriched genes in zebrafish. Dev Biol, 294(2), 482-496. Cheung, A. F., Carter, A. M., Kostova, K. K., Woodruff, J. F., Crowley, D., Bronson, R. T., Haigis, K. M. et Jacks, T. (2010) Complete deletion of Ape results in severe polyposis in mice. Oncogene, 29(12), 1857-1864. Chiba, H., Itoh, T., Satohisa, S., Sakai, N., Noguchi, H., Osanai, M., Kojima, T. et Sawada, N. (2005) Activation of p21CIPl/WAFl gene expression and inhibition of cell proliferation by overexpression of hepatocyte nuclear factor-4alpha. Exp Cell Res, 302(1), 11-21. Chou, W. C, Prokova, V., Shiraishi, K., Valcourt, U., Moustakas, A., Hadzopoulou- Cladaras, M., Zannis, V. I. et Kardassis, D. (2003) Mechanism of a transcriptional cross talk 301 between transforming growth factor-beta-regulated Smad3 and Smad4 proteins and orphan nuclear receptor hepatocyte nuclear factor-4. Mol Biol Cell, 14(3), 1279-1294. Chung, D. C. et Rustgi, A. K. (1995) DNA mismatch repair and cancer. Gastroenterology, 109(5), 1685-1699. Ciacci, C, Lind, S. E. et Podolsky, D. K. (1993) Transforming growth factor beta regulation of migration in wounded rat intestinal epithelial monolayers. Gastroenterology, 105(1), 93- 101. Cicchini, C, Filippini, D., Coen, S., Marchetti, A., Cavallari, C, Laudadio, I., Spagnoli, F. M., Alonzi, T. et Tripodi, M. (2006) Snail controls differentiation of hepatocytes by repressing HNF4alpha expression. J Cell Physiol, 209(1), 230-238. Cicchini, C, Laudadio, I., Citarella, F., Corazzari, M, Steindler, C, Conigliaro, A., Fantoni, A., Amicone, L. et Tripodi, M. (2008) TGFbeta-induced EMT requires focal adhesion kinase (FAK) signaling. Exp Cell Res, 314(1), 143-152. Clausen, M. R. et Mortensen, P. B. (1995) Kinetic studies on colonocyte metabolism of short chain fatty acids and glucose in ulcerative colitis. Gut, 37(5), 684-689. Cohen, C. J., Shieh, J. T., Pickles, R. J., Okegawa, T., Hsieh, J. T. et Bergelson, J. M. (2001) The coxsackievirus and adenovirus receptor is a transmembrane component of the tight junction. Proc Natl Acad Sci USA, 98(26), 15191-15196. Cohen, M. A., Ellis, S. M., Le Roux, C. W., Batterham, R. L., Park, A., Patterson, M., Frost, G. S., Ghatei, M. A. et Bloom, S. R. (2003) Oxyntomodulin suppresses appetite and reduces food intake in humans. The Journal of clinical endocrinology and metabolism, 88(10), 4696- 4701. Colegio, O. R., Van Itallie, C. M., McCrea, H. J., Rahner, C. et Anderson, J. M. (2002) Claudins create charge-selective channels in the paracellular pathway between epithelial cells. Am J Physiol Cell Physiol, 283(1), CI 42-147. Colletti, M., Cicchini, C, Conigliaro, A., Santangelo, L., Alonzi, T., Pasquini, E., Tripodi, M. et Amicone, L. (2009) Convergence of Wnt signaling on the FTNF4alpha-driven transcription in controlling liver zonation. Gastroenterology, 137(2), 660-672. Compton, C. C. et Greene, F. L. (2004) The staging of colorectal cancer: 2004 and beyond. CA: a cancer journal for clinicians, 54(6), 295-308. Conley, M. E. et Delacroix, D. L. (1987) Intravascular and mucosal immunoglobulin A: two separate but related systems of immune defense? Ann Intern Med, 106(6), 892-899. Cooney, R. et Jewell, D. (2009) The genetic basis of inflammatory bowel disease. Digestive diseases, 27(4), 428-442. 302 Cooper, H. S., Murthy, S. N., Shah, R. S. et Sedergran, D. J. (1993) Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Lab Invest, 69(2), 238-249. Cooper, H. S., Murthy, S., Kido, K., Yoshitake, H. et Flanigan, A. (2000) Dysplasia and cancer in the dextran sulfate sodium mouse colitis model. Relevance to colitis-associated neoplasia in the human: a study of histopathology, B-catenin and p53 expression and the role of inflammation. Carcinogenesis, 21(4), 757-768. Coqueret, O., Berube, G. et Nepveu, A. (1996) DNA binding by cut homeodomain proteins is down-modulated by protein kinase C. J Biol Chem, 271(40), 24862-24868. Coqueret, O., Berube, G. et Nepveu, A. (1998) The mammalian Cut homeodomain protein functions as a cell-cycle-dependent transcriptional repressor which downmodulates p21WAFl/CIPl/SDIl in S phase. Embo J, 17(16), 4680-4694. Coqueret, O., Martin, N., Berube, G., Rabbat, M., Litchfield, D. W. et Nepveu, A. (1998) DNA binding by cut homeodomain proteins is down-modulated by casein kinase II. J Biol Chem, 273(5), 2561-2566. Cornes, J. S. (1965) Number, size, and distribution of Peyer's patches in the human small intestine: Part I The development of Peyer's patches. Gut, 6(3), 225-229. Costa, R. H., Grayson, D. R. et Darnell, J. E., Jr. (1989) Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and alpha 1-antitrypsin genes. Mol Cell Biol, 9(4), 1415-1425. Coucouvanis, E. et Martin, G. R. (1999) BMP signaling plays a role in visceral endoderm differentiation and cavitation in the early mouse embryo. Development, 126(3), 535-546. Coussens, L. M. et Werb, Z. (2002) Inflammation and cancer. Nature, 420(6917), 860-867. Crestani, M., Sadeghpour, A., Stroup, D., Galli, G. et Chiang, J. Y. (1998) Transcriptional activation of the cholesterol 7alpha-hydroxylase gene (CYP7A) by nuclear hormone receptors. Journal of lipid research, 39(11), 2192-2200. Cunliffe, R. N., Rose, F. R., Keyte, J., Abberley, L., Chan, W. C. et Mahida, Y. R. (2001) Human defensin 5 is stored in precursor form in normal Paneth cells and is expressed by some villous epithelial cells and by metaplastic Paneth cells in the colon in inflammatory bowel disease. Gut, 48(2), 176-185. Cyster, J. G. (2003) Homing of antibody secreting cells. Immunol Rev, 194, 48-60. Dai, W., Liu, T., Wang, Q., Rao, C. V. et Reddy, B. S. (2002) Down-regulation of PLK3 gene expression by types and amount of dietary fat in rat colon tumors. International journal of oncology, 20(1), 121-126. Dai, W. (2004) Degradation of a non-cycling mammalian polo-like kinase. Cell Cycle, 3(5), 625-626. 303 Danese, S., Semeraro, S., Papa, A., Roberto, I., Scaldaferri, F., Fedeli, G., Gasbarrini, G. et Gasbarrini, A. (2005) Extraintestinal manifestations in inflammatory bowel disease. World J Gastroenterol, 11(46), 7227-7236. Darnell, J. E., Jr. (2002) Transcription factors as targets for cancer therapy. Nat Rev Cancer, 2(10), 740-749. Dawson, D. C. (1991) Ion channels and colonic salt transport. Annu Rev Physiol, 53, 321- 339. de Santa Barbara, P., van den Brink, G. R. et Roberts, D. J. (2003) Development and differentiation of the intestinal epithelium. Cell Mol Life Sci, 60(7), 1322-1332. DeBerardinis, R. J., Lum, J. J., Hatzivassiliou, G. et Thompson, C. B. (2008) The biology of cancer: metabolic reprogramming fuels cell growth and proliferation. Cell metabolism, 7(1), 11-20. Debongnie, J. C. et Phillips, S. F. (1978) Capacity of the human colon to absorb fluid. Gastroenterology, 74(4), 698-703. Del Rio, D., Stewart, A. J. et Pellegrini, N. (2005) A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress. Nutr Metab Cardiovasc Dis, 15(4), 316-328. Demidov, O. N., Timofeev, O., Lwin, H. N., Kek, C, Appella, E. et Bulavin, D. V. (2007) Wipl phosphatase regulates p53-dependent apoptosis of stem cells and tumorigenesis in the mouse intestine. Cell stem cell, 1(2), 180-190. Dennis, G., Jr., Sherman, B. T., Hosack, D. A., Yang, J., Gao, W., Lane, H. C. et Lempicki, R. A. (2003) DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome biology, 4(5), P3. Deplancke, B. et Gaskins, H. R. (2001) Microbial modulation of innate defense: goblet cells and the intestinal mucus layer. Am J Clin Nutr, 73(6), 1131S-1141S. Desai, S., Loomis, Z., Pugh-Bernard, A., Schrunk, J., Doyle, M. J., Minic, A., McCoy, E. et Sussel, L. (2008) Nkx2.2 regulates cell fate choice in the enteroendocrine cell lineages of the intestine. Dev Biol, 313(1), 58-66. Dickinson, L. A., Dickinson, C. D. et Kohwi-Shigematsu, T. (1997) An atypical homeodomain in SATB1 promotes specific recognition of the key structural element in a matrix attachment region. J Biol Chem, 272(17), 11463-11470. Dodge, A. D. et Harris, N. (1970) The mode of action of paraquat and diquat. Biochem J, 118(3), 43P-44P. 304 Dongol, B., Shah, Y., Kim, L, Gonzalez, F. J. et Hunt, M. C. (2007) The acyl-CoA thioesterase I is regulated by PPARalpha and HNF4alpha via a distal response element in the promoter. Journal of lipid research, 48(8), 1781-1791. Drewes, T., Senkel, S., Holewa, B. et Ryffel, G. U. (1996) Human hepatocyte nuclear factor 4 isoforms are encoded by distinct and differentially expressed genes. Mol Cell Biol, 16(3), 925-931. Duncan, S. A., Manova, K., Chen, W. S., Hoodless, P., Weinstein, D. C, Bachvarova, R. F. et Darnell, J. E., Jr. (1994) Expression of transcription factor HNF-4 in the extraembryonic endoderm, gut, and nephrogenic tissue of the developing mouse embryo: HNF-4 is a marker for primary endoderm in the implanting blastocyst. Proc Natl Acad Sci USA, 91(16), 7598- 7602. Duncan, S. A., Nagy, A. et Chan, W. (1997) Murine gastrulation requires HNF-4 regulated gene expression in the visceral endoderm: tetraploid rescue of Hnf-4(-/-) embryos. Development, 124(2), 279-287. Eaden, J. A., Abrams, K. R. et Mayberry, J. F. (2001) The risk of colorectal cancer in ulcerative colitis: a meta-analysis. Gut, 48(4), 526-535. Eckburg, P. B., Bik, E. M., Bernstein, C. N., Purdom, E., Dethlefsen, L., Sargent, M, Gill, S. R., Nelson, K. E. et Relman, D. A. (2005) Diversity of the human intestinal microbial flora. Science, 308(5728), 1635-1638. Eeckhoute, J., Formstecher, P. et Laine, B. (2001) Maturity-onset diabetes of the young Type 1 (MODYl)-associated mutations R154X and E276Q in hepatocyte nuclear factor 4alpha (HNF4alpha) gene impair recruitment of p300, a key transcriptional co-activator. Molecular endocrinology, 15(7), 1200-1210. Eeckhoute, J., Moerman, E., Bouckenooghe, T., Lukoviak, B., Pattou, F., Formstecher, P., Kerr-Conte, J., Vandewalle, B. et Laine, B. (2003) Hepatocyte nuclear factor 4 alpha isoforms originated from the PI promoter are expressed in human pancreatic beta-cells and exhibit stronger transcriptional potentials than P2 promoter-driven isoforms. Endocrinology, 144(5), 1686-1694. Eeckhoute, J., Oxombre, B., Formstecher, P., Lefebvre, P. et Laine, B. (2003) Critical role of charged residues in helix 7 of the ligand binding domain in Hepatocyte Nuclear Factor 4alpha dimerisation and transcriptional activity. Nucleic Acids Res, 31(22), 6640-6650. Eeckhoute, J., Formstecher, P. et Laine, B. (2004) Hepatocyte nuclear factor 4alpha enhances the hepatocyte nuclear factor 1 alpha-mediated activation of transcription. Nucleic Acids Res, 32(8), 2586-2593. el-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W. et Vogelstein, B. (1993) WAF1, a potential mediator of p53 tumor suppression. Cell, 75(4), 817-825. 305 el-Hodiri, H. M. et Perry, M. (1995) Interaction of the CCAAT displacement protein with shared regulatory elements required for transcription of paired histone genes. Mol Cell Biol, 15(7), 3587-3596. Ellrott, K., Yang, C, Sladek, F. M. et Jiang, T. (2002) Identifying transcription factor binding sites through Markov chain optimization. Bioinformatics, 18 Suppl 2, S100-109. Evans, R. M. (1988) The steroid and thyroid hormone receptor superfamily. Science, 240(4854), 889-895. Featherstone, M. (2002) Coactivators in transcription initiation: here are your orders. Curr Opin Genet Dev, 12(2), 149-155. Fedorak, R. N. (2008) Understanding why probiotic therapies can be effective in treating IBD. Journal of clinical gastroenterology, 42 Suppl 3Ptl,Slll-115. FitzPatrick, D. R., Carr, I. M., McLaren, L., Leek, J. P., Wightman, P., Williamson, K., Gautier, P., McGill, N., Hayward, C, Firth, H., Markham, A. F., Fantes, J. A. et Bonthron, D. T. (2003) Identification of SATB2 as the cleft palate gene on 2q32-q33. Hum Mol Genet, 12(19), 2491-2501. Formeister, E. J., Sionas, A. L., Lorance, D. K., Barkley, C. L., Lee, G. H. et Magness, S. T. (2009) Distinct SOX9 levels differentially mark stem/progenitor populations and enteroendocrine cells of the small intestine epithelium. Am J Physiol Gastrointest Liver Physiol, 296(5), Gl 108-1118. Forstner, J. F., Oliver, G. et Sylvester, F. A., Production, structure, and biologic relevance of gastrointestinal mucins, Raven Press, New-York, 1995. Fortin, G., Yurchenko, K., Collette, C., Rubio, M., Villani, A. C., Bitton, A., Sarfati, M. et Franchimont, D. (2009) L-carnitine, a diet component and organic cation transporter OCTN ligand, displays immunosuppressive properties and abrogates intestinal inflammation. Clin Exp Immunol, 156(1), 161-171. Franchimont, D., Vermeire, S., El Housni, H., Pierik, M., Van Steen, K., Gustot, T., Quertinmont, E., Abramowicz, M., Van Gossum, A., Deviere, J. et Rutgeerts, P. (2004) Deficient host-bacteria interactions in inflammatory bowel disease? The toll-like receptor (TLR)-4 Asp299gly polymorphism is associated with Crohn's disease and ulcerative colitis. Gut, 53(7), 987-992. Frank, D. N., St Amand, A. L., Feldman, R. A., Boedeker, E. C, Harpaz, N. et Pace, N. R. (2007) Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc Natl Acad Sci USA, 104(34), 13780-13785. Fraser, J. D., Martinez, V., Straney, R. et Briggs, M. R. (1998) DNA binding and transcription activation specificity of hepatocyte nuclear factor 4. Nucleic Acids Res, 26(11), 2702-2707. 306 Fre, S., Huyghe, M., Mourikis, P., Robine, S., Louvard, D. et Artavanis-Tsakonas, S. (2005) Notch signals control the fate of immature progenitor cells in the intestine. Nature, 435(7044), 964-968. Fu, W. et Noll, M. (1997) The Pax2 homolog sparkling is required for development of cone and pigment cells in the Drosophila eye. Genes Dev, 11(16), 2066-2078. Fubara, E. S. et Freter, R. (1973) Protection against enteric bacterial infection by secretory IgA antibodies. J Immunol, 111(2), 395-403. Fukata, M., Michelsen, K. S., Eri, R., Thomas, L. S., Hu, B., Lukasek, K., Nast, C. C, Lechago, J., Xu, R., Naiki, Y., Soliman, A., Arditi, M. et Abreu, M. T. (2005) Toll-like receptor-4 is required for intestinal response to epithelial injury and limiting bacterial translocation in a murine model of acute colitis. Am J Physiol Gastrointest Liver Physiol, 288(5), G1055-1065. Fukata, M., Vamadevan, A. S. et Abreu, M. T. (2009) Toll-like receptors (TLRs) and Nod like receptors (NLRs) in inflammatory disorders. Semin Immunol, 21(4), 242-253. Fukushima, Y., Oshika, Y., Tokunaga, T., Hatanaka, H., Tomisawa, M., Kawai, K., Ozeki, Y., Tsuchida, T., Kijima, H., Yamazaki, H., Ueyama, Y., Tamaoki, N., Miura, S. et Nakamura, M. (1999) Multidrug resistance-associated protein (MRP) expression is correlated with expression of aberrant p53 protein in colorectal cancer. Eur J Cancer, 35(6), 935-938. Fulurija, A., Lutz, T. A., Sladko, K., Osto, M., Wielinga, P. Y., Bachmann, M. F. et Saudan, P. (2008) Vaccination against GIP for the treatment of obesity. PLoS ONE, 3(9), e3163. Furney, S. J., Higgins, D. G., Ouzounis, C. A. et Lopez-Bigas, N. (2006) Structural and functional properties of genes involved in human cancer. BMC genomics, 7, 3. Furuse, M., Fujimoto, K., Sato, N., Hirase, T., Tsukita, S. et Tsukita, S. (1996) Overexpression of occludin, a tight junction-associated integral membrane protein, induces the formation of intracellular multilamellar bodies bearing tight junction-like structures. J Cell Sci, 109 ( Pt 2), 429-435. Furuse, M., Furuse, K., Sasaki, H. et Tsukita, S. (2001) Conversion of zonulae occludentes from tight to leaky strand type by introducing claudin-2 into Madin-Darby canine kidney I cells. J Cell Biol, 153(2), 263-272. Ganjam, G. K., Dimova, E. Y., Unterman, T. G. et Kietzmann, T. (2009) FoxOl and HNF-4 are involved in regulation of hepatic glucokinase gene expression by resveratrol. J Biol Chem, 284(45), 30783-30797. Ganz, T. (2003) Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol, 3(9), 710-720. 307 Garrison, W. D., Battle, M. A., Yang, C, Kaestner, K. H., Sladek, F. M. et Duncan, S. A. (2006) Hepatocyte nuclear factor 4alpha is essential for embryonic development of the mouse colon. Gastroenterology, 130(4), 1207-1220. Gatenby, R. A. et Gillies, R. J. (2004) Why do cancers have high aerobic glycolysis? Nat Rev Cancer, 4(11), 891-899. Gatz, S. A. et Wiesmuller, L. (2006) p53 in recombination and repair. Cell death and differentiation, 13(6), 1003-1016. Geboes, K., Ectors, N. et Geboes, K. P. (2005) Pathology of early lower GI cancer. Best Pract Res Clin Gastroenterol, 19(6), 963-978. Ghoshal, S., Pasham, S., Odom, D. P., Furr, H. C. et McGrane, M. M. (2003) Vitamin A depletion is associated with low phosphoenolpyruvate carboxykinase mRNA levels during late fetal development and at birth in mice. The Journal of nutrition, 133(7), 2131-2136. Giannasca, P. J., Giannasca, K. T., Falk, P., Gordon, J. I. et Neutra, M. R. (1994) Regional differences in glycoconjugates of intestinal M cells in mice: potential targets for mucosal vaccines. Am J Physiol, 267(6 Pt 1), GI 108-1121. Gierl, M. S., Karoulias, N., Wende, H., Strehle, M. et Birchmeier, C. (2006) The zinc-finger factor Insml (IA-1) is essential for the development of pancreatic beta cells and intestinal endocrine cells. Genes Dev, 20(17), 2465-2478. Gillingham, A. K., Pfeifer, A. C. et Munro, S. (2002) CASP, the alternatively spliced product of the gene encoding the CCAAT-displacement protein transcription factor, is a Golgi membrane protein related to giantin. Mol Biol Cell, 13(11), 3761-3774. Gingras, H., Cases, O., Krasilnikova, M., Berube, G. et Nepveu, A. (2005) Biochemical characterization of the mammalian Cux2 protein. Gene, 344, 273-285. Gordon, J. I. (1989) Intestinal epithelial differentiation: new insights from chimeric and transgenic mice. J Cell Biol, 108(4), 1187-1194. Goulet, B., Watson, P., Poirier, M., Leduy, L., Berube, G., Meterissian, S., Jolicoeur, P. et Nepveu, A. (2002) Characterization of a tissue-specific CDP/Cux isoform, p75, activated in breast tumor cells. Cancer Res, 62(22), 6625-6633. Goulet, B., Baruch, A., Moon, N. S., Poirier, M, Sansregret, L. L., Erickson, A., Bogyo, M. et Nepveu, A. (2004) A cathepsin L isoform that is devoid of a signal peptide localizes to the nucleus in S phase and processes the CDP/Cux transcription factor. Mol Cell, 14(2), 207- 219. Goulet, B., Truscott, M. et Nepveu, A. (2006) A novel proteolytically processed CDP/Cux isoform of 90 kDa is generated by cathepsin L. Biol Chem, 387(9), 1285-1293. 308 Goulet, B., Markovic, Y., Leduy, L. et Nepveu, A. (2008) Proteolytic processing of cut homeobox 1 by neutrophil elastase in the MV4;11 myeloid leukemia cell line. Mol Cancer Res, 6(4), 644-653. Grand, R. J., Watkins, J. B. et Torti, F. M. (1976) Development of the human gastrointestinal tract. A review. Gastroenterology, 70(5 PT.l), 790-810. Grandjean, V., Vincent, S., Martin, L., Rassoulzadegan, M. et Cuzin, F. (1997) Antimicrobial protection of the mouse testis: synthesis of defensins of the cryptdin family. Biol Reprod, 57(5), 1115-1122. Grapin-Botton, A. et Melton, D. A. (2000) Endoderm development: from patterning to organogenesis. Trends Genet, 16(3), 124-130. Gray, M. W., Burger, G. et Lang, B. F. (1999) Mitochondrial evolution. Science, 283(5407), 1476-1481. Green, K. J. et Gaudry, C. A. (2000) Are desmosomes more than tethers for intermediate filaments? Nat Rev Mol Cell Biol, 1(3), 208-216. Green, V. J., Kokkotou, E. et Ladias, J. A. (1998) Critical structural elements and multitarget protein interactions of the transcriptional activator AF-1 of hepatocyte nuclear factor 4. J Biol Chem, 273(45), 29950-29957. Gregorieff, A., Pinto, D., Begthel, H., Destree, O., Kielman, M. et Clevers, H. (2005) Expression pattern of Wnt signaling components in the adult intestine. Gastroenterology, 129(2), 626-638. Gross, K. J. et Pothoulakis, C. (2007) Role of neuropeptides in inflammatory bowel disease. Inflamm Bowel Dis, 13(7), 918-932. Guo, H., Wei, J., Inoue, Y., Gonzalez, F. J. et Kuo, P. C. (2003) Serine/threonine phosphorylation regulates FTNF-4alpha-dependent redox-mediated iNOS expression in hepatocytes. Am J Physiol Cell Physiol, 284(4), CI 090-1099. Guo, H., Gao, C, Mi, Z., Wai, P. Y. et Kuo, P. C. (2006) Phosphorylation of Serl58 regulates inflammatory redox-dependent hepatocyte nuclear factor-4alpha transcriptional activity. Biochem J, 394(Pt 2), 379-387. Guo, H., Gao, C, Mi, Z., Zhang, J. et Kuo, P. C. (2007) Characterization of the PC4 binding domain and its interactions with HNF4alpha. Journal of biochemistry, 141(5), 635-640. Gupta, R. K., Vatamaniuk, M. Z., Lee, C. S., Flaschen, R. C, Fulmer, J. T., Matschinsky, F. M., Duncan, S. A. et Kaestner, K. H. (2005) The MODY1 gene HNF-4alpha regulates selected genes involved in insulin secretion. J Clin Invest, 115(4), 1006-1015. Gupta, R. K., Gao, N., Gorski, R. K., White, P., Hardy, O. T., Rafiq, K., Brestelli, J. E., Chen, G., Stoeckert, C. J., Jr. et Kaestner, K. H. (2007) Expansion of adult beta-cell mass in 309 response to increased metabolic demand is dependent on HNF-4alpha. Genes Dev, 21(7), 756-769. Gupta, S., Luong, M. X., Bleuming, S. A., Miele, A., Luong, M, Young, D., Knudsen, E. S., Van Wijnen, A. J., Stein, J. L. et Stein, G. S. (2003) Tumor suppressor pRB functions as a co-repressor of the CCAAT displacement protein (CDP/cut) to regulate cell cycle controlled histone H4 transcription. J Cell Physiol, 196(3), 541-556. Guttman, J. A., Li, Y., Wickham, M. E., Deng, W., Vogl, A. W. et Finlay, B. B. (2006) Attaching and effacing pathogen-induced tight junction disruption in vivo. Cell Microbiol, 8(4), 634-645. Gyde, S. N., Prior, P., Allan, R. N., Stevens, A., Jewell, D. P., Truelove, S. C., Lofberg, R., Brostrom, O. et Hellers, G. (1988) Colorectal cancer in ulcerative colitis: a cohort study of primary referrals from three centres. Gut, 29(2), 206-217. Hadzopoulou-Cladaras, M, Kistanova, E., Evagelopoulou, C, Zeng, S., Cladaras, C. et Ladias, J. A. (1997) Functional domains of the nuclear receptor hepatocyte nuclear factor 4. J Biol Chem, 272(1), 539-550. Haegebarth, A. et Clevers, H. (2009) Wnt signaling, lgr5, and stem cells in the intestine and skin. Am J Pathol, 174(3), 715-721. Haigis, K. M. et Dove, W. F. (2003) A Robertsonian translocation suppresses a somatic recombination pathway to loss of heterozygosity. Nat Genet, 33(1), 33-39. Haigis, K. M., Hoff, P. D., White, A., Shoemaker, A. R., Halberg, R. B. et Dove, W. F. (2004) Tumor regionality in the mouse intestine reflects the mechanism of loss of Ape function. Proc Natl Acad Sci USA, 101(26), 9769-9773. Half, E., Bercovich, D. et Rozen, P. (2009) Familial adenomatous polyposis. Orphanet journal of rare diseases, 4, 22. Han, S. et Chiang, J. Y. (2008) Mechanism of Vitamin D receptor inhibition of cholesterol 7 {alpha}-hydroxylase gene transcription in human hepatocytes. Drug metabolism and disposition: the biological fate of chemicals, 37(3), 469-478. Harada, R., Vadnais, C, Sansregret, L., Leduy, L., Berube, G., Robert, F. et Nepveu, A. (2008) Genome-wide location analysis and expression studies reveal a role for pi 10 CUX1 in the activation of DNA replication genes. Nucleic Acids Res, 36(1), 189-202. Haramis, A. P., Begthel, H., van den Born, M, van Es, J., Jonkheer, S., Offerhaus, G. J. et Clevers, H. (2004) De novo crypt formation and juvenile polyposis on BMP inhibition in mouse intestine. Science, 303(5664), 1684-1686. Hardwick, J. C, Kodach, L. L., Offerhaus, G. J. et van den Brink, G. R. (2008) Bone morphogenetic protein signalling in colorectal cancer. Nat Rev Cancer, 8(10), 806-812. 310 Harnish, D. C, Malik, S., Kilbourne, E., Costa, R. et Karathanasis, S. K. (1996) Control of apolipoprotein AI gene expression through synergistic interactions between hepatocyte nuclear factors 3 and 4. J Biol Chem, 271(23), 13621-13628. Harries, L. W., Locke, J. M., Shields, B., Hanley, N. A., Hanley, K. P., Steele, A., Njolstad, P. R., Ellard, S. et Hattersley, A. T. (2008) The diabetic phenotype in HNF4A mutation carriers is moderated by the expression of HNF4A isoforms from the PI promoter during fetal development. Diabetes, 57(6), 1745-1752. Harries, L. W., Brown, J. E. et Gloyn, A. L. (2009) Species-specific differences in the expression of the HNF1 A, HNF1B and HNF4A genes. PLoS ONE, 4(11), e7855. Harrington, L., Srikanth, C. V., Antony, R., Shi, H. N. et Cherayil, B. J. (2007) A role for natural killer cells in intestinal inflammation caused by infection with Salmonella enterica serovar Typhimurium. FEMS immunology and medical microbiology, 51(2), 372-380. Hatzis, P. et Talianidis, I. (2001) Regulatory mechanisms controlling human hepatocyte nuclear factor 4alpha gene expression. Mol Cell Biol, 21(21), 7320-7330. Hatzis, P., Kyrmizi, I. et Talianidis, I. (2006) Mitogen-activated protein kinase-mediated disruption of enhancer-promoter communication inhibits hepatocyte nuclear factor 4alpha expression. Mol Cell Biol, 26(19), 7017-7029. Haupt, Y., Maya, R., Kazaz, A. et Oren, M. (1997) Mdm2 promotes the rapid degradation of P53. Nature, 387(6630), 296-299. Hayashi, Y., Wang, W., Ninomiya, T., Nagano, H., Ohta, K. et Itoh, H. (1999) Liver enriched transcription factors and differentiation of hepatocellular carcinoma. Mol Pathol, 52(1), 19-24. Hayhurst, G. P., Lee, Y. H., Lambert, G., Ward, J. M. et Gonzalez, F. J. (2001) Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol, 21(4), 1393-1403. Hayhurst, G. P., Strick-Marchand, H., Mulet, C, Richard, A. F., Morosan, S., Kremsdorf, D. et Weiss, M. C. (2008) Morphogenetic competence of HNF4 alpha-deficient mouse hepatic cells. Journal ofhepatology, 49(3), 384-395. He, X. C, Zhang, J., Tong, W. G., Tawfik, O., Ross, J., Scoville, D. H., Tian, Q., Zeng, X., He, X., Wiedemann, L. M., Mishina, Y. et Li, L. (2004) BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-beta-catenin signaling. Nat Genet, 36(10), 1117-1121. He, X. C, Yin, T., Grindley, J. C, Tian, Q., Sato, T., Tao, W. A., Dirisina, R., Porter- Westpfahl, K. S., Hembree, M., Johnson, T., Wiedemann, L. M., Barrett, T. A., Hood, L., Wu, H. et Li, L. (2007) PTEN-deficient intestinal stem cells initiate intestinal polyposis. Nat Genet, 39(2), 189-198. 311 Hemminki, A., Markie, D., Tomlinson, I., Avizienyte, E., Roth, S., Loukola, A., Bignell, G., Warren, W., Aminoff, M., Hoglund, P., Jarvinen, H., Kristo, P., Pelin, K., Ridanpaa, M., Salovaara, R., Toro, T., Bodmer, W., Olschwang, S., Olsen, A. S., Stratton, M. R., de la Chapelle, A. et Aaltonen, L. A. (1998) A serine/threonine kinase gene defective in Peutz- Jeghers syndrome. Nature, 391(6663), 184-187. Hendry, J. H., Roberts, S. A. et Potten, C. S. (1992) The clonogen content of murine intestinal crypts: dependence on radiation dose used in its determination. Radiation research, 132(1), 115-119. Hermeking, H., Lengauer, C, Polyak, K., He, T. C, Zhang, L., Thiagalingam, S., Kinzler, K. W. et Vogelstein, B. (1997) 14-3-3 sigma is a p53-regulated inhibitor of G2/M progression. Mol Cell, 1(1), 3-11. Hermiston, M. L., Wong, M. H. et Gordon, J. I. (1996) Forced expression of E-cadherin in the mouse intestinal epithelium slows cell migration and provides evidence for nonautonomous regulation of cell fate in a self-renewing system. Genes Dev, 10(8), 985-996. Hertz, R., Magenheim, J., Berman, I. et Bar-Tana, J. (1998) Fatty acyl-CoA thioesters are ligands of hepatic nuclear factor-4alpha. Nature, 392(6675), 512-516. Hertz, R., Kalderon, B., Byk, T., Berman, I., Za'tara, G., Mayer, R. et Bar-Tana, J. (2005) Thioesterase activity and acyl-CoA/fatty acid cross-talk of hepatocyte nuclear factor- 4{alpha}. J Biol Chem, 280(26), 24451-24461. Hirota, K., Daitoku, H., Matsuzaki, H., Araya, N., Yamagata, K., Asada, S., Sugaya, T. et Fukamizu, A. (2003) Hepatocyte nuclear factor-4 is a novel downstream target of insulin via FKHR as a signal-regulated transcriptional inhibitor. J Biol Chem, 278(15), 13056-13060. Hirota, K., Aoyama, H. et Fukamizu, A. (2005) Mutation analysis of HNF-4 binding sites in the human glucose-6-phosphatase promoter. International journal of molecular medicine, 15(3), 487-490. Hirota, K., Sakamaki, J., Ishida, J., Shimamoto, Y., Nishihara, S., Kodama, N., Ohta, K., Yamamoto, M., Tanimoto, K. et Fukamizu, A. (2008) A combination of HNF-4 and Foxol is required for reciprocal transcriptional regulation of glucokinase and glucose-6-phosphatase genes in response to fasting and feeding. J Biol Chem, 283(47), 32432-32441. Ho, S. B., Ewing, S. L., Montgomery, C. K. et Kim, Y. S. (1996) Altered mucin core peptide immunoreactivity in the colon polyp-carcinoma sequence. Oncology research, 8(2), 53-61. Ho, S. B., Dvorak, L. A., Moor, R. E., Jacobson, A. C, Frey, M. R., Corredor, J., Polk, D. B. et Shekels, L. L. (2006) Cysteine-rich domains of muc3 intestinal mucin promote cell migration, inhibit apoptosis, and accelerate wound healing. Gastroenterology, 131(5), 1501- 1517. Hoffmann, E. K., Lambert, I. H. et Pedersen, S. F. (2009) Physiology of cell volume regulation in vertebrates. Physiol Rev, 89(1), 193-277. 312 Hoffmann, I., Draetta, G. et Karsenti, E. (1994) Activation of the phosphatase activity of human cdc25A by a cdk2-cyclin E dependent phosphorylation at the Gl/S transition. Embo J, 13(18), 4302-4310. Hofmann, T. G., Moller, A., Sirma, H., Zentgraf, H., Taya, Y., Droge, W., Will, H. et Schmitz, M. L. (2002) Regulation of p53 activity by its interaction with homeodomain- interacting protein kinase-2. Nature cell biology, 4(1), 1-10. Hollander, D. (1999) Intestinal permeability, leaky gut, and intestinal disorders. Curr Gastroenterol Rep, 1(5), 410-416. Hollstein, M. et Hainaut, P. (2010) Massively regulated genes: the example of TP53. The Journal of pathology, 220(2), 164-173. Holmberg, C. I., Tran, S. E., Eriksson, J. E. et Sistonen, L. (2002) Multisite phosphorylation provides sophisticated regulation of transcription factors. Trends Biochem Sci, 27(12), 619- 627. Holmes, J. L., Van Itallie, C. M., Rasmussen, J. E. et Anderson, J. M. (2006) Claudin profiling in the mouse during postnatal intestinal development and along the gastrointestinal tract reveals complex expression patterns. Gene Expr Patterns, 6(6), 581-588. Hoist, J. J. (2007) The physiology of glucagon-like peptide 1. Physiol Rev, 87(4), 1409-1439. Holthuis, J., Owen, T. A., van Wijnen, A. J., Wright, K. L., Ramsey-Ewing, A., Kennedy, M. B., Carter, R., Cosenza, S. C, Soprano, K. J., Lian, J. B. et et al. (1990) Tumor cells exhibit deregulation of the cell cycle histone gene promoter factor HiNF-D. Science, 247(4949 Pt 1), 1454-1457. Honda, K., Nakano, H., Yoshida, H., Nishikawa, S., Rennert, P., Ikuta, K., Tamechika, M., Yamaguchi, K., Fukumoto, T., Chiba, T. et Nishikawa, S. I. (2001) Molecular basis for hematopoietic/mesenchymal interaction during initiation of Peyer's patch organogenesis. J Exp Med, 193(5), 621-630. Honda, R., Tanaka, H. et Yasuda, H. (1997) Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53. FEBSLett, 420(1), 25-21. Hong, Y. H., Varanasi, U. S., Yang, W. et Leff, T. (2003) AMP-activated protein kinase regulates HNF4alpha transcriptional activity by inhibiting dimer formation and decreasing protein stability. J Biol Chem, 278(30), 27495-27501. Hooper, L. V., Midtvedt, T. et Gordon, J. I. (2002) How host-microbial interactions shape the nutrient environment of the mammalian intestine. Annual review of nutrition, 22, 283- 307. Howe, J. R., Roth, S., Ringold, J. C, Summers, R. W., Jarvinen, H. J., Sistonen, P., Tomlinson, I. P., Houlston, R. S., Bevan, S., Mitros, F. A., Stone, E. M. et Aaltonen, L. A. 313 (1998) Mutations in the SMAD4/DPC4 gene in juvenile polyposis. Science, 280(5366), 1086-1088. Howe, J. R., Bair, J. L., Sayed, M. G., Anderson, M. E., Mitros, F. A., Petersen, G. M., Velculescu, V. E., Traverso, G. et Vogelstein, B. (2001) Germline mutations of the gene encoding bone morphogenetic protein receptor 1A in juvenile polyposis. Nat Genet, 28(2), 184-187. Huang da, W., Sherman, B. T. et Lempicki, R. A. (2009) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature protocols, 4(1), 44-57. Huang, J., Karakucuk, V., Levitsky, L. L. et Rhoads, D. B. (2008) Expression of HNF4alpha variants in pancreatic islets and Ins-1 beta cells. Diabetes/metabolism research and reviews, 24(7), 533-543. Huang, J., Levitsky, L. L. et Rhoads, D. B. (2009) Novel P2 promoter-derived HNF4alpha isoforms with different N-terminus generated by alternate exon insertion. Exp Cell Res, 315(7), 1200-1211. Hunter, T. (2000) Signaling-2000 and beyond. Cell, 100(1), 113-127. Hurley, J. H., Dean, A. M., Sohl, J. L., Koshland, D. E., Jr. et Stroud, R. M. (1990) Regulation of an enzyme by phosphorylation at the active site. Science, 249(4972), 1012- 1016. Hwang-Verslues, W. W. et Sladek, F. M. (2008) Nuclear receptor hepatocyte nuclear factor 4alphal competes with oncoprotein c-Myc for control of the p21/WAFl promoter. Molecular endocrinology, 22(1), 78-90. Hwang, P. M., Bunz, F., Yu, J., Rago, C, Chan, T. A., Murphy, M. P., Kelso, G. F., Smith, R. A., Kinzler, K. W. et Vogelstein, B. (2001) Ferredoxin reductase affects p53-dependent, 5-fluorouracil-induced apoptosis in colorectal cancer cells. Nat Med, 7(10), 1111-1117. Ikenouchi, J., Furuse, M., Furuse, K., Sasaki, H., Tsukita, S. et Tsukita, S. (2005) Tricellulin constitutes a novel barrier at tricellular contacts of epithelial cells. J Cell Biol, 171(6), 939- 945. Inoue, Y., Hayhurst, G. P., Inoue, J., Mori, M. et Gonzalez, F. J. (2002) Defective ureagenesis in mice carrying a liver-specific disruption of hepatocyte nuclear factor 4alpha (HNF4alpha ). HNF4alpha regulates ornithine transcarbamylase in vivo. J Biol Chem, 277(28), 25257-25265. Inoue, Y., Yu, A. M., Inoue, J. et Gonzalez, F. J. (2004) Hepatocyte nuclear factor 4alpha is a central regulator of bile acid conjugation. J Biol Chem, 279(4), 2480-2489. Inoue, Y., Peters, L. L., Yim, S. H., Inoue, J. et Gonzalez, F. J. (2006) Role of hepatocyte nuclear factor 4alpha in control of blood coagulation factor gene expression. Journal of molecular medicine, 84(4), 334-344. 314 Inoue, Y., Yu, A. M., Yim, S. H., Ma, X., Krausz, K. W., Inoue, J., Xiang, C. C, Brownstein, M. J., Eggertsen, G., Bjorkhem, I. et Gonzalez, F. J. (2006) Regulation of bile acid biosynthesis by hepatocyte nuclear factor 4alpha. Journal of lipid research, 47(1), 215- 227. lordanidou, P., Aggelidou, E., Demetriades, C. et Hadzopoulou-Cladaras, M. (2005) Distinct amino acid residues may be involved in coactivator and ligand interactions in hepatocyte nuclear factor-4alpha. J Biol Chem, 280(23), 21810-21819. Ireland, H., Houghton, C, Howard, L. et Winton, D. J. (2005) Cellular inheritance of a Cre- activated reporter gene to determine Paneth cell longevity in the murine small intestine. Dev Dyn, 233(4), 1332-1336. Irvine, E. J. et Marshall, J. K. (2000) Increased intestinal permeability precedes the onset of Crohn's disease in a subject with familial risk. Gastroenterology, 119(6), 1740-1744. Isaacs, K. et Herfarth, H. (2008) Role of probiotic therapy in IBD. Inflamm Bowel Dis, 14(11), 1597-1605. Ishikawa, F., Nose, K. et Shibanuma, M. (2008) Downregulation of hepatocyte nuclear factor-4alpha and its role in regulation of gene expression by TGF-beta in mammary epithelial cells. Exp Cell Res, 314(10), 2131-2140. Itzkowitz, S. H. et Harpaz, N. (2004) Diagnosis and management of dysplasia in patients with inflammatory bowel diseases. Gastroenterology, 126(6), 1634-1648. Iwahashi, H., Yamagata, K., Yoshiuchi, I., Terasaki, J., Yang, Q., Fukui, K., Ihara, A., Zhu, Q., Asakura, T., Cao, Y., Imagawa, A., Namba, M., Hanafusa, T., Miyagawa, J. et Matsuzawa, Y. (2002) Thyroid hormone receptor interacting protein 3 (trip3) is a novel coactivator of hepatocyte nuclear factor-4alpha. Diabetes, 51(4), 910-914. Iwasaki, A. et Kelsall, B. L. (1999) Freshly isolated Peyer's patch, but not spleen, dendritic cells produce interleukin 10 and induce the differentiation of T helper type 2 cells. J Exp Med, 190(2), 229-239. Iwasaki, A. et Kelsall, B. L. (2001) Unique functions of CD 11 b+, CD8 alpha+, and double- negative Peyer's patch dendritic cells. J Immunol, 166(8), 4884-4890. Iwase, K., Evers, B. M., Heimlich, M. R., Kim, H. J., Higashide, S., Gully, D. et Townsend, C. M., Jr. (1996) Indirect inhibitory effect of a neurotensin receptor antagonist on human colon cancer (LoVo) growth. Surgical oncology, 5(5-6), 245-251. Jacquemin, P., Lannoy, V. J., Rousseau, G. G. et Lemaigre, F. P. (1999) OC-2, a novel mammalian member of the ONECUT class of homeodomain transcription factors whose function in liver partially overlaps with that of hepatocyte nuclear factor-6. J Biol Chem, 274(5), 2665-2671. 315 Jahan, A. et Chiang, J. Y. (2005) Cytokine regulation of human sterol 12alpha- hydroxylase (CYP8B1) gene. Am J Physiol Gastrointest Liver Physiol, 288(4), G685-695. Jallepalii, P. V. et Lengauer, C. (2001) Chromosome segregation and cancer: cutting through the mystery. Nat Rev Cancer, 1(2), 109-117. Jang, M. H., Kweon, M. N., Iwatani, K., Yamamoto, M., Terahara, K., Sasakawa, C, Suzuki, T., Nochi, T., Yokota, Y., Rennert, P. D., Hiroi, T., Tamagawa, H., Iijima, H., Kunisawa, J., Yuki, Y. et Kiyono, H. (2004) Intestinal villous M cells: an antigen entry site in the mucosal epithelium. Proc Natl Acad Sci USA, 101(16), 6110-6115. Janne, M. et Hammond, G. L. (1998) Hepatocyte nuclear factor-4 controls transcription from a TATA-less human sex hormone-binding globulin gene promoter. J Biol Chem, 273(51), 34105-34114. Janssens, S., Burns, K., Tschopp, J. et Beyaert, R. (2002) Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88. Curr Biol, 12(6), 467-471. Jarman, A. P. et Ahmed, I. (1998) The specificity of proneural genes in determining Drosophila sense organ identity. Mech Dev, 76(1-2), 117-125. Jemal, A., Siegel, R., Ward, E., Hao, Y., Xu, J., Murray, T. et Thun, M. J. (2008) Cancer statistics, 2008. CA: a cancer journal for clinicians, 58(2), 71-96. Jenny, M., Uhl, C, Roche, C, Duluc, I., Guillermin, V., Guillemot, F., Jensen, J., Kedinger, M. et Gradwohl, G. (2002) Neurogenin3 is differentially required for endocrine cell fate specification in the intestinal and gastric epithelium. Embo J, 21(23), 6338-6347. Jensen, J., Pedersen, E. E., Galante, P., Hald, J., Heller, R. S., Ishibashi, M., Kageyama, R., Guillemot, F., Serup, P. et Madsen, O. D. (2000) Control of endodermal endocrine development by Hes-1. Nat Genet, 24(1), 36-44. Jiang, G., Nepomuceno, L., Hopkins, K. et Sladek, F. M. (1995) Exclusive homodimerization of the orphan receptor hepatocyte nuclear factor 4 defines a new subclass of nuclear receptors. Mol Cell Biol, 15(9), 5131-5143. Jiang, G., Lee, U. et Sladek, F. M. (1997) Proposed mechanism for the stabilization of nuclear receptor DNA binding via protein dimerization. Mol Cell Biol, 17(11), 6546-6554. Jiang, N., Wang, X., Jhanwar-Uniyal, M., Darzynkiewicz, Z. et Dai, W. (2006) Polo box domain of Plk3 functions as a centrosome localization signal, overexpression of which causes mitotic arrest, cytokinesis defects, and apoptosis. J Biol Chem, 281(15), 10577-10582. Jiang, S., Tanaka, T., Iwanari, H., Hotta, H., Yamashita, H., Kumakura, J., Watanabe, Y., Uchiyama, Y., Aburatani, H., Hamakubo, T., Kodama, T. et Naito, M. (2003) Expression and localization of PI promoter-driven hepatocyte nuclear factor-4alpha (HNF4alpha) isoforms in human and rats. Nuclear receptor, 1(1), 5. 316 Jing, H., Yen, J. H. et Ganea, D. (2004) A novel signaling pathway mediates the inhibition of CCL3/4 expression by prostaglandin E2. J Biol Chem, 279(53), 55176-55186. Johnson, T. K. et Judd, B. H. (1979) Analysis of the cut locus of Drosophila melanogaster. Genetics, 92, 485-502. Jover, R., Bort, R., Gomez-Lechon, M. J. et Castell, J. V. (2001) Cytochrome P450 regulation by hepatocyte nuclear factor 4 in human hepatocytes: a study using adenovirus- mediated antisense targeting. Hepatology, 33(3), 668-675. Kaiser, K. et Meisterernst, M. (1996) The human general co-factors. Trends Biochem Sci, 21(9), 342-345. Kalkuhl, A., Kaestner, K., Buchmann, A. et Schwarz, M. (1996) Expression of hepatocyte- enriched nuclear transcription factors in mouse liver tumours. Carcinogenesis, 17(3), 609- 612. Kamiya, A. et Gonzalez, F. J. (2004) TNF-alpha regulates mouse fetal hepatic maturation induced by oncostatin M and extracellular matrices. Hepatology, 40(3), 527-536. Kamiyama, Y., Matsubara, T., Yoshinari, K., Nagata, K., Kamimura, H. et Yamazoe, Y. (2007) Role of human hepatocyte nuclear factor 4alpha in the expression of drug- metabolizing enzymes and transporters in human hepatocytes assessed by use of small interfering RNA. Drug metabolism and pharmacokinetics, 22(4), 287-298. Kanke, T., Macfarlane, S. R., Seatter, M. J., Davenport, E., Paul, A., McKenzie, R. C. et Plevin, R. (2001) Proteinase-activated receptor-2-mediated activation of stress-activated protein kinases and inhibitory kappa B kinases in NCTC 2544 keratinocytes. J Biol Chem, 276(34), 31657-31666. Kapitskaya, M. Z., Dittmer, N. T., Deitsch, K. W., Cho, W. L., Taylor, D. G., Leff, T. et Raikhel, A. S. (1998) Three isoforms of a hepatocyte nuclear factor-4 transcription factor with tissue- and stage-specific expression in the adult mosquito. J Biol Chem, 273(45), 29801-29810. Karamouzis, M. V., Gorgoulis, V. G. et Papavassiliou, A. G. (2002) Transcription factors and neoplasia: vistas in novel drug design. Clin Cancer Res, 8(5), 949-961. Karin, M. (1994) Signal transduction from the cell surface to the nucleus through the phosphorylation of transcription factors. Curr Opin Cell Biol, 6(3), 415-424. Karlsson, L., Lindahl, P., Heath, J. K. et Betsholtz, C. (2000) Abnormal gastrointestinal development in PDGF-A and PDGFR-(alpha) deficient mice implicates a novel mesenchymal structure with putative instructive properties in villus morphogenesis. Development, 127(16), 3457-3466. 317 Kato, M, Kephart, G. M, Talley, N. J., Wagner, J. M., Sarr, M. G., Bonno, M., McGovern, T. W. et Gleich, G. J. (1998) Eosinophil infiltration and degranulation in normal human tissue. Anat Rec, 252(3), 418-425. Kayahara, T., Sawada, M, Takaishi, S., Fukui, H., Seno, H., Fukuzawa, H., Suzuki, K., Hiai, H., Kageyama, R., Okano, H. et Chiba, T. (2003) Candidate markers for stem and early progenitor cells, Musashi-1 and Hesl, are expressed in crypt base columnar cells of mouse small intestine. FEBSLett, 535(1-3), 131-135. Keast, J. R., Furness, J. B. et Costa, M. (1987) Distribution of peptide-containing neurons and endocrine cells in the rabbit gastrointestinal tract, with particular reference to the mucosa. Cell Tissue Res, 248(3), 565-577. Kedinger, M., Simon-Assmann, P. M., Lacroix, B., Marxer, A., Hauri, H. P. et Haffen, K. (1986) Fetal gut mesenchyme induces differentiation of cultured intestinal endodermal and crypt cells. Dev Biol, 113(2), 474-483. Kedinger, V., Sansregret, L., Harada, R., Vadnais, C, Cadieux, C, Fathers, K., Park, M. et Nepveu, A. (2009) pi 10 CUXl homeodomain protein stimulates cell migration and invasion in part through a regulatory cascade culminating in the repression of E-cadherin and occludin. J Biol Chem, 284(40), 27701-27711. Kensler, T. W. et Wakabayashi, N. (2010) Nrf2: friend or foe for chemoprevention? Carcinogenesis, 31(1), 90-99. Keshav, S. (2006) Paneth cells: leukocyte-like mediators of innate immunity in the intestine. JLeukoc Biol, 80(3), 500-508. Khanna-Gupta, A., Zibello, T., Kolla, S., Neufeld, E. J. et Berliner, N. (1997) CCAAT displacement protein (CDP/cut) recognizes a silencer element within the lactoferrin gene promoter. Blood, 90(7), 2784-2795. Kiernan, R., Bres, V., Ng, R. W., Coudart, M. P., El Messaoudi, S., Sardet, C, Jin, D. Y., Emiliani, S. et Benkirane, M. (2003) Post-activation turn-off of NF-kappa B-dependent transcription is regulated by acetylation of p65. J Biol Chem, 278(4), 2758-2766. Kim, Y. D., Park, K. G., Lee, Y. S., Park, Y. Y., Kim, D. K., Nedumaran, B., Jang, W. G., Cho, W. J., Ha, J., Lee, I. K., Lee, C. H. et Choi, H. S. (2008) Metformin inhibits hepatic gluconeogenesis through AMP-activated protein kinase-dependent regulation of the orphan nuclear receptor SHP. Diabetes, 57(2), 306-314. Kinzler, K. W., Nilbert, M. C, Su, L. K., Vogelstein, B., Bryan, T. M., Levy, D. B., Smith, K. J., Preisinger, A. C, Hedge, P., McKechnie, D. et et al. (1991) Identification of FAP locus genes from chromosome 5q21. Science, 253(5020), 661-665. Kistanova, E., Dell, H., Tsantili, P., Falvey, E., Cladaras, C. et Hadzopoulou-Cladaras, M. (2001) The activation function-1 of hepatocyte nuclear factor-4 is an acidic activator that mediates interactions through bulky hydrophobic residues. Biochem J, 356(Pt 2), 635-642. 318 Knights, C. D., Catania, J., Di Giovanni, S., Muratoglu, S., Perez, R., Swartzbeck, A., Quong, A. A., Zhang, X., Beerman, T., Pestell, R. G. et Avantaggiati, M. L. (2006) Distinct p53 acetylation cassettes differentially influence gene-expression patterns and cell fate. J Cell Biol, 173(4), 533-544. Kobayashi, K., Hernandez, L. D., Galan, J. E., Janeway, C. A., Jr., Medzhitov, R. et Flavell, R. A. (2002) IRAK-M is a negative regulator of Toll-like receptor signaling. Cell, 110(2), 191-202. Kobayashi, K. S., Chamaillard, M, Ogura, Y., Henegariu, O., Inohara, N., Nunez, G. et Flavell, R. A. (2005) Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science, 307(5710), 731-734. Kojima, K., Kishimoto, T., Nagai, Y., Tanizawa, T., Nakatani, Y., Miyazaki, M. et Ishikura, H. (2006) The expression of hepatocyte nuclear factor-4alpha, a developmental regulator of visceral endoderm, correlates with the intestinal phenotype of gastric adenocarcinomas. Pathology, 38(6), 548-554. Kojima, M, Hosoda, H., Date, Y., Nakazato, M., Matsuo, H. et Kangawa, K. (1999) Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature, 402(6762), 656-660. Koloski, N. A., Bret, L. et Radford-Smith, G. (2008) Hygiene hypothesis in inflammatory bowel disease: a critical review of the literature. World J Gastroenterol, 14(2), 165-173. Konishi, M., Kikuchi-Yanoshita, R., Tanaka, K., Muraoka, M., Onda, A., Okumura, Y., Kishi, N., Iwama, T., Mori, T., Koike, M., Ushio, K., Chiba, M., Nomizu, S., Konishi, F., Utsunomiya, J. et Miyaki, M. (1996) Molecular nature of colon tumors in hereditary nonpolyposis colon cancer, familial polyposis, and sporadic colon cancer. Gastroenterology, 111(2), 307-317. Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler, K. W., Vogelstein, B. et Clevers, H. (1997) Constitutive transcriptional activation by a beta-catenin- Tcf complex in APC-/- colon carcinoma. Science, 275(5307), 1784-1787. Korinek, V., Barker, N., Moerer, P., van Donselaar, E., Huls, G., Peters, P. J. et Clevers, H. (1998) Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4. Nat Genet, 19(4), 379-383. Kraal, G. et Mebius, R. E. (1997) High endothelial venules: lymphocyte traffic control and controlled traffic. Adv Immunol, 65, 347-395. Kraehenbuhl, J. P. et Neutra, M. R. (2000) Epithelial M cells: differentiation and function. Annu Rev Cell Dev Biol, 16, 301-332. Krajewski, J., Batmunkh, C, Jelkmann, W. et Hellwig-Burgel, T. (2007) Interleukin-lbeta inhibits the hypoxic inducibility of the erythropoietin enhancer by suppressing hepatocyte nuclear factor-4alpha. Cell Mol Life Sci, 64(7-8), 989-998. 319 Kritis, A. A., Argyrokastritis, A., Moschonas, N. K., Power, S., Katrakili, N., Zannis, V. I., Cereghini, S. et Talianidis, I. (1996) Isolation and characterization of a third isoform of human hepatocyte nuclear factor 4. Gene, 173(2), 275-280. Ktistaki, E., Ktistakis, N. T., Papadogeorgaki, E. et Talianidis, I. (1995) Recruitment of hepatocyte nuclear factor 4 into specific intranuclear compartments depends on tyrosine phosphorylation that affects its DNA-binding and transactivation potential. Proc Natl Acad Sci USA, 92(21), 9876-9880. Kucharzik, T., Walsh, S. V., Chen, J., Parkos, C. A. et Nusrat, A. (2001) Neutrophil transmigration in inflammatory bowel disease is associated with differential expression of epithelial intercellular junction proteins. Am J Pathol, 159(6), 2001-2009. Kufe, D. W. (2009) Mucins in cancer: function, prognosis and therapy. Nat Rev Cancer, 9(12), 874-885. Kunzelmann, K. et Mall, M. (2002) Electrolyte transport in the mammalian colon: mechanisms and implications for disease. Physiol Rev, 82(1), 245-289. Kurokowa, M., Lynch, K. et Podolsky, D. K. (1987) Effects of growth factors on an intestinal epithelial cell line: transforming growth factor beta inhibits proliferation and stimulates differentiation. Biochem Biophys Res Commun, 142(3), 775-782. Kurpios, N. A., Ibanes, M., Davis, N. M., Lui, W., Katz, T., Martin, J. F., Izpisua Belmonte, J. C. et Tabin, C. J. (2008) The direction of gut looping is established by changes in the extracellular matrix and in celhcell adhesion. Proc Natl Acad Sci USA, 105(25), 8499-8506. Laboisse, C, Jarry, A., Branka, J. E., Merlin, D., Bou-Hanna, C. et Vallette, G. (1995) Regulation of mucin exocytosis from intestinal goblet cells. Biochem Soc Trans, 23(4), 810- 813. Laboisse, C, Jarry, A., Branka, J. E., Merlin, D., Bou-Hanna, C. et Vallette, G. (1996) Recent aspects of the regulation of intestinal mucus secretion. Proc Nutr Soc, 55(1 B), 259- 264. Lahuna, O., Rastegar, M., Maiter, D., Thissen, J. P., Lemaigre, F. P. et Rousseau, G. G. (2000) Involvement of STAT5 (signal transducer and activator of transcription 5) and FfNF-4 (hepatocyte nuclear factor 4) in the transcriptional control of the hnf6 gene by growth hormone. Molecular endocrinology, 14(2), 285-294. Lai-Nag, M. et Morin, P. J. (2009) The claudins. Genome biology, 10(8), 235. Lamhonwah, A. M. et Tein, I. (2006) Novel localization of OCTN1, an organic cation/carnitine transporter, to mammalian mitochondria. Biochem Biophys Res Commun, 345(4), 1315-1325. 320 Lamlum, H., Papadopoulou, A., Ilyas, M, Rowan, A., Gillet, C, Hanby, A., Talbot, I., Bodmer, W. et Tomlinson, I. (2000) APC mutations are sufficient for the growth of early colorectal adenomas. Proc Natl Acad Sci USA, 97(5), 2225-2228. Lampinen, M., Ronnblom, A., Amin, K., Kristjansson, G., Rorsman, F., Sangfelt, P., Safsten, B., Wagner, M., Wanders, A., Winqvist, O. et Carlson, M. (2005) Eosinophil granulocytes are activated during the remission phase of ulcerative colitis. Gut, 54(12), 1714-1720. Landry, C, Clotman, F., Hioki, T., Oda, H., Picard, J. J., Lemaigre, F. P. et Rousseau, G. G. (1997) FfNF-6 is expressed in endoderm derivatives and nervous system of the mouse embryo and participates to the cross-regulatory network of liver-enriched transcription factors. Dev Biol, 192(2), 247-257. Lang, G. A., Iwakuma, T., Suh, Y. A., Liu, G., Rao, V. A., Parant, J. M, Valentin-Vega, Y. A., Terzian, T., Caldwell, L. C, Strong, L. C, El-Naggar, A. K. et Lozano, G. (2004) Gain of function of a p53 hot spot mutation in a mouse model of Li-Fraumeni syndrome. Cell, 119(6), 861-872. Larsson, L. I., St-Onge, L., Hougaard, D. M., Sosa-Pineda, B. et Gruss, P. (1998) Pax 4 and 6 regulate gastrointestinal endocrine cell development. Mech Dev, 79(1-2), 153-159. Laubitz, D., Larmonier, C. B., Bai, A., Midura-Kiela, M. T., Lipko, M. A., Thurston, R. D., Kiela, P. R. et Ghishan, F. K. (2008) Colonic gene expression profile in NHE3-deficient mice: evidence for spontaneous distal colitis. Am J Physiol Gastrointest Liver Physiol, 295(1), G63-G77. Lawrence, P. A. et Struhl, G. (1996) Morphogens, compartments, and pattern: lessons from drosophila? Cell, 85(7), 951-961. Lawson, K. A., Meneses, J. J. et Pedersen, R. A. (1986) Cell fate and cell lineage in the endoderm of the presomite mouse embryo, studied with an intracellular tracer. Dev Biol, 115(2), 325-339. Lawson, K. A. et Pedersen, R. A. (1987) Cell fate, morphogenetic movement and population kinetics of embryonic endoderm at the time of germ layer formation in the mouse. Development, 101(3), 627-652. Lawson, N. D., Khanna-Gupta, A. et Berliner, N. (1998) Isolation and characterization of the cDNA for mouse neutrophil collagenase: demonstration of shared negative regulatory pathways for neutrophil secondary granule protein gene expression. Blood, 91(7), 2517- 2524. Lazarevich, N. L., Cheremnova, O. A., Varga, E. V., Ovchinnikov, D. A., Kudrjavtseva, E. I., Morozova, O. V., Fleishman, D. I., Engelhardt, N. V. et Duncan, S. A. (2004) Progression of HCC in mice is associated with a downregulation in the expression of hepatocyte nuclear factors. Hepatology, 39(4), 1038-1047. 321 Lazarevich, N. L. et Fleishman, D. I. (2008) Tissue-specific transcription factors in progression of epithelial tumors. Biochemistry, 73(5), 573-591. Le Guevel, R., Oger, F., Lecorgne, A., Dudasova, Z., Chevance, S., Bondon, A., Barath, P., Simonneaux, G. et Salbert, G. (2009) Identification of small molecule regulators of the nuclear receptor HNF4alpha based on naphthofuran scaffolds. Bioorganic & medicinal chemistry, 17(19), 7021-7030. Leclerc, I., Lenzner, C, Gourdon, L., Vaulont, S., Kahn, A. et Viollet, B. (2001) Hepatocyte nuclear factor-4alpha involved in type 1 maturity-onset diabetes of the young is a novel target of AMP-activated protein kinase. Diabetes, 50(7), 1515-1521. Lee, C. S., Sund, N. J., Behr, R., Herrera, P. L. et Kaestner, K. H. (2005) Foxa2 is required for the differentiation of pancreatic alpha-cells. Dev Biol, 278(2), 484-495. Leedham, S. J., Schier, S., Thliveris, A. T., Halberg, R. B., Newton, M. A. et Wright, N. A. (2005) From gene mutations to tumours—stem cells in gastrointestinal carcinogenesis. Cell proliferation, 38(6), 387-405. Lefrancois, L., Olson, S. et Masopust, D. (1999) A critical role for CD40-CD40 ligand interactions in amplification of the mucosal CD8 T cell response. J Exp Med, 190(9), 1275- 1284. Lemaigre, F. et Zaret, K. S. (2004) Liver development update: new embryo models, cell lineage control, and morphogenesis. Curr Opin Genet Dev, 14(5), 582-590. Lenaz, G., Bovina, C., D'Aurelio, M., Fato, R., Formiggini, G., Genova, M. L., Giuliano, G., Merlo Pich, M., Paolucci, U., Parenti Castelli, G. et Ventura, B. (2002) Role of mitochondria in oxidative stress and aging. Ann N YAcadSci, 959, 199-213. Levine, M. et Tjian, R. (2003) Transcription regulation and animal diversity. Nature, 424(6945), 147-151. Levinson-Dushnik, M. et Benvenisty, N. (1997) Involvement of hepatocyte nuclear factor 3 in endoderm differentiation of embryonic stem cells. Mol Cell Biol, 17(7), 3817-3822. Li, J., Ning, G. et Duncan, S. A. (2000) Mammalian hepatocyte differentiation requires the transcription factor HNF-4alpha. Genes Dev, 14(4), 464-474. Li, K., Zhang, H., Wang, Y., Wang, Y. et Feng, M. (2006) Differential expression of FfNF4alpha isoforms in liver stem cells and hepatocytes. J Cell Biochem, 99(2), 558-564. Li, M. O., Wan, Y. Y. et Flavell, R. A. (2007) T cell-produced transforming growth factor- beta 1 controls T cell tolerance and regulates Thl- and Thl7-cell differentiation. Immunity, 26(5), 579-591. Li, S., Moy, L., Pittman, N., Shue, G., Aufiero, B., Neufeld, E. J., LeLeiko, N. S. et Walsh, M. J. (1999) Transcriptional repression of the cystic fibrosis transmembrane conductance 322 regulator gene, mediated by CCAAT displacement protein/cut homolog, is associated with histone deacetylation. J Biol Chem, 274(12), 7803-7815. Li, S., Aufiero, B., Schiltz, R. L. et Walsh, M. J. (2000) Regulation of the homeodomain CCAAT displacement/cut protein function by histone acetyltransferases p300/CREB-binding protein (CBP)-associated factor and CBP. Proc Natl Acad Sci USA, 97(13), 7166-7171. Li, T. et Chiang, J. Y. (2007) A novel role of transforming growth factor betal in transcriptional repression of human cholesterol 7alpha-hydroxylase gene. Gastroenterology, 133(5), 1660-1669. Li, T. S. et Marban, E. (2010) Physiological Levels of Reactive Oxygen Species are Required to Maintain Genomic Stability in Stem Cells. Stem cells, Epub. Li, X., Salisbury-Rowswell, J., Murdock, A. D., Forse, R. A. et Burke, P. A. (2002) Hepatocyte nuclear factor 4 response to injury involves a rapid decrease in DNA binding and transactivation via a JAK2 signal transduction pathway. Biochem J, 368(Pt 1), 203-211. Lichtenstein, P., Holm, N. V., Verkasalo, P. K., Iliadou, A., Kaprio, J., Koskenvuo, M., Pukkala, E., Skytthe, A. et Hemminki, K. (2000) Environmental and heritable factors in the causation of cancer—analyses of cohorts of twins from Sweden, Denmark, and Finland. N EnglJMed, 343(2), 78-85. Lievens, P. M., Donady, J. J., Tufarelli, C. et Neufeld, E. J. (1995) Repressor activity of CCAAT displacement protein in HL-60 myeloid leukemia cells. J Biol Chem, 270(21), 12745-12750. Lievens, P. M., Tufarelli, C, Donady, J. J., Stagg, A. et Neufeld, E. J. (1997) CASP, a novel, highly conserved alternative-splicing product of the CDP/cut/cux gene, lacks cut-repeat and homeo DNA-binding domains, and interacts with full-length CDP in vitro. Gene, 197(1-2), 73-81. Liu, S. et Jack, J. (1992) Regulatory interactions and role in cell type specification of the Malpighian tubules by the cut, Kruppel, and caudal genes of Drosophila. Dev Biol, 150(1), 133-143. Lomax, A. E., Linden, D. R., Mawe, G. M. et Sharkey, K. A. (2006) Effects of gastrointestinal inflammation on enteroendocrine cells and enteric neural reflex circuits. Auton Neurosci, 126-127, 250-257. Lopez-Diaz, L., Jain, R. N., Keeley, T. M., VanDussen, K. L., Brunkan, C. S., Gumucio, D. L. et Samuelson, L. C. (2007) Intestinal Neurogenin 3 directs differentiation of a bipotential secretory progenitor to endocrine cell rather than goblet cell fate. Dev Biol, 309(2), 298-305. Lough, J. et Sugi, Y. (2000) Endoderm and heart development. Dev Dyn, 217(4), 327-342. Love-Gregory, L. et Permutt, M. A. (2007) HNF4A genetic variants: role in diabetes. Current opinion in clinical nutrition and metabolic care, 10(4), 397-402. 323 Lu, P., Liu, J., Melikishvili, M., Fried, M. G. et Chi, Y. I. (2008) Crystallization of hepatocyte nuclear factor 4 alpha (FTNF4 alpha) in complex with the FINF1 alpha promoter element. Acta crystallographica, 64(Pt 4), 313-317. Lucas, B., Grigo, K., Erdmann, S., Lausen, J., Klein-Hitpass, L. et Ryffel, G. U. (2005) FfNF4alpha reduces proliferation of kidney cells and affects genes deregulated in renal cell carcinoma. Oncogene, 24(42), 6418-6431. Lucas Sd, S., Lopez-Alcorocho, J. M., Bartolome, J. et Carreno, V. (2004) Nitric oxide and TGF-betal inhibit FfNF-4alpha function in HEPG2 cells. Biochem Biophys Res Commun, 321(3), 688-694. Luo, W. et Skalnik, D. G. (1996) CCAAT displacement protein competes with multiple transcriptional activators for binding to four sites in the proximal gp91phox promoter. J Biol Chem, 271(30), 18203-18210. Lussier, C. R., Babeu, J. P., Auclair, B. A., Perreault, N. et Boudreau, F. (2008) Hepatocyte nuclear factor-4alpha promotes differentiation of intestinal epithelial cells in a coculture system. Am J Physiol Gastrointest Liver Physiol, 294(2), G418-428. Macleod, K. F., Sherry, N., Harmon, G., Beach, D., Tokino, T., Kinzler, K., Vogelstein, B. et Jacks, T. (1995) p53-dependent and independent expression of p21 during cell growth, differentiation, and DNA damage. Genes Dev, 9(8), 935-944. Madara, J. L., Nash, S., Moore, R. et Atisook, K. (1990) Structure and function of the intestinal epithelial barrier in health and disease. Monogr Pathol, (31), 306-324. Madison, B. B., Dunbar, L., Qiao, X. T., Braunstein, K., Braunstein, E. et Gumucio, D. L. (2002) Cis elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. J Biol Chem, 277(36), 33275-33283. Madison, B. B., Braunstein, K., Kuizon, E., Portman, K., Qiao, X. T. et Gumucio, D. L. (2005) Epithelial hedgehog signals pattern the intestinal crypt-villus axis. Development, 132(2), 279-289. Maeda, H. et Akaike, T. (1998) Nitric oxide and oxygen radicals in infection, inflammation, and cancer. Biochemistry, 63(7), 854-865. Maeda, S., Hsu, L. C, Liu, H., Bankston, L. A., Iimura, M., Kagnoff, M. F., Eckmann, L. et Karirj, M. (2005) Nod2 mutation in Crohn's disease potentiates NF-kappaB activity and IL- lbeta processing. Science, 307(5710), 734-738. Maeda, Y., Rachez, C, Hawel, L., 3rd, Byus, C. V., Freedman, L. P. et Sladek, F. M. (2002) Polyamines modulate the interaction between nuclear receptors and vitamin D receptor- interacting protein 205. Molecular endocrinology, 16(7), 1502-1510. 324 Maeda, Y., Seidel, S. D., Wei, G., Liu, X. et Sladek, F. M. (2002) Repression of hepatocyte nuclear factor 4alpha tumor suppressor p53: involvement of the ligand-binding domain and histone deacetylase activity. Molecular endocrinology, 16(2), 402-410. Maeda, Y., Hwang-Verslues, W. W., Wei, G., Fukazawa, T., Durbin, M. L., Owen, L. B., Liu, X. et Sladek, F. M. (2006) Tumour suppressor p53 down-regulates the expression of the human hepatocyte nuclear factor 4alpha (HNF4alpha) gene. Biochem J, 400(2), 303-313. Maeno, E., Ishizaki, Y., Kanaseki, T., Hazama, A. et Okada, Y. (2000) Normotonic cell shrinkage because of disordered volume regulation is an early prerequisite to apoptosis. Proc Natl Acad Sci USA, 97(17), 9487-9492. Magee, T. R., Cai, Y., El-Houseini, M. E., Locker, J. et Wan, Y. J. (1998) Retinoic acid mediates down-regulation of the alpha-fetoprotein gene through decreased expression of hepatocyte nuclear factors. J Biol Chem, 273(45), 30024-30032. Magenheim, J., Hertz, R., Berman, I., Nousbeck, J. et Bar-Tana, J. (2005) Negative autoregulation of HNF-4alpha gene expression by HNF-4alphal. Biochem J, 388(Pt 1), 325- 332. Mailly, F., Berube, G., Harada, R., Mao, P. L., Phillips, S. et Nepveu, A. (1996) The human cut homeodomain protein can repress gene expression by two distinct mechanisms: active repression and competition for binding site occupancy. Mol Cell Biol, 16(10), 5346-5357. Maitra, U., Seo, J., Lozano, M. M. et Dudley, J. P. (2006) Differentiation-induced cleavage of Cutll/CDP generates a novel dominant-negative isoform that regulates mammary gene expression. Mol Cell Biol, 26(20), 7466-7478. Malik, S. et Karathanasis, S. K. (1996) TFIIB-directed transcriptional activation by the orphan nuclear receptor hepatocyte nuclear factor 4. Mol Cell Biol, 16(4), 1824-1831. Malik, S., Wallberg, A. E., Kang, Y. K. et Roeder, R. G. (2002) TRAP/SMCC/mediator- dependent transcriptional activation from DNA and chromatin templates by orphan nuclear receptor hepatocyte nuclear factor 4. Mol Cell Biol, 22(15), 5626-5637. Mannervik, M., Nibu, Y., Zhang, H. et Levine, M. (1999) Transcriptional coregulators in development. Science, 284(5414), 606-609. Marmorstein, R. (2001) Protein modules that manipulate histone tails for chromatin regulation. Nat Rev Mol Cell Biol, 2(6), 422-432. Marsh, D. J., Dahia, P. L., Coulon, V., Zheng, Z., Dorion-Bonnet, F., Call, K. M., Little, R., Lin, A. Y., Eeles, R. A., Goldstein, A. M., Hodgson, S. V., Richardson, A. L., Robinson, B. G., Weber, H. C, Longy, M. et Eng, C. (1998) Allelic imbalance, including deletion of PTEN/MMACI, at the Cowden disease locus on 10q22-23, in hamartomas from patients with Cowden syndrome and germline PTEN mutation. Genes, chromosomes & cancer, 21(1), 61- 69. 325 Marsh, M. N. et Cummins, A. G. (1993) The interactive role of mucosal T lymphocytes in intestinal growth, development and enteropathy. J Gastroenterol Hepatol, 8(3), 270-278. Martin-Padura, I., Lostaglio, S., Schneemann, M., Williams, L., Romano, M., Fruscella, P., Panzeri, C, Stoppacciaro, A., Ruco, L., Villa, A., Simmons, D. et Dejana, E. (1998) Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration. J Cell Biol, 142(1), 117-127. Martin-Soudant, N., Drachman, J. G., Kaushansky, K. et Nepveu, A. (2000) CDP/Cut DNA binding activity is down-modulated in granulocytes, macrophages and erythrocytes but remains elevated in differentiating megakaryocytes. Leukemia, 14(5), 863-873. Martinez-Jimenez, C. P., Kyrmizi, I., Cardot, P., Gonzalez, F. J. et Talianidis, I. (2010) Hepatocyte nuclear factor 4alpha coordinates a transcription factor network regulating hepatic fatty acid metabolism. Mol Cell Biol, 30(3), 565-577. Martinez, E. (2002) Multi-protein complexes in eukaryotic gene transcription. Plant molecular biology, 50(6), 925-947. Martinon, F., Mayor, A. et Tschopp, J. (2009) The inflammasomes: guardians of the body. Annu Rev Immunol, 27, 229-265. Massague, J. (2000) How cells read TGF-beta signals. Nat Rev Mol Cell Biol, 1(3), 169-178. Mazure, N. M., Nguyen, T. L. et Danan, J. L. (2001) Severe hypoxia specifically downregulates hepatocyte nuclear factor-4 gene expression in HepG2 human hepatoma cells. Tumour Biol, 22(5), 310-317. McCart, A. E., Vickaryous, N. K. et Silver, A. (2008) Ape mice: models, modifiers and mutants. Pathology, research and practice, 204(7), 479-490. Michl, P., Ramjaun, A. R., Pardo, O. E., Warne, P. H., Wagner, M., Poulsom, R., D'Arrigo, C., Ryder, K., Menke, A., Gress, T. et Downward, J. (2005) CUTL1 is a target of TGF(beta) signaling that enhances cancer cell motility and invasiveness. Cancer Cell, 7(6), 521-532. Michl, P. et Downward, J. (2006) CUTL1: a key mediator of TGFbeta-induced tumor invasion. Cell Cycle, 5(2), 132-134. Michl, P., Knobel, B. et Downward, J. (2006) CUTL1 is phosphorylated by protein kinase A, modulating its effects on cell proliferation and motility. J Biol Chem, 281(22), 15138-15144. Miyawaki, K., Yamada, Y., Yano, H., Niwa, H., Ban, N., Ihara, Y., Kubota, A., Fujimoto, S., Kajikawa, M., Kuroe, A., Tsuda, K., Hashimoto, H., Yamashita, T., Jomori, T., Tashiro, F., Miyazaki, J. et Seino, Y. (1999) Glucose intolerance caused by a defect in the entero-insular axis: a study in gastric inhibitory polypeptide receptor knockout mice. Proc Natl Acad Sci U SA, 96(26), 14843-14847. 326 Monteleone, G., Kumberova, A., Croft, N. M., McKenzie, C, Steer, H. W. et MacDonald, T. T. (2001) Blocking Smad7 restores TGF-betal signaling in chronic inflammatory bowel disease. J Clin Invest, 108(4), 601-609. Montgomery, R. K. et Shivdasani, R. A. (2009) Promininl (CD 133) as an intestinal stem cell marker: promise and nuance. Gastroenterology, 136(7), 2051-2054. Moolgavkar, S. H. et Luebeck, E. G. (2003) Multistage carcinogenesis and the incidence of human cancer. Genes, chromosomes & cancer, 38(4), 302-306. Moon, N. S., Berube, G. et Nepveu, A. (2000) CCAAT displacement activity involves CUT repeats 1 and 2, not the CUT homeodomain. J Biol Chem, 275(40), 31325-31334. Moon, N. S., Premdas, P., Truscott, M., Leduy, L., Berube, G. et Nepveu, A. (2001) S phase- specific proteolytic cleavage is required to activate stable DNA binding by the CDP/Cut homeodomain protein. Mol Cell Biol, 21(18), 6332-6345. Moran, A. P. (1996) The role of lipopolysaccharide in Helicobacter pylori pathogenesis. Aliment Pharmacol Ther, 10 Suppl 1, 39-50. Moreno-Sanchez, R., Rodriguez-Enriquez, S., Marin-Hernandez, A. et Saavedra, E. (2007) Energy metabolism in tumor cells. The FEBS journal, 274(6), 1393-1418. Moretta, L., Bottino, C, Pende, D., Mingari, M. C, Biassoni, R. et Moretta, A. (2002) Human natural killer cells: their origin, receptors and function. Eur J Immunol, 32(5), 1205- 1211. Mori-Akiyama, Y., van den Born, M., van Es, J. H., Hamilton, S. R., Adams, H. P., Zhang, J., Clevers, H. et de Crombrugghe, B. (2007) SOX9 is required for the differentiation of paneth cells in the intestinal epithelium. Gastroenterology, 133(2), 539-546. Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B. et Kinzler, K. W. (1997) Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta- catenin or APC. Science, 275(5307), 1787-1790. Morrisey, E. E., Tang, Z., Sigrist, K., Lu, M. M., Jiang, F., Ip, H. S. et Parmacek, M. S. (1998) GATA6 regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo. Genes Dev, 12(22), 3579-3590. Morrison, S. J. et Spradling, A. C. (2008) Stem cells and niches: mechanisms that promote stem cell maintenance throughout life. Cell, 132(4), 598-611. Mortensen, K., Christensen, L. L., Hoist, J. J. et Orskov, C. (2003) GLP-1 and GIP are colocalized in a subset of endocrine cells in the small intestine. Regulatory peptides, 114(2- 3), 189-196. Moser, A. R., Pitot, H. C. et Dove, W. F. (1990) A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science, 247(4940), 322-324. 327 Moser, A. R., Dove, W. F., Roth, K. A. et Gordon, J. I. (1992) The Min (multiple intestinal neoplasia) mutation: its effect on gut epithelial cell differentiation and interaction with a modifier system. J Cell Biol, 116(6), 1517-1526. Mowat, A. M. (2003) Anatomical basis of tolerance and immunity to intestinal antigens. Nat Rev Immunol, 3(4), 331-341. Nakazato, M., Murakami, N., Date, Y., Kojima, M., Matsuo, H., Kangawa, K. et Matsukura, S. (2001) A role for ghrelin in the central regulation of feeding. Nature, 409(6817), 194-198. Nascimbeni, R., Di Fabio, F., Di Betta, E., Mariani, P., Fisogni, S. et Villanacci, V. (2005) Morphology of colorectal lymphoid aggregates in cancer, diverticular and inflammatory bowel diseases. Mod Pathol, 18(5), 681-685. Nauck, M. A., Homberger, E., Siegel, E. G., Allen, R. C, Eaton, R. P., Ebert, R. et Creutzfeldt, W. (1986) Incretin effects of increasing glucose loads in man calculated from venous insulin and C-peptide responses. The Journal of clinical endocrinology and metabolism, 63(2), 492-498. Naya, F. J., Huang, H. P., Qiu, Y., Mutoh, H., DeMayo, F. J., Leiter, A. B. et Tsai, M. J. (1997) Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev, 11(18), 2323-2334. Nedumaran, B., Hong, S., Xie, Y. B., Kim, Y. H., Seo, W. Y., Lee, M. W., Lee, C. H., Koo, S. H. et Choi, H. S. (2009) DAX-1 acts as a novel corepressor of orphan nuclear receptor HNF4alpha and negatively regulates gluconeogenic enzyme gene expression. J Biol Chem, 284(40), 27511-27523. Neish, A. S. (2009) Microbes in gastrointestinal health and disease. Gastroenterology, 136(1), 65-80 Nenci, A., Becker, C, Wullaert, A., Gareus, R., van Loo, G., Danese, S., Huth, M., Nikolaev, A., Neufert, C, Madison, B., Gumucio, D., Neurath, M. F. et Pasparakis, M. (2007) Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature, 446(7135), 557-561. Nepveu, A. (2001) Role of the multifunctional CDP/Cut/Cux homeodomain transcription factor in regulating differentiation, cell growth and development. Gene, 270(1-2), 1-15. Neufeld, E. J., Skalnik, D. G., Lievens, P. M. et Orkin, S. H. (1992) Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut. Nat Genet, 1(1), 50-55. Ng, A. Y., Waring, P., Ristevski, S., Wang, C, Wilson, T., Pritchard, M., Hertzog, P. et Kola, I. (2002) Inactivation of the transcription factor Elf3 in mice results in dysmorphogenesis and altered differentiation of intestinal epithelium. Gastroenterology, 122(5), 1455-1466. 328 Ni, J., Chen, S. F. et Hollander, D. (1996) Effects of dextran sulphate sodium on intestinal epithelial cells and intestinal lymphocytes. Gut, 39(2), 234-241. Nieto, M. A. (2002) The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol, 3(3), 155-166. Nikolaidou-Neokosmidou, V., Zannis, V. I. et Kardassis, D. (2006) Inhibition of hepatocyte nuclear factor 4 transcriptional activity by the nuclear factor kappaB pathway. Biochem J, 398(3), 439-450. Nirodi, C, Hart, J., Dhawan, P., Moon, N. S., Nepveu, A. et Richmond, A. (2001) The role of CDP in the negative regulation of CXCL1 gene expression. J Biol Chem, 276(28), 26122- 26131. Nishio, H. et Walsh, M. J. (2004) CCAAT displacement protein/cut homolog recruits G9a histone lysine methyltransferase to repress transcription. Proc Natl Acad Sci USA, 101(31), 11257-11262. Nolte, H., Spjeldnaes, N., Kruse, A. et Windelborg, B. (1990) Histamine release from gut mast cells from patients with inflammatory bowel diseases. Gut, 31(7), 791-794. Nusrat, A., Parkos, C. A., Bacarra, A. E., Godowski, P. J., Delp-Archer, C, Rosen, E. M. et Madara, J. L. (1994) Hepatocyte growth factor/scatter factor effects on epithelia. Regulation of intercellular junctions in transformed and nontransformed cell lines, basolateral polarization of c-met receptor in transformed and natural intestinal epithelia, and induction of rapid wound repair in a transformed model epithelium. J Clin Invest, 93(5), 2056-2065. Nystedt, S., Emilsson, K., Wahlestedt, C. et Sundelin, J. (1994) Molecular cloning of a potential proteinase activated receptor. Proc Natl Acad Sci USA, 91(20), 9208-9212. Odom, D. T., Zizlsperger, N., Gordon, D. B., Bell, G. W., Rinaldi, N. J., Murray, H. L., Volkert, T. L., Schreiber, J., Rolfe, P. A., Gifford, D. K., Fraenkel, E., Bell, G. I. et Young, R. A. (2004) Control of pancreas and liver gene expression by HNF transcription factors. Science, 303(5662), 1378-1381. Ogata, M., Awaji, T., Iwasaki, N., Miyazaki, S., Bell, G. I. et Iwamoto, Y. (2002) Nuclear translocation of SHP and visualization of interaction with HNF-4alpha in living cells. Biochem Biophys Res Commun, 292(1), 8-12. Ogura, Y., Suruga, K., Takase, S. et Goda, T. (2005) Developmental changes of the expression of the genes regulated by retinoic acid in the small intestine of rats. Life sciences, 77(22), 2804-2813. Ohashi, R., Tamai, I., Inano, A., Katsura, M., Sai, Y., Nezu, J. et Tsuji, A. (2002) Studies on functional sites of organic cation/carnitine transporter OCTN2 (SLC22A5) using a Ser467Cys mutant protein. The Journal of pharmacology and experimental therapeutics, 302(3), 1286-1294. 329 Ohnmacht, C. et Voehringer, D. (2009) Basophil effector function and homeostasis during helminth infection. Blood, 113(12), 2816-2825. Ohta, S., Bahrun, U., Tanaka, M. et Kimoto, M. (2004) Identification of a novel isoform of MD-2 that downregulates lipopolysaccharide signaling. Biochem Biophys Res Commun, 323(3), 1103-1108. Okada, Y. et Maeno, E. (2001) Apoptosis, cell volume regulation and volume-regulatory chloride channels. Comp Biochem Physiol A Mol Integr Physiol, 130(3), 377-383. Olive, K. P., Tuveson, D. A., Ruhe, Z. C, Yin, B., Willis, N. A., Bronson, R. T., Crowley, D. et Jacks, T. (2004) Mutant p53 gain of function in two mouse models of Li-Fraumeni syndrome. Cell, 119(6), 847-860. Oshima, T., Kawasaki, T., Ohashi, R., Hasegawa, G., Jiang, S., Umezu, H., Aoyagi, Y., Iwanari, H., Tanaka, T., Hamakubo, T., Kodama, T. et Naito, M. (2007) Downregulated PI promoter-driven hepatocyte nuclear factor-4alpha expression in human colorectal carcinoma is a new prognostic factor against liver metastasis. Pathology international, 57(2), 82-90. Oswald, F., Winkler, M., Cao, Y., Astrahantseff, K., Bourteele, S., Knochel, W. et Borggrefe, T. (2005) RBP-Jkappa/SHARP recruits CtlP/CtBP corepressors to silence Notch target genes. Mol Cell Biol, 25(23), 10379-10390. Otsuka, M, Kang, Y. J., Ren, J., Jiang, H., Wang, Y., Omata, M. et Han, J. (2010) Distinct effects of p38alpha deletion in myeloid lineage and gut epithelia in mouse models of inflammatory bowel disease. Gastroenterology, 138(4), 1255-1265, 1265 el251-1259. Otte, J. M., Kiehne, K. et Herzig, K. H. (2003) Antimicrobial peptides in innate immunity of the human intestine. J Gastroenterol, 38(8), 717-726. Otte, J. M., Cario, E. et Podolsky, D. K. (2004) Mechanisms of cross hyporesponsiveness to Toll-like receptor bacterial ligands in intestinal epithelial cells. Gastroenterology, 126(4), 1054-1070. Ouellette, A. J., Hsieh, M. M., Nosek, M. T., Cano-Gauci, D. F., Huttner, K. M., Buick, R. N. et Selsted, M. E. (1994) Mouse Paneth cell defensins: primary structures and antibacterial activities of numerous cryptdin isoforms. Infect Immun, 62(11), 5040-5047. Ouyang, B., Pan, H., Lu, L., Li, J., Stambrook, P., Li, B. et Dai, W. (1997) Human Prk is a conserved protein serine/threonine kinase involved in regulating M phase functions. J Biol Chem, 272(45), 28646-28651. Owen, R. L., Piazza, A. J. et Ermak, T. H. (1991) Ultrastructural and cytoarchitectural features of lymphoreticular organs in the colon and rectum of adult BALB/c mice. Am J Anat, 190(1), 10-18. 330 Ozeki, T., Takahashi, Y., Kume, T., Nakayama, K., Yokoi, T., Nunoya, K., Hara, A. et Kamataki, T. (2001) Co-operative regulation of the transcription of human dihydrodiol dehydrogenase (DD)4/aldo-keto reductase (AKR)1C4 gene by hepatocyte nuclear factor (HNF)-4alpha/gamma and HNF-1 alpha. Biochem J, 355(Pt 2), 537-544. Packey, C. D. et Sartor, R. B. (2009) Commensal bacteria, traditional and opportunistic pathogens, dysbiosis and bacterial killing in inflammatory bowel diseases. Current opinion in infectious diseases, 22(3), 292-301. Pani, G., Giannoni, E., Galeotti, T. et Chiarugi, P. (2009) Redox-based escape mechanism from death: the cancer lesson. Antioxidants & redox signaling, 11(11), 2791-2806. Pani, G., Galeotti, T. et Chiarugi, P. (2010) Metastasis: cancer cell's escape from oxidative stress. Cancer metastasis reviews, 29(2), 351-378. Panwala, C. M., Jones, J. C. et Viney, J. L. (1998) A novel model of inflammatory bowel disease: mice deficient for the multiple drug resistance gene, mdrla, spontaneously develop colitis. J Immunol, 161(10), 5733-5744. Papadakis, K. A. et Targan, S. R. (2000) Role of cytokines in the pathogenesis of inflammatory bowel disease. Annual review of medicine, 51, 289-298. Pappo, J. et Owen, R. L. (1988) Absence of secretory component expression by epithelial cells overlying rabbit gut-associated lymphoid tissue. Gastroenterology, 95(5), 1173-1177. Pare, J. F., Roy, S., Galarneau, L. et Belanger, L. (2001) The mouse fetoprotein transcription factor (FTF) gene promoter is regulated by three GATA elements with tandem E box and Nkx motifs, and FTF in turn activates the Hnfibeta, Hnf4alpha, and Hnfl alpha gene promoters. J Biol Chem, 276(16), 13136-13144. Parkin, D. M, Bray, F., Ferlay, J. et Pisani, P. (2005) Global cancer statistics, 2002. CA: a cancer journal for clinicians, 55(2), 74-108. Parkin, J. et Cohen, B. (2001) An overview of the immune system. Lancet, 357(9270), 1777- 1789. Parviz, F., Li, J., Kaestner, K. H. et Duncan, S. A. (2002) Generation of a conditionally null allele of hnf4alpha. Genesis, 32(2), 130-133. Parviz, F., Matullo, C, Garrison, W. D., Savatski, L., Adamson, J. W., Ning, G., Kaestner, K. H., Rossi, J. M., Zaret, K. S. et Duncan, S. A. (2003) Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat Genet, 34(3), 292-296. Patterson, E. S., Addis, R. C, Shamblott, M. J. et Gearhart, J. D. (2008) SOX 17 directly activates Zfp202 transcription during in vitro endoderm differentiation. Physiol Genomics, 34(3), 277-284. 331 Pavlick, K. P., Laroux, F. S., Fuseler, J., Wolf, R. E., Gray, L., Hoffman, J. et Grisham, M. B. (2002) Role of reactive metabolites of oxygen and nitrogen in inflammatory bowel disease. Free radical biology & medicine, 33(3), 311-322. Pearson, E. R., Boj, S. F., Steele, A. M., Barrett, T., Stals, K., Shield, J. P., Ellard, S., Ferrer, J. et Hattersley, A. T. (2007) Macrosomia and hyperinsulinaemic hypoglycaemia in patients with heterozygous mutations in the HNF4A gene. PLoS Med, 4(4), el 18. Pederson, R. A., Satkunarajah, M., Mcintosh, C. H., Scrocchi, L. A., Flamez, D., Schuit, F., Drucker, D. J. et Wheeler, M. B. (1998) Enhanced glucose-dependent insulinotropic polypeptide secretion and insulinotropic action in glucagon-like peptide 1 receptor -/- mice. Diabetes, 47(7), 1046-1052. Perilhou, A., Tourrel-Cuzin, C., Zhang, P., Kharroubi, I., Wang, H., Fauveau, V., Scott, D. K., Wollheim, C. B. et Vasseur-Cognet, M. (2008) The MODYl gene for hepatocyte nuclear factor 4alpha and a feedback loop control COUP-TFII expression in pancreatic beta cells. Mol Cell Biol, 28(14), 4588-4597. Petrescu, A. D., Hertz, R., Bar-Tana, J., Schroeder, F. et Kier, A. B. (2002) Ligand specificity and conformational dependence of the hepatic nuclear factor-4alpha (HNF-4alpha ). J Biol Chem, 277(27), 23988-23999. Petrescu, A. D., Payne, H. R., Boedecker, A., Chao, H., Hertz, R., Bar-Tana, J., Schroeder, F. et Kier, A. B. (2003) Physical and functional interaction of Acyl-CoA-binding protein with hepatocyte nuclear factor-4 alpha. J Biol Chem, 278(51), 51813-51824. Pfeiffer, T., Schuster, S. et Bonhoeffer, S. (2001) Cooperation and competition in the evolution of ATP-producing pathways. Science, 292(5516), 504-507. Pierik, M., Joossens, S., Van Steen, K., Van Schuerbeek, N., Vlietinck, R., Rutgeerts, P. et Vermeire, S. (2006) Toll-like receptor-1, -2, and -6 polymorphisms influence disease extension in inflammatory bowel diseases. Inflamm Bowel Dis, 12(1), 1-8. Pineda Torra, I., Jamshidi, Y., Flavell, D. M., Fruchart, J. C. et Staels, B. (2002) Characterization of the human PPARalpha promoter: identification of a functional nuclear receptor response element. Molecular endocrinology, 16(5), 1013-1028. Pineton de Chambrun, G., Peyrin-Biroulet, L., Lemann, M. et Colombel, J. F. (2010) Clinical implications of mucosal healing for the management of IBD. Nat Rev Gastroenterol Hepatol, 7(1), 15-29. Pinto, D., Gregorieff, A., Begthel, H. et Clevers, H. (2003) Canonical Wnt signals are essential for homeostasis of the intestinal epithelium. Genes Dev, 17(14), 1709-1713. Plaisancie, P., Barcelo, A., Moro, F., Claustre, J., Chayvialle, J. A. et Cuber, J. C. (1998) Effects of neurotransmitters, gut hormones, and inflammatory mediators on mucus discharge in rat colon. Am J Physiol, 275(5 Pt 1), G1073-1084. 332 Polyak, K., Xia, Y., Zweier, J. L., Kinzler, K. W. et Vogelstein, B. (1997) A model for p53-induced apoptosis. Nature, 389(6648), 300-305. Poon, E., Harris, A. L. et Ashcroft, M. (2009) Targeting the hypoxia-inducible factor (HIF) pathway in cancer. Expert reviews in molecular medicine, 11, e26. Potten, C. S. (1975) Kinetics and possible regulation of crypt cell populations under normal and stress conditions. Bulletin du cancer, 62(4), 419-430. Potten, C. S., Owen, G. et Booth, D. (2002) Intestinal stem cells protect their genome by selective segregation of template DNA strands. J Cell Sci, 115(Pt 11), 2381-2388. Potten, C. S. (2004) Radiation, the ideal cytotoxic agent for studying the cell biology of tissues such as the small intestine. Radiation research, 161(2), 123-136. Powell, D. W., Mifflin, R. C, Valentich, J. D., Crowe, S. E., Saada, J. I. et West, A. B. (1999) Myofibroblasts. II. Intestinal subepithelial myofibroblasts. Am J Physiol, 277(2 Pt 1), C183-201. Pravda, J. (2005) Radical induction theory of ulcerative colitis. World J Gastroenterol, 11(16), 2371-2384. Pretlow, T. P., Barrow, B. J., Ashton, W. S., O'Riordan, M. A., Pretlow, T. G., Jurcisek, J. A. et Stellato, T. A. (1991) Aberrant crypts: putative preneoplastic foci in human colonic mucosa. Cancer Res, 51(5), 1564-1567. Pryor, W. A. et Stanley, J. P. (1975) Letter: A suggested mechanism for the production of malonaldehyde during the autoxidation of polyunsaturated fatty acids. Nonenzymatic production of prostaglandin endoperoxides during autoxidation. The Journal of organic chemistry, 40(24), 3615-3617. Qian, A., Cai, Y., Magee, T. R. et Wan, Y. J. (2000) Identification of retinoic acid- responsive elements on the HNF1 alpha and HNF4alpha genes. Biochem Biophys Res Commun, 276(3), 837-842. Qu, X., Lam, E., Doughman, Y. Q., Chen, Y., Chou, Y. T., Lam, M., Turakhia, M., Dunwoodie, S. L., Watanabe, M., Xu, B., Duncan, S. A. et Yang, Y. C. (2007) Cited2, a coactivator of HNF4alpha, is essential for liver development. Embo J, 26(21), 4445-4456. Quennet, V., Yaromina, A., Zips, D., Rosner, A., Walenta, S., Baumann, M. et Mueller- Klieser, W. (2006) Tumor lactate content predicts for response to fractionated irradiation of human squamous cell carcinomas in nude mice. Radiother Oncol, 81(2), 130-135. Rampino, N., Yamamoto, H., Ionov, Y., Li, Y., Sawai, H., Reed, J. C. et Perucho, M. (1997) Somatic frameshift mutations in the BAX gene in colon cancers of the microsatellite mutator phenotype. Science, 275(5302), 967-969. 333 Rastegar, M., Rousseau, G. G. et Lemaigre, F. P. (2000) CCAAT/enhancer-binding protein-alpha is a component of the growth hormone-regulated network of liver transcription factors. Endocrinology, 141(5), 1686-1692. Read, N. W. et Gwee, K. A. (1994) The importance of 5-hydroxytryptamine receptors in the gut. Pharmacology & therapeutics, 62(1-2), 159-173. Reddy, S., Yang, W., Taylor, D. G., Shen, X., Oxender, D., Kust, G. et Leff, T. (1999) Mitogen-activated protein kinase regulates transcription of the ApoCIII gene. Involvement of the orphan nuclear receptor HNF4. J Biol Chem, 274(46), 33050-33056. Reijnen, M. J., Sladek, F. M., Bertina, R. M. et Reitsma, P. H. (1992) Disruption of a binding site for hepatocyte nuclear factor 4 results in hemophilia B Leyden. Proc Natl Acad Sci U S A, 89(14), 6300-6303. Reimann, F. et Gribble, F. M. (2002) Glucose-sensing in glucagon-like peptide-1-secreting cells. Diabetes, 51(9), 2757-2763. Reimann, F., Habib, A. M., Tolhurst, G., Parker, H. E., Rogers, G. J. et Gribble, F. M. (2008) Glucose sensing in L cells: a primary cell study. Cell metabolism, 8(6), 532-539. Rescigno, M., Urbano, M., Valzasina, B., Francolini, M., Rotta, G., Bonasio, R., Granucci, F., Kraehenbuhl, J. P. et Ricciardi-Castagnoli, P. (2001) Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat Immunol, 2(4), 361- 367. Rhee, J., Inoue, Y., Yoon, J. C., Puigserver, P., Fan, M., Gonzalez, F. J. et Spiegelman, B. M. (2003) Regulation of hepatic fasting response by PPARgamma coactivator-1 alpha (PGC-1): requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis. Proc Natl Acad Sci U S ^,100(7), 4012-4017. Rhee, J., Ge, H., Yang, W., Fan, M, Handschin, C, Cooper, M., Lin, J., Li, C. et Spiegelman, B. M. (2006) Partnership of PGC-1 alpha and HNF4alpha in the regulation of lipoprotein metabolism. J Biol Chem, 281(21), 14683-14690. Rhee, K. J., Wu, S., Wu, X., Huso, D. L., Karim, B., Franco, A. A., Rabizadeh, S., Golub, J. E., Mathews, L. E., Shin, J., Sartor, R. B., Golenbock, D., Hamad, A. R., Gan, C. M., Housseau, F. et Sears, C. L. (2009) Induction of persistent colitis by a human commensal, enterotoxigenic Bacteroides fragilis, in wild-type C57BL/6 mice. Infect Immun, 77(4), 1708- 1718. Rindi, G., Leiter, A. B., Kopin, A. S., Bordi, C. et Solcia, E. (2004) The "normal" endocrine cell of the gut: changing concepts and new evidences. Ann N Y Acad Sci, 1014, 1-12. Robinson-Rechavi, M., Maina, C. V., Gissendanner, C. R., Laudet, V. et Sluder, A. (2005) Explosive lineage-specific expansion of the orphan nuclear receptor HNF4 in nematodes. Journal of molecular evolution, 60(5), 577-586. 334 Rochette, P. J., Bastien, N., Lavoie, J., Guerin, S. L. et Drouin, R. (2005) SW480, a p53 double-mutant cell line retains proficiency for some p53 functions. Journal of molecular biology, 352(1), 44-57. Rodriguez, J. C, Ortiz, J. A., Hegardt, F. G. et Haro, D. (1998) The hepatocyte nuclear factor 4 (HNF-4) represses the mitochondrial HMG-CoA synthase gene. Biochem Biophys Res Commun, 242(3), 692-696. Roediger, W. E. (1982) Utilization of nutrients by isolated epithelial cells of the rat colon. Gastroenterology, 83(2), 424-429. Roessner, A., Kuester, D., Malfertheiner, P. et Schneider-Stock, R. (2008) Oxidative stress in ulcerative colitis-associated carcinogenesis. Pathology, research and practice, 204(7), 511- 524. Rojas, R. et Apodaca, G. (2002) Immunoglobulin transport across polarized epithelial cells. Nat Rev Mol Cell Biol, 3(12), 944-955. Roth, S., Franken, P., van Veelen, W., Blonden, L., Raghoebir, L., Beverloo, B., van Drunen, E., Kuipers, E. J., Rottier, R., Fodde, R. et Smits, R. (2009) Generation of a tightly regulated doxycycline-inducible model for studying mouse intestinal biology. Genesis, 47(1), 7-13. Roth, U., Jungermann, K. et Kietzmann, T. (2002) Activation of glucokinase gene expression by hepatic nuclear factor 4alpha in primary hepatocytes. Biochem J, 365(Pt 1), 223-228. Rugtveit, J., Bakka, A. et Brandtzaeg, P. (1997) Differential distribution of B7.1 (CD80) and B7.2 (CD86) costimulatory molecules on mucosal macrophage subsets in human inflammatory bowel disease (IBD). Clin Exp Immunol, 110(1), 104-113. Ruse, M. D., Jr., Privalsky, M. L. et Sladek, F. M. (2002) Competitive cofactor recruitment by orphan receptor hepatocyte nuclear factor 4alphal: modulation by the F domain. Mol Cell Biol, 22(6), 1626-1638. Saam, J. R. et Gordon, J. I. (1999) Inducible gene knockouts in the small intestinal and colonic epithelium. J Biol Chem, 274(53), 38071-38082. Sablina, A. A., Budanov, A. V., Ilyinskaya, G. V., Agapova, L. S., Kravchenko, J. E. et Chumakov, P. M. (2005) The antioxidant function of the p53 tumor suppressor. Nat Med, 11(12), 1306-1313. Saha, N. R., Smith, J. et Amemiya, C. T. (2010) Evolution of adaptive immune recognition in jawless vertebrates. Semin Immunol, 22(1), 25-33. Sandle, G. I., Hayslett, J. P. et Binder, H. J. (1986) Effect of glucocorticoids on rectal transport in normal subjects and patients with ulcerative colitis. Gut, 27(3), 309-316. 335 Sandle, G. I., Higgs, N., Crowe, P., Marsh, M. N., Venkatesan, S. et Peters, T. J. (1990) Cellular basis for defective electrolyte transport in inflamed human colon. Gastroenterology, 99(1), 97-105. Sangiorgi, E. et Capecchi, M. R. (2008) Bmil is expressed in vivo in intestinal stem cells. Nat Genet, 40(7), 915-920. Sansom, O. J., Reed, K. R., Hayes, A. J., Ireland, H., Brinkmann, H., Newton, I. P., Batlle, E., Simon-Assmann, P., Clevers, H., Nathke, I. S., Clarke, A. R. et Winton, D. J. (2004) Loss of Ape in vivo immediately perturbs Wnt signaling, differentiation, and migration. Genes Dev, 18(12), 1385-1390. Sansonetti, P. J. (2004) War and peace at mucosal surfaces. Nat Rev Immunol, 4(12), 953- 964. Sansregret, L., Goulet, B., Harada, R., Wilson, B., Leduy, L., Bertoglio, J. et Nepveu, A. (2006) The pi 10 isoform of the CDP/Cux transcription factor accelerates entry into S phase. Mol Cell Biol, 26(6), 2441-2455. Sansregret, L. et Nepveu, A. (2008) The multiple roles of CUX1: insights from mouse models and cell-based assays. Gene, 412(1-2), 84-94. Santaguida, M., Ding, Q., Berube, G., Truscott, M., Whyte, P. et Nepveu, A. (2001) Phosphorylation of the CCAAT displacement protein (CDP)/Cux transcription factor by cyclin A-Cdkl modulates its DNA binding activity in G(2). J Biol Chem, 276(49), 45780- 45790. Sanyal, S., Bavner, A., Haroniti, A., Nilsson, L. M., Lundasen, T., Rehnmark, S., Witt, M. R., Einarsson, C, Talianidis, I., Gustafsson, J. A. et Treuter, E. (2007) Involvement of corepressor complex subunit GPS2 in transcriptional pathways governing human bile acid biosynthesis. Proc Natl Acad Sci USA, 104(40), 15665-15670. Sattler, U. G. et Mueller-Klieser, W. (2009) The anti-oxidant capacity of tumour glycolysis. International journal of radiation biology, 85(11), 963-971. Scapini, P., Lapinet-Vera, J. A., Gasperini, S., Calzetti, F., Bazzoni, F. et Cassatella, M. A. (2000) The neutrophil as a cellular source of chemokines. Immunol Rev, 111, 195-203. Schett, G., Zwerina, J. et Firestein, G. (2008) The p38 mitogen-activated protein kinase (MAPK) pathway in rheumatoid arthritis. Ann Rheum Dis, 67(7), 909-916. Schilli, R., Breuer, R. I., Klein, F., Dunn, K., Gnaedinger, A., Bernstein, J., Paige, M. et Kaufman, M. (1982) Comparison of the composition of faecal fluid in Crohn's disease and ulcerative colitis. Gut, 23(4), 326-332. Schmid, T., Zhou, J., Kohl, R. et Brune, B. (2004) p300 relieves p53-evoked transcriptional repression of hypoxia-inducible factor-1 (HIF-1). Biochem J, 380(Pt 1), 289-295. 336 Schmitz, H., Barmeyer, C, Fromm, M., Runkel, N., Foss, H. D., Bentzel, C. J., Riecken, E. O. et Schulzke, J. D. (1999) Altered tight junction structure contributes to the impaired epithelial barrier function in ulcerative colitis. Gastroenterology, 116(2), 301-309. Schonbeck, U. et Libby, P. (2001) The CD40/CD154 receptor/ligand dyad. Cell Mol Life Sci, 58(1), 4-43. Schonhoff, S. E., Giel-Moloney, M. et Leiter, A. B. (2004) Neurogenin 3-expressing progenitor cells in the gastrointestinal tract differentiate into both endocrine and non- endocrine cell types. Dev Biol, 270(2), 443-454. Schwartz, B., Algamas-Dimantov, A., Hertz, R., Nataf, J., Kerman, A., Peri, I. et Bar-Tana, J. (2009) Inhibition of colorectal cancer by targeting hepatocyte nuclear factor-4alpha. Int J Cancer, 124(5), 1081-1089. Seguin, L., Liot, C, Mzali, R., Harada, R., Siret, A., Nepveu, A. et Bertoglio, J. (2009) CUX1 and E2F1 regulate coordinated expression of the mitotic complex genes Ect2, MgcRacGAP, and MKLP1 in S phase. Mol Cell Biol, 29(2), 570-581. Sel, S., Ebert, T., Ryffel, G. U. et Drewes, T. (1996) Human renal cell carcinogenesis is accompanied by a coordinate loss of the tissue specific transcription factors HNF4 alpha and HNF1 alpha. Cancer letters, 101(2), 205-210. Semenza, G. L. (1998) Hypoxia-inducible factor 1: master regulator of 02 homeostasis. Curr Opin Genet Dev, 8(5), 588-594. Shai, Y. (1999) Mechanism of the binding, insertion and destabilization of phospholipid bilayer membranes by alpha-helical antimicrobial and cell non-selective membrane-lytic peptides. Biochim Biophys Acta, 1462(1-2), 55-70. Shekhawat, P. S., Srinivas, S. R., Matern, D., Bennett, M. J., Boriack, R., George, V., Xu, H., Prasad, P. D., Roon, P. et Ganapathy, V. (2007) Spontaneous development of intestinal and colonic atrophy and inflammation in the carnitine-deficient jvs (OCTN2(-/-)) mice. Molecular genetics and metabolism, 92(4), 315-324. Shen, W., Scearce, L. M, Brestelli, J. E., Sund, N. J. et Kaestner, K. H. (2001) Foxa3 (hepatocyte nuclear factor 3 gamma) is required for the regulation of hepatic GLUT2 expression and the maintenance of glucose homeostasis during a prolonged fast. J Biol Chem, 276(46), 42812-42817. Shibata, H., Toyama, K., Shioya, H., Ito, M., Hirota, M., Hasegawa, S., Matsumoto, H., Takano, H., Akiyama, T., Toyoshima, K., Kanamaru, R., Kanegae, Y., Saito, I., Nakamura, Y., Shiba, K. et Noda, T. (1997) Rapid colorectal adenoma formation initiated by conditional targeting of the Ape gene. Science, 278(5335), 120-123. Shih, I. M., Zhou, W., Goodman, S. N., Lengauer, C, Kinzler, K. W. et Vogelstein, B. (2001) Evidence that genetic instability occurs at an early stage of colorectal tumorigenesis. Cancer Res, 61(3), 818-822. 337 Shroyer, N. F., Wallis, D., Venken, K. J., Bellen, H. J. et Zoghbi, H. Y. (2005) Gfil functions downstream of Mathl to control intestinal secretory cell subtype allocation and differentiation. Genes Dev, 19(20), 2412-2417. Shroyer, N. F., Helmrath, M. A., Wang, V. Y., Antalffy, B., Henning, S. J. et Zoghbi, H. Y. (2007) Intestine-specific ablation of mouse atonal homolog 1 (Mathl) reveals a role in cellular homeostasis. Gastroenterology, 132(7), 2478-2488. Silverberg, M. S. (2006) OCTNs: will the real IBD5 gene please stand up? World J Gastroenterol, 12(23), 3678-3681. Sinclair, A. M., Lee, J. A., Goldstein, A., Xing, D., Liu, S., Ju, R., Tucker, P. W., Neufeld, E. J. et Scheuermann, R. H. (2001) Lymphoid apoptosis and myeloid hyperplasia in CCAAT displacement protein mutant mice. Blood, 98(13), 3658-3667. Skalnik, D. G., Strauss, E. C. et Orkin, S. H. (1991) CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter. J Biol Chem, 266(25), 16736-16744. Slack, J. M. (1986) Epithelial metaplasia and the second anatomy. Lancet, 2(8501), 268-271. Sladek, F. M., Zhong, W. M., Lai, E. et Darnell, J. E., Jr. (1990) Liver-enriched transcription factor FfNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev, 4(12B), 2353-2365. Sladek, F. M. (1993) Orphan receptor FfNF-4 and liver-specific gene expression. Receptor, 3(3), 223-232. Sladek, F. M., Ruse, M. D., Jr., Nepomuceno, L., Huang, S. M. et Stallcup, M. R. (1999) Modulation of transcriptional activation and coactivator interaction by a splicing variation in the F domain of nuclear receptor hepatocyte nuclear factor 4alphal. Mol Cell Biol, 19(10), 6509-6522. Smith, J. A. (1994) Neutrophils, host defense, and inflammation: a double-edged sword. J Leukoc Biol, 56(6), 672-686. Smith, T. A. (2000) Mammalian hexokinases and their abnormal expression in cancer. British journal of biomedical science, 57(2), 170-178. Smythies, L. E., Sellers, M., Clements, R. H., Mosteller-Barnum, M., Meng, G., Benjamin, W. H., Orenstein, J. M. et Smith, P. D. (2005) Human intestinal macrophages display profound inflammatory anergy despite avid phagocytic and bacteriocidal activity. J Clin Invest, 115(1), 66-75. Snippert, H. J., van Es, J. H., van den Born, M., Begthel, H., Stange, D. E., Barker, N. et Clevers, H. (2009) Prominin-l/CD133 marks stem cells and early progenitors in mouse small intestine. Gastroenterology, 136(7), 2187-2194 e2181. 338 Soderholm, J. D., Olaison, G., Peterson, K. H., Franzen, L. E., Lindmark, T., Wiren, M., Tagesson, C. et Sjodahl, R. (2002) Augmented increase in tight junction permeability by luminal stimuli in the non-inflamed ileum of Crohn's disease. Gut, 50(3), 307-313. Song, K. H., Li, T. et Chiang, J. Y. (2006) A Prospero-related homeodomain protein is a novel co-regulator of hepatocyte nuclear factor 4alpha that regulates the cholesterol 7alpha- hydroxylase gene. J Biol Chem, 281(15), 10081-10088. Sosa-Pineda, B., Chowdhury, K., Torres, M., Oliver, G. et Gruss, P. (1997) The Pax4 gene is essential for differentiation of insulin-producing beta cells in the mammalian pancreas. Nature, 386(6623), 399-402. Soussi, T. et Beroud, C. (2001) Assessing TP53 status in human tumours to evaluate clinical outcome. Nat Rev Cancer, 1(3), 233-240. Spalding, D. M. et Griffin, J. A. (1986) Different pathways of differentiation of pre-B cell lines are induced by dendritic cells and T cells from different lymphoid tissues. Cell, 44(3), 507-515. Spector, T. et Cao, S. (2010) A possible cause and remedy for the clinical failure of 5- fluorouracil plus eniluracil. Clinical colorectal cancer, 9(1), 52-54. Spencer, J., MacDonald, T. T., Finn, T. et Isaacson, P. G. (1986) The development of gut associated lymphoid tissue in the terminal ileum of fetal human intestine. Clin Exp Immunol, 64(3), 536-543. Sprang, S. R., Acharya, K. R., Goldsmith, E. J., Stuart, D. I., Varvill, K., Fletterick, R. J., Madsen, N. B. et Johnson, L. N. (1988) Structural changes in glycogen phosphorylase induced by phosphorylation. Nature, 336(6196), 215-221. St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A. et Gruss, P. (1997) Pax6 is required for differentiation of glucagon-producing alpha-cells in mouse pancreas. Nature, 387(6631), 406-409. St Clair, W. H. et Osborne, J. W. (1985) Crypt fission and crypt number in the small and large bowel of postnatal rats. Cell and tissue kinetics, 18(3), 255-262. Stainier, D. Y. (2005) No organ left behind: tales of gut development and evolution. Science, 307(5717), 1902-1904. Stegmaier, P., Kel, A. E. et Wingender, E. (2004) Systematic DNA-binding domain classification of transcription factors. Genome informatics, 15(2), 276-286. Stein, G. S., Stein, J. L., van Wijnen, A. J. et Lian, J. B. (1994) Histone gene transcription: a model for responsiveness to an integrated series of regulatory signals mediating cell cycle control and proliferation/differentiation interrelationships. J Cell Biochem, 54(4), 393-404. 339 Stevenson, L. F., Sparks, A., Allende-Vega, N., Xirodimas, D. P., Lane, D. P. et Saville, M. K. (2007) The deubiquitinating enzyme USP2a regulates the p53 pathway by targeting Mdm2. Embo J, 26(4), 976-986. Stoyanova, II et Gulubova, M. V. (2002) Mast cells and inflammatory mediators in chronic ulcerative colitis. Acta histochemica, 104(2), 185-192. Strobel, S. et Mowat, A. M. (1998) Immune responses to dietary antigens: oral tolerance. Immunol Today, 19(4), 173-181. Suaud, L., Formstecher, P. et Laine, B. (1999) The activity of the activation function 2 of the human hepatocyte nuclear factor 4 (HNF-4alpha) is differently modulated by F domains from various origins. Biochem J, 340 (Pt 1), 161-169. Suaud, L., Hemimou, Y., Formstecher, P. et Laine, B. (1999) Functional study of the E276Q mutant hepatocyte nuclear factor-4alpha found in type 1 maturity-onset diabetes of the young: impaired synergy with chicken ovalbumin upstream promoter transcription factor II on the hepatocyte nuclear factor-1 promoter. Diabetes, 48(5), 1162-1167. Sudarsan, V., Anant, S., Guptan, P., VijayRaghavan, K. et Skaer, H. (2001) Myoblast diversification and ectodermal signaling in Drosophila. Dev Cell, 1(6), 829-839. Suemori, S., Ciacci, C. et Podolsky, D. K. (1991) Regulation of transforming growth factor expression in rat intestinal epithelial cell lines. J Clin Invest, 87(6), 2216-2221. Sugai, M., Umezu, H., Yamamoto, T., Jiang, S., Iwanari, H., Tanaka, T., Hamakubo, T., Kodama, T. et Naito, M. (2008) Expression of hepatocyte nuclear factor 4 alpha in primary ovarian mucinous tumors. Pathology international, 58(11), 681-686. Sukhdeo, K., Mani, M., Zhang, Y., Dutta, J., Yasui, H., Rooney, M. D., Carrasco, D. E., Zheng, M., He, H., Tai, Y. T., Mitsiades, C, Anderson, K. C. et Carrasco, D. R. (2007) Targeting the beta-catenin/TCF transcriptional complex in the treatment of multiple myeloma. Proc Natl Acad Sci USA, 104(18), 7516-7521. Sumi, K., Tanaka, T., Uchida, A., Magoori, K., Urashima, Y., Ohashi, R., Ohguchi, H., Okamura, M., Kudo, H., Daigo, K., Maejima, T., Kojima, N., Sakakibara, I., Jiang, S., Hasegawa, G., Kim, I., Osborne, T. F., Naito, M., Gonzalez, F. J., Hamakubo, T., Kodama, T. et Sakai, J. (2007) Cooperative interaction between hepatocyte nuclear factor 4 alpha and GATA transcription factors regulates ATP-binding cassette sterol transporters ABCG5 and ABCG8. Molecular and cellular biology, 27(12), 4248-4260. Sun, C. M., Hall, J. A., Blank, R. B., Bouladoux, N., Oukka, M., Mora, J. R. et Belkaid, Y. (2007) Small intestine lamina propria dendritic cells promote de novo generation of Foxp3 T reg cells via retinoic acid. J Exp Med, 204(8), 1775-1785. Sun, J. et Deng, W. M. (2005) Notch-dependent downregulation of the homeodomain gene cut is required for the mitotic cycle/endocycle switch and cell differentiation in Drosophila follicle cells. Development, 132(19), 4299-4308. 340 Sun, J. et Deng, W. M. (2007) Hindsight mediates the role of notch in suppressing hedgehog signaling and cell proliferation. Dev Cell, 12(3), 431-442. Sun, K., Montana, V., Chellappa, K., Brelivet, Y., Moras, D., Maeda, Y., Parpura, V., Paschal, B. M. et Sladek, F. M. (2007) Phosphorylation of a conserved serine in the deoxyribonucleic acid binding domain of nuclear receptors alters intracellular localization. Molecular endocrinology, 21(6), 1297-1311. Superti-Furga, G., Barberis, A., Schreiber, E. et Busslinger, M. (1989) The protein CDP, but not CPl, footprints on the CCAAT region of the gamma-globin gene in unfractionated B-cell extracts. Biochim Biophys Acta, 1007(2), 237-242. Surapureddi, S., Rana, R., Reddy, J. K. et Goldstein, J. A. (2008) Nuclear receptor coactivator 6 mediates the synergistic activation of human cytochrome P-450 2C9 by the constitutive androstane receptor and hepatic nuclear factor-4alpha. Molecular pharmacology, 74(3), 913-923. Sussel, L., Kalamaras, J., Hartigan-O'Connor, D. J., Meneses, J. J., Pedersen, R. A., Rubenstein, J. L. et German, M. S. (1998) Mice lacking the homeodomain transcription factor Nkx2.2 have diabetes due to arrested differentiation of pancreatic beta cells. Development, 125(12), 2213-2221. Suzuki, M., Fujikura, K., Inagaki, N., Seino, S. et Takata, K. (1997) Localization of the ATP-sensitive K+ channel subunit Kir6.2 in mouse pancreas. Diabetes, 46(9), 1440-1444. Sweet, K., Willis, J., Zhou, X. P., Gallione, C, Sawada, T., Alhopuro, P., Khoo, S. K., Patocs, A., Martin, C, Bridgeman, S., Heinz, J., Pilarski, R., Lehtonen, R., Prior, T. W., Frebourg, T., Teh, B. T., Marchuk, D. A., Aaltonen, L. A. et Eng, C. (2005) Molecular classification of patients with unexplained hamartomatous and hyperplastic polyposis. Jama, 294(19), 2465-2473. Swevers, L. et Iatrou, K. (1998) The orphan receptor BmHNF-4 of the silkmoth Bombyx mori: ovarian and zygotic expression of two mRNA isoforms encoding polypeptides with different activating domains. Mech Dev, 72(1-2), 3-13. Takahashi, H., Martin-Brown, S., Washburn, M. P., Florens, L., Conaway, J. W. et Conaway, R. C. (2009) Proteomics reveals a physical and functional link between hepatocyte nuclear factor 4alpha and transcription factor IID. J Biol Chem, 284(47), 32405-32412. Takahashi, T., Sano, B., Nagata, T., Kato, H., Sugiyama, Y., Kunieda, K., Kimura, M., Okano, Y. et Saji, S. (2003) Polo-like kinase 1 (PLK1) is overexpressed in primary colorectal cancers. Cancer science, 94(2), 148-152. Takai, N., Hamanaka, R., Yoshimatsu, J. et Miyakawa, I. (2005) Polo-like kinases (Plks) and cancer. Oncogene, 24(2), 287-291. 341 Takaishi, H., Matsuki, T., Nakazawa, A., Takada, T., Kado, S., Asahara, T., Kamada, N., Sakuraba, A., Yajima, T., Higuchi, H., Inoue, N., Ogata, H., Iwao, Y., Nomoto, K., Tanaka, R. et Hibi, T. (2008) Imbalance in intestinal microflora constitution could be involved in the pathogenesis of inflammatory bowel disease. Int J Med Microbiol, 298(5-6), 463-472. Takata, K., Matsuzaki, T. et Tajika, Y. (2004) Aquaporins: water channel proteins of the cell membrane. Progress in histochemistry and cytochemistry, 39(1), 1-83. Takayama, T., Ohi, M., Hayashi, T., Miyanishi, K., Nobuoka, A., Nakajima, T., Satoh, T., Takimoto, R., Kato, J., Sakamaki, S. et Niitsu, Y. (2001) Analysis of K-ras, APC, and beta- catenin in aberrant crypt foci in sporadic adenoma, cancer, and familial adenomatous polyposis. Gastroenterology, 121(3), 599-611. Tarn, P. P. et Loebel, D. A. (2007) Gene function in mouse embryogenesis: get set for gastrulation. Nature reviews, 8(5), 368-381. Tanaka, T., Jiang, S., Hotta, H., Takano, K., Iwanari, H., Sumi, K., Daigo, K., Ohashi, R., Sugai, M., Ikegame, C, Umezu, H., Hirayama, Y., Midorikawa, Y., Hippo, Y., Watanabe, A., Uchiyama, Y., Hasegawa, G., Reid, P., Aburatani, H., Hamakubo, T., Sakai, J., Naito, M. et Kodama, T. (2006) Dysregulated expression of PI and P2 promoter-driven hepatocyte nuclear factor-4alpha in the pathogenesis of human cancer. The Journal of pathology, 208(5), 662-672. Tanaka, Y., Imai, T., Baba, M., Ishikawa, I., Uehira, M., Nomiyama, H. et Yoshie, O. (1999) Selective expression of liver and activation-regulated chemokine (LARC) in intestinal epithelium in mice and humans. Eur J Immunol, 29(2), 633-642. Tang, E. D., Nunez, G., Barr, F. G. et Guan, K. L. (1999) Negative regulation of the forkhead transcription factor FKHR by Akt. J Biol Chem, 274(24), 16741-16746. Tarin, D. (1972) Tissue interactions in morphogenesis, morphostasis and carcinogenesis. J Theor Biol, 34(1), 61-72. Theodossi, A., Spiegelhalter, D. J., Jass, J., Firth, J., Dixon, M., Leader, M., Levison, D. A., Lindley, R., Filipe, I., Price, A. et et al. (1994) Observer variation and discriminatory value of biopsy features in inflammatory bowel disease. Gut, 35(7), 961-968. Thibault, R., Blachier, F., Darcy-Vrillon, B., de Coppet, P., Bourreille, A. et Segain, J. P. (2010) Butyrate utilization by the colonic mucosa in inflammatory bowel diseases: a transport deficiency. Inflamm Bowel Dis, 16(4), 684-695. Thiery, J. P. et Sleeman, J. P. (2006) Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol, 7(2), 131-142. Thomas, H., Jaschkowitz, K.., Bulman, M, Frayling, T. M., Mitchell, S. M., Roosen, S., Lingott-Frieg, A., Tack, C. J., Ellard, S., Ryffel, G. U. et Hattersley, A. T. (2001) A distant upstream promoter of the HNF-4alpha gene connects the transcription factors involved in maturity-onset diabetes of the young. Hum Mol Genet, 10(19), 2089-2097. 342 Thomas, H., Senkel, S., Erdmann, S., Arndt, T., Turan, G., Klein-Hitpass, L. et Ryffel, G. U. (2004) Pattern of genes influenced by conditional expression of the transcription factors HNF6, HNF4alpha and HNFlbeta in a pancreatic beta-cell line. Nucleic Acids Res, 32(19), el50. Thor, K. et Rosell, S. (1986) Neurotensin increases colonic motility. Gastroenterology, 90(1), 27-31. Thorstensen, L., Lind, G. E., Lovig, T., Diep, C. B., Meling, G. I., Rognum, T. O. et Lothe, R. A. (2005) Genetic and epigenetic changes of components affecting the WNT pathway in colorectal carcinomas stratified by microsatellite instability. Neoplasia, 7(2), 99-108. Tomasi, T. B., Jr., Tan, E. M., Solomon, A. et Prendergast, R. A. (1965) Characteristics of an Immune System Common to Certain External Secretions. J Exp Med, 121, 101-124. Torres-Padilla, M. E., Fougere-Deschatrette, C. et Weiss, M. C. (2001) Expression of HNF4alpha isoforms in mouse liver development is regulated by sequential promoter usage and constitutive 3' end splicing. Mech Dev, 109(2), 183-193. Torres-Padilla, M. E., Sladek, F. M. et Weiss, M. C. (2002) Developmental^ regulated N- terminal variants of the nuclear receptor hepatocyte nuclear factor 4alpha mediate multiple interactions through coactivator and corepressor-histone deacetylase complexes. J Biol Chem, 277(47), 44677-44687. Troughton, W. D. et Trier, J. S. (1969) Paneth and goblet cell renewal in mouse duodenal crypts. J Cell Biol, 41(1), 251-268. Truscott, M., Raynal, L., Premdas, P., Goulet, B., Leduy, L., Berube, G. et Nepveu, A. (2003) CDP/Cux stimulates transcription from the DNA polymerase alpha gene promoter. Mol Cell Biol, 23(8), 3013-3028. Truscott, M, Raynal, L., Wang, Y., Berube, G., Leduy, L. et Nepveu, A. (2004) The N- terminal region of the CCAAT displacement protein (CDP)/Cux transcription factor functions as an autoinhibitory domain that modulates DNA binding. J Biol Chem, 279(48), 49787-49794. Truscott, M., Denault, J. B., Goulet, B., Leduy, L., Salvesen, G. S. et Nepveu, A. (2007) Carboxyl-terminal proteolytic processing of CUX1 by a caspase enables transcriptional activation in proliferating cells. J Biol Chem, 282(41), 30216-30226. Truscott, M., Harada, R., Vadnais, C, Robert, F. et Nepveu, A. (2008) pi 10 CUX1 cooperates with E2F transcription factors in the transcriptional activation of cell cycle- regulated genes. Mol Cell Biol, 28(10), 3127-3138. Tsukita, S., Furuse, M. et Itoh, M. (2001) Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol, 2(4), 285-293. 343 Turner, J. R. (2009) Intestinal mucosal barrier function in health and disease. Nat Rev Immunol, 9(11), 799-809. Ueda, A., Takeshita, F., Yamashiro, S. et Yoshimura, T. (1998) Positive regulation of the human macrophage stimulating protein gene transcription. Identification of a new hepatocyte nuclear factor-4 (HNF-4) binding element and evidence that indicates direct association between NF-Y and HNF-4. J Biol Chem, 273(30), 19339-19347. Ueda, Y., Su, Y. et Richmond, A. (2007) CCA AT displacement protein regulates nuclear factor-kappa beta-mediated chemokine transcription in melanoma cells. Melanoma research, 17(2), 91-103. Umetani, N., Sasaki, S., Watanabe, T., Shinozaki, M., Matsuda, K., Ishigami, H., Ueda, E. et Muto, T. (1999) Genetic alterations in ulcerative colitis-associated neoplasia focusing on APC, K-ras gene and microsatellite instability. Jpn J Cancer Res, 90(10), 1081-1087. Unger, R. H. et Eisentraut, A. M. (1969) Entero-insular axis. Archives of internal medicine, 123(3), 261-266. van de Wetering, M., Sancho, E., Verweij, C, de Lau, W., Oving, I., Hurlstone, A., van der Horn, K., Batlle, E., Coudreuse, D., Haramis, A. P., Tjon-Pon-Fong, M., Moerer, P., van den Born, M, Soete, G., Pals, S., Eilers, M., Medema, R. et Clevers, H. (2002) The beta- catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell, 111(2), 241-250. van der Flier, L. G. et Clevers, H. (2009) Stem cells, self-renewal, and differentiation in the intestinal epithelium. Annu Rev Physiol, 71, 241-260. van der Flier, L. G., Haegebarth, A., Stange, D. E., van de Wetering, M. et Clevers, H. (2009) OLFM4 is a robust marker for stem cells in human intestine and marks a subset of colorectal cancer cells. Gastroenterology, 137(1), 15-17. van der Flier, L. G., van Gijn, M. E., Hatzis, P., Kujala, P., Haegebarth, A., Stange, D. E., Begthel, H., van den Born, M., Guryev, V., Oving, I., van Es, J. H., Barker, N., Peters, P. J., van de Wetering, M. et Clevers, H. (2009) Transcription factor achaete scute-like 2 controls intestinal stem cell fate. Cell, 136(5), 903-912. van der Sluis, M, Melis, M. H., Jonckheere, N., Ducourouble, M. P., Buller, H. A., Renes, I., Einerhand, A. W. et Van Seuningen, I. (2004) The murine Muc2 mucin gene is transcriptionally regulated by the zinc-finger GATA-4 transcription factor in intestinal cells. Biochem Biophys Res Commun, 325(3), 952-960. Van der Sluis, M, De Koning, B. A., De Bruijn, A. C, Velcich, A., Meijerink, J. P., Van Goudoever, J. B., Buller, H. A., Dekker, J., Van Seuningen, I., Renes, I. B. et Einerhand, A. W. (2006) Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology, 131(1), 117-129. 344 van Es, J. H., Jay, P., Gregorieff, A., van Gijn, M. E., Jonkheer, S., Hatzis, P., Thiele, A., van den Born, M., Begthel, H., Brabletz, T., Taketo, M. M. et Clevers, H. (2005) Wnt signalling induces maturation of Paneth cells in intestinal crypts. Nature cell biology, 7(4), 381-386. van Es, J. H., van Gijn, M. E., Riccio, O., van den Born, M, Vooijs, M, Begthel, H., Cozijnsen, M., Robine, S., Winton, D. J., Radtke, F. et Clevers, H. (2005) Notch/gamma- secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature, 435(7044), 959-963. Van Itallie, C, Rahner, C. et Anderson, J. M. (2001) Regulated expression of claudin-4 decreases paracellular conductance through a selective decrease in sodium permeability. J Clin Invest, 107(10), 1319-1327. Van Itallie, C. M., Fanning, A. S. et Anderson, J. M. (2003) Reversal of charge selectivity in cation or anion-selective epithelial lines by expression of different claudins. Am J Physiol Renal Physiol, 285(6), F1078-1084. Van Itallie, C. M. et Anderson, J. M. (2006) Claudins and epithelial paracellular transport. Annu Rev Physiol, 68, 403-429. van Wijnen, A. J., Aziz, F., Grana, X., De Luca, A., Desai, R. K., Jaarsveld, K., Last, T. J., Soprano, K., Giordano, A., Lian, J. B. et et al. (1994) Transcription of histone H4, H3, and HI cell cycle genes: promoter factor HiNF-D contains CDC2, cyclin A, and an RB-related protein. Proc Natl Acad Sci USA, 91(26), 12882-12886. van Wijnen, A. J., van Gurp, M. F., de Ridder, M. C, Tufarelli, C, Last, T. J., Birnbaum, M, Vaughan, P. S., Giordano, A., Krek, W., Neufeld, E. J., Stein, J. L. et Stein, G. S. (1996) CDP/cut is the DNA-binding subunit of histone gene transcription factor HiNF-D: a mechanism for gene regulation at the Gl/S phase cell cycle transition point independent of transcription factor E2F. Proc Natl Acad Sci USA, 93(21), 11516-11521. Vanhorenbeeck, V., Jacquemin, P., Lemaigre, F. P. et Rousseau, G. G. (2002) OC-3, a novel mammalian member of the ONECUT class of transcription factors. Biochem Biophys Res Commun, 292(4), 848-854. Vaquerizas, J. M., Kummerfeld, S. K., Teichmann, S. A. et Luscombe, N. M. (2009) A census of human transcription factors: function, expression and evolution. Nature reviews, 10(4), 252-263. Velcich, A., Yang, W., Heyer, J., Fragale, A., Nicholas, C, Viani, S., Kucherlapati, R., Lipkin, M., Yang, K. et Augenlicht, L. (2002) Colorectal cancer in mice genetically deficient in the mucin Muc2. Science, 295(5560), 1726-1729. Vernia, P., Gnaedinger, A., Hauck, W. et Breuer, R. I. (1988) Organic anions and the diarrhea of inflammatory bowel disease. Dig Dis Sci, 33(11), 1353-1358. 345 Vervoort, M., Zink, D., Pujol, N., Victoir, K., Dumont, N., Ghysen, A. et Dambly- Chaudiere, C. (1995) Genetic determinants of sense organ identity in Drosophila: regulatory interactions between cut and poxn. Development, 121(9), 3111-3120. Vetuschi, A., Latella, G., Sferra, R., Caprilli, R. et Gaudio, E. (2002) Increased proliferation and apoptosis of colonic epithelial cells in dextran sulfate sodium-induced colitis in rats. Dig DisSci, 47(7), 1447-1457. Vijay-Kumar, M., Sanders, C. J., Taylor, R. T., Kumar, A., Aitken, J. D., Sitaraman, S. V., Neish, A. S., Uematsu, S., Akira, S., Williams, I. R. et Gewirtz, A. T. (2007) Deletion of TLR5 results in spontaneous colitis in mice. J Clin Invest, 117(12), 3909-3921. Viollet, B., Kahn, A. et Raymondjean, M. (1997) Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4. Mol Cell Biol, 17(8), 4208-4219. Voehringer, D. (2009) The role of basophils in helminth infection. Trends in parasitology, 25(12), 551-556. Vogelstein, B., Fearon, E. R., Hamilton, S. R., Kern, S. E., Preisinger, A. C, Leppert, M, Nakamura, Y., White, R., Smits, A. M. et Bos, J. L. (1988) Genetic alterations during colorectal-tumor development. N EnglJ Med, 319(9), 525-532. Vousden, K. H. et Prives, C. (2009) Blinded by the Light: The Growing Complexity of p53. Cell, 137(3), 413-431. Waldman, T., Kinzler, K. W. et Vogelstein, B. (1995) p21 is necessary for the p53-mediated Gl arrest in human cancer cells. Cancer Res, 55(22), 5187-5190. Waller, S., Tremelling, M., Bredin, F., Godfrey, L., Howson, J. et Parkes, M. (2006) Evidence for association of OCTN genes and IBD5 with ulcerative colitis. Gut, 55(6), 809- 814. Wang, B., Cai, S. R., Gao, C., Sladek, F. M. et Ponder, K. P. (2001) Lipopolysaccharide results in a marked decrease in hepatocyte nuclear factor 4 alpha in rat liver. Hepatology, 34(5), 979-989. Wang, H., Gauthier, B. R., Hagenfeldt-Johansson, K. A., Iezzi, M. et Wollheim, C. B. (2002) Foxa2 (FINF3beta ) controls multiple genes implicated in metabolism-secretion coupling of glucose-induced insulin release. J Biol Chem, 277(20), 17564-17570. Wang, J. et Yi, J. (2008) Cancer cell killing via ROS: to increase or decrease, that is the question. Cancer biology & therapy, 7(12), 1875-1884. Wang, J. C, Stafford, J. M. et Granner, D. K. (1998) SRC-1 and GRIP1 coactivate transcription with hepatocyte nuclear factor 4. J Biol Chem, 273(47), 30847-30850. 346 Wang, L., Gao, J., Dai, W. et Lu, L. (2008) Activation of Polo-like kinase 3 by hypoxic stresses. J Biol Chem, 283(38), 25928-25935. Wang, Q., Xie, S., Chen, J., Fukasawa, K., Naik, U., Traganos, F., Darzynkiewicz, Z., Jhanwar-Uniyal, M. et Dai, W. (2002) Cell cycle arrest and apoptosis induced by human Polo-like kinase 3 is mediated through perturbation of microtubule integrity. Mol Cell Biol, 22(10), 3450-3459. Wang, Z. et Burke, P. A. (2007) Effects of hepatocyte nuclear factor-4alpha on the regulation of the hepatic acute phase response. Journal of molecular biology, 371(2), 323-335. Wehkamp, J., Harder, J., Weichenthal, M., Schwab, M, Schaffeler, E., Schlee, M., Herrlinger, K. R., Stallmach, A., Noack, F., Fritz, P., Schroder, J. M, Bevins, C. L., Fellermann, K. et Stange, E. F. (2004) NOD2 (CARD15) mutations in Crohn's disease are associated with diminished mucosal alpha-defensin expression. Gut, 53(11), 1658-1664. Wehkamp, J., Salzman, N. H., Porter, E., Nuding, S., Weichenthal, M., Petras, R. E., Shen, B., Schaeffeler, E., Schwab, M., Linzmeier, R., Feathers, R. W., Chu, H., Lima, H., Jr., Fellermann, K., Ganz, T., Stange, E. F. et Bevins, C. L. (2005) Reduced Paneth cell alpha- defensins in ileal Crohn's disease. Proc Natl Acad Sci USA, 102(50), 18129-18134. Whelan, J. et McEntee, M. F. (2004) Dietary (n-6) PUFA and intestinal tumorigenesis. The Journal of nutrition, 134(12 Suppl), 3421S-3426S. Whitman, W. B., Coleman, D. C. et Wiebe, W. J. (1998) Prokaryotes: the unseen majority. Proc Natl Acad Sci USA, 95(12), 6578-6583. Wigle, J. T. et Oliver, G. (1999) Proxl function is required for the development of the murine lymphatic system. Cell, 98(6), 769-778. Williamson, E., Bilsborough, J. M. et Viney, J. L. (2002) Regulation of mucosal dendritic cell function by receptor activator of NF-kappa B (RANK)/RANK ligand interactions: impact on tolerance induction. J Immunol, 169(7), 3606-3612. Wilson, B. J., Harada, R., LeDuy, L., Hollenberg, M. D. et Nepveu, A. (2009) CUX1 transcription factor is a downstream effector of the proteinase-activated receptor 2 (PAR2). J Biol Chem, 284(1), 36-45. Wilson, J. J. et Kovall, R. A. (2006) Crystal structure of the CSL-Notch-Mastermind ternary complex bound to DNA. Cell, 124(5), 985-996. Windle, H. J., Fox, A., Ni Eidhin, D. et Kelleher, D. (2000) The thioredoxin system of Helicobacter pylori. J Biol Chem, 275(7), 5081-5089. Wolpin, B. M. et Mayer, R. J. (2008) Systemic treatment of colorectal cancer. Gastroenterology, 134(5), 1296-1310. 347 Wren, A. M. et Bloom, S. R. (2007) Gut hormones and appetite control. Gastroenterology, 132(6), 2116-2130. Wu, Z., Puigserver, P., Andersson, U., Zhang, C, Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R. C. et Spiegelman, B. M. (1999) Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell, 98(1), 115-124. Xavier, R. J. et Podolsky, D. K. (2007) Unravelling the pathogenesis of inflammatory bowel disease. Nature, 448(7152), 427-434. Xie, S., Wang, Q., Wu, H., Cogswell, J., Lu, L., Jhanwar-Uniyal, M. et Dai, W. (2001) Reactive oxygen species-induced phosphorylation of p53 on serine 20 is mediated in part by polo-like kinase-3. J Biol Chem, 276(39), 36194-36199. Xie, S., Wu, H., Wang, Q., Cogswell, J. P., Husain, I., Conn, C, Stambrook, P., Jhanwar- Uniyal, M. et Dai, W. (2001) Plk3 functionally links DNA damage to cell cycle arrest and apoptosis at least in part via the p53 pathway. J Biol Chem, 276(46), 43305-43312. Xie, X., Liao, H., Dang, H., Pang, W., Guan, Y., Wang, X., Shyy, J. Y., Zhu, Y. et Sladek, F. M. (2009) Down-Regulation of Hepatic HNF4{alpha} Gene Expression during Hyperinsulinemia via SREBPs. Molecular endocrinology, 23(4), 434-443. Xie, Y. B., Nedumaran, B. et Choi, H. S. (2009) Molecular characterization of SMILE as a novel corepressor of nuclear receptors. Nucleic Acids Res, 37(12), 4100-4115. Xiong, Y., Hannon, G. J., Zhang, H., Casso, D., Kobayashi, R. et Beach, D. (1993) p21 is a universal inhibitor of cyclin kinases. Nature, 366(6456), 701-704. Xu, L., Hui, L., Wang, S., Gong, J., Jin, Y., Wang, Y., Ji, Y., Wu, X., Han, Z. et Hu, G. (2001) Expression profiling suggested a regulatory role of liver-enriched transcription factors in human hepatocellular carcinoma. Cancer Res, 61(7), 3176-3181. Yamagata, K., Furuta, H., Oda, N., Kaisaki, P. J., Menzel, S., Cox, N. J., Fajans, S. S., Signorini, S., Stoffel, M. et Bell, G. I. (1996) Mutations in the hepatocyte nuclear factor- 4alpha gene in maturity-onset diabetes of the young (MODY1). Nature, 384(6608), 458-460. Yamagata, K., Daitoku, H., Shimamoto, Y., Matsuzaki, H., Hirota, K., Ishida, J. et Fukamizu, A. (2004) Bile acids regulate gluconeogenic gene expression via small heterodimer partner-mediated repression of hepatocyte nuclear factor 4 and Foxol. J Biol Chem, 279(22), 23158-23165. Yamaguchi, Y. et Yoshikawa, K. (2001) Cutaneous wound healing: an update. The Journal of dermatology, 28(10), 521-534. Yamamoto, T., Shimano, H., Nakagawa, Y., Ide, T., Yahagi, N., Matsuzaka, T., Nakakuki, M., Takahashi, A., Suzuki, H., Sone, H., Toyoshima, H., Sato, R. et Yamada, N. (2004) 348 SREBP-1 interacts with hepatocyte nuclear factor-4 alpha and interferes with PGC-1 recruitment to suppress hepatic gluconeogenic genes. J Biol Chem, 279(13), 12027-12035. Yang, H. Y., Wen, Y. Y., Chen, C. H., Lozano, G. et Lee, M. H. (2003) 14-3-3 sigma positively regulates p53 and suppresses tumor growth. Mol Cell Biol, 23(20), 7096-7107. Yang, Q., Bermingham, N. A., Finegold, M. J. et Zoghbi, H. Y. (2001) Requirement of Mathl for secretory cell lineage commitment in the mouse intestine. Science, 294(5549), 2155-2158. Yang, Y., Zhang, M., Eggertsen, G. et Chiang, J. Y. (2002) On the mechanism of bile acid inhibition of rat sterol 12alpha-hydroxylase gene (CYP8B1) transcription: roles of alpha- fetoprotein transcription factor and hepatocyte nuclear factor 4alpha. Biochim Biophys Acta, 1583(1), 63-73. Yasuda, S., Arii, S., Mori, A., Isobe, N., Yang, W., Oe, H., Fujimoto, A., Yonenaga, Y., Sakashita, H. et Imamura, M. (2004) Hexokinase II and VEGF expression in liver tumors: correlation with hypoxia-inducible factor 1 alpha and its significance. Journal of hepatology, 40(1), 117-123. Ye, D. Z. et Kaestner, K. H. (2009) Foxal and Foxa2 control the differentiation of goblet and enteroendocrine L- and D-cells in mice. Gastroenterology, 137(6), 2052-2062. Yin, J., Harpaz, N., Tong, Y., Huang, Y., Laurin, J., Greenwald, B. D., Hontanosas, M., Newkirk, C. et Meltzer, S. J. (1993) p53 point mutations in dysplastic and cancerous ulcerative colitis lesions. Gastroenterology, 104(6), 1633-1639. Yoon, J. C, Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C. R., Granner, D. K., Newgard, C. B. et Spiegelman, B. M. (2001) Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature, 413(6852), 131-138. Yoshida, E., Aratani, S., Itou, H., Miyagishi, M., Takiguchi, M., Osumu, T., Murakami, K. et Fukamizu, A. (1997) Functional association between CBP and HNF4 in trans-activation. Biochem Biophys Res Commun, 241(3), 664-669. Yoshida, H., Honda, K., Shinkura, R., Adachi, S., Nishikawa, S., Maki, K., Ikuta, K. et Nishikawa, S. I. (1999) IL-7 receptor alpha+ CD3(-) cells in the embryonic intestine induces the organizing center of Peyer's patches. Int Immunol, 11(5), 643-655. You, M., Fischer, M., Cho, W. K. et Crabb, D. (2002) Transcriptional control of the human aldehyde dehydrogenase 2 promoter by hepatocyte nuclear factor 4: inhibition by cyclic AMP and COUP transcription factors. Arch Biochem Biophys, 398(1), 79-86. Young, H. M., Ciampoli, D., Hsuan, J. et Canty, A. J. (1999) Expression of Ret-, p75(NTR)-, Phox2a-, Phox2b-, and tyrosine hydroxylase-immunoreactivity by undifferentiated neural crest-derived cells and different classes of enteric neurons in the embryonic mouse gut. Dev Dyn, 216(2), 137-152. 349 Yu, A. S., Enck, A. H., Lencer, W. I. et Schneeberger, E. E. (2003) Claudin-8 expression in Madin-Darby canine kidney cells augments the paracellular barrier to cation permeation. J Biol Chem, 278(19), 17350-17359. Yu, D., Wang, Z. H., Cheng, S. B., Li, H. K., Chan, H. B. et Chew, E. C. (2001) The effect of arsenic trioxide on the expression of Hsc and HNF4 in nuclear matrix proteins in HepG2 cells. Anticancer Res, 21(4A), 2553-2559. Yuan, X., Ta, T. C, Lin, M., Evans, J. R., Dong, Y., Bolotin, E., Sherman, M. A., Forman, B. M. et Sladek, F. M. (2009) Identification of an endogenous ligand bound to a native orphan nuclear receptor. PLoS ONE, 4(5), e5609. Zanetti, M. (2004) Cathelicidins, multifunctional peptides of the innate immunity. J Leukoc Biol, 75(1), 39-48. Zangar, R. C, Davydov, D. R. et Verma, S. (2004) Mechanisms that regulate production of reactive oxygen species by cytochrome P450. Toxicology and applied pharmacology, 199(3), 316-331. Zavadil, J. et Bottinger, E. P. (2005) TGF-beta and epithelial-to-mesenchymal transitions. Oncogene, 24(37), 5764-5774. Zbar, A. P., Simopoulos, C. et Karayiannakis, A. J. (2004) Cadherins: an integral role in inflammatory bowel disease and mucosal restitution. J Gastroenterol, 39(5), 413-421. Zeissig, S., Burgel, N., Gunzel, D., Richter, J., Mankertz, J., Wahnschaffe, U., Kroesen, A. J., Zeitz, M., Fromm, M. et Schulzke, J. D. (2007) Changes in expression and distribution of claudin 2, 5 and 8 lead to discontinuous tight junctions and barrier dysfunction in active Crohn's disease. Gut, 56(1), 61-72. Zeitlinger, J. et Stark, A. (2010) Developmental gene regulation in the era of genomics. Dev Biol, 339(2), 230-239. Zhang, J. V., Ren, P. G., Avsian-Kretchmer, O., Luo, C. W., Rauch, R., Klein, C. et Hsueh, A. J. (2005) Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake. Science, 310(5750), 996-999. Zhang, M. et Chiang, J. Y. (2001) Transcriptional regulation of the human sterol 12alpha- hydroxylase gene (CYP8B1): roles of heaptocyte nuclear factor 4alpha in mediating bile acid repression. J Biol Chem, 276(45), 41690-41699. Zhang, W., Tsuchiya, T. et Yasukochi, Y. (1999) Transitional change in interaction between HIF-1 and HNF-4 in response to hypoxia. Journal of human genetics, 44(5), 293-299. Zhong, W., Sladek, F. M. et Darnell, J. E., Jr. (1993) The expression pattern of a Drosophila homolog to the mouse transcription factor HNF-4 suggests a determinative role in gut formation. Embo J, 12(2), 537-544. 350 Zhong, W., Mirkovitch, J. et Darnell, J. E., Jr. (1994) Tissue-specific regulation of mouse hepatocyte nuclear factor 4 expression. Mol Cell Biol, 14(11), 7276-7284. Zhou, L., Lopes, J. E., Chong, M. M, Ivanov, II, Min, R., Victora, G. D., Shen, Y., Du, J., Rubtsov, Y. P., Rudensky, A. Y., Ziegler, S. F. et Littman, D. R. (2008) TGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat function. Nature, 453(7192), 236-240. Zhou, Z., Kang, X., Jiang, Y., Song, Z., Feng, W., McClain, C. J. et Kang, Y. J. (2007) Preservation of hepatocyte nuclear factor-4alpha is associated with zinc protection against TNF-alpha hepatotoxicity in mice. Experimental biology and medicine, 232(5), 622-628. ANNEXES Tableau 3 : Facteurs de differentiation intestinale Intestin grele Colon Unigene Titre du gene Ratio p-value Ratio p-value Mm.57229 atonal homolog 1 (Drosophila) Atohl 1,2365 0,0705 0,8202 0,3290 Mm.4875 delta-like 1 (Drosophila) DIM 1,2016 0,0360 0,8731 0,2785 Mm.441439 E74-like factor 3 Elf3 1,5497 0,0109 1,2460 0,0372 Mm.390859 hairy and enhancer of split 1 (Drosophila) Hes1 1,0365 0,7763 1,2397 0,2059 Mm. 137268 hairy and enhancer of split 5 (Drosophila) Hes5 1,0970 0,4083 1,0936 0,3469 Mm.4578 forkhead box A1 Foxal 1,4457 0,0194 1,1240 0,5779 Mm.938 forkhead box A2 Foxa2 1,3914 0,0138 1,3867 0,0926 Mm.458005 forkhead box A3 Foxa3 1,3789 0,0178 0,9361 0,7933 Mm.2078 growth factor independent 1 Gfi1 1,2898 0,0520 0,9375 0,8984 Mm.379070 insulinoma-associated 1 Insml 1,2063 0,1508 1,1336 0,5632 Mm.42242 ISL1 transcription factor, LIM/homeodomain IsM 1,2761 0,1796 0,9893 0,9579 Mm.4325 Kruppel-like factor 4 (gut) Klf4 0,9911 0,9263 0,9920 0,9464 Mm.4636 neurogenic differentiation 1 Neurodl 0,9982 0,9902 0,9123 0,6547 Mm.330639 NK2 transcription factor related, locus 2 Nkx2-2 1,0439 0,6829 0,9107 0,4288 Mm.266665 neurogenin 1 Neurogl 0 8569 0,0292 0,9227 0,5197 Mm.42017 neurogenin 2 Neurog2 0,7984 0,0226 1,1106 0,2419 Mm.57236 neurogenin 3 Neurog3 1,0421 0,6877 0,9237 0,5559 Mm.290610 Notch gene homolog 1 (Drosophila) Notchl 1,2384 0,1109 1,1284 0,3967 Mm.254017 Notch gene homolog 2 (Drosophila) Notch2 1,2802 0,0665 0,7280 0,0087 Mm.439741 Notch gene homolog 3 (Drosophila) Notch3 1,0324 0,6901 2,5307 0,0002 Mm.8026 paired box gene 4 Pax4 0,8769 0,2465 1,0754 0,3824 Mm.3608 paired box gene 6 Pax6 0,9925 0,9277 1,0236 0,8277 Mm.2533 paired box gene 8 Pax8 0,6384 0,0075 1,0558 0,4802 Mm.389714 pancreatic and duodenal homeobox 1 Pdx1 0,9195 0,3159 1,0781 0,5575 Mm.286407 SRY-box containing gene 9 Sox9 1,4990 0,0305 1,0542 0,8474 Tableau 4 : Hormones enteroendocrines Intestin grele Colon Unigene Titre du gene Ratio p-value Ratio p-value Mm.441696 agouti related protein Agrp 1,1476 0,1099 1,0806 0,5491 Mm.4137 chromogranin A Chga 1,0479 0,6400 0,9385 0,8628 Mm.30041 coatomer protein complex subunit alpha (xenin) Copa 0,9777 0,7302 0,9699 0,6655 Mm.2619 cholecystokinin Cck 1,8713 0,0048 1,3507 0,1130 Mm.12906 dopa decarboxylase Ddc 0,9410 0,5256 1,3273 0,1398 Mm.379095 ghrelin Ghrl 1,9934 0,0000 1,1469 0,2402 Mm.4767 gastrin Gast 0,9516 0,7541 1,1727 0,0761 Mm.45494 glucagon Gcg 1,3571 0,0028 0,2630 0,0031 Mm.456 gastric intrinsic factor Gif 1,6097 0,0488 1,1159 0,2850 Mm.248452 gastric inhibitory polypeptide Gip 0,2692 0,0000 1,1609 0,1461 Mm.20298 gastrin releasing peptide Grp 1,0358 0,5903 0,2786 0,0038 Mm.22246 neuromedin B Nmb 0,9599 0,6664 0,9949 0,9610 Mm. 154796 neuropeptide Y Npy 0.8067 0,0541 1,0090 0,9473 Mm.64201 neurotensin Nts 0,4481 0,0001 0,1503 0,0008 Mm. 1269 pancreatic polypeptide Ppy 1,0269 0,7215 1,0548 0,6804 Mm.46248 peptide YY Pyy 1,8679 0,0238 0,9346 0,6977 Mm.5038 secretogranin II Scg2 1,3254 0,0168 0,3073 0,0198 Mm.4723 secretin Set 0,9804 0,8172 1,0702 0,8135 Mm.2453 somatostatin Sst 0,8986 0,3002 0,4099 0,0332 Mm.223674 synaptophysin Syp 1,2534 0,0099 1,0123 0,9007 Mm. 1440 tachykinin 1 Tad 1,7834 0,0391 0 5303 0,0368 Mm.248684 tryptophan hydroxylase 1 Tph1 1,6002 0,0134 0,7667 0,5232 Mm.98916 vasoactive intestinal polypeptide Vip 0,7481 0,1850 0,3496 0,1089 353 Figure 7 : Genes communs entre la souris Sodl"7", les souris traitees au Diquat et le jejunum des souris Hnf4ocAI c Sod1~"" • DQ 12hRBf Hnf4a"ec Up-regulated 1 25x, p < 05 Down-regulated 1 25x, p < 05 Gene symbol Sod1- DQ12h Hnf4oalEC Up Cebpd 1 16 5 41 3 55 MM 4 52 8 29 2 76 Gadd45g -103 4 31 2 09 Rab30 2 50 18 57 197 Tubb2a 2 68 3 50 1 94 Cdknla 1 48 4 16 194 Gadd45b 1 14 1143 189 Atf3 3 40 1 19 175 Cdknla 1 89 147 1 74 ZbtbIB -1 08 8 11 158 Ddlt4 2 27 520 151 Down Dbp -2 13 -3 55 -4 30 Hsd3b3 -1 08 -2 48 -2 62 Sod1 -125 p-value < 05