This item is the archived peer-reviewed author-version of:

DNA barcoding from the Congo and the Lower Guinean provinces : assembling a reference library for poorly inventoried fauna

Reference: Sonet Gontran, Snoeks Jos, Nagy Zoltán T., Vreven Emmanuel, Boden Gert, Breman Floris C., Decru Eva, Hanssens Mark, Ibala Zamba Armel, Jordaens Kurt, ....- DNA barcoding fishes from the Congo and the Low er Guinean provinces : assembling a reference library for poorly inventoried fauna Molecular ecology resources - ISSN 1755-098X - 19:3(2019), p. 728-743 Full text (Publisher's DOI): https://doi.org/10.1111/1755-0998.12983 To cite this reference: https://hdl.handle.net/10067/1579890151162165141

Institutional repository IRUA This article isprotected rights by All copyright. reserved. 10.1111/1755 doi: lead todifferences version between this andthe of Version Reco been and throughtypesetting, proofreadingwhich may thecopyediting, process, pagination This article undergone has for and buthas accepted been not review publication fullpeer 9 8 7 6 5 4 3 2 1 * Corresponding author ([email protected]) Erik Verheyen MusschootTobias Breman G DNA barcoding Running title reference barcod DNA Articletype : Resource Article GONTRANMR. SONET (Orcid ID 0000:

Accepted Articleontran 4000 Liège, EvolutionaryMorphologyLaboratory,andFunctional Liège, of University Republic of the Congo. Mbanza P. S. I. Leuven, Belgium. Herestraat 49 O&N1, Gasthuisberg KULeuven, Core Genomics UZLeuven, 1, B Antwerp, of University Congo. DéveloppementB.P. Ngouabi,deRural,Institut Marien Université Wageningen, NetherlandsThe Research and University Wageningen 3 and Biodiversity of Laboratory Leuven, KU Leuvensesteenweg 13, Africa, Central for Museum Royal 29, and OD Sciences, Natural of Institute Belgian Royal 000 B - 2 2610 Antwerp, Belgium.

- ,4 Leuven, Belgium. 1 Sonet* ,

libra 000 EvaDecru

ing

1 Brussels, , ry poorlyfor inventoried fauna Belgium. 6 1 ,

2 fish , Snoeks Jos - es Jeroen Van Houdt Jeroen Van 0998.12983 -

gnu Dpreet e ilge BP 17 Mbanza 127, B.P. Biologie, de Département Ngungu, 2

, es from MarkHanssens Belgium.

B from

Department of Biology of Department - Central AfricaCentral 3080 Tervuren, Belgium. 2 ,3

, h Congo the

.

otn T. Zoltán 7 2 , - , 0001 eatet f Biology of Department Maarten Steenberge Van ArmelIbalaZamba ,

isseais Group Biosystematics

- 7310 n te oe Gien provinces Guinean Lower the and Nagy

Evolutionary Genomics, Ch. de Bériotstraat 32, B 32, Bériotstraat de Ch. Genomics, Evolutionary -

9574) - 1

,

Evolutionary Ecology Group Ecology Evolutionary

maul Vreven Emmanuel

5 , K ,

urt Jordaens urt 1, – 2,

Dovnalete 1 60 PB 6708 1, Droevendaalsesteeg ,

etbae, Entomology, Vertebrates, 3 Phylogeny , Soleil rd. Pleasecite article this as

69 Brazzaville, Republic of the Brazzaville,ofRepublic 69 2 ,

Lunkayilakio 2 et Boden Gert , 6 , Place du 20 du Place

- - V gnu Democratic Ngungu,

JEMU ictor Mamonekeneictor - ,

Universiteitsplein o 62 B 602, box : sebig a assembling , Vautierstraat , 2 Wamuini , - Août lrs C. Floris

JEMU -

7 3000 , 8 B , 9 5 - - , , ,

This article isprotected rights by All copyright. reserved. is campaign this of goal 2009) Hebert, & Hanner, Ward, 2011; Kolokotronis, & Ward, Desalle, Hanner, 2011; Steinke, assembling Life of Barcode Fish The 1 Biodiversity, Freshwater, Keywords descriptions ichthyofauna a providedata barcode variation) intraspecific assignments inconsistent teams research independent by performed studies across morphospecies) 102 large and divergencebarcode in present morphospecies morphospecies Ogowe and province, ichthyological Guinean Lower the of basins drainage major three Here diversity. fish Congo The Abstract

AcceptedIntroduction Article 16.1% of of 16.1% - scale DNA scale

lese

a standardized reference standardized a W ietfe 194 identified We . ,

e is the Hwvr txnmc scrutiny taxonomic However, .

and Lower Guinean Lower and indispensable analysis (92.8%) barcode clusters representing putative species) putative representing clusters barcode ,

we barcoded 741 specimens from specimens 741 barcoded we < . 2.5 We c We .

measure of geneticvariability of measure Our results Our

% of initiative . corresponded

Taxonomy, to to ompar A freshwater fishes of the L the of fishes freshwater both

small fractionsmall of to delimit allow

were due to unkn to due were ed opopce blnig o 2 eea n 2 fmle. Most families. 25 and genera 82 to belonging morphospecies neighbouring

ichthyological (FISH report more than 17 putative new species and species new putative 17 than more report

ih species fish pce asgmns eoe n atr taxonom after and before assignments species library of of library COI, species

- O) s n nentoa rsac collaboration research international an is BOL) o itnt lses f N barcodes DNA of clusters distinct to I

the chthyofauna, DNA and build a ,

ctylgcl provinces ichthyological

fish provinces identification own diversity own soitd with associated barcodes ower Congo pu Congo ower

es that the

barcoded here ( facilitates the facilitates coherent Lower and Middle Congo River and from and River Congo Middle and Lower

are Central Africa

for all fish species fish all for

n observed and understudied through (undescribedspecies

were blished in 2011 (191 specimens, (191 2011 in blished referencelibrary eiin ad new and revisions 12.

also barcoded in barcoded also inventory the comparison of of comparison the ol one only , 9

% hotspots of of hotspots Kouilou of ht most that

(Becker, Hanner, & Hanner, (Becker, the

of . show that show

morphospecies . c pae and updates ic

underexplored

- ir, Nyanga Niari, show and f h four the Of

a the global the iig at aiming unknown ae of cases previous ed species

query . The . DNA DNA

This article isprotected rights by All copyright. reserved. the throughout d species reported studies 2011) libraries difficulties. librar southern part its decades 2005) al., et (Thieme document poorly remains fauna Steenberge, Vreven, Snoeks,& 2014; Wamuini, Vreven, Vandewalle, Mutambue, Snoeks, & 2010) Sh 1976; Stewart, & Roberts 2017; expeditions, field system 1 characterized is and 1975 2008 Tedesco, & Stiassny, Paugy, Oberdorff, Lévêque, 2011; al., et Darwall 2011; Darwall, Africa: Central up make that on gaps knowledge main the of One Foresti, & Oliveira, 2013; Pugedo,Andrade de Neto, Pessali, Birindelli, Carvalho, & 2016) inventoried poorly morpholog 2007) Hebert, & (Ratnasingham Data Life of Barcode the in database sequence reference the against sequences Accepted 000 Article ie bsn so ihhoanl iiaiis ih h Cno Basin Congo the with similarities ichthyofaunal show basins river ) y . described

and for and T for (Froese & Pauly, 2018) Pauly, & (Froese

he Congo he for 328 species of the Lower Congo Lower the of species 328 for (e.g.

the y h mi DA acdn suis ouig n hs region this on focusing studies barcoding DNA main The

alone Stiassny, Teugels, & Hopkins, 2007; Walsh & Mamonekene, 2014) Mamonekene, & Walsh 2007; Hopkins, & Teugels, Stiassny, is characterized by very high 206 species of of species 206 ichthyofauna species region local inventories and inventories local B areas is asin

as . insufficient

h Lwr una poic hs en oe nesvl suid n h last the in studied intensively more been has province Guinean Lower The

, a hotspot a

rm h region the from is characterized by characterized ifcl cmiain of compilation difficult

the second largest catchment area in the world after the Amazon the after world the in area catchment largest second the lmtto ise, hc are which issues, elimitation of of the

. the C Despite more than a century of taxonomic efforts taxonomic of century a than more Despite entral Africa entral

. ed Arl Mayden, (April, n of N broe libraries barcode DNA orth og B Congo

fish diversity fish and global umway et al., 2003; 2003; al., et umway new species descriptions species new - eastern part of the Congo B Congo the of part eastern

xldn lks iu n Tanganyika and Kivu lakes excluding taxonomically hyperdiverse taxonomically ag areas large levels of fish diversity fish asin

(Lowenstein, Osmundson, Becker, Hanner, Becker, Osmundson, (Lowenstein, is a is

n Lwr una provinces Guinean Lower and

complex

anr & enthz 2011) Bernatchez, & Hanner, (Snoeks, Harrison, & Stiassny, 2011) Stiassny, & Harrison, (Snoeks, endemism dniiain keys identification

of the Congo Congo the of concerns the concerns

and slow and lo aiiae pce discovery species facilitate also

rmrl de o iie exploration limited to due primarily tasy Mmnkn, 07 Van 2007; Mamonekene, & Stiassny .

T hedevelopment of ( e.g. asin process Boulenger, 1901; Boulenger, fauna B

two sn ean un remain asin salse DA barcoding DNA established impeding

Bok e a. 2011) al., et (Brooks ( Decru et al., 2016) al., et Decru ichthyo s

, which is which , (L. H. Pereira, Hanner, Pereira, H. (L. and

.

and Although s Although Bok, le, & Allen, (Brooks,

identif faunal a

with Systems

the DNA reference atclry in particularly

. fraught with fraught , Decru et al., et Decru der

with & Stiassny, &

Malagarazi

cto of ication numerous ; Roberts, ; provinces explored ome ,

. Both .

about when BOLD Basin i , , its of ts

This article isprotected rights by All copyright. reserved. Brazzaville) 2007 during sampled were specimens 741 of total A 2.1 2 obtained for thesame databefore set combined to independently for across and barcod DNA Congo to related data taxonomical pursu species and characters involvedare deeply Guinea Lower and used Regi African the of recommendations the with line In Musschoot, Snoeks, Schliewen,& 2016) ( approaches taxonomic regions knowledge. ecological and taxonomic level, species the to specimens

AcceptedMaterials and M Article Sampling rswtr fish freshwater

DNA barcoding as a tool a as barcoding DNA e i n the Democratic Republic of the Congo (DRC) and in the Republic of the Congo Congo the of Republic the in and (DRC) Congo the of Republic Democratic the n

two is identifications

expose

ichthyologic

(Fig. 1 and 1 (Fig. e data e betvs (1) objectives: ascertain

for the same the for DNA barcodes is recognized as recognized is barcodes DNA d n

ethods confirm the confirm to a to in ichthyological es

the

unamb

Table S1 Table al 2 al., et Janzen 2015; Hanner, & (Hubert plethora of species identification problems which should be addressed with addressed be should which problems identification species of plethora y 1 evaluating (1) by e.g.

provinces revision

to Decru, Vreven, & Snoeks, 2012, 2013; Lowenstein et al., 2011; Vreven, 2011; al., et Lowenstein 2013; 2012, Snoeks, & Vreven, Decru, part of the Congolese drainage sy drainage Congolese the of part iguous speciesidentifications and (2)

to link presumed ) . ak f pce dsrbto data, distribution species of lack

inventory the inventory In the Congo the In

provinces

of the Afr the of . lese and L and lese N broe sequences barcode DNA

We also We (in 2012) s consequence, a As .

conspecificity of morphologically identified species identified morphologically of conspecificity

. otropical hte DA acd libraries barcode DNA whether

O assess ower Guinean fish biodiversity; fish Guinean ower lese ur team comprises experienced fish taxonomists that taxonomists fish experienced comprises team ur

an and fish four field campaigns field four

appropriate ichthyological province (CO province ichthyological

after biodiversity the dynamics of building of dynamics the

fish fauna. onal Working Group of FISH of Group Working onal

(in

the 2018

to s

N barcoding DNA strategy tem of several areas several of T morphospecies ) he combined use of useof hecombined 0; ht & hkr 2017) Thaker, & Sheth 009; recent compar and

(Lowenstein et al., 2011) al., et (Lowenstein carried out carried crnc ak f up of lack chronic a to taxonomic updates. ing improve

a DNA barcoding results (2) to (2) ),

of ht r generated are that

DNA barcode DNA

and we sampled we of the Congo the of between fish -

the

BOL BOL assess nih existing enrich es morphological

reliability rm the from (

2008) 2004 and 2004

whether - (Congo to

can be can a tot a

library within Basin - . date ,

We we

se of al -

This article isprotected rights by All copyright. reserved. represented morphological used ‘ RMCA. ( al. et using achieved was of presence difficult rather be to proved were specimens All 2.2 formalin and stored individually (Hallprint tags anchor bar F Polo specimens belongs sites sampling re DRC), specimens 496 of sp. ishes were caught were ishes Accepted Articlepresent ’ Morphological

- and were treated as different morphospecies in the DNA barcoding analyses (see below) (see analyses barcoding DNA the in morphospecies different as treated were and Ogoweand Ngongo) ‘ ui rgt ak DC, and DRC), bank, (right Luki 2016) cf.

Specimens that did not entirely correspond to a to correspond entirely not did that Specimens

to the Middle Congo Middle the to ’

p for specimens resembling the nominal species but showing at least one one least at showing but species nominal the resembling specimens for in three major drainagemajor threein o

or through direct comparison with type specimens and other and specimens type with comparison direct through or geographical variation point or potential r are deposited the at Royal Museum for Central Africa (RMCA, Tervuren, Belgium). tions character included in

species

of n boue r ihy concentr highly or absolute in using gill nets gill using the the drainagebasins of identified

the undescribed available taxonomic literature taxonomic available etos f the of sections that .

Lower Congo whereas Congo Lower identification Australia , because

.

devi In as

. A represen A . the Lower Guinean ichthyological province (LG) province ichthyological Guinean Lower the morphospecies

ated to the extent that we were we that extent the to ated systems éii ( Léfini species of )

n ue fr N aayi. i cis ee ape and sampled were clips Fin analysis. DNA for used and the s antem f h Lwr og ad ol Malebo Pool and Congo Lower the of mainstream

ih bn, Congo bank, right the

, viz. ed n vge opooia seis boundaries species morphological vague and lack of identification keys for some areas or groups, the groups, or areas some for keys identification of lack

tative selection was selection tative to a to Djoué (rightbank, Congo

Kouilou the based on on based possible td ethanol. ated Léfini listed - Niari, known species known

undescribed species. - is situated in the in situated is their in the Supporting Information of Information Supporting the in

Brazzaville). Nyanga andNyanga oce s Voucher

xenl opooy a morphology, external individually

unable -

Brazzaville were indicated with indicated were h three The voucher Ogowe (includingOgoweO p t cmn wr fxd in fixed were ecimens o decide o

tagged using tagged Middle Congo. Middle W , we sampled we ,

), Inkisi), (leftbank, e usede specimens first

whether . tributaries ‘ diagnostic

sp. task task This task This nylon which , ’

‘

gowe, cf. the at

D Other when . W . ecru that 245 this ’

or T e -

This article isprotected rights by All copyright. reserved. paragenetypesfo ( USA). m the following chemistry v3.1 BigDye or v1.1 BigDye using sequencers capillary automated ABI on out carried was sequencing DNA primers. vector M13 vacuum and Germany) Nagel, Pla PCR 96 NucleoFast the using or USA) Healthcare, (GE columns kit purification DNA using visualized 72 s; 60 for °C The M13 ( (2005) versio tailed the ox region barcode 1 and quantity DNA tissue. for protocols standard following (Qiagen kits Tissue & Blood DNeasy using extracted was DNA genomic Total 2.3 specimen that was considered asan specimens examined the Life Technologies Life CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 000

Accepted Articleidase DNA PCR profile was as follows: as was profile PCR

reverse( DNA sequences were quality pcrpooee (NanoDrop spectrophotometer , subunit data collection FishF1 – 27)

— t ( _t1 C for °C I (COI) gene (COI) I 1.2% n of the primer pair origi pair primer the of n llowing h 5’ the , USA). ,

(Messing, Crea Seeburg,& 1981) TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC agarose gel electrophoresis. Purification was done either on illustra GFX PCR GFX illustra on either done was Purification electrophoresis. gel agarose mn ad usqet trg o te ape a 4 at samples the of storage subsequent and min, 7 -

end

Chakrabarty most likely most Sequences obtained from type specimens were given the labels holo labels the given were specimens type from obtained Sequences — Fle, lc, oh Lt, Viehe, 1994) Vrijenhoek, & Lutz, Hoeh, Black, (Folmer, - as suggested by Hebert by suggested as purification. PCR products were sequenced bi sequenced were products PCR purification.

94

- °C for 3 min; 35 min; 3 for °C checked, assembled and alignedSeqScape with the v2.5 software hybrid: represent

(2010).

T cnlge, USA echnologies, nally published by published nally

Coptodon tholloni

ed

a species new species a – .

40 cycles of 94 of cycles 40 ,

anufacturer’s instructions (Life Technologies, (Life instructions anufacturer’s Cywinska, Ball and DeWaard and Ball Cywinska, ). ) T

Ward, Zemlak, Innes, Last and Hebert and Last Innes, Zemlak, Ward, apiy h sadr a standard the amplify o x using rendalli to purity

science °C for 40 s, 53 s, 40 for °C

tail

s was checked using the ND the using checked was

. M13

We also also We

- were products PCR °C. directionally using the using directionally

f h cytochrome the of

owr ( forward Te Netherlands The , )

°C for 40 s and 72 and s 40 for °C

(2003) n FishR2_t1 and use te (Macherey te d ia DNA nimal

‘x’ , we used we , – 21) for one for -

and and c - - )

This article isprotected rights by All copyright. reserved. connectivity. sparse and similarity clusters 2007) Hebert, & (Ratnasingham speci hypothetical delimit to used be among distances pairwise of distribution the in gaps detect automatically 0.1) and 0.001 between distances intraspecific maximal (prior selections). multiple for available not currently bPTP and the of the 2012) Achaz, & Brouillet, species putative any without work methods morphospecies among 2012) Meier, 2004) Strimmer, & Claude, (Paradis, U GenBank (AMNH) History Natural of Museum American the from samples all selecting available ( after obtained A+B) set (data set produc set data COI the on performed were Analyses 2.4 2 sing Accepted Article011) DNA General Mixed Yule Coalescent(GMYC) model

. Poisson EA v6.06 MEGA

This latter data set (B) set data latter This eod wt hg sqec smlrt ad onciiy ad eaae toe ih lower with those separates and connectivity, and similarity sequence high with records

analys

to using the keywords ‘ Africa Central for were were determine

n asse te xsec o a a betw gap a of existence the assessed and treeprocesses ( e used to analyse to used s :

h atmtc acd gp icvr (BD method (ABGD) discovery gap barcode automatic the priori a Tmr, tce, Peterson, Stecher, (Tamura,

molecular operatio molecular Clis Byi, rikhn, Amtog 2012) Armstrong, & Cruickshank, Boykin, (Collins, , the Refined Single Linkage (RESL) a (RESL) Linkage Single Refined the , . It was It .

nweg o seis dniy n wr dvlpd o approximate to developed were and identity species of knowledge Barcode b represent PTP) m data sets A and A+B and A sets data . It first It . merging our data with data our merging

assembled by assembled The GMYC The , w , es ’ odel ,

e ‘ performs a performs . Congo s The RESL analysis was performed using the BOLD System BOLD the using performed was analysis RESL The calculated

the largest data set data largest the nal taxonomic units ( units taxonomic nal

( Zhang, Kapli, Pavlidis, Stamatakis,& 2013). (single threshold approach) threshold (single ’

and

h BD ehd a used was method ABGD The an independent rese independent an

iisi & ua, 2013) Kumar, & Filipski, (Ponsal., 2006) et

single linkage clustering of of clustering linkage single

‘ whereas RESL was only used for data set A set data for usedonly was RESL whereas pairwise fish ed here (data set A) and on a combined data combined a on and A) set (data here ed ’

the ( een TableS1

nalysis

records uncorrected p uncorrected

of freshwater fish sequences fish freshwater of itne within distances and using uncorrected p uncorrected using and M OTUs) ) .

(

Ratnasingham and published by published arch team arch from a Bayesian implementation DNA barcodes DNA and the and

. - and

distances

We the DNA barcodes DNA the (Puil the ih eal settings default with

. opopce and morphospecies

h R akg ape package R the It onodd from downloaded then

ade Lambert, landre,

records records Lowenstein et al. et Lowenstein b was & PTP PTP

Hebert (Srivathsan & (Srivathsan ABGD, G - applied compiled by compiled distances , which , models are models and then and publicly , 2013)

(tool MYC four four . All . can

to ,

This article isprotected rights by All copyright. reserved. were mixed with other sequences (singleton) sequence single one classificatio tree. the not95%)bootstrap and value> (with amixed were with MOTUs species delimiting 1 Mormyridae). the set constructed were trees (NJ) joining neighbour above finally generations. ( b on run wereanalyses Both analysis conducted for used trees phylogenetic inference substitutions of number the in transition a on intra and concept. species phylogenetic the on based Lanfear, Calcott, Kainer, Mayer & 000 s priin cee n best and scheme partition est

Accepteds Article

data set (>60 sequences per family for Alestidae, Cichlidae, , Distochodontidae Cyprinidae, Cichlidae, Alestidae, for family per sequences (>60 set data A and A

replicates.

evaluatedagreement the between the morphospecies and the DNA barcodeclusters and . Rather, we Rather, .

was - species branching species (BI) hs nlss a performed was analysis This A+B those those using s vial i 21 ad n 2018 in and 2012 in available ns

Convergencew conducted of phylogeny and the and phylogeny of Node support of the NJ trees trees NJ the of support Node and for the five families that are re are that families five the for and

Given the conceptual problems associated with the interpretation of NJ trees when trees NJ of interpretation the with associated problems conceptual the Given the Yule model and a constant clock in clockconstant a and model Yule the obtained from a tree a from obtained Mir Siag Viy, N, 2006) Ng, & Vaidya, Shiyang, (Meier,

used it used sn RAxML using

the CIPRES ScienceGatewayCIPRES the to assess if assess to

rates on a time a on rates as MC and GMYC checked

ee o aaye a clusters as analysed not were .

-

Stamatakis, i substitution fit maximum likelihood (ML) method (ML) likelihood maximum -

all based cluster analysis. cluster based

(Stamatakis and t and DNA barcodes DNA b o dt st A n AB and A+B and A sets data for - T, epciey T respectively. PTP,

calibrated ultrametric tree ultrametriccalibrated The first The he first 25% of the trees were discardedwere(“burn treesthe of 25% first he . was

2014)

O u

and does not require an ultrametric tree ultrametric an require not does and bviously, sing evaluated by non by evaluated presented by the highest numberhighest the by presented , oes siae uig attoFne v 1.1 v. PartitionFinder using estimated models

.

2015) MEGA v6.06 MEGA For

identifies (Miller BEAST2 (Bouckaert et al., 2 al., (Bouckaert et BEAST2

DNA barcodes obtained for obtained BI, t opopce ht ee ersne by represented were that morphospecies w dd o ue h N te t delimit to tree NJ the use not did we ,

ih 00 otta pseudo bootstrap 1000 with wo parallel runs wererun for

For , Pfeiffer, & Schwartz & Pfeiffer, ,

They . the tran the he

the (Tamura et al., 2013) al., et (Tamura

- is phylogenetic first parametric bootstrapping using bootstrapping parametric

each latter

were only considered if they if considered only were were used to reconstruct t reconstruct to used were from other whereas the second is based is second the whereas sition points between inter between points sition morphospecies clusteredmorphospecies

analysis, sn te taxonomical the using morpho 014) ,

of sequences in sequences of 2010) d istance analys

. T . for the data the for - replicates . he second he 20

speciesin usingthe obtained Bayesian - in”)

million - i w s based . a We nd he as - .

This article isprotected rights by All copyright. reserved. lowerwas than theresults 2018of (92.8%,see above). tree NJ the in thefound clusters the with 2012, agreement in morphospecies inof proportion available classification taxonomic the with analysed was set data same the When lumped (and sometimesshared their DNA barcodes) with other morphospecies with here analysed (92.8%) morphospecies 2A). (Fig. morphospecies MOTUs different partition, morphospecies other with lumped were 18 while species, putative different in split partitions 0.001 207 were COI of basis exclusive the on identified between within distances (0 overlapped ranges their as gap barcoding those than lower much singletons morpho per morphospecies BCOVR001 obtained We 3.1 3

Accepted Article Results The

provisional names provisional , 0 (RESL), 207 ),

new

Marcusenius moorii Marcusenius ) ( d - . Table S1 Table 7 to 17

sacs mn broe o te ae MOTUs same the of barcodes among istances species averaged 3.82 averagedspecies Pairwise p Pairwise DNA barcode library DNA , 82 genera 82 ,

lra camerunensis Clarias BCOVR741 (1.5 ). barcodes

204 For example, i example, For - – distancesobservedw

81) bt o lwr xet hn hn comparisons when than extent lower a to but 28.1%), and eight representing nominal species nominal representing eight and observed among morphospecies (20 morphospecies among observed –

212 , h cutrn otie i obtained clustering The

25 families 25 -

17 and f 589 of GY) n 186 and (GMYC)

n h Ba the in

( and ranged and data set M. kutuensis M. n the partition considering 207 207 considering partition the n –

and 10 ord 10 and (Table S2 and S2 (Table 652 (Clariidae)

A) cd o Lf Dt Sses BOLD) Systems, Data Life of rcode ae ar (bp) pairs base ithin eachmorphospecies(mean=0.96ithin

– from 1 from 10

– Mryia) (3.4 (Mormyridae) – 210 ( 210 ers 2 (bPTP). 220 .

7 (0 ad 0 and % te J tree NJ the n

– ( Fig. S1 Fig. to 27 to

.% ecee te neseii p interspecific the exceeded 7.2%) Table S1 Table ABGD (55 ) –

. The .

with . for for 28.1 7 )

(0 %) l mtos rdcd ey similar very produced methods All . morphospecies

) The number of sequences obtained sequences of number The – 741

were split in different in split were

, respectively). %, 1.9%) prior maximal distances of 0.013 of distances maximal prior (Fig. 2 (Fig.

14 – MOTUs ocre with concurred 4.6%).

remaining morphospecies remaining specimens A vrapd ih hs of those with overlapped ) , . The 17 morphospecies were morphospecies 17 However, t However,

(see below) (see were numbers of of numbers ,

%) were generallywere %) ( ersnig 194 representing (176/197=89.3%) rcs ID Process o eape p example, For were based on on based were 8 o te 194 the of 180

represented byrepresented .

here was no was here n h same the In clusters - . distances

MOTUs from , or , ( six – -

This article isprotected rights by All copyright. reserved. of reached camerunensis any show not did they although 9.4%) to s (0 provinces ichthyological within divergences divergences barcode and Only 3.2 M beninensis (singleton). with haplotype common a shared Mormyridae) (singleton, differences ( the to (2.6%) similar more Besides, 0.5%). haplotype. ocellatum gabonensis of barcodes DNA with inhaplotypegroups tree. NJ the of clusters the matching In pecimens from different ichthyological provinces showed provinces ichthyological different from pecimens G were LG

Accepted Article some in the Congo (CO) provinces (CO) Congo the in Kouilou four orphospecies

7.2%

case , of the 194 the of (singleton) C.

Similarly, DNA barcodes DNA Similarly, - n is closest its and ihy iegn fo toe of those from divergent highly ‘ hs lo held also This ir, G (3.4 LG Niari,

cf.

cf. . , h mrhseis defined morphospecies the s,

(Clariidae), For ’

N broe for barcodes DNA in identification) clustered or maculatum

Hemichromis occurring in

the morphospecies

and for P. binotatus P. mn ihhooia poics (0.7 provinces ichthyological among Lefini4.1(divergence of lra gabonensis Clarias

the –

cluster .%. n oe ae, opopce soig io morphological minor showing morphospecies cases, some In 3.6%). (singleton), for for Labeobarbus N ba DNA

neighbouring elongatus

aatrrs beninensis Malapterurus (Fig. 3A) (Fig.

(Lefini, CO, singleton) than to presumed conspecifics occurring inoccurring conspecificspresumed to than singleton)CO, (Lefini, ercpau simus Petrocephalus lra angolensis Clarias of

sequenced The The Coptodon tholloni Coptodon rcode C. acutirostre C. .

sp. ‘intermediate’ and In o In (Cichlidae),

from CO

shared COI haplotypes: after the taxonomic update of 2018 2018 of update taxonomic the after ichthyological provinces iegne between divergence osiuu mrhlgcl differences morphological conspicuous – ne of them, of ne

here – 1.9%) (6.0 Clarias angolensis Clarias 6.1% between the groupsbetweenthe 6.1% the – were 9.4%).

) and Inkisi Four . Fg 2B) (Fig. the

(Cichlidae) (Mormyridae)

C. collected

DNA barcodes DNA important DNA barcode divergences (up divergences barcode DNA important Mlpeuia) and (Malapteruridae)

Marcusenius moorii Marcusenius The (2.4

sp. ‘Lefini’ (singleton) shared the same the shared (singleton) ‘Lefini’ sp. Ctenopoma – . .% wr i te ag o the of range the in were 1.7%)

– n h tre te morphospecies, other three the In Petrocephalus ouain o L wr dvdd in divided were LG of populations L. .% iegne between divergence 2.6%

(Clariidae) contained at least two least at contained(Clariidae)

sp. ‘Inkisi’ (Cyprinidae).

clustered with clustered both in both h seies of specimens the Petrocephalusmicrophthalmus

(data set A) from Aaatde species (Anabantidae) obtained from specimens from obtained ) but one groupclusteredbut one ) the Lower Guinean (LG) Guinean Lower the the

cf. (Mormyridae)

Ogowe Malapterurus

C. microphthalmus congicus were . C For

O L) were (LG)

still

and Clarias Clarias ,

(0.2

DNA , not LG cf. C. –

This article isprotected rights by All copyright. reserved. other (LG): Ivindomyrus in found were (9.9%) barcodes undescribed two O 3.3 M neighbouring province. lukulae undescribed (5.3 ( with province divergen barcode contrast In 5.5%) (CO) different a in collected specimens of (divergences niger Mastacembelus from populations CO the while three 2 ur results ur Accepted.9 Article – –

5.5%) 3.1%); (Fig. 3A) (Fig. Nannocharax orphospecies werelarger than those morphospecies DNA

( LG

(Fig. 3B) (Fig. ; )

, also

acd cl barcode Garra

Paramormyrops

and sp. ‘short’ (singleton) ‘short’ sp. four morpho . Interestingly, divergences Interestingly,

show Chiloglanis 0 : with ces congeneric –

cf. undescribed Pareutropius debauwi .% ihn lses n 1.9 and clusters within 0.5% sp. ‘Nyanga’ ( ‘Nyanga’ sp. from

species ornata ed with provisional names showed relatively high DNA barcode divergences barcode DNA high relatively showed names provisional with ses (4.8 usters

(Mastacembelidae) high a single the

cf.

(

(Cyprinidae, CO) (Cyprinidae, CO cf.

between rivers adjacentof omrd wt srknl dfeet opoois an morphologies different strikingly with mormyrids diversity within a single ichthyological province ichthyological single a within diversity ht eebe seis rm h nihorn province neighbouring the from species resembles that batesii morphologically

morphospecies ); sp. kingsleyae the

ichthyological province – singleton Coptodon

. the .% mn cutr) nt eae t ter egahcl origin, geographical their to related not clusters), among 9.2% river ‘ Also, o Also, debauwi Kouilou

( CO), no DNA barcode was available for representativesthefor available was of barcode DNA no CO), nii and Inkisi :

Kouilou between rivers of the same the of rivers between

, ne undescribed distichodontid was found in found was distichodontid undescribed ne Mryia, O with CO) (Mormyridae,

, >7.2% divergence >7.2%

cf. - - like ir (LG) Niari with or cluster four

rendalli hwd oh opooia dfeecs and differences morphological both showed closest ’ - –

Niari (LG), Polo (LG), Niari .% mn cutr) ec cutr representing cluster each clusters), among 5.5% (, LG) showed LG) (Schilbeidae,

the Garra ornata Garra Lefini

:

oia seis found species nominal

Cclde LG (Cichlidae, provinces

Ivindomyrus (data set A) o DA acds ee observed were barcodes DNA of s

hrd n haplotype one shared

with the other the with

( - LG Ogowe (LG), Inkisi (CO) and Lefini and (CO) Inkisi (LG), Ogowe ( 1.9 Paramormyrops )

(4.8%) ) with ) p ‘lnae (igeo) and (singleton) ‘elongate’ sp.

– ichthyological province ichthyological 4.6%)

divergences of divergences .

Coptodon

. For (Fig. 4A) (Fig.

Nannocharax

in two other two the dvret DNA divergent d

kingsleyae

. (

i. 3A Fig. neighbouring For example, For rendalli

the ,

Labeo 8.9

) hitherto Nyanga .

– S )

.

(5.3

9.4% even DNA ( with ( CO

LG For cf. – ) )

This article isprotected rights by All copyright. reserved. (0 t by represented was which (Schilbeidae) observed were divergences morphospecies, 0.5 (Mormyridae, (Nothobranchiidae 2 species three hypostomatus (Mochokidae 4 (Fig. Considerable Parauchenoglanis Parauchenoglanis 3.4% Nyanga) ( divergencesof parvus ( 8.7% basins: river different similar most morphologically the Cichlidae Distichodontidae – – Acceptedhaplotypes 4 Article 0.7% and 2.9

.

The same was observed was same The B)

with from . were found in three different river basins and showed and basins river different three in found were

, Ogowe, LG), LG), Ogowe, , F

u o them of our also also

mhlu nigricaudatus Amphilius ,

Nyanga fromLefini the DNA barcode divergences barcode DNA of CO of

divergence 4.6 (Distichodontidae ) –

withi wo well wo found 3.4% divergencewithin and betweenclades, the respectively) , – balayi

– 1.7 , Polo 4.8 1.0%) , p ‘ sp.

we detected we

( n Amphilius LG, LG, % with %

- the in – . Ogowe, C - were % divergence 2%

differentiated clades differentiated of s . singleton) and balayi the

p ‘ sp. single river Enteromius miolepisEnteromius

within a single river single a within 0.5 from nii (CO) Inkisi

Pollimyrus

duponti cf. 0 , - LG,

ie (Claroteidae) like’

(CO) (CO) different – sub omly ecie species described formally 1.4% nigricaudatus –

.

1.2% different river basins of of basins river different singleton) - Enteromius

drainage wa elongate from )

(0.7 , s represented by ) ,

among

Doumea haplotype groups haplotype and and nigripinnis – 3.8%)

Kouilou found in sympatry in found

within basin show Chromidotilapia paiim ubangiense Opsaridium ’

(

sp. ( from Lefini from Amphiliidae the Kouilou

( Kouilou were also detected also were cf.

ed ‘

of

- miolepis Niari h sm river same the (Mormyridae haplotype

sanaga showing the a divergence of of divergence a

- two haplotypestwo Niari -

Niari Lefini

( ( ( each haplotype group haplotype each , LG Fg 4A) (Fig. - CO) LG

like Nyanga, LG ,

(Amphiliidae )

,

cf. .

DNA barcode DNA

.

Fg 4B) (Fig. LG) in ’

(Fig. 4C) (Fig.

10.6 groups Chilochromis and ) Nannocharax ( 0.5 , kingsleyae Cyprinidae the

for .

– LG

Six within Fg 4C) (Fig. 10.8% Ogowe and Ogowe (Cyprinidae a seventh a –

) 13.5% C (1.4%divergence) : ) , 3. :

. show them of Epiplatys multifasciatus Epiplatys savorgnani Atopochilus 8 0 , ntoeu petersii Gnathonemus p ‘ sp. % .

, nine ) – diverg

(Cichlidae . sp. ‘ sp. Inkisi

2.6% with ed : divergence duponti

n h to last two the In sp.

cib grenfelli Schilbe

morphospecies a duponti represented by represented 1.2 , morphospecies ee on in found were in

) , ences divergence Nannocharax , CO ‘ the parvus Distichodus deep – , ) 3.8%

LG

show Ogowe , one , one of Nyanga of of ) ’

- with ) 1.4 like (LG, was .

ed of In – : ’ ’

This article isprotected rights by All copyright. reserved. all of MOTUs) morphospecies on based were comparisons when MOTUs (bPTP). 267 261 were COI 2A). (Fig. A set data in than more even ( morphospecies among and within distances Barcode pres (56 sets data were there set data 12 A+B) set 47 with morphospeciessequencesper available of number The 102 DNA191 the with merged was set data Our 3.4 within (singleton) between found divergence and (Claroteidae) In

Acceptedord Article otat w as reported also we contrast, The c ent inboth data set morpho ers Oreochromis

(0 morphospecies ombin co barcodes

– (average of 3.51 specimens sequenced per species, ranging from 1 to 27) ranging fromsequenced3.51 1 perspecies, specimens (average of

2 ( unted

both species, 48 species, . t 4

– . were for for %) overlapped with those of different MOTUs ( MOTUs different of those with overlapped %) 266 n h priin considering partition the In ed

Cichlidae) data set data P.

932 DNA barcode librar of freshwaterfish of

(

represented both in Aand B. We also observe

ABGD ( 81 singletons 81 cf. 9.2%

DNA

pantherinus s represented by represented genera

was

between

with A

sequences representing 26 representing sequences Oreochromis niloticus Oreochromis a vr sal 07) oprdt te neseii divergence interspecific the to compared (0.7%) small very was

and 3 4

prior maximal distances maximal prior (

after (12. small , 47 for for 47 which

publicly available data set data available publicly O

(singleton) (0.7 (singleton) 9 es .

% allof morphospecies) y updat niloticus

fromthe (data set A+B) COI a The

B was

single sequence single , respectively , ing the ing numbers of of numbers itne between distances

261 a lower numb lower a and Lower

MOTUs

(Fig. 2A) (Fig. (nine

O - taxonomy 1% .

0 schwebischi 3 , Fig. 4A Fig. , – Congo average )

of of DNA 23.4 . morphospecies, 96 morphospecies, MOTUs , . T

. 0.013 itne aog acds f h same the of barcodes among distances The combined The he

er than er In the same partition, same the In

1.2 . and

barcode of of

(data set B) (data set – number of morphospecies that were that morphospecies of number ). d

Table S1 Table

– –

Lowenstein et al. et Lowenstein identified on the exclusive basis of basis exclusive the on identified d 1.87 More surprisingly, More Parauchenoglanis 0.001 28. ). 0

that19 morphospecies weresplit –

the sum o sum the 28.7 7

s %), but to a lower extent than extent lower a to but %), and ranged from one to eight, to one from rangedand ) and ) ), % ) 253 , . DNA barcode library barcode DNA

, respectively) , Th 18 families 18

genera – Sarotherodon galilaeus Sarotherodon f thef is 265 data set data

42 singleton (GMYC) ( .

2011) ,

In

the p ‘ sp. 27 families 27 MOTUs

the combinedthe and 8 8 and

rep inter

overlapped

balayi containing

and 229 and resent s generic in ord (16.1% found (data - both

like’ and ers ed – .

This article isprotected rights by All copyright. reserved. matched barcodes (102). Mormyridae and (130) Distichodontidae (215), Cyprinidae (126), Cichlidae families B Eugnathichthys macroterolepis species gabonensis miolepis case, another with (A) furcidens of P with lumped was (A) Labeobarbus inconsistencies ( Cyprinidae ( sets data separate morphospecies decr tree NJ the In ( lump and split both were morphospecies 16 and morphospecies 6 species, putative more or two in TableS2 ollimyrus Acceptedthe to ourselves limit we elow, Article oia species nominal eased to 78. to eased

were f

one haplotype one ). B identified (B) r hc we which or (Fig (A)

f the of

cf.

(A) but lumped with some haplotypes of of haplotypes some with lumped but (A) 8

.

sp. ‘intermediate’ and with

), Distichodontidae (1), (1), Distichodontidae ), nigripinnis Enteromius holotaeniaEnteromius (Table S2 and Fig. S2) Fig. and S2 (Table 5 pi i dfeet lses ( clusters different in split were ) ht were that . 3

Cichlidae only only % (92.8% in data set A and A set data in (92.8% % M

Table S2 Table n the in .

caused by a lumping of morphospecies of lumping a by caused lineolatus ornata G.

independently.

amassed morpho of of

(A) with (A)

P. maculipinnis P. : upd r pi i te obnd J tree NJ combined the in split or lumped

NJ tree: tree: NJ ) B ) oth oth ) . ). species

They belong They

(B) (B),

the P. maculipinnis P. comparison of comparison data set data , M , L. , t ,

Ctenopoma (B) was (B) ae lineatus

ihs nme o sequences of number highest sp. ‘Inkisi’(A)

he proportion of of proportion he . omrde (7 Mormyridae Similarly, 1

rsn in present masuianus

opopce wr lme wt a lat n other one least at with lumped were morphospecies

s contained s (B) Enteromius ed

lumped with

and 78

to the Anabantidae (2 morphospecies (2 Anabantidae the to

morphospecies lra gabonensis Clarias (B) .4% in data set B). set data in .4% cf

Citharinus gibbosus Citharinus . clustered with

(B) both .

nigropannosum O (B) C.

) and Citharinidae (2). (2). Citharinidae and ) ther inconsistencies were due to due were inconsistencies ther Coptodon

with morphospecies clustering morphospecies

angolensis rubrostigma with aa sets data E. miolepisE.

M. sirenoides M.

with provisional names (‘ names provisional with L.

assignments

green tholloni L. (A)

d ih te pttv species putative other with ed

: stenostoma We observed that observed We snltn ) a sp was B) (singleton, (

, (A) with (A) (A), which was P

the

ee o polmtc in problematic not were eaormu interruptus henacogrammus paiim ubangiense Opsaridium identified here identified i (B) i

snltn A), (singleton, and

lsia (3 sequences), (73 Alestidae (A) with

, and DNA barcode DNA and C.

C Pollimyrus nigripinnis Pollimyrus

Some .

C. macrolepis C.

(B) gabonense Alestidae congicus in distinct clusters distinct in .

Garra split fromthe split

), Clariidae (1), Clariidae ), . f hs new these of Finally, three Finally,

2 sp. the lumping the Mormyrops 1 . l

: T : t from it cf. ’ of t of Although

(B) or he ornata (A). he 57 he ,

‘ s

DNA cf. and and

the for ’ C. In E. ): )

This article isprotected rights by All copyright. reserved. resolved were (92.8%) 194 Lower the of basins drainage major three and t With 4.1 Undescribed diversity in t 4 Mormyrops lumped cluster of divergences macroterolepis Eugnathichthys species represented inboth datasets cluster of divergences with barcodes DNA showed and province) different a in team (each provinces ichthyological different in collected were set (B ( morphospecies other kheeli Raiamas the r sets our using identified ( the some 2011) ubrostigma Discussion )

Accepted Article. and

two data set data Two opopce wt DA barcode DNA with morphospecies had DNA barcode DNA his

ed appear

Labeobarbus stenostoma Labeobarbus data set n h N tree NJ the in morphospeciesassociated to one valid

DNA barcode library barcode DNA codn t ter opopce identification morphospecies their to according six

masuianus ,

B

E. . ed morphospecies

) clustered in the NJ tree in accordance with the morphospecies assignments morphospecies the with accordance in tree NJ the in clustered )

Hence, the Hence, miolepis s 10.84%

. to to The threeThe others s larger sampling (10 sampling larger

from the two species two the from allow holotaenia Enteromius (B)

: and (Fig as

olmrs maculipinnis Pollimyrus with

four four the itnt lses f N barcodes DNA of clusters distinct . Opsaridium ubangienseOpsaridium

he new DNAbarcode library

8

of

n common in M. sirenoides ) identification of of identification DNA barcode DNA . was

741 (B) were lumped with other morphospecies other with lumped were (B) Mormyridae morphospecies(

4.6

ersne b DA barcodes DNA by represented fishes collected from the Low the from collected fishes s C – . . tholloni .

5.5%. u N te aayi showed analysis tree NJ Our were . ed

(A) T s (3 s (B) : he

according their to morphospecies identification. Only speciesname (

( una (G ihhooia province ichthyological (LG) Guinean A identical in our study our in identical , and the Fig ll C Garra

N barcode DNA and 10 and

. tholloni . . (B) Labeo altivelis ee morphospecies seven se )

M. lineolatusM. 7 were split in different clustersdifferent in split were

) w seis while species two .

a lme with lumped was

cf. Distichodontidae:

C (data set A) ornata Hwvr ohr morphospecies other However, . .

and 1 1 and

congicus Labeo . s

, oee, t However, , (B) Labeobarbus macrolepidotus f he of three of C (A er and Middle Congo River (CO) River Congo Middle and er

. annectens

) , with , they , congicus ,

that Fig Labeo greenii Labeo that .

M. M.

hs tx c taxa these 6 on i bt datasets both in found ee split were with S ) were . vn u o te eight the of out even

xnmc assignment axonomic furcidens Cyprinidae: in the in ) m

and of of s morphospecies ost these

. nigripinnis P. distinct Lowenstein et al. et Lowenstein L. after combiningafter

combined ,

(A

cf.

e a we n show and (A) ud n ould ) ( , Enteromius annectens

L. lin L. ( Both data Both

15.2% ( Fig ssociate ) t be ot . eatus .

were

data

9 Five and (A) ) in ) ) ed .

) ,

This article isprotected rights by All copyright. reserved. 2016) Gan, & Wang, Guan, Shen, 2011; 2016; al., et new morphospecies by distinguished be may taxa overlooked Other >5% divergences 1.4 seven species, known analyses barcoding DNA the (14)werethem of Th cluster also including tree NJ our by suggested 2016) al., et Vreven 2010; Berrebi, & Kasapidis, Labeobarbus Congolapiabilineata mainly a provided Indeed, the and diversity undescribed clustering.barcode DNA and NJ and bPTP GMYC, remains a major e

Accepted– Article

NJ 35 divergences 13.5% DNA barcod DNA taxa

Clarias diverging from a species living in living species a from diverging tree u to due t he results obtained for the same data set set data same the for obtained results he

was acknowledged in most DNA barcoding campaigns focusing on large river basins large river on focusingcampaignsbarcoding DNA most acknowledgedinwas ) or or ) agr ubr f inconsistenc of number larger Hubert et al., 2008; Nascimento et al., 2016; Pereira, Pazian, Hanner, Foresti, & Oliveira, & Pazian,Foresti,Hanner,Pereira, 2016; al., etNascimento al., 2008; et Hubert

, specimensas identified Brei Ceul Ktí, ahro, Tieools 21; Ts 2014; Tsigenopoulos, & Machordom, Kotlík, Chenuil, (Berrebi,

present in a single a in present four the revision of of revision the o species to es obtained here obtained es challenge within

already

tree diverging from a species living in the neighbouring ichthyological province and province ichthyological neighbouring the in living species a from diverging (Dunz, Vreven, & Schliewen,2012) & Vreven, (Dunz, C. gabonensis ) . ) three

, more specifically, more ,

reveal

he adtoa undescribed additional Three revealed in thisunderstudied species n were and hs peoyi variation phenotypic whose : A considerable proportion of the proportion of considerable A

three of the four the of ed Hepsetus

suggest the existence of of existence the suggest

province .

some

by morphological analysis

olce i a ige oain n nt soitd o any to associated not and location single a in collected led rpre by reported already C. angolensisC. another river of of river another

inconsistencies between mo between inconsistencies

morphospecies . i (Decru et al., 2013; 2013; al., et (Decru . The contribution of DNA barcoding for the detection of detection the for barcoding DNA of contribution The . s hn hs bsd n h cret aooy This taxonomy. current the on based those than es M to species that species to lil lnae wr ssetd within suspected were lineages ultiple

DNA barcode DNA

Ohr case Other . but based on the taxonomic the on based but represent - rich fauna. Indeed, our

and is

the

species er e al. et Decru o yt known yet not present in both in present more than more

are the synonymization of the same province same

se inconsistencies can b inconsistenciescan se and supported as separatedinsupportedas and MOTUs three divergences

either o oeloe boiest were biodiversity overlooked of s

er, nes & rvn 2015) Vreven, & Snoeks, Decru, r suggested are

differentli

rphology 17 not yet described (splitting described yet not

( 2016)

undescribed (

ichthyological province ichthyological lumping of of ( DNA barcodes DNA

anal . neages belonging to aneagesbelongingto - 0.7

based identifications based o eape i example, For knowledge of knowledge – yses by 3.8% within 3.8% Varicorhinus

n h N tree NJ the in

e

N barcode DNA species

(ABGD attributed toattributed igenopoulos, Enteromius

showing

( , RESL, . Most . Dec the n other 2012

nine and

ru in s is ) , . .

This article isprotected rights by All copyright. reserved. and provinces ichthyological fr specimens (496 here collected 2005) al., et Thieme 1975; Afr 4.2 recent exclude cannot we ( tribe cichlidsame the belongingto genera, related appear bPTP and GMYC RESL, (ABGD, analyses all by MOTU same the niloticus Oreochromis introgression. or species young species several barcodeinterspecificdista MOTUs and species between agreement better a in 2017) Vreven, & Snoeks, Chilala, Gajdzik, large with species markers divergences ‘intermediate’ 2017) Snoeks, species undescribedrepresent may and analyses morphometric miolepis Bezault

Acceptedis ica Article Conspecifics in

radiation in a similar a in

divided into ichthyogeographical provincesichthyogeographical into divided in order to check if they represent they if check to order in et al., 2012 al., et n h bss f N broe. hy ol sbeunl b dsigihd using distinguished be subsequently could They barcodes. DNA of basis the on Sc cases Such .

.

or or

delineations ovrey peoyi differences phenotypic Conversely, (Nwani et al., 2011)

intraspecific Coptodon adjacentichthyological DN species misidentification species ). Hence, t Hence, ).

A barcoding study barcoding A and

ae o e netgtd with investigated be to have nces would become more similar to those observed forthoseMOTUsobservedsimilar tobecomewould more nces , Sarotherodon galilaeus Sarotherodon which a dfe fo the from differ may congicus i nt sho not did h phenotypic e s

e reflects o eape te N barcodes DNA the example, For

o . observation

m

and O and CO . (Nwani et al., 2011) al., et (Nwani

Even if most of t of most if Even hg DA acd divergences barcode DNA high w provinces endemism and dispersal. and endemism variation species that cannot be identified be cannot that species ,

. tholloni C. incomplete lineage so lineage incomplete s

could 245 from from 245

MOTUs (Dunz & (Dunz showed small divergences and were grouped in grouped were and divergences small showed on the on

as reported as (data b

etween be

( ee o ascae with associated not were ugsig ht h rne o intra of ranges the that suggesting additional

the consequence of consequence the

ae on based set A) set bas he Schliewen LG

. se

Representatives of these two closely two these of Representatives

is , Fig. S1 Fig. , ) Labeobarbus

, (Van Ginneken, Decru, Verheyen, & Verheyen, Decru, Ginneken, (Van taxonomic investigations taxonomic o

in f only only

rting, taxonomic over taxonomic rting,

fish fauna composition fauna fish Labeo

apig n atraie DNA alternative and sampling Out of the 194 the of Out N barcodes DNA ,

2013) ). These ). f pcmn ietfe as identified specimens of n ws sampled was one

altivelis

are known to hybridise to known are using p ‘nii and ‘Inkisi’ sp. mn ichthyological among

introgressi small distances small

(Van Steenberge, (Van DNA barcodes DNA

n h css of cases the in morphospecies N barcode DNA - splitting or splitting in on will

( Roberts, Fig. 2 Fig. in both both in

even if even

L. result -

also and sp.

A), or -

This article isprotected rights by All copyright. reserved. assig name species Accepted common in species mor study other the in collected not were study one in collected region this of diversity ichthyological impressive specie including sets. data generated independently large Constructing 4.4 2B) observed size medium to small several includes province Guinean Lower the River, Congo main the to connected 2011)Articleal., et Nwani 2016; al., n the inNigeriaand southeastern in level system river suspected already studies barcoding DNA 4.3 illustratingdistinction the of that say can we barco DNA found those from different ( provinces . D DNAbarcoding asa d DNAbarcode divergences phospecies

eep and uniform sampl osa riv coastal

within des acsnu moorii Marcusenius ,

showing divergences of of divergences showing s mainly collected in the same part of the Co the of part same the in collected mainly s

(3 99 ers morphospecies (4/4) morphospecies 4 .5 nment has a minor effect on this on effect minor a has nment - /26

cl rfrne irre o DA acds fe rqie te seby of assembly the requires often barcodes DNA of libraries reference scale ) % of all 194 all of % Th . 2011) al., et (Brooks 3

jointeffort

s to measurements two ese opopce i common) in morphospecies

in the neighbouring provinceneighbouring the in the ichthyofauna ingnecessary is to confirm the .

within ichthyologic Compared to the Congo Basin, which includes large tributary basins tributary large includes which Basin, Congo the to Compared 0.7 ,

morphospecies

(data set A+B) – 1.7%). Combining our data set with that of of that with set data our Combining or or 2.9 species group species . cases of cases – This could explain why most cases of of cases most why explain could This h ohr opopce wr ete morphologically either were morphospecies other The 13% e

of the twoprovinces . Considering both morphology and DNA barcodes, DNA and morphology both Considering . sampled in this study this in sampled

al (Snoeks et al., 2011) al., et (Snoeks

hw ht h err soitd ih alternative with associated error the that show

intraspecific geographic resolution of COI at the at COI of resolution geographic intraspecific provinces

observation orth n DA acd clusters barcode DNA and s

(4/5 morphospecies) were found in LG in found were morphospecies) (4/5

or - eastern part of the of parteastern

resolution

were represented by distinct clusters of clusters distinct byrepresented were ngolese drainage system confirmed system drainagengolese

. This was measured was This . (data set A)

and that and .

at thislevel . T . represent divergent lineages divergent represent he majority of the species the of majority he

much work remains to be to remains work much oesen t al. et Lowenstein Congo B Congo .

( both both 221 putative 42/261 COI asin in term in divergence

( Decru etDecru

( 2011)

(Fig.

s the

of - ,

This article isprotected rights by All copyright. reserved. AcceptedRiver, (Ogowe th of places other from described all were which species, following available. name existing only the with identified were barcodes diversity. unknown treating miolepis maculipinnis sirenoides M. barcodes: DNA barcodes or teams if judge to needed detect, to difficult more is misidentification when species, related closely specimens for of possible HM418112) Article6197 ( family different a of specimens clustering compared m First, morphospe within and among distances between overlap larger and inconsistencies (more that show is treated are they way among observed inconsistencies for obtained libraries discuss reference and report intentionally studies barcoding DNA few done

to get a comprehensive knowledge of the fish diversity in diversityfish the comprehensiveofaknowledge get to dt st B) set (data isidentifications . This could be the case for for case the be could This . (A).

2) of of species assignment becomes more problematic morebecomes assignment species with correctly identified specimens of the same species. same the of specimens identified correctly with

sm rivers same e voucher and orsod to correspond (B) Anyway LG, LG, (A) Labeo lineatus Labeo , ihrns macrolepis Citharinus identified

Gabon) wih was which , formally described species described formally and most , speciment

crucial

. masuianus M. and Labeo , :

Opsaridium ubangiense Opsaridium lra gabonensis Clarias n single one

as inconsistences

Indeed,

for the reliability of DNA barcoding species identifications.DNAspecies barcoding reliability of the for

(B) mislabelling

aai velifera Sanagia the same fauna same the

(Fig. 5 (Fig. - 073 olce in collected A, and Mochokidae - the following pairs of species showing identical or very similar very or identical showing species of pairs following the 7242 i ) and of of and ) n L. greenii L.

species (A) (B), several

(

identifiedas

ewe dt st were sets data between become and olmrs nigripinnis Pollimyrus

Monostichoduslootensi

DRC 1) were 1) Ooe River, (Ogowe r ) ant e itnuse o te basis the on distinguished be cannot 3) or . This is This .

, (A) ) C. ae, ifrn lnae soig iegn DNA divergent showing lineages different cases, . n nei seis of species endemic an

M , (Ubangi River, River, (Ubangi gibbosus ( Mormyrops furcidens Mormyrops codn t is GenBank its to according saeln i as poal for probable also is islabelling obvious

not consistently recognized by independent by recognized consistently not regrettable Garra drainage systems drainage in the l the in

(B)

LG, ornata hn iietfe seies are specimens misidentified when the Etrmu holotaenia Enteromius , ibrar CO,

Gabon)

This Lower Congo. Lower

because This A ad n hpoye of haplotype one and (A)

y combining data sets A and B and A sets combiningdata y

asd by caused in datasetin Central African Republic African Central ( HM418231 a lkl te ae o the for case the likely was would

,

(A) or or Cameroon. neois rubrostigma Enteromius

inconsistencies and the and inconsistencies geographically distant geographically oe investiga more and

explain the aberrant the explain

B, Cyprinidae)withB, dfeet a of way different a ceso number accession Unfortunately,too , Fig. 6 Fig. , M. lineolatus M. oce t voucher h sm is same The ). Our resultsOur (B) For moreFor

of of in is tion and - ) cies) DNA 062

and (B)

P. P. E. - , .

This article isprotected rights by All copyright. reserved. consistency the and Mwale,Hanner, Swartz,& 2008) diversity endemismlevelsof fishandfreshwaterhigh with DRC the as particu Of support. logistical and capacity of lack a and inaccessibility conflicts, to due problematic remains field the in species of collection representative geographically specimens rate the Unfortunately, to descriptions) formal MOTUs of divergentDNA with barcodes areas unexplored fromsamples new of sequencing the that implies taxonomy established an on based tool identification species barcodinga as works ideally DNA included. be will populations more and species more when surveys biodiversity comprehensive from far is library reference barcode reliable provide to necessary are highlight species boundariesspeciesare unknown. DNA i accurate less inevitably are assignments Taxonomic a to Similarly either nigripinnis ( names provisional with us by identified macroterolepis Eugnathichthys d omrde cnan eea o wih uh f h seis diversity species the of much which for genera contain Mormyridae) nd

Acceptedguide further taxonomic investigation Article newphenotypes hitherto unknown for delineations specific )

in the field the in do not show any DNA barcode divergence with the described species and species described the with divergence barcode DNA any show not do n hs study this in the study of of study the cases where cases , for which for ,

ih maue of measure a with of of

and taxonomic revisions taxonomic and - limiting factor limiting ih identification fish W . Decru et al. (2016) al. et Decru e .

the study of of study the T therefore MOTUs can be u be can MOTUs

oolslikeABGD,bPTP RESL,GMYCor . (Chiloango T hegrowing database of pce description species

s barcod

when exploring

in describing biodiversity will remain the collection of new of collection the remain will biodiversity describing in eomn uig rvsoa seis sinet (.. not (i.e. assignments species provisional using recommend eei variability genetic

y facilitating by Garra additional ,

, the families showing most inconsistencies (Cyprinidae inconsistencies most showing families the ,

G Angola LG, ing the species . This is especially true for Africa, where routine and routine where Africa, for true especially is This . sed sed

offersopportunit the cf. in combination with combination in n the pr the n ornata specimens s

poorly inventoried fauna and .

)

or recentlyor diverged species

. oprsn aog eeec collections reference among comparisons DNA barcodes It n te css m cases, other In

,

Kes Eiko, 2012) Erickson, & (Kress esence of undescribed lineages because lineages undescribed of esence t s evident is it

Ctenopoma il eoe nraigy sfl for useful increasingly become will and comparisons with type mat type with comparisons and is

mainly use mainly

y lar concern are concern lar (Froese& to to

morphospeciesassignments

indeed provided

quantify co the cf ht h dvlpd DNA developed the that .

nigropannosum

rhlgcl variants orphological (Desalle, 2006) (Desalle, ful to flag specimens flag to ful remains

. Pauly, 2018; Swartz,2018;Pauly,

increase verycoherent .

countries such countries correspond to correspond Or results Our .

nsistencyof overlooked. s

the speed ,

. This . P. erial sets

cf.

This article isprotected rights by All copyright. reserved. AcceptedBecker, S., Hanner,& R., Steinke, (2011).D. Fiveyears FISHof April, J., Mayden, R.,Hanner,R., Bernatchez,& (2011).L. Geneticcalibration of species diversity African FISH References suggestions. Policy Science Belgian the (BELSPO by funded was barcoding DNA Cooperation. Development Belgian Ibala Armel and Wamuini Soleil projects, Ph.D. their For Cooperation. Development Belgian the and RMCA the between Agreement Congo Framework du douces d’eaux poissons Article des conservation l’ pour Brazzaville Ngouabi, Marien l’Université de populations des biologie de laboratoire au ‘Appui RA04F11 project and project Africa for FishBase the Malebo’, Pool project Fish Acknowledgements inmade taxonomic expertsare that capable to barcode DNA 2008) al., et (Swartz es DNA 108 among America North ’s freshwaterfishes. BOLPAFFAreport.pdf 2008. Retrieved from http:/ initiativeof Life (FISH

ee olce ad aa band hns to thanks obtained data and collected were Mliicpiar neze o d dvriet a d vse vn e Beneden de van vissen de van diversiteit de op onderzoek ‘Multidisciplinair ). , 10602

, 22 h atos hn te he rvees f hs ril fr hi vr constructive very their for article this of reviewers three the thank authors The

-

BOL RegionalBOL Working Group. (2008). (

sup aa il only will data – 10607. doi: 10.1073/pnas.1016437108 1), 3

. However, t However, . – 9. doi:9. 10.3109/19401736.2010.535528

- BOL) Regional Working Group pe u specie up speed /www.barcodeoflife.org/sites/default/files/materials/FISH he rising number of number rising descriptions s analysethem - Proceedingsof theNational Academy Z amba benefitted from a sandwich grant from the from grant sandwich a from benefitted amba Workshop reportof the first African FishBarcode putative new species new putative the

. Addis Ababa, Ethiopia, 21 September - rzail’ bt fnne truh the through financed both Brazzaville’, ega Sine Policy Science Belgian . if

-

BOL: Briefstatus report.

cnieal ivsmn wud be would investment considerable a td d l boiest e la et biodiversité la de étude

reported (BELSPO, on the basis of basis the on of Sciences Mitochondrial - og e de en Kongo -

ci 1) Actie ,

This article isprotected rights by All copyright. reserved. Decru, E., Vreven, E., Snoeks,& J. (2012). Arevision of the West African Decru, E., Vreven, E., Danadu, C.,Walanga, A., Mambo, T., Snoeks, & J. (2017). Decru, E., Snoeks, J.,Vreven, & E. (2015). Taxonomic evaluation theof De Darwall, R. W. Smith, T., K. G., Allen, J.,D. Holland, R. A., Harrison, I.J., Brooks,& G.E. E. (2011). Collins, A., R. Boykin, L. M., Cruickshank,R. Armstrong, H., & F. K. (2012). Barcoding’s next top Chakrabarty Brooks, E. G.E., Allen, J.,D. Boulenger, G. A. (1901). Bouckaert, R., Heled, J., Kühnert,D., Vaughan, T., Wu, C Bezault, Berrebi, Chenuil,P., A., Kotlík,P.,

Acceptedcru, E., Moelants, T., De Gelas, K., Vreven, E., Verheyen, E., Snoeks, & J. (2016). Article e1003537. doi: 10.1371/journal.pcbi.1003537 a2: softwareplatform for Bayesia Biology m História Naturalda e Ciência. em arte áreas científicasdo interesse seu Cartaxana, A. Correia,M. & F. Lopes L. (Eds.), evolutionary history of the genus Hepsetidae) withdescription a of Acta Ichthyologica Piscatoria et Itimbiri, Aruwimi, and Lindi/Tshopo rivers (Congo basin): Diversity and distribution patterns. of Freshwaters basin the with revalidation of 10.1111/1755 the north challengesin freshwaterfishes: A mismatch between morphology and DNA barcoding infish of (IUCN). and Gland, Switzerland: International Union for Conservation of Nature and Natural Resources and distribution offreshwater species throughout mainland Africa Diversityof Life inAfrican Freshw Ecology and Evolution model: an evaluation nucleotide of substitution models for taxonomy. Union for Conservation of Natureand Natural Resources(IUCN). Biodiversity inCentral Africa Indépendantdu Congo. eiotic

Z.,

Rognon, ,

,

P s 2012 egregation ini . -

eastern part of theCongo basin. (2010) Zootaxa 2632 , 817562. doi -

, 0998.12445 X., 26 .

Clota, Genetypes: a concept helpto integrate molecular phylogenetics and (3), 273 Lespoissons du bassin du Congo

, & Darwall, R. W. (2011). T. 3 ntergeneric

, 457 F., ,

67 – :

287. Gharbi,

10.1155/2012/817562 Machordom, A.,& Tsigenopoulos, C. S.(2014). Disentangling the . Cambridge,United Kingdom and Gland, Switzerland: International –

– 68. H. microlepis 465. doi: 10.1111/j.2041 ,

47

aters: Under Water, Under Threat. An analysisof thestatus Barbus Hepsetusakawo n evolutionary analysis.

(3), K., h ybrids of Tilapias Baroiller, 225

sensu lato, a twenty years adventure. In J.M. Alves,A. (pp. 29 –

Molecular Ecology Resources (Teleostei: Hepsetidae). 247. doi: 10.3750/AIEP/02085 Professor CarlosAlmaça (1934

J – - The andStatus Distribution ofFreshwater F., 55).

-

sp. andnov. a redescription of H., Xie, D., … Drummond, A.J. (2014). BEAST . Brussels,Belgium: Publication del’État

& .

Lisboa, Portugal: Museu Nacional de International Journal of Evolutionary Chevassus, - 210X.2011.00176.x

PLoS ComputationalPLoS Biology, 10(4),

specimen identification.

Hepsetus

. Cambridge, United Kingdom B. Hepsetus Ichthyological Exploration

(2012). , 16 Ichthyofauna of the

from the Congo

(1), 342

– (Characiformes: Analysis theof Taxonomic 2010) Hepsetus – – Methodsin 352. doi:

Estado

The da This article isprotected rights by All copyright. reserved. AcceptedLanfear, R., Cal Kress, W. J., Erickson,& D. (2012).L. DNA Barcodes: Methods and Protocols. In Janzen, H., Hallwachs, D. W., Blandin, Burns, P., J. M., Cadiou, J. M., Chacon, I., … Wilson, J. J. (2009). Hubert,N., Hanner,R., Holm, E., Mandrak, N. E., Taylor, E.,Burridge, M., Bernatchez,… L Hubert,N., Hanner, & R. (2015). DNA Barcoding, speciesdelineation and taxonomy:historical a Hebert, P. N., D. Cywinska, A., Ball,S. L., & DeWaard, J.(2003). R. Biological identifications through Hanner,R., Desalle, R., Ward, D., R. & Kolokotronis, S. Froese, R., & Pauly, (2018 D. ArticleFolmer,O., Black, M., Hoeh, W., Lutz, R., & Dunz, A.R.,Vreven, E., Dunz, A Desalle,R. (2006). Decru, E., Vreven, E., Snoeks,& J. (2013). Arevision of the LowerGuinean Evolution haplotilapiinecichlid fishes formerly referred to" as Rubinoff.to Fish Bi (Characiformes; Hepsetidae) withdescription the of 10.1080/00222933.2011.622055 odoe schemesfor phylogenomic datasets. 591 Molecular Biology Molecular Ecology Resources Integration of DNA barcoding an into ongoing inven 10.1371/journal.pone.0002490 Identifying Canadian perspective. 270 DNA barcodes. special issue. Retrieved February 12, 2017, from www.fishbase.org Marine Biology and Biotechnology mitochondrial cytochrome 179. basinCongo (Perciformes: Cichlidae). . R - (1512), 313

6_1 .

(Bloch, 1794). & ology

Schliewen , cott, B., Kainer,D., Mayer, C.& 68 , Conservation Biology DNA Barcodes (1) 82 Species d Mitochondrial DNA – Proceedingsof the Royal Society of London. SeriesB, Biological Sciences (4),1351 , 321. doi: 10.1098/rspb.2002.22 64 & Schliewen,& U. K.(2012).

, (pp. 3

– U Journal ofNa

80. doi: 10.1016/j.ympev.2013.03.015 . freshwater f K iscovery versus speciesidentification inDNA barcoding efforts: r , January 25 .

– – ( 2013). 8). Totowa,New Jer 1375. doi: 10.1111/jfb.12079 , c

3 oxidasesubunit Ifrom diverse metazoan invertebrates. , , 44 9

(sup

Molecular phylogenyand revised classification of the , – tural History ishes through DNA Barcodes. , 22 , 58. 20 ). FishBase. Worl 3 1), 1 (sup1), 1 (5), 294 BMC Evolutionary Biology (5), 1545

Ichthyological Exploration ofFreshwaters Vrijenhoek,(1994). R. DNA primersfor amplification of –

Stamatakis, A.(2014) 26. doi: 10.1111/j.1755 Congolapia – – sey: Humana Press. doi: 10.1007/978 299. , – 2. doi:2. 10.3109/1940 46 1547. doi:1547. 10.1111/j.1523 18 - O. (2011). TheFish Barcodeof Life (FISH (1

– d Wide Web electronic publication. toryof complex tropical biodiversity. Tilapia Hepsetus kingsleyae 2), 1

, a new , a genus from thecentral

– 23. doi:23. ".

Molecular Phylogeneticsand . ,

PLoS ONE

Selecting optimal partitioning 14 - 0998.2009.02628.x , 82 1736.2011.598767 Hepsetus . doi:

, - sp. nov. 3 1739.2006.00543.x Methodsin (6), e2490. doi: 10.1186/1471

species , 23 Journal of (2), 155 - . (2008). 1

Molecular - 61779

esponse , - BOL) - – -

This article isprotected rights by All copyright. reserved. AcceptedPugedo, M. deL., Andrade Neto, F.R., Pessali, C., T. Birindelli, O J. L. Pons, J., Barraclough, Pereira, L. H., Hanner,R., Pereira, L. H. G., Pazian, M. F.,Hanner,R., Foresti, F., Oliveira,& C. (2011). Paradis, E., Claude,J., Strimmer,& K. (2004). Nwani, C.D., Becker, S.,Braid, H. Ude, E., F., E. Oko Nascimento, H. S., M. Almeida, S., M. Veira, N.M. S., Limeira Filho, D., Lima,C., R. Barros, C., M. & ArticleMiller, M. Messing, J., Crea, R., Meier,Shiyang, R., Vaidya, K., G., Ng,& K.P. (2006). L. barcoding DNA and taxonomy inDiptera: a Lowenstein, J. H., Osmundson, T. W., Becker,S., Hanner,R., & 715 tale highof intraspecific variability and lowidentification success. DNA with a multi DNA barcodesinto a multi 4020 Global diversity fish (Pisces)of infreshwater. 2148 region: the Jequitinhonha River Basin. Integrativetaxonomy supportsnew candidate fish speciesinpoorly a studied neotropical Systematic Biology ( 2156 megadiverse Neotropical freshwaterfish fauna? 10.3109/19401736.2011.588213 Characidae)from the Upper Paran Basin of Brazil. hidden diversity intheNeotropical freshwater fish language. 10.3109/19401736.2010.536537 phylogeographic resolution within somespecies. discriminatesfreshwater fishes from southeastern Nigeria and providesriver system 10.4238/gmr.15038476 Itapecuru Basin in Maranhão, Brazil. Fraga, E.C.(2016). Environments Workshop (GCE) in for Research 2006 –

, A., Pfeiffer, 728. - - - ference largeof phylogenetic trees. 22 8259 14 ) 14 . Sequence ( - - sup 82 20 ,

Bioinformatics 9 - 7 Lévêque, C., Oberdorff, T., Paugy, Stiassny,D., M. J.,L. Tedesco,& A.P. (2008). (2), 309 - 1), 52 gene performanceassessment of the genus Labeoa as casestudy. & Seeburg, H. (1981). P. A system for shotgun DNA sequencing.

T. G. W. & - – based species delimitation for the DNA taxonomy undescribedof insects. , – DNA barcoding reveals high levels geneticof diversity in the fishes of the

70. doi: 10. 55 Foresti, F.,& Oliveira, C. (2013). Can barcoding DNA accurately discriminate 321. ,

Gomez Schwartz, T. (2010 , 595

,

doi: 20 - year inventoryyear offishes the of the hyperdiverse Lower Congo River, – (2), 289 609 -

Zurita, 3109/19401736.2010.537748 ,

pp. . doi:

1 – Geneticsand Molecular Research J. – 290. doi: 10.1093/bioinformatics/btg412 10.1080/10635150600852011 8 , Genetica

. doi: Cardoso, APE: Analyses of Phylogeneticsand Evolution inR , November14 Paperpresented at the

10.1109/GCE.2010.5676129 Hydrobiologia gwu, I., O. & Hanner,R. (2011). DNA barcoding ,

144 BMC Genetics A. Mitochondrial DNA Mitochondrial DNA Piabina argentea ,

Duran, (3), 341 )

.

Stiassny, M. J.L. (2011). Incorporating Creating the CIPRES Science Gateway , D. P. D. –

595 349. doi: 10.1007/s10709 ., Carvalho,& C.(2016). D. , 14 , , 545

2010 Gateway Computing Hazell, Systematic Biology (1), 20. doi: 10.1186/1471

,

(Characiformes: DNA barcoding reveals , – 22 , 22 567. doi: 10.1007/978 15

( S. sup (

(3). doi: sup ,

& 1), 1), 43

1), 1), 87 Vogler

Nucleic Acids Mitochondrial – – 51. doi: 96. doi: , - , level A. P. 55 - 016 (5),

- -

- 1 - This article isprotected rights by All copyright. reserved. AcceptedStiassny, L.M. J., Teugels, Hopkins,G. G.,& C.D. (2007). Stiassny, L.M. J., & Mamonekene, V.(2007). Stamatakis, A. (2015) Srivathsan Snoeks, J., Harrison, I.J., & Stiassny, L.M. J. (2011). statusThe and distribution of freshwater fishes. Shumway, C., Mosibono, Ifuta,D., S., Sullivan, J., Schelly, R., Punga, J., … Puema, V. (2003). Sheth, B. &P., Thaker,V. S. (2017). DNA barcoding and traditional taxonomy: an integrated ArticleShen, Guan, Y., Wang,L., D., Gan, & X. (2016). DNAbarcoding and evaluation of genetic Roberts, T. R., & Stewart, D. J Roberts, T. R. (1975). Geographical distribution Africanof freshwater fishes. Ratnasingham Ratnasingham, S., Hebert, & P. N.D. (2007). BO Puillandre,N., Lambert,A., Brouillet, S.,& Achaz, G.(2012). Linnean Society Index Number (BIN)System. Ecology Notes 294X.2011.05239.x primaryfor species delimitation. 9903 10.5281/zenodo.179053 Congo River,with ain the Democratic Republic Congo.of 6.14.1 0031.2011.00370.x divergencesin theDNA Natureand Natural Resources(IUCN). Cambridge,United Kingdom and Gland, Switzerland: International Union for Conservation of andstatus distribution offreshwater speciesthroughout mainland Africa In Aquarium Environ Biodiversity Survey: Systematics, Ecology and Conservation Along theCongo River, Congo River approach for biodiversity conser doi: 10.1002/ece3.2060 Cyprinidaefish inthe midstream of the Yangtze River. 317. the LowerZaire Congoor River. The diversityof lifein African freshwaters: Under Water,

- , A., & Meier, R.(2012). 4 –

6.1 ment and Development Project (CREDP) ,

S 4.14 . ,

& ,

. doi: Hebert 7 , .

, 355 57 Using RAxML to Infer Phylogenies. (4), 249

10.1002/0471250953.bi0614s51 – , 364. doi: 10.1111/j.1471

P - . (1976). anEcological and SystematicSurvey Fishesof in the Rapids of barcoding literature,

. D – . 319. doi: 10.1111/j.1096 N PLoS ONE On the inappropriateuse of Kimura .

(2013) Bulletin of the Museum ofComparative Zoology vation. Molecular Ecology .

, A DNA

Micralestes 8 Genome (7), LD : LD : TheBarcode of Life Data System.

e66213. Cladistics - b . Boston, Massachusetts: NewEngland - ased 8286.2006.01678.x , 60

Poissons d’eauxPoissons douces saumâtreset de , (Characiformes, Alestidae) theof lower Current (7),618 21 - r

3642.1975.tb01893.x doi: egistry for Ecology and Evolution ABGD, Automatic Barcode Gap Discovery , (8), 1864

2

8

Zootaxa 10.1371/journal.pone.0066213 , 190 Under Threat. An analysisof the – protocolsin bioinformatics 628. doi: 10.1139/gen – – a 194. - 77. doi: 10.1111/j.1365 2 ll , - 29

a parameter( K2P ) nimal

doi: , 17 Zoological Journal ofthe

(pp. 42 – 10.1111/j.1096 29. s

pecies: , 6

doi: (9), 2702 Molecular , – 147 73). 73).

diversity in - t 2015 he Barcode (6),239 ,

– 51 - - 2713. -

0167 ,

–

This article isprotected rights by All copyright. reserved. AcceptedZhang, J., Kapli, P., Pavlidis, P., & Ward, R. Zemlak,D., T. S. Ward, R. Hanner,D., R., & Hebert, P. N. D. (2009). The campaign to DNA barcode allFISH fishes, Wamuini, S. Vreven,L., E., Vandewalle, P., Mutambue,Snoeks, S.,& J. (2010). Walsh, G., & Mamonekene, V.(2014). A collection fishesof from tributaries of thelower Kouilou, Vreven, J. E. W. N.,M. Musschoot, T., Snoeks, J., Schliewen,& U. K.(2016). The African hexaploid Van Steenberge, M., Vreven, Snoeks, & E., J. (2014). Van Steenberge, M., Gajdzik, L., Chilala, A.,Snoeks, J., Vreven,& E. (2 ArticleVan Ginneken, M., Decru, E., Verheyen, E., Snoeks, & J. (2017). Morphometry and DNA barcoding Tsigenopoulos, C.S.,Kasapidis, P., Berrebi,& (2010).P. Phylogeneticrelationships hexaploiof Thieme, L.,M. Abell, R., Burgess,N., Lehner, Tamura, Stecher, K., G., Peterson, Filipski,D., A.,& Kumar, S. (2013). MEGA6: Molecular evolutionary Swartz, E. R., Mwale, M., Hanner,R., & USA:Island Press. Freshwater ecoregions ofAfrica and Madagascar: Aconservation assessment 10.1093/molbev/mst197 geneticsanalysis version 6.0. fish diversity and conservation. African fish diversity and conservation .SAfrJ Sci Arole for barcoding inthe study of African basse Guinée, ouest del’Afrique centrale, volumes and1 2 360 Australia’s fish species. Journal ofFish Biology journal ofichthyology knowledge theof ichthyofauna inInkisi the River, LowerCongo (RDC) Africa. Noumbi and smallercoastal basin systems, Republicof Congo, the LowerGuinea, we Linnean Society (:Torini Cyprinidae): review a of tumultuous history. basin): A doi: 10.1111/zsc.12203 fins: speciesdelineation of Congolese basin, Africa r and Evolution sized barbs (genus eveal crypticdiversity inthegenus (1462), 1847 Check List fauna of mixed origin. – ,

Corrigendum. 56 , – 177 , (2),851 1857. doi:1857. 10.1098/rstb.2005.1716

10 Labeobarbus , Innes,B. H., Last, R.,P. Hebert, & P. N.D. (2005). DNA barcoding (2), 231 (4),900 , , 34

74 Philosophical Transactionsof the Royal Society B: Biological Sciences

– , 83 (2), 329 856. doi: 10.1016/j.ympev.2010.02.006 Stamatakis, A. (2013). Ageneral species delimitation method with – – European Journal ofTaxonomy – 305. doi: 10.1111/zoj.12366 912. doi: 10.15560/10.4.900 Molecular Biology and Evolution 91 South African Journal of Science Ichthyological Exploration ofFreshwaters , Cyprinidae)based on mtDNA data. .

– Swartz, E.R. (2008). Arole barcodingfor instudy the of 356. doi: 10.1111/j.1095 Enteromius Labeo B., Dinerstein, E., Olson, D., …Skelton, (2005). P.

(Cyprinidae). Thefishes of the Upper Luapula area(Congo

(Cypriniformes: Cyprinidae) fromCongo the

Zoologica Scripta . Paris, France: IRD Éditions. - , (314). doi: 10.5852/ejt.2017.314 8649.2008.02080.x , 30 , 017). Don’tjudge a fishits by 104 , 2725

Zoolog Molecular Phylogenetics , 293 . Cybium: – Contribution to the 2729. doi: , – ical Journal ofthe 24 298. , 46 (4), 329 . Washington, (3),264

international

– st 345.

– - central 274. d large

- BOL. ,

- This article isprotected rights by All copyright. reserved. Accepted Article 10.1093/bioinformatics/btt499 applications to phylogeneticplacements.

Bioinformatics ,

29 (22), 2869 – 2876. doi:2876. This article isprotected rights by All copyright. reserved. represent circles Open box. the outliers outsidethis range. from range interquartile the times <1.5 situated values of range represent ichthyological Congolese CO: distances sequences ( (top) morphospecies among and within 2. Figure borders, respectively. sampling Lowenstein records of al. et (2011). Blue lines orange and lines represent political and rivers Red Lefini). triangles: Malebo, Kouilou Pool and Djoué disks: symbols Inkisi, stars: Luki, (diamonds: province i Congolese the within situated study this of sites collection the mark symbols Orange 1. Figure Figures and tables JS GS work. lab the performed JVH and ZTN TM VM, EV Author Contributions https://doi.org/10.5061/dryad.5qj120q in deposited are A+B and A sets data COI the of alignments DNA carineae MK074701 BCOVR741 DNA sequences: Data Accessibility Statement bottom

Accepted , Article er K , JS, JS, , J , EVre and MVS -

) (right) ) : ir, imns Nag, tr Pl Ooe and Ogowe Polo star: Nyanga, diamonds: Niari,

ersn or apig eod fo te oe Gien ctylgcl rvne (disks: province ichthyological Guinean Lower the from records sampling our represent MK074655 A: among Sampling locations of this study and Lowenstein et al. (2011) at different at (2011) al. et Lowenstein and study this of locations Sampling n E cletd h fish the collected ED and EV

the interquartile range. Bold horizontal bars represent medians. Whiskers represent the represent Whiskers medians. represent bars horizontal Bold range. interquartile the . Aetde Cclde Cyp Cichlidae, (Alestidae,

- 17 Boxplots representing the ranges of of ranges the representing Boxplots re, H

ologenetype . This was done was This . (project (project JVH, ZTN, FCB and GS designed the research. the designed GS and FCB ZTN, JVH, Process ID specimens of the same morphospecies same the of specimens

- 8 and

wrote the manuscript BCOVR)

MK074660 in of of

province

the Barcode of Life Data Systems (BOLD) for all families and for the five families represented by more than 60than more representedby families five the for and families all for yoots carineae Synodontis

a es

d ceso nmes n eBn are GenBank in numbers accession nd , LG: Lower Guinean ichthyological Guinean Lower LG: , iia, itcootde n Mormyridae) and Distichodontidae rinidae,

. n promd h mrhlgcl identifications. morphological the performed and

, and , EV , .

ihn n among and within er , ZTN and JVH and ZTN , distances observed distances : MK074654

collected

rage Nog) Bak os represent dots Black Ngongo). triangle:

MVS, EVre, MVS, analysed the data the analysed

OU dtrie uig ABGD using determined MOTUs P .

within and among among and within the the n aa es lf) n A+B and (left) A sets data in aragenetypes

are ra Dgtl Repository: Digital Dryad province

from

GB, MH, SWL, MH, GB, from BCOVR001 . .

scales (A, B, C). B, (A, scales

GS, EV GS,

. Coloured boxes Coloured

MK073961 of of B: chthyological ie basins river

Synodontis ags of Ranges FCB, er , - ZTN, 17 to 17 to AIZ, AIZ, G

S, to .

This article isprotected rights by All copyright. reserved. ob incongruence *: cluster; same different the in merging in sets data A andB). split lumped morphospecies morphospecies (S: different assignments L: morphospecies clusters; and tree the in clusters barcode L from records (B): study; this from records new (A): nodes. the at given are values Bootstrap Mormyridae. family Figure incongrue *: cluster; same different the in merging in sets data A andB). split lumped morphospecies morphospecies (S: different assignments L: morphospecies clusters; and tree the in clusters barcode records study;(B): this from records new (A): nodes. the at given are values Bootstrap Distichodontidae. family Figure o incongruence *: cluster; same different the in merging in sets data A andB). split lumped morphospecies morphospecies (S: different assignments morphospecies L: and clusters; tree the in clusters barcode (B): study; this from from records records new (A): nodes. the at given are values Bootstrap Cyprinidae. family Figure different in split morphospecies (S: assignments morphospecies and clusters; L:different tree the in clusters (2011). barcode al. et Lowenstein from (A): nodes. records the at given are values Bootstrap Cichlidae. family Figure records from Lowenstein et al. (2011). at given are values Bootstrap Alestidae. family Figure distances Bootstrap valuesgiven are the nodes.at showing neighbour new the Subtrees the on from based extracted C: tree were joining subtrees province. These river. ichthyological same the in same collected morphospecies the of rivers different showing Subtrees B: province. ichthyological same 4 Figure the nodes.at new the n provinces 3 Figure Accepted Article eighbour 8 7 6 5 9 . barcode data set databarcode . . . . .

.

B: .

: utes showing Subtrees A: Neighbour Neighbour Neighbour Neighbour ing province ing Neighbour A: from Lowenstein et al. (2011). al. et Lowenstein from

oesen t l (2011). al. et Lowenstein S utes showing Subtrees bre showing ubtrees wnti e a. (2011). al. et owenstein - - - - morphospecies lumped in the same cluster). Joining (NJ) tree (uncorrectedp tree (NJ) Joining (uncorrectedp tree (NJ) Joining (uncorrectedp tree (NJ) Joining (uncorrectedp tree (NJ) Joining - Joining s .

These subtrees were extracted from the neighbour the from extracted were subtrees These ( data set data

re ucretd p (uncorrected tree

itne aog eaiey similar relatively among distances acd dt set data barcode

itne between distances itne within distances A)

and using uncorrected p uncorrectedusing and

Bold Bold Bold Bold

noain idct icnrecs ewe DNA between incongruences indicate annotations DNA between incongruences indicate annotations DNA between incongruences indicate annotations h nds () nw eod fo ti suy (B): study; this from records new (A): nodes. the

-

annotations indicate incongruences between DNA between incongruences indicate annotations itne fr all for distance) ( data set set data - - - - morphospecies distance) for all for distance) all for distance) distance) for all for distance) all for distance) itne within distances ar o similar of pairs

A) - distances.

n uig norce p uncorrected using and e rcrs rm hs td; (B): study; this from records new

opopce cletd n the in collected morphospecies N barcode DNA

DNA barcodeDNA barcodeDNA DNA barcodeDNA barcodeDNA found morphospecies opopce cletd in collected morphospecies Bootstrap

in - joining tree based on on based tree joining both c otie after obtained nce eune o the of sequences

sequences of the sequencesof the sequencesof sequences of the sequencesof the sequencesof values are givenare values

ichthyological

tie after btained olce in collected and after tained - distances. within -

This article isprotected rights by All copyright. reserved. replicate Lowenstein et al. oxidase subunit Igene, 589 pairwise Fig are indicated nodesat (1 oxidase subunit Igene, 589 pairwise Fig tree, new: in differentclusters of the NJlumped: tree, different morphospecieslumped in cluster one of the NJ and clustersin the neighbour consistency between specimens sampled per species in the different Table S2 (ABGD, RESL, GMYCand bPTP). their collection and their information theiron Table S1 Supporting information

Accepted ure Articleure

S S1 2

s). uncorrected p uncorrected p (sup (sup

(sup (sup new

- - 001 - - 001 002 002

inconsistency observed after merging data sets Aand B. ( - - 2011 - - TableS1 TableS1 FigS1 FigS1 morphological (morpho)species - - ) distance distance

(data setB, 191 specimens). Bootstrap valuesindicated are nodes at (1 - - 000 molecular operational taxonomicunit S2) S2) - - - - S2). S2) 652 bp) 932of fish 652 bp) of . .

replicate - Neighbour joining tree constructed with pairwisedeletion and using Neighbour joining tree constructed with pairwisedeletion and using joining (NJ)tree. OK: c .

List all of List allfish of s among the s among the identificati s). the 741 identifications

fish

es DNA barcode DNA barcode species analysed

on (accordingon to the taxonomy of es

fish analysed i dataset

sequenced here(data set A, 741 specimens) and by es onsistent,

sequenced here(data setA (according to the taxonomy of s (A,and B A+B)and n thisstudy sequences sequences

in this study, with -

: no: data, split: morphospecies split ID based on

(data setsA, and B A+B)

(5’ (5’

- - end of thecytochrome c end of thecytochrome c

different methods information on

2012 2012 and 201 number of ).

Bootstrap va

2012 and 201 the , with 8 lues ), 000 8

)

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article