1
MOLECULAR AND BIOCHEMICAL CHARACTERIZATION
OF PLANT GROWTH PROMOTING RHIZOBACTERIA FOR
ENHANCING CROP YIELD
UMMAY AMARA
03-arid-120
Department of Soil Science & Soil and Water Conservation Faculty of Crop and Food Sciences Pir Mehr Ali Shah Arid Agriculture University Rawalpindi Pakistan 2
2015 MOLECULAR AND BIOCHEMICAL CHARACTERIZATION
OF PLANT GROWTH PROMOTING RHIZOBACTERIA FOR
ENHANCING CROP YIELD
by
UMMAY AMARA (03-arid-120)
A thesis submitted in partial fulfillment
of the requirements for the degree of
Doctor of Philosop hy in Soil Science
Department of Soil Science & Soil and Water Conservation
Faculty of Crop and Food Sciences
Pir Mehr Ali Shah
Arid Agriculture University Rawalpindi 3
Pakistan
2015
CERTIFICATION
I hereby undertake that this research is an original one and no part of this thesis falls under plagiarism. If found otherwise, at any stage, I will be responsible for the consequences.
Student’s Name: Ummay Amara Signature: ______
Registration No: 03-arid-120 Date: ______
Certified that contents and form of the thesis entitled “Molecular and
Biochemical Characterization of Plant Growth Promoting Rhizobacteria for Enhancing Crop Yield” submitted by Ms. Ummay Amara have been found satisfactory for the requirement of the degree.
Supervisor: ______(Dr. Rifat Hayat)
Co-Supervisor: ______(Dr. Iftikhar Ahmed)
Member: ______(Prof. Dr. Safdar Ali)
Member: ______(Dr. Ghulam Shabbir)
Chairperson: ______
4
Dean: ______
Director, Advanced Studies: ______
5
CONTENTS
Page
List of Tables viii
List of Figures ix
Acknowledgment x
ABSTRACT xi
1. INTRODUCTION 1
2. REVIEW OF LITERATURE 5
2.1 ROLE OF PGPRS IN CROP PRODUCTION 6
2.2 MECHANISMS OF PLANT GROWTH PROMOTION 7
2.2.1 Biological Nitrogen Fixation 8
2.2.2 Solubilization of Phosphates 10
2.2.3 Phytohormones Production by PGPRs 16
2.2.3.1 Indole-3-acetic acid (IAA) production 17
2.2.3.2 1-Aminocyclopropane-1-carboxylate deaminase production 19
2.2.3.3 Cytokinin production 23
2.2.3.4 Gibberellins production 25
2.2.4 Increased Iron Uptake 26
2.3 APPROACHES TO DEVELOP PGPRS 29 6
3. MATERIALS AND METHODS 35
3.1 SURVEY FOR SAMPLES COLLECTION 35
3.2 EXPERIMENTAL SITE 35
3.3 ISOLATION AND PURIFICATION OF BACTERIA 35
3.4 PLANT GROWTH PROMOTING CHARACTERIZATION 36
3.4.1 Phosphate Solubilization 36
3.4.2 Production of Indole-3-Acetic Acid (IAA) 37
3.4.3 Production of Siderophore 37
3.4.4 nifH Gene Amplification 37
3.5 PHENOTYPIC AND BIOCHEMICAL CHARACTERIZATIO 37
3.6 CHEMOTAXONOMIC ANALYSIS 38
3.7 IDENTIFICATION USING MOLECULAR TECHNIQUE 40
3.7.1 Preparation of DNA Template 40
3.7.2 Amplification of 16S rRNA Gene by PCR 40
3.7.3 Purification of PCR Products 41
3.7.4 DNA Sequencing 41
3.7.5 Phylogenetic Analysis (Bioinformatics) 41 7
3.8 SCREENING UNDER GROWTH CHAMBER 42
3.9 EVALUATION UNDER POT AND FIELD CONDITIONS 42
3.10 PLANT ANALYSIS 43
15 3.11 ASSESSMENT OF N2-FIXATION BY NATURAL N 44
3.12 STATISTICAL ANALYSIS 44
4. RESULTS AND DISCUSSION 46
4.1 CHARACTERIZATION FOR PGP TRAITS 46
4.1.1 Indole-3-Acetic Acid (IAA) 46
4.1.2 Phosphate Solubilizations 47
4.1.3 nifH Gene Amplification 48
4.1.4 Siderophore Activity, Catalase, Oxidase and Gram Staining 49
4.2 IDENTIFICATION USING 16S rRNA GENE SEQUENCING 53
4.3 VALIDATION Of NCCP-231T (Kosakonia sp.) 53
4.3.1 Molecular Characterization 57
4.3.2 Characterization for Biochemical and PGP Traits 73
4.3.3 Biochemical and Phenotypic Description 73 8
4.3.4 Chemotaxonomic Characterization 76
4.4 GROWTH CHAMBER EXPERIMENT 82
4.4.1 Wheat Root and Shoot Growth 85
4.4.2 Soybean Root and Shoot Growth 87
4.5 BIOCHEMICAL CHARACTERIZATION OF PGPRs 91
4.6 GREENHOUSE EXPERIMENTS 94
4.6.1 Inoculation Effects of Selected PGPRs on Wheat 95
4.6.2 Inoculation Effects of Selected PGPRs on Soybean 101
4.7 FIELD EXPERIMENTS 105
4.7.1 Inoculation Effects with PGPRs on Growth of Wheat 105
4.7.1.1 Biomass yield 105
4.7.1.2 Grain yield 106
4.7.1.3 Total shoot N yield of wheat 107
4.7.2 Inoculation Effects with PGPRs on Growth of Soybean 109
4.7.2.1 Biomass yield 109
4.7.2.2 Grain yield 110
4.7.2.3 Total shoot N yield of soybean 110 9
4.7.2.4 Total N2-fixed by soybean 112
SUMMARY 114
LITERATURE CITED 119
APPENDICES 150
List of Tables
Table No. Page
1. Effect of PGPRs on different crop and their responses 12
2. Phosphate solubilization by PGPRs and crop responses 21
3. Plant growth regulator releases by PGPRs 31
4. PGPRs isolated from different location 39
5. Characterization of PGPRs isolated from soybean and chickpea crop 50
6. Characterization of PGPRs isolated from wheat crop 54
7. Identification of PGPRs based on 16S rRNA gene sequence 58
8. Phenotypic and molecular identification of NCCP-231T 75
9. Biochemical characteristics of NCCP-231T 77
10. Characterization of NCCP-231T isolated for PGP traits 81
11. Cellular fatty acid composition and G+C content of strain NCCP-231T 83
12. Effect of PGPRs possessing high plant growth promoting activity 86 10
13. Effect of PGPRs possessing high plant growth promoting activity 90
14. Biochemical characterization of selected PGPRs by using API 20E 92
15. Biochemical characterization of PGPRs by using API ZYM 93
16. Antibiotic resistant test of PGPRs 96
17. Effect on root and shoot growth of wheat by inoculation of PGPRs 99
18. Effect on root and shoot growth of soybean by inoculation of PGPRs 103
19. Effect on yield of wheat as affected by inoculation of PGPRs 108
20. Effect on yield of soybean as affected by inoculation of PGPRs 111 List of Figures
Fig. No. Page
1. Soil phosphorus mobilization and immobilization by PSBs 18
2. Biosynthetic Pathway of IAA Synthesis in Bacteria 24
3. Mechanism to decrease level of ethylene in the root of plants 27
4. Phylogenetic tree of 231, A45, A84 and A85 belonging to Kosakonia 61
5. Phylogenetic tree of A52 belonging to the genus Burkholderia 62
6. Phylogenetic tree of A6 belonging to the genus Arthrobacter 63
7. Phylogenetic tree of A81 belonging to the genus Microbacterium 64
8. Phylogenetic tree of A2, A4 and A5 belonging to the genus Acinetobacter 65 11
9. Phylogenetic tree of A15, A18, A64 and A72 belonging to Psychrobacter 66
10. Phylogenetic tree of A25, A27, A29, A48, A49, A56, A58, A59 and A78 67
11. Phylogenetic tree of A44, A53 and A63 belonging to genus the Serratia 68
12. Phylogenetic tree of A42 and A88 belonging to the genus Pseudomonas 69
13. Phylogenetic tree of A28 belonging to the genus Serratia 70
14. Phylogenetic tree of A35 and A46 belonging to the genus Staphylococcus 71
15. Phylogenetic tree of A61 and A62 belonging to the genus Enterobacter 72
16. Phylogenetic tree of NCCP-231T 74
17. Polar lipid profile of NCCP-231T 84
18. Bacterial antibiotic resistant activity of selected PGPRs. 97 ACKNOWLEDGEMENTS
I am thankful to Almighty Allah for blessing me good health, strength
and perseverance needed to complete this study. I offer my humble gratitude
from the core of my heart to the Holy Prophet Hazrat Muhammad (SAWW)
who is forever a torch of guidance for the humanity as a whole.
I pay my thanks and respect to my supervisor, Dr. Rifat Hayat, who
guided me at each and every step of research. I am also very thankful to
members of my supervisory committee, Dr. Iftikhar Ahmed, Prof. Dr. Safdar
Ali and Dr. Ghulam 12
Shabbir, for their valuable suggestions and constructive criticism during the study. I wish to extend special thanks to Dr. Wei Xiao, Dr. Yong-Xia Wang and
Prof. Dr. Xiao-Long Cui, Yunnan institute of Microbiology, Yunnan
University, Kunming,
China for helping me to have an in-depth understanding of soil microbiology.
Heartiest thanks and deep appreciations are due to my affectionate sisters Shumaila Bilal, Faiza jabeen, Azeema kokab, Brother Abdul Mannan, my best friend Rabia Khalid and other family members for their prayers and sincere support during the study. Last but not least, I am thankful to my husband
Mr. Abdul Hadi and my son Abdul Wali Khan for their love and friendly cooperation in my life.
(Ummay Amara)
13
ABSTRACT
Plant-microbe interaction in the rhizosphere is the determinant of soil fertility and plant health. The beneficial bacteria residing in the surroundings of roots play a vital role in stimulating the plant growth. Soil bacteria are being utilized in agriculture for long times for their ability to improve plant nutrition.
The objective of proposed study was to identify the potent PGPRs by using molecular tagging of 16S rRNA gene sequencing. The PGPRs were to be isolated from rhizospheric soil of wheat and soybean. Potential PGPRs were applied alone and in combination with varying rates of fertilizers to determine their impact on yield of crops under controlled and field conditions. For this purpose, extensive survey had been carried out for the collection of rhizospheric soil of legumes (soybean and chickpea) grown in farmer’s field at Pothwar
(Rawalpindi, Attock & Chakwal) and for wheat from the districts of
Rawalpindi, Attock, Chakwal, Haripur, Abbottabad and Gilgit. Dilution plate technique was use by using Tryptic Soya Agar (TSA; Difco) as nutrient media for the isolation of rhizospheric soil bacteria. More than eighty bacterial strains were isolated and characterized for plant growth promoting (PGP) properties like auxin i.e. indole acetic acid (IAA), P-solubilization, siderophore, and nifH gene amplification. For biochemical characterization of potential isolates, API kits (API ZYM and API 20E) were used. Maximum indole production (311.08
μg mL-1) was recorded by A60 (Bacillus aryabhattai) while A63 (Serratia marcescens subsp. sakuensis) solubilize phosphate up to 954.32 µg mL-1. Only four strains A42, A10, A62 and A84 were successfully amplified for 400 bp nifH gene. Most of the isolated bacterial strains were positive for siderophore production test and exhibited a clear orange zone on the chrome azurol S (CAS) agar medium. Molecular technique of 16S rRNA gene sequencing was applied 14
on the 40 most potent PGPRs on the basis of above mentioned traits for their identification. The DNA of each strain was amplified using universal primers and purified amplified products (DNA) were sent to MACROGEN (Seoul,
Korea) for gene sequencing. Rhizospheric bacterial strains were differentiated through BLAST search and characterized according to their specific genera.
Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain
NCCP-231T isolated from chickpea is member of the genus Kosakonia and exhibited sequence similarity of 97.85% to Kosakonia oryzae and 97.53% to
Kosakonia arichidis and subjected to a polyphasic taxonomic study with foreign and performed phenotypic and genotypic analysis. Most promising characterized and identified PGPRs were selected for further screening and evaluation of soybean and wheat growth under growth chamber. All selected
PGPRs enhance the root, shoot length and weight significantly over control and based on the results obtained, three strains A18 (Psychrobacter maritimus), A28
(Serratia proteamaculans) and A29 (Bacillus anthracis) were selected for wheat, and A51 (Bacillus aryabhattai), A62 (Enterobacter kobei) and A63
(Serratia marcescens subsp. sakuensis) for soybean for further evaluating their effect under pot and field conditions with varying rates of NP fertilizers. Data regarding pot and field experiment revealed that all selected PGPRs improved root and shoot growth, biomass and grain yield of both crops over control but maximum production was recorded in treatment where combined application of
PGPRs and full dose of recommended fertilizer were applied. These results support our hypothesis that use of PGPRs or combinations of PGPRs and chemical fertilizer can enhance the nutrient use efficiency of fertilizers and crop production.
15
Chapter 1
INTRODUCTION
In agriculture, crop growth is influenced by numerous biotic and abiotic factors. Different physical and chemical approaches are used by growers for managing soil environment and crop yields (Smith, 1997). There is very thin layer of soil surrounding plant roots considered very important and dynamic area for root activity and metabolism known as rhizosphere (Saharan and Nehra, 2011). Rhizosphere support large and active microbial population involved to impart beneficial effects on plant growth. This microbial population is vital in maintaining root health, uptake of nutrients and to crop response. The rhizosphere bacteria exert beneficial effects on crops due to their direct and indirect mechanism are termed as plant growth promoting rhizobacteria (PGPRs) (Kloepper et al., 1988).
PGPRs directly affect the plant growth by producing phytohormones (Glick, 1995) like IAA (indole acetic acid), auxin, gibberellins, cytokinins, and ethylene (Cattelan et al., 1999; Zhang et al., 1997) and enhancement in uptake of nutrients by plant. Indirect effect includes protection of plant from phytopathogens through the production of metabolic products like antibiotics, siderophores and hydrogen cyanide (Glick, 1995; Kloepper, 1993). The effect of phytohormones is direct, as they stimulate root growth, providing more sites for infection and nodulation (Garcìa et al., 2004). PGPRs inoculation has been reported to significantly increase the growth and yield of cash crops (Asghar et al., 2002; Hayat et al., 2013). Several species of bacteria like Alcaligenes, Arthrobacter,
Azospirillum, Azotobacter, Bacillus, Burkholderia, Enterobacter, Klebsiella,
1 Pseudomonas and Serratia have been traditionally used as PGPRs for crop growth (Glick, 1995). Phytohormones or plant growth regulators (PGRs) are the organic substances with a characteristic to enhance the physiological processes even at low concentrations released by PGPRs. The contribution of these PGRs in development and growth of plant is quite evident (Dobbelaere et al., 2003). Five different known classes of PGRs are auxins, abscisic acid, cytokinens, ethylene and gibberlins (Zahir et al., 2004). Among all classes auxin has been stated to be dominant and indole acetic acid (IAA) is physiologically the most known and active auxin responsible for inducing short and long term positive responses in crop roots through cell differentiation, cell elongation and cell division (Hagen, 1990). Auxin also induces changes in genes expression 16
especially in apical domination, tropistic responses, flowering, fruit ripening and senescence (Guilfoyle et al., 1998).
In developing sustainable agriculture system, application of PGPRs has found key role in crop growth (Shoebitz et al., 2009; Sturz et al., 2000) and nitrogen is generally considered major limiting nutrients. Although, abundant amount of molecular nitrogen is present and comprised 78% of the earth’s atmosphere. First, it must be converted to ammonia or nitrate form for incorporation into living organisms because in this form, it cannot be directly utilized by plants (Hayat et al., 2012). Conversion of atmospheric N into ammonia or nitrate forms by different procedures biological nitrogen fixation (BNF) fixes more than 60% of atmospheric N and mainly occurs through symbiotic association of N2•fixing bacteria i.e. Rhizobium possessing the enzyme with nitrogenase legumes (and some woody species) and non•symbiotic (free•living, associative or endophytic) i.e. Acetobacter, Azospirillum, Azotobacter, Azoarcus, cyanobacteria and diazotrophicus. Along with BNF, phosphate solubilization is similarly very important. Phosphorus is important macronutrients for biological development and growth. Phosphate solubilizing bacteria (PSBs) have the ability to convert inorganic phosphate into organic form thus increasing its solubility in soil. They impart beneficial effects to environment by providing phosphate in a sustainable manner to the plants (Pradhan and Sukla, 2005). Many PGPRs are known as very good solubilizer for insoluble rock phosphate, organic and soil bound/accumulated phosphate in soil. Production of enzyme phosphatases by plants and microbes may be involved in conversion of organic form of phosphate to inorganic form for plant growth (Duff et al., 1994). Most dominant PSB belonging to Bacillus, Enterobacter and Pseudomonas are involved in phophate solubilization. PSB in the form of biofertilizer has huge potential to significantly increase the crop production by decreasing the fixed P reservoir in soil or utilization of natural assets of rock phosphates.
In this way, PGPRs are becoming more attractive alternatives as
bioinoculants and can be utilize as an additive to chemical fertilizers for improving crop yield in an integrated nutrient management system. Integrated nutrient management system help to minimize chemical input and enhanced nutrient use efficacy by combining chemical and biological sources of plant nutrients in an efficient and environmentally prudent manner (Adesmoye and Kloepper, 2009) and also helps to minimize the use of chemicals (Fernando et al., 2006). In order to utilize PGPRs bioinoculant in agriculture successfully, it is essential to identify their metabolic, phenotypic and genotypic diversity and their capability for the production of different 17
ranges of antimicrobial metabolites. Conventionally, phenotypic identification methods play an important role but identification at molecular level is now becoming more authenticated and reliable. The discovery of PCR and DNA sequencing techniques has lead to the use of these techniques for identification of bacteria at genus/species level. Sequence information from highly conserved region of the 16S rRNA gene is useful for studying phylogenetic relationships within species and genus (Olsen and Woese, 1993). To understand genotypic and phenotypic diversity of soil bacteria and their potential role as plant growth promoters in the rhizosphere, their interaction to crops and application as inoculant is very essential to understand (Rameshkumar et al., 2012).
Thus, integrated use of PGPRs and chemical fertilizer could be highly effective in improving yield and growth of crops. Keeping in view the above significance of PGPRs, the present study was designed with the following
objectives:
1. Isolation and characterization of bacterial strains for growth promoting traits
e.g. indole•3•acetic acid (IAA), P•solubilization and sidrophore assay;
2. Screening of the most promising selected bacterial strains based on growth
promoting traits under controlled conditions;
3. Identification of potential PGPRs using molecular technique i.e. phylogenetic
analysis based on 16S rRNA gene sequences
4. Evaluating effectiveness of the most potential PGPRs for improving growth
and yield of soybean and wheat under pot and field conditions.
18
Chapter 2
REVIEW OF LITERATURE
A narrow region of soil adjacent to the plant roots that is highly influenced by the root activity and metabolism is known as Rhizosphere (Dobbelaere et al., 2003). Abundant nutrients are present in this region due to the release of root exudates, monosaccharides, organic acids and amino acids, which enhance the active growth and various activities of microorganisms within the rhizosphere. Microorganisms in association with root could be parasitic, saprophytic or freeliving (Kunc and Macura, 1988). A specific group of bacteria among the microbial communities attributing positive effects on plant development by root colonizing are termed as plant growth promoting rhizobacteria (PGPRs) (Kloepper and Schroth, 1978). PGPRs effect plant health and production by various mechanisms that involve: (1) solubilization of inorganic nutrients; (2) stimulation of root growth; (3) suppression of root diseases; (Martínez et al., 2010); (4) recover structure of soil; and (5) inorganics leaching by microbes (Hayat et al., 2010).
Generally, PGPRs are categorized into two different groups: (i) extracellular PGPRs (ePGPR), usually exists in the rhizophere, on the rhizoplane or between the spaces of cell cortex; and (ii) intracellular PGPRs (iPGPR) inside the root cells, normally in specialized structure of nodules. The well•known iPGPR are
Rhizobium, which formed nodules in leguminous plants (Hayat et al., 2010). From 1950 till now hundreds of PGPR strains have been evaluated and studied in all possible conditions (laboratory, greenhouse and field conditions). Now developing countries use these PGPRs as bioinoculants on large land areas for better production (Zehnder et al., 2001). The main obstacle to apply this biotechnology is
5
the variation and lack of homogeneity when comparing the results of field trials.
The difference in results might be due to site, time and crop variation (Lambert and Joos, 1989). It is important to establish an effective bacterial inoculant by opting best PGPRs in accordance with the soil and crop.
19
2.1 ROLE OF PGPRs IN CROP PRODUCTION
The PGPRs belonging to wide range of bacterial genera are recognized to take part in many dynamic activities such as nutrient cycling, plant/seed growth and biological control of plant pathogen (Zahir et al., 2004) through the release of different substances (Table 3). Among PGPRs, Azospirillum, Bacillus, Pseudomonas are most studied genera but other bacterial genera are also included in this group. Most potential PGPRs are selected and utilized as inoculant (Ahemad and Khan, 2010). The application of PGPRs as inoculants becomes very attractive due to minimal use of chemical fertilizers and pesticides, and there are now an increasing number of inoculants being commercialized for various crops (Berg,
2009).
In general PGPRs enhance plant growth due to three mechanisms: (i) PGPRs served as biofertilizers (nitrogen•fixing bacteria and phosphate•solubilizing bacteria) support plant in nutrient uptake by providing fixed nitrogen and other nutrients (Kennedy and Islam, 2001); (ii) Phytostimulators (microbes producing phytohormones such as Azotobacter) can directly stimulate the growth of plants by producing plant hormones (Glick et al., 2007); (iii) Biological control agents (Bacillus, Pseudomonas and Trichoderma) defend plants against phytopathogenic organisms (Mohiddin, 2010). In agriculture, use of PGPRs as inoculant offer an alternative way to reduce the utilization of chemical fertilizer, different supplements and pesticides; play a key role in progressive increase in root and shoot length and dry matter production of plants. PGPRs also very helpful to minimize diseases in plants. Rhizobia (Allorhizobium, Azorhizobium, Bradyrhizobium, Mesorhizobium, Rhizobium, and Sinorhizobium) have been used successfully to permit a useful establishment of the symbiosis with leguminous plant for nitrogen fixation (Hayat et al., 2010). Oppositely, free living or nonsymbiotic rhizobacteria such as Bacillus, Azospirillum, Azotobacter, Klebsiella and
Enterobacter are also used to inoculate for improving plant productivity (Lynch,
1983) and phosphate solubilizing bacteria (PSB) such as species of Pseudomonas, Bacillus and Paenibacillus have been used to apply for significant improvement in phosphate availability (Brown, 1974).
2.2 MECHANISMS OF PLANT GROWTH PROMOTION
PGPRs have been distributed into two major groups, on the basis of their mechanisms: direct PGPRs that improve yield, seed emergence, or prompt plant growth and biocontrol PGPRs that help growth of plant indirectly (Glick et al., 1999). In the last two decades, significant work has been done to reveal both the 20
mechanisms by which PGPRs enhance plant productivity. Production of phytohormone and improved plant nutrition status were the two obvious mechanisms by which PGPRs directly prompt plant growth. Improved plant nutrition status by PGPRs is mostly improved by solubilization of inorganic phosphates and iron uptake by iron chelating siderophores production. PGPRs indirectly effect the plant growth by minimizing the impact of deleterious microorganisms that impede plant growth and development or parasitism, antibiosis, competition for nutrients, and/or trigger host defence system. Details discussion for these mechanisms and their individual participation in plant growth promotion are discussed below.
2.2.1 Biological Nitrogen Fixation Nitrogen is generally considered one of the major limiting nutrients in plant growth. Mostly our soils are nitrogen deficient and nitrogenous fertilization is very essential for attaining maximum crop yield. Although, abundant of molecular nitrogen is present in biosphere and comprised 78% of the earth’s atmosphere. First, it must be converted to ammonia or nitrate form for incorporation into living organisms because in this form, it cannot be directly utilized by plants (Hayat et al., 2012). Conversion of atmospheric N into ammonia or nitrate forms by three different procedures: (i) transformation into oxides of nitrogen in the atmosphere; (ii) industrial nitrogen fixation by using high temperature (300•500 °C) and catalysts to transform N to ammonia; (iii) Biological nitrogen fixation (BNF) by microorganisms using nitrogenase enzymes (Ahemad and khan, 2011). Among all other processes, BNF fixes more than 60% of atmospheric N presenting itself to be a sound and beneficial alternative to chemical fertilizers both economically and environmentally. Nitrogen fixing microorganisms can generally be divided into two different forms: (i) Symbiotic nitrogen fixing bacteria, contains members of the family Rhizobiaceae and formed a symbiotic interaction with host plants from the legume family e.g. Allorhizobium, Azorhizobium, Bradyrhizobium,
Mesorhizobium, Rhizobium, Sinorhizobium, and Frankia (Ahemad and Khan, 2010); (ii) non symbiotic bacteria (free living, endophytic and associative bacteria) includes Azospirillum, Azotobacter, Azocarus, cyanobacteria, diazotrophicus etc.
The method of BNF is carried out by using the nitrogenase enzymes encoded by nif genes (Ahemad and Khan, 2011) and fix genes. An enzyme complex nitrogenase encoded by 21
nifDK and nifH genes catalyses the process of nitrogen fixation in symbionts and free living microbes. Nitrogenase is comprised of two subunits; Subunit I consists of molybdenum•iron protein (MoFe) and subunit II consists of iron containing protein (Fe). Both the subunits are encoded by genes (nifK and nifD) along with the requirement of a cofactor for the activation of MoFe protein. The required cofactor is FeMo•Co. nif genes vary structurally and physically in microorganisms. The genes involved in nitrogen fixation process are numerous in number and are collectively termed as fix genes. The genes imparting direct and indirect roles in nitrogen fixation are exopolysaccharides, hydrogen uptake, glutamine synthase, dicarboxylate transport, nodulation efficiency, B•1, 2 Glucans and lipopolysaccharides. The release of flavonoid molecules and chemotactical reactions between rhizobia and leguminous plants lead to the formation of root nodule which is an indication of symbiotic nitrogen fixation. Rhizobium legume communication is possible due to the Nod factors. These are the vital elements of nodule formation. Nod factors lipochitoligosaccharides (LCOs) are secreted by microsymbionts from more than 30 nod, nol and noe genes and their corresponding proteins. The flavonoids (glycones or aglycones, chalcones, flavones, flavanones, isoflavones and coumestans) are released by plants on induction by nod factor from micro symbiont. The nitrogen fixation by rhizobia in legumes can also beneficial in associated with non•legumes through intercrops or crop rotation between cereal and symbiotic legumes (Hayat et al., 2008). A numerous experiment confirmed the ability of rhizobia to colonize roots of non•legumes and localize themselves internally in tissues (Spencer et al., 1994). Free•living bacteria/associative bacteria as well as strains of rhizobia can improve the growth of cereal crops by improving the N status through their capability to fix elemental form of nitrogen (Zahir et al., 2004). Kennedy and Islam, (2001) also described from BNF view point the contribution and mechanisms of associative bacteria to crop growth. Release of important nutrients e.g. NH4•N through BNF or ease of nutrient uptake by the plant is also considered as direct plant growth promotion. The important associative and free•living nitrogen fixing genera are Achromobacter, Acetobacter, Azospirillum,
Azotobacter, Azoarcus, Bacillus, Kelbsiella, Mycobacterium, Clostridia,
Citrobacter, Burkholderia, Enterobacter, Herbaspirillum, Pseudomonas, 22
Rhodobacter and Serratia.
2.2.2 Solubilization of Phosphates Phosphorus (P) is a major plant nutrient limiting plant growth. It significantly processes in plant including photosynthesis, respiration, energy transfer, molecular biosynthesis and signal transduction (Khan et al., 2010) and BNF in legumes (Saber et al., 2005). Like nitrogen, there is no enormous biologically available atmospheric source (Ezawa et al., 2002). Phosphorus is naturally insoluble or poorly soluble in soils. Inorganic form of phosphorus applied as soil fertilizer is it’s rapidly covert into immobilized form and becomes unavailable (Nautiyal, 1999). Although the average P content in soil is not very low, it is about 0.05% (W/W) but out of which very small portion 0.1 % is accessible to plants (Illmer and Schimmer, 1995) because of P•fixation. P•fixation is the term that describes the process of conversion of mobile phase of P into solid phase (Barber, 1995). This can happen in two ways either the sorption of phosphate on the surface of solid minerals or it is precipitated along with the free Al3+ and Fe3+ in the soil solution. Most of the soil P becomes fixed and chemical P fertilizers are used to meet the available P levels for crop production, which severely increase the input production cost and also impose negative effects on general soil condition and degradation of terrestrial, marine resources and freshwater (Sharma et al., 2013). Different plant utilizable forms of P are available but plant usually absorbed
−1 −2 in the form of H2PO4 or HPO4 . To convert insoluble forms of phosphate compounds to soluble form is a vital characteristic of PGPRs for enhancing crop yields (Rodríguez et al., 2006). Plant’s rhizospheric soils are highly rich in phosphate solubilizing bacteria (PSB) and isolated easily. PSBs are able to solubilize insoluble soil P and increase crop yields (Dhankhar et al., 2013). Microorganisms and soil interactions significantly participate in facilitating the supply between the available form of P in soil solution and the total P in soil through solubilisation, mineralization and immobilization. Main mechanism for phosphate solublizing includes ability of PSBs to decrease the pH level of the surroundings by the release of organic acids (Chen et al., 2006) e.g. acetic acids, citric acid, propionic acid, gluconic acid, lactic acid, 2•ketogluconic acid, isovaleric acid, malonic acid, 23
isobutyric acid, glycolic acid, succinic acid, oxalic acid. These organic acids releases fixed phosphates either by anion exchange or can chelate Al, Ca or Fe ions associated with the phosphates (Gyaneshwar et al., 2002). Production of acid phosphatase play a significant role in assimilation of phosphate from organic compounds by plants and microorganisms but it is less effective at the same pH as compared with organic acids (Sharma et al., 2011). Microorganisms, particularly the use of such PSBs as inoculants at the same time convert the fixed form of P into soluble form used as biofertilizer (Dhankhar et al., 2013). PSBs have a high capability improve P availability to plants in P deficient soils and suppress 24
Table 1: Effect of plant growth promoting rhizobacteria on different crops and their responses.
PGPRs Crops Responses References Bacillus circulans and Millet and peas Increased plant weight, Phosphate availability and Saber et al., 1977; Raj Bacillus megaterium uptake et al., 1981 Bacillus subtilis Mungbean Increased grain, biomass yield, and uptake of N and Gaind and Gaur, 1991 P Fluorescent pseudomonas Chick pea and Increased Seed germination, Growth and yield Kumar and dube, 1992 soybean
Pseudomonas putida and Canola, wheat Increase root and shoot length Glick et al., 1997 Pseudomonas fluorescens and potatoes Enterobacter agglomerans Canola Increased significantly plant growth De Freitas et al., 1997 Bradyrhizobium japonicum Radish Increased dry matter of radish plant by 15% without Antoun et al., 1998 nodulation over control
Pseudomonas putida Canola, lettuce, Increased plant height, seed weight, root and shoot Rodriguez et al., 1999; maize and elongation Gholami et al., 2009 tomato
Pseudomonas spp. Potatoes Increase root and shoot weight of potatoes Sturz et al., 2001 25
Bacillus amyloliquefaciens Rice Increased shoot and root lengths and grain yield Preeti et al., 2002 Azospirillum brasilense Wheat Improved germination, early growth, flowering and Dobbelaere et al., 2002 improve dry matter of root and shoot of plant Acinotobacter brasilense Soybean Improved root length and weight, and significantly Vessey, 2003 increase total root length upto 10•fold
Azospirillum brasilense Maize Significant increase of root hairs, root surface area Vessey, 2003 and root weight.
Pseudomonas fluorescens Peas Increase in nodulation mediated by inoculation with Vessey, 2003 was due to an increase in flavonoid exudation by the host plant.
Azospirillum brazilance Wheat Increased the number and length of lateral roots Ahmad et al., 2005
Pseudomonas stutzeri Rice Significantly increase rice growth Mirza and Mehnaz,, 2006
Azotobacter sp. Wheat Increased plant height, seed yield and enhanced Anjum et al., 2007 microbial population
Azospirillum lipoferum Cotton Increased Seed plant height (5%) and yield (21%) over Anjum et al., 2007 uninoculated control
Pseudomonas fluorescens Groundnut Enhance plant growth under saline conditions Saravanakumar and 26
Samiyappan, 2007 Azospirillum amazonense Rice Increased panicle number and nitrogen Elisete et al., 2008 accumulation at grain maturation (3•18%) and dry matter of grain (7•11.6%) over unioculated control
Pseudomonas aeurginose Tomato, spinach Increased dry biomass 31 % for tomato, 40 % for Adesemoye et al., 2008 and okra spinach and 36% for okra over control
Mesorhizobium ciceri Chickpea Increased Plant growth, grain yield and nutrient uptake Rokhzadi et al., 2008 significantly
Azospirillum brazilance Wheat Increased the number and length of lateral roots Shahab et al., 2009
Wheat Zarrin et al., 2009 Providencia and Increased germination percentage upto two•fold Brevundimonas diminuta over untreated controls. Pseudomnas putida (UW4) Canola Increase plant growth in saline conditions Naz and Bano, 2010 Rhizobium sp. RP5 Peas Increased dry matter, numbers of nodule, root N Ahemad et al., 2011 and shoot N, grain protein and seed yield
Brevundimonas diminuta and Wheat Increased plant height (40.91%), root weight Rana et al., 2011 Providencia sp. (85.71%) and panicle weight (37%) over unioculated control Bradyrhizobium sp. Green gram Increased leghaemoglobim by 120%, number of 27
nodule by 82%, seed yield, grain protein and root N.
A h e m a d e t a l . , 2 0 1 1
Enterobacter aerogenes and Wheat Increased shoot length and root length and biomass Hayat et al., 2012 Pseudomonas brenneri production Corynebacterium agropyri, Rice Improved germination percentage and seedling Ng et al., 2012 Enterobacter gergoviae growth 28
Bacillus gibsonii and Bacillus Wheat and beans Improved plant and spike length, and dry shoot and Hayat et al., 2013 subtilis subsp.inauosorum grain weight significantly over control
Azospirillum brasilense Wheat Increase grain yield Saber et al., 2012 Combined inoculation of Sorghum Improved grain and biomass yields anduptake of N Nandal and hooda, A.brasilense and and P as compared with single inoculation ofsingle 2013 bacteria Pseudomonas strica or Bacillus polymyxa Pseudomonas fluorescence Chickpea Stimulating yield and growth rate Rathore, 2014
29
diseases (Panhwar et al., 2012). Several important bacterial species belonging to the genera Pseudomonas, Bacillus and Rhizobium, have recognized as the most powerful PSBs (Banerjee et al., 2006; Hayat et al., 2010; Hayat et al., 2012). There are also reported that non•symbiotic nitrogen fixer Azotobacter serve as a very good phosphate solubilizer (Kumar et al., 2001). The combined inoculation of PSBs and PGPRs or PSBs and Arbuscular mycorrhiza could decrease fertilizer application without decreasing crop growth and yield (Sharma et al., 2011).
Synthesization of different phytohormones like Indole•3•acetic acid (IAA), Gibberellic acid (GA3), siderophore and improving the availability of different trace elements such as zinc, iron etc are important trait of PSBs (Ramkumar and Kannapiran, 2011). PSBs improve the yield and growth of different plants as documented in wheat and Zea mays (Afzal et al., 2005; Yasmin et al., 2012). Field experiments described that PSBs not only improve the yield, quality and growth of crops but also significantly decrease (1/3•1/2) the usage of organic or chemical fertilizers. The application of these inoculants by using different procedures can improve the effectiveness of synthetically and naturally produced P resources and optimize the production of crops (Yasmin and Bano, 2011).
2.2.3 Phytohormones Production by PGPRs Plant growth regulators (PGRs) are organic substances present in extremely small concentrations effect biochemical, morphological and physiological processes in plants. PGRs are signal molecule working as chemical messengers and significantly participate in growth and development of plant as growth regulators (Martínez et al., 2010; Salamone et al., 2005). Five majors PGRs auxins, abscisic acid (ABA), cytokinins, ethylene and gibberellins are usually called phytohormones, have advantageous effects on plant growth and they are produced endogenously by plants (Arshad and Frankenberger, 1993). Polyamines and brassinosteroids are also PGRs produced naturally by plant tissues and some synthetic compounds also trigger many physiological responses when they are artificially applied to plant tissues (Galston and Sawhney, 1990; Salisbury and Ross, 1992). Many bacterial and fungal species can synthesize phytohormones and synthesizing ability is distributed among plant and soil bacteria. Several studies confirmed that the PGPRs can improve plant growth through auxins production, ethylene, gibberellines and cytokinins (Bottini et al., 2004; Spaepen et al., 2008). 30
2.2.3.1 Indole-3-acetic acid (IAA) production Indole•3•acetic acid (IAA) is the most common, well•studied naturally occurring auxin having ability to control many aspects of plant growth some of them include the vascular tissues differentiation, growth elongation, apical dominance, initiation of lateral root, fruit setting and ripening. Plants produce active IAA produced by de novo synthesis from tryptophane which pass through either oxidative deamination (through indole•3•pyruvic acid formation) or decarboxylation (through tryptamine formulation by using indole•3•acetic acid aldehyde as an intermediate) (Ahemad and Khan, 2011). There are different pathways involved in the synthesis of IAA by microbes (Figure 2): (i) IAA formation via indole•3•pyruvic acid and indole•3•acetic acid aldehyde is present in most of rhizobacteria like Agrobacterium, Pseudomonas, Klebsiella etc; (ii) Conversion of tryptophane into indole•3•acetic aldehyde and produce tryptomine
e.g. Azospirilla and Pseudomonads; (iii) Biosynthesis of IAA via indole•3•
31
Figure 1: Schematic diagram of soil phosphorus mobilization and immobilization by Phosphate Solubilizing Bacteria (Sharma et al., 2013).
acetamide formation is reported for phytopathogenic bacteria Azospirillum, Agrobacterium tumefaciensm, Erwinia hebicola, Rhizobium spp. Bradyrhizobium sp. and Saprophytic Pseudomonads etc; (iv) In plant, biosynthesis of IAA via indole•3•acetonitrile is present, maybe the Cyanobacteria and Alcaligenes faecalis; (v) Tryptophane independent pathway, mostly present in plant and microorganisms e.g. Cyanobacteria and Azospirilla. However, formation of IAA using this pathway is non•significant and its mechanisms are unknown. It is well documented that more than 80% bacteria isolated from 32
rhizospheric soil of different crops have the capability to produce and release auxin (Loper and Schroth, 1986). Among the auxin producing PGPRs species, Azospirillum is most studied IAA producers
(Dobbelaere et al., 1999). Other IAA producing bacteria belong to the genera
Aeromonas, Azotobacter, Bacillus, Burkholderia, Enterobacter, Pseudomonas and Rhizobium (Ahmad et al., 2008; Hariprasad and Niranjana, 2009; Shoebitz et al., 2009; Swain et al., 2007). The formation of different amount of IAA by bacterial strains could be varied due to participation of different biosynthetic pathway, regulatory sequences, genes location and availability of enzymes to convert active free IAA to fixed form and also affected by environmental conditions (Ahemad and
Khan, 2011; Patten and Glick, 1996).
2.2.3.2 1-Aminocyclopropane-1-carboxylate (ACC) deaminase production Ethylene is documented as an important plant hormone, which regulating normal growth and development processes within plant body (Abeles et al., 1992; Ahemad and Kibret, 2014; Khalid et al., 2006). Ethylene has been recognized as a growth regulator and a very good stress hormone (Saleem et al., 2007). It is produced due to various environmental factors such as salinity, high temperature and drought, physical impendence, wounding, water logging, metal stress and disease (Arteca and Arteca, 2007; Ahemad and Kibret, 2014; Belimov et al., 2009; Bhattacharyya and Jha, 2012) etc. which may affect the nodulation and nitrogen fixation of leguminous plants. At low level of ethylene hormones in plant have positive effect but higher levels inhibit normal plant growth. PGPRs with enzyme, ACC deaminase, support growth and development of plant by declining level of ethylene, prompting salt tolerance and decreasing drought stress in plants (Ahemad and Kibret, 2014). Presently, bacterial strains containing ACC deaminase enzymes belong to wide range of genera such as Acinotobacter, Achromobacter, Enterobacter, Pseudomonas, Azospirillum, Agrobacterium, Alcaligenes, Serratia, Ralstonia and Rhizobium etc. (Ahemad and 33
Kibret, 2014; Kang et al., 2010; Shaharoona et al., 2007; Zahir et al., 2009). Such rhizobacteria utilize ethylene precursor ACC and transform it into NH3 and 2•oxobutanoate (Arshad et al., 2007). Numerous forms of stress are released by ACC deaminase producing bacteria, such as effects of phytopathogenic microorganisms (bacteria, fungi and viruses etc), and resistance to stress from flooding, extreme temperatures, polyaromatic hydrocarbons heavy metals, high salt concentration, insect predation, radiation, high light intensity, draft and wounding (Glick, 2012; Lugtenberg and Kamilova, 2009). Bio•fertilizers containing PGPRs with ACC•deaminase if applied have positive effect on plant growth and development (Shaharoona et al., 2006). PGPRs have played a vital role in the production of phosphataes, dehydroginase, βgluconase, antibiotic (Hass Keel, 2003). Their contribution in improving the organic matter contents and soil structure, solubilization of mineral phosphates and nutrients and stabilization of soil aggregates (Miller and Jastrow, 2000) has been cited. The engrossment of such biotechnologies minimizes the need of
21
Table 2: Phosphate solubilization by plant growth promoting rhizobacteria and crop responses.
PGPR Crops Responses R eferences
Bacillus circulans and Bacillus Millet and pea Increased plant weight and Phosphate uptake of Raj et al., 1981 inoculated plant megaterium Bacillus firmus pseudomonas and Enterobacter Rice Increased grain yield and Phosphate uptake Datta et al., 1982 spp. Maize Increased plant growth significantly over control Chabot et al., 1993 Pseudomonas putida and Rice, beans and wheat Increased crop yields Pseudomonas fluorescens Kloepper, 1994; P•solubilizing Pseudomonas and Glick, 1997 Enterobacter spp. Bacillus and Maize Positive growth promotion of inoculated plant De Freitas et al., Xanthomonas spp. 1997 Canola Increased the plant height and biomass yield De Freitas et al., Bacillus firmus 1997 Rice Increased grain yield and P•uptake of rice in a De Freitas et al., Pdeficient soil Burkholderia cepacia 1997 Phosphate solubilizing Common bean Significant increases number of nodules Peix et al., 2001 Pseudomonas and Bacillus spp. Wheat Increase in grain yield and phosphorous uptake Afzal et al., 2005
22
Pseudomonas spp. Rice Increased plant growth and disease control Pseudomonas spp. soybean Increased dry weight and number of nodules, grain yield, uptake and nutrient availability
Bacillus subtilis SU47 and Mungbean Increased biomass yield, grain yield, and P and N Arthrobacter spp. SU18 uptake Pseudomonas chlororaphis and Walnut seedlings Remarkably increased plant height, shoot and root Pseudomonas fluorescens dry weight phosphorous and nitrogen uptake Pseudomonas striata Soybean Significantly increased plant growth in sandy alluvial soil
Bacillus firlmus NCIM 2636 Rice Increased plant growth in acid soil
S a i k i a e t a l . , 2
0 0 5
M e h r v a r z e t a l . , 2 0 0 8 U p a d h y a y e t a
l . , 2 0 0 9 , 2 0 1 1 Yu et al., 2011
S h a r m a e t a l . , 2 0 1 3
S h a r m a e t a l . , 2 0 1 3
40
artificial fertizers as the nutrients remain in the soil system. These mechanisms possess significant plant growth promoting potential (Kennedy et al., 2004) which are also involved in improving the release of nutrients (Dobbelaere et al., 2003;
Ladha and Reddy, 2003; Lynch, 1990; Nautiyal et al., 2000; Walsh et al., 2001).
2.2.3.3 Cytokinin production Cytokinins are very good PGRs that control cytokinesis in tissues of crop plant (Skoog et al., 1965). Over 100 years ago, numerous scientists discovered the presence of substances that were capable to prompt cell division in cultured or damaged plant tissue (El•Showk et al., 2013). Letham (1963) stated that zeatin was isolated from Zea mays. According to him it was the first natural cytokinin with pure crystalline structure. Chemical synthesis proved the structure of zeatin to be (E)•4•(hydroxy•3•methyl•but•2•enyl) aminopurine. The most observable effect of cytokinin on plant to stimulate shoot and root growth and enhance cell division (Hayat et al., 2010) and they have been involved in many other important developmental processes in plants, including seed germination, organ formation, shoot meristem formation and maintenance and leaf senescence (Mok and Mok, 2001). Above 30 different growth promoting cytokinins compounds have been found in plants, plant associated microorganisms and in vitro conditions, most of proposed. Direct pathway, involving development of dimethylallyl pyrophosphate (DMAPP) and AdoMet: S•S•adenosyl•L•methionine; ACC: 1•aminocycloprpane1•carboxylate (Kang et al., 2010). N6•isopentenyladenosine monophosphate (i6 AMP) from AMP, followed by formation zeatin•type compounds from hydroxy• lation of the side chain and indirect pathway, in which released of cytokinins by
41
R-CH3-CHNH2-COOH (Tryptophane)
R-CH2-CONH2 R-CH2-CH2-CH2NH2 R-CH2-CO- COOH R-CH2-CHOH-COOH (Indole-3-acetamide) (Tryptamine) (Indole-3-pyruvic acid) (Indole-3-lacticacid)
R-CH2-CHO (Indole-3-acetaldehyde)
R-CH2-COOH (Indole-3-acetic acid)
Figure 2: Biosynthetic Pathway of IAA Synthesis in Bacteria (Ahemad and Khan 2013)
turnover of tRNA containing cis•zeatin. Cytokinins play significant role during development processes, from germination of seed to plant senescence and regulate different physiological and morphological processes 42
throughout the plant life, including respiration and photosynthesis (Arshad and Frankenberger, 1993). The variable effects recommend that cytokinins might have various mechanisms of action depend on the type of tissues, or the impacts of primary and secondary effects caused due to the variation in physiological states of the target cells
(Salisbury and Ross, 1992).
2.2.3.4 Gibberellins production Gibberellins (GAs) are another important natural plant growth regulators in higher plants. They are usually derived from gibberellic acid and control seed dormancy, stem proliferation, expansion of leaves and flowering (Javid et al., 2011). GAs were discovered in 1938, and isolated from Gibberella fujikuroi, a pathogenic fungus of rice (Miransari and smith, 2013). Otherwise, ethylene could be released from ACC and then cause stress responses including growth inhibition. In root nodule symbiosis, GAs play a significant role. There are more than 80 different gibberellins, but among all GA3 is the most commonly used form and
GA1 is the most active in plants, which is primarily responsible for stem elongation (Davies, 1995). Several pathways are involved for the biosynthesis of gibberellins from geranyldiphosphate. DELLA proteins are involved in the regulation of gibberellins, C•terminal GRAS domain is the core part of structure of DELLA protein eventually degraded by E3 ubiquitin ligase SCF (GID2/SLY1). Regulation of gibberellins is conducted by this protein (Miransari and smith, 2013). The accumulation of DELLAs in seeds becomes a cause to express the genes involved in the production of F•box proteins. The gibberellins receptor has recently been identified in rice. Gibberellin insensitive dawrf1 (GID1) protein interacts with DELLA proteins followed by their degradation in nucleus and binding with biologically active gibberlins (Willige et al., 2007). Role of gibberellins in plant growth and development is quite evident. The growth of stem is highly dependent upon the production of gibberellins. Their low levels in plant metabolism results in shorter height as compared to natural height. In reality shorter and thicker stems are preferred as 43
they can resist stress conditions and give better support therefore in grain production extensive use of gibberellin synthesis inhibitors is preferably chosen. On the other hand as they are beneficial for seed germination at breaking seed dormancy. They are positively considered for seeds that show resistance for germination.
2.2.4 Increased Iron Uptake Almost all living organisms required iron as an essential nutrient and play a significant part in various enzymes with redox activity. It’s also an important part of different processes e.g. photosynthesis, NO2 and N2 assimilation and •2 SO4 reduction, and is therefore essential for chlorophyll biosynthesis (Hayat et al., 2012). Excess amount of iron is present in soil than crop requirements but large part of iron is in highly insoluble form (ferric hydroxide). Irons become a limiting factor for plant development even in abundance of iron. Under iron limiting condition, most of the soil bacteria secrete low molecular weight compounds called siderophores, which readily form complexes with Fe+3 and make it available for iron uptake. Siderophores are small, high•affinity iron chelating compound secreted by microorganisms and help to simplify its bioavailability into the biological cell
44
Methionine
S • AdoMet ACC synthesis ACC deaminase ACC Ammonia, 2 • Oxobutanoate ACC
ACC oxidase
Ethylene Bacterium
Root elongation Stress responses
Plant root
Figure 3: A mechanism to decrease level of ethylene in the root of plants by bacterial ACC deaminase. ACC synthase release by the plant root and taken up the rhizobacteria and synthesized ACC deaminase in plant. Bacteria hydrolyze ACC to ammonia and 2•oxobutanoate. These hydrolysis processes maintains concentrations of ACC low in bacteria and allow continuous transfer of ACC from roots to bacteria.
(Schalk et al., 2001). Siderophores are usually water soluble and distributed into extracellular siderophores and intracellular siderophores. Rhizobacteria can be classified on the basis of their ability to utilize siderophores. Some rhizobacteria can consume siderophores of same the genus (homologous siderophores) while others can consume siderophores being produced by rhizobacteria of other genus
(heterogenous siderophores) (Khan et al., 2009). 45
Therefore, siderophores work as a solubilizing agent not only for iron but also form complexes with other heavy metals that severely contaminate the environment, such as Zn, Al, Ga, Cu, Cd, Pb and as well as also include radionuclides U and Np (Kiss and Farkas, 1998; Neubauer et al., 2000). The concentration of a soluble metal is increased when a siderophore is bound to it (Rajkumar et al., 2010). Different stresses on the plant due to high levels of heavy metals in soil could be minimized by bacterial siderophores. PGPRs in the rhizosphere produce and releases different type of siderophores under iron limited soil (Buyer et al., 1993). There are different types of siderophores: phenolcatecholates, hydroxamates and carboxylates. Pseudomonas species are the strong siderophore producers among all Gram•negative PGPRs by producing pyoverdine, pseudobactin, pyochelin, quinolobactin and salicylic acid (David et al., 2005). PGPRs with the ability to produce and release of siderophore play an essential part for bioavailability in rhizospheric soil. The solubility of iron depends upon the form of complex it forms and the efficiency of siderophore to chelate the iron from its complex determines its bioavailability in natural environment (Hersman et al., 2001). Production of siderophores by PGPRs suppressed the activity of root pathogens by utilizing available forms of soil iron (Kloepper et al., 1980) and with the availability or addition of iron even in acidic soils, the impact of these siderophores is minimized (Neilands and Nakamura, 1991). Iron uptake and transport by different bacterial species consumed different bacterial proteins and this uptake totally depends on the available concentration of soil iron.
2.3 APPROACHES TO DEVELOP PGPRs
Screening of PGPRs includes traditional as well as modern approaches. Modern approaches of screening these organisms from rhizosphere and nonrhizosphere soils are considered to be potent to improve the results of studying their effects on plant in laboratory. Soil and crop cultural practices, inoculant formulation and delivery are to be considered for rhizosphere management (Bowen et al., 1999). Root associated traits to enhance the establishment and proliferation of beneficial organisms is being pursued by genetic manipulation of host crops
(Mansouri et al., 2002; Smith et al., 1999). Multi•strain inocula formulations of
PGPR with known functions may enhance the stability in the field (Jetiyanon et al., 2002, Siddiqui et al., 2002). Molecular techniques are playing lead roles in mounting 46
our ability to understand and manage rhizosphere for obtaining improved and potent products (Nelson, 2004). Large number of mechanisms has been studied yet for engineering the rhizosphere for improved productivity of crops. This includes manipulation of plant for the modification of rhizosphere. This plays vital role in promoting the nutrient availability to plants, immunity against pathogens and boosting PGPR bacterial growth (Ryan et al., 2008). Modification of a strain of Pseudomonas with chitinase gene from Serratia marcescens by using an in vitro approach is highly beneficial. Through this technique the strain became effectively potent towards Fusarium oxysporum f.sp. redolens and Gaeumannomyces graminis var. triti (Sundheim et al., 1998). Experimentation with Pseudomonas flourescens (DAPG•producing PGPR strain) has verified that plant species possess the ability to sustain the growth and nourishment of varied microbial population and their genotypes in rhizosphere (Fuente et al., 2006; Landa et al., 2006). Notz et al. (2001) has significantly correlated the DAPG accumulation by Pseudomonas fluorescens CHAO with the expression of DAPG biosynthesis gene phlA. The greater expression of monocots as compared to the dicots was also observed in rhizosphere. Di Gregorio et al. (2006) noticed that in EDTA amended soils, inocula with combined application (Triton X•100 and Sinorhizobium sp. Pb002) was beneficial for phytoextraction of lead by Brassica juncea.
As soil is an indeterminate natural environment and the desired results are not always achieved, therefore the impact of PGPR application is different under lab, green house and field conditions. The profound variations in climate affected the efficiency of PGPR, but the undesirable field conditions are rendered as normal characteristics of agriculture (Zaidi et al., 2009). Plant growth promoting attributes function in synergistic phenomenon, and it is suggested that numerous mechanisms like nitrogen fixation, P•solubilization, phytohormone production, siderophore synthesis, ACC deaminase and anti•fungal activity etc. are collectively accounted for the enhanced plant yield and growth promotion (Ahemad and Kibret, 2014). Considerable increase in plant yields has been observed by the use of PGPR in both natural and controlled conditions. The broader use of PGPR may reduce the reliance on chemical fertilizers and pesticides in sustainable agriculture. Moreover, this technology is easily approachable to the farmers especially in developing 47
countries (Gamalero et al., 2009). One of the major challenges 48
Table 3: Plant growth regulator releases by plant growth promoting rhizobacteria and crop responses. PGPR PGRs Responses Crops References Azospirillum brasilense Indole•3•acetic acid, Pearl millet Increased lateral root and root hair Tien et al., 1979 Gibberellins, and cytokinin
Bacillus firmus Indole•3•acetic acid Rice Increased grain yield and Phosphate uptake Datta et al., 1982 pseudomonads polymyxa Indole•3•acetic acid Wheat grass Increased growth over uninoculated control Holl, 1988 Azospirillum spp. and Bacillus spp. Gibberellin Rice Increased N15 uptake Kucey, 1988
Azotobactor paspali Indole•3•acetic acid Canola and Increased growth significantly Abbas and Okon, wheat 1993 Azotobacter paspali IAA and other plant Canola, tomato Increased plant growth Abbass and Okon, hormones and wheat 1993 P•solubilizing Pseudomonas and Siderophores Maize Positive growth promotion of inoculated De Freitas et al., Enterobacter spp. plant 1997 Bacillus firmus P•solubilizing and Rice Increased grain yield and P•uptake in a De Freitas et al., Indole•3•acetic acid Pdeficient soil 1997 Azospirillum lipoferum Gibberellin Maize Alleviate temporary drought Cohen et al., 2001 49
Enterobacter cloacae and ACC deaminase Tomato Increased plant resistance in flood Grinchko and Glick,
Pseudomonas putida conditions 2001 Enterobactet cloacae, ACC deaminase Tomato Inoculated tomato seed increase plant Grinchko and Glick, Pseudomonas putida and resistance on 55 days to 9 consecutive days 2001 of flooding and increase resistant in salinity Achromobacter piechaudii Bacillus circulans, Bacillus firmus ACC deaminase Brassica Increased root length Ghosh et al., 2003 campestri and Bacillus globisporus Achromobacter piechaudii ACC deaminase Tomato Increased fresh and dry weight of Mayak et al., 2004 inoculated plants under saline and water stress conditions.
Pseudomonas asplenii. ACC deaminase Raps seeds Significant increase in fresh and dry weight Reed and Glick, and biomass yield 2005 Pseudomonas putida Indole•3•acetic acid Canola Increased 2•3 fold increases in the length Ahmad et al., 2005 of seedling roots
Pseudomonas fluorescens ACC deaminase Maize Increased root length and fresh weight Kausar and under saline conditions Shahzad, 2006 50
Sphingomonas spp. and Indole•3•acetic acid Orchid plant Increased seed germination rate Tsavkelova et al., Mycobacterium spp. seeds 2007 Bacillus subtilis Indole•3•acetic acid Edible tubercle Increased root and stem length and root Swain et al., 2007 and stem fresh weight Spingobacterium sp.and Indole•3•acetic acid Orchid plant Significantly increase rate of germination seed Tsavkelova et al., Mycobacterium spp. and stimulate root growth 2007 Pseudomonas fragi Hydrogen cyanide Wheat Significantly increases the germination seedlings Selvakumar et al., percentage, germination rate, plant biomass 2009 and nutrient uptake Providencia spp. Hydrogen cyanide Wheat Germination percentage is increases upto Zarrin et al., 2009 two fold compared to untreated controls
Bacillus subtilis Indole•3•acetic acid Sweet potatoes Increased in root and stem length, fresh Martínez et al., weight of the root and stem, root: stem 2010 ratio and significantly enhanced numbers of sprouts
Providencia spp. and Hydrogen cyanide Wheat Control fungus diseases and enhance Rana et al., 2011 Pseudomonas aeruginosa defense against phytopathogen 51
Corynebacterium agropyri, Indole•3•acetic acid Rice Improved seed germination and seedling Ng et al., 2012 Enterobacter gergoviae, Bacillus establishment amyloliquefaciens
Pseudomonas chlororaphis Siderophore production Maize Increased root shoot biomass and seed Hayat et al., 2012 germination rate
52
to encounter is the use of PGPR for their commercial application. This encompasses the procedures and practices to maintain the quality, reliability and productivity of biofertilizer. In this regard, B. subtilis has been in constant use for formulation of commercial biofertilizer (Malusá et al., 2012). In the development of potential PGPR biofertilizer, the main focus of the researchers is to assure their endurance and activity under field conditions. Many limitations are still there regarding registration and marketing of biofertilizers (Malusá and Vassilev, 2014). In Pakistan, National Institute for Biotechnology and Genetic Engineering
(NIBGE) has registered and commercialized the bacterial biofertilzer named as “Biopower” to be used for different leguminous and non•leguminous crops like rice, wheat, chickpea, soybean, maize, cotton etc. National Agricultural Research
Centre (NARC) has commercialized biofertilizer under the tag of “Biozote”; BiozoteN for leguminous crops, Biozote•P for all field crops and Biozote•Max for non•leguminous crops. Different bacterial genera are being considered as PGPR, but more focus is on Pseudomonas and Bacillus. Many potential species of Bacillus are temperature tolerant; therefore they can prolong more in commercial form, hence are extensively used in biofertilizers. At present, much research is requisite for extensive commercialization of PGPR biofertilizers, mainly because of their poor response under different field conditions (Malusá and
Vassilev, 2014) and among different plant cultivars (Remans et al., 2008). Therefore there is a dire need for in depth study on colonization and functioning of bacteria under variant soil and climatic conditions to ensure their potential use as biofertilizers.
Chapter 3
MATERIALS AND METHODS
Systematic study was carried out to isolate native strains of rhizobacteria from rhizospheric soil of different crops. In order to test their efficacy on growing crop, molecular, biochemical and plant growth promotion characterization was assessed. A series of experiments conducted under laboratory, green house and field to evaluate 53
the inoculation of most efficient strain of PGPRs for improving growth and yield of soybean and wheat. Methodology adopted during these studies is being described in this chapter.
3.1 SURVEY FOR SAMPLES COLLECTION
Comprehensive survey had been accomplished for the collection of rhizospheric soil of soybean and chickpea, i.e. (soybean and chickpea) grown in farmer’s field at Pothwar (Rawalpindi, Attock & Chakwal) and for wheat from the districts of Rawalpindi, Attock, Chakwal, Haripur, Abbottabad and Gilgit.
3.2 EXPERIMENTAL SITE
A field experiments were conducted at the research farm of the department of Soil Science and Soil and Water Conservation, PMAS•Arid Agriculture University Rawalpindi, Pakistan during 2011•2013 and 2014. The pH of the soil of the experimental field was 7.5 and belonged to Rawalpindi soil series (week medium and coarse sun angular blocky with nearly continuous thin cutans, Typic
Ustocrepts, Eutric Cambisols).
3.3 ISOLATION AND PURIFICATION OF BACTERIA FROM SOIL
35 Several PGPRs were isolated from rhizospheric soil of wheat, soybean and chickpea by using dilution plate technique where phosphate buffer saline (PBS,
1X) were used as saline solution. The PGPRs were grown on tryptic soya agar (TSA; Difco) medium. These plates were incubated at 28 °C for 2•3 days. To obtain pure individual colonies streaking was continued for the isolated bacterial strains on plates containing TSA media under sterilized conditions in laminar air flow cabinet. Repeated streaking was done to attain purity (Hayat et al., 2013) and they were designated according to their source and site.
54
3.4 PLANT GROWTH PROMOTING CHARACTERIZATION
Isolated PGPRs from different locations were characterized for different plant growth promoting traits.
3.4.1 Phosphate Solubilization Pikovskaya’s medium was prepared in agar plates to screen all the isolates for phosphate solubilization as described by Gaur (1990). The process of quantitative analysis of tricalcium phosphate solubilization was followed as reported by King (1932). In a nutshell the inoculation of test isolates was done in Pikovskaya’s broth (25ml) and kept for incubation for 4 days at 28 °C. The inoculated cultures were centrifuged at 15,000 rpm for 30 min. 1 ml supernatant from the centrifuged sample was taken and mixed with 10 ml chloromolibidic acid. Distilled water was added to raise the solution up to 45 ml. 0.25 ml chlorostannous acid was added in this solution and again distilled water was added to make the volume up to 50 ml. The absorbance of the blue color was read 600 nm and the standard curve obtained of KH2PO4 gave the amount of soluble phosphorus.
3.4.2 Production of Indole-3-Acetic Acid (IAA) The procedure for IAA production was followed as reported by Brick et al. (1991). Bacterial strains were cultured at on respective media at 28±2 °C on their respective media. Fully grown cultures (48•72 hrs) were centrifuged at 3000 rpm for 30 min. 2 ml of the obtained supernatant was mixed with two drops of orthophosphoric acid along with the addition of 4ml Salkowski reagent (50 ml, 35% of perchloric acid, 1 ml 0.5M FeCl3 solution). Pink color in the solution indicated IAA production. On spectrophotometer optical density was measured at 530 nm (Spectronic 20D). Standard graph of IAA (Hi•media) within 10•100 µg/mL gave the IAA concentration produced by the cultures.
3.4.3 Production of Siderophore Siderophores were detected by the formation of orange halos around bacterial colonies on Chrome Azural S (CAS) agar plates after incubation for 24 h at room temperature. The presences of siderophores were determined by Arnow’s assay (Schwyn and Neilands, 1987).
3.4.3 nifH Gene Amplification The nitrogen fixing potential for the bacteria were determine through PCR using reverse and forward primers PolRb (5ʹATSGCCATCATYTCRCCGGA3ʹ) and PolFb (5ʹTGCGAYCCSAARGCBGA CTC3ʹ) (Poly et al., 2000).
55
3.5 PHENOTYPIC AND BIOCHEMICAL CHARACTERIZATION
Gram staining, catalase, oxidase was determined by using (bioMérieux) kit according to the procedure described Cowan and Steel, (2004). Different API strips (Biomerieux) were used to characterize for various biochemical traits. The procedures was carried out in the Laminar flow Hood to ensued sterilized environment. The API 20E, API ZYM, ATB VET and API 50CHB kit were used for this purpose. Nikon E600 model of light microscope was proposed to determine the morphological characters of respective colonies which were isolated on TSA medium (Difco). The conditions applied were pH 7.0 and 28 °C temperature for 2 days. Spectrophotometric analysis at 600 nm with the duration of 12 and 24 h were done to determine the potential of colony growth on tryptic soy broth with variation in pH (4•10) and NaCl (0•8%). Likewise the colony growth was also determined by varying the temperature (4, 10, 16, 22, 28, 32, 37, 45 and 50 °C) of streaked TSA plates and keeping an optimum NaCl (%) and pH. The colonies were gram stained by using commercial kit (bioMérieux).
3.6 CHEMOTAXONOMIC ANALYSIS
For chemotaxonomic analysis the bacterial biomass was cultured at optimum on TSA (Difco). Microbial Identification System (MIDI) was used for the extraction of cellular fatty acids (Sasser 990) from fresh inoculum. They were further methylated and analysed according to the procedures (MIDI). Hewlett Packard 5890 series II gas chromatograph equipped with Ultra2 capillary column was used to analyse fatty acid methyl esters. Cellular fatty acid were identified by comparing the equivalent chain length (ECL) of each compound to a peak naming table that contains over 115 known standards.The obtained quantity of each compound represented the percentage of cellular fatty acids in the bacterium. 100 mg freeze dried cell material was taken to extract polar lipids by using two stage
methods as cited by (Tindall, 1990). DNA G+C contents were Table 4: PGPRs isolated from different location. PGPRs isolated from different location of soybean crop
Location Isolates
Malakand A58, A59, A60, A61, A62 and A63 56
Rawalakot A15, A16 and A18 Swat A51, A52, A53, A54, A55, A56, A74, A75, A76, A77, A79 and
A80
NARC Islamabad A19, A48, A49, A, A50, A64, A65, A66, A67, A68, A69, A70,
A71, A72, A73, A78, A81 and A83
PGPRs isolated from different location of wheat crop
Gilgit A2, A4, A5, A6, A25, A26, A27, A28, A29, A33, A35, A42, A1, A3,
A9, A23, A30, A31, A32, A34, A36, A37, A38, A40, A41,
A45, A46 and A88
Attock A7, A8, A10, A12, A13, A14, A21, A43, A84, AAUR•40, AAUR• 42 and AAUR43
determined by culturing strain at 28 °C on TSA (Difco) for 72 hours. DNA was extracted using QIAGEN Genomic tips as defined by manufacturer (Qiagen, Germany). DNA G+C content was analyzed according to the method described by (Mesbah et al., 1989) using HPLC, (model LC•10Ad VP; Shimadzu, Japan) under the following condition: column, Cosmil 5C18R (Nacalai); mobile phase. 0.2 M ammonium phosphate: acetonitorile (40:1); column temperature.
57
3.7 IDENTIFICATION USING MOLECULAR TECHNIQUES
3.7.1 Preparation of DNA Template DNA template was prepared by picking individual colony with the help of sterilize toothpick and dissolve in 0.2 mL ependorf tube containing 1X Tris EDTA (Ethylenediamine tetra acetic acid). PCR were performed at 95 °C to obtain template
3.7.2 Amplification of 16S rRNA Gene by PCR The isolated strains were identified using modern techniques of PCR and DNA sequence analysis. For this purpose, nearly complete 16S rRNA gene sequences of the strains were obtained after PCR amplification of the genes as described by Katsivela et al. (1999) using universal forward and reverse primers:
9F (5ʹGAGTTTGATCCTGGCTCAG3ʹ) and 1510R (5ʹGGCTACCTTGTTAC
GA3ʹ). In a thermo cycler 25 µL of the reaction mixture was initially denatured at 94 °C for 2 min, followed by 30 cycles of denaturing at 94 °C for 2 min; primer strengthening at 55 °C for 60 sec: primer extension at 72 °C for 2 min and final extension at 72 °C for 10 min (Hayat et al., 2013). Amplified PCR products of 16S ribosomal gene was separated on 1% agarose gel in 0.5•x TE (Tris•EDTA) buffer containing 2 µL ethidium bromide (20 mg/mL). λ Hind•III ladder marker was used as a size marker. The gel was viewed under UV light and photographed using gel documentation system (Hayat et al., 2013).
3.7.3 Purification of PCR Products Amplified PCR products of full•length 16S rRNA genes were purified using PCR purification kit (QIAGEN) according to the standard protocol recommended by the manufacturer (Hayat et al., 2013).
3.7.4 DNA Sequencing The purified PCR products were sequenced by using four universal forward and reverse primers (Tamura et al., 2007).
Primers Sequence 5ʹ3ʹ
9F GAGTTTGATCCTGGCTCAG
1510R GGCTACCTTGTTACGA 58
515F GTGCCAGCAGCCGCGGT
926R CCGTCAATTCCTTTGAGTTT
3.7.5 Phylogenetic Analysis (Bioinformatics) The sequence results obtained was blast through DDBJ and sequence of all the related species was retrieved to get the exact nomenclature of the isolates.
Phylogenetic analysis was also be carried out using bioinformatics (Tamura et al., 2007). These potential phylogenetically identified strains will be inoculated to soybean and wheat for growth promotion and N2•fixation under controlled and natural field environment.
3.8 SCREENING UNDER GROWTH CHAMBER
On the basis of above PGP characteriztion the most promising identified PGPRs were selected to evaluate their effectiveness on growth of soybean and wheat under controlled conditions. For this purpose, Surface disinfection of seeds of both soybean (Glycine max (L.) Merr. and wheat (Triticum aestivum L.) was done by using the method illustrated by Khalid et al. (2004). The seeds were dipped in ethanol and 0.2% (w/v) HgCl2 solutions. Treated seeds were sown in plastic container containing sterile soil and placed in 25±1 °C, adjusted to 12•h light at relative humidity of 70%. Three plants per treatment were maintained and crop parameter like shoot, root length and dry weight were recorded. The treatments were designed in a completely randomized design with four replications. Plant growth was monitored by determining root, shoot length and weight at the end of experiment and most effective PGPRs were selected to assess their potential under pot and field environment.
3.9 EVALUATE EFFECTIVENESS OF PGPRs UNDER
GREENHOUSE AND FIELD
The pot experiment was conducted in greenhouse to evaluate the potential PGPRs selected from temperature controlled growth chamber experiment. Ten kg sterilized soil per pot was used. Sterilized seeds were treated with inoculums of three selected PGPRs (consortium) with half and full rate of recommended NP fertilizer. Uninoculated pot was considered as control. The pot experiment was carried out in completely randomized design (CRD) with three replications. To estimate the response of treatments on different growth parameters e.g., shoot, root length, dry weight were recorded at the time of maturity. Field experiments were also conducted in university research farm by using the same treatments having plot size of 4m×4m in randomized complete block design (RCBD) with three replications. For total biomass and grain yield of soybean and wheat the plant sample were harvested, dried, 59
weighed and total biomass were determined. For grain yield plant samples were threshed manually and then total yield converted to t ha•1.
3.10 PLANT ANALYSIS FOR TOTAL NITROGEN
Sampling of shoot and grain of soybean was done at harvest. Sample preparation was carried out by drying them in oven at 65 °C for 48 h and then grinding was done by using Wiley Mill. These were packed in plastic containers for determination of N content. For N2•fixation by natural 15N abundance only the samples of soybean were sent for analysis to Stable Isotope Unit, University of
Waikato, Hamilton, New Zealand
For total nitrogen, all digestion tubes were taken containing 0.2 g of ground plant material and 4.4 ml of digestion mixture (selenium powder, lithium sulphate and hydrogen peroxide). The whole mixture was digested for two hours at 360 °C. When the solution became colorless 50 ml of water was added in it and mixed well. On cooling, the volume was raised up to 100 ml and mixed. The solution was allowed to settle and clearer solution was used for analysis of Total Nitrogen (TN) calorimetrically (Anderson and Ingram, 1993). Colorimetric determination of TN was performed by taking 0.1 ml of all standards and samples separately in test tube with the addition of 5 ml reagent (sodium salicylate, sodium citrate and sodium tartarate and sodium nitroprusside). After mixing the prepared mixture another reagent (NaOH, water and sodium hypochlorite) was added to it with a time interval of 15 min and the final mixture was left for one hour. When complete development was observed the absorbance of each sample was measured by using spectrophotometer at 665 nm. Plant TN was calculated by using the following formula: TN % = C/W 0.01
Where C is corrected concentration (µg mL•1) and W is Weight of sample (g).
60
15 3.11 ESTIMATION OF N2-FIXATION BY NATURAL N ABUNDANCE
An estimate of % Pfix (proportion of N derived from air) were obtained using the following equation.
%Pfix = 100 x 15N (soil N) • 15N (legume N)
( 15N (soil N) –B)
Where: 15N of soil N is usually determined from a reference plant ( non N2• fixing) grown under the same conditions. B 15 is the N of the same N2•fixing plants when grown with •1 N2 as the sole source of N. kg N ha (legume) = total biomass kg ha•1 x plant N%. kg N fixed ha•1 = kg ha•1(Legume) x % Pfix x 1.5*
*1.5 factor is used to include an estimate for contribution by below ground N
(Peoples et al., 1989).
Grain kg N ha•1 = Total grain yield kg ha•1 x grain N%
•1 •1 N2•fixed kg ha in grain = grain kg ha x %Pfix (Shearer and Kohl, 1986).
3.12 STATISTICAL ANALYSIS
The data collected for various characteristics were subjected to analysis of variance and means was analyzed in completely randomized designed and randomized completely block designed by taking treatments as the only factor (Steel et al., 1997). Phylogenetic analyses were performed using bioinformatics software like CLUSTAL X (version 1.8w), BioEdit and MEGA•6 packages
(Tamura et al., 2007).
61
4645
Chapter 4
RESULTS AND DISCUSSION
More than eighty plant growth promoting rhizobacteria (PGPRs) were isolated from rhizospheric soil of wheat, soybean and chickpea and were evaluated for their PGP trait including P•solubilization, IAA, siderophores, nifH etc. Most potential PGPRs were screened on the basis of their efficacy for improving crop growth under controlled growth chamber. The best performing PGPRs were further evaluated under greenhouse and field conditions.
4.1 CHARACTERIZATION FOR PLANT GROWTH
PROMOTING TRAITS
Eighty three PGPRs were isolated on their specific media and chacterized for plant growth promoting traits e.g. Indole•3•Acetic Acid (IAA), Phosphate solubilization, siderophore, nifH gene and bicochemical characterization including catalase, oxidase, Gram staining and different API strips (API ZYM and API 20E) were used.
4.1.1 Indole-3-Acetic Acid (IAA)
Forty PGPRs were isolated from rhizospheric soil of soybean from diversified agro ecological regions of Pakistan. Their ability to produce IAA in pure culture in the presence (500 μg mL•1) and absence of L•tryptophan was determined (Table 5). L•tryptophan (L•TRP) is the precursor of indole•3•acetic acid (IAA). Without Ltryptophan, strain A60 produced significant amounts of IAA (290.45 μg mL•1) as compared to other PGPRs (0.13105.59 μg mL•1). As the
46 concentration of Ltryptophan (500 μg mL•1) was added in the culture, significant differences were recorded in production of IAA, ranging from 1.07 μg mL•1 to 311.08 μg mL•1. Strain designated as A60, isolated from Malakand soil showed highest production of IAA (311.08 μg mL•1) followed by A62 which produced (270.93 μg mL•1) of IAA.
63
The range of IAA production obtained from PGPRs isolated from rhizospheric soils of wheat was 1.38282.47 μg mL•1 (Table 6). Highest IAA production was estimated from the strain A7 both in the presence and absence of tryptophan (282.47 μg mL•1 and 104.68 μg mL•1 respectively). The other PGPR strain A88, produced 77.75 μg mL•1 IAA with tryptophan and without tryptophan produced 30.81 μg mL•1. L•tryptophan is considered an efficient physiological precursor of auxins in higher plants as well as for microbial biosynthesis of auxins (Arshad and Frankenberger, 1993). IAA production and L•tryptophan
concentration seemed to be directly related with the increased concentration of Ltryptophan in medium.
The presence of tryptophan allows the microorganisms to produce auxins like IAA in a greater quantity as compared to their absence (Javaid and Arshad, 1997). Barea et al. (1976) also found that 80% of the bacteria isolated from the rhizosphere of various plants produced auxins in addition to other plant growth regulators (PGRs).
4.1.2 Phosphate Solubilizations Phosphate solubilization by PGPRs was determined quantitatively by using the protocol described by King (1932). The result showed that PGPRs were capable for solubilization of inorganic phosphates (tri•calcium phosphate). PSolubilizing activity of strains isolated from soybean was observed from 2.63 to
954.32 µg mL•1. Isolate A63 was found with the maximum solubilzation of 954.32 µg mL•1 followed by the A61, A36, A81, and A26 which showed solubilzation capability of 755.54, 624.22, 570.85 and 556.63 µg mL•1, respectively. Strains A36 and A26 isolated from rhizospheric soils of wheat plant from the area of Chakwal showed P•solubilization up to 624.22 and 556.63 µg mL•1 respectively. Quantity of solubilization obtained from strain A36 was highest among all isolated PGPRs.
Microbes play significant role in improving the nutrient availability and their supply to the plants and solubilize unavailable phosphorous compounds (Banik and Dey, 1983; Kang et al., 2002). Many PGPRs are identified as very well solubilizers of insoluble rock phosphate P, soil accumulated•P or bounded and organic•P (Richardson, 1994). These microbes have been normally isolated from rhizospheric soil of various higher plants e.g. aubergine (Ponmurugan and Gopi,
2006), chilli (Ponmurugan and Gopi, 2006), soybean (Son et al., 2006), mustard 64
(Chandra et al., 2007), wheat (Ahmad et al., 2008) and rice (Chaiharn and Lumyong, 2009). Gluconic acid, 2•ketogluconic acid, acetate, citerate, glycolate, lactate, oxalate, succinate and tartarate are the different organic acids released by microbes (Hayat et al., 2010; Puente et al., 2004) and inorganic phosphate solubilization is possible due to the release of these organic acids (Yadav and Dadarwal, 1997). Phosphate solubilizing bacteria can serve as an active
biofertilizer supplier to enhance the availability of P•nutrition to crop plants.
4.1.3 nifH Gene Amplification DNA of all the isolated strains was amplified for 400 bp nifH gene, which codes for the nitrogenase reductase enzyme involved in N2•fixation. Nitrogen fixation capability was found in strains A10 and A42 isolated from chickpea and wheat soils respectively and strains A62 and A84 isolated from soybean. Phosphate solubilization, N2•fixation and production of IAA (growth promoting hormone) are the processes involved in improving the nutrient uptake of plants. These processes are carried out with the help of PGPRs (Hayat et al., 2012). Those PGPRs have the potential to produce phytohormones, solubilization of phosphorus and fix nitrogen, when these PGPRs are used as inoculants they significantly enhance crop yield
(Khan et al., 2009).
4.1.4 Siderophore Activity, Catalase, Oxidase and Gram Staining.
Siderophore activity was recorded qualitatively to estimate the possible ability of PGPRs to support plants in absorption of iron from soil. Results of qualitative measurement of siderophores production showed that A15, A18, A48, A49, A51, A52, A53, A56, A58, A59, A60, A61, A64, A72, A73 isolates from soybean, A4, A5, A6, A9, 12, 13, A26, A27, A28, A29, A33, A35, A42, A46 and A99 isolates from wheat and A10 from chickpea were positive for siderophore production test and showed a clear orange zone on the CAS agar medium containing plates. Siderophore production (by rhizospheric bacteria) is significant in promoting plant growth by making iron available to plants in even iron deficient soils (Glick et al., 1999). The siderophore production can promote the direct supply of iron to plants, or deprive the fungal pathogens of iron (Ahmad et al., 2008). In the present study most of strains were positive for catalase and
Table 5: Characterization of plant growth promoting rhizobacteria isolated from soybean and chickpea crop for plant growth promoting traits.
Strain Location IAA with IAA without P Siderophore Catalase Oxidase nif H Gram tryptophane trytophane solubilization assay amplification staining
A58 Malakand 10.39±0.16 7.76±3.24 35.05±1.03 + w+ − − + A59 7.64±0.00 4.87±0.11 215.12±1.04 + − − − + A60 311.08±0.01 290.45±0.01 449.98±0.11 + _ _ − + A61 232.65±0.09 105.59±0.86 755.54±2.42 + + _ − − A62 270.93±0.02 91.07±2.76 84.38±1.18 − + _ + − A63 20.66±0.55 13.87±0.22 954.32±2.16 − + _ − − A15 Rawalakot 113.29±0.55 31.57±0.83 183.13±10.96 + + _ − − A16 13.83±0.16 12.21±0.01 3.69±1.68 − − _ − − A18 107.39±0.05 34.57±0.08 192.92±1.27 + + − − − A51 Swat 10.11±0.01 9.68±0.83 373.71±0.35 + w+ _ − + A52 3.04±0.10 1.07±2.11 16.17±1.41 + w+ − − − A53 1.07±2.11 8.75±0.26 462.86±3.02 + + − − − A54 7.37±0.00 7.03±2.57 3.36±2.35 − + − − − A55 8.66±0.22 7.55±0.24 64.09±3.50 − + − − − 51
A56 7.43±0.01 0.67±0.16 301.78±1.45 + _ _ − + A57 20.32±0.01 8.00±0.01 765.05±2.54 − + − − − A74 3.49±0.12 2.43±0.10 15.64±3.15 − + + − − A75 1.28±0.16 16.40±0.51 17.67±1.08 − + − − − A76 10.52±0.03 6.12±6.67 5.71±2.24 − + − − − A77 1.53±0.01 1.95±0.34 38.71±3.82 − + − − + A79 2.40±0.14 1.87±1.8 32.22±1.99 − + − − − A80 4.45±0.01 0.13±0.57 41.24±2.49 − + − − − A19 NARC 36.03±.1.73 18.66±0.36 2.63±11.56 − w+ − − − A48 Islamabad 17.93±0.36 11.03±1.46 14.64±0.25 + − − − + A49 9.76±0.23 9.08±0.22 315.54±1.02 + w+ − − + A11 22.65±.12 15.59±1.22 2.92±9.30 − + − − − A50 9.76±0.33 9.08±0.32 8.52±3.31 − − − − − A64 4.39±0.29 3.11±0.36 477.56±0.66 + + + − − A65 8.03±0.30 3.09±0.19 32.32±2.22 − + − − − A66 3.15±0.51 18.70±0.40 47.60±0.58 − + − − + A67 3.15±0.51 18.70±0.40 38.85±3.48 − + − − + A68 1.18±0.03 0.63±0.10 107.18±1.00 − + − − − A69 7.73±0.00 4.51±0.29 35.25±0.08 − + − − −
A70 3.72±0.07 13.58±1.70 22.91 ±2.49 − + − − −
A71 2.13±0.24 2.36±0.21 30.31±2.07 − + − − + A72 82.22±1.09 42.67±0.13 433.31±1.91 + + − − − A73 12.43±0.11 9.56±0.11 214.38±3.32 + + + − + A78 7.63±0.01 3.08±0.12 304.37±1.83 − − − − + A81 7.85±0.22 4.15±0.001 570.85±2.14 − + − − + A85 6.04±0.00 3.87±0.21 188.27±0.78 + + − − − A10 15.40±0.83 6.25±3.91 163.95±1.29 + − w+ + −
Values indicate the mean ± SE for three replications.
53
only 3 and 4 isolates out of total were positive for oxidase from soybean and wheat respectively. Catalase production in PGPRs may be potentially very beneficial and must be very resistant to environmental, chemical and mechanical stress. On the basis of their Gram staining reaction 14 (35%) and 11 (24%) isolates from soybean and wheat out of total respectively were found gram positive (Table 4 and 5).
4.2 IDENTIFICATION OF PGPRs USING
PHYLOGENETIC ANALYSIS BASED ON 16S rRNA GENE
SEQUENCES
Based on plant growth promoting (PGP) and biochemical characterization, identification of forty PGPRs were performed using robust method of 16S rRNA gene sequence (Table 7). The phylogenetic positions of each PGPR was concluded by analysing its 16S rRNA gene sequence and comparing it with the known sequences in GenBank database by BLAST search and multiple sequence alignment with the closest matches performed with the Clustal X program (Thomspson et al., 1994). Mega 6 software and Bioedit was used for the construction of phylogenetic tree. Identified PGPRs belong to 11 different genera namely Acinetobacter, Arthrobacter, Bacillus, Burkholderia, Enterobacter,
Kosakonia, Pseudomonas, Psychrobacter, Microbacterium, Serratia, and Staphylococcus. All identified PGPRs shared more than 97% similarity with their closest phylogenetic relatives. Identification and similarity percentage with closely related species is given in Table 7. Whereas, phylogenetic relationship of isolated
PGPRs with closely related species is given in Figures 4•15.
4.3 VALIDATION Of NCCP-231T (Kosakonia sp.) AS A NOVEL
DIAZOTROPHIC BACTERIUM
Table 6: Characterization of plant growth promoting rhizobacteria isolated from wheat crop for plant growth promoting traits.
Strain Location IAA with IAA without P Siderophore Catalase Oxidase nif H Gram tryptophane trytophane solubilization assay amplification staining
A2 Gilgit 43.31±0.28 26.27±0.01 104.54±0.13 + + − − − A4 16.65±0.29 9.59±0.15 110±5.82 + + − − − A5 16.88±0.11 12.40±0.07 106.70±1.36 + + − − − A6 16.89±0.53 15.53±0.32 14.55±0.25 + w+ − − + A25 6.14±0.01 5.38±0.07 345.72±2.49 + − w+ − + A26 8.20±0.02 6.72±0.25 556.63±0.33 + + − − − A27 12.31±0.02 9.12±1.49 332.88±2.65 + + − − + A28 58.68±1.11 16.02±0.82 428.26±1.33 + − − − − A29 2.81±0.14 3.08±0.50 204.50±24.1 + − − − + A33 16.78±0.27 13.99±0.15 209.07±0.50 + + − − + A35 19.10±0.02 14.77±0.01 153.47±1.08 + + − − + A42 11.11±0.35 7.14±0.02 2.96±1.27 + + − + − A88 77.75±0.19 30.81±0.58 378.49±1.33 + + − − − A1 27.94±0.70 4.72±0.04 92.15±6.60 − + _ − + A3 16.04±0.04 13.44±1.11 42.84±6.13 − + − − − 55
A9 15.46±0.25 14.45±0.25 136.59±15.47 + + − − − A23 5.31±0.03 5.07±0.34 64.35±0.50 − + + − − A30 4.07±0.02 3.29±0.01 271.3±0.53 − + + − − A31 9.94±0.16 5.74±0.17 123.89±17.03 − + − − − A32 11.47±0.30 4.13±0.01 64.35±4.81 − − − − − A34 2.93±0.02 2.46±0.01 78.90±11.61 − − − − − A36 30.11±0.02 11.21±0.85 624.22±1.64 − + _ − − A37 5.47±0.02 2.49±0.01 177.91±0.58 − + − − + A38 4.82±0.11 3.07±0.11 96.60±0.66 − + − − − A39 51.60±1.60 2.58±0.05 111.19±0.99 − + − − − A40 50.20±0.27 30.32±0.00 173.53±8.33 − + − − + A41 47.95±1.08 18.64±0.12 175.84±7.4 − + − − − A45 5.04±0.00 2.87±0.21 190.2781 − + − − − A46 Attock 23.10±0.29 18.73±4.08 164.57±0.72 + + − − + A7 282.47±0.07 104.68±0.86 222.18±19.2 − + − − − A8 10.16c±0.03 7.86±0.07 439.65±1.70 − + − − − A12 5.10±0.33 2.21±2.66 159.61±1.41 + − − − + A13 46.45±0.82 31.49±0.39 464.14±1.74 + + − − − A14 75.05±0.65 46.76±0.70 83.20±6.63 − + − − −
A21 18.34±0.20 10.03±0.11 106.10±1.07 − + − − −
A43 10.72±0.01 8.69±0.02 51.56±4.97 − + − − − A84 3.14±1.01 1.38±0.03 173.80±1.21 − + − + − AAUR •40 19.35±0.02 15.81±8.07 96.88±0.85 − + − − − AAUR •42 11.11±0.35 7.14±0.02 95.50±3.15 − + − − − AAUR 10.72±0.01 8.69±0.02 94.98±8.08 − + − − − •43
Values indicate the mean ± SE for three replications.
57
NCCP•231T was isolated from root nodule of chickpea (Cicer arietinum) collected from farmer field of District Attock, Pakistan. Type strain was Gramnegative, anaerobic diazotrophic bacterium. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain NCCP•231T is a member of the genus Kosakonia and exhibited sequence similarity of 97.852% to Kosakonia oryzae and 97.535% to Kosakonia arichidis and subjected to a polyphasic taxonomic study with foreign collaboration and performed phenotypic and genotypic analysis to fullfil the minimum standard to validate new taxas of aerobic and endospore farming bacteria.
4.3.1 Molecular Characterization
The 16S rRNA gene sequence of the strain NCCP•231T (DDBJ accession number AB610883) was a continuous stretch of 1478 bp complete sequence of NCCP•231T was compared with closely related type strains derived by BLAST search against the GenBank database. It has been revelaed in phylogenetic analysis of the 16S rRNA gene sequences that NCCP•231T belongs to the genus Kosakonia while showing sequence similarity of 97.85% to Kosakonia oryzae and 97.53% to Kosakonia arichidis. Also these members are distinctly seperated from the clade of the novel isolate in the phylogenetic trees (Figure 16). The generation of phylogenetic tree was done by Neighbor•Joining method while using PHYLIP software package (Felsentein, 2005). Accession number of each type strain is shown in parenthesis. The confirmation for peresence of nifH gene was done by gel electrophoresis following by PCR amplification using the forward and reverse nifH gene primers PolFb (5ʹTGCGAYCCSAARGCBGACTC3ʹ) and PolRb
(5ʹATSGCCATCATYTCRCCGGA3ʹ) as described by (Poly et al., 2000). It was
74
Table 7: Identification of plant growth promoting rhizobacteria based on 16S rRNA gene sequence with their assigned accession number.
Closely related Taxa identified by BLAST search using ezbiocloud.net Location Sr. # Strain I.D. Highest similarity of 16S sampling isolation Species DDBJ Accession rRNA gene sequence % of Source of
1 A48 NARC Soybean Bacillus thuringiensis 99.71 LC009432 2 A49 Islamabad Bacillus cereus 100.00 AB972805 3 A64 Psychrobacter maritimus 99.26 AB975337 4 A68 Psychrobacter maritimus 98.93 AB972808 5 A72 Psychrobacter maritimus 99.22 AB975350 6 A73 Bacillus safensis 99.86 AB975351 7 A78 Bacillus cereus 100.00 AB975348 8 A85 Kosakonia arachidis 98.16 LC019122 9 A81 Microbacterium foliorum 99.14 AB975349 10 A58 Malakand Soybean Bacillus megaterium 99.41 AB975360 11 A59 Bacillus anthracis 99.87 AB975361 12 A60 Bacillus aryabhattai 99.56 AB976098 13 A61 Enterobacter cloacae subsp. dissolvens 99.69 AB975357 75
14 A62 Kosakonia kobei 100.00 AB976103 15 A63 Serratia marcescens subsp. sakuensis 99.60 AB976097 16 A15 Rawalakot Soybean Psychrobacter maritimus 98.99 17 A18 Psychrobacter maritimus 100.00 AB975345 18 A44 Attock Wheat Serratia nematodiphil 99.86 LC009433 19 A46 Staphylococcus equorum subsp. equorum 99.58 AB975354 20 A84 Kosakonia arachidis 99.81 AB975352 21 A9 Chakwal Wheat Acinetobacter calcoaceticus 100 LC009434 22 A25 Bacillus cereus 99.87 AB975355 23 A26 Pseudomonas koreensis 99.84 AB976102 24 A27 Bacillus cereus 99.86 AB975341 25 A28 Serratia proteamaculans 99.89 AB975340 26 A29 Bacillus anthracis 99.09 AB975342 27 A33 Bacillus safensis 100.00 AB975356 28 A35 Staphylococcus equorum subsp. linens 99.84 AB975338 29 A42 Pseudomonas azotoformans 99.76 AB975336 30 A45 Kosakonia arachidis 100.00 AB975353 31 A88 Pseudomonas libanensis 99.74 AB972809 32 A2 Gilgit Wheat Acinetobacter junii 99.28 AB976099 33 A4 Acinetobacter lwoffii 99.85 AB976100 34 A5 Acinetobacter lwoffii 99.740 AB975343 35 A6 Arthrobacter phenanthrenivorans 99.70 AB972807 36 A51 Swat Soybean Bacillus aryabhattai 99.85 AB975358 76
37 A52 Burkholderia cepacia 99.88 LC009452 38 A53 Serratia marcescens subsp. marcescens 100.00 AB972806 39 A56 Bacillus marisflavi 99.68 LC009453 40 A10 Chickpea Kosakonia oryzae 97.85* AB610883
77
NCCP•231T Kosakonia radicincitans D5/23T (AY563134) Kosakonia oryzae Ola 51T (EF488759) A45, A84, A85
Enterobacter oryziphilus REICA 142T (JF795013) Enterobacter oryzendophyticus REICA 082T (JF795011)
Kosakonia sacchari SP1T (JQ001784) Kosakonia cowanii CIP 107300T (AJ508303)
Cedecea lapagei GTC 346T (AB273742) Enterobacter ludwigii DSM 16688T (AJ853891) Enterobacter cancerogenus LMG 2693T (Z96078) Escherichia vulneris ATCC 33821T (AF530476)
Enterobacter cloacae subsp. dissolvens LMG 2683T (Z96079)
Enterobacter cloacae subsp. cloacae ATCC 13047T (CP001918)
T Klebsiella pneumoniae Klebsiella variicola F2R9subsp (. ozaenaeAJ783916 ATCC 11296) T (Y17654)
Klebsiella quasipneumoniae subsp. quasipneumoniae 01A030T (HG933296) Klebsiella quasipneumoniae subsp. similipneumoniae 07A044T (HG933295) Klebsiella pneumoniae subsp. rhinoscleromatis ATCC 13884T (ACZD01000038) Xenorhabdus poinarii DSM 4768T
0.005
78
Figure 4: Neighbor•joining phylogenetic tree of NCCP•231, A45, A84 and A85 belonging to the genus Kosakonia and their relationship with closely related species.
61
Burkholderia cenocepacia J2315T (AM747720)
Burkholderia vietnamiensis LMG 10929T (AF097534) Burkholderia latens R•5630T (AM747628)
A52 ( Burkholderia anthina R•4183T (AJ420880)
Burkholderia seminalisLC009452) R•24196T (AM747631)
Burkholderia metallica Burkholderia ubonensis R•16017 CIP
107078T (AM747632) (EU024179) T
Burkholderia stabilis Burkholderia pyrrocinia LMG 14294 LMG T 14191 (AF148554)T (U96930)
Burkholderia ambifariaBurkholderia diffusa R• AMMD15930T (AM747629)T (CP000442) Burkholderia pseudomallei 79
T Burkholderia lata Burkholderia arboris R 383 •(CP000150)24201T (AM747630)
T Burkholderia multivorans Burkholderia pseudomultivorans ATCC BAALMG 26883•247 (ALIWT (HE962386)01000278)
Burkholderia glumae LMG 2196T (AMRF01000003)
Burkholderia plantarii LMG 9035T (U96933) Burkholderia oklahomensis C6786T (ABBG01000575) ATCC 23343T (DQ108392) Burkholderia endofungorum HKI 456T (AM420302)
0.005
Figure 5: Neighbor•joining phylogenetic tree of A52 belonging to the genus Burkholderia and their relationship with closely related species.
62
80
Arthrobacter oryzae KV • 651 T (AB279889) T Arthrobacter humicola KV • 653 (AB279890) Arthrobacter pascens DSM 20545 T (X80740) T Arthrobacter globiformis NBRC 12137 ( BAEG01000072) Arthrobacter sulfonivorans ALLT (AF235091) Arthrobacter scleromae YH • 2001 T ( AF330692 ) Arthrobacter polychromogenes DSM 20136 T (X80741) Arthrobacter oxydans DSM 20119 T (X83408) Arthrobacter siccitolerans 4J 27 T (GU815139) Arthrobacter chlorophenolicus A6 T (CP001341) Arthrobacter phenanthrenivorans Sphe3 T (CP002379)
A6 (AB972807) Arthrobacter defluvii 4C 1 • a T (AM409361) T Arthrobacter equi IMMIB L• 1606 (FN673551) T Arthrobacter niigatensis LC4 ( AB248526) Arthrobacter tumbae LMG 19501 T (AJ315069) T Arthrobacter subterraneus CH7 (DQ097525) Arthrobacter parietis LMG 22281T (AJ639830 T Arthrobacter tecti LMG 22282 (AJ639829 T Arthrobacter sanguinis DSM 21259
0.01
Figure 6: Neighbor•joining phylogenetic tree of A6 belonging to the genus Arthrobacter and their relationship with closely related species.
81
63 A81 (AB975349)
Microbacterium foliorumMicrobacterium aerolatum DSM 12966V•73T (AJ309929)T (AJ249780)
Microbacterium natorienseMicrobacterium phyllosphaerae TNJL143 DSM 13468•2 (AY566291)T (AJ277840) T
Microbacterium insulae Microbacterium xylanilyticum DS•66T S3(EU239498)•ET (AJ853908)
Microbacterium azadirachtaeMicrobacterium marinum H101 T AI•S262T (HQ622524) (EU912487)
Microbacterium oleivorans Microbacterium arborescens DSM 16091 T DSM 20754 (AJ698725)T (X77443)
Microbacterium ginsengiterraeMicrobacterium imperiale DCY37 DSM 20530T (EU873314)T (X77442)
Microbacterium paraoxydansMicrobacterium hydrocarbonoxydans CF36T (AJ491806) DSM 16089T (AJ698726) 82
T Microbacterium oxydansMicrobacterium luteolum DSM 20578 IFO 15074 T(AB004718) (Y17227)
Microbacterium maritypicum Microbacterium liquefaciens DSM 12512 DSM T 20638 (AJ853910)T (X77444)
Arthrobacter globiformis NBRC12137T
0.01
Figure 7: Neighbor•joining phylogenetic tree of A81 belonging to the genus Microbacterium and their relationship with closely related species.
64 Prolinoborus fasciculus CIP 103579T (JN175353) Acinetobacter venetianus RAG•1T (AKIQ01000085) Acinetobacter kookii 11•0202T (JX137279) Acinetobacter ursingii DSM 16037T (AIEA01000080) Acinetobacter haemolyticus CIP 64.3T (APQQ01000002) Acinetobacter baumannii ATCC 19606T (ACQB01000091) Acinetobacter calcoaceticus DSM 30006T (AIEC01000170) Acinetobacter brisouii CIP 110357T (KI530762) A4 (AB976100), A5 (AB975343)
83
Acinetobacter gerneri DSM 14967T (APPN01000041) A2 (AB976099) Acinetobacter guillouiae CIP 63.46T (APOS01000028) Acinetobacter tjernbergiae DSM 14971T (ARFU01000016) Acinetobacter parvus DSM 16617T (AIEB01000124) Acinetobacter tandoii DSM 14970T (KE007359) Acinetobacter indicus CIP 110367T (KI530754
Acinetobacter johnsonii CIP 64.6T (APON01000005) T Acinetobacter oryzae B23 (GU954428) Acinetobacter kyonggiensis KSL5401•037T (FJ527818) T (APQD01000004) Acinetobacter bouvetii DSM 14964
Alkanindiges illinoisensis MVABHex1T
0.01
Figure 8: Neighbor•joining phylogenetic tree of A2, A4 and A5 belonging to the genus Acinetobacter and their relationship with closely related species.
65
84
T Psychrobacter submarinus Psychrobacter marincola KMM 277KMM 225T (AJ309941)(AJ309940)
Psychrobacter pulmonis CECT 5989T (AJ437696) Psychrobacter faecalis Iso•46T (AJ421528)
Psychrobacter maritimusAB975345), A64 ( Pi2AB975337)•200T (AJ609272), A68 (AB972808), A72 (AB975350) A15, A18 (
T Psychrobacter aquaticus Psychrobacter vallis CMS 39 CMS 56T (AJ584832) (AUSW01000009)
T PsychrobacterPsychrobacternamhaensis aquimaris SW SW•210•242T (AY722804) (AY722805)
T PsychrobacterproteolyticusPsychrobacter nivimaris 88 116/2•7 T(AJ272303) (AJ313425)
T Psychrobacter cryohalolentisPsychrobacter Psychrobacter okhotskensis MD17 K5 (CP000323)T (AB094794)
T Psychrobacter arcticus Psychrobacterluti NF11 273 • 4(AJ430828)T (CP000082)
T Psychrobacter glacincola fozii NF23T (AJ430827) DSM 12194 (AJ312213)
T Psychrobacter immobilisAcinetobacter calcoaceticus DSM 7229 DSM30006 (AJ309942)T
0.01 85
Figure 9: Neighbor•joining phylogenetic tree of A15, A18, A64, A68 and 72 belonging to the genus Psychrobacter and their relationship
with closely related species. 66
Bacillus toyonensis BCT•7112T (CP006863) A48 (LC009432)
BMW66•Sequence•792 Bacillus anthracis Ames (AE016879) Bacillus mycoides DSM 2048T (ACMU01000002 A25 (AB975355), A27 (AB975341), A49 (AB972805), A78
A29 (AB975342), A59 (AB975361
Bacillus pseudomycoides DSM 12442T (ACMX01000133 Bacillus bingmayongensis FJAT•13831T (JN885201)
Bacillus gaemokensis BL3•6 KCTC 13318T (FJ416489)
Bacillus manliponensis BL4•6T (FJ416490)
T Bacillus cytotoxicus NVH 391•98 (CP000764) Bacillus halmapalus DSM 8723T (X76447)
Bacillus luciferensis LMG 18422T (AJ419629) Bacillus litoralis SW•211T (AY608605)
Bacillus herbersteinensis D•1•5aT (AJ781029) 86
Bacillus persicus B48T (HQ433471)
Bacillus flexus IFO 15715T (AB021185)
Bacillusshackletonii LMG 18435 A58 (AB975360)T (AJ250318)
Bacillus hwajinpoensis SW72 T
0.005
Figure 10: Neighbor•joining phylogenetic tree of A25, A27, A29, A48, A49, A56, A58 and A59 belonging to the genus Psychrobacter and their relationship with closely related species. 67
Kluyvera cryocrescens ATCC 33435T (AF310218 Enterobacteraerogenes KCTC 2190T (CP002824) Kluyvera georgiana ATCC 51603T (AF047186) T (CP003026)
Enterobacter soli LF7a Enterobacter asburiae JCM 6051T (AB004744) Cedecea davisae DSM 4568T (ATDT01000040) Cedecea neteri GTC1717T (AB086230)
A53 (AB972806)Gibbsiella quercinecans FRB 97T (GU562337)
Klebsiella variicola F2R9T (AJ783916) Serratia rubidaea JCM 1240T (AB004751) Serratia odorifera DSM 4582T (ADBY01000001
87
Serratiamarcescens subsp. sakuensis KREDT (AB061685 A63 (AB976097)
A44 (Serratia ficariaLC009433) DSM 4569T (AJ233428)
T PectobacteriumaroidearumSerratia entomophila DSM 12358 SCRI 109 (AJ233427)T (JN600322)
Leminorellagrimontii DSM 5078T (AJ233421)
Photorhabdus luminescens subsp. luminescens ATCC29999T 0.005
Figure 11: Neighbor joining phylogenetic tree of A44, A53 and A63 belonging to the genus Serratia and their relationship with closely related species.
68 88
Pseudomonas lurida DSM 15835T (AJ581999)
T Pseudomonas poae DSM 14936 (AJ492829)
Pseudomonas trivialis DSM 14937T (AJ492831) Pseudomonas cedrina subsp. fulgida P515/12T (AJ492830) Pseudomonas tolaasii ATCC 33618T (D84028) A88 (AB972809 ) Pseudomonas migulae CIP 105470T (AF074383)
Pseudomonas gessardii CIP 105469T (AF074384) Pseudomonas cedrina subsp. cedrina CFML 96•198T (AF064461)
Pseudomonas palleroniana CFBPT (4389)
Pseudomonas extremorientalisPseudomonas proteolytica CMS 64 T KMM 3447 (AJ537603)T (AF405328)
T Pseudomonas simiae OLi (AJ936933) Pseudomonas azotoformans IAM1603T (D84009) Pseudomonas synxantha IAM12356T (D84025) Pseudomonas mucidolens IAM12406T (D84017) Pseudomonas panacis CG20106T (AY787208) A42 (AB975336)
Pseudomonas costantinii CFBP 5705T (AF374472) Pseudomonas brenneri CFML 97391T (AF268968)
89
0.5
Figure 12: Neighbor•joining phylogenetic tree of A88 and A52 belonging to the genus Pseudomonas and their relationship with closely related species.
69
Yersinia kristensenii ATCC 33638T (ACCA01000078) Yersinia enterocolitica subsp. palearctica Y11T (FR729477) Cronobacter turicensis z3032T (FN543093) Serratia liquefaciens ATCC 27592T (CP006252) Hafnia alvei ATCC 13337T (M59155) Serratia fonticola LMG 7882T (AVAH01000293)
Yersinia enterocolitica subsp. enterocolitica ATCC 9610T (AF366378) Yersinia aldovae ATCC 35236T (AF366376) Yersinia intermedia ATCC 29909T (AF366380) Yersinia mollaretii ATCC 43969T (AF366382)
A28 ( AB975340)
Serratia plymuthica DSM 4540T (AJ233433) Obesumbacterium proteus DSM 2777T (AJ233422) Serratia quinivorans CP6aT (AJ279045)
Serratia entomophila DSM 12358T (AJ233427) Serratia proteamaculans DSM 4543T (AJ233434)
Serratia glossinae
90
Yersinia pekkanenii AYV7.1KOH2T (GQ451990)
Yersinia pekkanenii AYV7.1KOH2T (GQ451990) C1T (FJ790328) Serratia ficaria DSM 4569T (AJ233428)
1
Figure 13: Neighbor•joining phylogenetic tree of A28 and belonging to the genus Serratia and their relationship with closely related species.
70
91
Staphylococcus cohnii subsp. cohnii ATCC 29974T (D83361)
Staphylococcus cohnii subsp. cohnii ATCC 29974T (D83361) Staphylococcus nepalensis CW1T (AJ517414)
Staphylococcus arlettae ATCC 43957T (AB009933)
T Staphylococcus gallinarum ATCC 35539 (D83366) T Staphylococcus xylosus ATCC 29971 (D83374) Staphylococcus saprophyticus subsp. bovis GTC 843T (AB233327)
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305T (AP008934) Staphylococcus succinus subsp. succinus AMG•D1T (AF004220 T Staphylococcus succinus subsp. casei SB72 (AJ320272) T Staphylococcus equorum subsp. equorum ATCC 43958 (AB009939) A46 (AB975354)
A35 (AB975338))
Staphylococcus kloosii ATCC 43959T (AB009940) Staphylococcus lugdunensis ATCC 43809T (AB009941) Staphylococcus devriesei LMG 25332T (FJ389206)
Staphylococcus haemolyticus ATCC 29970T (L37600) T Staphylococcus hominis subsp. novobiosepticus GTC 1228 (AB233326) Staphylococcus hominis subsp. hominis DSM 20328T (X66101) Paenibacillus polymyxa ATCC842T
0.02
Figure 14: Neighbor•joining phylogenetic tree of A46 and A35 belonging to the genus Staphylococcus and their relationship with closely related species. 92
71
Klebsiella michiganensis W14 T (JQ070300 Enterobacter cancerogenus LMG 2693T (Z96078) Klebsiella oxytoca JCM 1665 T (AB004754) Enterobacter cloacae subsp. cloacae ATCC 13047 T (CP001918) T Enterobacter oryzendophyticus REICA 082 (JF795011) Enterobacter cloacae subsp. dissolvens LMG 2683T (Z96079)
Enterobacter ludwigii DSM 16688 T (AJ85389) Leclercia adecarboxylata GTC 1267 T (AB273740 T Enterobacter siamensis C2361 (HQ888848) A61 (AB975357) A62 (AB976103) Enterobacter hormaechei ATCC 49162 T ( AFHR01000079) Lelliottia amnigena JCM 1237 T (AB004749) Cedecea lapagei GTC 346 T (AB273742) E rwinia aphidicol a DSM 19347T (AB273744) Citrobacter murliniae CDC 2970• 59 T (AF025369) Citrobacter freundii ATCC 8090 T ( ANAV01000046)
Citrobacter youngae CECT 5335 T (AJ564736) T Citrobacter werkmanii CDC 0876 • 58 (AF025373) Xenorhabdus poinarii DSM4768 T
0.005 Figure 15: Neighbor joining phylogenetic tree of A61 and A62 belonging to the genus Enterobacter and their relationship with closely related species.
72
73
found that G + C content of the genomic DNA, strain NCCP•231T was 54.99 mol % which lies within the prescribed range for the genus Kosakonia
(Nozawaet al., 2000; Richard, 1984).
4.3.2 Characterization for Biochemical and Plant Growth Promoting Traits NCCP•231T and refrence strains were grown under similar conditions and characterized for plant growth promoting traits e.g. indole•3•acetic acid (IAA), phosphate solubilization, siderophore, nifH gene and bicochemical characterization including catalase, oxidase, gram staining and different API strips (API ZYM and
API 20E) were used. Their ability to produce IAA in pure culture in the presence (500 μg mL•1) and absence of L•tryptophan was determined (Table 10). With Ltryptophan, NCCP•231T produced significant amounts of IAA (15.40 μg mL•1) and refrence strains K. arichidis (KCTC 22375) and K. oryzae (CGMCC 7012) produced as 3.14 μg mL•1 and 12.04 μg mL•1 respectively. NCCP•231T solubilized P upto 163.95 μg mL•1 and positive for siderophore production. nifH gene was present in NCCP•231T and both reference strains. API 20E, ATB VET and 50CHB were run for biochemical characterization and results are mentioned in Table 9.
4.3.3 Biochemical and Phenotypic Description
The colonies of isolated strain NCCP•231T showed round and slightly irregular shapes with sticky opaque surface and convex elevation. Their color was initially off•white that turned into light to dark yellow later. Its diameter was 0.2•4 mm and showed growth at pH 6•8 and 7 to be optimum. The described morphological and chemical characteristics of the colonies of isolated strain supports it to be a member of the genus Kosakonia. Tempreture range for optimum
95
NCCP-231T Kosakonia radicincitans D5/23T (AY563134) Kosakonia oryzae Ola 51T (EF488759) Kosakonia arachidis Ah•143T (EU672801) Enterobacter oryziphilus REICA 142T (JF795013) Enterobacter oryzendophyticus REICA 082T (JF795011) Kosakonia sacchari SP1T (JQ001784)
Kosakonia cowanii CIP 107300T (AJ508303)
Enterobacter ludwigiiCedecea lapagei DSM 16688 GTC 346TT ((AB273742AJ853891))
Enterobacter cancerogenus LMG 2693T (Z96078) Escherichia vulneris ATCC 33821T (AF530476) Enterobacter cloacae subsp. dissolvens LMG 2683T (Z96079) Enterobacter cloacae subsp. cloacae ATCC 13047T (CP001918) Klebsiella variicola F2R9T (AJ783916) Klebsiella pneumoniae subsp. ozaenae ATCC 11296T (Y17654)
Klebsiella quasipneumoniae subsp. quasipneumoniae 01A030T (HG933296)
T Klebsiella pneumoniae subsp. rhinoscleromatisKlebsiella quasipneumoniae subsp. similipneumoniae ATCC 13884 07A044T ( ACZD01000038(HG933295) )
Xenorhabdus poinarii DSM 4768T
0.005 96
Figure 16: Neighbor•joining phylogenetic dendrogram based on a comparison of the 16S rRNA gene sequences of NCCP•231 and some of their closest phylogenetic taxa.
74 Table 8: Phenotypic and molecular identification of NCCP•231T from closely related reference strains.
Characteristics NCCP•231T Kosakonia arichidis (KCTC 22375) Kosakonia oryzae (CGMCC 7012) Growth temperature 10•45 oC 20•30 oC 10–40 oC range (oC) Optimum growth 28•37 oC Optimum growth 28 oC Optimum growth 20•37 oC Growth pH range 4•10 4•10 4•10 Optimum growth at 7.5 Optimum growth at 7 Optimum growth at 3.5•10 Growth Nacl (w/v) After 24hrs 0•6% After After 24hrs 0•5% After After 24hrs 0•5% After range 48 hrs 0•6% 48 hrs 0•5% 48 hrs 0•5%
Molecular Identification of NCCP•231T
Closely related taxa identified by BLAST search using the EzTaxon server (http://147.47.212.35:8080/) Strain
Strain ID Source Name Species Strain DDBJ Similarity of 16S Accession rRNA gene sequence (%)
Kosakonia oryzae Ola 51T EF488759 97.852
NCCP•231 Chickpea Kosakonia Kosakonia arachidis Ah•143T EU672801 97.535 nodule sp. Enterobacter cloacae T subsp. dissolvens LMG 2683 Z96079 95.969 97
Enterobacter cloacae ATCC 13047T CP001918 95.962 subsp. cloacae
DDBJ DNA Data Bank of Japan
76
growth was within 16 and 45 °C and keeping 28 °C as optimum temperature. No growth was observed with temperature ≥50 ○C and ≤4 ○C and slight growth at 10 ○C after several days. The results thus distinguished the strain from the closely related species. The above mentioned strain can survive with 6% NaCl concentrations on TSA (pH 7.5, 37 °C).
4.3.4 Chemotaxonomic Characterization
Nearly all the whole•cell the strains NCCP•231T with fatty acid profiles is C16:0 (29.80%). A comparison was done for the fatty acid profiles with strain NCCP•231T and associated strains, the table of 9 in which is displayed. For estimating the G+C content, we have used Escherichia coli as standard. The content of G+C of the type strain was 54.99%. The polar lipids of strain NCCP231T were found to consist of phosphatidylethanolamine, diphosphatidylglycerol, phosphatidylglycerol, amino phospholipids, phospholipids and unidentified polar lipids. The reference strain Kosakonia arichidis showed a similar polar lipid profile to type strain but aminophospholipids and unidentified groups are absents. The isolation of NCCP•231T was done from root nodule of chickpea and is affirmative for nifH gene. The existence of bacteria apart from Rhizobium in root nodules was first indicated by (Sturz et al., 1997). Manninger and Antal, (1970) also mentioned the presence of rhizobia and several other bacteria in the root nodules of the Leguminosae. Endophytic bacteria have also been isolated from legume plants such as clover (Sturz et al., 1997), alfalfa (Gagne et al., 1987) and soyabean (Oehrle,
2000).
NCCP•231T was Gram•negative, anaerobic, and negative for catalase and
99
Table 9: Biochemical characteristics of NCCP•231T with closely related reference strains.
50CHB ATB VET API 20E Test Test NCCP• K. arichidis K. oryzae NCCP•231 K.arichidis K. NCP• K.arichidis K.oryzae 231 (KCTC 22375) (CGMCC 7012) (KCTC 22375) oryzae 231 (KCTC 22375) (CGMCC 7012) (CGMCC Test 7012)
24h 48h 24h 48h 24h 48h
ERY + + + + + + PEN + + + ONPG + + +
DARA + + + + + + AMO + + + ADH + + –
LARA + + + + + + AMC – – – LDC – – –
RIB + + + + + + OXA – + + CIT – – –
DXYL + + + + – + CFT – + – H2S + + –
LXYL + + + + – + CFP – – – Urease + + –
ADO + + + + – + STR – – – TDA – – – 100
MDX + + + + + + SPE – – – IND –
GAL + + + + + + KAN – – – VP – – +
GLU + + + + + + GEN – – – GEL – – +
FRU + + + + + + APR – – – GLU + + –
MNE + + + + + + CMP – – – MAN + + +
SBE + + + + + + TET – – – INO + + –
RHA + + + + + + DOT – – – SOR + + +
DUL + + + + + + ERY + + + RHA + + +
INO + + + + + + LIN + + + SAC + + +
MAN + + + + + + PRI + + + (MEL + + –
SOR + + + + + + TYL + + + (AMY + + +
MDM + + + + + + COL – – – (ARA) + + + 101
MDG + + + + + – TSU – – – NO2 – – –
NAG + – + + + + SUL + – – N2 + + +
AMY + + + + + + FLU – – _
ARB + + + + + + OXO – – –
ESC + + + + + + ENR – – – SAL + + + + + + FUR + + +
CEL + + + + + + FUC + + +
MAL + + + + + + RFA + + +
LAC + + + + + + MTR + + +
MEL + + + + + +
SAC + + + + + +
TRE • – – – – –
INU + + + – + + 102
MLZ + + + – – –
RAF – – – – –
AMD – – – – – –
GLYG – – – – – –
XLT – – – – – –
GEN – – – + – – TUR – – – – – –
LYX + + + + – –
TAG – – – – – –
DFUC – – – + + +
LFUC – – – – – –
LFUC – – – – – –
LARL – – – – – – 103
GNT – – – – – –
2KG – – – – – –
5KG – – – – – –
104
Table 10: Characterization of NCCP•231T isolated for plant growth promoting
traits.
Plant growth promoting traits NCCP•231T K. arichidis K.oryzae (KCTC 22375) (CGMCC 7012)
IAA with tryptophane (μg mL•1) 15.40±0.83 3.14±1.01 12.40±0.83
IAA without trytophane (μg mL•1) 6.25±3.91 1.38±0.03 6.55±1.91
Psolubilization (μg mL•1) 163.95±1.29 173.80±1.21 153.95±2.29
Siderophore assay + _ +
nifH amplification + + +
Gram staining _ _ _
Catalase _ + _ Oxidase + + _
105
weakly positive for oxidase and solubilized tricalcium phosphate in a broth culture 161.7 µg mL•1 with decrease in pH from 7±2 to 4.97 and produce IAA in the presence of tryptophan (g mL•1) is 15.40 µg mL•1. Phenotypic characterization indicates that NCCP•231T show slightly different range from other two closely related strains. The type strain NCCP•231T resisted 6% NaCl concentrations (w/v) on TSA (pH 7.0) at 28 ○C but tolerance of other than type strain resisted 5% NaCl.
In the present study, analysis of 16S rRNA genes sequences showed that strain NCCP•231T is closely related to K. arichidis and K. oryzae with 100% bootstrap. The main constituents of lipids and polysaccharides are the fatty acids. These fatty acids have been broadly used for taxonomic purposes. The inconsistency (variability in chain length, double•bond position, and substituent groups) in the structure of fatty acids makes them perfect to be used in taxon description and for the comparative analysis of profiles obtained under the same growth conditions (Suzuki et al., 1993). Major cellular fatty acid of type strain NCCP•231T is 16:0.
On the basis of the phylogenetic, physiological and phenotypic analyses, NCCP231T is considered to represent a novel species of the genus Kosakonia, for which the name Kosakonia pakistanis sp. nov. is proposed. The DDBJ/GenBank accession number of the 16S rRNA gene sequence of strain NCCP•231T is
AB610883.
4.4 INOCULATION EFFECT OF PGPRs ON WHEAT AND
SOYBEAN UNDER GROWTH CHAMBER
On the basis of PGP activity, the most promising identified PGPRs were selected to evaluate their effect on growth of wheat and soybean under controlled growth chamber conditions. Plant growth was monitored by determining root, Table 11: Cellular fatty acid composition and G+C 106
content of strain NCCP231T and the related type strains Kosakonia species. Fatty Acids A10 K. arichidis K.oryzae (KCTC 22375) (CGMCC 7012)
10:0 0.10 0.10 0.09
12:0 4.91 5.17 5.43
13:0 • 0.08 ND
12:0 3OH ND 0.07 ND
14:0 7.75 6.73 7.40
14:0 2OH ND ND 0.21
16:1 w5c 0.26 0.21 0.26
16:0 29.80 27.20 30.07
16: 0 N alcohol ND 0.23 ND
17:0 cyclo 7.84 8.99 11.51
17:0 ND 0.25 ND
17:0 10•methyl ND 0.16 ND
18:0 0.17 0.11 0.22
19:0 cyclo w8c 0.37 0.46 1.04
Feature 2 12.14 11.84 10.56
Feature 3 20.64 23.29 15.30 Feature 8 16.03 15.11 17.91
G+C content for NCCP•231T and reference strains
G+C Content (%) 54.99 52.85 54.91
107
L1
L2 DPG DPG
PG PE PG PE
PN2 PN1
PN3 PN2 PN1 PL2 PN3 PL1 PL1
E. Arachidis ( All Lipids ) NCCP - 231 ( All Lipids )
Figure 17: Polar lipid profile of NCCP•231Tafter separation by two•dimensional thin layer chromatography and spraying with 5% molybdatophosphoric acid to show all lipids DPG: Diphosphatidylglyc PG: phosphati dylglycerol, PE: phosphatidylethanolamine, PL1•PL4: phospholipids, PNI•PN2:
Aminophopholipids, L1•L3: Unidentified lipid.
shoot length and dry weight at the end of experiment.
108
4.4.1 Wheat Root and Shoot Growth The effect of PGPRs inoculation on root length of wheat is presented in Table 12. Inoculation of wheat seedlings with PGPRs significantly increased root length and all inoculated treatments were appreciably different from the control. The increase in root length with different degree of effectiveness, ranging from 39 to 128%. Data revealed that A29 (Bacillus sp.) and A28 (Serratia proteamaculans) were most effective PGPRs strains as they promoted root length up to 128 and 94% respectively over control (uninoculated). Whereas A7 (Pseudomonas libanensis) and A51 (Bacillus aryabhattai) PGPR strains were found least effective as they increased the root length up to 39 and 43% respectively over control Similarly, the effect of PGPRs for improving root dry weight of wheat is given in Table 12. It was observed that PGPRs possessing high PGP activity were most effective than control (uninoculated). A29 (Pseudomonas koreensis) and A28 (Serratia proteamaculans) were found to be the best in increasing root dry weight over the uninoculated treatments and promoted root dry weight up to 128 and 94% respectively. In contrast, the PGPRs A51 (Bacillus aryabhattai) and A29 (Bacillus sp.) were least effective as they increased the root dry weight up to 16 and 35% respectively over control. The efficiency of PGPRs differing in PGP activity potential for improving shoot length of wheat grown under controlled conditions is evident from the data presented in the Table 12. Results showed that all the tested
PGPRs significantly increased shoot length and the data illustrated that A29 (Bacillus sp.), A18 (Psychrobacter maritimus) and A33 (Bacillus safensis) was the
least effective as it increased shoot length by 12, 8 and 8% Table 12: Effect of PGPRs possessing high plant growth promoting activity signigficantly enhanced root, shoot length and weight of wheat under controlled condtions.
Control 4.7 g 0.02 c 23.7 f 0.92 c
Media 6.1 f 0.02 d 24.6 def 1.13 bc
Psychrobacter maritimus 7.2 cd 0.03 c 25.6 bc 1.31 abc
Staphylococcus equorum 7.0 cde 0.03 bc 25.2 cd 1.26 abc
Bacillus sp. 10.7 a 0.02 c 26.6 a 1.66 a 109
Pseudomonas libanensis 6.7 def 0.03 c 25.3 cd 1.20 bc
Bacillus safensis 8.9 b 0.02 c 25.6 bc 1.51ab
Bacillus aryabhattai 6.5 ef 0.02 d 24.2 ef 1.05 c
Serratia proteamaculans 9.1 b 0.04 a 26.3 ab 1.69 a
Acinetobacter calcoaceticus 7.5 c 0.04 a 24.8 cde 1.21 bc
Pseudomonas koreensis 6.7 def 0.03 ab 22.6 g 0.99 c
The mean (n=4) with different small letters indicate significant difference at probability level < 0.05
over control respectively. Similarly, the impact of PGPRs possessing PGP activity on shoot dry weight is presented in Table 12. Results showing that effect of inoculation with selected PGPRs on shoot dry weight of wheat with selected PGPRs increased the shoot dry weight ranging from 185 to 456% over control
(uninoculated). All of the PGPRs were significantly different from the control. A51 (Bacillus aryabhattai) and A9 (Acinetobacter calcoaceticus) were found to be the best to enhance root dry weight by 283 and 297% respectively. In contrast A29 (Bacillus anthracis) and A33 (Bacillus safensis) were the least effective as they increased shoot length up to 155 and 163% over control respectively.
4.4.2 Soybean Root and Shoot Growth The results for the effect of PGPRs inoculation on root length of soybean (Table 13) showed a significant increase in root length (152%) over control, by the inoculation with A10 (Kosakonia arichidis) followed by A27 (Bacillus cereus) which increased length up to 115% over control (uninocuated). While, A63 (Serratia marcescens subsp. sakuensis) and A2 (Acinetobacter junii) were found least effective as they increased the root length up to 24 and 46% respectively. Similarly, 110
the efficiency of selected PGPRs for improving root dry weight of soybean is given in Table 13. Results revealed that significant increase was recorded in root dry weight in response of PGPRs inoculation was up to 135%. The maximum increase 135, 100 and 97% in dry root weight of soybean was observed in response to inoculation with A10 (Kosakonia arichidis), A27 (Bacillus cereus) and A51 (Bacillus aryabhattai) over control respectively. While A15 (Psychrobacter maritimus) and A63 (Serratia marcescens subsp. sakuensis) were found least effective as they increased the root dry weight up to 7 and 15% over control (uninoculated) respectively.
Results showed that all the tested PGPRs significantly enhanced the shoot length from 4 to 71% over control (uninoculated) (Table 11). The maximum increase 71% in shoot length of soybean was observed in response to inoculation with A27 (Bacillus cereus) followed by A10 (Kosakonia arichidis) and A61 (Enterobacter cloacae subsp. dissolvens) which increase 62 and 55% over control respectively. In contrast, A63 (Serratia marcescens subsp. sakuensis) and A2 (Acinetobacter junii) was the least effective as they increased shoot length by 4% and 20% respectively. Similarly, the impact of PGPRs possessing PGP activity on shoot dry weight is presented in Table 8. Results revealed that significant increase was recorded in shoot dry weight in response to PGPRs inoculation was up to 456%. Maximum increase 456% in shoot dry weight was observed in response to inoculation with A48 (Bacillus thuringiensis) over control (uninoculated). While A51 (Bacillus aryabhattai) and A62 (Enterobacter kobei) were found least effective as they enhanced the root dry weight up to 100 and 191% over control respectively. Experiments (root and shoot growth) were conducted for assessing plant growth promoting activity (PGP) of PGPRs under controlled conditions. Data revealed that PGPRs significantly promote root and shoot growth in their different potential. A significant positive correlation between PGP activity of PGPRs and growth parameters was recorded. Results clearly showed that the selected PGPRs proved to be the most effective in improving all the growth and yield parameters of both crops i.e. wheat and soybean. It is very likely that auxin production, phosphate solubilization and other PGP activities of the PGPRs stimulate plant root growth and root surface area for improved uptake of phosphorus and other nutrients. Our 111
findings are supported by Okon and Vanderleyden, (1997) that the secretion of PGP substances by the bacteria are responsible for the beneficial effects of PGPRs. According to Goldstein and Krishnaraj, (2007) most of the insoluble forms of phosphates are present as iron, aluminum and calcium phosphate in soils and mechanisms involved in phosphate solubilization by biosynthesis of different kind of organic acids by rhizobacteria (acetic acid, citric acid, gluconic acid, lactic acid and propionic acid etc) (Chen et al., 2006; Delvasto et al., 2008; Goldstein and Krishnaraj, 2007; Illmer and Schinner, 1992). Increment in the root biomass in the form of accelerated root growth, modified root architectural system and stimulation of seed germination is obtained by inoculation of soil with PGPRs (Martínez, 2010). When individual strains were used as inoculants an increase in orchid seed germination was observed after being inoculated with Sphingomonas sp. and IAA producing Mycobacterium sp. (Tsavkelova et al., 2007). The most commonly used mechanism to describe the effects of PGPRs on plants has been known as the synthesis of phytohormones. IAA has been identified as the most important hormone for plant growth promotion. Noel et al. (1996) described that in genotobiotic conditions the growth of canola and lettuce has been modified by direct participation of plant growth regulators including IAA. In our study selected PGPRs Bacillus, Enterobacter, Serratia and Kosakonia spp. were found most prominent among all isolated genera which were significantly effective on growth of wheat and soybean. Hayat et al. (2013) also reported that Bacillus, Lysinibacillus, Enterobacter, Pseudomonas and Serratia spp. are very good PGPRs with PGP traits like IAA production, phosphate solubilization and N2•fixation (Beneduzi et al., 2008; Liu et al., 2006; Vesey, 2003) and are also being used for crop production as bioinoculants. The Bacillus Table 13: Effect of PGPRs possessing high plant growth promoting activity signigficantly enhanced root, shoot length and weight of soybean under controlled condtions.
Control 5.0 d 0.02 e 25.4 g 0.1 j 112
Media 5.9 cd 0.02 e 29.6 ef 0.4 h
Acinetobacter junii 8.9 b 0.03 bc 30.3 ef 0.7 e
Enterobacter cloacae 11.0 a 0.03 c 39.3 bc 0.7 c
Serratia marcescens 6.1cd 0.02 e 35.8 cd 0.5 g 8.3 b 0.02 de 33.3 de 0.7 d Psychrobacter maritimus
Enterobacter kobei 7.7 bc 0.02 d 33.3 de 0.4 h
Bacillus thuringiensis 8.4 b 0.02 de 32.5 de 0.8 a
Bacillus aryabhattai 9.2 ab 0.04 b 35.8 cd 0.3 i
Kosakonia arachidis 9.5 ab 0.04 b 33.0 de 0.6 f
Bacillus cereus 9.6 ab 0.04 b 43.5 a 0.7 e
Kosakonia oryzae 8.6 b 0.046 a 41.1 ab 0.8 b
The mean (n=4) with different small letters indicate significant difference at probability level < 0.05
species are also reported to increase the yield in wheat (Çakmakçi et al., 2007; DeFreits, 2000), maize (Pal, 1998) and beans. Kishore et al. (2005) also stated that many Serratia species have antifungal characters along with PGP traits and enhanced the growth and yield of legumes, maize and sorghum. Likewise, when we use Enterobacter as biofertilizer, can significantly enhances growth in rice and maize (Kim et al., 1998). Combined inoculation of Phosphate solubilizing bacteria and PGPRs can minimize the application of phosphate fertilizers upto 50% without reducing crop yield (Yazdani et al., 2009). Our results clearly recommend that if rhizobacteria chosen for in vitro auxin production and growth promotion under controlled conditions, immediately can help for the selection of potent PGPRs.
113
4.5 BIOCHEMICAL CHARACTERIZATION OF EFFECTIVE PGPRS
Based on the results of growth chamber experiment, most effective PGPRs were selected for further biochemical characterization and experimentation. The biochemical characters of most effective PGPRs (Table 14 and 15) showed that all selected PGPRs strains were positive for citrate utilization but negative for H2S production. Serratia marcescens subsp. sakuensis, Enterobacter cloacae subsp. dissolvens and Serratia proteamaculans were positive for arginine dihydrolase, lysine decarboxylase and orinthine decarboxylase while Bacillus aryabhattai, Bacillus anthracis and Psychrobacter maritimus were negative. The differential characteristic between Bacillus aryabhattai and Bacillus anthracis was recorded, strain Bacillus aryabhattai was positive for B•galactosidase production while negative for Bacillus anthracis. Serratia marcescens subsp. sakuensis and Psychrobacter maritimus were positive for urease production while others were negative. Differentiation characters among Serratia marcescens subsp. sakuensis
92
Table 14: Biochemical characterization of selected plant growth promoting rhizobacteria by using API 20E.
(A18) (A28) (A29) (A51) (A62) (A63) Psychrobacter Serratia Bacillus Bacillus Enterobacter Serratia Biochemical test maritimus proteamaculans anthracis aryabhattai cloacae subsp. marcescens subsp. dissolvens sakuensis B•galactosidase - + ˗ + + + Arginine dihydrolase + + - ˗ + + Lysine decarboxylase - + - - + + Orinthine decarboxylase - + - - + + Citrate utilization + + + + + + H2S production ------Urease + - - - - + Tryptophane deaminase + - + + - + Indole production - - - - - + Acetoin production + - - - + - Gelatinase (GEL) - + + - - + Glucose (GLU) - + + - + + Mannitol (MAN) - + - - + + Inositol (INO) - + - - - Sorbitol (SOR) - + - - + + Rhamnose (RHA) - - - - + - Saccharose (SAC) - + + - + + Melibiose (MEL) - + - - + + Amygdalin (AMY) - - + - + + Arabinose (ARA) - + - - + -
+ Positive, - negative
93
Table 15: Biochemical characterization of plant growth promoting rhizobacteria by using API ZYM.
(A62) (A63) (A18) (A28) (A29) (A51) Enterobacter Serratia Biochemical test Psychrobacter Serratia Bacillus Bacillus cloacae subsp. marcescens maritimus proteamaculans anthracis aryabhattai dissolvens subp. sakuensis Alkaline Phospaha Estarase(C4) + + + + + +
Esterase (C4) + + + + + + Estarase Lipase + + + + + + Lipase(C14) ------Leucine arylamidase + + + + + + Vanile arylamidase - + - + + + Cystine arylamidase + + - + + + Trypsin + - - + + + αChymotrypsin + + + + + + Acid phosphatase + + + + + + Naphthol•AS•BIphosphohydrolase + + + + + +
αgalactosidase • + - + + - Nacetylβglucosidase • - - • - + αmannosidase • - • + - - αfucosidase • • - - - - + Positive, - negative
117
94
and other strains can be done based on indole production; Serratia marcescens subsp. sakuensis was positive for indole production while Psychrobacter maritimus, Serratia proteamaculans, Bacillus anthracis, Bacillus aryabhattai and Enterobacter cloacae subsp. dissolvens were negative. Gelatinase production results shows that Serratia marcescens subsp. sakuensis, Serratia proteamaculans and Bacillus anthracis were postive while others were negative. Strains Serratia marcescens subsp. sakuensis, Enterobacter cloacae subsp. dissolvens and Serratia proteamaculans can assimilate Glucose, Mannitol, Saccharose and Melibiose while Bacillus aryabhattai, Bacillus anthracis and Psychrobacter maritimus can not. All strains were positive for Alkaline Phospaha Estarase (C4), Esterase (C4), Estarase Lipase, Leucine arylamidase, Chymotrypsin, Acid phosphatise, Naphthol•AS•BIphosphohydrolase while negative for Lipase (C14), Vanile arylamidase. Nacetylβglucosidase was positive only for Serratia marcescens subsp. sakuensi while αmannosidase was positive only for Bacillus aryabhattai. The detail antimicrobial resistivity test was mentioned in Table 16. On the agar plate bacterial isolates were tested for resistantant to each of forteen different antibiotics. The clear zone around each disc are the zone of inhibition that indicate the extent of the test bacteria's inability to survive in the presence of the test antibiotics. The result revealed that Psychrobacter maritimus was resistant to gentamycin, amikacin and tobramycin while sensitive to penicillin. Sensitivity to erythromycin was seen in Psychrobacter maritimus, Serratia marcescens subsp. sakuensis and Bacillus aryabhattai while others were resistant Sensitivity to ampicillin and novobiocin was only confined to the genus Bacillus sp. while resistant to tetracycline was seen only in the genus
Serratia.
4.6 INOCULATION EFFECT OF PGPRs UNDER GREENHOUSE
Pot experiments were conducted to evaluate the effectiveness of different selected PGPRs for improving shoot and root growth of wheat and soybean under controlled greenhouse conditions. 118
4.6.1 Inoculation Effects of Selected PGPRs on Wheat (Triticum aestivum L.) The combination of PGPRs (Psychrobacter sp. + Serratia sp. + Bacillus sp.) and NP fertilizer signiciantly increases plant height over control (Table 17). All the treatments had a significant effect on plant height but maximum height was recorded in T6 (Psychrobacter sp. + Serratia sp. + Bacillus sp. + NP @ 50•40 mg kg•1) and it resulted in 126.5% increase in plant height followed by T5 (Psychrobacter sp. + Serratia sp. + Bacillus sp.+ NP @ 25•20 mg kg•1) which showed 113% increase over control (uninoculated + no fertilizer). Among the treatments, lowest height was recorded in T2 (NP @ 25•20 mg kg•1) and T3 (NP @ 50•40 mg kg•1) as they increased shoot length by 21% and 63% over control respectively. Results indicated that combined application of PGPRs and chemical fertilizer increased plant height significantly as compared to the application of PGPRs or chemical fertilizer alone. This may be attributed to the enhanced nutrient uptake due to the proliferated roots through growth promoting activity of PGPRs along with some other mechanisms (Ahmad et al., 2011, 2012; El Husseini et al.,
2012; Nadeem et al., 2009). The present results are in line with the findings of Saber et al. (2012) who concluded that PGPRs improve plant height and productivity by synthesizing phytohormones and enhance the general availability of nutrients. These results also confirmed the previous findings (Khalid et al.,
1997; Marcos and Suttle, 1995; Naveed, 2008) that increase in plant height of
96
Table 16: Antibiotic resistant test of plant growth promoting rhizobacteria.
(A62) (A63) (A18) (A28) (A29) (A51) Enterobacter Serratia Antibiotic test Psychrobacter Serratia Bacillus Bacillus cloacae subsp. marcescens subsp. maritimus proteamaculans anthracis aryabhattai Dissolvens sakuensis Erythromycin (15 µg) S R R S R S Chloronphenicol (30 R R S S R S µg) Tobramycin (10 µg) R S S S S S Clindamycin (2 µg) R R S R R R Rifampin (5 µg) R R S S S R Tetracycline S R S S S R Ampicillin R R S S R R Novobiocin R R S S R R Penicillin (10 µg) S R R R R R Ciprofloxacin (5 µg) S R S S S S Vanomycin(30 µg) S R S S R R Gentamycin(10 µg) R S S S S S Amikacin(30 µg) R S S S S S Norfloxacin(10 µg) R S S S R S R resistant, S sensitive
121
A18 (Psychrobacter maritimus ) A28 (Serratia proteamaculans )
A29 (Bacillus anthracis ) A51 (Bacillus aryabhattai )
A63 A62 (Enterobacter kobei ) ( Serratia marcescens subsp. Sakuensis )
Figure 18: Showing bacterial antibiotic resistant activity of selected PGPRs. various crops is attributed to microbial inoculation or combined application of chemical and biofertilizers (Jilani et al., 2007; Khaliq et al., 2006; Koushal and Singh, 2011). Results indicated that inoculation with selected PGPRs in the form of consortium with different rate of fertilizer (Table 17) increased shoot dry weight significantly over control (uninoculated + no fertilizer). Maximum increase of 78% in shoot dry weight was recorded in T6 (Psychrobacter sp. + Serratia sp. + Bacillus sp.+ NP @ 50•40 mg kg•1) followed by T5 (Psychrobacter sp. + Serratia sp. + Bacillus sp.+ NP @ 25•20 mg kg•1) which showed 63% increase over control (uninoculated + no fertilizer). Among the treatments, lowest height was recorded in T2 (NP @ 25•20 mg kg•1) and T3 (NP @ 50•40 mg kg•1) as they increased shoot length by 12% and 10% respectively.
122
PGPRs inoculation was comparatively more effective but significant enhancement in shoot dry weight was recorded in response to inoculation along with fertilizer. Similar results were recorded by Shaharoona et al. (2008) who found that Pseudomonas fluorescens and Pseudomonas fluorescens biotype F significantly improved the root and shoot growth of wheat with various levels of NPK fertilizers. These results are also supported by El•Kholy et al. (2005), according to them co•inoculation of Rhodotorula and Azotobacter in the presence of half the recommended doses of chemical fertilizer considerably improved growth parameters. These result are also supported by Dobbelaere et al. (2001) who recorded that inoculated wheat plants enhanced rate of germination, seed yield and root and shoot biomass. Root length is an important agronomic parameter for overall plant growth and development. Better root elongation and proliferation improves the intake of water and nutrients by plants. The results regarding root Table 17: Effect on root and shoot growth of wheat by inoculation of PGPRs with and without NP fertilizer. Growth signifcantly increases by combination of PGPRs and NP fertilizer (Full recommended rate), under pot experiment.
Control 4.71 f 1.58 d 2.19 f 1.58 d
NP @ 25•20 mg kg•1 7.86 e 1.77 c 2.66 e 1.77 c
NP @ 50•40 mg kg•1 18.20 d 1.74 c 3.59 d 1.74 c 21.51 c 1.80 c 4.12 c 1.80 c Psychrobacter sp. + serratia sp.
+ Bacillus sp. 25.02 b 2.57 b 4.66 b 2.57 b Psychrobacter sp. + serratia sp.
+ Bacillus sp. +NP @ 25•
20 mg kg•1
Psychrobacter sp. + serratia sp. 26.90 a 2.81 a 4.96 a 2.81 a + Bacillu s sp. + NP @ 50•40 mg kg•1
The mean (n=3) with different small letters indicate significant difference at probability level < 0.05
PGPRs: (Psychrobacter maritimus + Serratia proteamaculans + Bacillus sp.) 123
length of wheat (Table 17) indicated that inoculation length of wheat (Table 17) indicated that inoculation with selected PGPRs in the form of consortium either alone or in combination with fertilizer increase shoot length significantly over control (uninoculated + no fertilizer). Maximum increase of 470% in root length was recorded in T6 (Psychrobacter sp. + serratia sp. + Bacillus sp.+ NP @ 50•40 mg kg•1) followed by T5 (Psychrobacter sp. + serratia sp. + Bacillus sp. + NP @ 25•20 mg kg•1) and T4 (Psychrobacter sp. + serratia sp.
+ Bacillus sp.) which showed 430% and 356% increase over control respectively.
Among the treatments, lowest increase of 67% in height was recorded in T2 (NP @ 50•40 mg kg•1). Selected PGPRs showed tremendous positive effects on root length of wheat in pot experiments and improved root length significantly as compared to control, this evidence reinforced positive correlation between in vitro PGP activity of PGPRs and root length in pot experiment. Ghosh et al. (2003) reported that seed and root inoculation with different PGPRs promotes root growth through different PGP activity. The better root growth subsequently resulted in better shoot growth and grain yield. The reported literature supports the results being described in the present study. Sohal et al. (1996) explored that coinoculation of Azotobacter chroococcum and phosphate solubilizating microorganisms (PSM) showed effective results im growth, yield and fertilizer economy. Similarly Zaidi and Khan, (2005) reported that growth, yield and nutrient uptake of wheat plant was enhanced by the co•inoculation of Azotobacter chroococcum (nitrogen•fixing) + Pseudomonas striata (phosphate solubilizing microorganism) + Glomus fasciculatum (arbuscular mycorrhizal fungus). Another study by Shaharoona et al. (2008) revealed that the inoculation of Pseudomonas fluorescens enhances the root growth and ultimately the nutrients uptake is improved and increased. The use of different potent PGPRs and their effective result in growth and yield has been reported by Karlidag et al. (2007).
Maximum increase in shoot weight was recorded in T6 (Psychrobacter sp.
+ Serratia sp. + Bacillus sp. + NP @ 50•40 mg kg•1) and T5 (Psychrobacter sp. + Serratia sp. + Bacillus sp. + NP @ 25•20 mg kg•1) which showed 78% and 63% increase over control (Table 17). Overall, PGPRs inoculation with different rate of fertilizer increased shoot weight significantly over control. Among the treatments, lowest height was recorded in T2 (NP @ 25•20 mg kg•1) i.e. 22% higher than control (uninoculated + no fertilizer). In our results, positive correlation coefficient was found between root weight and other plant growth parameters. The better root growth subsequently resulted in better shoot growth and grain yield. Hernandez and Chailloux, (2004) reported the same result concluding that the dry weight of tomato 124
transplants grown with 75% fertilizer and two co•inocuated PGPRs was greater than tne one obtained without PGPR inoculation.
4.6.2 Inoculation Effects of Selected PGPRs on Soybean (Glycine max (L.) Merr.
Shoot length is an important parameter which determines the potential of crop. The results regarding shoot length of soybean are presented in Table 18 indicated that inoculation with selected PGPRs in the form of consortium either alone or in combination with fertilizer increase shoot length significantly over control. Maximum increase of 83% in shoot length was observed with T6 (Bcillus sp. + Enterobacter sp.+ Serratia sp.+ NP @ 10•30 mg kg•1) followed by T3 (NP @ 10•30 mg kg•1) and T5 (Bcillus sp. + Enterobacter sp.+ Serratia sp.+ NP @ 5•15 mg kg•1), they showed increase in length up to 72% and 64% respectively over control (uninoculated). Among the treatments, lowest height was recorded in T2
(NP @ 5•15 mg kg•1) that showed 18% increase over control.
Results regarding shoot dry weight of soybean showed that application of PGPRs with fertilizer tremendously increases shoot weight as compared to control and other treatments. These results are supported by other researchers (Nezarat and Gholami, 2009; Biari et al., 2008; Woodard, 2000) who concluded that the effect of PGPRs with chemical fertilizers have a major impact on crop growth improvement. Similar result was reported by Shaharoona et al. (2008), with the inoculation of Pseudomonas fluorescens significantly enhanced N use efficiency at all fertilizer levels in wheat and increased upto 115%, 52%, 26%, and 27% over control at N, P, and K application rates of 25%, 50%, 75%, and 100% recommended doses, respectively. It is apparent from the Table 18 that all the treatments were significantly different than control. Maximum increase in dry shoot weight was recorded with T6 (Bcillus sp. + Enterobacter sp.+ Serratia sp.+ NP @ 10•30 mg kg•1) followed by T4 (Bcillus sp. + Enterobacter sp.+ Serratia sp.) and T5 (Bcillus sp. + Enterobacter sp.+ Serratia sp. + NP @ 5•15 mg kg•1), which showed maximum increase in shoot weight was recorded up to 140%, 114% and 110% over control respectively. Among the treatments, minimum plant length was recorded in T2 (NP @ 5•15 mg kg•1) which was 58% higher than control. The results revealed that significant enhancement in shoot dry weight was recorded in response to inoculation of PGPRs (Bcillus sp. + Enterobacter sp. + Serratia sp.) along with fertilizer over T1 (control). These results are found to be inline with the results of Shaharoona et al. (2008) who revealed that the combined inoculation of Table 18: Effect on root and shoot growth of soybean by inoculation of PGPRs with and without NP fertilizer. Growth signiciantly increases by combination of PGPRs and NP fertilizer (Full recommended rate), under pot experiment. 125
Control 3.66c 0.53 d 14.70 f 1.66 f
NP @ 5•15mg kg•1 4.66 c 0.68 c 17.53 e 5.56 d
NP @ 10•30mg kg•1 6.66 b 0.72 bc 25.33 b 7.74 a 7.33 ab 0.77 abc 22.56 d 4.54 e Bcillus sp. + Enterobacter sp.+ Serratia sp.
8.00a 0.83 ab 24.08 c 6.16 c Bcillus sp. + Enterobacter sp.+ Serratia sp.+NP @ 5•
15 mg kg•1
Bcillus sp. + Enterobacter 8.00 a 0.86 a 26.92 a 7.01 b sp.+ Serratia sp+ NP @
10•30 mg kg•1
The mean (n=3) with different small letters indicate significant difference at probability level < 0.05
PGPRs: (Bcillus aryabhattai + Enterobacter cloacae subsp. dissolvens + Serratia
marcescens subsp. sakuensis)
PGPRs vividly enhanced the growth of shoot and root of crops by using different levels of chemical fertilizers. These result are also supported by Dobbelaere et al. (2001) who recorded that inoculated wheat plants improved germination rate, seed yield and biomass of root system and shoot biomass, similar result were also reported in barley and maize (Chabot et al., 1996; Höflich et al., 1994).
The results on the subject of number of pods plant•1 presented in Table 18 indicate that integrated use of selected PGPRs with fertilizer significantly increase number of pods plant•1 over control (uninoculated + no fertilizer). Maximum number of pods were recorded in T6 (Bcillus sp. + Enterobacter sp.+ Serratia sp.+ NP @ 126
10•30 mg kg•1) followed by T4 (Bacillus sp. + Enterobacter sp.+ Serratia sp.), which showed increase up to 118.5% and 100% respectively over control
(uninoculated). Other treatments where PGPRs (Bcillus sp. + Enterobacter sp.+ Serratia sp.) were applied either in combinations or alone improved number of pods per plant as compared to control.
Among the treatments, lowest number of pods plant•1 was recorded in T2 (NP@ 5•15mg kg•1), which showed 27% increase over control. These results are in line with Asghar et al. (2002), who stated that seed inoculation with most promising PGPRs significantly increased grain yield, plant height, oil content and number of pods per plant over control. These results are inline with the present study that number of pods per plant and grain yield enhanced up to 133% and 118% respectively over control. Dileepkumar and Dube, (1992) also documented that soybean seed inoculation of PGPRs produced 37% increase in number of pods per plant over control. The results of dry root weight are presented in Table 18. T6 (Bacillus sp.+Enterobacter sp.+ Serratia sp.+ NP @ 10•30 mg kg•1) was found to be the best in increasing dry root weight that resulted in 140% increase in root weight over the control followed by T4 (Bcillus sp. + Enterobacter sp.+ Serratia sp.) and T5 (Bcillus sp. + Enterobacter sp.+ Serratia sp. + NP @ 5•15 mg kg•1), they showed maximum increase in weight up to 114% and 110% respectively.
Among the treatment, lowest height was recorded in T2 (half rate of fertilizer) i.e. 58% higher than control (uninoculated + no fertilizer). Various researchers reported that under controlled conditions, inoculation of root and seed with PGPRs enhance root growth through PGP activity. The better root growth generally resulted in good shoot and grain yield. Similar results are presented by Shaharoona et al. (2008), according to them efficiency of nutrients was increased by inoculating PGPRs which in trun increased root growth and therefore plants efficiently uptook the nutrients. Similarly, by using PGPRs for the enhancement of plant nutrition in sustainable agriculture has been documented by Karlidag et al.
(2007).
4.7 INOCULATION EFFECT OF PGPRs UNDER FIELD
4.7.1 Inoculation Effects with PGPRs on Growth of Wheat (Triticum
aestivum L.)
Field experiment was conducted to assess the possible role of different plant growth promoting trait of selected PGPRs for improving growth and yield of wheat under field conditions. The same treatments of pot experiment were used to further evaluate their potential under natural field conditions.
127
4.7.1.1 Biomass yield Data regarding the effects of PGPRs with or without chemical fertilizer on biomass yield are summarized in Table 19. Result exposed that all treatments increased biomass yield significantly as compared to control. Maximum yield of biomass was recorded in T6 (Bcillus sp. + Enterobacter sp+ Serratia sp.+ 100•80 kg ha•1) which increased yield up to 34%. Next effective result was recorded in T3 (NP@ 100•80 kg ha•1) and T4 (Bcillus sp. + Enterobacter sp+ Serratia sp.)which showed 27% and 11% increase over control respectively. In contrast, the minimum increase in biomass was recorded in T2 (NP @ 50•40 kg ha•1), where only 15% increase over control was recorded. From the results it was concluded that total biomass yield of wheat was better in inoculated treatment with full dose of recommended fertilizer rather than control or chemical fertilizer alone. Present results supported the hypothesis that use of PGPRs or combinations of PGPRs and chemical fertilizer can enhance the nutrient use efficiency of fertilizers. These results are in line with the conclusions of Shaharoona et al. (2008) who concluded that application of selected PGPR strains significantly improved the growth parameters of wheat with various levels of fertilizers. Similarly Rizwan et al. (2008) also reported that application of chemical fertilizer plus biological fertilizer could produce highest yield as compared to either chemical or biological treatments alone.
4.7.1.2 Grain yield Data regarding the effects of PGPRs with or without chemical fertilizer on grain yield are summarized in Table 19. Data revealed that all treatments increased grain yield significantly as compared to control. T6 (Bacillus sp. + Enterobacter sp.+ Serratia sp.+NP @ 100•80 kg ha•1) was found to be best in increasing grain yield that resulted in 59.6% increase followed by T3 (NP @ 100•80 kg ha•1) and T2 (NP @ 50•40 kg ha•1), which increased yield up to 81% and 50% over control respectively. In contrast, the minimum increase was recorded in T4 (Bacillus sp. + Enterobacter sp. + Serratia sp.) where only 20% increase over control, was recorded. Grain yield is one of the significant parameters of yield and yield components. From the result we concluded that integrated use of PGPRs and fertilizer was found the most effective in enhancing grain yield as compared to other treatments. There are similarities in these results and those of Dobbelaere et al. (2001, 2002) who concluded that inoculation effect of PGPR (Azospirillum brasilense) on growth of spring wheat resulted in more grain yield as compared to non•inoculated (Alagawadi et al., 1992; Tiwari et al., 1989; Yasari and Patwardhan, 2007). Similar results are presented by Adesemoye et al. (2009), according to them fertilizer rate could be reduced if supplemented with PGPRs.
4.7.1.3 Total shoot N of wheat Data regarding the effects of PGPRs with or without chemical fertilizer on nitrogen contents are summarized in Table 19. The amount of N up taken by wheat clearly depicted that combined application of PGPRs with fertilizer increased the nitrogen yield as compared to other treatments. However, efficiency of inoculation varied in each fertilizer treatment. T6 (Bacillus sp. + Enterobacter sp.+ Serratia sp.+ NP@ 100•80 kg ha•1) was found to be the most effective in enhancing nitrogen content and 128
increase N up to 28%. Next most effective treatment was T3 (NP@ 100•80 kg ha•1) which increased shoot nitrogen content up to 26% over control. It was observed that inoculation with PGPRs along with full rate of recommended fertilizer showed significant enhancement on N content of the crop Table 19: Effect on yield of wheat as affected by inoculation of PGPRs with and without NP fertilizer. Yield significantly increases by combination of PGPRs and NP fertilizer (Full recommended rate), under field experiment.
Control 3.84 c 1.66 d 1.56 b
NP @ 50•40 kg ha•1 4.44 b 2.51 ab 1.52 B
NP @ 100•80 kg ha•1 4.88 a 2.19 bc 1.85 a 4.45 b 1.72 d 1.37 c Bacillus sp. + Enterobacter sp.+ Serratia sp.
Bacillus sp. + Enterobacter sp.+ 4.27 b 1.95 cd 1.55 b
Serratia sp. + NP @ 50•40 kg ha•1
Bacillus sp. + Enterobacter sp.+ 5.18 a 2.65 a 1.88 a Serratia sp. +NP @ 100•80 kg ha•1
The mean (n=3) with different small letters indicate significant difference at probability level < 0.05
PGPRs: (Psychrobacter maritimus+ Serratia proteamaculans + Bacillus anthracis) over control. This argument is supported by Khalid et al. (1999) according to them
PGPRs significantly improved the N contents in grain and straw of wheat crop. Also, N uptake per gram of tissue and N uptake on a whole•plant basis were significantly better than the corresponding non inoculated controls.
4.7.2 Inoculation Effects with PGPRs on Growth of Soybean (Glycine max (L.) Merr.
To identify the role of selected PGPRs in improving the growth and yield of soybean crop by the enhancement of growth promoting traits field experiments were conducted.
129
4.7.2.1 Biomass yield
Data regarding biomass yield of soybean are presented in Table 20.
Maximum yield of biomass was recorded in T6 (Bacillus sp. + Enterobacter sp.+ Serratia sp.+ NP @ 20•60 kg ha•1) which increased yield up to 137%. T3 (NP @ 20•60 kg ha•1) and T5 (Bacillus sp. + Enterobacter sp.+ Serratia sp. + NP @ 10•30 kg ha•1) also showed promising result and increased yield up to 135% and 122% over control respectively. In contrast, the minimum increasing results of treatment was recorded in T2 (NP @ 10•30 kg ha•1) where only 89% increase over control was recorded. From the result concluded that co•inoculation of PGPRs with fertilizer produce highest biomass yield compared to either chemical or PGPRs alone. In term of biomass our results are similar with the finding of Dobbelaere et al. (2007) who observed that inoculated wheat plants improved germination rate, seed yield and biomass of root system and shoot biomass. It was further confirmed by Shaharoona et al. (2006), who documented that integrated use of effective PGPRs with fertilizer improved the root and shoot growth significantly as compared to PGPRs and/or fertilizer alone.
4.7.2.2 Grain yield
In case of grain yield, maximum enhancement (191%) in grain yield was recorded in T6 (Bacillus sp. + Enterobacter sp.+ Serratia sp.+ NP @ 20•60 kg ha1) (Table 20). In contrast, the minimum increasing results of treatment was recorded in T4 (Bacillus sp. + Enterobacter sp.+ Serratia sp.) where only 20% mean increase over the control was recorded. Dobbelaere et al. (2001, 2002), studied that the grains of cereal inoculated with PGPRs showed efficient yield as compared to the non•inoculated plants. This has compliance with the result of the present study in which grain yield increment was observed with inoculation of PGPRs and fertilizers. This increment in yield could be the result of improved abilities of PGPRs under field conditions such as to colonize soil, solubilize phosphates and production of biologically active substances.
4.7.2.3 Total shoot N of soybean
Data regarding the effects of PGPRs with or without chemical fertilizer on nitrogen content of soybean grown in natural field environment, are displayed in Table. 20. It was apparent from the collected results that isolated PGPR consortium enhanced the nitrogen yield under the fertilizer treatments as compare to control.
However, maximum increase in nitrogen content was recorded in T6 (Bacillus sp. + Enterobacter sp. + Serratia sp. + NP @ 20•60 kg ha•1) which increased yield up to 17% while T3 (NP @ 20•60 kg ha•1) showed better result and increase N content up to 15%. Least result was in T4 (Bacillus sp. + Enterobacter sp.+ Serratia sp.) Table 20: Effect on yield of soybean as affected by inoculation of PGPRs with and without NP fertilizer. Yield signiciantly increases by combination of PGPRs and NP fertilizer (Full recommended rate), under field experiment. 130
Control 1.91 d 0.64 f 1.91b 175.77 d
NP @ 10•30 kg ha•1 3.55 c 1.75 d 1.95b 325.54 c
NP @ 20•60 kg ha•1 4.49 a 1.83 b 2.19 a 517.54 a
Bacillus sp. + Enterobacter 3.87 b 1.50 e 1.76 c 302.42 c sp.+ Serratia sp.
Bacillus sp. + Enterobacter sp.+ Serratia sp. +NP @ 10•30 kg 4.25 a 1.77 c 1.96 b 448.40 b ha•1
Bacillus sp. + Enterobacter sp.+ Serratia sp. +NP @ 20•60 4.53 a 1.87 a 2.22 a 500.26 a kg ha•1
The mean (n=3) with different small letters indicate significant difference at probability level < 0.05
where •7% reduction in N content was recorded. Higher N content were recorded with the application of seed inoculation with PGPR along with recommended chemical fertilizers. These findings are in agreement with the findings of Das et al. (2004) and Zahir et al. (2007). This may be due to a possible reduction of N losses due to leaching, denitrification or volatilization. This demonstrated that the inoculation of wheat seeds with PGPR and addition of recommended resulted in improved N use efficiency.
131
4.7.2.4 Total N2-fixed by soybean
Data regarding total uptake of N by soybean presented in Table 20. PGPRs: (Bacillus aryabhattai + Enterobacter cloacae subsp. dissolvens + Serratia marcescens subsp. sakuensis). Maximum increase was recorded in T6 (Bcillus sp. + Enterobacter sp.+ Serratia sp.+ NP @ 20•60 kg ha•1) which increased uptake up to 216% over control. T3 (NP @ 20•60 kg ha•1) and T5 (Bacillus sp. + Enterobacter sp.+ Serratia sp.+ NP @ 10•30 kg ha•1) also showed promising result and increased yield up to 194% and 155% over control respectively. In contrast, the minimum increasing results of treatment was recorded in T4 (Bacillus sp. + Enterobacter sp.+ Serratia sp.) where only 72% increase over control was recorded. The results obtained support the hypothesis that inoculation of PGPRs, especially mixture of PGPRs strains along with fertilizers promote the plant’s ability in the uptake of N from fertilizer. The same result concluding that PGPRs applied along with fertilizers promote plant growth has been presented by Adesemoye et al. (2010). Based on the current 15N results it should be noted that full rate of fertilizer recommended for wheat growth. Choice of selective PGPRs can enhance the efficient use of fertilizers by plants thus declining the rates of fertilizers being used. The work of Hernandez and Chailloux, (2004) and Dell and
Rice, (2005) supports the results obtained.
132
SUMMARY
The experiment one was designed with the objectives to characterize isolated bacterial strains and identification of most potential bacterial strains by using phylogenetic analysis based on 16S rRNA gene sequences. Several survey was accomplished in Pothwar (Rawalpindi, Attock and Chakwal), district of Haripur, Abbottabad, Gilgit, RawalaKot and Azad Jammu and Kashmir for collection of rhizospheric soil and nodules. Dilution plate technique and phosphate buffer saline solution (PBS; 1X) were used for isolation of soil bacteria, and tryptic soya agar (TSA; Difco) was used as nutrient medium. While, yeast extract mannitol (YEM) were used for the growth of bacteria isolated from root nodules.
Eighty three bacterial strains of eleven different genera included Acinetobacter,
Arthrobacter, Bacillus, Burkholderia, Enterobacter, Kosakonia, Pseudomonas, Psychrobacter, Microbacterium, Serratia, and Staphylococcus were isolated and characterized for different PGP traits like phophate solubilization, indole•3•acetic acid (IAA), nifH amplification and siderophore production. A Gram•negative bacteria designated as NCCP•231T was isolated from root nodule of chickpea and 16S rRNA gene sequence similarities with other closely related species are approximately 97.85% to Kosakonia oryzae and 97.53% to Kosakonia arichidis and polyphasic taxonomic experiments were performed to validate the isolated strain in Korea Research Institute of Bioscience & Biotechnology, Republic of Korea. The colonies showed round and slight irregular shape with sticky and opaque surface having convex elevation. The size of colony was noted to be 0.4•4 mm and color was initially off white that shifted towards light yellow later on. Optimum temperature and pH were recorded as 28 °C and 7.5, respectively.
114
However colonies were formed at 6•8 pH and 16•45 °C. The type strain NCCP231T resisted 6% NaCl concentrations (w/v) on TSA (pH 7.0) at 28 ○C and produced 15.40 μg mL•1 IAA and solubilized P upto 163.95 μg mL•1. Phylogenetic, physiological and phenotypic analyses proved that NCCP•231T is a potential novel species of the genus Kosakonia, for which the name kosakonia pakistanensis sp. nov. is proposed. The DDBJ GenBank accession number of strain NCCP•231T is 133
AB610883.
All bacterial strains including NCCP•231T solubilized substantial quantity of
inorganic phosphate. However, maximum phosphate solubilization (954.32 μg mL•1) was observed by the inoculation of A63 (Serratia
marcescens subsp. sakuensis) followed by A61 (Enterobacter cloacae subsp. dissolvens) which solubilize phosphate up to 755.54 μg mL•1. The ability to produce IAA in the absence and presence of Ltryptophan (500 μg mL•1) was determined. In the absence of Ltryptophan A60 produced significant amounts of IAA (290.45 μg mL•1) as compared to other PGPRs (0.13105.59 μg mL•1). As the concentration of Ltryptophan (500 μg mL•1) was added in the culture, IAA production of A60 was increased up to 311.08 μg mL•1. Results of quantitative measurement of siderophore production revealed that PGPRs designated as A15, A18, A48, A49, A51, A52, A53, A56, A58, A59, A60, A61, A64, A72, A73 isolated from soybean and A4, A5, A6, A9, A10, 12, 13, A26, A27, A28, A29, A33, A35, A42, A46 and A99 isolated from wheat were positive and exhibited a clear orange zone on the CAS agar medium containing plates.
Based on plant growth promoting activity, identification of forty PGPRs was performed using robust method of phylogenetci analysis based on 16S rRNA gene sequences. Phylogenetic position of each strain was determined by analysing its 16S rRNA sequence and comparing it with the known sequences in GenBank database by BLAST search and multiple sequence alignment with the closest matches performed with the Clustal X program (Thomspson et al., 1994). Phylogenetic tree construction was performed with Bioedit and Mega 6 software by neighbor joining method. On the basis of PGP characterization, best characterized PGPRs were selected for further screening and to evaluate their effectiveness on growth of soybean and wheat under controlled growth chamber conditions. Most promising A2 (Acinetobacter junii), A61 (Enterobacter cloacae subsp. dissolvens), A63 (Serratia marcescens subsp. Sakuensis), A15 (Psychrobacter maritimus), A62
(Enterobacter kobei), A48 (Bacillus thuringiensis), A51 (Bacillus aryabhattai), A85
(Kosakonia arachidis), A27 (Bacillus cereus) and A10 (Kosakonia oryzae) were
selected for soybean and for wheat A18 (Psychrobacter maritimus), A35
(Staphylococcus equorum subsp. linens), A29 (Bacillus anthracis), A7
(Pseudomonas libanensis), A33 (Bacillus safensis), A51 (Bacillus aryabhattai),
A28 (Serratia proteamaculans), A9 (Acinetobacter calcoaceticus), A26 (Pseudomonas koreensis) were selected for growrh chamber experiment. Data regarding root and shoot growth was recorded and result revealed that all selected PGPR strains significantly increase root length, shoot length, dry root weight, and 134
dry shoot weight over control (uninoculated). On the base of crop seedling data best three growth promoting PGPRs for each crop were selected from growth chamber experiment i.e. A18 (Psychrobacter maritimus), A28 (Serratia proteamaculans) and A29 (Bacillus anthracis) was selected from wheat and A51
(Bacillus aryabhattai), A62 (Enterobacter cloacae subsp. dissolvens) and A63 (Serratia sakuensis marcescens subsp.) from soybean for further evaluation their impact crop plant under pot and field conditions.
A pot experiment was also carried out under greenhouse controlled conditions at PMAS•AAUR during 2011•12 for wheat and 2012 for soybean. The purpose of pot experiment was to explore the positive response of PGPRs on wheat and soybean growth. The pots were filled with 8 kg sterile soil with sandy clay loam texture sampled from the experimental fields of PMAS Arid Agriculture University Rawalpindi. The soil belongs to Rawalpindi soil series week medium and coarse sun angular blocky with nearly continuous thin cutans, Typic Ustocrepts
(EutricCambisols, FAO; GOP, 1974) with 7.27 pH. Three strains A18 (Psychrobacter maritimus), A28 (Serratia proteamaculans) and A29 (Bacillus anthracis) for wheat and A51 (Bacillus aryabhattai), A62 (Enterobacter kobei)and A63 (Serratia marcescens subsp. sakuensis) for soybean were selected for further evaluating their effect with different rates of fertilizers along with sterile soil as control. The inocula of each strain was prepared, experiments were designed in Complete Randomized Design (CRD) and replicated three times with the six treatment i.e. T1: Control, T2: NP @ 25•20 mg kg•1, T3: NP @ 50•40 mg kg•1, T4: Psychrobacter sp. + Serratia sp. + Bacillus sp., T5: Psychrobacter sp. + Serratia sp. + Bacillus sp. +NP @ 25•20 mg kg•1, T6: Psychrobacter sp. + Serratia sp. + Bacillus sp. + NP @ 25•20 mg kg•1 for wheat and T1: Control, T2: NP @ 5•15 mg kg•1, T3: NP @ 10•30 mg kg•1, T4: Bacillus sp. + Enterobacter sp. + Serratia sp, T5: Bacillus sp. + Enterobacter sp. + Serratia sp. + NP @ 5•15 mg kg•1, T6: Bacillus sp.+ Enterobacter sp.+ Serratia sp. + NP @ 10•30 mg kg•1 for soybean.
The growth parameters studied were shoot length, shoot dry weight, root length and root dry weight of soybean and wheat.
Field experiments on wheat and soybean at research farm of Arid Agriculture University Rawalpindi (AAUR) during 2012•13 and 2014 were carried out. The seeds were inoculated with potent selected strains. The plot size was selected to be 4x4 m. The experiments were designed in randomized complete block design (RCBD) and replicated thrice. Crop parameters studied include biomass yield (t •1 •1 ha ), grain yield (t ha ), nitrogen content in straw (%) was recorded. N2•fixation of soybean crop was assessed by δ15N natural abundance technique. A finely crushed sample of both soybean and reference non legume
(wheat) was sent to Stable Isotope Unit, University of Waikato, Hamilton, New 135
Zealand for analysis of 15N using an isotope ratio mass spectrometer.
The conclusion of the study relates that inoculated soil shows enhanced crop growth and N2•fixation in legumes as compared to uninoculated soil. On the other hand this result revealed the plant growth promoting (PGP) and plant health promoting (PHP) traits of selected strains. There are many limitations in the use of PGPR as biofertilizers including climatic effect, soil types and indigenous bacteria present in the soil. This hurdle can be minimized by repeated field trials; which are costly and slow because annually many crops can be grown only once. Therefore there should be the repetition of field trials for selection of effective PGPR for selective crops and also to manifest their effectiveness for different climatic conditions and soil types.
LITERATURE CITED
Abbas, Z. and Y. Okon. 1993. Plant growth promotion by Azotobacter paspali in the rhizosphere. Soil Biol. Biochem., 25: 1075•1083.
Abeles, F. B., P. W. Morgan and M. E. Saltveit Jr. 1992. Ethylene in plant biology. 2nd ed., Academic Press. New York. 414 pp.
Adesemoye, A. O., H. A. Torbert and J. W. Kloepper. 2008. Enhanced plant nutrient use efficiency with PGPR and AMF in an integrated nutrient management system. Can. J. Microbiol., 54 (10): 876•886.
Adesemoye, A. O. and J. W. Kloepper. 2009. Plant•microbes interactions in enhanced fertilizer use efficiency. Appl. Microbiol. Biotechnol., 85:1•12.
Adesemoye, A. O., H. A. Torbert and J. W. Kloepper. 2010. Increased plant uptake of nitrogen from 15N•depleted fertilizer using plant growth•promoting rhizobacteria. Appl. Soil Ecol., 46 (1): 54•58.
Afzal, A., M. Ashraf, S. A. Asad and M. Farooq. 2005. Effect of phosphate solubilizing microorganisms on phosphorus uptake, yield and yield traits of wheat (Triticum aestivum L.) in rainfed area. Int. J. Agric. Biol., 7: 207209.
Ahemad, M. and M. S. Khan. 2010. Influence of selective herbicides on plant growth promoting traits of phosphate solubilizing Enterobacter asburiae strain PS2. Res. J. Microbiol., 5: 849•857.
Ahemad, M. and M. S. Khan. 2011. Toxicological assessment of selective pesticides towards plant growth promoting activities of phosphate solubilizing Pseudomonas aeruginosa. Acta Microbiol. Immunol. Hung., 58: 169•187.
Ahemad, M. and M. Kibret. 2014. Mechanisms and aplications of plant growth 136
119
promoting rhizobacteria: Curent perspective. J. King Saud Univ. Sci., 26: 1•
20.
Ahmad, F., I. Ahmad and M. S. Khan. 2005. Indole acetic acid production by the indigenous isolates of Azotobacter and fluorescent Pseudomonas in the presence and absence of tryptophan. Turk. J. Biol., 29: 29•34.
Ahmad, F., I. Ahmad and M. S. Khan. 2008. Screening of free•living rhizospheric bacteria for their multiple plant growth promoting activities. Microbiol. Res., 163: 173•181.
Ahmad, M., Z. A. Zahir, H. N. Asghar and M. Asghar. 2011. Inducing salt tolerance in mung bean through co•inoculation with rhizobia and plantgrowth•promoting rhizobacteria containing 1•aminocyclopropane•1carboxylate•deaminase. Can. J. Microbiol., 57: 578•589.
Ahmad, M., Z. A. Zahir, H. N. Asghar and M. Arshad. 2012. The combined application of rhizobial strains and plant growth promoting rhizobacteria improves growth and productivity of mung bean (Vigna radiata L.) under salt•stressed conditions. Ann. Microbiol., 62: 1321•1330.
Alagawadi, A. R. and A. C. Gaur. 1992. Inoculation of A. brasilense and phosphate•solubilizing bacteria on yield of sorghum (Sorghum bicolor L. Moench) in dry land. Trop. Agric., 9: 347•350.
Anderson, J. M. and J. S. I. Ingram. 1993. Tropical Soil Biology and Fertility. A handbook of methods. C. A. B. International, Wallingfold, U. K. p. 70•74 and 82•87.
Anjum, M. A., M. R. Sajjad, N. Akhtar, M. A. Qureshi, A. Iqbal, A. R. Jami and M. Hassan. 2007. Response of cotton to plant growth promoting
rhizobacteria inoculation under different levels of nitrogen. J. Agric. Res., 45 (2): 135•143.
Antoun, H., C. J. Beauchamp, N. Goussard, R. Chabot and R. Lalande. 1998. Potential of Rhizobium and Bradyrhizobium species as plant growth promoting rhizobacteria on no legumes: effect on radishes (Raphanus sativus L.). Plant Soil, 204: 57•67.
Arshad, M. and W. T. Frankenberger. 1993. Microbial production of plant growth regulators. In: F. Blaine & J. Metting, (eds.), Soil Microbial Ecology.
Marcel and Dekker, Inc., New York, p. 307•347.
Arshad, M., M. Saleem and S. Hussain. 2007. Perspectives of bacterial ACCdeaminase in phytoremediation. Trends Biotechnol., 25: 356•362. 137
Arteca, R. N. and J. M. Arteca. 2007. Heavy•metal•induced ethylene production in Arabidopsis thaliana. J. Plant Physiol., 164 (11): 1480•1488.
Asghar, H. N., Z. A. Zahir, M. Arshad and A. Khaliq. 2002. Relationship between in vitro production of auxins by rhizobacteria and their growth promoting activities in Brassica juncea L. Biol. Fertil. Soils, 35: 231•237.
Banerjee, M. R., L. Yesmin and J. K. Vessey. 2006. Plant growth promoting rhizobacteria as biofertilizers and biopesticides. In: M. K. Rai (ed.),
Handbook of microbial biofertilizers. Food Products Press, New York: p. 137•181.
Banik, S. and B. K. Dey. 1983. Alluvial soil microorganisms capable of utilising insoluble aluminium phosphate as a sole source of phosphorus. Zbl. Mikrobiol., 138: 437•442.
Barea, J. M., E. Navamo and E. Monotoya. 1976. Production of plant growth regulators by rhizosphere phosphate solubilizing bacteria. J. Appl.
Bacteriol., 40: 129•134.
Barber, S. A. 1995. Soil nutrient bioavailability: A mechanistic approach. 2nd ed.,
John and Wiley Sons, Inc. New York. 414 pp.
Belimov, A. A., I. C. Dodd, N. Hontzeas, J. C. Theobald, V. I. Safronova and W. J. Davies. 2009a. Rhizosphere bacteria containing ACC•deaminase increase yield of plants grown in drying soil via both local and systemic hormone signaling. New Phytol., 181: 413•423.
Belimov, A. A., I. C. Dodd, V. I. Safronova and W. J. Davies. 2009b. ACC• deaminase•containing rhizobacteria improve vegetative development and yield of potato plants grown under water•limited conditions. Asp. Appl. Biol., 98: 163•169
Beneduzi, A., D. Peres, L. K. Vargas, M. H. Bodanese•Zanettini and L. M. P. Passaglia. 2008. Evaluation of genetic diversity and plant growth promoting activities of nitrogen•fixing bacilli isolated from rice fields in South Brazil.
Appl. Soil Eco., 39: 311•320.
Berg, G. 2009. Plant•microbe interactions promoting plant growth and health:
perspectives for controlled use of microorganisms in agriculture. Appl. Microbiol. Biotechnol., 84: 11•18.
Bhattacharyya, P. N. and D. K. Jha. 2012. Plant growth•promoting rhizobacteria
(PGPR): emergence in agriculture. World J. Microbiol. Biotechnol., 28: 1327•1350. 138
Biari, A., A. Gholami and H. A. Rahmani. 2008. Growth promotion and enhanced nutrient uptake of maize (Zea mays L.) by application of plant growth promoting rhizobacteria in arid region of Iran. J. Bio. Sci., 8 (6): 10151020.
Bottini, R., F. Cassan and P. Picolli. 2004. Gibberellin production by bacteria and its involvement in plant growth promotion. Appl. Microbiol. Biotechnol.,
65: 497•503.
Bowen, G. D. and A. D. Rovira. 1999. The rhizosphere and its management to improve plant growth. Adv. Agron., 66: 1•102.
Brick, J. M., R. M. Bostock and S. E. Silverstone. 1991. Rapid in situ assay for indole acetic acid production by bacteria immobilized on nitrocellulose membrane. Appl. Environ. Microbiol., 57: 535•538.
Brown, M. E. 1974. Seed and root bacterization. Annu. Rev. Phytopathol., 12: 181•
197.
Buyer, J. S., M. G. Kratzke and L. J. Sikora. 1993. A method for detection of pseudobactin, the siderophore produced by a plant growth promoting
Pseudomonas strain, in the barley rhizosphere. Appl. Environ. Microbiol., 59: 677•681.
Çakmakçi, R., M. Erat, Ü. G. Erdoan and M. F. Dönmez. 2007. The influence of PGPR on growth parameters, antioxidant and pentose phosphate oxidative cycle enzymes in wheat and spinach plants. J. Plant Nutr. Soil Sci., 170: 288•295.
Cattelan, A. J., P. G. Hartel and J. J. Fuhrmann. 1999. Screening for plant growth rhizobacteria to promote early soybean growth. Soil Sci. Soc. Am. J., 63: 1670•1680.
Chabot, R., H. Antoun and M. Cescas. 1993. Growth stimulation of corn and romiane lettuce by microorganisms solubilizing inorganic phosphorous. Can. J. Microbiol., 39: 941•947.
Chabot, R., H. Antoun and M. P. Cescas. 1996. Growth promotion of maize and lettuce by phosphate solubilizing Rhizobium leguminosarum biovar phaseoli. Plant Soil, 184: 311•321.
Chaiharn, M. and S. Lumyong. 2009. Phosphate solubilization potential and stress tolerance of rhizobacteria from rice soil in Northern Thailand. World J. Microbiol. Biotechnol., 25: 305•14.
Chandra, S., K. Choure, R. C. Chaubey and D. K. Maheshwari. 2007. Rhizosphere competent Mesorhizobium loti MP6 induces root hair curling, inhibits Sclerotina sclerotiorum and enhances growth of Indian mustard (Brassica campestris). Braz. J. Microbiol., 38: 124•130. 139
Chen, Y. P., P. D. Rekha, A. B. Arun, F. T. Shen, W. A. Lai and C. C. Young. 2006. Phosphate solubilizing bacteria from subtropical soil and their tricalcium solubilizing abilities. Appl. Soil Ecol., 34: 33•41.
Cohen, A., C. Travaglia, H. Reinoso, P. Piccoli and R. Bottini. 2001. Azospirillum inoculation and inhibition of gibberellin and ABA synthesis in maize seedlings under drought. Proc. Plant Growth Regul. Soc. Am., 28: 88•93.
Cowan, S. T. and K. J. Steel. 2004. Manual for the identification of medical bacteria. 3rd ed., Cambridge University Press, London, 331 pp.
Das, A., M. Parsad and R. C. Guatam. 2004. Residual effect of organic and inorganic sources of nitrogen applied to cotton (Gossipium hirsutum) on succeeding wheat (Triticum aestivum). Indian J. Agron., 49 (3): 143•146.
Datta, M., S. Banish and R. K. Gupta. 1982. Studies on the efficacy of a phytohormone producing phosphate solubilizing Bacillus firmus in augmenting paddy yield in acid soils of Nagaland. Plant Soil, 69: 365•373.
David, C., C. Herve, F. Nicolas, S. J. Isabelle, A. Mohamed and P. Franc. 2005.
The crystal structure of the pyoverdine outer membrane receptor FpyA from
Pseudomonas aeruginosa at 3.6 Å resolution. J. Mol. Biol., 347: 121•134.
Davies, P. J. 1995. The plant hormones: Their nature, occurrence, and functions. In: P. J. Davies, (ed.), Plant hormones: physiology, biochemistry and molecular biology. Kluwer Academic publishers, Netherland: 13•38.
De Freitas, J. R., M. R. Banerjee and J. J. Germida. 1997. Phosphate•solubilizing rhizobacteria enhance the growth and yield but not phosphorus uptake of canola (Brassica napus). Biol. Fertil. Soils, 36: 842•855.
Dell, C. J. and C. W. Rice. 2005. Short•term competition for ammonium and nitrate in tall grass prairie. Soil Sci. Soc. Am. J., 9: 371•377.
Delvasto, P., A. Valverde, A. Ballester, J. A. Munoz, F. Gonzalez, M. L. Blazquez, J. M. Igual and C. G. Balboa. 2008. Diversity and activity of phosphate bioleaching bacteria from a high•phosphorus iron ore. Hydrometallurgy, 92: 124•129.
Dhankhar, R., S. Sarita, D. Anil and S. Rajbala. 2013. The role of phosphorus solublizing bacteria (PSB) in soil management: an overview. Int. J. dev. Res., 3 (9): 31•36.
Di Gregorio, S., M. Barbafieri, S. Lampis, A. M. Sanangelantoni, E. Tasiand and G. Valini. 2006. Combined application of Triton X•10 and Sinorhizobium sp. Pb02 inoculum for the improvement of lead phytoextraction by Brassica juncea in EDTA amended soil. Chemosphere, 63: 293•29.
Dilfuza, E. 2012. Indole acetic acid production by root associated bacteria and its involvement in plant growth and development In: A. H. Keller & 140
M. D. Fallon, (eds.), Auxins: Structure, Biosynthesis and Functions. Nova Publishers, USA: 103•122.
Dobbelaere, S., A. Croonenborghs, A. Thys, A. van de Broek and J. Vanderleyden.
1999. Phytostimulatory effect of Azospirillum brasilense wild type and mutant strains altered in IAA production on wheat. Plant Soil, 212: 155164.
Dobbelaere, S., A. Croonenborghs, A. Thys, D. Ptacek, J. Vanderleyden, P. Dutto,
C. Labandera•Gonzalez, J. Caballero•Mellado, J. F. Aguirre, Y. Kapulnik, S. Brener, S. Burdman, D. Kadouri, S. Sarig and Y. Okon. 2001. Responses of agronomically important crops to inoculation with Azospirillum. Aust. J. Plant Physiol., 28: 871•879.
Dobbelaere, S., A. Croonenborghs and A. Thys. 2002. Effect of inoculation with wild type Azospirillum brasilense and A•irakense strains on development and nitrogen uptake of spring wheat and grain maize. Bio. Fert. Soils, 36 (4): 284•297.
Dobbelaere, S., J. Vanderleyden and Y. Okon. 2003. Plant growth•promoting effects of diazotrophs in the rhizosphere. Crit. Rev. Plant Sci., 22: 107•149.
Duff, S. M. G., G. Sarath and W. C. Plaxton. 1994. The role of acid phosphatases in plant phosphorus metabolism. Physiol. Plantarum, 90: 791•800.
El•Husseini, M. M., B. Helmut and J. Helmut. 2012. The biofertilising effect of seed dressing with PGPR Bacillus amyloliquefaciens FZB 42 combined with two levels of mineral fertilizing in African cotton production. Arch.
Phytopathol. Plant Prot., 45: 2261•2271.
Elisete, P. R., S. R. Luciana, L. M. D. O. Andre, D. B. V. Lucia, D. S. T. K. Regina, U. Segundo and M. R. Veronica. 2008. Azospirillum amazonense inoculation: Effects on growth, yield and N2 fixation of rice (Oryza sativa L.). Plant Soil, 302: 249•261.
El•Kholy, M. A., S. El•Ashry and A. M. Gomaa. 2005. Biofertilization of maize crop and its impact on yield and grains nutrient content under low rates of
mineral fertilizers. J. Appl. Sci. Res., 1 (2): 117•121.
El•Showk, S., R. Ruonala and Y. Helariutta. 2013. Crossing paths: cytokinin signalling and cross talk. Development, 140: 1373•1383.
Ezawa, T., S. E. Smith and F. A. Smith. 2002. P metabolism and transport in AM fungi. Plant Soil, 244: 221•230.
Fernando, W. G. D., S. Nakkeeran and Y. Zhang. 2006. Biosynthesis of antibiotics by PGPR and its relation in biocontrol of plant diseases. In: Z. A. Siddiqui (ed.), PGPR: Biocontrol biofertilization. Springer, Netherlands: 67•109. Gagne, S., C. 141
Richard, H. Roussean and H. Antoun. 1987. Xylem residing bacteria in alfalfa roots. Can. J. Microbiol., 33: 996•1000.
Gaind, S. and A. C. Gaur. 1991. Thermotolerant phosphate solubilizing microorganisms and their interaction with mung bean. Plant Soil, 133: 141149.
Galston, A. W. and R. K. Sawhney. 1990. Polyamines in plant physiology. Plant
Physiol., 94: 406•410.
Gamalero, E., G. Berta and B. R. Glick. 2009. The use of microorganisms to facilitate the growth of plants in saline soils. In: M. S. Khan, A. Zaidi & J.
Musarrat, (eds.), Microbial Strategies for Crop Improvement. Springer, Berlin, Heidelberg.
Garcìa, J. A. L., A. Probanza, A. B. Ramos, J. Barriuso and F. J. G. Mañero. 2004. Effect of inoculation with plant growth promoting rhizobacteria (PGPRs) and Sinorhizobium fredii on biological nitrogen fixation, nodulation and growth of Glycine max cv. osumi. Plant Soil, 267: 143•153.
Gaur, A. C. 1990. Phosphate solubilizing microorganisms as biofertilizers. Omega
Scientific Publishers. New Delhi. 176 pp.
Gholami, A., S. Shahsavani and S. Nezarat. 2009. The effect of plant growth promoting rhizobacteria (PGPR) on germination, seedling growth and yield of maize. World Acad. Sci. Eng. Technol., 49: 19•24.
Ghosh, S., J. N. Penterman, R. D. Little, R. Chavez and B. R. Glick. 2003. Three newly isolated plant growth•promoting bacilli facilitate the seedling growth of canola, Brassica campestris. Plant Physiol. Biochem., 41: 277•281.
Glick, B. R. 1995. The enhancement of plant growth by free•living bacteria. Can. J. Microbiol., 41: 109•117.
Glick, B. R. and Y. Bashan. 1997. Genetic manipulation of plant growth promoting bacteria to enhance biocontrol of phytopathogens. Biotechnol. Adv., 15: 353•378.
Glick, B. R., C. L. Patten, G. Holgin and D. M. Penrose. 1999. Biochemical and genetics mechanisms used by plant growth promoting bacteria. Imperial College Press, London. 267 pp.
Glick, B. R., B. Todorovic, J. Czarny, Z. Cheng, J. Duan and B. McConkey.
2007. Promotion of plant growth by bacterial ACC deaminase. Crit. Rev.
Plant Sci., 26: 227•242. 142
Glick, B. R. 2012. Plant growth promoting bacteria: Mechanisms and applications. Scientifica, 1•15.
Goldstein, A. H. and P. U. Krishnaraj. 2007. Phosphate solubilizing microorganisms vs. phosphate mobilizing microorganisms: What separates a phenotype from a trait?. In: E. Velazquez & C. Rodríguez•Barrueco (eds.), First International Meeting on Microbial Phosphate Solubilization.
Springer, 203•213.
Grichko, V. P. and B. R. Glick. 2001. Amelioration of flooding stress by ACC deaminase containing plant growth promoting bacteria. Plant Physiol. Bioch., 39: 11•17.
Guilfoyle, T., G. Hagen, T. Ulmasov and J. Murfett. 1998. How does auxin turn on genes? Plant Physiol., 118: 341•347.
Gyaneshwar, P., G. N. Kumar, L. J. Parekh and P. S. Poole. 2002. Role of soil microorganisms in improving P nutrition of plants. Plant Soil, 245: 83•93.
Haas, D. and C. Keel. 2003. Regulation of antibiotic production in root colonizing
Pseudomonas spp. and relevance for biological control of plant disease. Ann. Rev. Phytopathol., 41: 117•153.
Hagen, G. 1990. The control of gene expression by auxin. In: P. J. Davies (ed.),
Plant Hormones and their role in plant growth and development. Kluwer Academic Publishers, Netherlands: 149•163.
Hariprasad, P. and S. R. Niranjana. 2009. Isolation and characterization of phosphate solubilizing rhizobacteria to improve plant health of tomato. Plant Soil, 316: 13•24.
Hayat, R., S. Ali., M. T. Siddique and T. H. Chatha. 2008. Biological nitrogen fixation of summer legumes and their residual effects on subsequent rainfed wheat yield. Pak. J. Bot., 40 (2): 711•722.
Hayat, R., S. Ali, U. Amara, R. Khalid and I. Ahmed. 2010. Soil beneficial bacteria and their role in plant growth promotion: a review. Ann. Microbiol., 60: 579•598.
Hayat, R., I. Ahmed and R. I. Sheirdil. 2012. An overview of plant growth promoting rhizobacteria (PGPR) for sustainable agriculture. In: M. Ashraf, M. Öztürk, M. S. A, Ahmad & A. Aksoy (eds.), crop production for agricultural improvement, part 3. Springer, Dordrecht: 557•579.
Hayat, R., I. Ahmed, J. Peak, M. Ehsan, M. Iqbal and Y. H. Chang. 2013. A moderately boron tolerant candidates novel soil bacterium Lysinibacillus Pakistanensis sp. nov. Cand., isolated from soybean (Glycine max L) rhizosphere. Pak. J. Bot., 45: 41•50. 143
Hernandez, M. and M. Chailloux. 2004. Arbuscular mycorrhizal fungi and bacteria rhizosphere as an alternative to the mineral nutrition of tomato. Tropical crops, 25: 5•12.
Hersman, L. E., J. H. Folsythe, L. O. Ticknor and P. A. Maurice. 2001. Growth of
Pseudomonas mendocina on Fe (III) (hydr) oxides. Appl. Environ. Microbiol., 67: 4448•4453.
Höflich, G., W. Wiehe and G. Köhn. 1994. Plant growth stimulation by inoculation with symbiotic and associative rhizosphere microorganisms. Experientia, 50: 897•905.
Holl, F. B., C. P. Chanway, R. Turkingtdn and R. Radley. 1988. Growth response of crested wheat grass (Agropyron crisrarum L.), white clover (Trifilium repens L.). and perennial ryc grass (Lolium perenne L.) to inoculation with Bacillus polymyxo. Soil Biol. Biochem., 20: 19•24.
Illmer, P. and F. Schimmer. 1992. Solubilization of inorganic phosphates by microorganisms isolated from forest soil. Soil Biol. Biochem., 24: 389•395.
Illmer, P. and F. Schimmer. 1995. Solubilization of inorganic calcium phosphates solubilization mechanisms. Soil Biol. Biochem., 27: 257•263.
Javaid, M. and M. Arshad. 1997. Growth promotion of two wheat cultivars by plant growth promoting rhizobacteria. Pak. J. Bot., 29: 243•248.
Javid, M. G., A. Sorooshzadeh, F. Moradi, S. A. M. M. Sanavy, and I. Allahdadi.
2011. The role of phytohormones in alleviating salt stress in crop plants. Aust. J. Crop Sci., 5: 726•734.
Jetiyanon, K. and J. W. Kloepper. 2002. Mixtures of plant growth•promoting rhizobacteria for induction of systemic resistance against multiple plant diseases. Biol. Control, 24: 285•91.
Jilani, G., A. Akram, R. M. Ali, F. Y. Hafeez, I. H. Shamsi, A. N. Chaudhry and A. G. Chaudhry. 2007. Enhancing crop growth, nutrients availability, economics and beneficial rhizosphere microflora through organic and biofertilizers. Ann. Microbiol., 57: 177•183.
Kang, S. C., C. G. Hat, T. G. Lee and D. K. Maheshwari. 2002. Solubilization of insoluble inorganic phosphates by a soil•inhabiting fungus Fomitopsis sp. PS102. Curr. Sci., 82: 439•442.
Kang, B. G., W. T. Kim, H. S. Yun and S. C. Chang. 2010. Use of plant growth promoting rhizobacteria to control stress responses of plant roots. Plant Biotechnol. Rep., 4: 179•183.
Karlidag, H. A., M. Esitken, Turan and F. Sahin. 2007. Effects of root inoculation of plant growth promoting rhizobacteria (PGPR) on yield, growth and nutrient element contents of apple. Sci. Hortic., 114: 16•20. 144
Kausar, R. and S. M. Shahzad. 2006. Effect of ACC•deaminase containing rhizobacteria on growth promotion of maize under salinity stress. J. Agri. Soc. Sci., 2: 216•218.
Kennedy, I. R. and N. Islam. 2001. The current and potential contribution of asymbiotic nitrogen requirements on farms: a review. Aust. J. Exp. Agric., 41: 447•457.
Kennedy, I. R., A. T. M. A. Choudhury and M. L. Kecske´s. 2004. Non•symbiotic bacterial diazotrophs in crop•farming systems: can their potential for plant
growth promotion be better exploited. Soil Biol. Biochem., 36: 1229•1244.
Khalid, A., M. Arshad, Z. A. Zahir and A. Khaliq. 1997. Potential of plant growth promoting rhizobacteria for enhancing wheat yield. J. Anim. Plant Sci., 7: 53•56.
Khalid, M., Z. A. Zahir, A. Waseem and M. Arshad.1999. Azotobactor and L• tryptophan application for improving wheat yield. Pak. J. Biol. Sci., 2: 739742.
Khalid, A., M. Arshad and Z. A. Zahir. 2004. Screening plant growth•promoting rhizobacteria for improving growth and yield of wheat. J. Appl. Microbiol., 96: 473•480.
Khalid, A., M. Arshad and Z. A. Zahir. 2006. Phytohormones: microbial production and applications. In: N. Uphoff (ed.), Biological approaches to sustainable soil systems. Taylor and Francis, Florida: 207•220.
Khaliq, A., M. K. Abbasi and T. Hussain. 2006. Effects of integrated use of organic and inorganic nutrient sources with effective microorganisms (EM) on seed cotton yield in Pakistan. Bioresour. Technol., 7: 967•972.
Khan, M. S., A. Zaidi, P. A. Wani and M. Oves. 2009. Role of plant growth promoting rhizobacteria in the remediation of metal contaminated soils. Environ. Chem. Lett., 7: 1•19.
Khan, M. S., A. Zaidi, M. Ahemad, M. Oves and P. A. Wani. 2010. Plant growth promotion by phosphate solubilizing fungi•current perspective. Arch. Agron. Soil Sci., 56 (1): 73•98.
Kim, K. Y., D. Jordan and G. A. McDonald. 1998. Effect of phosphate solubilizing bacteria and vesicular arbuscular mycorrhizae on tomato growth and soil
microbial activity. Biol. Fertil. Soils, 26: 79•87.
King, J. E. 1932. The colorimetric determination of phosphorus. J. Biochem., 26: 292.
Kishore, G. K., S. Pande and A. R. Podile. 2005. Biological control of collar rot disease with broad•spectrum antifungal bacteria associated with groundnut. 145
Can. J. Microbiol., 51: 123•132.
Kiss, T. and E. Farkas. 1998. Metal•binding ability of desferrioxamine B. J. Inclusion Phenom. Mol. Recognit. Chem., 32: 385•403.
Kloepper, J. W. and M. N. Schroth. 1978. Plant growth•promoting rhizobacteria on radishes. In: Proceedings of the 4th International Conference on Plant
Pathogenic Bacteria. vol. II. Station de Pathologie Végétale et de Phytobacté•riologie, INRA, Angers, France: 879•882.
Kloepper, J. W., J. Leong, M. Teintze and M. N. Schroth. 1980. Enhanced plant growth by siderophores produced by plant growth•promoting rhizobacteria. Nature, 286: 885•886.
Kloepper, J. W., R. Lifshitz and M. N. Schorth. 1988. Pseudomonas inoculants to benfits plant production. J. Anim. Plant Sci., 1: 60•64.
Kloepper, J. W. 1993. Plant growth promoting rhizobacteria as biological control agents. In: F. B. Metting Jr, (ed.), Soil Microbial Ecology. Dekker, New York: 255•274.
Kloepper, J. W. 1994. Plant growth•promoting rhizobacteria (other systems). In: Y.
Okon (ed.), Azospirillum/Plant Associations. CRC Press, Boca Raton, FL, USA. 111•118.
Koushal, S. and P. Singh. 2011. Effect of integrated use of fertilizer, FYM and
biofertilizer on growth and yield performance on soyabean (Glycine max
(L.) Merill). Res. J. Agric. Sci., 43: 193•197.
Kucey, R. M. N. 1988. Plant growth•altering effects of Azospirillum brasilense and
Bacillus C•11•25 on two wheat cultivars. J. Appl. Bacteriol., 64: 187•196.
Kumar, B. S. D. and H. C. Dube. 1992. Seed bacterization with a fluorescent pseudomonas for enhanced plant growth, yield and disease control. Soil Biol. Biochem., 24: 539•542.
Kumar, V., R. K. Behl and N. Narula. 2001. Establishment of phosphate solubilizing strains of Azotobacter chroococcum in the rhizosphere and their effect on wheat cultivars under greenhouse conditions. Microbiol. Res., 156: 87•93.
Kunc, F. and J. Macura, 1988. Mechanisms of adaptation and selection of microorganism in the soil. In: V. Vančura & F. Kunc, (eds.), Soil Microbial Association, Elsevier, Amesterdam: 281•299.
Ladha, J. K. and P. M. Reddy. 2003. Nitrogen fixation in rice systems: state of knowledge and future prospects. Plant Soil, 252: 151•167. 146
Lambert, B. and J. Joos. 1989. Fundamental aspects of rhizobacterial plant growth promotion research. Trends Biotechnol., 7: 215•219.
Landa, B. B., O. V. Mavrodi., K. L. Schroeder, R. Allende•Molar and D. M. Weller. 2006.
Enrichment and genotypic diversity of phlD containing fluorescent Pseudomonas spp., in two soils after a century of wheat and flax monoculture. FEMS Microbiol. Ecol., 55: 351•368.
Letham, D. S. 1963. Zeatin, a factor inducing cell division from Zea mays. Life
Sci., 8: 569•573.
Liu, W., X. Xu, X. Wu, Q. Yand, Y. Luo and P. Christie. 2006. Decomposition of silicate minerals by Bacillus mucilaginosus in liquid culture. Annu. Conf.
Soc. Environ. Geochem. Health, 28: 133•140.
Loper, J. E. and M. N. Schroth. 1986. Influence of bacterial sources of indole•3• acetic acid biosynthetic on root elongation of sugar beet. Phytopathol., 76:
386•389.
Lugtenberg, B. J. and F. Kamilova. 2009. Plant•growth•promoting rhizobacteria. Annu. Rev. Microbiol., 63: 541•556.
Lynch, J. M. 1983. Soil biotechnology. Microbiological factors in crop productivity. Black well Scientific Publications. London. p. 191.
Lynch, J. M. 1990. The Rhizosphere, Wiley Interscience, Chichester. Imperial
College Press, London. p. 267.
Malusá, E., L. Sas•Paszt and J. Ciesielska. 2012. Technologies for beneficial microorganisms inocula used as biofertilizers. Scient. World J., 2012: 491206.
Malusá, E., and N. Vassilev. 2014. A contribution to set a legal framework for biofertilisers. Appl.Microbiol. Biotech., 98 (15): 6599•6607.
Manninger, E. and M. Antal. 1970. Rhizobium and other bacteria in the root nodules of leguminous plants. I. Sterilization of the surface of root nodules of Soja max (soyabeans). Zentralbl. Bakteriol. Parasitenk. Infektionskr. Hyg. 124: 684•687.
Mansouri, H., A. Petit, P. Oger and Y. Dessaux. 2002. Engineered rhizosphere: the trophic bias generated by opine•producing plants is independent of the opine type, the soil origin, and the plant species. Appl. Environ. Microbiol., 68: 2562•2566. 147
Marcos, A. K. and J. C. Suttle. 1995. Effect of compost on rhizosphere microflora of tomato and on the incidence of plant growth promoting rhizobacteria.
Can. J. Microbiol., 61 (1): 194•199.
Martínez, V. O, M. A. Jorquera, D. E. Crowley, G. Gajardo and M. L. Mora. 2010. Mechanisms and practical considerations involved in plant growth
promotion by rhizobacteria. J. Soil Sci. Plant Nutr., 10: 293•319.
Mayak, S., T. Tirosh and B. R. Glick. 2004. Plant growth•promoting bacteria confer resistance in tomato plants to salt stress. Plant Physiol. Biochem., 42:
565•572.
Mehrvarz, S., M. R. Chaichi and H. A. Alikhani. 2008. Effects of Phosphate solubilizing microorganisms and phosphorus chemical fertilizer on yield and yield components of barely (Hordeum vulgare L.). Am. Eurasian J.
Agric. Environ. Sci., 3: 822•828.
Mesbah, M., U. Premachandra and W. B. Whitman. 1989. Precise measurement of the G+C 297 content of deoxyribonucleic acid by high•performance liquid chromatography. Int. J. Syst. Bacteriol., 298 (39): 159•167.
Miller, R. M. and J. D. Jastrow. 2000. Mycorrhizal fungi influence soil structure.
In: Y. Kapulnik & D. D. Douds, (eds.), Arbuscular mycorrhizas: Physiology and Function. Kluwer Academic Publishers, Netherlands: 3•18.
Miransari, M., H. Riahi, F. Minaie and D. L. Smith. 2013. Improving soybean
(Glycine max L.) N2•fixation under salinity stress. J. Plant Growth Regul., 35: 3075•3084.
Mirza, M., S. Mehnaz, P. Normand, C. Prigent•Combaret, Y. Moenne•Loccoz, R. Bally and K. A. Malik. 2006. Molecular characterization and PCR•detection of a nitrogen fixing Pseudomonas strain promoting rice growth. Biol. Fertil. Soils, 43: 163•170.
Mohiddin, F. A., M. R. Khan and S. M. Khan. 2010. Why Trichoderma is considered super hero (super fungus) against the evil parasites. J. Plant
Pathol., 9: 1•11.
Mok, D. W. and M. C. Mok. 2001. Cytokinin metabolism and action. Annu. Rev. Plant Biol., 52: 89•118.
Nadeem, S. M., Z. A. Zahir, M. Naveed and M. Arshad. 2009. Rhizobacteria containing ACC deaminase confer salt tolerance in maize grown on salt affected soils. Can. J. Microbiol., 55: 1302•1309. 148
Nautiyal, C. S. 1999. An efficient microbiological growth medium for screening phosphate solubilizing microorganisms. FEMS Microbiol. Lett., 170: 265270.
Nautiyal, C. S., S. Bhadauria, P. Kumar, H. Lal, R. Momdal and D. Verma. 2000. Stress induced phosphate solubilization in bacteria isolated from alkaline soils. FEMS Microbiol. Lett., 182: 291•296.
Naveed, M., M. Khalid., D. L. Jones., R. Ahmad and Z. A. Zahir. 2008. Relative efficacy of Pseudomonas spp., containing ACC•deaminase for improving growth and yield of maize (Zea mays L.) in the presence of organic
fertilizer. Pak. J. Bot., 40: 1243•1251.
Naz, I. and A. Bano. 2010. Biochemical, molecular characterization and growth promoting effects of phosphate solubilizing Pseudomonas sp. isolated from weeds grown in salt range of Pakistan. Plant Soil, 334: 199•207.
Ng, L. C., M. Sariah, O. Sariam, O. Radziah and M. A. Z. Abidin. 2012. Rice seed bacterization for promoting germination and seedling growth under aerobic cultivation system. Aust. J. Crop Sci., 6: 170•175.
Neilands, J. B. and K. Nakamura. 1991. Detection, determination, isolation, characterization and regulation of micrbial iron chelates. In: G.
Winkelmann (ed.), Handbook of microbial iron chelates. CRC Press. Florida: 235•269.
Nelson, L. M. 2004. Plant growth promoting rhizobacteria (PGPR): Prospects for new inoculants. Crop Management, 10: 301•305.
Neubauer, U., G. Furrer, A. Kayser and R. Schulin. 2000. Siderophores, NTA, and citrate: potential soil amendments to enhance heavy metal mobility in phytoremediation. Int. J. Phytorem., 2: 353•368.
Nezarat, S. and A. Gholami. 2009. Screening plant growth promoting rhizobacteria for improving seed germination, seedling growth and yield of maize. Pak. J. Biol. Sci., 12: 26•32.
Noel, T. C., C. Sheng, C. K. Yost, R. P. Pharis and M. F. Hynes. 1996. Rhizobium leguminosarum as a plant growth•promoting rhizobacterium: direct growth promotion of canola and lettuce. Can. J. Microbiol., 42: 279•283.
Notz, R., M. Maurhofer, U. Schnider•Keel, B. Duffy, D. Haas and G. Défago. 2001. Biotic factors affecting expression of the 2, 4•diacetylphloroglucinol biosynthesis gene phlA in Pseudomonas fluorescens biocontrol strain CHAO in the rhizosphere. Phytopathol., 91: 873•881.
Nozawa•Inoue, M., K. M. Scow and D. E. Rolston. 2005. Reduction of perchlorate and nitrate by microbial communities in vadose soil. Appl. Environ. Microbiol., 71: 3928•3934. 149
Okon, Y. and J. Vanderleyden. 1997. Root•associated Azospirillum species can stimulate plants. ASM News, 63: 366•370.
Olsen, G. J. and C. R. Woese. 1993. Ribosomal RNA: a key to phylogeny. J. Bacteriol., 7: 113•123.
Pal, S. S. 1998. Interactions of an acid tolerant strain of phosphate solubilizing bacteria with a few acid tolerant crops. Plant Soil, 198: 169•177.
Panhwar, Q. A., O. Radziah, A. R. Zaharah, M. Sariah and I. M. Razi. 2012. Isolation and characterization of phosphate•solubilizing bacteria from aerobic rice. Afr. J. Biotechnol., 11: 2711•2719.
Patten, C. and B. R. Glick. 1996. Bacterial biosynthesis of indole•3•acetic acid.
Can. J. Microbiol., 42: 207•220.
Peix, A., A. A. Rivas•Boyero, P. F. Mateos, C. Rodriguez•Barrueco, C. E. Martinez•Molina and E. Vlazquez. 2001. Growth promotion of chickpea and barley by a phosphate solubilizing strain of Mesorhizobium mediterraneum under growth. Soil Biol. Biochem., 33: 103•110.
Peoples, M. B., A. W. Faizah, B. Rekasem and D. F. Herridge. 1989. Methods for evaluating nitrogen fixation by nodulated legumes in the field. ACIAR Canberra. 22•45 pp.
Ponmurugan, P. and C. Gopi. 2006. In vitro production of growth regulators and phosphatase activity by phosphate solubilizing bacteria. Afr. J. Biotechnol., 5: 348•350.
Poly, F., L. J. Monrozier and R. Bally. 2000. Improvement in the RFLP procedure for studying the diversity of nifH genes in communities of nitrogen fixers in soil. Res. Microbiol., 152: 95•103.
Pradhan, N. and L. B. Sukla. 2005. Solubilization of inorganic phosphate by fungi isolated from agriculture soil. Afr. J. Biotechnol., 5: 850•854.
Preeti, V., M. S. Reddy, S. Kavitha, P. Velusamy, R. S. D. Paulraj, S. M.
Purushothaman, V. B. Priyadarisini, S. Bharathkumar, J. W. Kloepper and S. S. Gnanamanickam. 2002. Role of biological preparations in enhancement of rice seedling growth and grain yield. Curr. Sci., 83: 1140•
1143.
Puente, M. E., Y. Bashan, C. Y. Li and V. K. Lebsky. 2004. Microbial populations and activities in the rhizoplane of rock•weathering desert plants. Root colonization and weathering of igneous rocks. Plant Biol., 6: 629•642.
Raj, J., D. J. Bagjaraj and A. Manjunath. 1981. Influence of soil inoculation with vesicular•arbuscular mycorhiza and a phosphate disolving bacterium on plant growth and P uptake. Soil Biol. Biochem., 13: 105•108. 150
Rajkumar, M., N. Ae, M. N. V. Prasad and H. Freita. 2010. Potential of siderophore producing bacteria for improving heavy metal phytoextraction.
Trends Biotechnol., 28: 142•149.
Rameshkumar, N., N. Ayyadurai, N. kayalvizhi and P. Gunasekaran. 2012. Genotypic and phenotypic diversity of PGPR Fluorescent pseudomonads isolated from the rhizosphere of sugarcane (Saccharum officinarum L.). J. Microbiol. Biotechnol., 22 (1): 13•24.
Ramkumar, V. and E. Kannapiran. 2011. Isolation of total heterotrophic bacteria and phosphate solubilizing bacteria and in vitro study of phosphatase activity and production of phytohormones by PSB. Arch. Appl. Sci. Res., 3 (5): 581•586.
Rana, A., B. Saharan, M. Joshi, R. Prasanna, K. Kumar and L. Nain. 2011. Identification of multi•trait PGPR isolates and evaluating their potential as inoculants for wheat. Ann. Microbiol., 61: 893•900.
Rathore, P. 2014. A review on approaches to develop plant growth promoting rhizobacteria. Int. J. Recent Scientific Research, 5 (2): 403•407.
Reed, M. L. E. and B. R. Glick. 2005. Growth of canola (Brassica napus) in the presence of plant growth•promoting bacteria and either copper or polycyclic aromatic hydrocarbons. Can. J. Microbiol., 51: 1061•1969.
Remans, S., M. W. Blair, G. Manrique, L. E. Tovar, I. M. Rao, A. Croomenborghs, G. R. Torres, M. El•Howeity, J. Michiels and J. Vanderleyden. 2008. Physiological and genetic analysis of root responsiveness to auxin•producing plant growth•promoting bacteria in common bean (Phaseolus vulgaris L.).
Plant Soil, 302: 149•161.
Richardson, A. E. 1994. Soil microorganisms and phosphorous availability. In: C. E. Pankhurst, B. M. Doube & V. V. S. R. Gupta (eds.), Soil biota:
management in sustainable farming systems. CSIRO, Australia: 50•62.
Richard, C. 1984. New species of Enterobacteriaceae (1979•1983). Bull. Inst. Pasteur., 82: 255•277.
Rizwan, A., M. Arshad, A. Khalid and A. Zahir. 2008. Effectiveness of organic biofertilizer supplemented with chemical fertilizer for improving soil water retention. Aggregate stability, growth and nutrient uptake of maize. J. Sustain. Agric., 34: 57•77.
Rodriguez, H. and R. Fraga. 1999. Phosphate solubilizing bacteria and their role in plant growth promotion. Biotechnol. Advances., 17: 319•339.
Rodríguez, H., R. Fraga, T. González and Y. Bashan. 2006. Genetics of phosphate solubilization and its potencial applications for improving plant growth promoting bacteria. Plant Soil, 287: 15•21. 151
Rokhzadi A, A. Asgharzadeh, F. Darvish, G. Nour•Muhammadi and E. Majidi. 2008. Influence of plant growth promoting rhizobacteria on dry matter accumulation and yield of chickpea (Cicer arietinum L.) under field conditions. Am. Eurasian J. Agric Environ. Sci., 3 (2): 253•257.
Ryan, R. P., K. Germaine, A. Franks, D. J. Ryan and D. N. Dowling. 2008.
Bacterial endophytes: recent developments and applications. FEMS Microbiol. Lett., 278: 1•9.
Salisbury, F. B. and C. Ross. 1992. Plant Physiology 4th ed., Wadsworth, Belmont.
CA. 682 pp.
Saber, Z., H. Pirdashti, M. Esmaeili, A. Abbasian and A. Heidarzadeh. 2012. Response of wheat growth parameters to co•inoculation of plant growth promoting rhizobacteria (PGPR) and different levels of inorganic nitrogen and phosphorus. World Appl. Sci. J., 16: 213•219.
Saber, M. S. M., M. Yousry and M. O. Kabesh. 1977. Effect of manganese application on the activity of phosphorus dissolving bacteria in a calcareous soil cultivated with pea plants. Plant Soil, 47: 335•339.
Saber, K., L. Nahla, D. Ahmed and A. Chedly. 2005. Effect of P on nodule formation and N fixation in bean. Agron. Sustain. Develop., 25: 389•393.
Saharan, B. S. and V. Nehra. 2011. Plant growth promoting rhizobacteria: a critical review. Life Sci. Med. Res., 21: 1•30.
Saikia, R., B. P. Singh, R. Kumar and D. K. Arora. 2005. Detection of pathogenesis related proteins•chitnase and b•1, 3•glucanase in induced chickpea. Curr. Sci., 89: 659•63.
Salamone, G. D. I. E., R. K. Hynes and L. M. Nelson. 2005. Role of cytokinins in plant growth promotion by rhizosphere bacteria. In: Z. A. Siddiqui, (ed.), PGPR: biocontrol and biofertilization. Springer. Netherland: 173•195.
Saleem, M., M. Arshad, S. Hussain and A. S. Bhatti. 2007. Perspective of plant growth promoting rhizobacteria (PGPR) containing ACC deaminase in
stress agriculture. J. Ind. Microbiol. Biotechnol., 34: 635•648.
Saravana, K. D. and R. Samiyappan. 2007. ACC deaminase from Pseudomonas fluorescens mediated saline resistance in groundnut (Arachis hypogaea)
plants. J. Appl. Microbiol., 102: 1283•1292.
Schalk, I. J., C. Hennard, C. Dugave, K. Poole, M. A. Abdallah and F. Pattus.
2001. Iron•free pyoverdin binds to its outer membrane receptor FpvA in 152
Pseudomonas aeruginosa: a new mechanism for membrane iron transport. Mol. Microbiol., 39: 351•360.
Schwyn, B. and J. B. Neilands. 1987. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem., 160: 47•56.
Selvakumar, G., M. Mohan, S. Kundu, A. D. Gupta, P. Joshi, S. Nazim and H. S.
Gupta. 2008. Cold tolerance and plant growth promotion potential of Serratia
marcescens strain SRM (MTCC 8708) isolated from flowers of summer squash
(Cucurbita pepo). Lett. Appl. Microbiol., 46: 171•175.
Shahab, S., A. Nuzhat and S. K. Nasreen. 2009. Indole acetic acid production and enhanced plant growth promotion by indigenous PSBs. Afr. J. Agric. Res., 4: 1312•1316.
Shaharoona, B., M. Arshad and Z. A. Zahir. 2006. Effect of plant growth promoting rhizobacteria containing ACC deaminase on maize (Zea mays L.) growth under axenic conditions and on nodulation in mung bean (Vigna radiata L.). Lett. Appl. Microbiol., 42: 155•159.
Shaharoona, B., M. Arshad and A. Khalid. 2007. Differential response of etiolated pea seedling to 1•aminocyclopropane•1•carboxylate and/or L•methionine utilizing rhizobacteria. J. Microbiol., 45: 15•20.
Shaharoona, B., M. Naveed, M. Arshad and Z. A. Zahir. 2008. Fertilizer•dependent efficiency of Pseudomonads for improving growth, yield, and nutrient use efficiency of wheat (Triticum aestivum L.) Appl. Microbiol. Biotechnol.,
79: 147•155.
Sharma, B. N., A. Johri, O. P. Ramesh and S. V. S. Joshi. 2011. Selection of plant growth•promoting Pseudomonas spp. that enhanced productivity of soybean•wheat cropping system in central India. J. Microbiol. Biotechnol., 21: 1127•1142.
Sharma, A., D. Shankhdhar and S. C. Shankhdhar. 2013. Enhancing grain iron content of rice by the application of plant growth promoting rhizobacteria. Plant, Soil Environ., 59: 89•94.
Shearer, G. and D. H. Kohl. 1986. N2•fixation in field settings: estimations based on natural 15N abundance. Aust. J. Plant Physiol., 13: 699•756.
Shoebitz, M., C. M. Ribaudo, M. A. Pardo, M. L. Cantore, L. Ciampi and J. A. Curá. 2009. Plant growth promoting properties of a strain of Enterobacter ludwigii isolated from Lolium perenne rhizosphere. Soil Biol. Biochem., 41: 1768•1774.
Siddiqui, I. A. and S. S. Shaukat. 2002. Rhizobacteria•mediated induction of systemic resistance (ISR) in tomato against Meloidogyne javanica. J. 153
Phytopathol., 150: 469•473.
Skoog, F., F. N. Strong and C. O. Miller. 1965. Cytokinins. Science, 148: 532•533.
Smith, R. S. 1997. New inoculant technology to meet changing legume management. In: C. Elmerich, A. Kondorosi & W. E. Newton (eds.),
Biological Nitrogen Fixation for the 21st Century. Kluwer, Netherland: 621622.
Smith, K. P. and R. M. Goodman. 1999. Host variation for interactions with beneficial plant•associated microbes. Annu. Rev. Phytopathol., 37: 473491.
Sohal, P. K., R. P. Gupta and M. S. Pandher. 1996. Effect of inoculation of Azotobacter and PSM on fertilizer economy, plant growth and yield of winter maize. In: Nitrogen Fixation with Non•legumes: Proceedings of the 7th International Symposium on Nitrogen Fixation with Non•legumes, 1621 October, 1996, Faisalabad, Pakistan. Kluwar, Academic Publishers, USA.
Son, T. T. N., C. N. Diep and T. T. M. Giang. 2006. Effect of Bradyrhizobia and phosphate solubilizing bacteria application on soybean in rotational system in the Mekong delta. Omonrice, 14: 48•57.
Spaepen, S., S. Dobbelaere, A. Croonenborghs and J. Vanderleyden. 2008. Effects of Azospirillum brasilense indole•3•acetic acid production on inoculated wheat plants. Plant Soil, 312: 15•23.
Spencer, D., E. K. James, G. J. Ellis, J. E. Shaw and J. I. Sprent. 1994. Interactions between rhizobia and potato tissue. J. Exp. Bot., 45: 1475•1482.
Steel, R. G., J. H. Torrie and D. A. Dickey. 1997. Principles and Procedures of Statistics: A biometrical approach. 3rd ed., McGraw Hill Book co. Inc. New York. 633 pp.
Sturz, A. V., B. R. Christie, B. G. Matheson and J. Nowak. 1997. Biodiversity of endophytic bacteria which colonized red clover nodules, roots, stems, and foliage and their influence on host growth. Biol. Fertil. Soils., 25:13•19.
Sturz, A. V. and J. Nowak. 2000. Endophytic communities of rhizobacteria and the strategies required to create yield enhancing associations with crops. Appl.
Soil Ecol., 15: 183•190.
Sturz, A. V., B. G. Mathenson, W. Arsenault, J. Kimpinski and B. R. Christie. 2001. Weeds as a source of plant growth promoting rhizobacteria in agricultural soils. Can. J. Microbiol., 47: 1013•1024.
Sundheim, L., A. R. Poplawsky and A. H. Elingboe. 1998. Molecular cloning of two chitnase genes from Serratia marcescens and their expression in Pseudomonas species. Physiol. Mol. Plant Pathol., 3: 483•491. 154
Suzuki, K., M. Goodfellow and A. G. ÓDonnell. 1993. Cell envelopes and classification. In: M. Goodfellow & A. G. ÓDonnell, (eds.), Handbook of new bacterial systematics. Academic, London: 195•250.
Swain, M. R., S. K. Naskar and R. C. Ray. 2007. Indole•3•acetic acid production and effect on sprouting of Yam (Dioscorea rotundata L.) minisetts by
Bacillus subtilis isolated from culturable cowdung microflora. Pol. J. Microbiol., 56: 103•110.
Tamura, K., J. Dudley, M. Nei and S. Kumar. 2007. MEGA 4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol., 24: 1596•1599.
Tien, T. M., M. H. Gaskins and D. H. Hubbell. 1979. Plant growth substances produced by Azospirillum brasilense and their effect on the growth of pearl millet (Pennisetum americanum L.). Appl. Environ. Microbiol., 37:10161024.
Tindall, B. J. 1990. Lipid composition of Halobacterium lacusprofundi. FEMS
Microbiol. Lett., 66: 199•202.
Tsavkelova, E. A., T. A. Cherdyntseva, S. Y. Klimova, A. I. Shestakov, S. G.
Botina and A. I. Netrusov. 2007. Orchid•associated bacteria produce indole3•acetic acid, promote seed germination, and increase their microbial yield in response to exogenous auxin. Arch. Microbiol., 188: 655•664.
Upadhyay, S. K., D. P. Singh and R. Saikia. 2009. Genetic diversity of plant
growth•promoting rhizobacteria isolated from rhizospheric soil of wheat
under saline conditions. Curr. Microbiol., 59: 489•496.
Upadhyay, S. K., J. S. Singh and D. P. Singh. 2011. Exopolysaccharide producing plant growth•promoting rhizobacteria salinity condition. Pedosphere, 21: 214•222.
Vessey, J. K. 2003. Plant growth•promoting rhizobacteria as biofertilizers. Plant
Soil, 255: 571•586.
Walsh, U. F., J. P. Morrissey and F. O’Gara. 2001. Pseudomonas for biocontrol of phytopathogens: from functional genomics to commercial exploitation.
Curr. Opin. Biotechnol., 12: 289•295.
Willige, B., S. Ghosh, C. Nill, M. Zourelidou, E. Dohmann, A. Maier, and C. Schwechheimer. 2007. The della domain of GA insensitive mediates the interaction with the GA insensitive dwarf1A gibberellin receptor of Arabidopsis. Plant Cell, 19: 1209•1220. 155
Woodard, H. J. and A. Bly. 2000. Maize growth and yield responses to seed inoculated N2•fixing bacteria under dry land production conditions. J. Plant Nutr., 23: 55•65.
Yadav, K. S. and K. R. Dadarwal. 1997. Phoshpate solubilization and mobilization through soil microorganism. In: K. R. Dadarwal (ed.), Biotechnological approaches in soil microorganisms for sustainable crop production. Scientific Publishers, Jodhpur: 293•308.
Yasari, E. and A. M. Patwardhan. 2007. Effects of Aztobacter and Azospirillium inoculations and chemical fertilizers on growth and productivity of Canola. Asian J. Plant Sci., 6 (1): 77•82.
Yasmin, H. and A. Bano. 2011. Isolation and characterization of Phosphate
Solublizing Bacteria from rhizosphere Soil of Khewra salt range and Attock. Pak. J. Bot., 43: 1663•1668.
Yasmin, H., B. Asghari, R. Samiullah, R. Naz, U. Farooq, A. Nosheen and S. Fahad. 2012. Growth promotion by P•solubilizing, siderophore and bacteriocin producing rhizobacteria in Zea mays L. J. Med. Plants Res., 6 (3): 553•559.
Yazdani M., M. A. Bahmanyar, H. Pirdashti and M. A. Esmaili. 2009. Effect of Phosphate solubilization microorganisms (PSM) and plant growth promoting rhizobacteria (PGPR) on yield and yield components of corn (Zea mays L.). Proc. World Acad. Sci. Eng. Technol., 37: 90•92.
Yu, X., X. Liu, T. H. Zhu, G. H. Liu and C. Mao. 2011. Isolation and characterization of phosphate•solubilizing bacteria from walnut and their effect on growth and phosphorus mobilization. Biol. Fert. Soils, 47: 437446.
Zahir, Z. A., M. Arshad and W. T. Frankenberger. 2004. Plant growth promoting rhizobacteria: application and perspectives in agriculture. Adv. Agron., 81:
96•168.
Zahir, Z. A., A. Munir, H. N. Asghar, B. Shahroona and M. Arshad. 2007. Effectiveness of Rhizobacterium containing ACC•deaminase for growth promotion of pea (Pisum sativum) under drought conditions. J. Microbiol.
Biotechnol., 18: 958•963.
Zahir, Z. A., U. Ghani, M. Naveed, S. M. Nadeem and H. N. Asghar. 2009.
Comparative effectiveness of Pseudomonas and Serratia sp. containing ACC•deaminase for improving growth and yield of wheat (Triticum aestivum L.) under salt•stressed conditions. Arch. Microbiol., 191: 415•424.
Zaidi, A. and M. S. Khan. 2005. Interactive effect of rhizospheric microorganisms on growth, yield and nutrient uptake of wheat. J. Plant Nutr., 28: 20792092. 156
Zaidi, A., M. S. Khan, M. Ahemad and M. Oves. 2009. Plant growth promotion by phosphate solubilizing bacteria. Acta Microbiol. Immunol. Hung., 56: 263284.
Zarrin, F., M. Saleemi, Z. Muhammad, T. Sultan, Aslam, Riaz•Ur• Rehman and C. M. Fayyaz. 2009. Antifungal activities of plant growth promoting rhizobacteria isolates against Rhizoctonia solani in wheat. Afr. J. Biotechnol., 8 (2): 219•225.
Zehnder, G. W., J. F. Murphy, E. J. Sikora and J. W. Kloepper. 2001. Application of rhizobacteria for induced resistance. Eur. J. Plant Pathol., 107: 39•50.
Zhang, F., B. Pan and D. L. Smith. 1997. Application of gibberellic acid to the surface of soybean seed (Glycine max (L.) Merr.) and symbiotic nodulation, plant development, final grain and protein yield under short season conditions. Plant Soil, 188: 329•335. 157
APPENDICES
Appendix 1: ANOVA table for growth of wheat and soybean under growth chamber.
SOV df
Treatment 11 F p≥F F p≥F F p≥F F p≥F
Error 24 15.4 0.000 8.19 0.000 19.6 0.000 15.4 0.000
Total 35
SOV
Treatment 11 F p≥F F p≥F F p≥F F p≥F Error 24 15.4 0.000 11.1 0.000 2.76 0.013 853 0.000 Total 35
158
150
Appendix 2: ANOVA table for growth of wheat and soybean under greenhouse.
SOV df
Treatment 5 F p≥F F p≥F F p≥F F p≥F
Error 12 3260 0.000 201.11 0.000 643 0.000 172 0.000
Total 17 159
Appendix 3: ANOVA table for growth of wheat and soybean under field.
df Replication 2 F p≥F F p≥F F P≥F Treatment 5 14.21 0.0003 12.38 0.0005 36.04 0.000 Error 10
Total 17
Coefficient of variation 1.60% 3.63% 1.52% Soybean field experiment
SOV df Biomass yield Grain yield Total Shoot N
160
Replication 2 F p≥F F p≥F F p≥F Treatment 5 94.61 0.000 12958 0.000 81.14 0.000 Error 10
Total 17
clxi
c l x i