The Role of Pycr1 in the Pathomechanism of Autosomal Recessive Cutis Laxa

vorgelegt von Saniye Sprenger, geborene Yumlu aus Fritzlar

von der Fakultät III – Prozesswissenschaften der Technischen Universität Berlin zur Erlangung des akademischen Grades

Doktor der Ingenieurwissenschaften — Dr.-Ing. —

genehmigte Dissertation

Promotionsausschuss: Vorsitzender: Prof. Dr. Leif-Alexander Garbe, TU-Berlin Gutachter: Prof. Dr. Roland Lauster, TU-Berlin Prof. Dr. Uwe Kornak, Charité, MPI-MG Prof. Dr. Jens Kurreck, TU-Berlin

Tag der wissenschaftlichen Aussprache: 18. Juli 2014 Berlin 2014 D 83 Die vorliegende Arbeit wurde in der Zeit von Januar 2009 bis Juni 2014 am Max-Planck- Institut für Molekulare Genetik sowie am Institut für Medizinische und Humangenetik der Charité Universitätsmedizin unter der Leitung von Prof. Dr. Uwe Kornak und Prof. Dr. Stefan Mundlos angefertigt. Hiermit erkläre ich an Eides Statt, dass die vorliegende Dissertation in allen Teilen von mir selbständig angefertigt wurde und die benutzen Hilfsmittel und Literaturquellen voll- ständig angegeben worden sind. Weiter erkläre ich, dass ich nicht schon anderweitig ein- mal die Promotionsabsicht angemeldet oder ein Promotionseröﬀnungsverfahren beantragt habe. Berlin, den 10.06.2014

...... Saniye Sprenger Contents

1 Introduction 8 1.1 Deﬁnition of cutis laxa ...... 8 1.1.1 Acquired cutis laxa (ACL) ...... 8 1.1.2 Inherited cutis laxa ...... 9 1.2 PYCR1 ...... 15 1.3 The proline cycle ...... 16 1.4 Mitochondria ...... 17 1.4.1 Mitochondrial energy production ...... 18 1.4.2 Mitochondrial reactive oxygen species ...... 19 1.4.3 Mitochondria and apoptosis ...... 20 1.4.4 Mitochondrial morphology ...... 21 1.4.5 Mitochondria and aging ...... 24 1.5 Aims of the study ...... 26

2 Abstract 27

3 Zusammenfassung 29

4 Material 31 4.1 Instruments ...... 31 4.2 Chemicals ...... 32 4.3 Buﬀers ...... 32 4.4 Enzymes ...... 32 4.5 Kits ...... 33 4.6 Plasmids ...... 33 4.7 Antibodies ...... 34 4.8 Bacteria ...... 34 4.9 Primer ...... 35 4.10 Software ...... 39 4.11 Internet resources ...... 39

5 Methods 40 5.1 Molecular Biological Methods ...... 40 5.1.1 DNA Isolation ...... 40 5.1.2 RNA isolation ...... 41

4 5.1.3 Generation of cDNA ...... 42 5.1.4 Polymerase chain reaction (PCR) ...... 42 5.1.5 Sanger sequencing ...... 46 5.1.6 Cloning ...... 46 5.1.7 Southern blot with radioactively labeled probes ...... 48 5.2 Microbiological Methods ...... 49 5.2.1 Preparation of electro-competent E. coli ...... 49 5.2.2 Electroporation of E. coli ...... 50 5.2.3 Bacterial recombination ...... 50 5.3 General Cell Culture Methods ...... 50 5.3.1 Thawing of cells ...... 50 5.3.2 Splitting of cells ...... 50 5.3.3 Cryopreservation of cells ...... 51 5.3.4 Cell number determination ...... 51 5.3.5 Cell transfection ...... 51 5.3.6 Immunocytochemistry (ICC) ...... 51 5.4 ES Cell Culture Methods ...... 52 5.4.1 Preparation of murine embryonic ﬁbroblasts (MEF) ...... 52 5.4.2 Mitotically inactivation of MEFs ...... 52 5.4.3 Cultivation of embryonic stem cells ...... 53 5.4.4 Transfection of ES cells ...... 53 5.4.5 Selection of transfected ES cells ...... 54 5.4.6 Isolation of ES cell colonies ...... 54 5.4.7 Expansion of ES cell colonies ...... 54 5.4.8 Cryopreservation of ES cells in 96-well plates ...... 54 5.4.9 Thawing and expanding ES cells ...... 55 5.4.10 Screening of targeted ES cells ...... 55 5.4.11 Tetraploid aggregation ...... 55 5.5 Biochemical Methods ...... 55 5.5.1 Protein extraction from cultured cells ...... 55 5.5.2 Protein extraction from tissue ...... 56 5.5.3 Determination of protein concentration ...... 56 5.5.4 SDS PAGE ...... 56 5.5.5 Western blot (WB) ...... 57 5.5.6 Determination of ATP concentration ...... 57 5.5.7 Determination of lactate concentration ...... 58 5.5.8 PicoGreen dsDNA Quantitation ...... 58

5 5.5.9 Sample preparation for OXPHOS complex activity determination 58 5.6 Histological Methods ...... 59 5.6.1 Tissue preparation for electron microscopy ...... 59 5.6.2 Paraﬃn embedding and sectioning ...... 59 5.6.3 Cryo embedding and sectioning ...... 59 5.6.4 Methylmethacrylat (MMA) embedding and sectioning ...... 59 5.6.5 Immunhistochemistry (IHC) on paraﬃn embedded tissue ..... 60 5.6.6 Immunhistochemistry on cryo embedded tissue ...... 60 5.6.7 Histological stainings ...... 61 5.7 Radiological Methods ...... 62 5.7.1 MicroCT Analysis ...... 62

6 Results 63 6.1 Expression analysis of Pycr1 in mice ...... 63 6.2 Human and murine PYCR proteins are highly conserved ...... 63 6.3 Generation of the Pycr1 conditional knock out mouse model ...... 66 6.3.1 Strategy for targeting Pycr1 ...... 66 6.3.2 Identification of targeted stem cells ...... 66 6.3.3 Generation of transgenic mice ...... 67 6.3.4 Pycr1 knock out has an efficiency of 100 % ...... 69 6.4 The Pycr1 mouse model reflects major aspects of the human disease . . 71 6.4.1 Pycr1 −/− mice present a skin phenotype ...... 72 6.4.2 Pycr1 −/− mice present a bone phenotype...... 73 6.4.3 Pycr1 −/− mice present a muscular phenotype ...... 78 6.5 Pycr1 deficiency causes mitochondrial dysfunction ...... 86 6.5.1 Pycr1 deficiency causes metabolic changes ...... 86 6.6 Expression and biochemical comparison of PYCR paralogues in men and mice ...... 90 6.6.1 Human and murine PYCR paralogues are similarly expressed in adult tissues ...... 90 6.6.2 Human and murine PYCR proteins are differently post-translationally modified...... 91 6.7 The knock down of Pycr paralogues decreases stress resistance and increases apoptosis ...... 92

7 Discussion 96 7.1 Generation of the Pycr1 knock out model ...... 96

6 7.2 Pycr1 and dermal abnormalities ...... 96 7.3 Pycr1 and bone abnormalities ...... 98 7.4 Pycr1 and muscular abnormalities ...... 100 7.5 Pycr1 and mitochondrial alterations ...... 102 7.6 Pycr1, proline and the mitochondrial redox system ...... 106 7.7 Diﬀerences between human and murine PYCRs ...... 107 7.8 Examples for species diﬀerences in metabolic diseases ...... 109

8 References 111

9 Appendix 126 Acknowledgements ...... 126 List of ﬁgures ...... 129 List of tables ...... 130 Abbreviation ...... 131 List of publications ...... 132

7 1 Introduction

Aging is defined as a gradual change in an organism that leads to an increased risk of weakness, disease and death. As a process, it occurs at the cellular, organic and at the level of the total organism over the entire adult life span. In the course of aging, biological functions and the ability to adapt to stress decline. Overall effects of aging include: decline in memory and cognition; loss of elasticity of the skin; loss of bone mass and; loss of muscle strength [1]. In the course of a lifetime almost all organs undergo a constant remodeling, including formation and degradation of cells and extra cellular material. In healthy and young individuals this remodeling is in a homeostasis, whereas with age and aging-related disorders degradation overwhelms the new formation. Aging-related, or progeroid, disorders are a group of rare genetic syndromes characterized by premature aging. Several monogenic disorders are known to premature cause the hallmarks of aging. Most of the causative genes are encoding DNA repair factors or are affecting the nuclear stability and chromatin structure [2]. In addition, in several animal models of premature aging, mitochondrial dysfunction was reported [2]. Cutis laxa (CL) describes a group of disorders reflecting cardinal symptoms of aging. Understanding the pathomechanism of CL disorders could help towards a better understanding of the mechanisms of aging.

1.1 Deﬁnition of cutis laxa

Cutis laxa, from the Latin meaning lax or loose skin, is an umbrella term describing a heterogeneous group of rare connective tissue disorders associated with abnormalities of elastic fibers, which are important components of the extra cellular matrix (ECM). The connective tissue provides structure and strength to the skin, muscles, joints and inner organs. The most common and obvious characteristic of CL is sagging and inelastic skin. The skin often hangs in loose folds, causing the face and other parts of the body to have a prematurely aged, progeroid, appearance. CL does not only affect the skin, but dependent on the type of the disease, other organ systems, including the skeleton, muscles, neural system, heart, blood vessels, intestines, and lungs may also be affected. CL may be acquired or inherited.

1.1.1 Acquired cutis laxa (ACL)

ACL most often occurs in adulthood and is thought to be associated with various conditions and drugs and is frequently associated with inﬂammatory dermatosis [3]. In some cases of ACL, low lysyl oxidase (LOX) activity and high cathepsin G levels are reported,

8 which indicate impaired formation and enhanced degradation of elastic fibers [4]. Cathep- sin G is a protease involved in connective tissue remodeling at sites of inflammation and the LOX copper enzyme is involved in the maturation of elastic fibers.

1.1.2 Inherited cutis laxa

Congenital CL may be inherited in an autosomal dominant, autosomal recessive or X-linked mode.

1.1.2.1 X-linked cutis laxa (XLCL)

Patients diagnosed with XLCL have a distinct and unique presentation at birth. Be- sides generalized CL they have a characteristic facial appearance with a thinned face, long philtrum, hooked and beaked nose, brittle hair, high forehead and large fontanels. Furthermore, systemic features including cardiovascular, gastrointestinal and skeletal abnormalities are reported. Mutations in ATP7A, encoding for a copper transporter, have been identiﬁed to cause XLCL [5], [6].

1.1.2.2 Autosomal dominant cutis laxa (ADCL)

ADCL becomes apparent at birth or in early childhood with loose and wrinkled skin. It is considered to be a mild form of CL with limited systemic involvement, although associated features are cardiac valve anomalies and hernias. In some cases aortic root dilatation and emphysema have been reported. Disease causing mutations have been identified in genes encoding for elastic fiber components, elastin (ELN) and fibulin5 (FBLN5) [5], [7], [8].

1.1.2.3 Autosomal recessive cutis laxa (ARCL) type 1

The group of ARCL combines several syndromes with heterogeneous organ involvements and severities that are divided in two subtypes. ARCL type 1 is the most severe form of CL, most patients die in childhood from cardiac or respiratory failure. Besides the typical skin phenotype of CL, ARCL1 is often accompanied by lung atelectasis and emphysema, gastrointestinal and genitourinary diverticula as well as vascular anomalies. Also associated are craniofacial anomalies, joint laxity and hip dislocation. In some cases hernias are also described. Although FBLN5, ﬁbulin-like extracellular matrix-protein2 EFEMP2 and latent TGF-beta binding protein4 (LTBP4) have been identiﬁed as causative for ARCL1, the genetic etiologies for the majority of ARCL1 cases are still unknown [5], [9], [10], [11].

9 1.1.2.4 Autosomal recessive cutis laxa type 2 (ARCL2)

Whereas ADCL and ARCL1 are caused by defects in structural extracellular matrix (ECM) proteins, causative genes for ARCL2 have been identified in different metabolic pathways (figure 1). ARCL2 (ARCL2A and ARCL2B) appears to be associated with

Figure 1: ARCL2-associated genes. A, Frequency of mutations in ARCL2-associated genes in our current cohort. From 211 affected individuals 23 % carry mutation in PYCR1, 24 % in ATP6V0A2, 12 % in GORAB and 3 in % ALDH18A1. One patient showed a RIN2 mutation. In 38 % the molecular cause for the ARCL phenotype is not yet identified. Adapted from [12]. B, Location of gene products associated with ARCL2. Adapted from [13]. a spectrum of genetically heterogeneous conditions with variable severity. It is apparent at birth or in early childhood and associated with classical CL phenotype including loose and wrinkled skin and growth and developmental retardation and skeletal anomalies. Intrauterine growth retardation, muscular hypotonia, hip dislocation, pigeon breast, scoliosis, inguinal hernia and flat feet are further common features of ARCL2. Systemic manifestations are usually mild and pulmonary emphysema and cardiac anomalies are rare [5], [13]. In the majority of ARCL2 cases the disease causing genes are unknown (figure 1) [12], however, mutations in genes coding for proteins localized in the Golgi apparatus, endo- somes and mitochondria were identified in recent years [14], [15], [16], [17], [18]. Auto- somal recessive cutis laxa type 2 is subdivided in two groups: ARCL2A with glycosylation defects and ARCL2B without glycosylation defects. Both subtypes share overlapping features with other diseases like De Barsy syndrome (DBS), Wrinkly Skin syndrome (WSS), Gerodermia osteodysplastica (GO) and Macrocephaly, alopecia, CL and scoliosis (MACS). Mutations in the vesicular H + -ATPase (v-ATPase) subunit a2 (ATP6V0A2) have been identified to be causative for ARCL2A with overlapping features of WSS [15]. The v-ATPase is localized in the Golgi apparatus and intracellular vesicles and is involved in protein trafficking and degradation. Mutations in ATP6V0A2 lead to N- and O-linked glycosylation defects. Accumulation of tropoelastin in the Golgi, resulting in disintegration of the Golgi cisternae were described in patients with mutations in ATP6V0A2 [19].

10 Hennies et al. identified mutations in GORAB in patients with GO, which is considered as subform of ARCL2 [14]. Special features of GO are lax and wrinkly skin at the dorsa of hands and feet, osteoporosis with increased risk of bone fractures and jaw hypoplasia. GORAB is a golgin, interacting with RAB6 and involved in intracellular trafficking processes. Defects of glycosylation have not been observed in patients with mutations in GORAB [14]. Macrocephaly, alopecia, cutis laxa and scoliosis (MACS) is a very rare syndrome caused by mutations in the Ras And Rab Interactor 2 (RIN2) gene. The characteristics of MACS besides lax and wrinkled skin include: changes to the facial appearance including coarsening of the face, sagging chin, and thickened lips; mild alterations of serum protein levels and mental retardation. RIN2 is an interactor of RAB5 and involved in endosomal trafficking. It is assumed, that RIN2 deficiency impairs ER-to-Golgi or Golgi-to-plasma membrane trafficking [18], [20]. ARCL2B with overlapping features of DBS and WSS is caused by the dysfunction of two members of the proline biosynthesis cycle (section 1.3), Δ1-pyrroline-5-carboxylate reductase (PYCR1) and Δ1-pyrroline-5-carboxylate synthase (P5CS), that are both localized in mitochondria. The effects of PYCR1 and P5CS deficiency are very similar, however the P5CS phenotype is more severe, presumably due to the existence of PYCR2, a highly identical paralogue of PYCR1.The features of PYCR1-related ARCL are described in the following section. ARCL2B, as a consequence of mutations in ALDH18A1 (P5CS) are characterized by lax and wrinkly skin, microcephaly with neurodegradation, structural brain abnormalities, severe mental retardation and subcapsular cataracts. Furthermore hypotonia, joint laxity, seizures and peripheral neuropathy and dystonic movements of hands and feet are typical [21], [17]. In addition serum parameters are changed in patients suffering from P5CS-related ARCL. Hyperammonemia, hypoprolinaemia as well as lowered levels of intermediates of the urea cycle, ornithine, citrulline and arginine were observed [22]. P5CS catalyses the reduction of glutamate to P5C, a precursor of proline and ornithine (figure 6, section 1.3). Decreased levels of ornithine impair the urea cycle, which in turn leads to lowered serum levels of citrulline, arginine and hyperammonemia. The pathomechanism of a P5CS dysfunction is not fully understood; it is speculated that protein synthesis could be impaired in tissues depending on high endogenous levels of proline. The presence of a proline transporter at axon ends of glutamtergic neurons suggests proline functions as a neurotransmitter [23]. This could explain the severe mental retardation and neurodegradation [13]. Furthermore, it was shown that proline plays a role in oxidative stress regulation [24]. Dysfunction of proline biosynthesis, therefore, could lead to developmental defects through increased oxidative stress [16], [13].

11 1.1.2.5 PYCR1-related autosomal recessive cutis laxa type 2

By homozygous mapping of a cohort of CL patients with unknown genetic background, followed by high throughput sequencing, our group identified PYCR1 as a new disease causing gene for ARCL [16]. To date over 50 cases in more than 30 families with PYCR1- related ARCL have been described [16], [25], [26], [27], [28], [29], [30], [31], [26]. Typical symptoms of PYCR1 caused ARCL are generalized connective tissue weakness with wrinkly and lax skin, most pronounced at the dorsa of hands and feet, as well as translucent skin with visible veins, which was reported in the majority of affected individuals. Patients have a typical facial presentation: a triangular face with progeroid appearance that is due to lax skin and abnormalities of the jaw (figure 2).

Figure 2: Features of PYCR1-related cutis laxa. A, Typical triangular facial appearance. B, Cutis laxa at the dorsum of the hand. C, Cutis laxa and translucent skin at the abdomen. D, Osteopenia at the spine. E - H, Findings in skin biopsy. E and F, Weigert staining reveals sparse, thinned and fragmented elastic fibers in the reticular dermis compared to control F; scale bar: 100 mm. G and H, Ultrastructural analyses shows markedly reduced elastic fiber (arrows) size with a reduction in both the fibrillar and amorphous components compared to control H; scale bar: 500nm. Adapted from [16] and [32].

Further common features are osteopenia, muscular hypotonia, hernias and contrac- tures of the fingers. Patients show mental retardation of variable degree and, aplasia, or hypoplasia of the corpus, callosum was also evident in many cases. More severely affected individuals additionally showed cataracts or dystonic movements. Features of Pycr1-related ARCL usually got milder during the first years of development. Ultrastructural investigation of the skin showed rarefaction and fragmentation of elastic fibers, but not of collagen fibers. PYCR1 deficient patients have no glycosylation abnormalities. Although PYCR1 is a member of the de novo proline biosynthesis pathway

12 (section 1.3), affected individuals show only slightly decreased serum proline levels, but within normal ranges [16]. Furthermore Reversade et al. investigated the mitochondrial network of human adult skin fibroblasts (HAF), since PYCR1 and the proline cycle are localized in mitochondria. Ultrastructural analysis revealed abnormal morphology of mitochondria and their cristae. Moreover the authors could demonstrate that a PYCR1 deficiency increases the sensitivity against oxidative stress in HAFs, resulting in mitochondrial dysfunction. HAF cells carrying mutations in the PYCR1 gene, respond with the fragmentation of the mitochondrial network as well as with the decrease of their mitochondrial membrane potential (MMP) and with increased apoptosis, to moderate H2O2 stress (figure 3) [16].

Figure 3: PYCR1 deficiency increases sensitivity to oxidative stress. A, Loss of PYCR1 causes the collapse of the mitochondrial network upon oxidative stress. Control HAFs and HAFs from patients carrying a Pycr1 mutation were incubated for 5min with 500 μM H2O2. Mitochondria were visualized with 100nM Mito Tracker (Invitrogen). Scale bar, 40μm. B, Mitochondrial membrane potential is reduced in fibroblasts from affected individuals. Control and affected fibroblasts were cultured under standard and oxidative stress conditions with 200 μM H2O2 for 2h in medium without FCS. To determine the mitochondrial membrane potential, cells were incubated with 40nM 3,3’-dihexyloxacarbocyanine iodide (Molecular Probes) for 15min and analyzed on a FACSCalibur cytofluorometer. C, Quantification of apoptotic cell death by TUNEL. HAFs from control and affected individuals showed no differences in apoptosis under normal conditions. Under oxidative stress conditions (10min with 200 μM H2O2 in medium without FCS and subsequent 24h cultivation in medium with 0,4 % FCS) 5-fold more apoptosis was observed in cells from affected individuals. Data are averaged from three independent experiments. Error bars are representing SD.

We could also demonstrate that these cells present increased sensitivity against starva-

13 tion stress. PYCR1 deficient cells treated for 48h with starvation medium (0.5% FCS and no glucose) react with the fragmentation of their mitochondrial network (figure 4). Un- der stress conditions control cells exhibit long, tubular and interconnected mitochondria, whereas mitochondria of patients cells are shorter, appear to be roundish and lose the connections between each other. Fragmentation indicates loss of mitochondrial integrity and dysfunction (section 1.4.4). In HeLa cells the knock down of PYCR1 is sufficient to cause this effect (figure 4).

Figure 4: PYCR1 deficiency increases sensitivity to starvation stress. The loss of PYCR1 causes the collapse of the mitochondrial network upon starvation stress. Control fibroblasts and fibroblasts from affected individuals were incubated for 48h under standard conditions and starvation conditions (no glucose and 0.5 % FCS). Also the knock down of PYCR1 in HeLa cells causes mitochondrial fragmentation. RNAi mediated knock down of PYCR1 for 72h results in the collapse of the mitochondrial network compared to controls. Control cells were transfected with scrambled siRNA. Cells were fixed with 4% PFA and stained with an antibody against PYCR1 in green and MRP L12 in red. Nuclei were visualized with DAPI. Under standard conditions no differences in the fragmentation of the mitochondrial network were observed, whereas under starvation conditions a clear fragmentation can be denoted. Scale bar, 5 μm.

Additionally, morpholino mediated knock down experiments in Xenopus and Zebraﬁsh showed defects in skin development and remarkable increase in cell death in Pycr1 mor- phant skin. 30 disease causing mutation and one deletion of the PYCR1 locus are known to date. Recently, Dimopoulou et al. published a genotype-to-phenotype correlation study of PYCR1-related ARCL cases. The authors described an accumulation of mutations in exons 4, 5, and 6, 84% of the missense mutations observed resided in exons 4 to 6 (ﬁgure 5) [32]. It is supposed that the pathomechanisms of P5CS and PYCR1-related ARCL are very similar, albeit P5CS patients show a hypoprolinaemia. The pathophysiological basis appears to be an impaired mitochondrial function leading to developmental defects

14 through increased apoptosis.

Figure 5: Distribution of ARCL2B causing mutation in the PYCR1 gene. Mutational spectrum of PYCR1 A schematic overview of all known PCYR1 mutations. On top of the exon overview all missense whereas below all other types of mutations are shown. Adapted from [32].

1.2 PYCR1

PYCR1 is an enzyme involved in the do novo biosynthesis of the amino acid (aa) proline and catalyzes the final step by reducing Δ1-pyrroline-5-carboxylate (P5C) to proline in a NAD(P)H dependent manner. Therefore, it has two distinct functions: First to synthesize proline, and second to regulate intracellular redox potential by oxidizing NAD(P)H. It is encoded by the gene PYCR1, localized on chromosome 17q25. Meng et al. demonstrated the structure of human PYCR1 as a decameric architecture consisting of five ho- modimers. N-terminally, the monomers possesses a conserved dinucleotide-binding Ross- mann motif (NAD(P)H binding domain) and at the C-terminus a dimerization domain. The decamer builds a yo-yo shape with a circular groove at the periphery of its structure. The catalytic site, including the NAD(P)H binding and the dimerization domain are localized in this peripheral groove. The center of the PYCR1 decamer is formed by a negatively charged channel [33]. The structures of two bacterial PYCR enzymes have been identified by Nocek, B [34]. PYCR1 and the PYCRs of N. meningitide and S. pyogenes share generally similar monomer structure and dimer architecture, including the Rossmann motif in the N-terminal domain and the dimerization domain at the C terminus. PYCR of N. meningitide is building a homodimer, while S. pyogenes PYCR has also a decameric architecture. This leads to the suggestion that oligomerization varies according to species [33], [34]. In many species, including human and mouse, two other paralogues are existing, PYCR2 (chromosome 1q42) and PYCRL (chromosome 8q24). Whereas PYCR1 (319aa) and PYCR2 (320aa) are very similar to each other (85% homology), PYCRL is 40aa shorter

15 at the C-terminus (including minor parts of the dimerization domain) and shares only 45% sequence homology to the other two isoforms. Beside this structural distinctions PYCRL differs also in functional aspects. While PYCR1 and PYCR2 are mitochondrially localized, PYCRL is a cytoplasmic enzyme. It has been shown, that PYCR1 and PYCR2 synthesize proline from P5C generated either from glutamate or ornithine, whereas PYCRL utilizes P5C generated exclusively from ornithine. Furthermore PYCRL has a higher affinity to NADPH as a cofactor, the other two paralogues prefer NADH [35]. The truncated C- terminus together with the preference of NADPH support the theory of Nocek et al. that PYCRL is more closely related to the ancestral (bacterial) forms of PYCR, that also utilize NADPH and consist of ~280 aa [34], [35]. To date little is known about the function of PYCR2, which makes it difficult to compare functional differences between PYCR1 and PYCR2. DeIngeniis et al. showed evidence for substrate inhibition of only PYCR2 at the lower end of physiological proline concentration range, leading to the suggestion that PYCR1 is the dominant enzyme in human mitochondrial proline biosynthesis [35].

1.3 The proline cycle

Proline is a secondary amine, which makes it unique among the 20 protein forming amino acids. This makes proline not suitable for the usual amino acid metabolizing enzymes. The proline cycle was first described by Strecker et al. [36], [37]. The mitochondrial proline-biosynthesis cycle consists of four core enzymes (firgure6) and requires two other amino acids, glutamate and ornithine. PYCRs reduce Δ1-pyrroline-5-carboxylate (P5C) to proline in a NAD(P)H dependent manner. De Ingeniis et al. found out that mitochondrial PYCR1 and PYCR2 utilize NADH whereas the cytoplasmic PYCRL needs NADPH as co-factor [35]. Proline then is oxidized by proline dehydrogenase (PRODH) back to P5C. This requires the reduction of one molecule FAD to FADH2. P5C is either hydrolyzed from ornithine by the bidirectional enzyme ornithine-δ-aminotransferase (OAT) or it can be reduced in an ATP and NAD(P)H depended manner from glutamate by the enzyme P5C synthase (P5CS). The enzyme P5C dehodrogenase (P5CDH) oxidizes P5C back to glutamate with usage of NAD+. The conversion of arginine to ornithine by arginase links this cycle to the urea cycle and oxidation of glutamate to α-ketogluterate making a connection to the TCA cycle: two important metabolic pathways. Since the proline metabolism is directly connected to the NAD(P)/NAD(P)H redox couple, it additionally functions as a redox shuttle. Proline is involved in the respond to different kinds of stress. In plants, proline is described to act as an osmolyte which increases the osmotic potential when exposed to drought stress. Furthermore, there

16 Figure 6: Proline biosynthesis pathway. P5C: Δ1-pyrroline-5-carboxylate, PYCR: Δ1-pyrroline-5- carboxylate reductase, P5CS: P5C synthase, P5CDH: P5C dehydrogenase, TCA cycle: tricarboxylic acid cycle. Adapted from [36], [38], [39]. is evidence that proline acts as an antioxidant by scavenging reactive oxygen species (ROS). The accumulation of proline as a response to oxidative stress, by increased ROS production, has been shown to protect against oxidative damage in plants, S. cereviseae and mammalian cells [40], [41], [42]. It is suggested that the intracellular accumulation of proline is an adaptive response to stress that enables oxidative stress protection. On the other hand, the degradation of proline by PRODH provokes ROS production and causes oxidative stress [38]. Moreover it has been shown, that PRODH is up regulated in p53 mediated apoptosis [43]. Taking together these ﬁndings, the proline cycle pathway provides more than an amino acid for protein biosynthesis. It serves as a redox shuttle and is involved in apoptosis pathways. Furthermore the proline metabolism is involved in the regulation of redox homeostasis and exhibits dual function as a pro-oxidant via PRODH and as a ROS scav- enger.

1.4 Mitochondria

More than a hundred years ago, mitochondria were ﬁrst identiﬁed and described as bacteria within eukaryotic cells. Later on, in the 1950s, they were recognized as metabolically active energy producing cell organelles [44]. Depending on the energy demand, usually

17 cells contain hundreds or thousands of mitochondria. In many cell types mitochondria are organized in interconnected tubular networks, that are highly dynamic and change their shape by constant fusion and fission events [45], [44]. Mitochondria contain two membranes that are different in their structure and function. The outer membrane (OM) encloses the entire mitochondrium and has a protein-to- phospholipid ratio of 1:1. It contains several transport proteins (porins). The mitochondrial OM is permeable for ions and small molecules up to 5kDa. The mitochondrial inner membrane (IM) is folded and forms so called cristae that increase its surface area. The protein-to-phospholipid ratio of the IM is 4:1 and it is composed to up to 20 % of cardiolipin, which is exclusively found in the IM or in bacterial plasma membranes and makes the IM impermeable for ions. Therefore the IM contains a variety of transport proteins. However, the main component of the IM is the oxidative phosphorylation machinery which is responsible for the adenosine triphosphate (ATP) production. The area between the two membranes, the inter membrane space (IMS), is chemically equivalent to the cytosol with respect to small molecules. The mitochondrial matrix is enclosed by the IM. The matrix contains only selected molecules, including various enzymes, mitochondrial DNA (mtDNAs) and the mitochondrial transcription and translation machinery. Mitochondria house many biochemical pathways, two of these of primary imprtance are the tricarboxylic acid (TCA) cycle and the oxidation of fatty acids. The TCA cycle is essential for aerobic respiration by supplying the majority of NADH and FADH2, required for oxidative phosphorylation (OXPHOS). However, the TCA cycle also provides intermediates for numerous other biochemical processes. Acetyl-CoA is the start point for this cycle, being derived either from pyruvate or the oxidation of fatty acids and amino acids (figure 7) [46], [47].

1.4.1 Mitochondrial energy production

The main function of mitochondria is to produce ATP through the electron transport chain (ETC) and the oxidative phosphorylation system. ATP is the most widely used cellular energy source and organisms must be able to generate a constant supply of this molecule. The OXPHOS system is localized in the IM and consists of ﬁve multimeric enzyme complexes and two electron carriers.

Complex I-IV are oxidreductase complexes that transfer electrons to reduce O2 to H2O and pump protons from the matrix to the IMS. This process primarily utilizes electrons and protons from NADH and FADH2 derived from the metabolism of glucose to CO2 and H2O during the TCA cycle. This causes a disequilibrium of protons between the mitochondrial

18 Figure 7: Mitochondrial structure and the OXPHOS system. A simplified schema of the mitochondrial structure and the OXPHOS system. The shapes with roman numbers illustrate the five complexes. IMS: inter membrane space, TCA cycle: tricarboxylic acid cycle. [46]. matrix and the IMS creating a gradient in both pH and electric charge and establishes an electrochemical potential at the IM. Utilizing this membrane potential, Complex V (F0F1 ATPase) allows the controlled flow back of protons to the matrix, to generate ATP. The OXPHOS process begins with transferring two electrons from NADH to the complex I. The electrons are channeled through the complex and transferred to the electron carrier coenzyme Q. This process results in pumping four protons in the IMS. Complex II transfers two electrons from FADH2 to coenzyme Q but without pumping protons. Re- duced coenzyme Q moves along the IM to complex III. This complex oxidizes coenzyme Q by transferring electrons from it to the second electron carrier involved in the OXPHOS process, the cytochrome c. Each transferred electron results in pumping one proton across the IM. In complex IV electrons from cytochrome c are funneled to the terminal electron acceptor, O2, to form two molecules of H2O. This process drives pumping of two protons per electron that reaches H2O. Protons of the IMS cannot pass directly the IM, they have to use a channel to balance the disequilibrium. The F0 subunit of complex V provides this channel. The movement of protons back to the matrix causes a rotation of the F1 subunit of the ATPase. The physical movement of the F1 subunit is harnessed to form ATP thereby coupling membrane potential generated by the proton pumps to phosphorylation of ADP (figure 7) [46], [47].

1.4.2 Mitochondrial reactive oxygen species

As described above, the ETC is the major source of ATP, however its second function is to generate reactive oxygen species (ROS). One to four percent of the oxygen consumed is

19 converted directly to ROS. The main sites for ROS generation are complex I and III. ROS •− • include superoxide anions (O2 ), hydroxyl free radicals (OH2 ) and hydrogen peroxides

(H2O2), all of them can damage DNA, proteins and lipids and can decrease the mitochondrial membrane potential. To avoid this, many intracellular and intramitochondrial antioxidant enzymes and molecules are available. Cytosolic Cu- and Zn- superoxide dis- •− • mutases (SODs) as well as mitochondrial MnSOD convert (O2 ) and (OH2 )to(H2O2) which is subsequently reduced to water by glutathione peroxidase or catalase [46], [47]. In addition to these enzymes antioxidant function is described for proline, cytochrome c, ubiquinol, vitamin E and the cytochrome c oxidase (COX) [48], [49]. Since Harman postulated the free radical theory of aging in 1950s, ROS were considered as harmful byproducts of the ETC. Oxidative stress results from the imbalance between an excess of ROS generation and antioxidant response. Oxidative stress damages macromolecules and triggers apoptosis. It is implicated in various disease states such as atherosclerosis, diabetes, cancer, neurodegeneration, and aging [50], [51]. However, in the last decade it has become more and more evident that ROS play important roles as signaling factors in many diﬀerent pathways, including, regulation of oxygen sensing, immune response, adrenal steroidogenesis, proliferation, and regeneration processes of a variety of tissues [52] [53].

1.4.3 Mitochondria and apoptosis

Mitochondria provide major parts of energy essential for cell survival, however additionally they have an active role in apoptosis, the programmed cell death [50]. The release of cytochrome c and apoptosis inducing factor (AIF) from the mitochondria to the cytosol activates the formation of the apoptosome, the structure required for activation of Caspase 9 [54], [54]. Cytochrome c binds to the adaptor protein Apaf-1 which subsequently assembles with Caspase 9 to form the apoptosome. The apoptosome processes and activates eﬀector caspases such as Caspase 3 that triggers the cell-death fate [55]. The exact mechanism behind cytochrome c release remains unknown, but there is evidence that several pathways are involved. Firstly, increased generation of ROS causes the decrease of mitochondrial membrane potential and the oxidation of cardiolipin, resulting in opening of unspeciﬁc pores in the IM. This in turn leads to osmotic swelling of the mitochondrial matrix, followed by rup- ture of the OM and release of the mitochondrial content [56]. Secondly, it is known that imbalance of Ca2+ homeostasis triggers the release of cytochrome c. Upon proapoptotic stimuli cytoplasmic cytochrome c binds to certain receptors on the surface of the endo-

20 plasmic reticulum (ER) which stores large amounts of Ca2+. This receptor binding causes the release of Ca2+. The overall increase of Ca2+ imbalances the mitochondrial Ca2+ homeostasis, triggering a massive release of cytochrome c [57], [58]. Thirdly, the mitochondrial outer membrane permeabilization (MOMP) is controlled by the Bcl-2 family. The Bcl-2 family consists of more than 30 proteins, which can be divided into three sub- groups: Bcl-2-like antiapoptotic factors and Bax-like and BH-3-like proapoptotic factors. Cleavage of the proapoptotic Bid into its truncated form (tBid), results in the activation and oligomerization of proapoptotic Bax and Bak in the outer mitochondrial membrane, which in turn causes MOMP. Permeabilization and therefore release of cytochrome c can be inhibited by antiapoptotic proteins like Bcl-2 or Bcl-xL [44]. Therefore, mitochondria play a crucial and active role in apoptosis induction.

1.4.4 Mitochondrial morphology

Mitochondria are highly dynamic cell organelles, steadily changing their shape. The mitochondrial appearance at any given moment in time is only a snapshot of their morphology. Therefore, mitochondria are semi-autonomous organelles whose boundaries are constantly redefined during their lifetime. Mitochondrial morphology is controlled by two opposing processes: mitochondrial fusion and fission. Fusion of mitochondria allows the optimal distribution of mitochondrial components like mtDNA, enzymes and redox equivalents within the mitochondrial network of a cell to optimize their function. Fission enables the segregation of damaged nucleoids or depolarized parts of mitochondria for subsequent mitophagy. Therefore mitochondrial dynamics reflect quality control mechanisms. Chan and Galloway reviewed findings concerning mitochondrial fusion and fission. Within the last decade evidence raised that mitochondrial morphology and function influence each other in both directions [59], [60]. As an example: Bernard et al. demonstrated that inhibition of complex I with the chemical compound rotenone leads to a massive fragmentation of the mitochondrial network [61]. The morphology of the network was restored with recovery of complex I [62]. However, on the contrary, inhibition of mitochondrial fission resulted in deficiencies in respiration and ATP production [63]. These observations indicate that changes in functional states of mitochondria lead to morphological alterations and vice versa. Whereas mitochondrial fission often plays a proapoptotic role, mitochondrial fusion protects cells from cell death. It has been shown that on the one hand, mitochondrial fusion is reduced following induction of apoptosis [64], and on the other hand over expression of fusion factors reduce the level of apoptosis [65]. Furthermore, depletion of fusion factors results in poor cell growth and enhances susceptibility to apoptotic stimuli [65], [66].

21 The key players regulating mitochondrial fusion and fission have been identified. In mammalian cells the highly conserved large GTPases Mitofusin 1 and 2 (Mfn1 and Mfn2) as well as Optic atrophy 1 (OPA1) control the fusion of adjacent mitochondria. Mfn1 and Mfn2 are transmembrane proteins, located at the mitochondrial outer membrane [67], [68]. The cytosolic C termini of both proteins are tethering neighboring mitochondria together by building homotypic or heterotypic complexes in trans [67]. The dynamin-like GTPase OPA1 is required for the fusion of the inner membrane. OPA1 is localized in the matrix and associated with the mitochondrial inner membrane [69]. Several isoforms of OPA1, resulting from alternative splicing and proteolytic processing, are existing. In response to mitochondrial dysfunction through the decrease of the membrane potential, large isoforms of OPA1 are proteolytic processed to small ones. These small isoforms are not capable of initiating the fusion process. As a consequence, fusion of mitochondria is blocked, and due to ongoing mitochondrial fission, dysfunctional parts of mitochondria are segregated from the network of intact mitochondria (figure 8) [70], [71]. The exact mechanism of mitochondrial fusion remains unknown. Mutations in Mfn1 and OPA1 are associated with neurodegenerative diseases [72], [73]. Key players of the mitochondrial fission machinery are Drp1 and Fis1. Fis1 is a small protein that is uniformly localized to the outer membrane of mitochondria through its C-terminal transmembrane domain, most of the protein faces the cytosol. Drp1 is a dynamin-like GTPase localized in the cytosol and to punctate spots on mitochondrial surface. Subsets of these spots mark future sites of fission [74]. The exact mechanism of mitochondrial fission remains unsolved yet, but it is known that cytosolic Drp1 is recruited to constricted areas of the mitochondrial tubes; the fission sites. At these constriction sites, Drp1, most likely binds to Fis1 and assembles into spirals around the mitochondrial tubes [75]. The recruitment and activation of Drp1 is depended on a subset of post translational modifications, such as sumolysation, ubiquitination and phosphorylation (figure 8) [76] [77].

1.4.4.1 Mitochondrial morphology and apoptosis

Imbalances of mitochondrial fusion and ﬁssion processes, resulting in fragmentation, have been linked to apoptotic cell death and apoptosis has been linked to morphological changes of the mitochondrial network [78]. However, fragmentation of mitochondria does not necessarily indicate apoptosis. Frank et al. demonstrated that induction of apoptosis causes the fragmentation of the mitochondrial network in a Drp1 depended manner [79]. In turn, the over expression of a dominant negative form of Drp1 (Drp1K38A) prevented the release of cytochrome c and

22 Figure 8: Schematic overview of mitochondrial fusion and fission. A, Schema of mitochondrial tethering prior fusion. Mfn1 and Mfn2 are localized at the mitochondrial outer membrane. The cytosolic HR2 domains (brown cylinders) of Mfns of two adjacent mitochondria are interacting heterotypic or homotypic and tether the two mitochondria together. OPA1 (purple ovals) are localized in the inter membrane space and associated to the inner membrane. Fusion of the inner membranes is mediated by OPA1. B, Schema of mitochondrial fission. Fis1 (red rectangles) resides uniformly at the outer membrane with most of its structure facing the cytosol. Drp1 (green ovals) exists both in the cytosol and on mitochondria in punctate spots, most likely in contact with Fis1. i, Initial constriction of the tubular mitochondria is independent from Drp1 and Fis1. However, a portion of the Drp1 sites mark future constriction sites. ii, In the course of fission, cytosolic Drp1 is recruited to the fission sites and assembles into spirals around the mitochondria and probably further constricts the mitochondrial tubule to mediate membrane fission. iii, After fission is completed, the Drp1 complex is localized to the end of one of the daughter mitochondria prior to disassembly. Modified from [59]. therefore the initiation of the mitochondrial apoptosis pathway [79]. Furthermore, it has been demonstrated, that Drp1, Mfn2 and the proapoptotic protein Bax mediate the mitochondrial outer membrane permeabilization (MOMP) and cytochrome c release [64]. It has been suggested, that Bax translocates to mitochondrial fission sites marked by the presence of Drp1 [80]. Additionally, Karbowski et al. proposed an accumulation of Mfn2 at these foci mediates Bax-induced MOMP [64]. Moreover, it was demonstrated that Fis1, which plays a key role in mitochondrial and peroxisomal fission, induces apoptosis independently from Bax or Bak. Fis1 interacts with Bap31 an integral membrane protein at the outer ER membrane promoting vesicular trafficking. This interaction promotes the Ca2+ release from ER and triggers mitochondrial

23 cytochrome c flux, triggering apoptosis [81], [82]. Whereas mitochondrial fission often plays a proapoptotic role, mitochondrial fusion protects cells from cell death. It has been shown that on the one hand, mitochondrial fusion is reduced following induction of apoptosis [64], and on the other hand over expression of fusion factors reduce the level of apoptosis [65]. Furthermore, depletion of fusion factors results in poor cell growth and enhances susceptibility to apoptotic stimuli [65], [66]. To- gether these findings demonstrate, that mitochondrial fusion and fission is involved in life and death decisions of cells.

1.4.5 Mitochondria and aging

Aging is defined as a progressive, generalized impairment of function resulting in an increased susceptibility to environmental stress and increases in the risk of disease and death. Aging is considered to be a major risk factor for many of the diseases affecting modern societies including cardiovascular conditions, cancer and neurodegenerative diseases. The free radical theory of aging postulated in the 1950s by Denham Harman is still a popular explanation for the process of aging, although this theory is discussed contro- versially [83]. The initial theory suggested that aging, as well as associated degenerative diseases, could be attributed to the deleterious effects of ROS. Accumulation of oxidative damage to DNA, proteins and lipids in the course of life was suggested to lead to aging processes. The main source of ROS is the mitochondrial OXPHOS. Increased oxidative damage in mitochondria decreases the mitochondrial membrane potential, resulting in a vicious cycle between mitochondrial dysfunction and ROS generation. It has been shown that ROS detoxification enzymes like superoxide dismutases (SODs) and catalases reduce their activity in the course of life, leading to an accumulation of oxidative damage [84]. In accordance to the theory, altered mitochondrial function with decreased respiratory capacity, decreased oxidative phosphorylation and increased concentrations of ROS are reported to be associated with age [84]. Furthermore expression pattern of genes involved in mitochondrial energy metabolism decline with age in many different species [85], [86]. Additionally, different laboratories demonstrated that over expression of ROS detoxifying MnSOD in D. melanogaster and mitochondrial catalases in mice extended life span and reduced ROS [87], [88]. As mentioned before, the free radical theory of aging is not without controversy. Van Raamsdonk and colleague demonstrated that the deletion of mitochondrial MnSOD in D. melanogaster also extents life span, but increases ROS generation [89]. Furthermore Trifunovic et al. demonstrated that mitochondrial DNA polymerase with defective proof

24 reading activity increase in somatic mtDNA mutations, resulting in reduced lifespan and premature onset of aging phenotypes such as weight loss, reduced subcutaneous fat and osteoporosis, but interestingly without increasing the ROS production [90]. Recently, It- sara and colleagues demonstrated in D. melagonaster that mutations in somatic mtDNA accelerates the process of aging and the generation of ROS. They furthermore demonstrated that the majority of mutations in mtDNA results from rather from replication defects than from oxidative damage [91]. These ﬁndings question Harman’s free radical theory of aging and require a diﬀerent point of view concerning the role of mitochondrial ROS formation. Although oxidative damage contributes to the processes of aging, the relation between aging and ROS remains complex.

25 1.5 Aims of the study

PYCR1-related autosomal recessive cutis laxa (ARCL) is a rare genetic disorder characterized by lax and wrinkly skin, especially at the dorsa of hands and feet and the abdomen, intrauterine growth retardation, osteopenia and muscular hypotonia. PYCR1 is a highly conserved mitochondrial enzyme, catalyzing the final step in the proline de novo biosynthesis. In many species, including man and mice, two further paralogues, PYCR2 and PYCRL exist. In previous studies, our group demonstrated that a deficiency of PYCR1 in human skin fibroblasts decreases the mitochondrial stress resistance. Upon oxidative stress, the mitochondrial membrane potential declines, resulting in fragmentation of the mitochondrial network and apoptosis. However, the role of PYCR1 in the pathogenesis of PYCR1-related ARCL remains unclear. The aim of this study was to gain further insights into the function of PYCR1. Animal models are widely used and promising tools to study human genetic disorders. On this account, the first aim was to generate a Pycr1 knock out mouse model. The second aim was to characterize the phenotypic outcome of a loss of this gene with histological, radiological and molecular biological methods. Characterization of tissues presenting the cardinal symptoms that is skin and the musculoskeletal system was in the main focus. Depending on the results of the characterization, the third aim was to shed light on the mechanisms underlying the phenotypes. And finally, with in vitro experiments using Pycr1 deficient and control murine embryonic fibroblasts (MEFs) as well as applying RNAi mediated knock down of Pycr1 and its paralogue Pycr2, it was aimed to enlighten physiological functions of murine Pycrs and find similarities and differences between their human orthologues.

26 2 Abstract

Cutis laxa is an umbrella term for several disorders having in common lax and wrinkled skin most likely due to rarefaction of elastic fibers in the connective tissues. Autosomal recessive cutis laxa (ARCL) with progeroid features caused by mutations in PYCR1 is mainly characterized by intrauterine growth retardation, connective tissue weakness, reduced bone mass, muscular hypotonia and mental retardation of variable degree, leading to an overall progeroid appearance. PYCR1 is an enzyme catalyzing the final step of de novo proline synthesis and was shown to be localized within mitochondria. In many species, including human and mouse, two further paralogues, PYCR2 and PYCRL exist. In order to gain further insight into the PYCR1-related ARCL pathomechnism a constitutive knock out mouse line for Pycr1 (Pycr1 −/−) was generated. The characterization of this mouse model revealed that it reflects major aspects of the human disease. Histological analyses of the skin showed a hypoplasia of the dermis. This was most prominent in eight weeks old mice where the dermal layer was significantly thinner than in control mice. Furthermore, Pycr1-deficient animals demonstrated a mild form of osteopenia with reduced trabecular bone volume and trabecular number compared to controls. This was most obvious in four weeks old mice and declined with age. In tibiae of four weeks old Pycr1 deficient mice the number of osteocytes is reduced and differentiation defects are present. Coherently, marker genes for late osteoblastic and osteocytic differentiation are down regulated in this tissue. Moreover, it was found that the number of bone resorbing osteoclasts is decreased. Contrary, the osteoclast differentiation and activation factor RankL was significantly up regulated in enriched osteoblastic fractions of tibiae from Pycr1 −/− mice, whereas the expression of its antagonist Opg remains unchanged. Beside an altered skin and bone morphology, a disproportion of muscle fiber types was evident in Pycr1 deficient mice, most pronounced in four weeks old animals and declining with age. The number of mitochondrial rich type I fibers was significantly increased. A tendency of up regulation of myocyte enhancer factor-2 (Mef2) transcription factor genes was observed in Pycr1 deficient muscles compared to control ones.The Mef2 transcription factor family has a large impact on fiber type determination and transition of glycolytic type II fibers to oxidative type I fibers. In in vitro assays it could be demonstrated, that Pycr1 deficient murine embryonic fibroblasts (MEFs) constitute a partial fragmentation of the mitochondrial network, compared to wild type MEFs. Increased concentrations of lactate produced by cultured Pycr1 deficient MEFs indicates elevated glycolytic activity, which in turn indicates impaired res-

27 piration caused by deficiency of Pycr1. Furthermore, in knock down experiments, using RNA interference against the Pycr1 paralogue Pycr2, it could be shown that the down regulation of the paralogue Pycr2 has a more pronounced effect on the fragmentation of the mitochondrial network and induction of apoptosis than the knock down of Pycr1. Interestingly, the protein size of human PYCR1 is bigger than PYCR2 in immunoblot. This difference is also present between the mouse proteins, but in an inverted fashion. Taking together these findings, the Pycr1 knock out mouse model reflects major aspects of PYCR1-related ARCL, but in a milder form. Despite a high evolutionary conservation the function of Pycr1 seems to differ among vertebrate species. Combined with the observation, that the proportion of human and murine Pycr paralogues protein sizes are inverted, indicate species differences between the function of human and murine Pycrs.

28 3 Zusammenfassung

Cutis laxa ist ein Sammelbegriff für eine heterogene Gruppe von Erkrankungen des Bin- degewebes, gekennzeichnet durch eine Verminderung der elastischen Fasern. Eine Unter- form der autosomal rezessiven cutis laxa (ARCL) wird hervorgerufen durch Mutationen in pyrroline-5-carboxylate reductase 1 (PYCR1). PYCR1 ist ein Enzym des Prolinbiosynthese Zyklus und ist in Mitochondrien lokalisiert. In vielen Spezies existieren zwei weitere Paraloge, PYCR2 und PYCRL. Um das Verständnis der Funktion von Pycr1 zu vertiefen, wurde im Rahmen dieser Arbeit zunächst ein Mausmodel erstellt. Die Charakterisierung des konstitutiven Pycr1 knock outs (Pycr1-/-) zeigte, dass dieses Mausmodel die Kardinalsymptome der PYCR1- assoziierten ARCL widerspiegelt. Histologische Untersuchungen zeigten eine Hypoplasie der Dermis, welche am stärksten bei acht Wochen alten Tieren ausgeprägt ist. Pycr1 defiziente Tiere haben eine signifikant verringerte Dicke der Dermis. Des Wei- teren weisen Pycr1 defiziente Tiere eine milde Form der Osteopenie in Röhrenknochen auf, welche mit einer Reduktion des trabekulären Knochenvolumens sowie der Anzahl der Trabekel einhergeht. Der Osteopeniephänotyp ist am deutlichsten bei vier Wochen alten Tieren ausgeprägt und nimmt mit dem Alter ab. Weiterhin konnte gezeigt werden, dass die Anzahl der Osteozyten im corticalen Knochen reduziert ist sowie, dass die Osteo- zyten Pycr1 defizienter Tiere Merkmale einer gestörten terminalen Differenzierung ausf- weisen. Diese Vermutung wird gestützt durch Expressionsanalysen von Markergenen der Osteoblasten- und Osteozytendifferenzierung. Auch die Anzahl der knochenabbauenden Osteoklasten ist vermindert. Interessanterweise, wurde jedoch gezeigt, dass die Expression von Rankl, einem Faktor welcher die Differenzierung und Aktivierung von Osteoklasten bewirkt, in Pycr1 defizienten Knochen herauf reguliert ist, wobei die Expression von Opg, dem Antagonisten von RankL unverändert bleibt. Zusätzlich zu den Veränderungen in der Haut und im Knochen wurde in Muskelbiop- taten von Pycr1 defizienten Tieren ein Missverhältnis der Muskelfasertypen festgestellt, welche am prägnantesten bei vier Wochen alten Tieren manifestiert ist und mit dem Alter abnimmt. Im Vergleich zu Kontrolltieren, weisen Tiere mit einer Pycr1 Defizienz deutlich mehr Typ I Muskelfasern auf. Darüber hinaus wurde die Tendenz festgestellt, dass die Mitglieder der Myozyten Enhancer Faktor 2 (Mef2) Transkriptionsfaktor Famile hoch reguliert sind. Die Mef2 Transkriptionsfaktoren spielt eine wichtige Rolle bei der Determi- nierung von oxidativen Typ I Fasern und der Transition von glykolytischen Typ II Fasern zu Typ I Fasern. Mit Hilfe von in vitro Experimenten konnte des Weiteren gezeigt werden, dass der

29 Verlust von Pycr1 in murinen embryonalen Fibroblasten (MEFs) zu einer partiellen Frag- mentierung des mitochondrialen Netzwerkes führt. Deutlich erhöhte Laktatwerte in Pycr1 deﬁzienten MEFs, im Vergleich zu Kontrollzellen, deuten auf eine gesteigerte glycolytische Aktivität hin, was wiederum auf eine Verminderung der Zellatmung schließen lässt. Zusätzlich zeigte sich mittels knock down Experimenten, dass eine Verminderung des Paraloges Pycr2 einen stärkeren Eﬀekt auf Veränderungen des mitochondrialen Netzwer- kes und apoptosevermittelten Zelltod hat als eine Verminderung von Pycr1. Interessanter- weise, zeigte sich im Vergleich von humanem und murinen PYCRs ein Größenunterschied zwischen beiden Paralogen, der in der Maus umgekehrt ist. Die beschriebenen Ergebnisse verdeutlichen, dass das Pycr1 knock out Model die Kardi- nalsymtome der PYCR1-assoziierten ARCL widerspiegelt, jedoch in einer milderen Form. Trotz der hohen evolutionären Konservierung von Pycr1 scheint es funktionelle Unter- schiede in verschiedenen Spezies der Wirbeltiere zu geben. Diese Ergebnisse, zusammen mit der Beobachtung eines umgekehrten Größenverhältnisses von humanen und murinen Pycr Paralogen, deutet auf einen Speziesunterschied in der Funktion von humanen und murinen Pycr Proteinen hin.

30 4 Material

4.1 Instruments

Table 1: Centrifuges

Name Supplier Microtiter plate centrifuge 5416 Eppendorf Micro centrifuge 5415 D Eppendorf Chilling centrifuge 5417 R Eppendorf Chilling centrifuge Sorvall RC-5 Thermo Electron

Table 2: Thermo cyclers

Name Supplier GeneAmp PCR System 2700 Applied Biosystems GeneAmp PCR System 2720 Applied Biosystems GeneAmp PCR System 9700 Applied Biosystems ABIPrism HT 7900 Real-time Cycler Applied Biosystems

Table 3: Microscopy

Name Supplier Microscope DMR Leica Camera AxioCam HRc Zeiss Microscope Axiovert 200M Zeiss Camera AxioCam MRm Zeiss Stereo microscope MZ6 Leica Stereo microscope MZ7-5 Leica Light source KL1500 LCD Leica LSM700 Zeiss

31 Table 4: Histology

Name Supplier Microtome Cool Cut HM355S Microm Microtome 2050 Supercut Reichert-Jung Cryotome H560 Microm Embedding station EC 350-1&2 Microm Dehydration stationTP 1020 Leica

Table 5: Other instruments

Name Supplier BioRobot M48 workstation Qiagen Imaging system Curix 60 Agfa Luminometer MicroBeta TriLux 1450 Wallac Plate reader Spectra Max 250 Molecular Devices Nanodrop Thermo Scientiﬁc Bioruptor UCD-300 Diagenode

4.2 Chemicals

Unless denoted otherwise, all chemicals were supplied by Merck (Darmstadt), Sigma- Aldrich (Deisenhofen) and Roth (Karlsruhe).

4.3 Buﬀers

If not mentioned otherwise, all solutions were prepared according to Sambrook, et al. 2001

4.4 Enzymes

Restriction enzymes, ligase, polymerases and other DNA modifying enzymes were purchased from MBI Fermentas.

32 4.5 Kits

Table 6: Kits

Name Supplier NucleoSpin Plasmid Macherey-Nagel Nucleobond PC100 Macherey-Nagel NucleoSpin Gel and PCR Clean-up Macherey-Nagel TaqMan Reverse Transcription Reagents Roche/Applied Biosystems BigDye Terminator v3.1 Sequencing Kit Applied Biosystems BCA Protein Assay Kit Pierce RNAeasy-Kit Qiagen Vectastain IgG Mouse ABC Kit Biozol Peroxidase Substrate Kit DAB SK-4100 Vector Laboratories MagAttract DNA Blood Mini Kit Qiagen ATPlite Luminescence Assay System PerkinElmer Lactate Colorimetric Assay BioVision PicoGreen dsDNA quantitation assay life Technologies SYBR Green qPCR Master Mix life Technologies siRNA Pycr1 D-053702-04-0005 Thermo Scientiﬁc siRNA Pycr2 D-062454-04-0005 Thermo Scientiﬁc Human MTC Panel I Clonetech

4.6 Plasmids

Table 7: Vectors, expression constructs and bacs

Name Application Supplier pDTA generation of targeting vector Prof. Carmen Birchmeier (MDC, Berlin) pHW025 generation of targeting vector Prof. Carmen Birchmeier (MDC, Berlin) pCMAFlag5a expression of Flag tagged proteins Sigma Aldrich pTAgfp sub cloning of PCR products Dr. Jochen Hecht (MPIMG, Berlin) BMQ 30L18 generation of targeting vector Sanger resources

33 4.7 Antibodies

Table 8: Antibodies

Name Host Supplier primary antibodies anti-PYCR1 rabbit PtgLabs anti-Myosin (slow) mouse Sigma-Aldrich anti-Cytochrome c mouse Cell Signaling anti-cleaved Caspase3 rabbit Cell Signaling anti-Cyclophilin mouse Abcam anti-Gapdh goat Abcam secondary antibodies Alexa Fluor 488 anti rabbit goat life Technologies Alexa Fluor 546 anti mouse goat life Technologies anti-mouse IgG HRP conjugate goat Millipore anti-rabbit IgG HRP conjugate goat Millipore anti-goat IgG HRP conjugate donkey Millipore

4.8 Bacteria

Table 9: Bacterial strains

Name Application Supplier E. coli Top10 cloning Invitrogen E. coli DH10B cloning Invitrogen E. coli Dy380 recombination Prof. Carmen Birchmeier (MDC, Berlin) E. coli EL250 recombination and expression of ﬂp re- Prof. Carmen Birchmeier combinase (MDC, Berlin) E. coli EL350 recombination and expression of Prof. Carmen Birchmeier cre recombinase (MDC, Berlin)

34 4.9 Primer

All primer were purchased as HPSF puriﬁed products from Euroﬁns MWG (Ebersberg) and designed with the online software Primer3 (http://primer3.ut.ee/).

Table 10: Primer for Pycr1 cKO targeting construct

Primer name Primer sequence 5’ –> 3’ RecA_F-SalI gacGTCGACTCTTCGCAGGACTCCTCTTC RecA_R-HindIII AGCGCTAAGCTTTAGGAGCA RecB_F-HindIII TGTAGCTAAGCTTTGCTGCT RecB_R-XbaI TTGGTTGGTTCTAGATCTCA RecC_F-SalI-ScaI gacGTCGACgacAGTACTTTTTGCTGCACACCTGACTC RecC_R-BcII-HindIII gacAAGCTTCCATGATCATCACCCTAGCC RecD_F-NotI gacGCGGCCGCGCCAGGATTTTCAGGCTAAG RecD_R-SacI gacGAGCTCTGGAATAGGTCCCCTTTGAA RecE_F-XhoI gacCTCGAGAGGTACCACTGAGCCCTGTC RecE_R-EcoRI gacGAATTCCCTGGGAAAGGTCATGAAGA RecF_F-NotI gacGCGGCCGCCATGTCCAGGTCCCTCTGTT RecF_R-SacII gacCCGCGGATACAGCTGCAAGGCCACTT

Table 11: Standard cloning primer

Primer name Primer sequence 5’ –> 3’ T3 Promoter TAATACGACTCACTATAGGG T7 Promoter CATTTAGGTGACACTATAG Sp6 Promoter AATTAACCCTCACTAAAGGG

Table 12: Primer for southern blot probes

Primer name Primer sequence 5’ –> 3’ 5’Probe_F GCGAGCCCCTACTCTCTGTT 5’Probe_R GAAGGCTGCTGTGAAGTTGC 3’Probe_F ATCCGGGGTCGTGTTTAAGT 3’Probe_R GGGACATCCCTTAGCACAAA

35 Table 13: Primer embryonic stem cell screening

Primer name Primer sequence 5’ –> 3’ mPycr1_copy_F1 GGCCTAGCACCTTCTTCATGA mPycr1_copy_R1 GGACCTGGACATGTTTCACTCA mPycr1_copy_F2 GACAGCTTGTGAGCAGCAAGAT mPycr1_copy_R2 CTTGGCTCTGCTTTACACTAACAGA mAlbumin_F CTGCAATCCTGAACCGTGT mAlbumin_R TTCCACCAGGGATCCACTAC mF8_EX8_F AAATTCGCTCGGTTGCTAAA mF8_EX8_R TGAAGGTGCATAGTCCCAGTC

Table 14: Primer for genotyping

Primer name Primer sequence 5’ –> 3’ Pycr1-wt_F GGATGACACAGTTTCTGTTTGG Pycr1-wt_R AGCCAGGAAGAGCACATCAC Pycr1-ﬂox_F CCATCGGTTCCATAACTTCG Pycr1-ﬂox_R AAGCTGAGAGCCCTGTGTGT Pycr1-excis_F TTTTGCTGCACACCTGACTC Pycr1-excis_R GCCTTGGCTCTGCTTTACAC Cre_F GAGTGATGAGGTTCGCAAGA Cre_R CTACACCAGAGACGGAAATC

Table 15: Primer for overexpression constructs

Primer name Primer sequence 5’ –> 3’ mCMVPy1-NotI_F TCATATGCGGCCGCTCCAGACATGAGCGTAGGCTT CAT mCMVPy1-SalI_R CTGTATGTCGACGGGCAGTGGCTTGACAT mCMVPy2-NotI_F TCATATGCGGCCGCTGCGGCCATGAGCGTGGGT mCMVPy2-SalI_R CTGTATGTCGACCTCCTTCTTGCTTCCCTGGGC

36 Table 16: Primer for mtDNA copy number determination

Primer name Primer sequence 5’ –> 3’ mtDNA:mCO1_F TGCTAGCCGCAGGCATTAC mtDNA:mCO1_R GGGTGCCCAAAGAATCAGAAC gDNA:mNDUVF1_F CTTCCCCACTGGCCTCAAG gDNA:mNDUVF1_R CCAAAACCCAGTGATCCAGC

Table 17: Primer for expression proﬁling of human genes

Primer name Primer sequence 5’ –> 3’ qhGapdh_F CTGGTAAAGTGGATATTGTTGCCAT qhGapdh_R TGGAATCATATTGGAACATGTAAAC qhPycr1_San_F1 CAGTTTCTGCTCTCAGGAAG qhPycr1_San_R1 GCTGACAGCTTCTTCTCAAT qhPycr2_San_F1 CTGTCGGCTCACAAGATAA qhPycr2_San_R1 GATGAAGGGGATGATATGTG

37 Table 18: Primer for expression proﬁling of murine genes

Primer name Primer sequence 5’ –> 3’ qmAktin_F CTGTATTCCCCTCCATCGTG qmAktin_R GGAGAGCATAGCCCTCGTAG qmGapdh_F AACTTTGGCATTGTGGAAGG qmGapdh_R CAGTCTTCTGGGTGGCAGTG qmPycr1_F AGACATGGACCAAGCTACGG qmPycr1_R ACGCTGTCAGCTTCTTTTCG qmPycr2_F GGAGGATGGGTGTGAATCTG qmPycr2_R GCCATCAGCTTCTTCTCCAC qmMyosin2_F AAGCGAAGAGTAAGGCTGTC qmMyosin2_R CTTGCAAAGGAACTTGGGCTC qmMyosin7_F GCAGCAGGTGGATGATCTGGAGG qmMyosin7_R GCTGACTGCCCAGGGCTTGC qmSOD1_F AGGGAACCATCCACTTCGAG qmSOD1_R TGCTGGCCTTCAGTTAATCC qmSOD2_F CCGAGGAGAAGTACCACGAG qmSOD2_R ATATGTCCCCCACCATTGAA qmGpx1_F CAGAAGCGTCTGGGACCTC qmGpx1_R TCGGACGTACTTGAGGGAAT qmMef2a_F AACGAGCCTCATGAAAGCAG qmMef2a_R AGCATCAGGGCTCTCACAAC qmMef2b_F TCTGGGTAGCTTTGCCTTCT qmMef2b_R GTCTACAGCGTCCCTCGTTG qmMef2d_F CAGCGAATCACTGATGAACG qmMef2d_R AGCACACTCAGCTCGTAGGC qmBglap_F CCTGGCTGCGCTCTGTCT qmBglap_R TGCTTGGACATGAAGGCTTTG qmCol1a1_F TGTTCAGCTTTGTGGACCTC qmCol1a1_R TCAAGCATACCTCGGGTTTC qmCol1a2_F TGCTCAGCTTTGTGGATACG qmCol1a2_R GGGACCATCAACACCATCTC Fgf23_F TGGGCACTGCTAGAGCCTAT Fgf23_R TGGCTCCTGTTATCACCACA qmRankL_F GTACGCCAACATTTGCTTTCG qmRankL_R GTAGGTACGCTTCCCGATGTTT qmOpg_F ATGAACAAGTGGCTGTGCTG qmOpg_R TCTTCCTCCTCACTGTGCAG qmOsx_F GAGGCCTTTCGTCTGCAACT qmOsx_R TTCTTCTCCCGGGTGTGAGT qmSost_F AGACCTCCCCACCATCCCTAT qmSost_R TGTCAGGAAGCGGGTGTAGTG qmSpp1_F TGGTGCCTGACCCATCTCA qmSpp1_R TTCATTGGAATTGCTTGGAAGA

38 4.10 Software

Table 19: Software

Name Application Microsoft Oﬃce Data analysis, text processing CorelDraw Image processing Photoshop Image processing Axio Vision Digital photography SDS qPCR analysis SkyScan software package μCT analysis DNA Star Seqman Sequence analysis CloneManager Sequence analysis ImageJ Image analysis

4.11 Internet resources

Table 20: Internet resources

Resource Address UCSC Genome Browser http://genome.ucsc.edu/ NCBI http://www.ncbi.nlm.nih.gov/ Ensembl Genome Browser http://www.ensembl.org/index.html Genestream www.xylian.igh.cnrs.fr SMART http://smart.embl- heidelberg.de T-Coffee http://tcoffee.crg.cat/apps/tcoffee/do:regular Boxshade www.ch.embnet.org

39 5 Methods

5.1 Molecular Biological Methods

All classical molecular biological or microbiological experiments not described in this section were performed according to the handbooks "Molecular Cloning: A Laboratory Manual" (Sambrook, et al., 2012).

5.1.1 DNA Isolation

5.1.1.1 Isolation of Plasmid-DNA

Depending on the amount needed, plasmid-DNA was isolated with the NucleoSpin Plasmid Mini Kit (Machery and Nagel, small scale) or the Nucleobond PC100 kit (Machery and Nagel, medium scale) according to the manufacturer’s speciﬁcations.

5.1.1.2 Isolation of BAC-DNA

2ml bacterial culture was centrifuged to harvest the cells. The pellet was resuspended in 0.2ml cold, fresh-made GTE. Lysis was performed by adding 0.2ml BAC-lysis-buﬀer, gently inverting the tube and incubation of 5min at RT. After neutralization with 0.2ml 3 M KAc, pH 4.8, tubes were again gently inverted and 5min incubated on ice. The lysates were centrifuged at top speed for 6min at 4℃ . Supernatants were transferred into fresh pre-chilled tubes containing 1.4ml ice-cold EtOH. DNA was precipitated 15min on ice and pelleted by centrifugation at top speed for 30sec. The DNA was washed twice with

500 μl cold 70% EtOH prior dissolving the BAC-DNA in an appropriate amount of ddH2O.

GTE-buﬀer: 10% Glucose, 10 mM EDTA; pH 8, 30 mM Tris; pH 8 BAC-lysis-buﬀer: 0.1 M NaOH, 1% SDS

5.1.1.3 Isolation of Genomic DNA

Isolation of genomic DNA was necessary for determination of animal genotypes, ES cell screening and mtDNA copy number determination. These applications require varying levels of DNA purity and diﬀerent isolation protocols.

Genomic DNA isolation for genotyping and cloning (low purity)

40 For genotyping purposes, animal biopsies were digested overnight in 0.5ml SDS-buﬀer with 200 μg/ml proteinase K at 55℃ . The following day, 0.25ml 5M NaCl was added and incubated 10min on a rocker at RT. The samples were subsequently placed on ice for 10min, before spinning them for 10min at 8000rpm and 4℃ . 500 μl supernatant were transferred into a new tube and 1ml ice-cold ethanol was added. Samples were centrifuged again for 10min at 13000rpm and 4℃ and the supernatant was discarded. The pellet was washed twice with 70% EtOH prior to dissolving the genomic DNA in an appropriate amount of ddH2O.

SDS-buﬀer: 0.85% SDS, 17 mM EDTA; pH 8, 170 mM NaCl, 17 mM Tris; pH 7.5

Genomic DNA isolation for ES cell screening (high purity)

For ES cell screening, cells were plated on 96-well plates. The cells were twice washed with DPBS (Lonza) and lysed with ES cell lysis buﬀer. DNA isolation was performed automated with the MagAttract DNA Mini Kit M48 (Qiagen) kit and the GenoMTM-48 pipetting DNA extraction robot according to the manufacturer’s protocol.

ES cell lysis buﬀer: 1% SDS, 100 mM EDTA, 100 mM NaCl, 50 mM Tris; pH 7.4

Genomic DNA isolation for mtDNA copy number determination (high purity)

For mtDNA copy number determination, DNA was isolated either from muscle biopsies or MEFs. DNA was isolated with the Wizard Genomic DNA puriﬁcations kit (Promega) according to the manufacturer’s protocol.

5.1.2 RNA isolation

Total RNA was extracted with peqGold TriFast (peqLab) according to speciﬁcations of the manufacturer.

5.1.2.1 Total RNA isolation from cells

Cells were lysed direct in the wells with 600 μl TriFast per 6-well. After an incubation for 10min at RT lysates were transferred in 1.5ml test tube. 0.2ml chlorophorme per ml TriFast were added. After a second incubation for 10min at RT the tubes were

41 centrifuged for 15min at 4℃ and 1300rpm. The aqueous supernatant were transferred to new test tubes and precipitated with isopropanole. After two washing steps with 70%

EtOH (diluted with DEPC H2O) the pellets were dried and dissolved in DEPC H2O. The RNA was stored at -80℃ until further use.

5.1.2.2 Total RNA isolation tissue

Animal tissue was right after dissection snap frozen in liquid nitrogen and stored at -80℃ until further use. For total RNA isolation the material was again frozen in liquid nitrogen and pulverized with a metal mortar. The pulverized tissue was homogenized in 1ml TriFast per 10-20 mg tissue with the TissueLyser (Qiagen) using 5mm steel beads at 30hz for 20sec (two repeats). Lysates were centrifuged at 4℃ and 1300rpm for 5min and the supernatants were transferred to a new test tube. The extraction of the RNA was performed as described above.

5.1.3 Generation of cDNA

For expression analysis with quantitative RT-PCR (qPCR) and cloning of genes for expression constructs, cDNA was produced with the TaqMan Reverse Transcription Reagents (Applied Biosystems) using random hexamers. 1 μg total RNA was transcribed in 50 μl.

5.1.4 Polymerase chain reaction (PCR)

5.1.4.1 Standard PCR protocol

DNA amplification was performed with Taq- and Pfu-polymerases produced by the institute. The advantage of the Taq-polymerase is its ability to add an adenosine residue to the 3’-end of the amplified DNA double strand. This enables quick and easy insertion into pTA-GFP vector (Dr. Jochen Hecht) for later applications. However, this polymerase shows no proof-reading activity. Pfu-polymerase with 3’- 5’ exonuclease activity was used for applications requiring high fidelity DNA. In cases, where both characteristics were required, a mixture of both polymerases (1 part Pfu : 10 parts Taq) was applied. The reagents were pipetted, according to the standard PCR protocol (tab. 22), into a chilled 0.2ml reaction tube and incubated in a thermo cycler with following program: PCR products were analyzed on 1% to 3% agarose gels.

5.1.4.2 Colony PCR

Colony PCR is a fast and easy method to identify successful sequence insertion and its orientation in a vector. Bacterial colonies can be used directly as DNA templates. The

42 Table 21: Standard PCR program

Phase Temperature Time Cycles initial denaturation 94℃ 3 min

denaturation 94℃ 30 sec primer annealing depends on Tm 30 sec 25 - 35 cycles elongation (Taq/Pfu) 72℃/ 68℃ 1 min per 1 kb

ﬁnal elongation (Taq/Pfu) 72℃/ 68℃ 7 min end 94℃ ∞

Table 22: Standard PCR protocol

Amount Reagent 20-100 ng DNA template 2.5 μl 10x reaction buﬀer (provided by the institute) 1.5 μl dNTPs (1.25 mM, Fermentas) 1 μl 5’-primer (10 μM) 1 μl 3’-primer (10 μM) 0.5 μl DNA polymerase

add to 25μl with ddH H2O colonies were picked with sterile pipette tips, streaked out on a replica-plate (LB-agarose) and dipped into a PCR tube containing standard PCR reaction mix with appropriate primer.

43 Table 23: Speciﬁcations for Pycr1 genotyping

Primer name Primer sequence Ta Product length Pycr1-wt_F GGATGACACAGTTTCTGTTTGG 56.9℃ 405 bp Pycr1-wt_R AGCCAGGAAGAGCACATCAC Pycr1-ﬂox_F CCATCGGTTCCATAACTTCG 61℃ 334 bp Pycr1-ﬂox_R AAGCTGAGAGCCCTGTGTGT Pycr1-excis_F TTTTGCTGCACACCTGACTC 55℃ 354 bp Pycr1-excis_R GCCTTGGCTCTGCTTTACAC Cre_F GAGTGATGAGGTTCGCAAGA 55℃ 650 bp Cre_R CTACACCAGAGACGGAAATC

5.1.4.3 Ampliﬁcation of genes for expression constructs

Generally, genes were amplified from appropriate cDNA with a Pfu/Taq-polymerase Table 24: Pycr1 genotyping protocol mixture and cloned into pTA-GFP, where Amount Reagent their sequence fidelity was determined by Sanger-sequencing. The gene specific 20-100 ng DNA primers for amplification contained suitable 2.5 μl 10x reaction buffer restriction sites for sub cloning into the tar- 1.5 μl dNTPs (1.25 mM) get vector. (0.75 μl DMSO for flox PCR only) 1 μl 5’-primer (10 μM) 5.1.4.4 Genotyping PCRs 1 μl 3’-primer (10 μM) 0.5 μl DNA polymerase For genotyping, genomic DNA was extracted from either amnions or tail-cuts. add to 25μl with ddH H2O The PCR protocols and programs for genotyping the mouse-strains used in this study are described below (tab. 24; 25).The specific primer sequences with their annealing temperatures (Ta) and product length are indicated in table (tab. 23).

44 5.1.4.5 Quantitative real-time PCR (qPCR)

The expression level of specific genes can be quantified with quantitative real-time PCR, in this case Table 25: Pycr1 genotyping program with SYBR green, which binds specifically double- Temp Time Cycles stranded DNA. During the PCR reaction, the rise in fluorescence due to the increase of PCR product 94℃ 3 min is measured in real-time. Suitable primers were de- 94℃ 30 sec signed with Primer3 59.6℃ 30 sec 35 cycles (http://bioinfo.ut.ee/primer3-0.4.0/) and the target 72℃ 45 sec sequence included exon/intron boundaries whenever 72℃ 7 min possible, to exclude signal variation due to genomic 94℃ ∞ DNA contamination. The reaction was carried out in 384 well plates in a volume of 12 μl on an ABIPrism HT 7900 Real-time Cycler (Ap- plied Biosystems). The data analysis was performed with the software SDS 2.1 (Applied Biosystems).

Relative real time qPCR on RNA

To compare expression levels of measured genes in various tissues relative to a housekeeping gene, 4-16 ng cDNA - depending on the expected expression level -, 4.5 pmol of forward and reverse primer and 50% 2x SYBR Green PCR Master Mix (Applied Biosys- tems) were used for one reaction. The standard curve was produced with 1:2 dilutions, starting with 4 - 16 ng cDNA - depending on the expected expression level - decreasing down to 0.375-1.5 ng cDNA. Relative quantiﬁcation was achieved by calibrating the individual cDNAs to the levels of the housekeeping gene GAPDH. If not denoted otherwise, the here presented data are averages and standard deviations of triplicates of one representative experiment out of at least three.

Relative real time qPCR on gDNA

For quantiﬁcation of mitochondrial DNA in comparison to genomic DNA whole cell DNA was isolated (5.1.1.3) ,and 20 ng were used as template per well. For pre-screening of targeted embryonic stem cells gDNA was isolated as described in section 5.1.1.3 and 20 ng DNA was used as template for the qPCR reactions.

Absolute real time qPCR on RNA

45 Absolute qPCR was used to determine the number of speciﬁc transcripts in various tissues. Therefore plasmids containing either the whole gene of interest or the amplicon of interest were cloned (see below) and used as templates for the standard curves. This allows calculating the exact number of template molecules. The standard curves were generated by 1:10 dilutions starting from a concentration of 1 ng/μl. The dilutions 10−3 ng/μl to 10−7 ng/μl were used for the standard curves. To avoid loss of DNA at these dilutions, all reactions were performed in nuclease-free H2O with 0.01 % Tween20.

5.1.5 Sanger sequencing

Sequencing was performed by Mohsen Karbasiyan (Institute for Medical Genetics, Charité) on a ABI 3700 capillary sequencer (Applied Biosystems).The sequencing-PCR was set up using BigDye v3.1 (Applied Biosystems), according to the speciﬁcations of the manufacturer. The reaction was cleaned up with ethanol precipitation before it was transferred to the Charité for capillary electrophoresis.

5.1.6 Cloning

5.1.6.1 Expression constructs

To over express Pycr1 and Pycr2, the sequences were cloned into the pFlag-CMV- 5a (Sigma-Aldrich) vector using NotI and SalI restriction sites. The sequences were ampliﬁed from cDNA prepared from embryonic mouse tissue. According restriction sites were attached to the primers (table 15).

5.1.6.2 Standard plasmids for absolute quantiﬁcation

Cloning of standard plasmids for the human and murine orthologues of Gapdh was performed with TA-cloning of the amplicons of the qPCR primers into the pTA-GFP vector. As standard plasmids for murine Pycr1 (NM_144795.3) and Pycr2 (NM_133705.2) the pFlag-CMV-5a expression constructs were used. The plasmids for the human Pycr paralogues were kindly provided by Björn Fischer (Charité).

5.1.6.3 Targeting construct for Pycr1 cKO mouse

The intended strategy for the targeting vector was to ﬂank exons 3 to 6 with loxP sites in the same orientation. It was also aimed to insert a neomycin resistance gene cassette ﬂanked by frt sites as a positive selection marker and a diphtheria toxin A (DTA) cassette as a negative selection marker for later embryonic stem (ES) cell selection. The initial

46 point was a BAC (BMQ-30L18) containing the genomic locus of Pycr1 (GRCm38: Chr. 11 (NL_000077.6):120.600.936 - 120.667.002). The targeting vector was designed to consist of a 3.3 kb 5’ homology arm (short arm) and a 4.3 kb 3’ homology arm (long arm). The targeting construct was mainly generated by bacterial recombineering. Recom- bineering (recombination-mediated genetic engineering) is an eﬃcient tool for fast and thorough construction of vectors for manipulation of the mouse genome.

Cloning of the genomic sub clone

The genomic sub clone describes the target vector, containing the wild type locus of interest. Therefore the genomic sub clone was constructed to carry a 10.1 kb region flanking the Pycr1 gene, starting from position 120.636.678 bp to 120.647.610 bp (GRCm38: Chr. 11 (NL_000077.6)). To introduce the region of interest (ROI) into the destination vector pDTA (kindly provided by Dr. Carmen Birchmeier, MDC), homology arms of 337 bp 5’ flanking (A) and 231 bp 3’ flanking (B) the ROI were cloned in the multiple cloning site of pDTA. Homology arm A was cloned using SalI and HindIII restriction sites and homology arm B using Hind III and XbaI. According restriction sites were attached to the primers (table 10) for amplifying the arms. After linearization of the resulting plasmid pDTA-AB with HindIII and electroporated (5.2.2) in DY380 (kindly provided by Dr. Car- men Birchmeier, MDC) containing the BAC and recombineering was performed (5.2.3).

Insertion of the ﬁrst loxP site

The first loxP site was inserted between exon 2 and exon 3 of the Pycr1 gene. Therefore homology arms (C, 201 bp and D, 180 bp) corresponding to this region were inserted in the plasmid pHW025 (kindly provided by Dr. Carmen Birchmeier, MDC). pHW025 carries a neomycin resistance gene cassette flanked by frt sites, flanked by loxP sites. Region C (GRCm38: Chr. 11 (NL_000077.6): 120.642.628 - 120.642.829) was cloned with XhoI and HindIII sites 5’ of one loxP site and region D (GRCm38: Chr. 11 (NL_000077.6): 120.642.419 - 120.642.599) with NotI and SacII 3’ of the other. According restriction sites were attached to the primers (primer sequences see below) for amplifying the regions. This modified plasmid (pHW025_CD) was linearized with XhoI and electroporated in DY380 cells containing the genomic sub clone. After recombination in DY380, the resulting plasmid was electroporated in the E. coli strain EL350 containing a tightly controlled arabinose-inducible cre gene. After induction, cre mediates recombination between two identical loxP sites, resulting in excision of the neomycin resistance cassette, its flanking frt sites and one loxP site.

47 Insertion the neomycin resistance cassette and the second loxP site

The neomycin resistance cassette and the second loxP site was inserted between exon 6 and exon 7 of the Pycr1 gene. Again homology arms (E, 226 bp and F, 257 bp) corresponding to this region were cloned in pHW025. Region E (GRCm38: Chr. 11 (NL_000077.6): 120.640.825 - 120.641.051) was cloned with XhoI and EcoRI restriction site in pHW025 to replace the 5’ loxP site. Region F (GRCm38: Chr. 11 (NL_000077.6): 120.640.491 - 120.640.748) was cloned with NotI and SacII restriction sites 3’ of the second loxP site. According restriction sites were attached to the primers (primer sequences see below) for amplifying the regions. pHW025_EF was linearized with XhoI and electroporated in DY380 cells containing the genomic sub clone modiﬁed with the ﬁrst loxP site and recombination was performed.

5.1.7 Southern blot with radioactively labeled probes

Southern blot is a method to detect speciﬁc gDNA fragments which were transferred to a membrane. For detection small labeled DNA fragments (probes) are used. In this case probes were labeled radioactively with P32.

5.1.7.1 DNA preparation

Approximately 10 μg gDNA were digested with the restriction enzyme ScaI over night at 37℃ in a humid chamber. After separation of the resulting DNA fragments on an 0.7 % agarose gel for 4-6h at 70V, the DNA load and the fragment sizes were documented together with a UV-sensitive ruler laid alongside the gel.

5.1.7.2 DNA transfer

After documentation, the gel was depurinated for 15min in 0.25 % HCl, to induce fragmentation of the DNA. This increases the eﬃciency of the transfer. Subsequently the gel was washed 5min in ddH2O and denatured for 15min in 1.5 % NaCl with 0.5 % NaOH. Meanwhile a positively charged nylon membrane (Hybond-XL, Amersham Bioscience) was soaked 3min in ddH2O and incubated together with 4 slices of 3MM Chr Whatman paper were for at least 15min in 1.5 % NaCl with 0.5 % NaOH. The blotting stack was assembled onto a dish ﬁlled with 1.5 % NaCl, 0.5 % NaOH with a bridge of Whatman paper. As blot 2 Whatman sheets, the agarose gel, the equilibrated membrane, 2 Whatman sheets and a 15 cm stack of paper towels were assembled. Each layer was soaked in 1.5 % NaCl, 0.5 % NaOH and air bubbles were removed with a glass test tube, rolling over the surface.

48 A glass plate was placed on top to pin down this stack. The transfer was done over night. Next day, the membrane was rinsed in 2x SSC and DNA transfer was controlled under UV-light. The membrane was ﬁrst air dried and then twice cross linked with the auto-cross function of the Stratagen-UV-Cross linker.

5.1.7.3 Probe labeling

Probes were labeled with the Random Prime Labeling kit Ready PrimeII (GE Health- care) according to the manufacturer’s specifications. 25 ng PCR product or plasmid fragments were labeled with P32 dCTP (50 μCi) 1h at 37℃. Unincorporated P32 dCTP were removed with Microspin S-200 HR columns (GE Healthcare) according to the manufacturer’s specifications. Labeled probes were measured with a scintillation counter and only probes with a specific activity over 6*105 cpm/μg were used for hybridization.

5.1.7.4 Hybridization

During the labeling process, the membrane was pre-hybridized and blocked 30min to 1h at 65℃ in a hybridization oven. Pre-hybridization / blocking was performed in Church- buffer with 100 μg salmon sperm DNA per ml. Labeled probes were denatured at 95℃ for 5min and subsequently added to the pre-hybridization / blocking buffer. Hybridization was performed over night at 65 ◦C in a hybridization oven. The next day the membrane was washed twice for 5min in low-stringency-buffer at 50℃ and twice for 20min in high- stringency-buffer at 65℃. After the last washing step the membrane was placed on a low-stringency-buffer soaked Whatman paper and wrapped in plastic foil. Detection was performed with a phosphor-imager after an incubation of 16-24h.

Church-buffer: Sodium phosphate buffer, 0.25 M pH 7.2; EDTA, 1mM; BSA, 1%; SDS, 7%. Low-stringency-buffer: 2 x SSC; 0.05 % SDS. High-stringency-buffer: 0.1 x SSC; 0.1 % SDS.

5.2 Microbiological Methods

5.2.1 Preparation of electro-competent E. coli

Bacteria were grown to an OD600 of 0.6. Per electroporation approach 10ml bacterial suspension were quickly chilled on ice and centrifuged at 4000rpm for 10min at 2-3℃.

49 The pellet was thoroughly resuspended with 1ml ice-cold ddH2O and transferred in a new pre-chilled tube. The bacteria were again pelleted at 9000rpm for 1min at 2-3℃. This washing step was repeated thrice. After the ﬁnal washing step bacterial pellet was resuspended thoroughly in 40 μl ddH2O and used for subsequent electroporation.

5.2.2 Electroporation of E. coli

Electro-competent cells were transferred in pre-chilled electroporation-cuvettes. Per reaction 3-6 μl (100-200 ng) BAC or linearized plasmid were added. Electroporation was performed an a Biorad Pulser with 1.75 kV. It was aimed to achieve a time constant of 3.5 - 4.5 msec. After electroporation 1ml antibiotic-free LB was added and bacteria were transferred to a new test tube and incubated for 2h. Cells were plated on LB-agar plates containing the appropriate antibiotic for selection.

5.2.3 Bacterial recombination

For bacterial recombination the recombination competent E. coli DY380 strain, containing a defective λ prophage with recombination proteins exo, bet, and gam being controlled by the temperature-sensitive repressor cI857, were used. Prior making the cells electro- competent 50ml bacterial suspension at an OD600 of 0.6 were transferred to a pre-warmed sterile 250ml Erlenmeyer ﬂask and were incubated for 12min at 42℃.

5.3 General Cell Culture Methods

HeLa, MEF, MAF and HAF cells were generally cultivated in DMEM (high glucose, Gibco) supplemented with 10%FCS (Biochrome), 1% L-glutamine, 1% penicillin/streptavidin (both Gibco), which was always warmed up to 37řC before use. Cells were kept in an humidiﬁed incubator at 37℃ and 5% CO2 and medium was changed every 2 or 3 days.

5.3.1 Thawing of cells

Cells were thawed quickly in a 37℃ water bath and immediately transferred into a Falcon tube containing 10ml standard medium. After the suspension was centrifuged at 800rpm for 5min, cells were resuspended in 10ml fresh medium and plated into a cell culture ﬂask or dish. The following day, the medium was changed to remove last traces of DMSO.

5.3.2 Splitting of cells

In case the cultured cells reached 80-90% conﬂuency, cells were split into a new culture ﬂask or dish. For this purpose, the adherent cells were washed with DPBS (Lonza) and

50 trypsinized with 0.25% trypsin (Gibco) 3 to 7min at 37℃ until they detached. Immediately after, cells were taken up in medium, centrifuged, and resuspended, depending on the cell line and the purpose, 1:3 to 1:10 in fresh medium.

5.3.3 Cryopreservation of cells

Approximately 107 cells were resuspended in 1ml freezing-medium and transferred into a cryo-vial. These were immediately placed into a cooled (4℃) isopropanol-freezing container, which ensures freezing of the cells at a constant rate of 1℃ /min. The container was placed at -80℃ over night and the cryo-vials were transferred to liquid N2 storage two days later.

Freezing-medium: Growth medium supplemented with 20 % FCS instead of 10 % and with 10 % DMSO.

5.3.4 Cell number determination

In case a deﬁned cell number was required for an experiment, cells were counted in a Neubauer-chamber and plated out accordingly.

5.3.5 Cell transfection

Transfection with expression constructs were performed using the transfection reagent TurboFect (thermo Scientiﬁc) and transfections with SiRNA were performed using Inter- ferin (Polyplus), both according to the manufacturer’s protocols.

5.3.6 Immunocytochemistry (ICC)

Analysis of cellular distribution of proteins and mitochondrial morphology were carried out by immunocytochemistry (ICC). The protein of interest were labeled with primary antibodies and detected with fluorophore-coupled secondary antibodies (tab. 8). For this purpose cells were cultivated on round glass cover-slips in 6-well plates. Cells were fixed for 15min in 4 % PFA in PBS at RT. After washing thrice with PBS cells were permeabilized 10min in 0.4 % Titron X-100 in PBS at RT and again washed thrice. Blocking was performed with 3 % BSA in PBS for at least 30min washed twice and incubated with the primary antibody in an appropriately diluted in blocking-solution. Therefore 35 μl of the diluted antibody was dropped on parafilm in a humidified dark chamber and the cover- slip with the adherent cells were carefully placed upon it for overnight incubation at 4℃. The following day, the cells were washed thrice with PBS and incubated with secondary antibody and DAPI for 1h at RT.

51 5.4 ES Cell Culture Methods

5.4.1 Preparation of murine embryonic ﬁbroblasts (MEF)

In general, MEFs were obtained from embryos 13.5 dpc. MEFs, which were used as feeder cells for embryonic stem cells culturing were prepared from animals carrying heterozygous the neomycin resistance gene. Pregnant mouse was euthanized at day 13.5 pc, disin- fected with 70 % EtOH and the uterus was removed and also quickly rinsed with 70 % EtOH. Subsequently the embryos were isolated and stored for further use in ice-cold sterile DPBS. To increase the number of fibroblastic cells, the head, liver, spleen and heart were removed and in case of genotyping was required, used for DNA extraction. Embryos were transferred in a 6 cm culture dish each and minced with small scissors until the tissue appeared homogeneous. The minced tissue was collected in 5ml DPBS in a 15ml falcon tube, 5ml 0.25 % Trypsin/EDTA was added and incubated in a water bath at 37℃ with occasionally shaking. After 10min of incubation, 5ml was transferred to a 50ml falcon tube containing 25ml of MEF medium (AlfaMEM) and again 5ml 0.25 % Trypsin/EDTA was added to the tube with the minced tissue. This procedure was repeated tree times. After the last digestion the whole Trypsin/DPBS/tissue mix was transferred to the 50ml falcon tube containing MEF medium. The digested tissue was centrifuged at 800rpm for 5min at RT, the supernatant was removed and the pellet was resuspended in 6ml MEF medium per embryo. Each embryo was plated to a 25 cm2 cell culture flask and incubated in an humidified incubator at 37℃ and 5% CO2. Cells were splitted 1:2 or 1:3 when they reached a confluency of 80 - 90 %. The first two passages MEFs were kept in AlfaMEM-medium, thereafter DMEM was used.

AlfaMEM-MEF medium: AlfaMEM (high glucose, Gibco) supplemented with 15 % FCS (Biochrome), 1% L-glutamine, 1% penicillin/streptavidin (both Gibco)

DMEM-MEF medium: DMEM (high glucose, Gibco) supplemented with 10 % FCS (Biochrome), 1% L-glutamine, 1% penicillin/streptavidin (both Gibco)

5.4.2 Mitotically inactivation of MEFs

To maintain the pluripotency of embryonic stem cells (ESC) it is essential to seed these on a layer of feeder cells (inactivated MEFs). Feeder cells were mitotically inactivated by a treatment with Mitomycin C. Mitomycin C inhibits DNA synthesis by cross-linking DNA at 5’-CpG-3’ sequences and therefore prevents cell division while allowing surveillance and secreting key proteins such as Leukemia Inhibitory Factor (LIF) which is a crucial factor

52 for preventing diﬀerentiation of ESCs. When reached conﬂuency, MEFs were treated with medium supplemented with 10 μg Mitomycin C /ml. After 3h of incubation cells were washed thrice with DPBS and cultivated one more day under standard conditions. The following day inactivated MEFs were cryopreserved (see 5.3.3) in appropriate cell numbers.

Feeder medium: DMEM (high glucose, Gibco) supplemented with 10%FCS (PAN Biotech), 1% L-glutamine, 1% penicillin/streptavidin (both Gibco)

5.4.3 Cultivation of embryonic stem cells

For generation of the Pycr1 knock out mouse model, R1 embryonic stem cells were used. This is a pluripotent cell line derived from the mouse strain 129. ESCs were cultivated on a layer of inactivated feeder cells heterozygous for the neomycin resistance gene. For seeding the inactivated feeder cells, culture plates were gelatinized with sterile 0.1 % porcine gelatin in PBS for 30min at 37℃. Thereafter the gelatin solution was removed and the feeder cells were seeded in a concentration of 5*104 cells / cm2 in feeder medium. The following morning feeder medium was replaced by ESC medium. 3h later the ES cells were seeded on this plate. ES cells were cultivated in an humidiﬁed incubator at 37℃ and

5% CO2 and medium was changed every day.

ES cell medium: DMEM (high glucose, Gibco) supplemented with 15%FCS (PAN Biotech), 1% L-glutamine, 1% penicillin/streptavidin 1 % NEAA, 0.2 % ß-mercaptoethanol (all four Gibco), 1 % nucleoside (adenosine, guanosine, cytosine, uridine, thymidine, all Sigma Aldrich), 1 U/ml LIF (Millipore)

5.4.4 Transfection of ES cells

R1 cells were transfected by electroporation at a conﬂuency of 50 - 70 %. 3h prior electroporation the medium was exchanged. The cells were trypsinized and a single cell suspension was produced by very gently up- and down pipetting. Thereafter cells were centrifuged at RT 5min at 800rpm and washed in DPBS. This washing step was repeated once. Afterwards the cell pellet was resuspended in DPBS in a concentration of 1*107 cells per 0.8ml (one electroporation assay). 30 μg linearized targeting vector (linearized with PvuI) was added and gently mixed. This cell / DNA mixture was transferred to a electroporation cuvette with 0.4 cm gap and incubated for 5min at RT. transfection was performed at 250 V and 500 μF. Subsequently 1ml ES cell medium was added and the electroporated cells were seeded on three gelatinized 10 cm plated with inactivated feeder

53 cells.

5.4.5 Selection of transfected ES cells

The following day ES cell growth medium was replaced by ES cell selection medium containing additional 200 μg G418 / ml. G418 (Geneticin) is an antibiotic which blocks the polypeptide synthesis in both eukaryotes and prokaryotes and was therefore used for positive selection of targeted ES cells. Additionally the cells were negatively selected with diphtheria toxin A (DTA), to minimize random integration events. Cells were selected for 9 days.

5.4.6 Isolation of ES cell colonies

9 days after selection was started, ES cell were clearly visible as roundish colonies. Only undifferentiated colonies of medium size were isolated. Three hours prior the isolation process, cells were fed with fresh medium. Thereafter the cells were washed twice with DPBS and picked using a pipette under sterile conditions in DPBS. Colonies were picked in 10 μl and transferred to a 96-well plate (round bottom) already containing 30 μl 0.25 % Trypsin/EDTA. The cells were trypsinized for around 3min at 37℃. Trypsination was stopped by adding 100μl ES cell medium without G418 and cells were detached from each other by up- and down pipetting several times and finally transferred to another gelatinized 96-well plate (flat bottom) with inactivated feeder cells and 50 μl medium without G418 was added to each well. Per construct 384 colonies (three 96-well plates) were isolated.

5.4.7 Expansion of ES cell colonies

At day three after isolation the cell clones of every 96-well plate were expanded on 2 96- well plates for DNA isolation and 2 96-well plates for cryopreservation. For DNA isolation the 96-well plates were 30min gelatinized, the plates for cryopreservation were prepared by also gelatinization and seeding of inactivated feeder cells. The isolated ES cells were washed with DPBS, and trypsinized for 5min with 30 μl 0.25 % Trypsin/EDTA. The reaction was stopped with 170 μl ES cell medium without G418. Cells were up- and down pipetted to end up with single cell suspension. For DNA isolation 70 μl cell suspension was transferred on each DNA plate and for cryoconservation 30 μl cell suspension was transferred to each plate. The volumes of every well was adjusted to 200 μl.

5.4.8 Cryopreservation of ES cells in 96-well plates

The cells were washed once with DPBS. Following cells were incubated for 5min with 50 μl 0.25 % Trypsin/EDTA at 37℃ and afterwards pipetted several time to get a homogeneous

54 cell suspension. 100 μl fresh prepared cold 2x ES cell freezing medium was added and cells were again pipetted up- and down. Subsequently the plates containing the ES cells were wrapped with securely closed, wrapped with paraﬁlm and stored in a styrofoam box at -80℃ until further use.

5.4.9 Thawing and expanding ES cells

ES cell clones which appeared positive after the first qPCR screen were than thaw and expanded for further use. The thawing procedure was performed as described in section 5.3.1. From the 96-well plate cells were first seeded to 24-well plates prepared with gelatinization and feeder cells. When they reached sub-confluency, cells were transferred to 6 cm culture dishes and finally to 10 cm dishes.

5.4.10 Screening of targeted ES cells

Isolated ES cells were screened for correct targeting in two steps. The ﬁrst screening was performed with qPCR on gDNA, the Pycr1 wild type locus was detected and compared to the single copy gen Albumin. Only cells which appeared to have one Pycr1 wild type allele left (50% compared to untargeted ES cells) were thawed up and used for the second screen with southern blot analysis (5.1.7).

5.4.11 Tetraploid aggregation

ES cell preparation and generation of transgenic embryos was done at the transgenic service facility of the Max-Planck-Institut for molecular genetics, by Dr. Lars Wittler. Transgenic embryos were generated by tetraploid morula aggregation. This is a technique produces chimera with a extremely high percentage (over 95%) of cells derived from the manipulated stem cells. In brief murulae of two cell stage were isolated from pregnant mice and fused to tetraploidic cells by applying electrical current. These tetraploidic cells were then aggregated with the diploid manipulated stem cells. The tetraploidic cells are only able to form the extra-embryonic tissue; the manipulated ES cells form the embryoblast.

5.5 Biochemical Methods

5.5.1 Protein extraction from cultured cells

Adherent cells washed once with DPBS and lysed directly on the culture dish. For 10 cm dishes 1ml membrane lysis buﬀer, a containing protease inhibitor cocktail (Complete, Roche) was used, for 6-well plates 300 μl per well. Cells were incubated 10min at RT with the lysis buﬀer and were afterwards several times pipetted up and down. Lysates

55 were transferred to 1.5ml test tubes and sonicated in a cooled water bath in a series of impulses with low power for 30sec and rest for 30sec, four times (Bioruptor, life technologies). After the sonication step, cells were centrifuged at 4℃ for 5min at top speed. The supernatant was transferred to a new test tube and stored at -20℃ until further use.

Membrane lysis buﬀer: 50 mM NaF, 30 mM Nappi, 5mM EDTA, 1% Triton-X 100,1xTBS

5.5.2 Protein extraction from tissue

Tissue samples were right after dissection snap frozen in N2 and stored at -80℃ until further use. For protein extraction the material was deep frozen in liquid nitrogen and pulverized with a metal mortar. The pulverized tissue was homogenized in 1ml membrane lysis buﬀer per 10-20 mg tissue with the TissueLyser (Qiagen) using 5 mm steel beads at 30hz for 20sec (two repeats).Lysates were sonicated as described above and afterwards centrifuged at 4℃ and 1300rpm for 5min. The supernatants were transferred to a new test tube and stored at -20℃ until further use.

5.5.3 Determination of protein concentration

The determination of protein concentration was carried out using the BCA Protein Assay Reagent Kit (Pierce) according to the manufacturer. The extinction at 562 nm was determined with a titer-plate reader and unknown protein concentration was calculated by comparison to a BSA standard curve.

5.5.4 SDS PAGE

5.5.4.1 Gel preparation (polyacrylamide)

Depending on the expected protein sizes, gels with appropriate percentages of acry- lamide were prepared according to Sambrook, et al., 1989, using the Mini Protean II System (Biorad).

5.5.4.2 Sample preparation

The protein samples were derived from cell-culture cells mouse tissue and lysed as described above. Prior to electrophoresis, loading-buﬀer was added to the samples, which were subsequently boiled for 10min. Additionally a pre-stained protein ladder (Fermen- tas) was loaded to the gel, in order to determine the molecular weight of detected proteins.

56 4x loading-buﬀer: 2ml 1 M Tris, 4ml glycerine, 2ml 20% (w/v) SDS, 400 μl 1% bromephenol blue, 600ml ddH2O, 1ml 40x β-mercaptoethanol; pH 7.5

5.5.4.3 Electrophoresis

Gels were run with 80 V for 30min, thereafter the voltage was increased to 100 V until the bromephenol blue reached the lower edge of the glass slides. For better separation of large proteins, the running time was elongated.

5x running-buﬀer: 25 mM Tris, 25 0mM glycine, 0.1% (w/v) SDS

5.5.5 Western blot (WB)

5.5.5.1 Protein transfer

According to the size of the gel, a suitable peace of Polyvinylidene ﬂuoride (PVDF) membrane was activated in methanol and equilibrated in transfer-buﬀer. The proteins were transferred using the semi-dry blotting chamber (BioRad), considering the direction of transfer for the assembly of the gel-membrane sandwich. The blotting procedure was taking place at 22 V for 30min.

1x transfer-buﬀer: 25 mM Tris, 192 mM glycine, 20% MeOH

5.5.5.2 Protein detection

After blotting, the membrane was blocked in 5% milk powder in TBST for at least one hour, followed by overnight-incubation with primary antibody (tab- 8) in blocking solution at 4℃. The next day, the membrane was washed 3x in TBST for 5min and incubated with a suitable HRP-coupled secondary antibody for at least 1h at RT. Finally, the membrane was washed thrice and protein was visualized with enhanced chemo luminescence (ECL) solution (Rotilumin, Carl Roth). The signals were detected by the LAS 4000 Imaging System (Fuji) and quantiﬁed with ImageJ (National Institutes of Health).

TBST: TBS, 0.02 % Tween20

5.5.6 Determination of ATP concentration

ATP concentrations were measured using the ATPlite Assay Kit (PerkinElmer) in MEFs generated from Pycr1+/+ and PYCR1−/− embryos, following the manufacturer’s instructions. Brieﬂy, cells were grown in 96-well plates with 100 μl culture medium per

57 well. Cells were lysed with 50μl mammalian cell lysis solution per well and incubated for 5min at RT on an orbital shaker at 700rpm. Subsequently, 50μl substrate solution were added per well and the plate was incubated again 5min at RT on an orbital shaker at 700rpm. Afterwards, the plate was incubated for 10min at RT in the dark and the concentrations were measured with a luminometer (MicroBeta TriLux 1450, Wallace). The measurements were done in triplicates and repeated twice. The ATP concentrations per well were normalized to the DNA content per well (section 5.5.9).

5.5.7 Determination of lactate concentration

Lactate concentrations were measured using the Lactate Assay Kit (BioVision) in culture medium supernatants from MEFs generated from Pycr1+/+ and Pycr1−/− embryos, following the manufacturer’s instructions. Briefly, cells were grown in 96-well plates with 100 μl culture medium per well. 5μl medium supernatant of each well were transferred to a 96-well white plate and diluted with 45μl Lactate assay buffer (1:10) and mixed with the Reaction mix, containing Lactate assay buffer, a probe and an enzyme mix. The plate was incubated for 30min at RT in the dark and subsequently measured with a fluorescence reader at Ex/Em = 535/590nm (Plate reader Spectra Max 250, Molecular Devices). The measurements were done in triplicates and repeated twice. The ATP concentrations per well were normalized to the DNA content per well (section 5.5.9).

5.5.8 PicoGreen dsDNA Quantitation

To normalize the measured ATP and lactate concentrations in MEFs, concentrations were normalized to the dsDNA content per well. dsDNA was measured using PicoGreen dsDNA quantitation assay (life Technologies) following the manufacturer’s instructions. Briefly, cells grown in 96-well plates were lysed with 100μl ALP1 lysis buffer over night. 25μl lysate of each well were transferred to a 96-well white plate and diluted with 25μl TE buffer (1:2). 50μl PicoGreen reagent, diluted in TE buffer, were added per well, following briefly mixing, the plate was incubated for 5min protected from light. The concentrations were measured with a luminometer (MicroBeta TriLux 1450, Wallace).

5.5.9 Sample preparation for OXPHOS complex activity determination

The activity of the ﬁve OXPHOS complexes were measured in quadriceps femori of adult Pycr1+/+ and Pycr1−/− mice. The measurements were performed by Dr. Thatjana Gardeitchik (Radboud University, Nijmegen) according to standard protocols. Muscle specimens were dissected and snap frozen in liquid nitrogen. Specimens were stored at -80℃ for several days and shipped to Dr. Thatjana Gardeitchik with dry ice.

58 5.6 Histological Methods

5.6.1 Tissue preparation for electron microscopy

Muscle and skin specimens were right after dissection ﬁxed with 2.5 % glutaraldehyde in 50mM cacodylic acid, pH 7.2 over night at 4℃. Further tissue preparation, sectioning and electron microscopy was kindly done by Dr. Ingrid Hausser (Universitätsklinik, Heidelberg) for skin specimens and by Beatrix Fauler (MPI for molecular genetics, Berlin) for muscle specimens.

5.6.2 Paraﬃn embedding and sectioning

For histological experiments tissue was prepared and immediately fixed in 4% PFA/PBS at 4℃. Subsequently the tissue Table 26: Dehydration program for paraffin embedding was washed 3x with PBS and dehydrated for at least 30min Time Reagent in 50 % EtOH and afterwards in 70 % EtOH over night. Fur- ther dehydrating steps and paraffin impregnation took place 3 h 90 % EtOH with the use of an automated device, programmed as de- 3 h 95 % EtOH scribed in table 26. Paraffin-impregnated tissues were embed- 2 h 100 % EtOH ded in paraffin in the desired orientation and sectioned with 2 h 100 % EtOH a paraffin-mircrotome (Mikrom). Usually, the tissues were 2 h 100 % EtOH processed into 6 - 8 μm thick sections and dried overnight at 15 min UltraClear 37℃. 15 min UltraClear 30 min UltraClear 5.6.3 Cryo embedding and sectioning 3 h UltraClear/ Paraffin For cryo embedding muscle specimens were fixed in 4% 3 h Paraffin PFA/PBS at 4℃ and subsequently washed 3x in PBS. The fixed tissue was prepared for embedding with a overnight incubated in 15 % sucrose, at least 6h incubation in 30% sucrose and 30min incubation in the specimen matrix (Tissue- Tek) all at RT. Muscle specimens were embedded in the desired orientation in isopentane, cooled down in liquid nitrogen. Usually, the tissues were processed into 12 μm thick sections and dried for 1h at 37℃ and stored at -20℃.

5.6.4 Methylmethacrylat (MMA) embedding and sectioning

The bone samples were embedded in MMA (Polysciences) and then sectioned for histological study. The bone samples were ﬁrst ﬁxed in 4 % PFA for 24hours at 4℃. Then

59 the samples were dehydrated in 70 % EtOH for 24h, 80 % EtOH for 24h, twice in 100 % EtOH for 24h and twice in xylene for two h. The samples were inﬁltrated with in- ﬁltration MMA-solution (10 % v/v polyethylene glycerol (Sigma) and 0.33 % benzoyl peroxide in MMA) for at least 24h at 4℃. The polymerization was carried out at 4℃ in polymerization solution (10 % v/v polyethylene glycerol, 0.55 % benzoyl peroxide, 0.5 % v/v N,N-dimethyl-p-toluidine in MMA). The embedded samples were sectioned using a microtome (Leica RM2255) at 5ţm thickness for staining and analysis.

5.6.5 Immunhistochemistry (IHC) on paraﬃn embedded tissue

Tissue sections were deparaﬃnized and rehydrated with following protocol: 45min UltraClear, 2min 100 % EtOH, 2min UltraClear, 2min % EtOH, 2min 90 % EtOH,

2min 70 % EtOH, 3x 5min ddH2O. Following rehydration, the sections were boiled in citrate buﬀer (DAKO) for 10min for antigen retrieval and allowed to cool to RT. Subsequently, sections were washed thrice with PBS and blocked with blocking-solution for at least 1h at RT. Primary antibody was diluted in blocking reagent and dropped on the sections for overnight incubation at 4℃ in a humidiﬁed dark chamber. The following day, sections were washed 3x in PBX and incubated with secondary antibody and DAPI (1:1000) for 1 h at RT in the dark. After 3 further washes with PBS, sections were mounted with Fluoromount G.

PBSX: PBS, 0.02% TritonX-100 TSA-solution: 10 % v/v horse serum, 0.5 % Blocking Reagent (Perkin Elmer), 0.1% TritonX-100 in PBS Blocking-solution: 3 % v/v horse serum, 0.3 % BSA, 0.1% TritonX-100 in PBS

5.6.6 Immunhistochemistry on cryo embedded tissue

The sections were dried at RT for at least 3h, soaked in ddH2O for 10min and boiled in citrate buffer (DAKO) for 10min for antigen retrieval and allowed to cool to RT. Subsequently, sections were washed thrice with PBS and blocked with blocking-solution for at least 1h at RT. Primary antibody was diluted in blocking reagent and dropped on the sections for overnight incubation at 4℃ in a humidified dark chamber. The following day, sections were washed 3x in PBX and incubated with secondary antibody and DAPI (1:1000) for 1h at RT in the dark. After 3 further washes with PBS, sections were mounted with Fluoromount G. In case of non-fluorescent IHC, the ABC-kit (Vectastain) was used for antibody detection and the DAB-kit (Vector Laboratories) signal detection

60 (according to the manufacturer’s speciﬁcations) and the sections were then dehydrated mounted with Entellan (Merck).

5.6.7 Histological stainings

5.6.7.1 Von Kossa, Pikro-Fuchsin and Toluidine staining

This staining was only carried out on bone sections embedded in MMA. MMA sections were plasticized by washing in 2-methoxyethylacetate thrice for 10min. Thereafter the sections were washed in xylene twice for 5min and rehydrated through 100 %, 70 %, 50

% EtOH for 1min in each step. Next, the sections were rinsed in ddH2O and further they were incubated with 1 % silver nitrate solution for 3min and then washed in ddH2O thrice for 2min. Subsequently, the sections were developed in 5 % NaCO3 solution with 10 % formaldehyde for 2min. The sections were washed in running tab water for 10min.

Afterwards sections were washed in5%Na2S2O7solution to remove background staining. Thereafter sections were washed in running tab water for 10min. The sections were afterwards stained in Pikro-Fuchsin solution for 10min and four times washed in ddH2O. After this step the sections were stained with 0.025 % toluidine blue solution until attained desired intensity (approx. 2min). Finally the sections were then dehydrated and mounted with Entellan (Merck).

5.6.7.2 Elastika van Gieson staining

The Elastika van Gieson staining was performed on skin sections embedded in paraffin. The sections were deparaf- Table 27: Deparaffinization and rehydration finized and rehydrated by 20min incubation at 65℃ and following steps described in table 27. The sections were then Time Reagent stained for 30min in Resorcinfucin washed thoroughly with tab 45 min UltraClear water and rinsed in ddH2O. thereafter the staining was differ- 15 min UltraClear entiated in 80 % EtOH for 7min and again rinsed in ddH2O. 2 min 100 % EtOH The sections were then stained with Hämatoxilin (Weigert’s) 2 min UltraClear for 3min and blued for 10min in tab water. Subsequently the 2 min 100 % EtOH sections were stained with van Gieson-staining solution for 2 min UltraClear 2min and again rinsed in ddH2O before dehydrating in 70 % 2 min 100 % EtOH EtOH, 96 % EtOH, 100 % EtOH and UltraClear 2min each. 2 min 100 % EtOH Finally the sections were mounted with Entellan. 2 min 96 % EtOH 2 min 70 % EtOH

61 5.6.7.3 Mason Goldner staining

This staining was performed on paraffin sections. Prior the staining procedure, the sections were deparaffinized and rehydrated according to table 27. The sections were stained with Hämatoxilin (Weigert’s) for 3min and blued for 10min in tab water. Subsequently the sections were stained for 5min in Ponceau Acid-Fuchsin and afterwards rinsed in 1 % acetic acid. Sections were then stained in phospho wolframic acid-orange-G for 10min, briefly rinsed in 1 % acetic acid and subsequently stained with light green for 5min and again rinsed in 1 % acetic acid. Afterwards the sections were dehydrating in 70 % EtOH, 96 % EtOH, 100 % EtOH and UltraClear 2min each and mounted with Entellan.

5.6.7.4 Hämatoxylin Eosin (HE) staining

The HE staining was performed on cryo- and on paraffin sections. Paraffin sections were firstly deparaffinized and rehydrated as described in table 27. Cryo sections were air dried for 3h prior staining. The sections were washed in ddH2O for 5min and stained in Mayer’s hämotoxylin for 1-3min and blued for 10min in tab water. Subsequently the sections were rinsed in ddH2O and stained in with eosin for 1-3min. the sections were twice rinsed in ddH2O and dehydrating in 70 % EtOH, 96 % EtOH, 100 % EtOH and UltraClear for 2min each. Finally the sections were mounted with Entellan.

5.7 Radiological Methods

5.7.1 MicroCT Analysis

MicroCT analysis was done by using the SKYSCAN 1172 (Bruker). The trabecular bone measurement was done for a 500 μm region 300 μm under the proximal growth plate of the tibia and above the distal growth plate of the femur. The cortical bone measurement was done for 500 μm, at a region 4000 μm below the proximal growth plate of the tibia and above the distal growth plate.

62 6 Results

6.1 Expression analysis of Pycr1 in mice

Previous results [16] showed that mutations in the PYCR1 gene are causative for ARCL in humans. To ascertain if this gene plays a similar role in Mus musculus, the expression pattern of Pycr1 was detected in embryonic tissue by immunoﬂuorescence and with RT- PCR on RNA isolated from diﬀerent adult tissues. In embryonic tissues Pycr1 is ubiquitously expressed. Figure 9 shows a cryo-section of an E17.5 hind limb stained for Pycr1 in green (nuclei are stained with DAPI in blue). Pycr1 is present in various tissues like the skin, muscles, tendons and ligaments and also in chondrocytes.

Figure 9: Pycr1 is present in various tissues in embryonic limbs. Cryo-sections of embryonic (E17.5) hind limbs were stained with an anti-Pycr1 antibody. Nuclei were visualized with DAPI. Positive signals for Pycr1 were detected in the skin, muscles, tendons, ligaments and forming bones (chondrocytes).

In ﬁgure 10 the expression pattern of Pycr1 on a variety of adult tissues are presented. Expression analyses were conducted on RNA isolated from diﬀerent murine tissues with RT-PCR. The results were normalized to the housekeeping gene Gapdh. In adult tissues Pycr1 is ubiquitously expressed, but shows the highest levels in bone and the lowest levels in the placenta.

6.2 Human and murine PYCR proteins are highly conserved

It was demonstrated that murine Pycr1 is expressed in tissues, that are affected in patients suffering from PYCR1-related ARCL. Furthermore, protein sequence comparisons were performed to substantiate the assumption that the two orthologues fulfill the same function (figure 11 C and D). In man and mice three Pycr paralogues are existing. Human PYCR1 and PYCR2 are mitochondrially localized. It is assumed that PYCR2 is also involved in proline synthesis albeit the function of PYCR2 remains unclear [35]. PYCRL is localized in the cytoplasm and little is known about its function [35]. Given the different cellular localizations of

63 Figure 10: Pycr1 is expressed in a broad range of adult tissues. Absolute qPCR was performed to determine the number of speciﬁc transcripts on RNA isolated from diﬀerent tissues of adult C57BL/6 mice. Plasmids containing either the whole gene of interest or the amplicons of interest were cloned and used as templates for the standard curves. The standard curves were generated by 1:10 dilutions. The dilutions 10−3 ng/μl to 10−7 ng/μl were used for the standard curves. To avoid loss of DNA at these dilutions, all reactions were performed in nuclease-free H2O with 0.01 % Tween20. The results are presented as copy per molecule of the housekeeping gene (GAPDH). Pycr1 was expressed ubiquitously an all analyzed tissues, whereas in placental tissue hardly any expression was measured. Error bars are representing SD.

PYCR1 and PYCRL, the latter one was not taken into account for protein sequence comparison. Human and murine PYCR1 orthologues share 88.7% homology whereas human PYCR2 and murine Pycr2 present with 92.2% sequence identity. The majority of differences in the protein sequence are lying in the last 25 C-terminal amino acids where no Pfam domains are described. Comparison of both paralogues in one species reveals concordance of 84.7 % for human PYCRs and 81.6% for the murine paralogues (figure 11 A). The NAD(P) binding domain and the oxidoreductase domain at the N-terminus as well as the dimerisation domain at the C-terminus are highly conserved thru both species and paralogues (figure 11 C). These results suggest that the functions of human and murine PYCR1, and PYCR2 respectively are conserved, and justifies the approach of generating a conditional knock out mouse model to analyze the pathomechanism behind this genetic disorder.

64 Figure 11: Human and murine PYCR paralogues are highly conserved. A Table with homologies between human and murine PYCR paralogues. Homologies were calculated on the online platform Genestream (www.xylian.igh.cnrs.fr). Human PYCR1 and murine Pycr1 as well as PYCR2 and Pycr2 shared more homologies than the paralogues of individual species. B Functional domains of PYCR. The Pfam domains were predicted with SMART (http://smart.embl-heidelberg.de). C and D Protein sequence alignment of PYCR1 and PYCR2 orthologues. The Alignment was calculated with T-Coffee (http://tcoffee.crg.cat/apps/tcoffee/do:regular) and plotted with Boxshade (www.ch.embnet.org). Black shading indicate identical amino acids, gray shading indicate similar amino acids, white background indicate unrelated amino acids and red background indicate putative ubiquitination sites.

65 6.3 Generation of the Pycr1 conditional knock out mouse model

PYCR1 is causative for a subtype of autosomal recessive cutis laxa. Human and murine PYCR1 are highly conserved and similarly expressed in a wide range of tissues. We decided to generate a Pycr1 knock out mouse model to deeper analyze and therefore better understand the pathomechanism behind PYCR1-related autosomal recessive cutis laxa. To avoid potentially early embryonic lethality, a conditional knock out strategy was chosen, to generate tissue speciﬁc knock outs, if necessary.

6.3.1 Strategy for targeting Pycr1

The strategy for the targeting vector was to flank exons 3 to 6 with loxP sites in the same orientation to obtain an excision of the genomic region between the two loxP sites after cre-recombination. It was also aimed to insert a neomycin resistance gene cassette flanked by frt sites as a positive selection marker and a diphtheria toxin A cassette as a negative selection marker for later embryonic stem (ES) cell selection. The targeting vector was designed to consist of a 3.3 kb 5’ homology arm (short arm) and a 4.3 kb 3’ (long arm) for optimal integration in the targeted locus in ES cells (figure 12).

Figure 12: Strategy scheme for targeting Pycr1. The dashed lines between the wt allele and the targeting construct are representing the regions of homologous recombination. The length and the position of the homology arms are indicated. The genomic structure of the Pycr1 locus after cre-mediated recombination is shown in the bottom part of this ﬁgure (Pycr1 ko allele).

6.3.2 Identiﬁcation of targeted stem cells

ES cells were transfected with the targeting vector and selected for 10 days with G418 (neomycin) for genetically modiﬁed ES cells. After isolating individual ES cell clones, cells were pre-screened for correct targeting using qPCR copy number analysis. In the process of cloning the targeting vector, a region of 77 bp in intron 6 was deleted. The primers

66 for pre-screening of positive ES cell (ESC) clones were designed to speciﬁcally bind this region and therefore detect only the wild type allele. The results were normalized to the single-copy gene albumin and compared to the wild type situation (untargeted ES cells). ES cell clones with allele dosages less than 75% of the wild type Pycr1 allele ( indicated with red arrows) were chosen for further screening by Southern blot analysis (ﬁgure 13).

Figure 13: qPCR screening of ES cell clones. The targeted ESCs were pre-screened by qPCR for the speciﬁc loss of 77 bp in intron 6 due to cloning of the targeting construct. Two speciﬁc primer pairs detecting only the wt allele were used. The results are presented as copy number of the wt Pycr1 locus compared to the single copy gene albumin and to untreated ESC. ESC clones indicated with a red arrow, presenting less than 75% abundancy of the Pycr1 locus, were chosen for further screening. Untreated ESC served as positive control (pos.), the targeting vector served as negative control (Neg.).

To verify single (internal probe, data not shown) and correct recombination events (3’ and 5’ probes), ESC clones were analyzed by southern blotting and detection with P32 labeled probes (ﬁgure 14). The indicated clone F2 was chosen for tetraploid morula aggregation.

6.3.3 Generation of transgenic mice

Transgenic Pycr1 ﬂoxed animals were generated by the in-house transgenic-facility of the Max-Planck-Institute for Molecular Genetics. The chosen ES cell clone was expanded and aggregated with a tetraploid zona pellucida-free morula stage embryo. Tetraploid morulae were generated by electrofusing two two-cell-stage diploid embryo and further cultivation

67 Figure 14: Southern blot screening of ES cell clones.. A, Schematic illustration of wild type, targeted and ﬂoxed allele with indicated restriction sites, position of probes and size of expected fragments. B, Southern blot results with indicated ESC clones (letters and numbers at the bottom of the blots) and detected with indicated probes. Fragment sizes are denoted. The indicated clone F2 was chosen for tetraploid morula aggregation.

[92]. After incorporation of the ES cells into the embryo, the resulting blastocyst was transferred into a pseudo-pregnant female mouse. Tetraploid ES cell aggregation allows generating embryos that are almost completely ES cell derived. The resulting highly chimeric mice were crossed with wild type C57BL/6J mice. The offspring were analyzed for germline transmission. Genotyping PCRs were performed on DNA isolated from tail tips and the PCR products were sequenced to confirm that the offspring carry the floxed allele (figure 15 B). When germline transmission was proven, Pycr1 flox/+ mice were generated and crossed back to C57BL/6J mice to obtain a clear genetic background. In parallel, Pycr1 flox/+

68 mice were bred with Prrx1-Cre expressing mice to obtain a limb specific knock out. Paired related homeobox 1 (Prrx1) is expressed in the early limb mesenchyme but also to some degree in the interlimb flank and in the cranial and craniofacial mesenchyme [93]. Some of the offspring of matings from male Pycr1 flox/+ mice with females from the Prrx1- Cre line resulted in germline recombination events which gave rise to a viable constitutive knock out line (Pycr1 −/+). Activity of Cre-recombinase in the female Prrx1-Cre germline were described previously. The penetrance varies, depending on the particular floxed gene [93]. The recombination effect was confirmed by PCR and sequencing of the PCR products (figure 15 C). In the wild type situation, the primers used for detecting the excised allele would give rise to a product larger than 2000 bp, which could not be amplified under the chosen conditions.

6.3.4 Pycr1 knock out has an eﬃciency of 100 %

The previous section demonstrates, the homozygous germline excision of exon 3 to exon 6ofthePycr1 gene results in viable offspring. To ensure this deletion results in the loss of Pycr1 transcripts and therefore also the protein, qPCR and immuno-blot analyses on various tissues and cells were performed. The expression analyses were done with primers designed to detect the first two not affected exons. The expression levels and protein abundancy of Pycr2 was also monitored, to assess potential rescue effects by upregulation of this paralogue. Figure 16 A shows representative expression analyses on different tissues for the two paralogues Pycr1 and Pycr2. In muscle, bone and brain tissues the expression of Pycr1 is decreased down to less than 50 % in heterozygous animals. In tissues derived from homozygous animals no Pycr1 transcripts could be detected. These findings demonstrate that the deletion of exon 3 to exon 6 results in unstable and quickly degraded transcripts. The expression of Pycr2 was also affected by the loss of Pycr1. In muscle and bone tissue of heterozygous mice Pycr2 expression is significantly reduced (59 % and 52 % respectively). In homozygous conditions the reduction is even more pronounced. In brain the expression of Pycr2 remains nearly unaffected. To verify the loss of Pycr1 and the reduction of Pycr2 on protein level, immunoblots were performed (figure 16 B). The antibody used in this thesis to detect Pycr1 is also able to detect its paralogue Pycr2 (Ptglab). Immunoblots were performed on MEF lysates. The upper protein band represents Pycr1 protein and the lower one Pycr2. In accordance to the qPCR findings, in heterozygous MEFs Pycr1 abundancy was decreased to around 50 %. In homozygous knock out MEFs Pycr1 was undetectable. The abundancy of Pycr2 is not affected by the loss of Pycr1 in MEFs.

69 Figure 15: Identification of germline transmission and germline excision. PCR reactions were performed on DNA isolated from tail tips to identify mice carrying the wild type, floxed or excised allele for the Pycr1 locus. The amplicons were separated by agarose gel electrophoresis and Sanger sequenced. A, Specific amplification of the wild type allele. The sequence matches to the wild type situation. B, Detection of germline transmission of the floxed allele. The sequencing chromatography shows interruption of intron 2 by a loxP site with flanking remnants of vector backbone. C, Identification of cre recombination in the germline. Specific amplification of a fragment verifying the excision of the floxed exons. Offspring of Pycr1 flox/+ and Pycr1 flox/flox mice mated with female Prrx1-Cre mice being cre negative were analyzed. The sequencing chromatography shows intron 2 is linked to intron 6 by a loxP site with flanking remnants of vector backbone.

Taking together, the generated knock out mouse model for Pycr1 was viable and fertile, and showed no remaining expression. The knock out of Pycr1 was not rescued by an increased expression of its paralogue Pycr2, instead the expression of Pycr2 was rather decreased.

70 Figure 16: Quantification of the knock out efficiency. Validation of the knock out efficiency was performed on mRNA and protein level. To determine a potential rescue effect by upregulation of Pycr2 expression and protein abundancy this paralogue was monitored as well. A, Quantitative RT-PCR was performed on RNA isolated from quadriceps femoris, femora and whole brains from four weeks old animals. The results were normalized to Gapdh and presented as fold changes to the wild type tissues, respectively. The expression of Pycr1 in tissues derived from heterozygous mice were decreased to less than 50 % and absent in tissues from homozygous mice. The expression of Pycr2 was decreased in heterozygous quadriceps femoris and femora to approx. 60 % and to 33 % to 15 % in homozygous tissues, respectively. In brain tissue the expression of Pycr2 was nearly unaffected (all tissues, Pycr1+/+ n=3, Pycr1+/- n=3, Pycr1-/- n=3). Error bars are representing SD. B, Representative western blot analyses of different MEF lines. The upper protein band represents Pycr1 and the lower band Pycr2. Note that Pycr1 was completely vanished in homozygous ko cells. Pycr paralogues were detected with a rabbit anti-Pycr antibody (Ptglab), Gapdh (Santa Cruz) served as loading control.

6.4 The Pycr1 mouse model reﬂects major aspects of the human disease

To analyze if the Pycr1 knock out mouse model, which was generated in the scope of this thesis, reﬂects the aspects of human PYCR1-related autosomal recessive cutis laxa, in the further course of thesis only homozygous constitutive knock out (Pycr1 −/−) mice were studied. Animals were examined in tree postnatal stages: 4 weeks of age (juvenile), 8 weeks and 12 weeks of age (adult). The characterization was mainly focused on the most aﬀected tissues of the human disease: skin, skeleton and skeletal muscles.

71 6.4.1 Pycr1 −/− mice present a skin phenotype

Murine skin diﬀers in many respects from human skin. The major aspect is that murine skin contains a cutaneous muscle layer, panniculous carnosus, which is absent in human skin. The panniculous carnosus allows the movement of the skin and gives it more elasticity. Skin biopsies of Pycr1 −/− and Pycr1 +/+ mice were examined for alterations in the structure and composition of the skin layers using histological stainings of paraﬃn sections and transmission electron microscopy.

6.4.1.1 Pycr1 −/− mice have hypoplastic dermis

Skin sections of 4 weeks, 8 weeks and 12 weeks old mice were histologically analyzed after Elastica-van-Gieson-Staining (EvG-staining) and the diameter of the dermis was measured. Ten sections per animal were analyzed and at least in 20 areas per section the diameter was determined. Six Pycr1 wild type and four knock out animals were analyzed for 8 weeks old mice and for 4 weeks and 12 weeks old animals each three wild type and knock out animals were investigated. In all three groups a reduction in the thickness of the dermis could be observed. In skin biopsies of mice with 8 weeks of age a clear hypoplasia of the dermis with 30 % reduction of the diameter was observed (figure 17 A and C). The dermal diameter of 4 and 12 weeks old Pycr1 knock out mice also showed a mildly reduced diameter, which was not significantly different from control mice (figure 18 A and B). The diameter of the hypodermal fat tissue and muscle tissue were also measured, but no significant differences were observed (data not shown).

6.4.1.2 Extracellular matrix components in Pycr1 −/− dermis remains unchanged

As described in section 6.4.1.1 significant alterations in the dermal layer could be determined in skin specimens from animals at 8 weeks of age (figure 17 A). Therefore skin biopsies of these animals were further characterized for ultra structural changes in the composition of extracellular matrix (ECM) proteins. Especially the organization, abundance and caliber size of collagen and elastic fibers were assessed (figure 17 B). Preparation of the specimens (fixation, embedding) was done by Beatrix Fauler (MPIMG, Berlin). Further processing and assessment of ECM proteins was done by Prof. Ingrid Haußer (University Hospital, Heidelberg). No differences in the ultra structure of the dermal layer of Pycr1 deficient mice were observed. Taking together these findings, the loss of Pycr1 has an impact on the development of the dermis, but not on the production of ECM proteins of skin fibroblasts.

72 Figure 17: Structural and ultra structural observations in Pycr1 deficient skin. A, Representative histological skin sections. Elastica van Gieson staining on skin sections embedded in paraffin of eight weeks old animals. Genotype is indicated. ED: epidermis, D: dermis, HD: Hypodermis, HF: hair follicle. Note the hypoplasticity of the dermal layer. B Representative ultra structural images. Transmission electron microscopy (TEM) was performed on skin sections of eight weeks old animals. No significant differences in abundance, structure or caliber size of elastic and collagen fibers were observed. ELN: elastic fibers, Col: collagen fibers. C Quantification of diameter of the dermal layer. In histological sections the thickness of the dermis was measured (Pycr1 wt n=6 animals, Pycr1 ko n= 4 animals). Ten sections per animal were analyzed and per section at least 20 measurements were performed. Note the severe hypoplasia with 30 % reduction of the dermal diameter in Pycr1 deficient mice. Error bars are representing SD.

6.4.2 Pycr1 −/− mice present a bone phenotype

Pycr1 deficient animals were analyzed for different parameters regarding bone formation and turn-over. The focus in this study was on the trabecular bone of long bones of the lower limbs and especially on the tibiae. The aim was to assess whether the absence of Pycr1 reflects the human osteopenia phenotype. Furthermore it was intended to elucidate the mechanisms behind this.

6.4.2.1 Pycr1 −/− mice show osteopenia

The micro-CT technique has become a standard tool for the evaluation of bone structure and architecture. It allows direct 3D measurement of trabecular morphology, such as the volume of trabecular bone (bone volume to total volume BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th) and separation (Tb.Sp). Long bones of the lower extremities of Pycr1 −/− mice were examined with this technique and compared to their wild type siblings. Representative 3D reconstructions and quantiﬁcation of the standard trabecular bone parameters are shown in ﬁgure 19. The

73 Figure 18: Pycr1-deficiency causes alterations in murine skin. Representative histological skin sections. A, Elastica van Gieson staining on skin sections embedded in paraffin of mice with indicated age. Note the decreased thickness of the dermal layer in Pycr1-deficient mice.B Quantification of diameter of the dermal layer. In histological sections the thickness of the dermis was measured (both ages: Pycr1 wt n=3 animals, Pycr1 ko n= 3 animals respectively). Ten sections per animal were analyzed and per section at least 20 measurements were performed. Error bars are representing SD. presented data were gathered from n=6 Pycr1 +/+ n=5 and Pycr1 −/− tibiae of 4 weeks old mice. The bone volume to total volume ratio in Pycr1 deficient mice was significantly reduced to 50 % (p= 0.04) and the trabecular number was also dramatically lowered to 57 % (p= 0.06). Additional slight, but not significant, reduction of the trabecular thickness and increase of the space between individual trabecles was detected. These data indicate clearly an osteopenia in tibiae of 4 weeks old Pycr1 deficient animals. Tibiae of mice in the ages of 8 weeks (five wild type and knock out animals, each) and 12 weeks (four wild type and five knock out mice) were also scanned with the micro-CT technique. The results are presented in figure 20. In adult Pycr1 deficient mice there was only a consistent, but not significant tendency for trabecular bone osteopenia.

Furthermore femora of Pycr1 deficient mice at the above mentioned ages were analyzed (figure 21). Although there was a robust tendency towards a reduced trabecular bone mass the differences did not reach statistical significance. To summarize, Pycr1 deficient mice show a osteopenia phenotype in long bones of the lower limbs. In tibiae this observation was more prominent than in the femora. The osteopenia is more pronounced in bones of 4 weeks old mice than in elderly animals, indicating a rather regressive than a progressive course of disease.

74 Figure 19: Pycr1-deficiency causes a reduction of trabecular bone in tibiae from 4 week old juvenile mice. Radiological visualization and quantification of bone parameters. A Representative micro-CT 3D reconstructions. Medium resolution micro-CT (10μm, skyscan) images of control (Pycr1 +/+) and (Pycr1 −/−) tibiae from 4 week old mice. B Quantitative analysis of micro-CT scans from tibia showing osteopenia. Analyses were performed on the trabecular bone of tibiae from five control (Pycr1 +/+) and six knock out animals (Pycr1 −/−). Significant reduction of the bone volume to total volume ratio (BV/TV) and the number of trabecles (Tb.N) was observed. The trabecular thickness (Tb.Th) was slightly decreased and the trabecular separation (Tb.Sp) slightly increased. Error bars are representing SD.

Figure 20: differences in the trabecular bone in tibiae from 8 and 12 week old adult mice. Radiological visualization and quantification of bone parameters. Quantitative analysis of micro-CT scans from tibiae showing mild osteopenia. Analyses were performed on the trabecular bone of tibiae from five control (Pycr1 +/+) and knock out animals (Pycr1 −/−) for mice in the age of 8 weeks and four control and five knock out animals in the age of twelve weeks. Reduction of the bone volume to total volume ratio (BV/TV), number of trabecles (Tb.N) and trabecular thickness (Tb.Th) was observed. Error bars are representing SD.

6.4.2.2 Pycr1 −/− mice show histomorphometrical alterations

Further characterizations of the bone phenotype caused by Pycr1 deﬁciency, were performed in tibial bone of 4 weeks old animals. To better understand the decreased bone

75 Figure 21: No differences in the architecture of trabecular bone of femora. Radiological visualization and quantification of bone parameters. Quantitative analysis of micro-CT scans from femora showing mild osteopenia. Analyses were performed on the trabecular bone of femora from each n=4 wt am ko mice at the age of four weeks, each n=5 wt am ko mice at the age of eight weeks and n=4 wt mice and n=5 ko mice at the age of twelve weeks. Reduction of the bone volume to total volume ratio (BV/TV), number of trabecle (Tb.N) and trabecular thickness (Tb.Th) was observed. Error bars are representing SD. volume of Pycr1 deficient mice, described in section 6.4.2.1, tibiae of 4 weeks old animals were histologically examined. Bones were embedded in MMA (without decalcification) and sectioned in 5 μm slices. Osteoclasts, bone resorbing cells, were specifically visualized with the TRAP staining and counterstained with light-green (collagen, bone matrix) (figure 22 A). Tibiae of five wild-type and three knock out mice were quantified for the abundance of osteoclasts. Per tibia three to four sections were analyzed. The total number of osteoclasts surround- ing the trabecules were determined and normalized to the perimeter of trabecular bone (N.Oc/B.pm (/mm)). Surprisingly, the number of osteoclasts at the trabecules were significantly decreased by 25 % in Pycr1 deficient mice (p=0.003). This finding indicates, that the loss of Pycr1 does not affect the differentiation and/or activation of osteoclasts but potentially the homeostasis of bone formation and resorption. Masson-Goldner staining was performed on tibiae sections to further analyze osteocytes (figure 22 B), a major source of osteoclast-inducing Rankl. At the cortical bone near the proximal metaphysis of tibiae of 4 weeks old mice, the number of osteocytes per bone area (N.Ocyt/B.area (/mm)) were determined. Tibiae from n= 4 wild type and Pycr1 deficient mice, respectively, were analyzed. Three to four sections per animal were taken into account. The results show that the number of osteocytes in Pycr1 deficient mice were mildly, but not significantly decreased. Additionally Pycr1 deficient osteocytes appeared to be abnormally large, indicating a possible differentiation problem.

76 Osteocytes are mechanosensory cells that control the activity of osteoblasts (bone formation) and osteoclasts (bone resorption) [94]. Thus, bone turnover seemed to be impaired in Pycr1 deﬁcient mutants.

Figure 22: Pycr1-deficiency causes histomorphometrical changes. Representative histological sections of tibiae and histomorphometrical evaluation. A Representative images of Trap-light green staining on MMA embedded tibiae sections of 4 weeks old Pycr1 −/− animals and wild type siblings, to visualize osteoclasts. Histomorphometrical analyses revealed decreased number of osteoclasts in knock out animals. The number of osteoclasts was normalized to the perimeter of trabecular bone (N.Oc/B.pm/mm). The quantification was performed on n=5 Pycr1 +/+ and n=3 Pycr1 −/− tibiae. B Representative images of Masson-Goldner staining on MMA embedded tibiae sections of 4 weeks old animals. The number of osteocytes was decreased. Osteocytic number was determined in relation to cortical bone area (N.Ocyt/B.area/mm) in on Pycr1 +/+ n=4, Pycr1 −/− n=4 tibiae. Osteocytes of Pycr1 deficient cortical bone appeared to be enlarged, indicating terminal differentiation to mature osteocytes might be impaired. Error bars are representing SD.

6.4.2.3 Pycr1 −/− mice show defects in bone homeostasis

In order to verify the hypothesis that a deficiency of Pycr1 has an effect on bone homeostasis resulting in decreased bone volume, expression patterns of different osteoblastic and osteocytic markers were assessed. For quantitative RT-PCR, RNA was isolated from tibiae of 4 weeks old Pycr1 −/− (n=4) and control siblings (n=3). Bone marrow cells and the epiphyses were removed and the remaining diaphyses were fractionated into osteocyte- and osteoblast-enriched fractions, to better identify differences between these two cell types and to minimize adulteration. Figure 23 shows the expression pattern for the osteocytic fraction. All osteoblastic and osteocytic markers were more or less downregulated in Pycr1 deficient mice. The early osteoblast markers Collagen1a1 and Collagen1a2 were solely slightly downregulated whereas late osteoblast markers like Osterix (Osx, p=0.04), Osteocalcin (Bglap, p=0.03) and Osteopontin (Ssp1, p=0.01) were significantly less expressed. Likewise the osteocyte marker Sclerostin (Sost, p=0.01) and Fibroblast growth factor 23 (Fgf23, p=0.03) were

77 significantly downregulated in Pycr1 deficient mice. These results argue for maturation problems of early osteoblasts to terminally differentiated osteocytes. In figure 24 the osteoblast and osteocyte marker expression profile of the osteoblast enriched fraction is presented (n=2 Pycr1 +/+ and n=2 Pycr1 −/− ). In this fraction, no osteocyte marker genes were detected. The expression of all osteoblast markers were decreased in Pycr1 −/− mice. The osteoblast marker Osterix was significantly reduced (p= 0.04) in the mutant group, like it was shown for the osteocyte fraction. Interestingly, Receptor activator of NF-κ B Ligand (RankL) was substantially upregulated (p= 0.02). Rankl is a key factor for osteoclast differentiation and activation. Whereas the expression of Osteoprotegerin (Opg), the antagonist of Rankl, was not changed. These results seem to be contrary to the observation in section 6.4.2.2, that the number of osteoclasts was reduced. However, it could explain the reduction of trabecular bone volume in Pycr1 −/− animals (section) 6.4.2.1.

To summarize, tibiae of 4 weeks old Pycr1 −/− mice had reduced trabecular bone volume and a lower trabecular number. The osteoclast activation factor Rankl was upregulated, which could explain the loss of bone material, but the number of osteoclasts was reduced compared to wild type mice. Moreover osteocytes were not terminally mat- urated and their number was decreased. This was supported by the fact that marker genes for late osteoblastic and osteocytic diﬀerentiation are downregulated. Together, this demonstrates, that a deﬁciency of Pycr1 causes defects in bone homeostasis.

6.4.3 Pycr1 −/− mice present a muscular phenotype

Patients suffering from autosomal recessive cutis laxa often present with muscular hypotonia. The skeletal muscular system has a high energy demand and therefore is dependent on fully functional and efficient ATP production by oxidative phosphorylation. Therefore, the skeletal muscular system of the Pycr1 knock out mouse model was investigated. All analyses were conducted on the quadriceps femoris whereas for histology specifically the Musculus vastus intermedius was examined, which is a muscle located in the center of the quadriceps femoris.

78 Figure 23: Expression analyses on enriched osteocytes. Quantitative RT-PCR performed on RNA isolated from enriched osteocytic fractions of tibiae from four week old animals (n=3 Pycr1 +/+ and n=4 Pycr1 −/− ) and normalized to Gapdh. Early osteoblastic markers Collagen1a1 (Col1a1) and Collagen1a2 (Col1a2) were slightly decreased but late osteoblastic markers osterix (Osx, p=0.04), Osteocalcin (Bglap, p=0.03), Osteopontin (Ssp1, p=0.01) and osteocytic marker (Sost, p=0.01) and Fgf23 (p=0.03) were signiﬁcantly downregulated in Pycr1 deﬁcient mice. Error bars are representing SD.

6.4.3.1 Pycr1 −/− mice have inhomogeneous skeletal muscle ﬁber size

Firstly, cryo-sections were stained with hematoxylin and eosin (HE) to get an overview concerning the size and shape of muscle fibers. This staining allows to some degree to distinguish between the two major muscle fiber types the so called slow twitch (type I) and fast twitch (type II) fibers. Type I fibers appear to be smaller and also darker due to their high capillary density and type II fibers emerge to be larger and brighter in HE

79 Figure 24: Expression analyses on enriched osteoblasts. Quantitative RT-PCR performed on RNA isolated from enriched osteoblastic fractions of tibiae from four week old animals (n=2 Pycr1 +/+ and n=2 Pycr1 −/−) and normalized to Gapdh. Early osteoblastic markers Collagen1a1 (Col1a1) and Collagen1a2 (Col1a2) were slightly decreased but intermediate and late osteoblastic markers Osterix (Osx, p=0.04) and RankL (p=0.02) were significantly changed whereas Osteoprotegerin (Opg) remains unchanged in Pycr1 deficient mice. Error bars are representing SD. stainings. In Pycr1 mutant mice we observed that the muscle fiber sizes were inhomogeneous, meaning muscles contain many fibers with particular small and larger fibers (figure 25 A). The fiber sizes of M. vastus intermedius of n=3 Pycr1 wild type and mutant mice each were quantified in mice at four weeks of age. For this the largest diameter of each fiber was measured. To make a statistical statement four sections per animal with at least 200 cells per section were taken into account (figure 25 B). The determined cell sizes were arranged in five groups and cells were classified in these groups according to their diameter. The sizes of control and mutant muscle fibers followed a Gaussian distribution. However it was obvious that mutant fibers were smaller on average. Pycr1 −/− fibers matched more frequently to the groups of 0-10 μm and 11-20 μm (p=0.046 and p=0.02 respectively) and less frequently to the groups of 21-31 μm and 31-40 μm (p=0.02 and p=0.03 respectively). This finding indicates that the ratio of muscle fiber types in Pycr1 deficient mice was impaired. Additionally the fiber size of adult mice was measured (8w: Pycr1 +/+ n=4, Pycr1 −/− n=3 and 12W: Pycr1 +/+ n=3, Pycr1 −/− n=2). The observation of altered and inhomogeneous fiber size could also be observed in adult M. vastus intermedius, albeit the differences are not statistically significant (figure 26). However, these results support the indication, that the ratio of muscle fiber types is altered due to the loss of Pycr1.

80 Figure 25: Histological findings in Pycr1 deficient juvenile skeletal muscle. Histological overview and muscle fiber size quantification. A Representative histological muscle sections. HE staining on cryo-sections of M. vastus intermedius of four weeks old animals (genotype indicated). Black arrows denote muscle fibers with notably large or small size. B Fiber size of M. vastus intermedius sections were analyzed by measuring the largest diameter of individual muscle fibers. Fibers were classified in five groups (as indicated). Per genotype n=3 animals were analyzed. Per animal four sections and per section at least 200 cells were measured. The results present the number of cells with diameters ranging in the indicated groups per cross sectional area. Error bars are representing SD, * indicates significant differences (p-value below 0.05).

6.4.3.2 Pycr1 −/− show altered skeletal muscle ﬁber type proportion

To confirm this observation type I muscle fibers (Myosin slow) were stained immunohistochemically on cryo-sections (figure 27 A). The number of type I fibers were counted in n=3 mutant and wild type muscles, respectively, and four sections per muscle (M. vastus intermedius) of 4 weeks old mice. In figure 27 B the quantity of Myosin slow positive cells are plotted in relation to the cross sectional area. In Pycr1 −/− mice the number of type I muscle fibers is significantly increased (p=0.001). This result approves the disproportion of type I and type II fibers in M. vastus intermedius. Additional, the expression of myosin 4 (Myh4, specific for type II fibers) and myosin 7 (Myh7, specific for type I fibers) was measured in RNA isolated from quadriceps femoris (n=3 Pycr1 wild type and n=4 mutant mice, figure 27 C). The specific expression for myosin 4 was downregulated and the expression for myosin 7 was upregulated in Pycr1 deficient muscle, substantiating the muscle fiber type disproportion. In comparison to fast twitch fibers, the slow twitch muscle fibers have high oxidative capacity and therefore a high mitochondrial density. The mitochondrial mass in quadriceps femoris (n=8 Pycr1 wild type and mutant muscle, respectively) was appraised by quantitative PCR on isolated total DNA (genomic gDNA and mitochondrial mtDNA). The ratio of the mitochondrial encoded gene Cytochrome C Oxidase I (Co1) and the nuclear encoded encoded NADH dehydrogenase [ubiquinone] flavoprotein 1 (Ndufv1) is presented in figure 27 D. The mtDNA/gDNA ratio is 30 % increased in Pycr1 −/− muscle implying a higher mitochondrial density.

81 Figure 26: Histological findings in Pycr1 deficient adult skeletal muscle. Histological overview and muscle fiber size quantification. A Representative histological muscle sections. HE staining on cryo- sections of M. vastus intermedius of eight and twelve weeks old animals (genotype indicated). Black arrows denote muscle fibers with notably large or small size. B Fiber size of M. vastus intermedius sections were analyzed by measuring the largest diameter of individual muscle fibers. Fibers were classified in five groups (as indicated). At the age of eight weeks n=4 Pycr1 +/+and n=3 Pycr1 −/− were analyzed and at the age of twelve weeks n=3 Pycr1 +/+ and n=2 Pycr1 −/− mice. Per animal four sections and per section at least 200 cells were measured. The results present the number of cells with diameter ranging in the indicated groups per cross sectional area. Error bars are representing SD.

To confirm the muscle fiber type disproportion in adult mice, sections of M. vastus intermedius of eight and twelve weeks old mice were also stained immunohistochemically for skeletal slow myosin. The number of type I fibers were counted in n=3 mice per genotype for eight weeks old and n=4 mice for twelve weeks old animals (figure 28). As described in the literature [95] a decrease in the number of myosin slow positive cells with increasing age was observed. Corresponding to the data shown for juvenile mice, in eight weeks old mice the number of type I muscle cells is increased significantly in Pycr1 deficient mice. In twelve weeks old mice the numbers of myosin slow positive cells is comparable low in both, Pycr1 wild type and knock out mice, and even lower in Pycr1 deficient mice, compared to theire wild type siblings. These data suggest that the muscle fiber type disproportion is regressive in Pycr1 deficient mice. To sum up, a deficiency of Pycr1 led to a significant increase in the number of slow

82 Figure 27: Analyses of muscle fiber type proportion in juvenile mice. Histological and expression analyses of muscle fiber type proportion in Pycr1 deficient quadriceps femoris. A Representative im- munohistological muscle sections. Slow twitch muscle fibers (skeletal slow myosin (Sigma-Aldrich)) were detected on cryo-sections of M. vastus intermedius of four weeks old animals (genotype indicated). White arrows indicate myosin slow positive cells. B Myosin slow positive cells were counted in three animals per genotype and four sections per animal. The number of myosin slow positive cells were normalized to the cross sectional area of the M. vastus intermedius. Pycr1 −/− mice present significantly more slow twitch fibers (p=0.01). C The expression of Myosin 4 (Myh4) and Myosin 7 (Myh7) was assessed and normalized to Gapdh in n=3 Pycr1 wild type and n=4 mutant quadriceps femoris. Myh4 was downregulated and Myh7 was upregulated in mutant mice. D The abundance of mitochondria in quadriceps femoris biopsies was deduced by comparing the ratio of mtDNA to gDNA. qPCR was performed with specific primers for Co1 (mtDNA) and Ndufv1 (gDNA). The results present the fold change ratio of Co1/Nduvf1. Pycr1 +/+ n=8, Pycr1 −/− n=8. The mitochondrial mass was 30 % increased in specimens from Pycr1 −/− mice. Error bars are representing SD, * indicates significant differences (p-value below 0.05), n.s. indicates none significant differences (p-value above 0.05). twitch muscle fibers in quadriceps femoris of 4 and 8 weeks old mice. Myh7, a marker for slow twitch muscle fibers was increased and Myh4, which is specifically expressed in fast twitch muscle fibers was decreased in quadriceps femoris of 4 weeks old animals. Furthermore a tendency toward and increased mitochondrial density was observed. This phenotype vanished in adult mice at 12 weeks of age.

83 Figure 28: Analyses on muscle fiber type proportion in adult mice. Histological and expression analyses of muscle fiber type proportion in Pycr1 deficient quadriceps femoris. A Representative im- munohistological muscle sections. Slow twitch muscle fibers (skeletal slow myosin (Sigma-Aldrich)) were detected on cryo-sections of M. vastus intermedius of adult animals (age and genotype indicated). White arrows indicate myosin slow positive cells. B Myosin slow positive cells were counted in n=3 mice per genotype for eight weeks old and n=4 mice for twelve weeks old animals. The number of myosin slow positive cells were normalized to the cross sectional area of the M. vastus intermedius. Pycr1 −/− mice of eight weeks of age presented significantly more slow twitch fibers (p=0.008). Twelve weeks old mice showed no differences. Error bars are representing SD, * indicates significant differences (p-value below 0.05), ** indicates highly significant differences (p-value below 0.01).

6.4.3.3 Pycr1 −/− mice show altered expression of ﬁber type determination genes

It was described [96] that the transcription factor family Mef2 (Myocyte enhancer factor) together with calcineurin is involved in the determination of muscle fiber types. It was hypothesized that Mef2 could be responsible for the excessive formation of type I muscle fibers in Pycr1 deficient mutants. Expression levels of Mef2a, Mef2c and Mef2d were measured by quantitative RT-PCR on RNA isolated from quadriceps femoris (n=5 Pycr1 wild type and n=6 mutant muscle, figure 29 A) of 4 weeks old animals. The expression of all three Mef2 paralogues were slightly increased in Pycr1 −/− mice, but these changes did not reach statistical significance.

84 Figure 29: Expression pattern of fiber type determination and ROS detoxifying genes. Quantitative RT-PCR performed on RNA isolated from quadriceps femoris of four week old animals, normalized to Gapdh. Pycr1 +/+ n=5, Pycr1 −/− n=6. A Expression pattern for the Myocyte enhancer factor paralogues Mef2a, Mef2c and Mef2c. All three genes were slightly upregulated in Pycr1 deficient muscle. B Expression pattern for the cytoplasmic (Copper-Zinc Superoxide dismutase, CuSod) and mitochondrial (Manganase Superoxide dismutase, MnSod and Glutathione peroxidase1, Gpx1) detoxification genes. Only MnSod was significantly upregulated (p=0.03) in muscle biopsies from Pycr1 −/− mice compared to controls. Error bars are representing SD.

It is assumed, that the Mef2 transcription factor family also activates the mitochondrial ROS detoxiﬁcation enzyme Manganase Superoxide dismutase (MnSod) via p38 [97]. In previous experiments, we demonstrated that mutations in PYCR1 cause mitochondrial dysfunction (section 1.1.2.5). Mitochondrial dysfunction often leads to increased ROS production, which can be rescued by the mitochondrial detoxiﬁcation enzymes Manganase Superoxide dismutase (MnSod) and Glutathione peroxidase1 (Gpx1) and the cytoplasmic Copper-Zinc Superoxide dismutase (CuSod). In quantitative RT-PCR performed on RNA

85 isolated from muscle biopsies (figure 29 B) MnSod was significantly upregulated in Pycr1 deficient mice. In conclusion, Mef2 transcription factors might contribute to the fiber type siwtch and the elevated MnSod expression. However, other signaling pathways are likely to be involved.

6.5 Pycr1 deﬁciency causes mitochondrial dysfunction

In the previous section (section 6.4) it was demonstrated, that the knock out of Pycr1 coincided with tissue specific developmental defects reflecting the cardinal symptoms of PYCR1-related autosomal recessive cutis laxa, albeit a phenocopy of the human disorder could not be achieved. In an earlier study, we could demonstrate that the pathomechanism behind the human disease appears to be due to mitochondrial dysfunction leading to developmental changes through increased apoptosis [16]. In order to understand the pathophysiological basis behind the murine Pycr1 deficiency phenotype, mitochondrial integrity and function were assessed in MEFs and muscle specimens derived from wild type and Pycr1 knock out mice.

6.5.1 Pycr1 deﬁciency causes metabolic changes

Firstly, it was aimed to assess the structure of the mitochondrial network. Pycr1 wild type and ko MEFs were stained with an antibody detecting both Pycr paralogues in green (Ptglabs) and co-stained with an anti-Cytochrome C antibody as mitochondrial marker in red (figure 30). The co-localization of Pycr with the mitochondrial marker indicated the mitochondrial localization of the Pycr paralogues, as we hypothesized, since it was shown for the human orthologues [16], [35]. In Pycr1 ko MEFs the green Pycr signal was remarkably decreased, but still detectable due to the remaining Pycr2 expression (figure 30 A, lower panel). Under standard cultivation conditions (10 % FCS and 4.5 g/l glucose) it was obvious that the mitochondrial network of Pycr1 deficient MEFs was fragmented to some degree (figure 30 A i). To analyze whether the loss of Pycr1 increases the sensitivity to starvation stress (0.1 % FCS, no glucose) with a massive fragmentation of the mitochondrial network as result, such it was shown for PYCR1 deficient HAFs in figure 4, wild type and ko MEFs were cultured under starvation conditions. The effect shown in figure 4 could not be repeated with murine Pycr1 deficient cells. After two hours of exposure to starvation conditions, mitochondria of both, wild type and ko cells began to hyperfuse (figure 30 A ii). After 24 hours of starvation stress the highly interconnected networks started to undergo fission

86 Figure 30: Structure of mitochondrial network under starvation stress. A Representative immonofluorescence images of control (Pycr1 +/+) and knock out (Pycr1 −/−) MEFs stained for Pycr paralogues in green (Ptglab) and Cytochrome C in red (Abcam). Cells were cultured with standard conditions (10 % FCS, 4,5g/l glucose) and starvation conditions (0.1 % FCS, no glucose). No significant differences in the structure of mitochondrial network were observed. But Pycr1 −/− cells appeared to have a higher abundance of mitochondria. B Quantification of mitochondrial mass. The abundance of mitochondria in MEFs was quantified by comparing the ratio of mtDNA to gDNA. qPCR was performed with specific primers for Co1 (mtDNA) and Ndufv1 (gDNA). The results present the fold change ratios of Co1/Nduvf1. Pycr1 +/+ n=3, Pycr1 −/− n=3. Error bars are representing SD.

(figure 30 A iii) and after 48h massive cell death was observed. The remaining cells appear to be rather apoptotic than necrotic, due to shrinkage of the cell and the nucleus and nuclear condensation (figure 30 A iv). Although an increased sensitivity to starvation stress was not observed in Pycr1 deficient cells, the conducted experiment indicates an elevated mitochondrial density in Pycr1 ko

87 MEFs. Therefore the mitochondrial mass was estimated as described earlier. The ratio of mtDNA to gDNA was mildly increased (10 %) in Pycr1 −/− (30 B i and ii), which was not significant and does not suffice to explain the increased mitochondrial mass suggested by immunofluorescence staining. To analyze aspects of mitochondrial function, parameters for energy metabolism were assessed. The concentration of lactate in culture medium supernatant of control and starved (48h) MEFs were measured. Lactate was used as readout for ATP production via glycolysis. Additionally intra- and extracellular ATP concentrations were measured under the mentioned conditions. Figure 31 A demonstrates that lactate concentrations were significantly elevated under both conditions by 50 %. Furthermore no decreased ATP levels were observed under both conditions (figure 31 B).

Figure 31: Energy metabolism in Pycr1-deﬁcient MEFs. The presented results are average values of two independent measurements of each three diﬀerent cell clones in triplicates. A Lactate concentration was determined in the culture medium 48h after cultivation under standard or starvation conditions, respectively (BioVision). Note the increased concentrations in Pycr1 −/− MEFs, especially under starvation conditions (p=0.02). B ATP was measured in cells and medium (Roche). The ATP concentrations showed a slight tendency to be increased in −/− MEFs. Results are normalized to DNA content (Picogreen). Error bars are representing SD.

Pycr1 deficient MEFs did not respond with fragmentation of their mitochondrial network to moderate starvation stress, like it was shown for PYCR1 deficient HAFs. They rather sustained stress-induced mitochondrial hyperfusion (SIMH) like Pycr1 wild type MEFs. However, Pycr1 lacking MEFs present a higher mitochondrial density. The lactate concentration in culture medium supernatants of Pycr1 deficient cells is remarkably increased and even more under starvational terms, indicating a deficiency in mitochondrial energy metabolism resulting in an elevation of ATP production via glycolysis. Increased ATP concentration in Pycr1 −/− MEFs could be explained by increased energy demand due to a constant stress exposure resulting from the loss of Pycr1.

88 In order to further elucidate the integrity and energy metabolism, muscle specimens were analyzed by transmission electron microscopy (TEM) for structural changes of mitochondria (ﬁgure 32 A). In quadriceps femoris of Pycr1 deﬁcient mice numerous mitochondria have an abnormal structure. The cristae were deformed and appeared to decay. They did not exhibit the typical cross-striped structure. Also the mitochondrial outer membrane integrity seemed to be disturbed. TEM analyses were kindly performed by Beatrix Fauler, EM-facility of the MPI-MG, Berlin.

Figure 32: Mitochondrial ultrastructure and characterization of the OXPHOS complexes in muscle. A TEM images of mitochondria in Quadriceps femoris. n=1 Pycr1 wt and ko animals were analyzed. Numerous mitochondria of appeared with deformed cristae that did not exhibit the typical cross-striped structure. The mitochondrial outer membrane integrity seemed to be disturbed. B Characterization of the OXPHOS complexes in Quadriceps femoris. The activity of the five complexes were measured in n=9 Pycr1 wt and ko animals. No significant differences in the activity of the single complexes could be observed. Error bars are representing SD.

The mitochondrial respiratory chain (OXPHOS system) consists of five multimeric complexes which are located at the inner mitochondrial membrane. Oxidative phosphorylation is the major source of aerobic ATP production. Dysfunction of single or multiple complexes of the OXPHOS system are common cause of mitochondrial diseases. Therefore the activity of the OXPHOS complexes in quadriceps femoris was assessed (n=9 specimens from wild type and Pycr1 −/− mice respectively). No significant differences in the activity of the single complexes could be observed. The measurement of the complex activities was kindly performed by Dr. Thatjana Gardeitchik, Radboud University Nijmegen.

To sum up the findings of this section: Mitochondria of Pycr1 deficient MEFs cultured in standard conditions were mildly fragmented. The loss of Pycr1 did not enhance the fragmentation under starvation conditions but it led to significantly increased lactate production. The mitochondrial ultrastructure appeared to be abnormal with deformed cristae and loss of mitochondrial outer membrane integrity. However the complex activities of the mitochondrial respiratory chain were not affected. This indicates that the loss of Pycr1 has an effect on mitochondrial structure, integrity and metabolism, yet the function

89 of Pycr1 on these eﬀects remains unclear.

6.6 Expression and biochemical comparison of PYCR paralogues in men and mice

6.6.1 Human and murine PYCR paralogues are similarly expressed in adult tissues

To ascertain the quantity of human and murine PYCR transcripts in different tissues and also to determine the ratio of both paralogues, absolute quantification of the four PYCR gene products was performed. The results in figure 33 are presented as number of transcripts (gene of interest) per copy of the housekeeping gene GAPDH. cDNAs from human tissues were purchased from Clonetech. cDNAs were made from pooled tissues from three to fifteen healthy female and male Caucasians with ages raging between 19 and 69 years. Murine cDNAs were produced from pooled tissues from five adolescent female and male animals at the age of 5 weeks. In human tissues the transcripts appeared to be slightly more abundant. In most of the analyzed tissues of both species PYCR2 was four- to fifteen-fold higher expressed than PYCR1. The quantity of PYCR1 transcript was ranging between around one (heart, brain, liver, lung, kidney muscle and skin) and 70 (pancreas) copies per GAPDH molecule. The number of PYCR2 copies ranged between three and twenty copies per GAPDH transcript, except in skin, where less than one copy of PYCR2 per GAPDH was detected. In pancreatic tissues both paralogues were much more abundant than in the other tested tissues. Interestingly, PYCR1 was higher expressed than its paralogue in the most affected tissues (bone and skin) as well as in pancreatic tissue (figure 33 A and C). In murine tissues (figure 33 B and C) the number of Pycr1 transcripts were below one per GAPDH molecule in all analyzed tissues except pancreatic tissue where two copies of Pycr1 per GAPDH were present. The expression of Pycr2 ranged between 0.2 (heart, pancreas) and 3.5 (lung) transcripts per GAPDH molecule. In all analyzed murine tissues, except for pancreas, Pycr2 was two- to fifteen-fold more abundant than its paralogue. In pancreatic tissue Pycr1 was eight fold higher expressed. Figure 33 C presents the ratio of human and murine PYCR1 to PYCR2. In liver, kidney and pancreas, murine Pycr1 expression was higher than the Pycr2 expression. In skin, bone, placenta and lung human PYCR1 was higher expressed than PYCR2. This is notable, since these expression ratios correlated with disease expression in the different tissues in PYCR1-related ARCL.

90 Figure 33: Human and murine PYCR paralogues are similarly expressed. Absolute qPCR was performed to determine the number of specific transcripts in various tissues. Plasmids containing either the whole gene of interest or the amplicons of interest were cloned and used as templates for the standard curves. The standard curves were generated by 1:10 dilutions. The dilutions 10−3 ng/μl to 10−7 ng/μl were used for the standard curves. To avoid loss of DNA at these dilutions, all reactions were performed in nuclease-free H2O with 0.01 % Tween20. The results are presented as copy per molecule of the housekeeping gene (GAPDH). A Absolute quantification of PYCR1 and PYCR2 in a panel of human adult tissues (Human MTC Panel I, Clonetech). B Absolute quantification of Pycr1 and Pycr2 in a panel of murine adult tissues. C Ratio of PYCR1 to PYCR2 in the analyzed tissues. Error bars are representing SD.

6.6.2 Human and murine PYCR proteins are diﬀerently post-translationally modiﬁed

To accentuate the differences and similarities between human and murine PYCR paralogues, Western blot analyses were performed on cells expressing endogenous PYCRs and additionally on cells deficient for murine/human PYCR1 or cells over expressing murine/human PYCR1 and PYCR2. The antibody used in this thesis detects both paralogues of both species. In western blot analyses under reducing conditions (SDS-PAGE) the size of the four proteins appears to be different. The size of the PYCR proteins estimated with in-silico predictions (www.bioinformatics.org) are roughly the same (hPYCR1 33.37 kDa; hPYCR2

91 33.64 kDa; mPycr1 32.38 kDa; mPycr2 33.66 kDa). In lysates from human fibroblasts (HAF) the PYCR2 protein appeared to be approximately three to five kDa larger than its paralogue (figure 34 A). The paralogues could be distinguished by comparing lysates from wild type cells to lysates from PYCR1 deficient cells. PYCR1 deficient HAFs are carrying the p.K215_D319del mutation, resulting in an unstable protein. Figure 34 A shows clearly that the lower band is almost undetectable in lysates from affected HAFs, leading to the conclusion that this band corresponds to PYCR1. Additionally V5 tagged PYCR1 and PYCR2 were stably over-expressed in HeLa cells. The resulting proteins were detected with an anti-V5-antibody (Sigma-Aldrich). The results in figure (34 B) confirm that PYCR1 runs approx. three to five kDa lower than its paralogue PYCR2. Since the predicted difference in the size of the two proteins is only 0.3 kDa, this deviance can be explained by post-translational cleavage or ubiquitination. Surprisingly, the size ratios of murine Pycr1 and 2 were different (figure 34 C). The upper band, representing Pycr1 is diminished in heterozygous Pycr1 ko cells and absent in homozygous cells. Figure 34 D shows a western blot made by protein lysates from NIH3T3 cells, transiently over-expressing flag tagged mPycr1 and mPycr2. Proteins were detected with an anti-flag antibody (Sigma-Aldrich). The result indicated clearly that the size distribution and therefore the post-translational modification of murine Pycr paralogues are inversed to human PYCR paralogues.

6.7 The knock down of Pycr paralogues decreases stress resistance and increases apoptosis

Previously it was mentioned that three paralogues of Pycr exist. Pycr1 and Pycr2 are both described to be mitochondrially localized and share 82 % sequence homology, whereas PycrL is much shorter and supposed to be cytoplasmic [35]. In this thesis it was demonstrated, that the Pycr1 −/− mouse model reflects the main phenotypic and cellular features of PYCR1-related ARCL, but in a much milder form. To better understand this species difference it was intended to study the effect of deficiency both Pycr1 and Pycr2 on the mitochondrial structure and stress response in vitro. RNAi mediated knock-down experiments were performed on murine fibroblasts (NIH3T3). The two paralogues were downregulated separately and in combination. The mitochondrial structure and the apoptosis were assessed in cells cultured under standard conditions and oxidative stress conditions (moderate concentrations of H2O2, figure 35). The structure of the mitochondrial network was visualized with Pycr (green) and Cy- clophilin (red) co-staining (upper panel). Cells were also stained for cleaved (active)

92 Figure 34: Human and murine PYCR proteins differ in their size. Western blot analyses from different PYCR expressing cells. A HAF lysates from control (Ctrl.) and PYCR1 deficient (patient; p.K215_D319del) cells. The upper band represents PYCR2 and the lower one PYCR1. B HeLa cells over-expressing V5 tagged PYCR1 or PYCR2 respectively. Note the size difference. C Pycr1 wild type (+/+) heterozygous ko(+/-) and homozygous ko (-/-) MEFs. The upper protein band represents Pycr1 and the lower band Pycr2. Note that Pycr1 completely vanishes in the homozygous ko cells. D NIH3T3 cells transiently over-expressing flag tagged Pycr1 or Pycr2 respectively. Note the size difference. A and C, proteins were detected with an antibody against PYCR (PtgLabs), C and D proteins were detected with an antibody against flag and anti V5 (both Sigma-Aldrich).

Caspase3 to monitor apoptosis shown in the lower panel. Figure 35 A illustrates the response of NIH3T3 cells to the knock down of the Pycr paralogues under control culture conditions. Firstly, the knock down efficiency can be assessed by the loss of the green staining for the Pycr paralogues. The inlayed images demonstrate a transfected cell (diminished Pycr signal) alongside to an untransfected cell. Secondly, downregulation of each paralogue led to a fragmentation of the mitochondrial network. It seems that this consequence is even more obvious in cells transfected with siRNA against Pycr2. When both paralogues were downregulated the mitochondrial fragmentation was most pronounced. Thirdly, in cells transfected with scrambled siRNA (control siRNA) no apoptosis could be detected. However, cells treated with siRNA against Pycr1 or Pycr2 respectively or double-transfected for both paralogues, sporadically showed apoptotic signals. Mitochondrial structure and apoptosis were also analyzed in siRNA treated cells under oxidative stress conditions shown in figure 35 B. To assess the impact of the Pycr paralogues to mitochondrial fragmentation when exposed to oxidative stress, cells were treated for 30min in medium containing 500 μmol H2O2. Under these conditions control cells reacted with minor differences in the integrity of their mitochondrial network. A massive fragmentation of the network occured when Pycr1 was downregulated and

93 Figure 35: Effect of Pycr1 and -2 deficiency on mitochondrial structure and apoptosis. Represen- tative immonofluorescence of NIH3T3 cells transfected for 72h with scrambled siRNA (control siRNA) or siRNA against Pycr1, Pycr2 and both. Pycr paralogues were stained in green (Ptglab) and Cyclophilin as mitochondrial marker in red (Abcam). Apoptosis was detected by monitoring the abundance of active caspase 3 (Cell Signaling). A Under control conditions knock down of Pycr1 led to a partial fragmentation of the mitochondria. Mitochondrial fragmentation occured in an even higher degree after knock down of Pycr2 and most severe after double knock down of both Pycr paralogues. Under control conditions increased apoptosis was detected in cells transfected with siRNA against both Pycr paralogues. B Deficiency of the Pycr paralogues had also in impact on the sensitivity to oxidative stress (500 μmol H2O2, 30min). Mitochondrial network of cells deficient for Pycr paralogues reacted with massive fragmentation. Under oxidative stress conditions (500 μmol H2O2, 3h) Pycr1 deficient cells showed increased apoptosis. The number of apoptotic cells was even increased in Pycr2 deficient cells and cells deficient for both Pycr paralogues showed a massive apoptosis induced cell death. mitochondrial structure was completely disrupted when Pycr2 or both paralogues were downregulated.

94 Apoptosis was determined when cells were treated for 3h in medium containing 500 μmol

H2O2. In control cells hardly any apoptosis was detected whereas in cells transfected with siRNA against Pycr1 several apoptotic cells were present. The number of cells positive for cleaved Caspase3 was even elevated in cells where Pycr2 was downregulated. The double knock down of both paralogues resulted in a massive increase of apoptotic cells. In summary, the previously shown increased sensitivity against oxidative stress with loss of the mitochondrial integrity and increased apoptosis in HAFs carrying a functional mutation in the PYCR1 gene was also evident in Pycr1 deficient cells, but in a milder form. In contrast, Pycr2 deficient cells showed these effects in an even more pronounced manner. The double knock down of both murine paralogues showed the strongest effect, indicating the close functional relation between Pycr1 and -2 and the important role of Pycr2 for maintaining mitochondrial integrity.

95 7 Discussion

Cutis laxa describes a group of connective tissue disorders and is named after its most obvious characteristic - wrinkly, lax and inelastic skin - although they are usually multisys- temic disorders involving skeletal, muscular, cardiovascular, pulmonary and central nervous systems. Many different disease causative genes have been identified mostly coding for structural extracellular matrix (ECM) proteins (ELN) [98], [99] and [100]. In recent years, genes involved in different metabolic pathways and located at different cellular compart- ments, were identified to be causative for cutis laxa, including ATP6V0A2, GORAB, P5CS and PYCR1 [13]. Whereas it is obvious, that mutations in FBLN5, EFEMP2 and ELN cause connective tissue disorders, the involvement of metabolic enzymes in the pathomechanism of cutis laxa needs a more complex explanation.As an example, it has been shown, that mutations in ATP6V0A2 result in disintegration of the Golgi cisternae with impaired secretion and increased intracellular retention of tropoelastin [19]. To learn more about the complex mechanisms behind metabolic genes causing cutis laxa, with the special focus on PYCR1-related cutis laxa, we decided to use the mouse model as a tool for further elucidation.

7.1 Generation of the Pycr1 knock out model

Mouse models are widely used and powerful tools to study human genetic disorders due to their striking similarity to humans in anatomy, physiology, and genetics. In contrast to in vitro models, knock out mouse models allow to analyze the complex consequences of the loss of a gene during the development in the whole organism. Initially, it was intended to generate a speciﬁc knock out of Pycr1 in the early limp mesenchyme. However, matings from male Pycr1 flox/+ mice with females from the Prrx1- Cre line resulted in germline recombination events which gave rise to a viable constitutive knock out line (Pycr1 −/+). In this thesis only homozygous constitutive knock out Pycr1 −/− mice were analyzed. Additionally, it would be interesting, to compare Pycr1 −/− phenotype to a conditional knock out of Pycr1 in the early limp mesenchyme. It might be possible that the very early and complete loss of Pycr1 could have activated compensatory mechanisms that reduced the developmental defects.

7.2 Pycr1 and dermal abnormalities

In Pycr1 deﬁcient mice hypoplasia of the dermis was observed, although it is not immediately clear how the loss of Pycr1 leads to this phenotype. As Pycr1 catalyzes the ﬁnal step

96 of de novo proline synthesis and collagens, which are major components of the ECM, are comprised to approx. 23% of proline and hydroxyproline [101], it could be hypothesized that the loss of Pycr1 leads to decreased proline synthesis and this in turn impairs the formation of collagen fibrils. There are several points arguing against this hypothesis: Firstly, the mitochondrial localized proline synthesis pathway involving Pycr1, is not the only cellular source for proline. It is assumed, that its paralogue PycrL is involved in a cytosolic proline synthesis cycle [35]. Additionally proline is ingested with food. Hence, energetically it would be an additional expense to transport the mitochondrially produced proline across the mitochondrial membranes, when an already cytoplasmic pool of proline is available to synthesize collagen fibrils. Secondly, the serum proline concentrations in patients suffering from PYCR1-related ARCL were unchanged, although it is not clear if proline levels measured in circulating blood accurately reflect intracellular pools in the relevant tissues. Thirdly, and more importantly, TEM of skin biopsies showed no alterations in the abundance, structure or caliber size collagen fibers in Pycr1 deficient dermis and fourthly, the skin phenotype in PYCR1-related ARCL is described to arise from rarefaction and fragmentation of elastic fibers rather than from abnormalities of collagen fibers [16]. Kretz et al. reported the only known case with slightly abnormal collagen fibers due to variable caliber size [30]. However, irregularities of elastic fibers could also not be found in Pycr1 deficient skin sections. Presumably, the dermal hypoplasia is caused by increased apoptosis and/or proliferation defects of skin fibroblasts, resulting in less cells in the dermal layer and therefore propor- tionally less ECM proteins. Skin sections and skin lysates were analyzed for differences in apoptosis and proliferation, but without success. Western blot analyses of skin lysates were not evaluable due to plenitude of secondary bands probably caused by the abundance of ceratines and ECM proteins and also due to contamination with proteases as the skin and hairs are exposed to the environment. Immunohistochemically detection of cleaved Caspase3 and cleaved Parp as indicators for apoptosis and Ki67 and pHiston3 to detect proliferation were also unsuccessful, probably due to the mentioned reasons. For future studies, it is necessary to improve the conditions or to find better techniques to detect apoptosis and proliferation in skin samples, since this a pivotal question. To date there is no evidence in favor or against this hypothesis but there are several indications substantiating for apoptosis/proliferation defects. On the one hand, increased apoptosis could be demonstrated in NIH3T3 cells treated with siRNA against the Pycr paralogues in standard and also in oxidative stress conditions. Increased apoptosis was also described by Reversade et al. [16] in patients skin fibroblasts and in Pycr1 deficient xenopus and zebrafish.

97 On the other hand, PYCR1 was initially described as proliferation-inducing protein 45 (PIG45) [31] leading to the suggestion, that Pycr1 may play a role in cell growth regulation. Thus the loss of Pycr1 could reduce the number of ECM producing cells by increased apoptosis and decreased cell proliferation. Urban et al. and Hucthagowder reported that fibroblasts producing reduced amounts ECM components have elevated proliferation rates to compensate ECM fibril production [102], [19], indicating a tightly controlled apoptosis and proliferation ratio in skin fibroblasts.

7.3 Pycr1 and bone abnormalities

One major aspect of ARCL is the development of osteopenia. Osteopenia is a common bone disease characterized by reduced bone density and increased risk of fracture and is a milder form of osteoporosis. Both osteoporosis and osteopenia are typical signs of old age. Senile osteopenia is pathophysiological characterized by low bone turn-over. The decrease in bone formation exceeds the decrease in bone resorption [103]. The cellular and molecular mechanisms behind this is to date not fully understood. The constitutive Pycr1 −/− knock out mouse model, generated and characterized in the course of this thesis, presents a low turn-over osteopenia. Reduced bone volume to total volume ratio, trabecular number and trabecular thickness were observed in femora and more pronounced in tibia of Pycr1 −/− mice. These changes were more evident in bones of 4 weeks old mice than in elderly animals, which indicate a regressive course of the disease. Further characterizations revealed a decreased number of bone resorbing osteoclasts and of osteocytes with abnormally enlarged osteocytic lacunae. Mesenchymal stem cells differentiate into immature osteoblasts, which express bone matrix protein genes through the actions of Runx2, Osterix, and b-Catenin. The immature osteoblasts differentiate into mature osteoblasts, which express high levels of Osteocalcin and Osteopontin. Finally the mature osteoblasts are embedded in the bone matrix to become osteocytes. Expression analyses on bone tissue showed that marker genes for late osteoblasts and differentiated osteocytes were significantly downregulated in Pycr1 −/− mice. The decreased number of osteoclasts and osteocytes, together with the indications for impaired osteoblastic and osteocytic differentiation suggest that Pycr1 −/− mice have lowered bone turn-over resulting in osteopenia with decreased bone formation and decreased bone resorption. The lowered number and potential differentiation defects of the bone forming cells seem to overwhelm the defects of lowered number of osteoclasts. Osteocytes are mechanosensory cells that control the activity of osteoblasts and osteoclasts [94]. The signaling of Pycr1 −/− osteocytes therefore might misregulate bone turn-over processes

98 and lead to the osteopenia phenotype. Recently, it was shown that a mesenchymal stem cell specific or a osteoblast specific knock out of Neurofibromin 1 (Nf1) causes reduced bone volume and low bone mineral content. The skeletal abnormalities are a result of premature hypertrophy of growth plate chondrocytes and increased proliferation together with impaired differentiation of oste- blasts [104]. Kühnisch et al. demonstrated that osteocytes of these mice have enlarged lacunae, increasing the porosity of the bone [105]. Detailed expression profiling of osteoblastic / osteocytic differentiation markers and further histomorphometric analyses of osteoid formation together with in vitro osteoblast differentiation experiments could help to prove, if the Pycr1-associated osteopenia phenotype is caused by differentiation and maturation defects of osteocytes. Furthermore determination of apoptosis and proliferation rates of osteoblasts would answer the question if an imbalance in these processes reduces number of osteoblasts, which in turn could explain the decreased number of osteocytes. In the late 1990s key factors of osteoclastogenesis were discovered. The RANK/RANKL/OPG system plays the central role in the differentiation and activation of osteoclasts [106], [107], [108], [109]. Osteoclasts are derived from the hematopoi- etic linage, probably from monocytes and macrophages [110]. The progenitors of the bone resorbing cells present the receptor activator of nuclear factor κ B (RANK) on their cell surface. RANKL, the ligand of RANK, is a cell surface protein mainly expressed by osteoblasts and osteocytes. The expression of RANKL is induced by osteotropic factors such as 1α, 25-5-dihydroxyvitamin D3, PTH, and IL-11 [111]. The interaction between RANK and its ligand provokes the differentiation of monocytic progenitors into osteoclasts. As both RANK and RANKL are cell surface proteins, this interaction occurs either by direct cell-to-cell contacts of osteoblasts and osteoclastic progenitors or by interaction with RANK and soluble RANKL. Soluble RANKL (sRANKL) is produced by digestion of RANKL with metalloproteinases and can thereafter subsequently be secreted. Osteo- protegerin (OPG) is another regulator of osteoclastogenesis. It is mainly expressed by osteoblasts and also to some degree by osteocytes and is the decoy receptor of RNAKL and therefore inhibits the maturation of bone resorbing cells [106], [107], [108], [109]. In enriched osteoblastic fractions of tibiae from Pycr1 −/− mice a significant upregulation of Rankl was observed. This upregulation indicates an increase in osteoclast activation and differentiation, especially when regarding the unchanged Opg expression. However, the number of osteoclasts was rather decreased than increased in Pycr1 −/− bones. It remains to be clarified why increased Rankl expression does not activate osteoclast differentiation in Pycr1 −/− mice. One possible explanation could be that Rankl cannot reach to osteoclastic precursors in

99 the bone marrow. Expression analyses were performed on enriched osteoblastic fractions. Therefore bone marrow cells and the epiphyses were removed and the remaining diaphyses were fractionated in osteocyte enriched and osteoblast enriched fractions. With this method it is not possible to distinguish between Rankl and sRankl. It can be hypothesized that the in excess produced RankL remains membrane bound and cannot be secreted in the bone marrow cavity to interact with osteoclastic precursor cells. To verify this hypothesis the ratio of membrane bound Rankl to sRankl should be determined.

7.4 Pycr1 and muscular abnormalities

Another feature observed commonly in patients suffering from PYCR1-related ARCL is muscle hypotonia with psychomotor retardation [32], [31], [16]. Muscular hypotonia describes the state of reduced muscle tone and is often accompanied with reduced muscle strength. It is a symptom underlying a heterogeneous group of disorders usually presenting at birth or in early childhood. The most common morphological defects are nemaline rods, cores of varying size, central nuclei, and type I fiber hypotrophy. Vertebrate muscles consist of two types of myofibers. Type I (slow) fibers have an oxidative metabolism and are rich in mitochondria, their contractions are of long duration because they express myosin isoforms that are specialized for slow contraction but they have only low-force. Type II (fast) fibers have a mainly glycolytic metabolism and, they express fast myosins to perform short-duration contractions with high force. Muscular hypotonia most often goes along with neurological disorders affecting the central nervous system (central hypotonia) or peripheral nervous system, concerning the neuromuscular junction at the connection between the nerve endings (peripheral hypotonia). However, in many cases hypotonia is a manifestation of metabolic and connective tissue disorders [112] as well as of congenital fiber type disproportion [113], [114]. In Pycr1 deficient mice no obvious hypotonia was observed, although muscle force was not quantitatively measured. Nevertheless, histological examinations of muscle biopsies revealed a disproportion of muscle fiber types in Pycr1 deficient M. vastus intermedius in mice of 4, 8 and 12 weeks of age. Additionally, inhomogeneous fiber sizes were observed, with the tendency of being smaller than fibers of wild type siblings. In order to analyze if this change in fiber size goes along with a change in fiber type proportion, the rates of type I fibers were conducted immunohistochemically. The results showed clearly, that the proportion of muscle fiber types in Pycr1 −/− M. vastus medialis is shifted towards type I (slow twitch) muscle fibers. Additionally the expression of specific myosin isoforms for type I fibers (Myh7) and type II fibers (Myh4) were analyzed. The results confirm the histological findings, type I specific Myh7 is up regulated in Pycr1 −/− M. vastus intermedius.

100 Furthermore the mitochondrial mass was estimated by comparing mtDNA/gDNA ratio in muscle biopsies. In Pycr1 deficient muscles the amount of mtDNA was approximately 30 % higher compared to wt mice, indication Pycr1 −/− quadriceps femoris possess more mitochondria which in turn confirm the finding, that type I fibers are more abundant in Pycr1 deficient muscle. The inhomogeneous and in general smaller fiber size together with the increased number of type I fibers in Pycr1 mutant muscle, lead to the suggestion, that a deficiency of Pycr1 may cause a mild form of congenital fiber type disproportion (CFTD)-related hypotonia. DeChene et al. reviewed the recent findings on CFTD and summarized the criteria as [115]: • type I fibers are least 12 % smaller than type II fibers (not to be confused with congenital fiber size disproportion, were type I fibers are in general 40 % to 80 % smaller than type II fibers)

• numeric predominance of type I ﬁbers

• decreased presence of type II ﬁbers

• in general absence nemaline bodies or cores

• less frequent abnormalities are central nuclei or moth-eaten fibers To date there are six CFTP causing genes known: TPM3 and TMP2 encoding for alpha and beta tropomyosin respectively, which are cytoskeletal proteins; RYR1 encoding for ryanodine receptor which controls the sarcoplasmic reticulum calcium release; ACTA1 with the gene product actin-alpha1 having an important role in cell motility, structure and integrity, MYH7 encoding for myosin-heavy chain7, specific for type I fibers and cardiac muscle and SEPN1 encoding for selenoprotein N. There is not much known about the function SEPN1, but this gene is disease causing for several myopathies [115], [114]. Beside SEPN1 all other genes are involved in myofiber integrity and function. Although the pathomechnism of CFTD is still unclear. Myofiber subtypes are determined in embryonic and fetal development and the pattern- ing of fiber types within muscles becomes established within early postnatal stages [116], [117], [118]. However, specialized adult muscle fibers have a high plasticity. For instance, the contraction load, hormonal changes and certain systemic disease can cause fiber type transition [119]. Neurological over load and increased innervation leads to a switch from fast to slow fibers and decreased neuromuscular signaling causes a slow-to-fast myofiber conversion [120], [121]. Changes in the composition of muscle fibers are causing different myopathies but are also influencing whole-body metabolism. Increase of oxidative type I fibers protects against glucose intolerance [122].

101 The myocyte enhancer factor 2 (MEF2) transcription factor, a key regulator of embryonic organogenesis, promotes in adult muscle the transition of glycolytic type II fibers to oxidative type I fibers. It is assumed, that MEF2 co-regulates together with NFAT (nuclear factor of activated t cells), in a Ca+ depended and calcineurin activated manner, the transition of fast-to-slow fibers [96], [123], [124]. The expression levels of the members of the MEF2 transcription factor family (Mef2a, Mef2c and Mef2d) were measured by quantitative RT PCR on RNA isolated from quadriceps femoris, to analyze if the increased number type I fibers can be explained with a fast-to-slow fiber type transition. The expression of all three Mef2 isoforms were mildly (not significant) increased in Pycr1 deficient mice, which could contribute to fast-to-slow fiber transition, albeit it is likely that other mechanisms are involved in the observed disproportion of fiber types. Vrailas-Mortimer et al. reported, that MEF2 transcription factors also activate via p38 the expression of MnSOD in muscle tissue of D. melanogaster [97]. Mitochondrial dysfunction often leads to increased ROS production, which can be rescued by the mitochondrial localized detoxification enzymes Manganase Superoxide dismutase (MnSOD). It was shown that PYCR1-related ARCL cause mitochondrial dysfunction with elevated ROS generation in skin fibroblasts [16]. Therefore the mild increase of MEF2 in muscles of Pycr1 deficient mice could also be a consequence of oxidative stress due to mitochondrial dysfunction. The expression pattern of MnSod was significantly elevated in muscle biopsies of Pycr1 deficient mice. The up regulation of members of the Mef2 transcription factor family could either contribute to a fiber type transition from type II fibers toward type I fibers, which would partially explain the CFTD-like phenotype resulting in hypotonia or be a consequence of increased ROS production due to mitochondrial dysfunction, or both. To further elucidate the mechanism behind this phenotype, determination of the mitochondrial ROS concentrations should be performed. Additionally, in vitro fiber type transition experiments on isolated muscle fibers of Pycr1 wild type and control muscle fibers could provide further cues.

7.5 Pycr1 and mitochondrial alterations

Having described the phenotypic consequences of a loss of Pycr1, the next aim was to get insights into the cellular and effects of Pycr1 deficiency. As mentioned above, Pycr1 is a mitochondrial enzyme, involved in the de nove biosynthesis of proline. Mutations in PYCR1 decreases the resistance of fibroblasts to oxidative stress leading to increased apoptosis and mitochondrial dysfunction with depolarization of the mitochondrial mem-

102 brane potential (MMP) and mitochondrial fragmentation. Mitochondria are highly dynamic semi-autonomous cell organelles, which steadily change their shape by fusion and fission. Galloway et al. and David C. Chan reviewed the major aspects of mitochondrial fusion and fission [60] and [59]. The morphology of mitochondria depends on the balance between the opposing processes of fusion and fission. Increased fission leads to fragmentation, and increased fusion leads to elongation. It has been shown that in cells with reduced fusion, due to mitofusin deficiency, the mitochondrial tubularization can be restored by simultaneous inhibition of fission factors (Drp1) [67] and [66]. Fusion of mitochondria is assumed to be a mechanism required to distribute mitochondrial matrix components like mtDNA and redox equivalents properly within the mitochondria of a cell. Kawano et al. studied mitochondrial dynamics in Physarum polycephalum and interprets mitochondrial fusion as a sexual process to allow recombination of the mtDNA [125]. Mitochondrial fission enables segregating depolarized and therefore energetically ineffective parts. Hence, mitochondrial fusion and fission events reflect a mitochondrial quality control mechanism. On the one hand mitochondrial dynamics control their shape and distribution within the cell and on the other hand fusion and fission are also important for the bioenergetic function of mitochondria. Mitochondrial function is remarkably reduced in cells lacking the fusion factors mitu- fusins or OPA1. These cells show diminished oxygen consumption, ATP synthesis and heterogeneity in the membrane potential resulting in reduced cell growth [65], [66]. Fur- thermore, it was shown, that mitochondrial fission plays an important role in apoptosis. In several studies it could be demonstrated that mitochondria fragment in the course of cell death. This fragmentation appears at approximately the time when Bax, a proapoptotic Bcl2 family member, translocates to mitochondria, and before activation of caspases. Mitochondrial fragmentation depends on the activity of the fission factor Drp1 and Fis1. Inhibition of these molecules reduces the level of apoptosis [126], [78] and [79]. As it was demonstrated that mitochondrial morphology is associated to their function, the appearance of the mitochondrial network in Pycr1 deficient MEFs were assessed by co-immuno stainings of Pycr proteins with mitochondrial markers (Cytochrome C and Cyclophilin). First, it could be demonstrated that, like human PYCR1, murine Pycr proteins (presumably Pycr1 and Pycr2) are co-localized with mitochondrial markers. And second, the mitochondrial network of Pycr1 −/− MEFs showed a partial fragmentation. It was mentioned before that PYCR1 deficient HAFs react with a massive mitochondrial fragmentation to starvation stress. To analyze whether the loss of Pycr1 in MEFs has a similar effect, Pycr1 wild type and deficient MEFs were treated with starvation conditions

103 (0.1 % FCS, no glucose). The effect shown for HAFs could not be repeated with murine Pycr1 deficient cells. After two hours of exposure to starvation conditions, mitochondria of both, wild type and ko MEFs began to hyperfuse resulting in elongated mitochondria. This effect was shown before by different groups [127], [128] and [129]. They hypothesize that elongated mitochondria during starvation are protected from mitophagy. Further they speculate that through elongation the cristae density is increased and ATP synthase oligomerization is enhanced, resulting in elevated ATP production, which serves as a protective mechanism. 24h of starvational stress abrogated the elongation and induced mitochondrial fragmentation. This fragmentation was in individual Pycr1 deficient MEFs more pronounced. 48h of starvation led to a massive cell death in both wild type and knock out MEFs. These results indicate, that the protective mechanism of starvation abolishes with time. Whether no differences in response to starvation could be found, another discovery was made. It appeared that Pycr1 −/− MEFs have more mitochondria. This was apparent in immunostaining. Additional the ratio mtDNA to gDNA was measured in MEFs. In Pycr1 deficient MEFs the amount of mtDNA was nearly unchanged with a very mild increase of only 10 % compared to wild type MEFs. However, this does not argue against increased mitochondrial mass in Pycr1 deficient MEFs, but indicates that mitochondria Pycr1 deficient MEFs contain less mtDNA nucleoids. Furthermore metabolites of the energy metabolism were quantified to analyze if the observed fragmentation and the higher mitochondria contend in Pycr1 deficient MEFs have influences on energy metabolism in mitochondria. Lactate levels in culture medium supernatant were elevated under control and starvation conditions drastically (50%) in Pycr1 deficient MEFs. The concentration of ATP was assessed in medium supernatant and cells. ATP levels were also increased in Pycr1 deficient MEFs to approximately 30 %, albeit the differences were not significant. Elevated lactate concentration points to increased glycolytic activity in Pycr1 deficient cells. This in turn indicates a dysfunction of the mitochondrial energy metabolism since anaerobe glycolysis is compared to the oxidative phosphorylation much less effective. Interestingly, the ATP level in Pycr1 deficient MEFs does not decline, but is rather slightly increased. This could be on the one hand explained by lowered energy consumption, probably as a result of overall decreased metabolism of Pycr1 deficient cells. On the other hand it is likely that the loss of Pycr1 leads to an accumulation of NADH, which in turn could drive elevated OXPHOS and lactate synthesis. To gain further insights about mitochondrial metabolic alterations caused by a Pycr1 deficiency, metabolites of different tissues were extracted and are currently in examination. However, since lactate and ATP concentrations in MEFs lacking Pycr1 do not substan-

104 tially differ between standard and starvation culture conditions, the previous observation, that a Pycr1 deficiency does not affect the starvational stress resistance could be confirmed. Though, it is not clear if the observed mitochondrial fragmentation in Pycr1 lacking MEFs results from a mitochondrial dysfunction or if it is the cause of a dysfunction. In order to further elucidate mitochondrial function and energy metabolism the components of the oxidative phosphorylation (OXPHOS) system were characterized in muscle biopsies. The major components of the mammalian (OXPHOS) system are the five complexes of the respiratory chain, NADH:ubiquinone reductase (complex I), Succi- nate:ubiquinone reductase (complex II), Ubiquinol:cytochrome c reductase (complex III),

Cytochrome c oxidase (complex IV), and F1F0-ATP synthase (complex V). Complexes I-IV transfer electrons from reducing equivalents to water, creating a proton gradient across the inner mitochondrial membrane, which is used by a fifth complex to drive the synthesis of ATP [46]. Dysfunction of single or multiple complexes of the OXPHOS system are common causes of mitochondrial diseases. Surprisingly, no differences in the activity of the single complexes could be observed. Thus, the increased glycolytic activity in Pycr1 deficient MEFs does not arise from impaired oxidative phosphorylation. Since mitochondrial ATP synthesis requires O2, glycolysis might be up regulated as a consequence of impaired cellular respiratory. Another explanation could be that lacking Pycr1 induces the Warburg effect.

The Warburg effect describes the phenomenon, that in the presence of O2 OXPHOS or photosynthesis respectively, is reduced and glycolysis is upregulated. It has been described since many years, that highly proliferating cells, like cancer cells, can activate glycolysis in the presence of O2 [130], [131]. In the late 1970s Kowaloff et al. showed that lactate negatively regulates the activity of PRODH [132]. PRODH is an enzyme, also involved in the proline cycle. It catalyzes the oxidation of proline back to P5C. It was shown, that during this oxidation superoxide anions were generated [48], [133], [24]. The elevation of glycolytic activity which in turn leads to elevated lactate could be a rescue effect, to inhibit further degradation of proline and maintain the intra-mitochondrial proline level. Additionally, to the analyses of the OXPHOS complexes, the mitochondrial ultra structure in muscle specimens were examined using transmission electron microscopy (TEM). In quadriceps femoris of Pycr1 deficient mice numerous mitochondria with abnormal structure were observed. The cristae are deformed and appear to decay and do not exhibit the typical cross-striped structure. Also in many cases the mitochondrial outer membrane integrity seems to be disturbed. Since this experiment was conducted in only one Pycr1 wild type and one knock out animal respectively, these findings should be regarded with

105 care. Nonetheless, alterations in the mitochondrial ultra structure were also found in PYCR1 deficient HAFs and could give an explanation for the mentioned mitochondrial dysfunctions, but would argue against the Warburg effect in Pycr1 deficient MEFs.

7.6 Pycr1, proline and the mitochondrial redox system

Since the proline biosynthesis is distinct from metabolism of the other protein forming amino acids, it is assumed that it has a regulatory role. The proline cycle is directly linked to the NAD(P)H/NAD(P) redox couple, thus it is suggested, that this pathway has a secondary function as redox shuttle (ﬁgure 36) [39] and [38].

Figure 36: Proline biosynthesis pathway with redox equivalents P5C: Δ1-pyrroline-5-carboxylate, PYCR: Δ1-pyrroline-5-carboxylate reductase, P5CS: P5C synthase, P5CDH: P5C dehydrogenase, OAT: ornithine-δ-aminotransferase, TCA cycle: tricarboxylic acid cycle. Adapted from [36], [38], [39].

Furthermore it has been shown, that PRODH, P5CDH, and P5CS are upregulated by p53, that is known to induce apoptosis and function as a tumor suppressor [134], [135].

106 Donald SP et al. showed that the degradation of proline by PRODH induces the formation of ROS. ROS decrease the mitochondrial membrane potential, which inhibits the ETC and ATP synthesis as well as allows the release of cytochrome c, followed by the activation of the apoptosis cascade [133]. Additionally Krishnan et al. reported on the one hand elevated proline biosynthesis in

HEK 293 cell upon oxidative stress induced by H2O2 and a decrease in cell death in the same cell type, when PYCR2 and P5CS are over expressed [48]. On the other hand, when PRODH was over expressed, oxidative stress increased cell death and induced the intracellular ROS production. He furthermore provided evidence that proline protects the intracellular glutathione (GSH) pool [48]. GSH is an antioxidant, while reducing ROS it converts to its oxidized and dimerized form (GSSH). The ratio of GSH/GSSH within cells is often used as an indicator for cellular toxicity. This gives proline a status as a universal antioxidant that scavenges ROS. The reported upregulation of PYCRs due to oxidative stress could not be confirmed in this study neither in MEFs nor in HAFs (data not shown). However, the findings presented in this thesis, increased mitochondrial fragmentation and apoptosis due to Pycr1 and Pycr2 deficiency which both are producing proline in a NADH dependent manner, can be explained by the theories that proline has an antioxidant functions and that the proline cycle itself serves as a redox shuttle. Cells lacking Pycr should have impaired proline synthesis resulting in disarranged redox status, which affects the MMP and therefore the effectively of the ETC, ROS production and apoptosis and this in turn have effects on mitochondrial morphology.

7.7 Diﬀerences between human and murine PYCRs

It has been shown that the Pycr1 knock out mouse model reflects some major aspects of the human PYCR1-caused disease. However, the phenotype of the mouse model is less severe. This phenotypic characteristic may be due to species specific activity or function of the different PYCR proteins. To gain further insights into potential species differences between the human and murine PYCR paralogues, the number of transcripts of the four genes were measured in a panel of adult tissues by RT-PCR. In all murine tissues, but pancreas, Pycr2 was clearly present in higher levels than Pycr1. In human tissues the expression of PYCR2 was also in most of the analyzed samples clearly higher than the expression of PYCR1. Interestingly, in bone, skin and pancreas more PYCR1 than PYCR2 transcripts could be detected. In patients suffering from PYCR1-related cutis laxa, the skeletal and the integumentary system are the most severely affected, probably due to the higher expression

107 of PYCR1 in these tissues. The finding that Pycr2 is dominantly expressed in murine skin and bone indicates that Pycr1 and Pycr2 gene regulation differs compared to the human system. The observation that murine and human PYCR1 are highly expressed in pancreatic tissue supports the conjecture, that both orthologues play either a role in energy metabolism or maintenance of mitochondrial function. Pancreatic β cells are glucose sensing cells, which regulate the insulin release in an ATP dependent manner. In β cells the respiration and OXPHOS rates, are regulated by the availability of glucose, whereas in most other cell types, the ATP demand determines respiration rate. In β cells Glucose cannot be metabolized by anaerobic glycolysis, thus they metabolize nearly 100 % of glucose by OXPHOS, which makes fully functional mitochondrial respiration pivotal [136], [137]. To date no correlations between pancreatic diseases or diabetes and PYCR1 are reported. At this point, it is noteworthy to mention that the amount of transcripts does not necessarily correlate with the amount of translated and active protein within a cell. Nev- ertheless, the transcription level of a gene allows to draw conclusions about the resulting protein abundance. Beside the described expressional differences of human and murine PYCR paralogues alterations on the protein level were observed. The sizes of the PYCR proteins estimated with in-silico prediction are roughly the same at ~33 kDa. Interestingly, Western blot analyses revealed that the protein size of human PYCR1 is bigger than PYCR2 in immunoblot (~33 kDa for PYCR1 and ~37 kDa for PYCR2). This difference is also present between the mouse proteins, but in an inverted fashion (~35 kDa for Pycr1 and ~33 kDa for Pycr2). These changes argue rather for posttranslational modifications like acetylation, phosphorylation, ubiquitinationor glycosylation, whereas the latter one is unlike thus glycosy- lated mitochondrial proteins are rare, than for post translational cleavage. The identification of possible modifications is an ongoing project. Interestingly, human PYCR1 and murine Pycr2 have approx. the same size and seem to not be modified. RNAi mediated knock down experiments for Pycr1 and Pycr2 were conducted to study the influence of both paralogues on mitochondrial function. The mitochondrial morphology and apoptosis were used as read out. The experiments were performed under control conditions and additionally under oxidative stress conditions, to examine the stress response. The knock down of Pycr1 entailed a partial mitochondrial fragmentation and slight increase of apoptosis (under oxidative stress conditions). Whereas cells transfected with SiRNA against Pycr2 showed a more severe reaction regarding mitochondrial structure and apoptosis, indicating for a dominant function of Pycr2. The double knock down of both murine paralogues showed the strongest effect, indicating that in the murine sys-

108 tem both Pycr1 and Pycr2 are necessary to maintain mitochondrial function and integrity. Since there is not much known about the function of human PYCR2, one can only speculate about specific species differences of the human and murine orthologues. Nev- ertheless the presented data show that they are differential expressed in some tissues and that they are differential post translational modified. Recently, De Ingeniis et al. published a study about proline biosynthesis in melanoma were they deciphered some functional differences between the human PYCR1, PYCR2 and PYCRL [35]. The authors demonstrated that in melanoma cells, PYCR2 activity is inhibited by proline at the lower end of physiologic concentration range which leads to the suggestion, that PYCR1 is the more dominant enzyme. This is contrary to the conclusion made of the presented knock down experiments of Pycr1 and Pycr2 mentioned before. These species differences could be an explanation for the milder murine Pycr1 deficiency phenotype. Recently, our group published a genotype to phenotype correlation study of PYCR1- related ARCL. Dimopoulou et al. showed evidence that mutations in the first two exons of PYCR1 cause phenotypes with lower clinical scores and absence or only mild intellectual disabilities compared to mutations in exons 4-6 [32]. No disease causing mutations in exon 3 are known. It is speculated, that mutations in exons 1 and 2 either cause a decay of the protein or affect the import of PYCR1 in mitochondria. Furthermore it is hypothesized that an absence of PYCR1 in the mitochondrial compartment is less deleterious for tissue function than the presence of an altered protein that cannot carry out its enzymatic function. This hypothesis is underscored by the fact that also patients with a deletion of the entire PYCR1 locus do not show intellectual disability [30]. This indicates that the absence of PYCR1 in the mitochondrial compartment can be tolerated during development of the CNS. These findings lead to the suggestion that a mouse model with a knock in of a missense mutation in exons 4, 5 or 6 in Pycr1 would cause a more severe phenotype than the complete knock out of the gene, studied in this thesis.

7.8 Examples for species diﬀerences in metabolic diseases

Human and murine genomes share over 15.000 orthologues genes, representing around 80 % of the human and 75 % of the murine genome [138]. Thus, mouse models have become a fundamental tool in studying human congenital and especially monogenetic diseases. However, in certain cases mouse models do not reproduce the human phenotype, mouse models can either be more severely aﬀected or show no clinical phenotype. Elsea and Lu- cas have reviewed some mouse models for metabolic diseases which do not phenocopy the human disorders [139].

109 As an example: Lesch-Nyhan syndrome (OMIM #300322) is an X-linked recessive disorder caused by loss of function mutations in the HPRT gene. Hypoxanthine-guanine phos- phoribosyltransferase (HPRT) is involved in the purine salvage and dopamine metabolism. Deficiency of HPRT results in overproduction of uric acid and varying degrees of cognitive disability, and behavioral abnormalities that often include impulsive and self-injury. It is suggested that the neurological symptoms are caused by dopamine deficiency [140]. Two Hrpt knock out mouse models were generated, in both models, male mice have a total loss of Hprt activity and decreased dopamine levels in the brain. However, these mice have no clinical phenotype [141] and [142]. Another example is the Pompe disease also known as glycogen storage disease type II (OMIM #232300) that is an autosomal recessive disorder that results from a deficiency of the lysosomal enzyme α-l,4-glucosidase (GAA), which leads to abnormal lysosomal accumulation of glycogen. It is characterized by hypotonia, cardiomegaly, hepatomegaly, and cardiorespiratory failure [143]. Interestingly, an knock out of Gaa with a 129 x C57BL/6 x FVB murine genetic background results in a mild phenotype and later disease onset compared to the human phenotype. But when Gaa is deleted in mice with a 129 x C57BL/6 genetic background, the resulting phenotype is similar to human Pompe disease patients [143], [144] and [145].

This example makes highlights that the genetic background of the mouse models also can have an impact on the phenotype resulting from genetic manipulated mice. When the mouse model does not phenocopy the human disease it is necessary to study basic diﬀerences in mouse and human biology to gain knowledge about possible alternative pathways or diﬀerential gene regulation.

110 8 References

[1] Merriam-Webmaster. Deﬁnition of Aging.

[2] Claire L Navarro, Pierre Cau, and Nicolas Lévy. Molecular bases of progeroid syndromes. Hum. Mol. Genet., 15 Spec No(2):R151–61, October 2006.

[3] David R Berk, Danette D Bentley, Susan J Bayliss, Anne Lind, and Zsolt Urban. Cutis laxa: a review. J. Am. Acad. Dermatol., 66(5):842.e1–17, May 2012.

[4] C Fornieri, D Quaglino, G Lungarella, E Cavarra, R Tiozzo, M G Giro, M Canciani, J M Davidson, and I P Ronchetti. Elastin production and degradation in cutis laxa acquisita. J. Invest. Dermatol., 103(4):583–8, October 1994.

[5] Eva Morava, Maïlys Guillard, Dirk J Lefeber, and Ron a Wevers. Autosomal recessive cutis laxa syndrome revisited. Eur. J. Hum. Genet., 17(9):1099–110, September 2009.

[6] S G Kaler, L K Gallo, V K Proud, A K Percy, Y Mark, N A Segal, D S Goldstein, C S Holmes, and W A Gahl. Occipital horn syndrome and a mild Menkes phenotype associated with splice site mutations at the MNK locus. Nat. Genet., 8(2):195–202, October 1994.

[7] Dessislava Markova, Yaqun Zou, Franziska Ringpfeil, Takako Sasaki, Günter Kostka, Rupert Timpl, Jouni Uitto, and Mon-Li Chu. Genetic heterogeneity of cutis laxa: a heterozygous tandem duplication within the ﬁbulin-5 (FBLN5) gene. Am. J. Hum. Genet., 72(4):998–1004, April 2003.

[8] L Van Maldergem, E Vamos, I Liebaers, P Petit, G Vandevelde, A Simonis- Blumenfrucht, R Bouﬃoux, S Kulakowski, S Hanquinet, and P Van Durme. Severe congenital cutis laxa with pulmonary emphysema: a family with three aﬀected sibs. Am. J. Med. Genet., 31(2):455–64, October 1988.

[9] Elahe Elahi, Reza Kalhor, Setareh S Banihosseini, Noorossadat Torabi, Hamid Pour- Jafari, Massoud Houshmand, Seyed S H Amini, Ahmad Ramezani, and Bart Loeys. Homozygous missense mutation in ﬁbulin-5 in an Iranian autosomal recessive cutis laxa pedigree and associated haplotype. J. Invest. Dermatol., 126(7):1506–9, July 2006.

[10] Vishwanathan Hucthagowder, Nina Sausgruber, Katherine H Kim, Brad Angle, Li- hua Y Marmorstein, and Zsolt Urban. Fibulin-4: a novel gene for an autosomal recessive cutis laxa syndrome. Am. J. Hum. Genet., 78(6):1075–80, June 2006.

[11] Zsolt Urban, Vishwanathan Hucthagowder, Nura Schürmann, Vesna Todorovic, Lior Zilberberg, Jiwon Choi, Carla Sens, Chester W Brown, Robin D Clark, Kristen E Holland, Michael Marble, Lynn Y Sakai, Branka Dabovic, Daniel B Rifkin, and Elaine C Davis. Mutations in LTBP4 cause a syndrome of impaired pulmonary, gastrointestinal, genitourinary, musculoskeletal, and dermal development. Am. J. Hum. Genet., 85(5):593–605, November 2009.

111 [12] Björn Fischer, Aikaterini Dimopoulou, Johannes Egerer, Thatjana Gardeitchik, Alexa Kidd, Dominik Jost, Hülya Kayserili, Yasemin Alanay, Iliana Tantcheva-Poor, Elisabeth Mangold, Cornelia Daumer-Haas, Shubha Phadke, Reto I Peirano, Julia Heusel, Charu Desphande, Neerja Gupta, Arti Nanda, Emma Felix, Elisabeth Berry- Kravis, Madhulika Kabra, Ron a Wevers, Lionel van Maldergem, Stefan Mundlos, Eva Morava, and Uwe Kornak. Further characterization of ATP6V0A2-related autosomal recessive cutis laxa. Hum. Genet., 131(11):1761–73, November 2012.

[13] Miski Mohamed, Dorus Kouwenberg, Thatjana Gardeitchik, Uwe Kornak, Ron a Wevers, and Eva Morava. Metabolic cutis laxa syndromes. J. Inherit. Metab. Dis., 34(4):907–16, August 2011.

[14] Hans Christian Hennies, Uwe Kornak, Haikuo Zhang, Johannes Egerer, Xin Zhang, Wenke Seifert, Jirko Kühnisch, Birgit Budde, Marc Nätebus, Francesco Brancati, William R Wilcox, Dietmar Müller, Paige B Kaplan, Anna Rajab, Giuseppe Zampino, Valentina Fodale, Bruno Dallapiccola, William Newman, Kay Metcalfe, Jill Clayton- Smith, May Tassabehji, Beat Steinmann, Francis a Barr, Peter Nürnberg, Peter Wieacker, and Stefan Mundlos. Gerodermia osteodysplastica is caused by mutations in SCYL1BP1, a Rab-6 interacting golgin. Nat. Genet., 40(12):1410–1412, November 2008.

[15] Uwe Kornak, Ellen Reynders, Aikaterini Dimopoulou, Jeroen van Reeuwijk, Bjo- ern Fischer, Anna Rajab, Birgit Budde, Peter Nürnberg, Francois Foulquier, Dirk Lefeber, Zsolt Urban, Stephanie Gruenewald, Wim Annaert, Han G Brunner, Hans van Bokhoven, Ron Wevers, Eva Morava, Gert Matthijs, Lionel Van Maldergem, and Stefan Mundlos. Impaired glycosylation and cutis laxa caused by mutations in the vesicular H+-ATPase subunit ATP6V0A2. Nat. Genet., 40(1):32–4, January 2008.

[16] Bruno Reversade, Nathalie Escande-Beillard, Aikaterini Dimopoulou, Björn Fischer, Serene C Chng, Yun Li, Mohammad Shboul, Puay-Yoke Tham, Hülya Kayser- ili, Lihadh Al-Gazali, Monzer Shahwan, Francesco Brancati, Hane Lee, Brian D O’Connor, Mareen Schmidt-von Kegler, Barry Merriman, Stanley F Nelson, Amira Masri, Fawaz Alkazaleh, Deanna Guerra, Paola Ferrari, Arti Nanda, Anna Rajab, David Markie, Mary Gray, John Nelson, Arthur Grix, Annemarie Sommer, Ravi Savarirayan, Andreas R Janecke, Elisabeth Steichen, David Sillence, Ingrid Hausser, Birgit Budde, Gudrun Nürnberg, Peter Nürnberg, Petra Seemann, Désirée Kunkel, Giovanna Zambruno, Bruno Dallapiccola, Markus Schuelke, Stephen Robertson, Hanan Hamamy, Bernd Wollnik, Lionel Van Maldergem, Stefan Mundlos, and Uwe Kornak. Mutations in PYCR1 cause cutis laxa with progeroid features. Nat. Genet., 41(9):1016–21, September 2009.

[17] M R Baumgartner, C a Hu, S Almashanu, G Steel, C Obie, B Aral, D Rabier, P Kamoun, J M Saudubray, and D Valle. Hyperammonemia with reduced ornithine, citrulline, arginine and proline: a new inborn error caused by a mutation in the gene encoding delta(1)-pyrroline-5-carboxylate synthase. Hum. Mol. Genet., 9(19):2853– 8, November 2000.

112 [18] Lina Basel-Vanagaite, Ofer Sarig, Dov Hershkovitz, Dana Fuchs-Telem, Debora Rapaport, Andrea Gat, Gila Isman, Idit Shirazi, Mordechai Shohat, Claes D Enk, Efrat Birk, Jürgen Kohlhase, Uta Matysiak-Scholze, Idit Maya, Carlos Knopf, Anette Peﬀekoven, Hans-Christian Hennies, Reuven Bergman, Mia Horowitz, Akemi Ishida- Yamamoto, and Eli Sprecher. RIN2 deﬁciency results in macrocephaly, alopecia, cutis laxa, and scoliosis: MACS syndrome. Am. J. Hum. Genet., 85(2):254–63, August 2009.

[19] Vishwanathan Hucthagowder, Eva Morava, Uwe Kornak, Dirk J Lefeber, Björn Fischer, Aikaterini Dimopoulou, Annika Aldinger, Jiwon Choi, Elaine C Davis, Di- anne N Abuelo, Maciej Adamowicz, Jumana Al-Aama, Lina Basel-Vanagaite, Brid- get Fernandez, Marie T Greally, Gabriele Gillessen-Kaesbach, Hulya Kayserili, Em- manuelle Lemyre, Mustafa Tekin, Seval Türkmen, Beyhan Tuysuz, Berrin Yüksel- Konuk, Stefan Mundlos, Lionel Van Maldergem, Ron a Wevers, and Zsolt Urban. Loss-of-function mutations in ATP6V0A2 impair vesicular traﬃcking, tropoelastin secretion and cell survival. Hum. Mol. Genet., 18(12):2149–65, June 2009.

[20] Delﬁen Syx, Fransiska Malfait, Lut Van Laer, Jan Hellemans, Trinh Hermanns-Lê, Andy Willaert, Abdelmajid Benmansour, Anne De Paepe, and Alain Verloes. The RIN2 syndrome: a new autosomal recessive connective tissue disorder caused by deﬁciency of Ras and Rab interactor 2 (RIN2). Hum. Genet., 128(1):79–88, July 2010.

[21] P Kamoun, B Aral, and J M Saudubray. [A new inherited metabolic disease: delta1- pyrroline 5-carboxylate synthetase deﬁciency]. Bull. Acad. Natl. Med., 182(1):131– 7; discussion 138–9, January 1998.

[22] Matthias R Baumgartner, Daniel Rabier, Marie-Cécile Nassogne, Jean-Louis Du- ﬁer, Jean-Paul Padovani, Pierre Kamoun, David Valle, and Jean-Marie Saudubray. Delta1-pyrroline-5-carboxylate synthase deﬁciency: neurodegeneration, cataracts and connective tissue manifestations combined with hyperammonaemia and reduced ornithine, citrulline, arginine and proline. Eur. J. Pediatr., 164(1):31–6, January 2005.

[23] S Shafqat, M Velaz-Faircloth, V A Henzi, K D Whitney, T L Yang-Feng, M F Seldin, andRTFremeau. Human brain-speciﬁc L-proline transporter: molecular cloning, functional expression, and chromosomal localization of the gene in human and mouse genomes. Mol. Pharmacol., 48(2):219–29, August 1995.

[24] James M Phang, Jui Pandhare, and Yongmin Liu. The metabolism of proline as microenvironmental stress substrate. J. Nutr., 138(10):2008S–2015S, October 2008.

[25] Narges Nayereh Nouri, Omid Aryani, Behnam Kamalidehghan, and Massoud Housh- mand. Cutis laxa type II with mutation in the pyrroline-5-carboxylate reductase 1 gene. Pediatr. Dermatol., 30(6):e265–7, 2013.

113 [26] D Z Scherrer, M B Baptista, a H B Matos, C V Maurer-Morelli, and C E Steiner. Mutations in PYCR1 gene in three families with autosomal recessive cutis laxa, type 2. Eur. J. Med. Genet., 56(6):336–9, June 2013.

[27] YeÅ§erin Yildirim, Aslihan Tolun, and Beyhan Tüysüz. The phenotype caused by PYCR1 mutations corresponds to geroderma osteodysplasticum rather than autosomal recessive cutis laxa type 2. Am. J. Med. Genet. A, 155A(1):134–40, January 2011.

[28] Stefania Zampatti, Marco Castori, Bjoern Fischer, Paola Ferrari, Livia Garavelli, Carlo Dionisi-Vici, Emanuele Agolini, Anita Wischmeijer, Eva Morava, Giuseppe Novelli, H Johannes, Johannes Häberle, Uwe Kornak, and Francesco Brancati. De Barsy Syndrome: a genetically heterogeneous autosomal recessive cutis laxa syndrome related to P5CS and PYCR1 dysfunction. Am. J. Med. Genet. A, 158A(4):927–31, April 2012.

[29] Dar-Shong Lin, Chun-Yan Yeung, Hsuan-Liang Liu, Che-Sheng Ho, Chyong-Hsin Shu, Chih-Kuang Chuang, Yu-Wen Huang, Tsu-Yen Wu, Zon-Darr Huang, Yuan- Ren Jian, and Shuan-Pei Lin. A novel mutation in PYCR1 causes an autosomal recessive cutis laxa with premature aging features in a family. Am. J. Med. Genet. A, 155A(6):1285–9, June 2011.

[30] Rita Kretz, Bita Bozorgmehr, Mohamad Hasan Kariminejad, Marianne Rohrbach, Ingrid Hausser, Alessandra Baumer, Matthias Baumgartner, Cecilia Giunta, Ari- ana Kariminejad, and Johannes Häberle. Defect in proline synthesis: pyrroline- 5-carboxylate reductase 1 deﬁciency leads to a complex clinical phenotype with collagen and elastin abnormalities. J. Inherit. Metab. Dis., 34(3):731–9, June 2011.

[31] Duane L Guernsey, Haiyan Jiang, Susan C Evans, Meghan Ferguson, Makoto Mat- suoka, Mathew Nightingale, Andrea L Rideout, Sylvie Provost, Karen Bedard, An- drew Orr, Marie-Pierre Dubé, Mark Ludman, and Mark E Samuels. Mutation in pyrroline-5-carboxylate reductase 1 gene in families with cutis laxa type 2. Am. J. Hum. Genet., 85(1):120–9, July 2009.

[32] Aikaterini Dimopoulou, Björn Fischer, Thatjana Gardeitchik, Phillipe Schröter, Hülya Kayserili, Claire Schlack, Yun Li, Jaime Moritz Brum, Ingeborg Barisic, Marco Castori, Christiane Spaich, Elaine Fletcher, Zeina Mahayri, Meenakshi Bhat, Katta M Girisha, Katherine Lachlan, Diana Johnson, Shubha Phadke, Neerja Gupta, Martina Simandlova, Madhulika Kabra, Albert David, Leo Nijtmans, David Chi- tayat, Beyhan Tuysuz, Francesco Brancati, Stefan Mundlos, Lionel Van Maldergem, Eva Morava, Bernd Wollnik, and Uwe Kornak. Genotype-phenotype spectrum of PYCR1-related autosomal recessive cutis laxa. Mol. Genet. Metab., 110(3):352–61, November 2013.

[33] Zhaohui Meng, Zhiyong Lou, Zhe Liu, Ming Li, Xiaodong Zhao, Mark Bartlam, and Zihe Rao. Crystal structure of human pyrroline-5-carboxylate reductase. J. Mol. Biol., 359(5):1364–77, June 2006.

114 [34] B Nocek, C Chang, H Li, L Lezondra, D Holzle, F Collart, and A Joachimiak. Crys- tal structures of delta1-pyrroline-5-carboxylate reductase from human pathogens Neisseria meningitides and Streptococcus pyogenes. J. Mol. Biol., 354(1):91–106, November 2005.

[35] Jessica De Ingeniis, Boris Ratnikov, Adam D Richardson, David a Scott, Pedro Aza- Blanc, Surya K De, Marat Kazanov, Maurizio Pellecchia, Ze’ev Ronai, Andrei L Osterman, and Jeﬀrey W Smith. Functional specialization in proline biosynthesis of melanoma. PLoS One, 7(9):e45190, January 2012.

[36] H J STRECKER. The interconversion of glutamic acid and proline. I. The formation of delta1-pyrroline-5-carboxylic acid from glutamic acid in Escherichia coli. J. Biol. Chem., 225(2):825–34, April 1957.

[37] J PEISACH and H J STRECKER. The interconversion of glutamic acid and proline. V. The reduction of delta 1-pyrroline-5-carboxylic acid to proline. J. Biol. Chem., 237:2255–60, July 1962.

[38] Chien-an a Hu, Steven P Donald, Jian Yu, Wei-Wen Lin, Zhihe Liu, Gary Steel, Cassandra Obie, David Valle, and James M Phang. Overexpression of proline oxidase induces proline-dependent and mitochondria-mediated apoptosis. Mol. Cell. Biochem., 295(1-2):85–92, January 2007.

[39] James Ming Phang, Wei Liu, Chad Hancock, and Kyle J Christian. The proline regulatory axis and cancer. Front. Oncol., 2(June):60, January 2012.

[40] P P Saradhi, Alia, S Arora, and K V Prasad. Proline accumulates in plants exposed to UV radiation and protects them against UV induced peroxidation. Biochem. Biophys. Res. Commun., 209(1):1–5, April 1995.

[41] Changbin Chen and Martin B Dickman. Proline suppresses apoptosis in the fungal pathogen Colletotrichum trifolii. Proc. Natl. Acad. Sci. U. S. A., 102(9):3459–64, March 2005.

[42] Georg T Wondrak, Myron K Jacobson, and Elaine L Jacobson. Identiﬁcation of quenchers of photoexcited States as novel agents for skin photoprotection. J. Phar- macol. Exp. Ther., 312(2):482–91, February 2005.

[43] Yongmin Liu, Gregory L Borchert, Steven P Donald, Arkadiusz Surazynski, Chien- An Hu, Christine J Weydert, Larry W Oberley, and James M Phang. MnSOD inhibits proline oxidase-induced apoptosis in colorectal cancer cells. Carcinogenesis, 26(8):1335–42, August 2005.

[44] I E Scheﬄer. A century of mitochondrial research: achievements and perspectives. Mitochondrion, 1(1):3–31, June 2001.

[45] Benedikt Westermann. Mitochondrial membrane fusion. Biochim. Biophys. Acta - Mol. Cell Res., 1641(2-3):195–202, August 2003.

115 [46] Jeremy M. Berg, John L. Tymoczko, and Lubert Stryer. Biochemistry.WH Freeman, New York City, NY, 5th, edition, 2002.

[47] B Alberts, A Johnson, J Lewis, M Raﬀ, K Roberts, and P Walter. Molecular biology of the cell. Garland Publishing, Inc., New York, NY, 2002.

[48] Navasona Krishnan, Martin B Dickman, and Donald F Becker. Proline modulates the intracellular redox environment and protects mammalian cells against oxidative stress. Free Radic. Biol. Med., 44(4):671–81, February 2008.

[49] Julio F Turrens. Mitochondrial formation of reactive oxygen species. J. Physiol., 552(Pt 2):335–44, October 2003.

[50] Paul D Ray, Bo-Wen Huang, and Yoshiaki Tsuji. Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell. Signal., 24(5):981–90, May 2012.

[51] Magdalena L Circu and Tak Yee Aw. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic. Biol. Med., 48(6):749–62, March 2010.

[52] Philipp Niethammer, Clemens Grabher, a Thomas Look, and Timothy J Mitchison. A tissue-scale gradient of hydrogen peroxide mediates rapid wound detection in zebraﬁsh. Nature, 459(7249):996–9, June 2009.

[53] Laura a Sena and Navdeep S Chandel. Physiological roles of mitochondrial reactive oxygen species. Mol. Cell, 48(2):158–67, October 2012.

[54] Xuejun Jiang and Xiaodong Wang. Cytochrome C-mediated apoptosis. Annu. Rev. Biochem., 73:87–106, January 2004.

[55] S Rolland and B Conradt. The role of mitochondria in apoptosis induction in Caenorhabditis elegans: more than just innocent bystanders? Cell Death Diﬀer., 13(8):1281–6, August 2006.

[56] P X Petit, M Goubern, P Diolez, S a Susin, N Zamzami, and G Kroemer. Disruption of the outer mitochondrial membrane as a result of large amplitude swelling: the impact of irreversible permeability transition. FEBS Lett., 426(1):111–6, April 1998.

[57] Vladimir Gogvadze, Sten Orrenius, and Boris Zhivotovsky. Multiple pathways of cytochrome c release from mitochondria in apoptosis. Biochim. Biophys. Acta, 1757(5-6):639–47, 2006.

[58] P Pinton, C Giorgi, R Siviero, E Zecchini, and R Rizzuto. Calcium and apoptosis: ER-mitochondria Ca2+ transfer in the control of apoptosis. Oncogene, 27(50):6407–18, October 2008.

[59] Annu Rev, Cell Dev, Biol Downloaded, and David C Chan. Mitochondrial fusion and ﬁssion in mammals. Annu. Rev. Cell Dev. Biol., 22:79–99, January 2006.

116 [60] Chad a Galloway and Yisang Yoon. Perspectives on: SGP symposium on mitochondrial physiology and medicine: what comes first, misshape or dysfunction? The view from metabolic excess. J. Gen. Physiol., 139(6):455–63, June 2012. [61] Giovanni Benard, Nadège Bellance, Dominic James, Philippe Parrone, Helder Fer- nandez, Thierry Letellier, and Rodrigue Rossignol. Mitochondrial bioenergetics and structural network organization. J. Cell Sci., 120(Pt 5):838–48, March 2007. [62] Werner J H Koopman, Henk-jan Visch, Sjoerd Verkaart, LambertusWPJvanden Heuvel, Jan A M Smeitink, and Peter H G M Willems. Mitochondrial network complexity and pathological decrease in complex I activity are tightly correlated in isolated human complex I deficiency. Am. J. Physiol. Cell Physiol., 289(4):C881–90, October 2005. [63] Philippe a Parone, Sandrine Da Cruz, Daniel Tondera, Yves Mattenberger, Dominic I James, Pierre Maechler, François Barja, and Jean-Claude Martinou. Preventing mitochondrial fission impairs mitochondrial function and leads to loss of mitochondrial DNA. PLoS One, 3(9):e3257, January 2008. [64] Mariusz Karbowski, Damien Arnoult, Hsiuchen Chen, David C Chan, Carolyn L Smith, and Richard J Youle. Quantitation of mitochondrial dynamics by photola- beling of individual organelles shows that mitochondrial fusion is blocked during the Bax activation phase of apoptosis. J. Cell Biol., 164(4):493–9, February 2004. [65] Rie Sugioka, Shigeomi Shimizu, and Yoshihide Tsujimoto. Fzo1, a protein involved in mitochondrial fusion, inhibits apoptosis. J. Biol. Chem., 279(50):52726–34, De- cember 2004. [66] Hsiuchen Chen, Anne Chomyn, and David C Chan. Disruption of fusion results in mitochondrial heterogeneity and dysfunction. J. Biol. Chem., 280(28):26185–92, July 2005. [67] Hsiuchen Chen, Scott a Detmer, Andrew J Ewald, Erik E Griffin, Scott E Fraser, and David C Chan. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J. Cell Biol., 160(2):189–200, January 2003. [68] a Santel andMTFuller. Control of mitochondrial morphology by a human mitofusin. J. Cell Sci., 114(Pt 5):867–74, March 2001. [69] Lorena Griparic, Nicole N van der Wel, Ian J Orozco, Peter J Peters, and Alexan- der M van der Bliek. Loss of the intermembrane space protein Mgm1/OPA1 induces swelling and localized constrictions along the lengths of mitochondria. J. Biol. Chem., 279(18):18792–8, April 2004. [70] Stéphane Duvezin-Caubet, Ravi Jagasia, Johannes Wagener, Sabine Hofmann, Aleksandra Trifunovic, Anna Hansson, Anne Chomyn, Matthias F Bauer, Giuseppe Attardi, Nils-Göran Larsson, Walter Neupert, and Andreas S Reichert. Proteolytic processing of OPA1 links mitochondrial dysfunction to alterations in mitochondrial morphology. J. Biol. Chem., 281(49):37972–9, December 2006.

117 [71] Zhiyin Song, Hsiuchen Chen, Maja Fiket, Christiane Alexander, and David C Chan. OPA1 processing controls mitochondrial fusion and is regulated by mRNA splicing, membrane potential, and Yme1L. J. Cell Biol., 178(5):749–55, August 2007.

[72] C Alexander, M Votruba, U E Pesch, D L Thiselton, S Mayer, A Moore, M Ro- driguez, U Kellner, B Leo-Kottler, G Auburger, S S Bhattacharya, and B Wissinger. OPA1, encoding a dynamin-related GTPase, is mutated in autosomal dominant optic atrophy linked to chromosome 3q28. Nat. Genet., 26(2):211–5, October 2000.

[73] Stephan Züchner, Irina V Mersiyanova, Maria Muglia, Nisrine Bissar-Tadmouri, Julie Rochelle, Elena L Dadali, Mario Zappia, Eva Nelis, Alessandra Patitucci, Jan Senderek, Yesim Parman, Oleg Evgrafov, Peter De Jonghe, Yuji Takahashi, Shoij Tsuji, Margaret A Pericak-Vance, Aldo Quattrone, Esra Battaloglu, Alexander V Polyakov, Vincent Timmerman, J Michael Schröder, Jeﬀery M Vance, and Esra Battologlu. Mutations in the mitochondrial GTPase mitofusin 2 cause Charcot- Marie-Tooth neuropathy type 2A. Nat. Genet., 36(5):449–51, May 2004.

[74] E Smirnova, L Griparic, D L Shurland, and a M van der Bliek. Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol. Biol. Cell, 12(8):2245–56, August 2001.

[75] Elena Ingerman, Edward M Perkins, Michael Marino, Jason a Mears, J Michael McCaﬀery, Jenny E Hinshaw, and Jodi Nunnari. Dnm1 forms spirals that are structurally tailored to ﬁt mitochondria. J. Cell Biol., 170(7):1021–7, September 2005.

[76] Claudia Figueroa-Romero, Jorge a Iñiguez Lluhí, Julia Stadler, Chuang-Rung Chang, Damien Arnoult, Peter J Keller, Yu Hong, Craig Blackstone, and Eva L Feldman. SUMOylation of the mitochondrial ﬁssion protein Drp1 occurs at multiple noncon- sensus sites within the B domain and is linked to its activity cycle. FASEB J., 23(11):3917–27, November 2009.

[77] Chuang-Rung Chang and Craig Blackstone. Dynamic regulation of mitochondrial ﬁssion through modiﬁcation of the dynamin-related protein Drp1. Ann. N. Y. Acad. Sci., 1201:34–9, July 2010.

[78] S Desagher andJCMartinou. Mitochondria as the central control point of apoptosis. Trends Cell Biol., 10(9):369–77, September 2000.

[79] S Frank, B Gaume, E S Bergmann-Leitner, W W Leitner, E G Robert, F Catez, C L Smith, and R J Youle. The role of dynamin-related protein 1, a mediator of mitochondrial ﬁssion, in apoptosis. Dev. Cell, 1(4):515–25, October 2001.

[80] Clare Sheridan, Petrina Delivani, Sean P Cullen, and Seamus J Martin. Bax- or Bak-induced mitochondrial ﬁssion can be uncoupled from cytochrome C release. Mol. Cell, 31(4):570–85, August 2008.

[81] Ryota Iwasawa, Anne-Laure Mahul-Mellier, Christoph Datler, Evangelos Pazarent- zos, and Stefan Grimm. Fis1 and Bap31 bridge the mitochondria-ER interface to

118 establish a platform for apoptosis induction. EMBO J., 30(3):556–68, February 2011.

[82] Emilie Alirol, Dominic James, Denise Huber, Andrea Marchetto, Lodovica Vergani, Jean-claude Martinou, and Luca Scorrano. The Mitochondrial Fission Protein hFis1 Requires the Endoplasmic Reticulum Gateway to Induce Apoptosis âŰą. Mol. Biol. Cell, 17(November):4593–4605, 2006.

[83] D HARMAN. Aging: a theory based on free radical and radiation chemistry. J. Gerontol., 11(3):298–300, July 1956.

[84] Michael T Lin and M Flint Beal. Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases. Nature, 443(7113):787–95, October 2006.

[85] Steven A McCarroll, Coleen T Murphy, Sige Zou, Scott D Pletcher, Chen-Shan Chin, Yuh Nung Jan, Cynthia Kenyon, Cornelia I Bargmann, and Hao Li. Comparing genomic expression patterns across species identiﬁes shared transcriptional proﬁle in aging. Nat. Genet., 36(2):197–204, February 2004.

[86] Jacob M. Zahn, Rebecca Sonu, Hannes Vogel, Emily Crane, Krystyna Mazan- Mamczarz, Ralph Rabkin, Ronald W. Davis, Kevin G. Becker, Art B. Owen, and Stuart K. Kim. Transcriptional Proﬁling of Aging in Human Muscle Reveals a Common Aging Signature. PLoS Genet., 2(7):e115, 2006.

[87] Jingtao Sun, Donna Folk, Timothy J Bradley, and John Tower. Induced overexpression of mitochondrial Mn-superoxide dismutase extends the life span of adult Drosophila melanogaster. Genetics, 161(2):661–72, June 2002.

[88] Samuel E Schriner, Nancy J Linford, George M Martin, Piper Treuting, Charles E Ogburn, Mary Emond, Pinar E Coskun, Warren Ladiges, Norman Wolf, Holly Van Remmen, Douglas C Wallace, and Peter S Rabinovitch. Extension of murine life span by overexpression of catalase targeted to mitochondria. Science, 308(5730):1909–11, June 2005.

[89] Jeremy M Van Raamsdonk and Siegfried Hekimi. Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans. PLoS Genet., 5(2):e1000361, February 2009.

[90] Aleksandra Trifunovic, Anna Wredenberg, Maria Falkenberg, Johannes N Spelbrink, Anja T Rovio, Carl E Bruder, Mohammad Bohlooly-Y, Sebastian Gidlöf, Anders Oldfors, Rolf Wibom, Jan Törnell, Howard T Jacobs, and Nils-Göran Larsson. Pre- mature ageing in mice expressing defective mitochondrial DNA polymerase. Nature, 429(6990):417–23, May 2004.

[91] Leslie S Itsara, Scott R Kennedy, Edward J Fox, Selina Yu, Joshua J Hewitt, Monica Sanchez-Contreras, Fernando Cardozo-Pelaez, and Leo J Pallanck. Oxidative stress is not a major contributor to somatic mitochondrial DNA mutations. PLoS Genet., 10(2):e1003974, February 2014.

119 [92] Mika Tanaka, Anna-Katerina Hadjantonakis, Kristina Vintersten, and Andras Nagy. Aggregation chimeras: combining ES cells, diploid, and tetraploid embryos. Meth- ods Mol. Biol., 530(6):287–309, January 2009.

[93] Malcolm Logan, James F Martin, Andras Nagy, Corrinne Lobe, Eric N Olson, and Cliﬀord J Tabin. Expression of Cre Recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis, 33(2):77–80, June 2002.

[94] A G Robling, T Bellido, and C H Turner. Mechanical stimulation in vivo reduces osteocyte expression of sclerostin. J. Musculoskelet. Neuronal Interact., 6(4):354, 2006.

[95] Paola Rossi, Barbara Marzani, Silvana Giardina, Massimo Negro, and Fulvio Marza- tico. Human skeletal muscle aging and the oxidative system: cellular events. Curr. Aging Sci., 1(3):182–91, December 2008.

[96] H Wu, F J Naya, T a McKinsey, B Mercer, J M Shelton, E R Chin, a R Simard, R N Michel, R Bassel-Duby, E N Olson, and R S Williams. MEF2 responds to multiple calcium-regulated signals in the control of skeletal muscle ﬁber type. EMBO J., 19(9):1963–73, May 2000.

[97] Alysia Vrailas-Mortimer, Tania del Rivero, Subhas Mukherjee, Sanjay Nag, Alexan- dros Gaitanidis, Dimitris Kadas, Christos Consoulas, Atanu Duttaroy, Subhabrata Sanyal, and Tania Rivero. A muscle-speciﬁc p38 MAPK/Mef2/MnSOD pathway regulates stress, motor function, and life span in Drosophila. Dev. Cell, 21(4):783– 95, October 2011.

[98] Bart Loeys, Lionel Van Maldergem, Geert Mortier, Paul Coucke, Sabine Gerniers, Jean-Marie Naeyaert, and Anne De Paepe. Homozygosity for a missense mutation in ﬁbulin-5 (FBLN5) results in a severe form of cutis laxa. Hum. Mol. Genet., 11(18):2113–8, September 2002.

[99] Marjolijn Renard, Tammy Holm, Regan Veith, Bert L Callewaert, Lesley C Adès, Osman Baspinar, Angela Pickart, Majed Dasouki, Juliane Hoyer, Anita Rauch, Pamela Trapane, Michael G Earing, Paul J Coucke, Lynn Y Sakai, Harry C Dietz, Anne M De Paepe, and Bart L Loeys. Altered TGFbeta signaling and cardiovascular manifestations in patients with autosomal recessive cutis laxa type I caused by ﬁbulin-4 deﬁciency. Eur. J. Hum. Genet., 18(8):895–901, August 2010.

[100] M C Zhang, L He, M Giro, S L Yong, G E Tiller, and J M Davidson. Cutis laxa arising from frameshift mutations in exon 30 of the elastin gene (ELN). J. Biol. Chem., 274(2):981–6, January 1999.

[101] Adrian Barbul. Proline precursors to sustain Mammalian collagen synthesis. J. Nutr., 138(10):2021S–2024S, October 2008.

[102] Zsolt Urbán, Sheila Riazi, Thomas L Seidl, Jodi Katahira, Leslie B Smoot, David Chitayat, Charles D Boyd, and Aleksander Hinek. Connection between elastin hap- loinsuﬃciency and increased cell proliferation in patients with supravalvular aortic

120 stenosis and Williams-Beuren syndrome. Am. J. Hum. Genet., 71(1):30–44, July 2002.

[103] B L Riggs and L J Melton. Involutional osteoporosis. N. Engl. J. Med., 314(26):1676–86, June 1986.

[104] Mateusz Kolanczyk, Nadine Kossler, Jirko Kühnisch, Liron Lavitas, Sigmar Stricker, Ulrich Wilkening, Inderchand Manjubala, Peter Fratzl, Ralf Spörle, Bernhard G Herrmann, Luis F Parada, Uwe Kornak, and Stefan Mundlos. Multiple roles for neuroﬁbromin in skeletal development and growth. Hum. Mol. Genet., 16(8):874– 86, April 2007.

[105] Jirko Kühnisch, Jong Seto, Claudia Lange, Susanne Schrof, Sabine Stumpp, Karolina Kobus, Julia Grohmann, Nadine Kossler, Peter Varga, Monika Osswald, Denise Emmerich, Sigrid Tinschert, Falk Thielemann, Georg Duda, Wenke Seifert, Thaqif El Khassawna, David a Stevenson, Florent Elefteriou, Uwe Kornak, Kay Raum, Peter Fratzl, Stefan Mundlos, and Mateusz Kolanczyk. Multiscale, converg- ing defects of macro-porosity, microstructure and matrix mineralization impact long bone fragility in NF1. PLoS One, 9(1):e86115, January 2014.

[106] W S Simonet, D L Lacey, C R Dunstan, M Kelley, M S Chang, R Lüthy, H Q Nguyen, S Wooden, L Bennett, T Boone, G Shimamoto, M DeRose, R Elliott, a Colombero, H L Tan, G Trail, J Sullivan, E Davy, N Bucay, L Renshaw-Gegg, T M Hughes, D Hill, W Pattison, P Campbell, S Sander, G Van, J Tarpley, P Derby, R Lee, and W J Boyle. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell, 89(2):309–19, April 1997.

[107] D L Lacey, E Timms, H L Tan, M J Kelley, C R Dunstan, T Burgess, R Elliott, a Colombero, G Elliott, S Scully, H Hsu, J Sullivan, N Hawkins, E Davy, C Capparelli, a Eli, Y X Qian, S Kaufman, I Sarosi, V Shalhoub, G Senaldi, J Guo, J Delaney, and W J Boyle. Osteoprotegerin ligand is a cytokine that regulates osteoclast diﬀerentiation and activation. Cell, 93(2):165–76, April 1998.

[108] N Nakagawa, M Kinosaki, K Yamaguchi, N Shima, H Yasuda, K Yano, T Morinaga, and K Higashio. RANK is the essential signaling receptor for osteoclast diﬀerenti- ation factor in osteoclastogenesis. Biochem. Biophys. Res. Commun., 253(2):395– 400, December 1998.

[109] William J Boyle, W Scott Simonet, and David L Lacey. Osteoclast diﬀerentiation and activation. Nature, 423(6937):337–42, May 2003.

[110] N Udagawa, N Takahashi, T Akatsu, H Tanaka, T Sasaki, T Nishihara, T Koga, T J Martin, and T Suda. Origin of osteoclasts: mature monocytes and macrophages are capable of diﬀerentiating into osteoclasts under a suitable microenvironment prepared by bone marrow-derived stromal cells. Proc. Natl. Acad. Sci. U. S. A., 87(18):7260–4, September 1990.

121 [111] Kanami Itoh, Nobuyuki Udagawa, Kenichiro Matsuzaki, Masamichi Takami, Hi- toshi Amano, Toshimasa Shinki, Yutaka Ueno, Naoyuki Takahashi, and Tat- suo Suda. Importance of membrane- or matrix-associated forms of M-CSF and RANKL/ODF in osteoclastogenesis supported by SaOS-4/3 cells expressing recom- binant PTH/PTHrP receptors. J. Bone Miner. Res., 15(9):1766–75, September 2000.

[112] Darja Paro-Panjan and David Neubauer. Congenital hypotonia: is there an algo- rithm? J. Child Neurol., 19(6):439–42, June 2004.

[113] Caroline a Sewry. Pathological defects in congenital myopathies. J. Muscle Res. Cell Motil., 29(6-8):231–8, January 2008.

[114] Nigel F Clarke. Congenital ﬁber-type disproportion. Semin. Pediatr. Neurol., 18(4):264–71, December 2011.

[115] ET DeChene, Kang. PB, and AH Beggs. Congenital Fiber-Type Disproportion. In Roberta A Pagon, Margaret P Adam, Holly H Ardinger, Thomas D Bird, Cynthia R Dolan, Chin-To Fong, and Richard JH Smith, editors, GeneReviews. University of Washington, Seattle, Seattle, 2013 edition, 1993.

[116] J X DiMario, S E Fernyak, and F E Stockdale. Myoblasts transferred to the limbs of embryos are committed to speciﬁc ﬁbre fates. Nature, 362(6416):165–7, March 1993.

[117] M P Ontell, M M Sopper, G Lyons, M Buckingham, and M Ontell. Modulation of contractile protein gene expression in fetal murine crural muscles: emergence of muscle diversity. Dev. Dyn., 198(3):203–13, November 1993.

[118] D J Garry, R S Bassel-Duby, J A Richardson, J Grayson, P D Neufer, and R S Williams. Postnatal development and plasticity of specialized muscle ﬁber characteristics in the hindlimb. Dev. Genet., 19(2):146–56, January 1996.

[119] Kenneth M Baldwin and Fadia Haddad. Eﬀects of diﬀerent activity and inactivity paradigms on myosin heavy chain gene expression in striated muscle. J. Appl. Physiol., 90(1):345–57, January 2001.

[120] T Sugiura, H Miyata, Y Kawai, H Matoba, and N Murakami. Changes in myosin heavy chain isoform expression of overloaded rat skeletal muscles. Int. J. Biochem., 25(11):1609–13, November 1993.

[121] R J Talmadge. Myosin heavy chain isoform expression following reduced neuromuscular activity: potential regulatory mechanisms. Muscle Nerve, 23(5):661–79, May 2000.

[122] Jeﬀrey W Ryder, Rhonda Bassel-Duby, Eric N Olson, and Juleen R Zierath. Skele- tal muscle reprogramming by activation of calcineurin improves insulin action on metabolic pathways. J. Biol. Chem., 278(45):44298–304, November 2003.

122 [123] H Wu, B Rothermel, S Kanatous, P Rosenberg, F J Naya, J M Shelton, K a Hutcheson, J M DiMaio, E N Olson, R Bassel-Duby, and R S Williams. Activation of MEF2 by muscle activity is mediated through a calcineurin-dependent pathway. EMBO J., 20(22):6414–23, November 2001.

[124] E. R. Chin, E. N. Olson, J. a. Richardson, Q. Yang, C. Humphries, J. M. Shelton, H. Wu, W. Zhu, R. Bassel-Duby, and R. S. Williams. A calcineurin-dependent transcriptional pathway controls skeletal muscle ﬁber type. Genes Dev., 12(16):2499– 2509, August 1998.

[125] S Kawano, H Takano, and T Kuroiwa. Sexuality of mitochondria: fusion, recombination, and plasmids. Int. Rev. Cytol., 161:49–110, January 1995.

[126] David G Breckenridge, Marina Stojanovic, Richard C Marcellus, and Gordon C Shore. Caspase cleavage product of BAP31 induces mitochondrial ﬁssion through endoplasmic reticulum calcium signals, enhancing cytochrome c release to the cytosol. J. Cell Biol., 160(7):1115–27, March 2003.

[127] Ligia C Gomes, Giulietta Di Benedetto, and Luca Scorrano. During autophagy mitochondria elongate, are spared from degradation and sustain cell viability. Nat. Cell Biol., 13(5):589–98, May 2011.

[128] Angelika S Rambold, Brenda Kostelecky, Natalie Elia, and Jennifer Lippincott- Schwartz. Tubular network formation protects mitochondria from autophagoso- mal degradation during nutrient starvation. Proc. Natl. Acad. Sci. U. S. A., 108(25):10190–5, June 2011.

[129] Daniel Tondera, Stéphanie Grandemange, Alexis Jourdain, Mariusz Karbowski, Yves Mattenberger, Sébastien Herzig, Sandrine Da Cruz, Pascaline Clerc, Ines Raschke, Carsten Merkwirth, Sarah Ehses, Frank Krause, David C Chan, Christiane Alexan- der, Christoph Bauer, Richard Youle, Thomas Langer, and Jean-Claude Marti- nou. SLP-2 is required for stress-induced mitochondrial hyperfusion. EMBO J., 28(11):1589–600, June 2009.

[130] O WARBURG. On respiratory impairment in cancer cells. Science, 124(3215):269– 70, August 1956.

[131] Robert a Gatenby and Robert J Gillies. Why do cancers have high aerobic glycolysis? Nat. Rev. Cancer, 4(11):891–9, November 2004.

[132] E M Kowaloﬀ, J M Phang, a S Granger, and S J Downing. Regulation of proline oxidase activity by lactate. Proc. Natl. Acad. Sci. U. S. A., 74(12):5368–71, December 1977.

[133] Steven P Donald, X Y Sun, Chien-an A Hu, Jian Yu, Jay M Mei, David Valle, and James M Phang. Proline oxidase, encoded by p53-induced gene-6, catalyzes the generation of proline-dependent reactive oxygen species. Cancer Res., 61(5):1810– 5, March 2001.

123 [134] Kornelia Polyak, Yong Xia, Jay L Zweier, Kenneth W Kinzler, and Bert Vogelstein. A model for p53-induced apoptosis. Nature, 389(6648):300–5, September 1997.

[135] Chien-an A Hu, D Bart Williams, Siqin Zhaorigetu, Shadi Khalil, Guanghua Wan, and David Valle. Functional genomics and SNP analysis of human genes encoding proline metabolic enzymes. Amino Acids, 35(4):655–64, November 2008.

[136] Andreas Wiederkehr and Claes B Wollheim. Mitochondrial signals drive insulin secretion in the pancreatic β-cell. Mol. Cell. Endocrinol., 353(1-2):128–37, April 2012.

[137] Ingo B Leibiger, Kerstin Brismar, and Per-Olof Berggren. Novel aspects on pancreatic beta-cell signal-transduction. Biochem. Biophys. Res. Commun., 396(1):111–5, May 2010.

[138] Deanna M Church, Leo Goodstadt, Ladeana W Hillier, Michael C Zody, Steve Goldstein, Xinwe She, Carol J Bult, Richa Agarwala, Joshua L Cherry, Michael DiCuccio, Wratko Hlavina, Yuri Kapustin, Peter Meric, Donna Maglott, Zoë Birtle, Ana C Marques, Tina Graves, Shiguo Zhou, Brian Teague, Konstantinos Pota- mousis, Christopher Churas, Michael Place, Jill Herschleb, Ron Runnheim, Daniel Forrest, James Amos-Landgraf, David C Schwartz, Ze Cheng, Kerstin Lindblad- Toh, Evan E Eichler, and Chris P Ponting. Lineage-speciﬁc biology revealed by a ﬁnished genome assembly of the mouse. PLoS Biol., 7(5):e1000112, May 2009.

[139] Sarah H Elsea and Rebecca E Lucas. The mousetrap: what we can learn when the mouse model does not mimic the human disease. ILAR J., 43(2):66–79, January 2002.

[140] H a Jinnah, M D Jones, B E Wojcik, J D Rothstein, E J Hess, T Friedmann, and G R Breese. Inﬂuence of age and strain on striatal dopamine loss in a genetic mouse model of Lesch-Nyhan disease. J. Neurochem., 72(1):225–9, January 1999.

[141] M Hooper, K Hardy, A Handyside, S Hunter, and M Monk. HPRT-deﬁcient (Lesch- Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature, 326(6110):292–5, 1987.

[142] M R Kuehn, A Bradley, E J Robertson, and M J Evans. A potential animal model for Lesch-Nyhan syndrome through introduction of HPRT mutations into mice. Nature, 326(6110):295–8, 1994.

[143] A J Reuser, M. A. Kroos, M M Hermans, A G Bijvoet, M. P. Verbeet, O P Van Diggelen, W J Kleijer, and A T Van der Ploeg. Glycogenosis type II (acid maltase deﬁciency). Muscle Nerve. Suppl., 3(1):S61–9, January 1995.

[144] Nina Raben, Kanneboyina Nagaraju, Eunice Lee, Paul Kessler, Barry Byrne, L Lee, M LaMarca, Christina King, Jerrold Ward, Brian Sauer, and Paul Plotz. Targeted disruption of the acid alpha-glucosidase gene in mice causes an illness with critical features of both infantile and adult human glycogen storage disease type II. J. Biol. Chem., 273(30):19086–92, July 1998.

124 [145] N Raben, K Nagaraju, E Lee, and P Plotz. Modulation of disease severity in mice with targeted disruption of the acid alpha-glucosidase gene. Neuromuscul. Disord., 10(4-5):283–91, June 2000.

125 9 Appendix

Acknowledgements

An erster Stelle möchte ich mich bei Professor Dr. Stefan Mundlos und Professor Dr. Uwe Kornak für die Überlassung dieses Themas sowie für die fortwährende Unterstützung und das stete Interesse an meiner Arbeit bedanken. Ein besonderer Dank gilt auch Professor Dr. Roland Lauster für die Begleitung meiner wissenschaftlichen Ausbildung und seinem stets oﬀenen Ohr und Vertrauen sowie für die Übernahme der oﬃziellen Betreuung. Auch bei Professor Dr. Jens Kurreck möchte ich mich herzlich für die Übernahme des Koreferats bedanken.

Ein weiterer Dank geht an Dr. Ingrid Haußer-Siller für die elektronenmikroskopischen Untersuchen der Hautbioptate und ihre Expertise und freundliche Hilfe bei deren Beur- teilung. Auch Beatrix Fauler möchte ich für ihre unermüdlichen Bemühungen, ihr stetes Interesse und ihre Geduld bei der Durchführung der elektronenmikroskopischen Untersu- chung der Muskelbioptate herzlich danken. Dr. Thatjana Gardeitchik möchte ich ebenfalls danken für die Aktivitätsmessungen der Atmungskettenkomplexe.

Bei den Mitarbeitern des Tierhauses, ganz besonders bei Dr. Lars Wittler für Aggrega- tionsexperimente und Katja Reinsch für die hervorragende Mausarbeit, möchte ich mich ebenfalls bedanken.

Uwe, bei Dir möchte ich mich weiterhin für Deine großartige Betreuung bedanken. Du hast mir immer Raum für meine eigenen Ideen gelassen und mich auch mal zurückgeholt wenn es Zeit war fokussiert zu sein. An Deine stets sehr konstruktive und hilfreiche aber auch knallharte Kritik („Die ﬁgure tut mir in den Augen weh“) musste ich mich erst ge- wöhnen, aber ich wusste sie sehr zu schätzen. Auch für Deine vielen Tips & Tricks sowie für Deine Geduld und Dein Vertrauen in meine Fähigkeiten danke ich Dir. Diese Arbeit wäre ohne Deinen allumfassenden Überblick mit Sicherheit deutlich unverständlicher geworden.

Diese Arbeit wurde sowohl in der AG Mundlos am Max-Planck-Institut für Molekulare Genetik, sowie in der AG Kornak am Institut für Humangenetik der Charité durchgeführt. Da ich den größten Teil der Zeit am „MPI MG“ verbracht habe, möchte ich zunächst meinen Dank an alle Mitarbeiter der AG Mundlos ausdrücken. Wenn ich mich recht erin- nere, wird die AG Mundlos an der Charité die „Kuschelgruppe“ genannt, und tatsächlich war es auch recht kuschelig bei uns, mit sehr viel Hilfsbereitschaft, gegenseitem Interes- se an der Arbeit des anderen und viel wissenschaftlichem und nicht-wissenschaftlichem Austausch bei einem Kaﬀee in unserem, was den Kaﬀee angeht, exzellent ausgerüsteten Aufenthaltsraum oder auch mal einem kühlen Bier auf dem Balkon des „sunshine labs“. Mit Euch hatte ich eine großartige Zeit, an die ich mich sehr gerne zurückerinnere.

Liebe Hendrikje, nun komme ich endlich zu Dir: dass die Zeit meiner Doktorarbeit so großartig war, liegt zu einem erheblichen Teil daran, dass ich Dich kennengelernt habe.

126 Unsere vielen sinnlosen und auch sinnvollen Gespräche, die Euphorie und den Frust den wir geteilt haben, und Deinen messerscharfen Verstand werde ich bestimmt nicht vermissen müssen, denn ich bin mir sicher dass wir uns nicht so schnell aus den Augen verlieren!

Carola, auch Dir danke ich für die auﬂockernden Kicker-Spiele am Anfang meiner Dok- torarbeit, und auch ganz besonders dafür, dass Du am Ende meiner Doktorarbeit, die manchmal schon ermüdende Histo-Arbeit und das Auszählen der Zellen so tapfer durch- gezogen hast!

All den anderen Kollegen von denen viele zu Freunden geworden sind möchte ich an dieser Stelle auch meinen Dank aussprechen. Um einige von euch zu nennen, Daniel „Ibri“, Martin „der Etablierer“, Pedro „El Poncho“, Mickael „Miguel“ und Julia „die Andere“, auch dank Euch wird mir die AG Mundlos in einer guten Erinnerung bleiben. Natürlich muss ich hier auch die vielen Gespräche über science und die Welt („Na, sind die Ex- kremente mal wieder kaputt?“ und „Reingewhamst!“) mit meinem Oﬃcenachbarn Malte erwähnen. Auch bei Wibke, meiner treuen Kicker-Partnerin und einer exzellenten Köchin, möchte ich mich für die treue Freundschaft und die vielen kreativen Gespräche herzlich bedanken!

Nun zu der AG Kornak: Björn obwohl Du nie Zeit hattest, hast Du Dir doch erstaun- lich oft Zeit genommen mit mir über Pycr1 und die Welt zu reden. Ich möchte Dir ganz besonders danken. Von Dir habe ich sehr viel Methodisches und über das wissenschaftli- che Arbeiten und Präsentieren gelernt. Und nebenbei hatten wir auch eine Menge Spass, besonders auf Kreta!

Auch Johannes E., Claire, Hardy, Magdalena, Denise und Sabine danke ich für eure Hilfsbereitschaft und auch tatkräftige Hilfe. Auch wenn ich ein „auswärtiges“ Mitglied der AG Kornak war, habt ihr mir immer das Gefühl gegeben dazuzugehören und wart bei methodischen und wissenschaftlichen Problemen und Durchbrüchen für mich da.

Christopher, auch Dir möchte ich meinen Dank für Deine Unterstützung während der ersten Hälfte meiner Doktorarbeit aussprechen.

Zuletzt möchte ich meinen Liebsten danken. Dazu gehörst Du, Jürgen, und meine Familie. Angefangen mit den Schnitzeljagden über die „Versteckspiele “ bis zu Deiner Aufbauarbeit, hast Du mir gezeigt, dass Du es als Kollege und noch mehr als Freund echt drauf hast! Jürgen, auch wenn Dein Auftreten in meinem Leben, zunächst, sagen wir, ähm, ein mittelgroßes Chaos ausgelöst hast, Du bist das Beste an meiner Arbeit! Wie dankbar ich meiner Familie bin, kann ich hier gar nicht ausdrücken. Ihr wart tat- sächlich immer für mich da und habt mich unterstützt, auch in Situationen, in denen ich es nicht vorausgesehen habe. Ridvan, Du hast mich maßgeblich beeinﬂußst, in dem Du mir immer wieder gezeigt hast wie einfach das Leben ist und ermutigt hast zu tun was ich für richtig halte. Einen besser großen Bruder kann man sich nicht wünschen!

127 List of Figures

1 ARCL2-associated genes ...... 10 2 Features of PYCR1-related cutis laxa ...... 12 3 PYCR1 deficiency increases sensitivity to oxidative stress ...... 13 4 PYCR1 deficiency increases sensitivity to starvation stress ...... 14 5 Distribution of ARCL2B causing mutation in the PYCR1 gene ...... 15 6 Proline biosynthesis pathway ...... 17 7 Mitochondrial structure and the OXPHOS system ...... 19 8 Schematic overview of mitochondrial fusion and fission ...... 23 9 Pycr1 is present in various tissues in embryonic limbs ...... 63 10 Pycr1 is expressed in a broad range of adult tissues ...... 64 11 Human and murine PYCR paralogues are highly conserved ...... 65 12 Strategy scheme for targeting Pycr1 ...... 66 13 qPCR screening of ES cell clones ...... 67 14 Southern blot screening of ES cell clones ...... 68 15 Identification of germline transmission and germline excision ...... 70 16 Quantification of the knock out efficiency ...... 71 17 Structural and ultra structural observations in Pycr1 deficient skin .... 73 18 Pycr1-deficiency causes alterations in murine skin ...... 74 19 Pycr1-deficiency causes a reduction of trabecular bone in tibiae from 4 week old juvenile mice ...... 75 20 No differences in the trabecular bone in tibiae from 8 and 12 week old adult mice ...... 75 21 No differences in the architecture of trabecular bone of femora ...... 76 22 Pycr1-deficiency causes bone histomorphometrical changes ...... 77 23 Expression analyses on enriched osteocytes ...... 79 24 Expression analyses on enriched osteoblasts ...... 80 25 Histological findings in Pycr1 deficient juvenile skeletal muscle ...... 81 26 Histological findings in Pycr1 deficient adult skeletal muscle ...... 82 27 Analyses of muscle fiber type proportion in juvenile mice ...... 83 28 Analyses of muscle fiber type proportion in adult mice ...... 84 29 Expression pattern of fiber type determination and ROS detoxifying genes 85 30 Structure of mitochondrial network under starvation stress ...... 87 31 Energy metabolism in Pycr1-deficient MEFs ...... 88 32 Mitochondrial ultrastructure and characterization of the OXPHOS complexes in muscle ...... 89

128 33 Human and murine PYCR paralogues are similarly expressed ...... 91 34 Human and murine PYCR proteins differ in their size ...... 93 35 Effect of Pycr1 and -2 deficiency on mitochondrial structure and apoptosis 94 36 Proline biosynthesis pathway with redox equivalents ...... 106

129 List of Tables

1 Centrifuges ...... 31 2 Thermo cyclers ...... 31 3 Microscopy...... 31 4 Histology ...... 32 5 Other instruments ...... 32 6 Kits ...... 33 7 Vectors, expression constructs and bacs...... 33 8 Antibodies ...... 34 9 Bacterial strains ...... 34 10 Primer for Pycr1 cKO targeting construct ...... 35 11 Standard cloning primer ...... 35 12 Primer for southern blot probes ...... 35 13 Primer embryonic stem cell screening ...... 36 14 Primer for genotyping ...... 36 15 Primer for overexpression constructs ...... 36 16 Primer for mtDNA copy number determination ...... 37 17 Primer for expression profiling of human genes ...... 37 18 Primer for expression profiling of murine genes ...... 38 19 Software ...... 39 20 Internet resources ...... 39 21 Standard PCR program ...... 43 22 Standard PCR protocol ...... 43 23 Specifications for Pycr1 genotyping ...... 44 24 Pycr1 genotyping protocol ...... 44 25 Pycr1 genotyping program ...... 45 26 Dehydration program for paraffin embedding ...... 59 27 Deparaffinization and rehydration ...... 61

130 ACL aquired cutis laxa kDa kilo dalton ADCL autosomal dominant cutis laxa ko knock out approx. approximately l liter (s) ARCL autosomal recessive cutis laxa lox P locus of X-over P1 ATP adenosine triphosphate m mili (prefix) bp base pairs M molar BSA bovine serum albumin MEF murine embrionic fibroblast ◦C Degree Celsius MetOH methanol cDNA coding DNA min minuit(s) C. elegans Caenorhabditis elegans mol moles Chr chromosome mRNA messenger RNA CMV cytomegalovirus n nano (prefix) Co2 carbon dioxide NADPH nicotinamide adenine dinucleotide phosphate DAPI 4’,6-Diamidin-2-phenylindol NADH nicotinamide adenine dinucleotide DBS De Barsy Syndrome O2 oxygen 1 ddH2O double distilled water P5C Δ -pyrroline-5-carboxylate depc diethylpyrocarbonate P5CDH P5C dehydrogenase DMEM Dulbeccos’s modified eagle’s P5CS P5C synthase medium DMSO dimethylsulfoxide PAGE polyacrylamide gel electrophoresis DNA deoxyribonucleic PBS phosphate-buffered saline dNTP deoxyribonucleotide PCR polymerase chain reaction e− electron PFA paraformaldehyde E embryonic stage Pfu Pyrococcus furiosus E. coli Escherichia coli PRODH proline dehydrogenase EDTA ethylenediaminetetraacetic acid PYCR Δ1-pyrroline-5-carboxylate reductase ER endoplasmic reticulum qPCR quantitative PCR EtOH ethanol RNA ribonucleic acid F1 first filial generation RNAi RNA interference FADH2 flavin adenine dinucleotide ROS reactive oxygen species FCS fetal calf serum rpm revolutions per minute FRT flippase recognition target RT room temperature g gram siRNA short interfering RNA GO Gerodermia Osteodysplastica s.d. standard deviation h hour(s) SDS sodium dodecyl sulfate H+ proton sec second(s) H2O water siRNA short interfering RNA H2O2 hydrogen peroxid WSS Wrinkly Skin Syndrome HAF human adult fibroblast wt wild type kb kilo bases XCL X-linked cutis laxa

131 List of publications Parts of this thesis were presented as poster as followed: A Mouse Model for PYCR1-related Autosomal Recessive Cutis Laxa EMBO Conference „Mitochondria in life, death and disease“, Kreta 2012 Day of Science, Max-Planck-Institut für Molekulare Genetik, Berlin 2012