DOCSLIB.ORG

Expression and Complex Formation of Simian Virus 40 Large T Antigen and Mouse P53 in Insect Cells DAVID, R

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression and Complex Formation of Simian Virus 40 Large T Antigen and Mouse P53 in Insect Cells DAVID, R JOURNAL OF VIROLOGY, Sept. 1988, p. 3109-3119 Vol. 62, No. 9 0022-538X/88/093109-11$02.00/0 Copyright © 1988, American Society for Microbiology Expression and Complex Formation of Simian Virus 40 Large T Antigen and Mouse p53 in Insect Cells DAVID, R. O'REILLY AND LOIS K. MILLER* Departments ofEntomology and Genetics, University of Georgia, Athens, Georgia 30602 Received 1 March 1988/Accepted 16 May 1988 Recombinant baculoviruses were constructed which express simian virus 40 large T antigen (SVT-Ag) or murine p53 to high levels in infected insect cells. Characterization of the expressed proteins revealed that they display many properties of the corresponding mammalian-derived proteins. Both proteins are of wild-type size, localize to the nucleus, are recognized by several SVT-Ag- or p53-specific monoclonal antibodies, and are phosphorylated in this system. Complexes are formed between baculovirus-derived SVT-Ag and p53 after coinfection of insect cells with both recombinant viruses. After infection of insect cells with either virus individually, each protein can self-associate to form a variety of oligomeric species. Pulse-chase experiments indicated that both SVT-Ag and p53 are highly stable in insect cells, even in the absence of complex formation. A variety of gene expression systems have been devel- able concerning the nature or site(s) of the phosphorylation oped recently with a view to achieving enhanced expression events involved (17, 34, 36). Baculovirus-derived human of eucaryotic proteins normally present at extremely low epidermal growth factor receptor displays an autophos- levels (44). A recently developed vector system with consid- phorylation activity like that of the wild-type protein (12). erable potential employs the baculovirus Autographa cali- We chose to study the expression of simian virus 40 fornica nuclear polyhedrosis virus (AcMNPV) to mediate (SV40) large T antigen (SVT-Ag) and murine p53, because expression of the cloned gene in insect cell cultures (25, 31, prior characterization of the numerous functions and post- 32). In this system, the gene is inserted in place of the translational modifications associated with these proteins AcMNPV polyhedrin gene, which is nonessential for viral has been extensive. SVT-Ag displays ATPase activity, replication in cell culture. Expression of the cloned gene is DNA-binding activity, and helicase activity (4, 5, 43, 57). then under the control of the polyhedrin promoter, resulting The protein is essential for viral DNA replication (59) and in high levels of expression late in infection. may associate with the host cell DNA polymerase alpha (53). To date, a wide range of genes has been expressed by It can immortalize and transform primary and established using the baculovirus system and in many cases, biologically cell lines, and these properties may be related to its ability to activp proteins have been obtained (32a; reviewed in refer- bind and stabilize the host cell protein p53 (30, 38, reviewed ence 25). Characterization of the expressed proteins has in reference 37). p53 itself is an immortalizing oncogene (6, shown that insect cells can carry out at least some of the 20, 39) and is implicated in the passage of cells from Go to G1 posttranslational modifications which occur in mammalian (21). Both SVT-Ag and p53 are phosphoproteins, and the cells. Signal sequence cleavage has been demonstrated for nature and sites of phosphorylation are largely determined human alpha- and beta-interferon and interleukin-2 and -3 (29, 45-49, 60). SVT-Ag is a particularly good model to study (27, 33, 54, 55), while the appropriate proteolytic cleavage of phosphorylation since there is much recent evidence linking human immunodeficiency virus env and gag proteins and phosphorylation to the regulation of a number of its biolog- influenza virus hemagglutinin is observed (16, 22, 26, 40). ical activities, especially viral DNA replication and DNA Polyomavirus large T antigen and the Drosophila Kruppel binding (11, 35, 48). protein display DNA-binding activity after synthesis in in- In this study, we describe the expression of SVT-Ag and sect cells (36, 42). Oligomerization, complex formation, or p53 by using the baculovirus expression system. The abun- both has been observed for baculovirus-expressed rotavirus dantly expressed proteins are localized in the insect cell major capsid antigen (7) and two influenza virus polymerase nucleus and adopt a structural conformation similar to that complex proteins (56). of their mammalian counterparts. Both proteins are phos- It is not yet clear whether all posttranslational modifica- phorylated and retain the ability to associate together after tions will be comparable in mammalian and insect cells. expression in insect cells. Glycosylation is one modification which appears to differ between mammalian and insect cells, but the significance of MATERIALS AND METHODS this difference is not yet known and several biologically Cells and viruses. Spodoptera frugiperda (fall armyworm) active have been by using glycoproteins already produced IPLB-SF21 cells (SF21 cells) (61) were maintained in TC-100 the baculovirus system. One of the posttranslational modi- medium (GIBCO Laboratories) supplemented with 10% fetal fications of is phosphorylation, because this key importance calf serum and 0.25% tryptose broth. Stocks of wild-type modification has been found to play a critical role in the (wt) virus, AcMNPV L-1 (24), were prepared and assayed as regulation of protein function in a variety of systems. It is described previously (31). Extracts of clone 6 rat cells (30), known that the c-myc, and Drosophila Kruppel protein, which express elevated levels of mouse p53, and AdS human T-cell leukemia virus type I p40" are phosphorylated SVR111-infected human 293 cells (10) containing SVT-Ag after expression in insect cells, but no information is avail- were provided by C. Prives. Construction of recombinant viruses. To generate recom- * Corresponding author. binant AcMNPVs expressing SVT-Ag and mouse p53, 3109 3110 O'REILLY AND MILLER J. VIROL. Bam HI Eco RI A 1781 CIan B (BgIll/Kpn I Pst I 3 ~~Kpn ST-Ag Eco RI 5190 pEV55SVT Xho I to (BgIU/StuI) 9.9 kb pEV55p53 BgIll3 7.8kb -'p~~~~~~~~~~~~~~~~~~~~~ p Polyhedrin 5' leoder p53 5 leader Polyhedrin 5' leoder SVT-Ag 5 leader -0 BgIll Eco RI - * (Bgl /StuD) I0 AAACCTATAAATAGATCTCGAGAATTCCATCCTGG AAAC CTATAAATAG ATC C CTAG GCTTTT 1t XhoI _-29y -105 FIG. 1. Structure of the transplacement plasmids pEV55SVT and pEV55p53 (not to scale). (A) In pEV55SVT, SV40 sequences from pSVT#5, including the cDNA copy of the SVT-Ag gene, are indicated by the hatched box. The arrow indicates the expected SVT-Ag transcript. SV40 nucleotide numbers are given. (B) For pEV55p53, the stippled box represents the p53 cDNA from pSV53c. Again, the p53 transcript is indicated. In both plasmids, AcMNPV sequences which flank the polyhedrin gene are presented as open boxes (P5' and P3'). The pUC8 sequences are indicated by a thin line. Selected restriction endonuclease sites are shown. Sites in parentheses are those present in the original fragments which were destroyed during the construction. The sequence of the pEV55-cDNA junction is given below each plasmid. In each case, the position of the fusion site relative to the AUG of the cloned gene is indicated. cDNA copies of these genes were cloned first into the type (31). The recombinant viruses were subjected to three transplacement plasmid pEV55. The structure of this vector rounds of plaque purification before large-scale virus stocks has been described previously (31, 32). The cDNA encoding were prepared. Viral DNA was isolated, and the structures SVT-Ag was excised from the plasmid pSVT#5 (constructed of the resultant viruses, vEV55SVT and vEV55p53, were by Y. Gluzman) by digestion with StuI (nucleotide 5191) and verified by restriction enzyme analysis and Southern blot- EcoRI (nucleotide 1780), yielding a fragment which extends ting. from 29 base pairs upstream of the ATG of SVT-Ag to Analysis of proteins synthesized in infected cells. SF21 cells approximately a kilobase downstream of the translational (106/35-mm Petri dish) were infected with wt or recombinant termination codon. This fragment was cloned into pEV55 viruses at a multiplicity of infection (MOI) of from 10 to 50 which had been previously digested with BglII (filled in with (see figure legends). At the appropriate times postinfection T4 DNA polymerase) and EcoRI. The recombinant plasmid (p.i.), the medium was removed and replaced with TC-100 obtained, pEV55SVT, is illustrated in Fig. 1A. lacking either methionine or phosphate. The cells were To construct pEV55p53, a cDNA encoding murine p53 labeled 1 h later with 50 ,uCi of [35S]methionine or 100 ,uCi of was excised from the plasmid pSV53c (19) by digestion with 32p; (New England Nuclear) in 0.5 ml of methionine- or EcoRI and BglII (filled in with T4 DNA polymerase). The phosphate-deficient medium. The lengths of the labeling resultant 1.33-kilobase fragment includes 105 base pairs of 5' periods are indicated in the individual figure legends. In flanking sequence and extends 20 base pairs beyond the certain experiments, the [35S]methionine pulse labeling was termination codon. It was inserted into pEV55 that had been chased by incubation of the cells in TC-100 containing an previously digested with KpnI (blunt ended within T4 DNA excess of unlabeled methionine. The cells were rinsed three polymerase) and EcoRI. The structure of the resultant plasmid, pEV55p53, is depicted in Fig. 1B. times in cold phosphate-buffered saline (PBS; 8 mM To confirm the structure of the pEV55-cDNA junction in Na2HPO4, 137 mM NaCl, 0.5 mM MgCl2, 1.6 mM KH2PO4, both pEV55SVT and pEV55p53, the DNA sequence span- 2.7 mM KCl [pH 8.0]) and incubated in 50 ,ul of lysis buffer ning the junction was determined by double-stranded se- (1% Nonidet P-40, 150 mM NaCl, 50 mM Tris hydrochloride quencing of plasmid DNA, essentially as described by Chen [pH 8.0]) containing 1 mM phenylmethylsulfonyl fluoride and Seeburg (3).
Load more

Recommended publications
  • Oncogenes of DNA Tumor Viruses1
    [CANCER RESEARCH 48. 493-496. February I. 1988] Perspectives in Cancer Research Oncogenes of DNA Tumor Viruses1 Arnold J. Levine Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544 Experiments carried out over the past 10-12 years have the cellular oncogenes. It will attempt to identify where more created a field or approach which may properly be termed the information is required or contradictions appear in the devel molecular basis of cancer. One of its major accomplishments oping concepts. Finally, this communication will examine ex has been the identification and understanding of some of the amples of cooperation between oncogenes and other gene prod functions of a group of cancer-causing genes, the oncogenes. ucts which modify the mode of action of the former. If we are The major path to the oncogenes came from the study of cancer- on the right track, then general principles may well emerge. causing viruses. The oncogenes have been recognized and stud Tumor formation in animals or transformation in cell culture ied by two separate but related groups of virologists focusing has been demonstrated with many different DNA-containing upon either the DNA (1) or RNA (2) tumor viruses (they even viruses (1). In most cases it has been possible to identify one or have separate meetings now that these fields have grown so a few viral genes and their products that are responsible for large). From their studies it has become clear that the oncogenes transformation or, in some cases, tumorigenesis. A list of these of each virus type have very different origins.
    [Show full text]
  • Tätigkeitsbericht 2007/2008
    Tätigkeitsbericht 2007/2008 8 200 / 7 0 20 Tätigkeitsbericht Stiftung bürgerlichen Rechts Martinistraße 52 · 20251 Hamburg Tel.: +49 (0) 40 480 51-0 · Fax: +49 (0) 40 480 51-103 [email protected] · www.hpi-hamburg.de Impressum Verantwortlich Prof. Dr. Thomas Dobner für den Inhalt Dr. Heinrich Hohenberg Redaktion Dr. Angela Homfeld Dr. Nicole Nolting Grafik & Layout AlsterWerk MedienService GmbH Hamburg Druck Hartung Druck + Medien GmbH Hamburg Titelbild Neu gestaltete Fassade des Seuchenlaborgebäudes Tätigkeitsbericht 2007/2008 Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie an der Universität Hamburg Martinistraße 52 · 20251 Hamburg Postfach 201652 · 20206 Hamburg Telefon: +49-40/4 80 51-0 Telefax: +49-40/4 80 51-103 E-Mail: [email protected] Internet: www.hpi-hamburg.de Das Heinrich-Pette-Institut ist Mitglied der Leibniz-Gemeinschaft (WGL) Internet: www.wgl.de Inhaltsverzeichnis Allgemeiner Überblick Vorwort ................................................................................................... 1 Die Struktur des Heinrich-Pette-Instituts .............................................. 2 Modernisierung des HPI erfolgreich abgeschlossen ............................ 4 60 Jahre HPI .............................................................................................. 5 Offen für den Dialog .............................................................................. 6 Preisverleihungen und Ehrungen .......................................................... 8 Personelle Veränderungen in
    [Show full text]
  • Inhibition of HIV-1 by an Anti-Integrase Single-Chain Variable
    Gene Therapy (1999) 6, 660–666 1999 Stockton Press All rights reserved 0969-7128/99 $12.00 http://www.stockton-press.co.uk/gt Inhibition of HIV-1 by an anti-integrase single-chain variable fragment (SFv): delivery by SV40 provides durable protection against HIV-1 and does not require selection M BouHamdan1, L-X Duan1, RJ Pomerantz1 and DS Strayer1,2 1The Dorrance H Hamilton Laboratories, Center for Human Virology, Division of Infectious Diseases, Department of Medicine; and 2Department of Pathology, Anatomy and Cell Biology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA, USA Human immunodeficiency virus type I (HIV-1) encodes the SFv-IN was confirmed by Western blotting and several proteins that are packaged into virus particles. Inte- immunofluorescence staining, which showed that Ͼ90% of grase (IN) is an essential retroviral enzyme, which has SupT1 T-lymphocytic cells treated with SV(Aw) expressed been a target for developing agents to inhibit virus repli- the SFv-IN protein without selection. When challenged, cation. In previous studies, we showed that intracellular HIV-1 replication, as measured by HIV-1 p24 antigen expression of single-chain variable antibody fragments expression and syncytium formation, was potently inhibited (SFvs) that bind IN, delivered via retroviral expression vec- in cells expressing SV40-delivered SFv-IN. Levels of inhi- tors, provided resistance to productive HIV-1 infection in bition of HIV-1 infection achieved using this approach were T-lymphocytic cells. In the current studies, we evaluated comparable to those achieved using murine leukemia virus simian-virus 40 (SV40) as a delivery vehicle for anti-IN (MLV) as a transduction vector, the major difference being therapy of HIV-1 infection.
    [Show full text]
  • SV40 Large T Antigen Targets Multiple Cellular Pathways to Elicit Cellular Transformation
    Oncogene (2005) 24, 7729–7745 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc SV40 large T antigen targets multiple cellular pathways to elicit cellular transformation Deepika Ahuja1,2, M Teresa Sa´ enz-Robles1,2 and James M Pipas*,1 1Department of Biological Sciences, University of Pittsburgh, Pittsburgh, PA 15260, USA DNA tumor viruses such as simian virus 40 (SV40) three proteins that are structural components of the express dominant acting oncoproteins that exert their virion (VP1, VP2, VP3) and two nonstructural proteins effects by associating with key cellular targets and termed large T antigen (T antigen) and small T antigen altering the signaling pathways they govern. Thus, tumor (t antigen). In addition, some members of the Polyoma- viruses have proved to be invaluable aids in identifying viridae encode additional proteins that are virus specific proteins that participate in tumorigenesis, and in under- or are encoded by a subset of viruses in the family. For standing the molecular basis for the transformed pheno- example, SV40 encodes three such proteins: agnopro- type. The roles played by the SV40-encoded 708 amino- tein, 17K T, and small leader protein. The genomes of acid large T antigen (T antigen), and 174 amino acid small all polyomaviruses can be divided into three elements: T antigen (t antigen), in transformation have been an early coding unit, a late coding unit, and a regulatory examined extensively. These studies have firmly estab- region (Figure 1). In a productive infection, expression lished that large T antigen’s inhibition of the p53 and Rb- of the early coding unit is effected by the cellular family of tumor suppressors and small T antigen’s action transcription apparatus and results in expression of the on the pp2A phosphatase, are important for SV40-induced large, small and 17K T antigens.
    [Show full text]
  • Hepatitis B Virus X Protein Inhibits P53 Sequence-Specific DNA Binding
    Proc. Nati. Acad. Sci. USA Vol. 91, pp. 2230-2234, March 1994 Medical Sciences Hepatitis B virus X protein inhibits p53 sequence-specific DNA binding, transcriptional activity, and association with transcription factor ERCC3 XIN WEI WANG*, KATHLEEN FORRESTER*, HEIDI YEH*, MARK A. FEITELSONt, JEN-REN GUI, AND CURTIS C. HARRIS*§ *Laboratory of Human Carcinogenesis, Division of Cancer Etiology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; tDepartment of Pathology and Cell Biology, Jefferson Medical College, Philadelphia, PA 19107; and tDepartment of Molecular Biology and Biochemistry, Shanghai Cancer Institute, Shanghai, People's Republic of China. Communicated by Bert Vogelstein, December 27, 1993 (receivedfor review December 9, 1993) ABSTRACT Chronic active hepatitis caused by infection about the role of HBX in HCC development. In this report, with hepatitis B virus, a DNA virus, is a major risk factor for we present results consistent with the hypothesis that HBX human hepatocellular carcinoma. Since the oncogenicity of binds to p53 and abrogates its normal cellular functions. several DNA viruses is dependent on the interaction of their viral oncoproteins with cellular tumor-suppressor gene prod- MATERIAL AND METHODS ucts, we investigated the interaction between hepatitis B virus X protein (HBX) and human wild-type p53 protein. HBX Plasmids. Plasmid constructs encoding GST-p53-WT, con- complexes with the wild-type p53 protein and inhibits its taining glutathione S-transferase (GST) fused to human wild- sequence-specific DNA binding in vitro. HBX expresslin also type p53, and GST-p53-135Y, containing GST fused to the inhibits p53-mediated transcrptional activation in vivo and the mutant p53 containing a His -* Tyr mutation at codon 135, in vitro asoition of p53 and ERCC3, a general transcription were provided by Jon Huibregtse (National Cancer Institute) factor involved in nucleotide excision repair.
    [Show full text]
  • P53 and the Viral Connection: Back Into the Future ‡
    cancers Review p53 and the Viral Connection: Back into the Future ‡ Ronit Aloni-Grinstein 1,2,†, Meital Charni-Natan 1,†, Hilla Solomon 1 and Varda Rotter 1,* 1 Department of Molecular Cell Biology, Weizmann Institute of Science, 76100 Rehovot, Israel; [email protected] (R.A.-G.); [email protected] (M.C.-N.); [email protected] (H.S.) 2 Department of Biochemistry and Molecular Genetics, Israel Institute for Biological Research, Box 19, 74100 Ness-Ziona, Israel * Correspondence: [email protected]; Tel.: +972-8-9344501; Fax: +972-8-9342398 † These authors contributed equally to this work. ‡ This review is dedicated to the 25th memorial year of Prof. Yosef Aloni of the Weizmann Institute of Science, for his seminal and important pioneering research in the field of molecular biology of the SV40 virus. Received: 15 May 2018; Accepted: 1 June 2018; Published: 4 June 2018 Abstract: The discovery of the tumor suppressor p53, through its interactions with proteins of tumor-promoting viruses, paved the way to the understanding of p53 roles in tumor virology. Over the years, accumulating data suggest that WTp53 is involved in the viral life cycle of non-tumor-promoting viruses as well. These include the influenza virus, smallpox and vaccinia viruses, the Zika virus, West Nile virus, Japanese encephalitis virus, Human Immunodeficiency Virus Type 1, Human herpes simplex virus-1, and more. Viruses have learned to manipulate WTp53 through different strategies to improve their replication and spreading in a stage-specific, bidirectional way. While some viruses require active WTp53 for efficient viral replication, others require reduction/inhibition of WTp53 activity.
    [Show full text]
  • Giorda KM, Raghava S, Hebert DN. the Simian Virus 40 Late Viral
    The Simian Virus 40 Late Viral Protein VP4 Disrupts the Nuclear Envelope for Viral Release Kristina M. Giorda, Smita Raghava and Daniel N. Hebert J. Virol. 2012, 86(6):3180. DOI: 10.1128/JVI.07047-11. Published Ahead of Print 11 January 2012. Downloaded from Updated information and services can be found at: http://jvi.asm.org/content/86/6/3180 http://jvi.asm.org/ These include: SUPPLEMENTAL MATERIAL http://jvi.asm.org/content/suppl/2012/02/14/86.6.3180.DC1.html REFERENCES This article cites 56 articles, 16 of which can be accessed free on June 8, 2012 by Univ of Massachusetts Amherst at: http://jvi.asm.org/content/86/6/3180#ref-list-1 CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ The Simian Virus 40 Late Viral Protein VP4 Disrupts the Nuclear Envelope for Viral Release Kristina M. Giorda,a,b Smita Raghava,a and Daniel N. Heberta,b Department of Biochemistry and Molecular Biologya and Program in Molecular and Cellular Biology,b University of Massachusetts, Amherst, Massachusetts, USA Simian virus 40 (SV40) appears to initiate cell lysis by expressing the late viral protein VP4 at the end of infection to aid in virus Downloaded from dissemination. To investigate the contribution of VP4 to cell lysis, VP4 was expressed in mammalian cells where it was predomi- nantly observed along the nuclear periphery.
    [Show full text]
  • PP2A-Dependent Disruption of Centrosome Replication and Cytoskeleton Organization in Drosophila by SV40 Small Tumor Antigen
    Oncogene (2008) 27, 6334–6346 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc ORIGINAL ARTICLE PP2A-dependent disruption of centrosome replication and cytoskeleton organization in Drosophila by SV40 small tumor antigen S Kotadia1,LRKao1, SA Comerford2, RT Jones1, RE Hammer3 and TL Megraw1 1Department of Pharmacology, The Cecil and Ida Green Center for Reproductive Biology Sciences, The University of Texas Southwestern Medical Center at Dallas, Dallas, TX, USA; 2Department of Molecular Genetics, The Cecil and Ida Green Center for Reproductive Biology Sciences, The University of Texas Southwestern Medical Center at Dallas, Dallas, TX, USA and 3Department of Biochemistry, The Cecil and Ida Green Center for Reproductive Biology Sciences, The University of Texas Southwestern Medical Center at Dallas, Dallas, TX, USA Viruses of the DNA tumor virus family share the ability to cell-cycle and apoptosis regulation, viral oncoproteins transform vertebrate cells through the action of virus- transform cells. Investigation of DNA tumor virus encoded tumor antigens that interfere with normal cell oncoproteins has led to the identification of many physiology. They accomplish this very efficiently by fundamental mechanisms of tumor suppression (Lavia inhibiting endogenous tumor suppressor proteins that et al., 2003; Ahuja et al., 2005). By altering the activity control cell proliferation and apoptosis. Simian virus 40 of p53, retinoblastoma protein and serine/threonine (SV40) encodes two oncoproteins, large tumor antigen, protein phosphatase 2A (PP2A), three key tumor which directly inhibits the tumor suppressors p53 and Rb, suppressors, SV40 can cause tumor formation in and small tumor antigen (ST), which interferes with transgenic mouse models (Ahuja et al., 2005; Arroyo serine/threonine protein phosphatase 2A (PP2A).
    [Show full text]
  • The Simian Virus 40 Large Tumor Antigen Activates Csrc and Requires Csrc for Full Neoplastic Transformation
    ANTICANCER RESEARCH 30: 47-54 (2010) The Simian Virus 40 Large Tumor Antigen Activates cSrc and Requires cSrc for Full Neoplastic Transformation ROZANNE ARULANANDAM, MULU GELETU and LEDA RAPTIS Departments of Microbiology and Immunology and Pathology, Queen's University, Kingston, Ontario, K7L 3N6, Canada Abstract. Aim: To investigate the role of the cellular The effects of TAg on the Rb family proteins are thought to be protooncogene product, cSrc, in neoplastic transformation by exerted by regulating the activity of the E2F transcription factors. the large tumor antigen of simian virus 40 (TAg), the ability of There are eight known E2F proteins (E2F1-8), all of which TAg to increase cSrc activity was examined. Materials and possess a DNA-binding domain that governs their interactions Methods: cSrc activity was measured in cells expressing wild- with a common consensus sequence present in the promoters of type or mutant TAg and compared to the parental line. Results: a number of genes (reviewed in (4, 5)). In quiescent cells, E2F- The results indicated that TAg expression in mouse 3T3 regulated genes are not expressed because their promoters are fibroblasts causes a dramatic increase in cSrc activity, a finding occupied primarily by p130/E2F4 complexes which repress which establishes TAg as a cSrc activator. This ability transcription. Following receptor stimulation, Rb proteins are depended upon a TAg, intact retinoblastoma-susceptibility gene inactivated through phosphorylation by the cyclin-dependent product (Rb) family-binding site. In addition, genetic ablation kinases and this results in the replacement of the p130/E2F4 of pRb in mouse fibroblasts increased cSrc activity, suggesting complexes by the ‘activating’ E2F1-3.
    [Show full text]
  • Identification of Rab18 As an Essential Host Factor for Bkpyv Infection Using a Whole Genome RNA 2 Interference Screen
    bioRxiv preprint doi: https://doi.org/10.1101/157602; this version posted June 29, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Identification of Rab18 as an Essential Host Factor for BKPyV Infection Using a Whole Genome RNA 2 Interference Screen 3 4 Linbo Zhaoa, Michael J. Imperialea,b,* 5 6 aDepartment of Microbiology and Immunology, bComprehensive Cancer Center, University of Michigan, 7 Ann Arbor, MI, 48109, USA 8 9 10 11 12 13 14 15 16 17 18 * Corresponding author. Department of Microbiology and Immunology, 1150 West Medical Center 19 Drive, 5724 Medical Science II, Ann Arbor, MI 48109-5620, USA. Tel. +1 (734) 763 9162. Fax: +1 (734) 20 764 3562. 21 E-mail addresses: [email protected] (L. Zhao); [email protected] (M.J. Imperiale). 22 23 24 1 bioRxiv preprint doi: https://doi.org/10.1101/157602; this version posted June 29, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 25 Abstract 26 27 BK polyomavirus (BKPyV) is a human pathogen first isolated in 1971. BKPyV infection is ubiquitous in the 28 human population, with over 80% of adults worldwide being seropositive for BKPyV. BKPyV infection is 29 usually asymptomatic; however, BKPyV reactivation in immunosuppressed transplant patients causes 30 two diseases, polyomavirus-associated nephropathy and hemorrhagic cystitis.
    [Show full text]
  • Nuclear Targeting of SV40 and Adenovirus
    Nuclear targeting of SV40 and adenovirus Urs F. Greber and Harumi Kasamatsu Urs Greber is at the Department of Zoology, Cell Biology Section, University of Zurich, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland. Harumi Kasamatsu is at the Department of Molecular, Cell and Developmental Biology and Molecular Biology Institute, University of California, Los Angeles, 405 Hilgard Ave, Los Angeles, CA 90024-1570, USA. Summary Import of viral DNA into the nucleus is essential for the successful replication of DNA tumor viruses. To achieve this goal viruses have adapted strategies to efficiently traverse the barriers between the plasma membrane and the nucleus of a host cell. Recent work on simian virus 40 (SV40) and adenovirus type 2 or 5 shows that SV40 DNA enters the nucleus through nuclear pore complexes (NPCs) in association with structural proteins, and that dissociation of adenovirus particles near the NPC is essential for nuclear import of the viral DNA. Karyophilic protein components of these viruses appear to mediate the nuclear entry of the viral genomes. 1 Viruses utilize unique subcellular sites for their multiplication. The information necessary for targeting infectious virions to their reproductive sites in the cell is contained within the virion structural proteins. For animal DNA viruses (except for poxviruses and iridoviruses), the nucleus is the site of all viral multiplication processes -genome replication, nucleocapsid formation, and progeny virion maturation 1. Targeting the viral DNA to the nucleus of a host cell is therefore a key event in the virion life cycle. Transport of nucleic acids across biological membranes is a process basic to all living organisms.
    [Show full text]
  • Interactions Between Polyomavirus Large T Antigen and the Viral Replication Origin Dna: How and Why
    INTERACTIONS BETWEEN POLYOMAVIRUS LARGE T ANTIGEN AND THE VIRAL REPLICATION ORIGIN DNA: HOW AND WHY by Yu-Cai Peng Department of Microbiology and Immunology McGill University, Montreal April, 1999 A thesis submitted to the Faculty of Craduate Studies and Re3earch in partial fulfullmeat of the requirements of the degree of doctor of philosophy @Yu-Cai Peng, 1999 National Library Biblioth ue nationale 1+1 of Canada du Cana7 a Acquisitions and Acquisitions et Bibliographie Srvices services bibliographiques 395 Wellmgton Street 395, nie Weliingîm Ottawa ON KIA ON4 OrtawaON K1AON4 Canada Canada The author has granted a non- L'auteur a accordé une licence non exclusive Licence ailowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfichelfilm, de reproduction sur papier ou sur format électronique. The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or othenvise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. TABLE OF CONTENTS Page Tableofcontents................................................... I Abstract .......................................................... VI Resumé........................................................... VI11 Acknowledgements ................................................. X Claim of contribution to kaowledge ................................... XI Listoffigures ...................................................... XllI Guidelines regarding doctoral thesis ................................... XV CHAPTER 1. INTRODUCTION .................................... 1 1. Overview: Life cycle of polyomavirus and simian virus 40 ..........
    [Show full text]