JOURNAL OF VIROLOGY, Sept. 1988, p. 3109-3119 Vol. 62, No. 9 0022-538X/88/093109-11$02.00/0 Copyright © 1988, American Society for Microbiology Expression and Complex Formation of Simian Virus 40 Large T Antigen and Mouse p53 in Insect Cells DAVID, R. O'REILLY AND LOIS K. MILLER* Departments ofEntomology and Genetics, University of Georgia, Athens, Georgia 30602 Received 1 March 1988/Accepted 16 May 1988 Recombinant baculoviruses were constructed which express simian virus 40 large T antigen (SVT-Ag) or murine p53 to high levels in infected insect cells. Characterization of the expressed proteins revealed that they display many properties of the corresponding mammalian-derived proteins. Both proteins are of wild-type size, localize to the nucleus, are recognized by several SVT-Ag- or p53-specific monoclonal antibodies, and are phosphorylated in this system. Complexes are formed between baculovirus-derived SVT-Ag and p53 after coinfection of insect cells with both recombinant viruses. After infection of insect cells with either virus individually, each protein can self-associate to form a variety of oligomeric species. Pulse-chase experiments indicated that both SVT-Ag and p53 are highly stable in insect cells, even in the absence of complex formation. A variety of gene expression systems have been devel- able concerning the nature or site(s) of the phosphorylation oped recently with a view to achieving enhanced expression events involved (17, 34, 36). Baculovirus-derived human of eucaryotic proteins normally present at extremely low epidermal growth factor receptor displays an autophos- levels (44). A recently developed vector system with consid- phorylation activity like that of the wild-type protein (12). erable potential employs the baculovirus Autographa cali- We chose to study the expression of simian virus 40 fornica nuclear polyhedrosis virus (AcMNPV) to mediate (SV40) large T antigen (SVT-Ag) and murine p53, because expression of the cloned gene in insect cell cultures (25, 31, prior characterization of the numerous functions and post- 32). In this system, the gene is inserted in place of the translational modifications associated with these proteins AcMNPV polyhedrin gene, which is nonessential for viral has been extensive. SVT-Ag displays ATPase activity, replication in cell culture. Expression of the cloned gene is DNA-binding activity, and helicase activity (4, 5, 43, 57). then under the control of the polyhedrin promoter, resulting The protein is essential for viral DNA replication (59) and in high levels of expression late in infection. may associate with the host cell DNA polymerase alpha (53). To date, a wide range of genes has been expressed by It can immortalize and transform primary and established using the baculovirus system and in many cases, biologically cell lines, and these properties may be related to its ability to activp proteins have been obtained (32a; reviewed in refer- bind and stabilize the host cell protein p53 (30, 38, reviewed ence 25). Characterization of the expressed proteins has in reference 37). p53 itself is an immortalizing oncogene (6, shown that insect cells can carry out at least some of the 20, 39) and is implicated in the passage of cells from Go to G1 posttranslational modifications which occur in mammalian (21). Both SVT-Ag and p53 are phosphoproteins, and the cells. Signal sequence cleavage has been demonstrated for nature and sites of phosphorylation are largely determined human alpha- and beta-interferon and interleukin-2 and -3 (29, 45-49, 60). SVT-Ag is a particularly good model to study (27, 33, 54, 55), while the appropriate proteolytic cleavage of phosphorylation since there is much recent evidence linking human immunodeficiency virus env and gag proteins and phosphorylation to the regulation of a number of its biolog- influenza virus hemagglutinin is observed (16, 22, 26, 40). ical activities, especially viral DNA replication and DNA Polyomavirus large T antigen and the Drosophila Kruppel binding (11, 35, 48). protein display DNA-binding activity after synthesis in in- In this study, we describe the expression of SVT-Ag and sect cells (36, 42). Oligomerization, complex formation, or p53 by using the baculovirus expression system. The abun- both has been observed for baculovirus-expressed rotavirus dantly expressed proteins are localized in the insect cell major capsid antigen (7) and two influenza virus polymerase nucleus and adopt a structural conformation similar to that complex proteins (56). of their mammalian counterparts. Both proteins are phos- It is not yet clear whether all posttranslational modifica- phorylated and retain the ability to associate together after tions will be comparable in mammalian and insect cells. expression in insect cells. Glycosylation is one modification which appears to differ between mammalian and insect cells, but the significance of MATERIALS AND METHODS this difference is not yet known and several biologically Cells and viruses. Spodoptera frugiperda (fall armyworm) active have been by using glycoproteins already produced IPLB-SF21 cells (SF21 cells) (61) were maintained in TC-100 the baculovirus system. One of the posttranslational modi- medium (GIBCO Laboratories) supplemented with 10% fetal fications of is phosphorylation, because this key importance calf serum and 0.25% tryptose broth. Stocks of wild-type modification has been found to play a critical role in the (wt) virus, AcMNPV L-1 (24), were prepared and assayed as regulation of protein function in a variety of systems. It is described previously (31). Extracts of clone 6 rat cells (30), known that the c-myc, and Drosophila Kruppel protein, which express elevated levels of mouse p53, and AdS human T-cell leukemia virus type I p40" are phosphorylated SVR111-infected human 293 cells (10) containing SVT-Ag after expression in insect cells, but no information is avail- were provided by C. Prives. Construction of recombinant viruses. To generate recom- * Corresponding author. binant AcMNPVs expressing SVT-Ag and mouse p53, 3109 3110 O'REILLY AND MILLER J. VIROL. Bam HI Eco RI A 1781 CIan B (BgIll/Kpn I Pst I 3 ~~Kpn ST-Ag Eco RI 5190 pEV55SVT Xho I to (BgIU/StuI) 9.9 kb pEV55p53 BgIll3 7.8kb -'p~~~~~~~~~~~~~~~~~~~~~ p Polyhedrin 5' leoder p53 5 leader Polyhedrin 5' leoder SVT-Ag 5 leader -0 BgIll Eco RI - * (Bgl /StuD) I0 AAACCTATAAATAGATCTCGAGAATTCCATCCTGG AAAC CTATAAATAG ATC C CTAG GCTTTT 1t XhoI _-29y -105 FIG. 1. Structure of the transplacement plasmids pEV55SVT and pEV55p53 (not to scale). (A) In pEV55SVT, SV40 sequences from pSVT#5, including the cDNA copy of the SVT-Ag gene, are indicated by the hatched box. The arrow indicates the expected SVT-Ag transcript. SV40 nucleotide numbers are given. (B) For pEV55p53, the stippled box represents the p53 cDNA from pSV53c. Again, the p53 transcript is indicated. In both plasmids, AcMNPV sequences which flank the polyhedrin gene are presented as open boxes (P5' and P3'). The pUC8 sequences are indicated by a thin line. Selected restriction endonuclease sites are shown. Sites in parentheses are those present in the original fragments which were destroyed during the construction. The sequence of the pEV55-cDNA junction is given below each plasmid. In each case, the position of the fusion site relative to the AUG of the cloned gene is indicated. cDNA copies of these genes were cloned first into the type (31). The recombinant viruses were subjected to three transplacement plasmid pEV55. The structure of this vector rounds of plaque purification before large-scale virus stocks has been described previously (31, 32). The cDNA encoding were prepared. Viral DNA was isolated, and the structures SVT-Ag was excised from the plasmid pSVT#5 (constructed of the resultant viruses, vEV55SVT and vEV55p53, were by Y. Gluzman) by digestion with StuI (nucleotide 5191) and verified by restriction enzyme analysis and Southern blot- EcoRI (nucleotide 1780), yielding a fragment which extends ting. from 29 base pairs upstream of the ATG of SVT-Ag to Analysis of proteins synthesized in infected cells. SF21 cells approximately a kilobase downstream of the translational (106/35-mm Petri dish) were infected with wt or recombinant termination codon. This fragment was cloned into pEV55 viruses at a multiplicity of infection (MOI) of from 10 to 50 which had been previously digested with BglII (filled in with (see figure legends). At the appropriate times postinfection T4 DNA polymerase) and EcoRI. The recombinant plasmid (p.i.), the medium was removed and replaced with TC-100 obtained, pEV55SVT, is illustrated in Fig. 1A. lacking either methionine or phosphate. The cells were To construct pEV55p53, a cDNA encoding murine p53 labeled 1 h later with 50 ,uCi of [35S]methionine or 100 ,uCi of was excised from the plasmid pSV53c (19) by digestion with 32p; (New England Nuclear) in 0.5 ml of methionine- or EcoRI and BglII (filled in with T4 DNA polymerase). The phosphate-deficient medium. The lengths of the labeling resultant 1.33-kilobase fragment includes 105 base pairs of 5' periods are indicated in the individual figure legends. In flanking sequence and extends 20 base pairs beyond the certain experiments, the [35S]methionine pulse labeling was termination codon. It was inserted into pEV55 that had been chased by incubation of the cells in TC-100 containing an previously digested with KpnI (blunt ended within T4 DNA excess of unlabeled methionine. The cells were rinsed three polymerase) and EcoRI. The structure of the resultant plasmid, pEV55p53, is depicted in Fig. 1B. times in cold phosphate-buffered saline (PBS; 8 mM To confirm the structure of the pEV55-cDNA junction in Na2HPO4, 137 mM NaCl, 0.5 mM MgCl2, 1.6 mM KH2PO4, both pEV55SVT and pEV55p53, the DNA sequence span- 2.7 mM KCl [pH 8.0]) and incubated in 50 ,ul of lysis buffer ning the junction was determined by double-stranded se- (1% Nonidet P-40, 150 mM NaCl, 50 mM Tris hydrochloride quencing of plasmid DNA, essentially as described by Chen [pH 8.0]) containing 1 mM phenylmethylsulfonyl fluoride and Seeburg (3).