DOCSLIB.ORG

Assignment of Homarus Capensis Ognized in the Genus Homarus: the American and European Lobsters, (Herbst, 1792), the Cape Lobster of H

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Assignment of Homarus Capensis Ognized in the Genus Homarus: the American and European Lobsters, (Herbst, 1792), the Cape Lobster of H Abstract.—Three species of nephropid lobsters have been rec- Assignment of Homarus capensis ognized in the genus Homarus: the American and European lobsters, (Herbst, 1792), the Cape lobster of H. americanus and H. gammarus of the northwestern and northeast- South Africa, to the new genus ern Atlantic, respectively, and the Cape lobster of South Africa, H. Homarinus (Decapoda: Nephropidae) capensis, few specimens of which have been studied until recently. Analysis of new specimens allows Irv Kornfield reconsideration of the systematic Department of Zoology and Center for Marine Studies status of this species and a subse- University of Maine, Orono, Maine 04469 quent transfer to a monotypic new genus Homarinus. Far smaller than its northern relatives, with a Austin B. Williams maximum observed carapace National Marine Fisheries Service Systematics Laboratory length of 47 mm, the Cape lobster has first chelae adorned with a National Museum of Natural History, Smithsonian Institution thick mat of plumose setae and less Washington, DC 20560 abundant setae on the carapace, tail fan, and abdominal pleura, Robert S. Steneck whereas these setae are absent in Homarus. Relative length and Department of Oceanography and Ira C. Darling Center shape of the carpus on pereopod 1, University of Maine, Walpole, Maine 04573 tooth pattern on cutting edges of first chelae, shape of the linguiform rostrum, large size of oviducal openings, and structure of male pleopods differ from corresponding features in Homarus. Comparative Until now, three species of neph- tend the range to Transkei (Kado et analysis of DNA from the mito- ropid lobsters have been recognized al., 1994). chondrial 16s rRNA gene demon- strated considerable sequence di- in the genus Homarus Weber, 1795 Regardless of its rarity, sufficient vergence of the Cape lobster (9.7%) (see Holthuis, 1991): H. americanus specimens of the Cape lobster, liv- from its putative congeners. The H. Milne-Edwards, 1837, the north- ing and preserved, are now avail- magnitude of this estimate relative western Atlantic American lobster; able for analysis of its distribution, to that between the two North At- H. gammarus (Linnaeus, 1758), the morphological, and genetic at- lantic species (1.3%) further sug- gests that taxonomic revision is northeastern Atlantic-Mediterra- tributes, and systematic status. warranted. nean European lobster; and if. cap- Results of our studies indicate that ensis (Herbst, 1792), the South Af- this species should be removed from rican Cape lobster. All are found in Homarus and placed in a genus of cool or cold temperate waters, and its own; this paper provides sup- the North Atlantic species range porting evidence for this action and into subarctic waters. The northern offers supplementary descriptive H. americanus and H. gammarus information on the species. are well-known, abundant, and eco- nomically valuable species, but the southern H. capensis has long been Homarinus, new genus problematic because only a few Figs. 1-4 specimens (13 males, 1 female) were known to exist in collections Type species—Homarus capensis (Barnard, 1950; Wolff, 1978; Hol- (Herbst, 1792) by present designa- thuis, 1991). Gilchrist (1918) had tion and monotypy. seen only three specimens and re- marked (p. 46) that "it is a very rare Description—Carapace moderately species, and is not even known to compressed, narrower than deep, Cape Fishermen." Kensley (1981) sparsely setose, middorsal carina recorded its distribution in the Cape barely evident on gastric region, ob- Manuscript accepted 25 September 1994. Province as Table Bay to East Lon- solescent on thoracic region posterior Fishery Bulletin 93:97-102 (1995). don, and recent new collections ex- to deep cervical groove. Rostrum 97 98 Fishery Bulletin 93(1). 1995 Figure I Homarinus capensis (Herbst). Living male, carapace length 3.41 cm, photographed in an aquarium in Sea Fisheries Research Institute, Cape Town, South Africa, by Robert Tarr. (a) Left lateral; (6) dorsal. Kornfield et al.: Cape lobster taxonomy 99 a d i — / Figure 2 Male pleopods (pi); mesial views of pi 1 (slight lateral folds on tips not shown in these views), and mesial views of appendix masculina on mesial ramus of pi 2: (a and b) Homarinus capensis, left (USNM 251452); (c and d) Homarus americanus, right (USNM 13952); (e and f) H. gammarus, right (USNM 2085). Scale is 1 mm: bar 1 applies to c through f; bar 2 applies to a and 6. linguiform in dorsal view, broad at base where mar- gins coalesce with orbits, margins bearing 4-6 small spines and gradually tapering anteriorly to rather abruptly pointed or narrowly rounded tip, reaching distal 1/3 of penultimate article of antennular peduncle, i •A, shallow dorsal concavity running its entire length. 5 Telson and uropods with thick fringe of plumose lliiilil§i iaS^S* "!' ?•••• setae on distal margin and with scattered non- plumose long setae dorsally on these appendages and *%5#S85g» hsfejfyl sixth abdominal segment. Telson as wide at base as #gm Kjjnj&j^Kwh fla long, with lateral margins slightly sinuous and '^# subparallel bearing obsolescent spines and rugae, each side ending in fixed posterolateral spine; ter- minal margin beyond spine broadly convex; distal 1/3 of surface bearing obsolescent transverse rugae. Figure 3 Uropods broadly subovate, sparsely setose on dorsal Homarinus capensis (Herbst), tail fan (from figure in H. surface; mesial ramus broadest near posterior mar- Milne-Edwards, 1851) gin with width about 0.73 length, row of obsolescent lateral marginal spines ending in fixed posterolat- eral spine; lateral ramus with width about 0.72 length, diaresis well behind midlength bearing row ing extensor margin and distributed a distance along of fixed but irregularly worn spines ending in stron- fixed finger; similar setae on mesial surface of car- gest spine at posterolateral angle. pus and ventral surface of merus. Fingers not gap- Chelae of first pereopods with thick coat of long ing; those of major chela with crushing teeth (often plumose setae on upper surface of palm, overhang- worn) opposed from near base to about midlength 100 Fishery Bulletin 93(1). 1995 ing form -inus, resembling. The gen- Ha ggtcgcaaacttttttgtcgatatgaactctcaaaataaataacgctgtt 50 der is masculine. Hg He Ha atccctaaagtaacttaaatttttaatcaacaancaanggatcanttaca 100 Homarinus capensis (Herbst, Hg 1792), new combination He .ca.c.a.t. Ha cacnnnnnnaaatatctctgtattttaaatttaaacagttacnnaaatta 150 Synonymy—Holthuis (1986:243, fig. Hg g 1) gave an exhaustive synonymy for He t c....t..a....a..t Homarus capensis, and a later Ha tatcatcgtcgccccaacgaaataattntagtatataaataatattaaac 200 (1991:59) less inclusive account. Hg c He ... t ac. c g t. These treatments are so recent and readily available that reiteration Ha tttcaactcatctaattatatactaaattattaagctttatagggtctta 250 Hg . .t here would be unnecessarily redun- He ..a...t g.a dant. Succeeding reference to the Ha tcgtccctttaaaatatttaagccttttcacttaaaagtcaaattcaatt 300 species follows. Hg He .tg.a . Homarus capensis.—Kado, Kittaka, Hayakawa and Pollock, 1994:72, Ha tttgtgtttgagacagtttgcttcttgtccaaccatteatacaagcetoc 350 Hg a....a figs. 2, 3, 4. He ac.t.t..c Material—Cape Province, South Af- Ha aattaagagactaatgactatgctaecttc 380 Hg rica. USNM 251451. Id, East Lon- He .g.nn. don?, R. Melville-Smith, 92-RMS-O, Nov 1992, regurg., dismembered, Figure 4 carapace length (cl) 26.5 mm, short Partial sequence for the mitochondrial 16s rRNA gene. Sequences for Homarus carapace length (scl) 21 mm, abdo- americanus (Ha), H. gammarus (Hg), and Homarinus capensis (He) have been men length (abdl) 33.0 mm. USNM deposited with GenBank Accession Numbers U11238, U11246, and U11247 respectively. Dots indicate nucleotides identical with Ha; letters indicate nucle- 251452.16, southwest Dassen Island otide substitutions at the homologous sites. Sites marked 'n' have unresolved [33=268, 18°05'E], regurgitated from nucleotides. Sebastichihys capensis, badly crushed and partly dismembered, R.S. Steneck, 92-D-2, 1 Dec 1992, cl 32 mm, scl 25.5 mm. USNM 251453. 19, Still followed by row of intermittent noncrushing moder- Bay [34=238, 21°27'E], dismembered, R. Melville- ate conical teeth with 4-6 smaller ones in intervals Smith, RMS7, abdl 45 mm. USNM 251454.19, Still between them; minor chela with latter pattern of Bay, regurg., R. Melville-Smith, RMS8, 5 mm, abdl noncrushing teeth on cutting edge of each finger; tips 47 mm. of fingers on each chela curved toward each other Additional specimens reported to us by R. Melville- and crossing. Smith, Sea Fisheries Institute, Cape Town: 16, North Carpus of major chela elongate; anterior margin Dassen Island, tide pool, RSS, 92-D-l, 3 Feb 1992; with two prominent spines and smaller ones between, 19. Port Alfred, RMS 1; Id, Houghham Park, Algoa palmar condyle subcircular and flattened, with sug- Bay; Id, Dassen Island, west side, RMS 3; Id, Cape gestion of spines or tubercles on its anteromesial St. Francis, RMS 4; 16, Cintsa Reef, East London, margin; dorsomesial margin strongly tuberculate and RMS 5; 16, Sunday's River mouth, RMS 6; 2d, Cape partly obscured by setae; shorter dorsolateral mar- St. Francis, RMS 9 and 10; 19, Haga Haga, Transkei gin also tuberculate but less prominently so; strong coast, RMS 11. low spines on mesioventral margin. Merus bearing subdistal anterolateral spine, well-separated sharp Description—As for genus with addition of the fol- tubercles on mesiodorsal margin, and mesioventral lowing details. row of fairly uniform small tubercles. Abdominal pleura well developed, with rounded Minor chela with similar but less developed orna- angles; pleuron of segment 1 small; pleuron of seg- mentation; merus with acute spines and spiniform ment 2 broad, overlapping first and third pleura; tubercles. pleura 3-4-5 with anteroventral angle rounded, pos- terolateral angle subrectangular; pleuron of segment Etymology—The name Homarinus is derived from 6 rounded ventrally, posterolateral angle rounded French homard, lobster, and the adjectival combin- and confluent with anterolateral angle of telson. Kornfield et al.: Cape lobster taxonomy 101 Telson with dorsal setae distributed in 3 longitu- using standard protocols (Kocher et al., 1989).
Load more

Recommended publications
  • A Classification of Living and Fossil Genera of Decapod Crustaceans
    RAFFLES BULLETIN OF ZOOLOGY 2009 Supplement No. 21: 1–109 Date of Publication: 15 Sep.2009 © National University of Singapore A CLASSIFICATION OF LIVING AND FOSSIL GENERA OF DECAPOD CRUSTACEANS Sammy De Grave1, N. Dean Pentcheff 2, Shane T. Ahyong3, Tin-Yam Chan4, Keith A. Crandall5, Peter C. Dworschak6, Darryl L. Felder7, Rodney M. Feldmann8, Charles H. J. M. Fransen9, Laura Y. D. Goulding1, Rafael Lemaitre10, Martyn E. Y. Low11, Joel W. Martin2, Peter K. L. Ng11, Carrie E. Schweitzer12, S. H. Tan11, Dale Tshudy13, Regina Wetzer2 1Oxford University Museum of Natural History, Parks Road, Oxford, OX1 3PW, United Kingdom [email protected] [email protected] 2Natural History Museum of Los Angeles County, 900 Exposition Blvd., Los Angeles, CA 90007 United States of America [email protected] [email protected] [email protected] 3Marine Biodiversity and Biosecurity, NIWA, Private Bag 14901, Kilbirnie Wellington, New Zealand [email protected] 4Institute of Marine Biology, National Taiwan Ocean University, Keelung 20224, Taiwan, Republic of China [email protected] 5Department of Biology and Monte L. Bean Life Science Museum, Brigham Young University, Provo, UT 84602 United States of America [email protected] 6Dritte Zoologische Abteilung, Naturhistorisches Museum, Wien, Austria [email protected] 7Department of Biology, University of Louisiana, Lafayette, LA 70504 United States of America [email protected] 8Department of Geology, Kent State University, Kent, OH 44242 United States of America [email protected] 9Nationaal Natuurhistorisch Museum, P. O. Box 9517, 2300 RA Leiden, The Netherlands [email protected] 10Invertebrate Zoology, Smithsonian Institution, National Museum of Natural History, 10th and Constitution Avenue, Washington, DC 20560 United States of America [email protected] 11Department of Biological Sciences, National University of Singapore, Science Drive 4, Singapore 117543 [email protected] [email protected] [email protected] 12Department of Geology, Kent State University Stark Campus, 6000 Frank Ave.
    [Show full text]
  • Epizootic Shell Disease in American Lobsters Homarus Americanus in Southern New England: Past, Present and Future
    Vol. 100: 149–158, 2012 DISEASES OF AQUATIC ORGANISMS Published August 27 doi: 10.3354/dao02507 Dis Aquat Org Contribution to DAO Special 6 ‘Disease effects on lobster fisheries, ecology, and culture’ OPENPEN ACCESSCCESS Epizootic shell disease in American lobsters Homarus americanus in southern New England: past, present and future Kathleen M. Castro1,*, J. Stanley Cobb1, Marta Gomez-Chiarri1, Michael Tlusty2 1University of Rhode Island, Department of Fisheries, Animal and Veterinary Sciences, Kingston, Rhode Island 02881, USA 2New England Aquarium, Boston, Massachusetts 02110, USA ABSTRACT: The emergence of epizootic shell disease in American lobsters Homarus americanus in the southern New England area, USA, has presented many new challenges to understanding the interface between disease and fisheries management. This paper examines past knowledge of shell disease, supplements this with the new knowledge generated through a special New Eng- land Lobster Shell Disease Initiative completed in 2011, and suggests how epidemiological tools can be used to elucidate the interactions between fisheries management and disease. KEY WORDS: Epizootic shell disease · Lobster · Epidemiology Resale or republication not permitted without written consent of the publisher INTRODUCTION 1992, Murray 2004). Changes in fishing policy may impact host biomass and disease dynamics. Knowl- The American lobster Homarus americanus (Milne edge about the epizootiology of ESD should be incor- Edwards) is an important component of the ecosys- porated into management strategies. The need to tem in southern New England (SNE) and supports a understand the impact of disease in this new era of valuable commercial fishery. Near the end of 1996, a emergent marine diseases is of utmost importance.
    [Show full text]
  • Lobster (Homarus Omericanus) Abundance in the Canadian
    NOT TO BE CITED WITHOUT PRIOR REFERENCE TO THE AUTHOR(S) Northwest Atlantic Fisheries Organization NAFO SCR Doc. 89/82 Serial No. NI666.... SCIENTIFIC COUNCIL MEETING — SEPTEMBER 1989 Lobster (Homarus omericanus) Abundance in the Canadian Maritimes Over the Last 30 Years, an Example of Extremes by D. S. Pezzack Benthic Fisheries and Aquaculture Division, Dept. of Fisheries and Oceans P. 0. Box 550, Halifax, Nova Scotia, Canada B3J 257 Abstract Lobster is one of the most important fisheries in inshore fishing communities of eastern Canada. During the last 30 years the fishery has experienced its lowest and highest landings in the 100 years of recorded landings. Landings in many parts of the coast reached record or near record lows in the late 1960's and early 1970's, then rose to high levels not experienced since 1900. Total Canadian lobster landings doubled between 1977 and 1986 and in some areas landings increased tenfold. The increase in landings during the last 10 years appears to be the result of increased recruitment. The recent increase in lobster landings have occurred in different stocks and management regimes, suggesting a wide spread environmental factor(s) as the primary cause. z Introduction Lobster is one of the most important fisheries in inshore fishing communities of eastern Canada (Fig.1), • representing 28% of the total landed value of Atlantic Canada fish in 1985. Lobsters are a long-lived species not usually subject to large fluctuations in abundance but during the last 30 years the fishery has experienced the en 44 lowest and highest landings in the 100 years of recorded landings (Fig.
    [Show full text]
  • Massachusetts Lobstermen's Association Free
    MASSACHUSETTS LOBSTERMEN’S ASSOCIATION JOIN TODAY and A LEADING Commercial Fishing Industry Association in New England show your support VOLUME 36 • JAN/FEB 2017 NEWSPAPER • WWW.LOBSTERMEN.COM MASSACHUSETTS FISH Sex change PG 18 LOBSTERMEN’S ASSOCIATION The LEADING Commercial Fishing Industry Association in New England ANNUAL WEEKEND Schedule PG 32 “The Massachusetts commercial fishing Baker-Polito Administration Announces and seafood industries provide delicious Seafood Marketing Program Partnership with Massachusetts Farm to School food and employment for thousands of people in the Commonwealth,” BOSTON – December 28, 2016 – The Baker-Polito Administration said Governor Charlie Baker. “This is today announced the Division of Marine Fisheries (DMF)’s a great connection to make and we look forward to the partnership Massachusetts Seafood Marketing Program has partnered with the between Massachusetts fishermen and farm-to-school programs to SALT MARSH nonprofit Massachusetts Farm to School Project to promote the provide the Commonwealth’s children with fresh, nutritious seafood PG 37 consumption of local seafood in schools. products that support cognitive development.” YOU CAN NOW FOLLOW THE MLA ON THE FOLLOWING SOCIAL MEDIAS 2 • M ASSACHUSETTS L OBSTER M EN ’ S A SSOCIATION • WWW . L OBSTER M EN . CO M COVER STORY promote seafood as part of Massachusetts Farm to School’s Massachusetts Harvest of the Month 2 0 1 7 campaign, hold a series of local seafood cooking demonstrations for institutional food service providers, and offered a seafood focus track at the Massachusetts Volume 27 • Jan/Feb 2017 Newsletter Farm & Sea to Cafeteria Conference in November www.lobstermen.com 2016. EBRUARY Published by the Mass.
    [Show full text]
  • Lobster Homarus Americanus
    MARINE ECOLOGY PROGRESS SERIES Vol. 85: 83-91.1992 Published August 27 Mar. Ecol. Prog. Ser. I l Natural diet and feeding habits of the postlarval lobster Homarus americanus Marie Antonette R. Juinio*,J. Stanley Cobb Department of Zoology, University of Rhode Island. Kingston, Rhode Island 02881, USA ABSTRACT: Postlarval Homarus arnericanus were collected from Block Island Sound, Rhode Island, USA, during 5 die1 neuston sampling periods in summer 1988 and 1989. The foregut contents of the postlarvae were determined and compared with the relative abundances of potential prey groups in the plankton. Nine taxonomic prey groups were identified in the gut contents (N = 802). The composi- tion of the prey groups and their relative frequencies of occurrence in the guts did not differ with time of day or sampling period. The frequent occurrence of copepods, decapod larvae, fish eggs and insect parts indicates a predominantly carnivorous feeding habit. Furthermore, the disproportionate fre- quency of occurrence of large copepod species and decapod larvae in the guts relative to their densities in the plankton suggests a preference for larger sized prey. Contrary to expectations, the mean gut fullness and condition of gut contents of individuals at different molt stages were not significantly different. Likewise, there was no significant difference in the incidence of guts with newly ingested prey between postlarvae in the premolt stages and those in the post and intermolt stages. Completely empty guts were rare. In addition, the variability in gut fullness and the condition of gut contents among individuals was high during all sampling periods. These indicate that postlarvae in the field forage successfully throughout the day.
    [Show full text]
  • The Lobster Newsletter July 1995
    VOLUME EIGHT JULY 1995 NUMBER ONE 1 RESEARCH NEWS %e‘St det 66 '\TSHERIES AND A Trans-Atlantic Perspective on QUACULTURE Homa rus Recruitment UPDATE FROM: RICHARD A. WAHLE LOBSTER FISHERIES OF INDIA For the better part of a decade scientists in New England and the Cana- dian Maritimes have made important strides in understanding the pro- cesses that in fluencing the benthic recruitment of the American lobster. FROM: E.V. RADHAKR15HNAN Published reports have identified cobble and boulder as an important nursery habitat for lobsters (Hudon 1987, Wahle & Steneck 1991, Incze & Spiny lobsters form one of the Wahle 1991), and in many ways this habitat remains one of the last fron- most valuable crustacean re- tiers of descriptive benthic ecology. That is because cobble defies tradi- sources of India. The richness of tional sampling techniques. For example, cores and grabs used in sand the lobster fauna is brought about and mud tend to break on cobble, and photo-quadrats just do not tell the by the range of habitats available - whole story. For cobble, the suction sampling method has opened a win- rock and mud through to coral dow not only on early benthic phase lobsters, but on the associated fauna reef. Annual landings increased as well. This tool has allowed us to begin leaming how potentially com- from 350 t in 1965 to 3,000 t in peting species may influence lobster recruitment. Here I make a trans- 1975, but declined sharply to 680 t Atlantic comparison of cobble habitat fauna that reveals dramatically in 1980. The fishery recovered to higher species diversity, but lower numbers of Homarus in Europe than 4,100 t in 1985, but has generally in New England.
    [Show full text]
  • Mapping Spawning and Hatching Grounds of the American Lobster Final Report
    The Lobster Conservancy Mapping Spawning and Hatching Grounds of the American Lobster Final Report Northeast Consortium Awards #03-658 & 05-952 Submitted by, Diane F. Cowan 23 November 2005 Period of Performance: 2002-2005 Contact Info: Diane F. Cowan The Lobster Conservancy P.O. Box 235 Friendship, ME 04547 207-832-8224 [email protected] 1 Final Report 23 November 2005 The Lobster Conservancy NEC Subcontract #05-952 Lobster Spawning and Hatching Abstract The purpose of this study was to investigate the relationship between temperature, movements and body size for ovigerous (egg-bearing) lobsters tagged recently after spawning and tracked throughout the 9-13 month brooding period. We made predictions about where and under what temperature conditions small (< size at 50% maturity) versus large (> size at 50% maturity) lobsters would brood. We found that although small female lobsters were abundant in Muscongus Bay, most were not ovigerous. Small ovigerous lobsters tended to spawn and remain inside the bay where they brooded at lower winter, but higher spring and summer temperatures than large ovigerous lobsters. In contrast, large ovigerous lobsters (>size at 50% maturity) were relatively rare, but most were ovigerous. They tended to spawn at greater distances from shore and while many stayed near where they spawned, others achieved a maximum displacement of up to 240 km. Large ovigerous lobsters were at more moderate temperatures throughout the year regardless of how far they traveled. Both small and large ovigerous lobsters experienced (1) sufficiently low winter temperatures for successful ovarian maturation, and (2) approximately the same number of degree days for egg development.
    [Show full text]
  • Species Fact Sheets Nephrops Norvegicus (Linnaeus, 1758)
    Food and Agriculture Organization of the United Nations Fisheries and for a world without hunger Aquaculture Department Species Fact Sheets Nephrops norvegicus (Linnaeus, 1758) Black and white drawing: (click for more) Synonyms Astacus norvegicus Fabricius, 1775 Homarus norvegicus Weber, 1795 Astacus rugosus Rafinesque, 1814 Nephropsis cornubiensis Bate & Rowe, 1880 Nephrops norvegicus meridionalis Zariquiey Cenarro, 1935 FAO Names En - Norway lobster, Fr - Langoustine, Sp - Cigala. 3Alpha Code: NEP Taxonomic Code: 2294200602 Scientific Name with Original Description Cancer norvegicus Linnaeus, 1758, Systema Naturae, (ed.10)1:632. Name placed on the Official List of Specific Names in Zoology, in Direction 36 (published in 1956). Geographical Distribution FAO Fisheries and Aquaculture Department Launch the Aquatic Species Distribution map viewer Eastern Atlantic region: from Iceland, the Faeroes and northwestern Norway (Lofoten Islands), south to the Atlantic coast of Morocco; western and central basin of the Mediterranean; absent from the eastern Mediterranean east of 25°E also absent from the Baltic Sea, the Bosphorus and the Black Sea. A record from Egypt is doubtful. Habitat and Biology Depth range from 20 to 800 m;the species lives on muddy bottoms in which it digs its burrows.It is nocturnal and feeds on detritus, crustaceans and worms. Ovigerous females are found practically throughout the year, the eggs laid around July are carried for about 9 months. Size The total body length of adult animals varies between 8 and 24 cm, usually it is between 10 and 20 cm. Interest to Fisheries The species is of considerable commercial value and is fished for practically throughout its range.
    [Show full text]
  • The Colonization of a Multi-Functional Artificial Reef Designed for the American Lobster, Homarus Americanus
    The University of Maine DigitalCommons@UMaine Electronic Theses and Dissertations Fogler Library Spring 5-8-2020 The Colonization of a Multi-functional Artificial Reef Designed for the American Lobster, Homarus Americanus Christopher Roy University of Maine, [email protected] Follow this and additional works at: https://digitalcommons.library.umaine.edu/etd Recommended Citation Roy, Christopher, "The Colonization of a Multi-functional Artificial Reef Designed for the American Lobster, Homarus Americanus" (2020). Electronic Theses and Dissertations. 3205. https://digitalcommons.library.umaine.edu/etd/3205 This Open-Access Thesis is brought to you for free and open access by DigitalCommons@UMaine. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of DigitalCommons@UMaine. For more information, please contact [email protected]. THE COLONIZATION OF A MULTIFUNCTIONAL ARTIFICIAL REEF DESIGNED FOR THE AMERICAN LOBSTER, HOMARUS AMERICANUS By Christopher Roy A.A. University of Maine, Augusta, ME. 2006 B.S. University of Maine, 2004 A THESIS SuBmitted in Partial Fulfillment of the Requirements for the Degree of Master of Science (in Animal Science) The Graduate School The University of Maine May 2020 Advisory Committee: Robert Bayer, Professor of Food and Agriculture, ADvisor Ian Bricknell, Professor of Marine Sciences Timothy BowDen, Associate Professor of Aquaculture © 2020 Christopher Roy All Rights ReserveD ii THE COLONIZATION OF A MULTIFUNCTIONAL ARTIFICIAL REEF DESIGNED FOR THE AMERICAN LOBSTER, HOMARUS AMERICANUS By Christopher Roy Thesis Advisor: Dr. Bob Bayer An Abstract of the Thesis Presented in Partial Fulfillment of the Requirements for the Degree of Master of Science (Animal Science) May 2020 HaBitat loss anD DegraDation causeD By the installation of infrastructure relateD to coastal population increase removes vital habitat necessary in the lifecycles of benthic and epibenthic species.
    [Show full text]
  • ASFIS ISSCAAP Fish List February 2007 Sorted on Scientific Name
    ASFIS ISSCAAP Fish List Sorted on Scientific Name February 2007 Scientific name English Name French name Spanish Name Code Abalistes stellaris (Bloch & Schneider 1801) Starry triggerfish AJS Abbottina rivularis (Basilewsky 1855) Chinese false gudgeon ABB Ablabys binotatus (Peters 1855) Redskinfish ABW Ablennes hians (Valenciennes 1846) Flat needlefish Orphie plate Agujón sable BAF Aborichthys elongatus Hora 1921 ABE Abralia andamanika Goodrich 1898 BLK Abralia veranyi (Rüppell 1844) Verany's enope squid Encornet de Verany Enoploluria de Verany BLJ Abraliopsis pfefferi (Verany 1837) Pfeffer's enope squid Encornet de Pfeffer Enoploluria de Pfeffer BJF Abramis brama (Linnaeus 1758) Freshwater bream Brème d'eau douce Brema común FBM Abramis spp Freshwater breams nei Brèmes d'eau douce nca Bremas nep FBR Abramites eques (Steindachner 1878) ABQ Abudefduf luridus (Cuvier 1830) Canary damsel AUU Abudefduf saxatilis (Linnaeus 1758) Sergeant-major ABU Abyssobrotula galatheae Nielsen 1977 OAG Abyssocottus elochini Taliev 1955 AEZ Abythites lepidogenys (Smith & Radcliffe 1913) AHD Acanella spp Branched bamboo coral KQL Acanthacaris caeca (A. Milne Edwards 1881) Atlantic deep-sea lobster Langoustine arganelle Cigala de fondo NTK Acanthacaris tenuimana Bate 1888 Prickly deep-sea lobster Langoustine spinuleuse Cigala raspa NHI Acanthalburnus microlepis (De Filippi 1861) Blackbrow bleak AHL Acanthaphritis barbata (Okamura & Kishida 1963) NHT Acantharchus pomotis (Baird 1855) Mud sunfish AKP Acanthaxius caespitosa (Squires 1979) Deepwater mud lobster Langouste
    [Show full text]
  • Risk Assessment of American Lobster (Homarus Americanus)
    Risk assessment of American lobster (Homarus americanus) Swedish Agency for Marine and Water Management Report 2016:4 Risk assessment of the American lobster (Homarus americanus) Swedish Agency for Marine and Water Management Swedish Agency for Marine and Water Management Date: 2016-07-29 (updated version) Publisher: Björn Sjöberg Cover page photo: Vidar Öresland ISBN 978-91-87967–09-2 Havs- och vattenmyndigheten Box 11930, 404 39 Göteborg www.havochvatten.se Risk assessment of the American lobster (Homarus americanus) Swedish Agency for Marine and Water Management Risk assessment of American lobster (Homarus americanus) Swedish Agency for Marine and Water Management Report 2016:4 Risk assessment of the American lobster (Homarus americanus) Swedish Agency for Marine and Water Management Preamble American lobster (Homarus americanus) Pest Risk Assessment has been produced following the scheme: GB non-native organism risk assessment scheme, version 5 which was prepared by CABI Bioscience (CABI), Centre for Environment, Fisheries and Aquaculture Science (CEFAS), Centre for Ecology and Hydrology (CEH), Central Science Laboratory (CSL), Imperial College London (IC) and the University of Greenwich (UoG). The pest risk assessment scheme constructed by the European and Mediterranean Plant Protection Organisation (EPPO, 1997 and in prep.) provided the basis for the Great Britain NonNative Organism Risk Assessment scheme. The EPPO scheme closely follows the international standard for phytosanitary measures (ISPM 11) on pest risk analysis produced by the International Plant Protection Convention (IPPC) (FAO, 2003). IPPC standards are recognised by the Sanitary and Phytosanitary Agreement of the World Trade Organization (WTO, 1994). More information on the scheme is provided at www.nonnativespecies.org/downloadDocument.cfm?id=158.
    [Show full text]
  • Homarus Americanus H
    BioInvasions Records (2021) Volume 10, Issue 1: 170–180 CORRECTED PROOF Rapid Communication An American in the Aegean: first record of the American lobster Homarus americanus H. Milne Edwards, 1837 from the eastern Mediterranean Sea Thodoros E. Kampouris1,*, Georgios A. Gkafas2, Joanne Sarantopoulou2, Athanasios Exadactylos2 and Ioannis E. Batjakas1 1Marine Sciences Department, School of the Environment, University of the Aegean, University Hill, Mytilene, Lesvos Island, 81100, Greece 2Department of Ichthyology & Aquatic Environment, School of Agricultural Sciences, University of Thessaly, Fytoko Street, Volos, 38 445, Greece Author e-mails: [email protected] (TEK), [email protected] (IEB), [email protected] (GAG), [email protected] (JS), [email protected] (AE) *Corresponding author Citation: Kampouris TE, Gkafas GA, Sarantopoulou J, Exadactylos A, Batjakas Abstract IE (2021) An American in the Aegean: first record of the American lobster A male Homarus americanus individual, commonly known as the American lobster, Homarus americanus H. Milne Edwards, was caught by artisanal fishermen at Chalkidiki Peninsula, Greece, north-west Aegean 1837 from the eastern Mediterranean Sea. Sea on 26 August 2019. The individual weighted 628.1 g and measured 96.7 mm in BioInvasions Records 10(1): 170–180, carapace length (CL) and 31.44 cm in total length (TL). The specimen was identified https://doi.org/10.3391/bir.2021.10.1.18 by both morphological and molecular means. This is the species’ first record from Received: 7 June 2020 the eastern Mediterranean Sea and Greece, and only the second for the whole basin. Accepted: 16 October 2020 However, several hypotheses for potential introduction vectors are discussed, as Published: 21 December 2020 well as the potential implication to the regional lobster fishery.
    [Show full text]