Trueclone: Authentic Full-Length Cdna Clones

2005 – 2006 PRODUCT CATALOG

TrueClone: Authentic Full-Length cDNA Clones

Dear Valued Customer,

The completion of the sequencing of the human genome provides us with an enormous amount of data related to individual genes and their transcripts. There remains, however, a large informational gap between a gene’s sequence and its biological function, and an even greater gap between the gene’s function and its complicated interactions with other genes. Unraveling and understanding gene functions and gene networks will undoubtedly be a great challenge for some time to come.

In 1997, OriGene formulated a vision that the availability of a physical collection of all human genes will be required to dissect gene function and genetic interactions. After over eight years of dedication, OriGene scientists have isolated more than 24,000 distinct human full-length cDNA clones representing over 15,000 loci, all in a unified pCMV expression ready vector. We have built the world’s largest searchable collection of cDNA clones, the TrueClone CollectionTM. We are proud of the fact that thousands of innovative researchers worldwide have been taking advantage of these ready-made clones to accelerate their research.

The value of the TrueClone collection is multifaceted: 1. As a source of individual genes. When an authentic human full-length cDNA clone is readily available, scientists are alleviated of the tedious work of gene cloning and can better direct their time and resources to more exciting discoveries downstream. 2. As a collection of gene families. For laboratories with relatively focused interests, the TrueClone collection can be used as an inventory for scientists to pick-and-assemble their own sub-collections and conduct functional assays. OriGene has pre-assembled several such sub-collections based on biological pathways or gene families, including protein kinases, GPCR’s, nuclear hormone receptors, and cytochrome P-450 genes. 3. As a comprehensive collection. Expression-ready TrueClones provide unprecedented opportunities for scientists to functionally test thousands of human genes in a uniformed cell based assay.This approach, which we call FlagArray (Full-Length cDNA Annotation of Gene functions), was recently employed by scientists at the Genomics Institute of the Novartis Research Foundation. Using 20,000 cDNA clones, including a large number of OriGene TrueClones, they successfully discovered and characterized several novel modulators of the Wnt signaling pathway.1

OriGene is dedicated to its mission of isolating every single human full-length cDNA clone that represents a functional transcript in the human genome. We are determined to make TrueClone the ultimate collection: where every gene can be found, and that every scientist can trust. We understand this is a formidable task. To adhere to the highest quality standards when isolating authentic clones is costly and time consuming; yet OriGene is committed to this effort. This strong commitment, coupled with our diverse scientific expertise, has made the TrueClone collection not only the most comprehensive available, but also the highest quality source. We welcome all suggestions from our customers to 1) enhance our gene collection 2) provide more extensive downstream applications and 3) improve our product support. We are especially interested in developing innovative technologies that functionally assay the human genome in its entirety. If you have an idea, an invention or a research program potentially involving large subsets of our collection of human full-length cDNA clones, please do not hesitate to contact us. The perfect collection of human full-length cDNA clones can only be attained via input and feedback from scientists like you. We look forward to earning your trust and to being your discovery partner.

From the OriGene Team

1. Identification of the Wnt signaling activator leucine-rich repeat in Flightless interaction protein 2 by a genome-wide functional analysis. Liu, J. et al. PNAS, Feb 2005; 102: 1927 - 1932. ii www.origene.com I.Full-length cDNAcloning...... 63 III...... 45 HuSH™ II. TrueClone™—Ready-cloned non-PCR human I. Sections full-length cDNAinCMVvectors...... 1 pRS vectors...... 61 Y ...... 75 Sure-RACE™ 5’-RACE Kit Rapid-Screen™ Longest-Clone ...... 64 Rapid-Screen™ arrayed cDNAlibraries Pr ...... 10 Gene-family basedcollection CloneSet: Human full-lengthgenes...... 2 east two-hybrid ...... 81 expression cDNAlibraries emade shRNAexpr OtherLibraries • Prostate CancerLibraries • • Rat Libraries • MouseLibraries • HumanLibraries • DupLEX-A™yeasttwo-hybrid systemkit • cDNA Mouse12-Tissue • cDNA Human12-Tissue • • LibraryScreen Human12-Tissue • Rat cDNALibraries • • HumancDNALibraries • • IonChannelCloneSet • • GPCRCloneSet • KinaseCloneSet • Breast CancerLibraries Mouse 6-T Mouse cDNALibraries P450 CloneS Nuclear HormoneR issue LibraryS h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: et ession panels eceptor CloneSet SM creen evcs...... 72 services ...... 46

iii Table of Contents iv Table of Contents reigifrain...... 143 Ordering information V ...... 85 Geneexpression IV. Miscellaneousmoleculartools...... 109 . uniLde ...... 140 ...... Quanti-Ladder ai-cn:PCR-basedgene expression profiling panel...... 86 Rapid-Scan™: Rapid-Load...... 142 ...... 141 Millennium™ marker Pr Pr Blue-Ribbon™ Poly A ...... 101 Multiple-Choice™ cDNAs Northern Blot...... 95 ...... 86 Real-TimePCR-basedgene expression profiling panel Real-Time-Scan™: e-v ot Drosophila PanelTissue (12 Parts/Stages) • MouseBrainPanel (48Parts/Stages) • (24Tissues) Panel MouseTissue • HumanBreastCancer(24Normals/Tumors) • HumanBrainPanel (12 Parts) • (24Tissues) Panel HumanTissue • Inno Broad rangeRNAsize(0.5kb-9kb) marker Broad rangeDNAsize(200bp-10kb) withquantityreference marker GPCRantibodies • Kinaseantibodies • RNA Rat Tissue • • RNA HumanTissue • cDNA Rat Tissue • • cDNA HumanTissue • • Rat RNABlot 12-Tissue • RNABlot Mouse12-Tissue • Human6-tissueRNABlotIII • RNABlotII Human12-Tissue • RNABlotI Human12-Tissue • Human Panel:Tissue (48tissues)NEW • ein collections alidat Mouse cDNA Mouse Tissue R at 1 vati datbde ...... 110 ed antibodies 2 ve PCRcompatibleloading buffer Brain-P T issue RNA ...... ar + t and TotalRNAs...... 105 RNA Blot www .or ig ene.com 130 TrueClone™ Ready-cloned non-PCR human full-length cDNA in CMV vectors

Over 24,000 individual clones

CloneSet™: Gene-family based collection 2 Ready-Cloned Non-PCR human Full-Length cDNA in CMV vectors TrueClone™ OriGene have beenannotatedbyNCBI. about 85percentofthetranscriptsequencesthat can befoundinthepublicdomain. They represent full-length cDNAcloneswhosenucleotidesequences OriGene “TC” a engine onourwebsite.Each cloneisrepresentedby All TrueClones arefullysearchable usingthesearch Visit ourwebsiteatwww.origene.com foreach forpriceandspecifications clone. OriGene’s inthescientificcommunity. clonesarepricedtoprovide valuetoourcustomers a OriGene’s beginningwith catalognumbers humanfull-lengthcDNAcloneshaveindividual 24,000 TC100001 Product Listing cDNA inCMVvectors Ready-cloned non-PCRhumanfull-length make everyeffortmake tocloneyourgeneforyou. fi yet includedinourcollection,youareencouragedto most updatedstatus.Ifyourgeneofinterestisnot accomplished. Pleasevisitourwebsiteoften forthe expanding TrueClone coverage untilourmissionis full-length transcript.Ourcloningeffort isaimedat nd growing.Each cloningeffort cloneispricedtoreflecttherespective neededtoproduceit. All of ll outacloningrequestformandourscientistswill unique catalognumberof6digitswithaprefix . ’ ’ s s TrueClone Collectioncontainsover 24,000 mission istocloneeverysinglehuman www .or ig ene.com expression-optimiz The mostcomprehensioncollection: Quick Mostcloneswillbe delivery: Authentic clones:noPCRar Expression-Ready: All clonesare over 24,000 (andgrowing) over 24,000 cDNA clonesavailable shipped within48hrs ADVANTAGES ed inaCMVvector tifacts Oxidative StressinNeuronalHT-22 Cells:GFPT2Protects CellsAgainstPeroxide 4. Identificationofp53 regulators bygenome-widefunctionalanalysis T cells or clones suitableforproteinexpressioninmammalian T suppressor phenotypes. 2. Highthroughputfunctionalgenomics:identificationofnovelgeneswithtumor Proc NatlAcadSciU SA.2004Mar9;101(10):3456-61. Mol CellProteomics.2004Aug;3(8):834-40. 3. High-throughputFunctionalGenomicsIdentifi Int JCancer. 2005Jan20;113(3):434-9. Proc NatlAcadSciUSA.2005Feb8;102(6):1927-32. protein 2byagenome-widefunctionalanalysis 1. Identifi o Collection —theworld’s largestsearchable setof technologies, OriGenehasbuiltits TrueClone throughput cloningandproprietaryRapid-Screen™ from primarycDNAlibraries.Utilizinghigh- been diligentinisolatingfull-lengthhumangenes and disease.Since1 fundamentals ofhumandevelopment,ph tounlockingof humancDNAsprovides thekey the human transcriptome. We believethata completeset clone everysinglehumangenetranscriptinthe OriGene Technologies isfocusedonitsmissionto hypothetical proteinshavingnoknownfunctions. these genes,many ofwhich still codefor researchers thefunctionaldissectionof topursue cannot provide thephysical clonesneeded to allow archiving genesequenceinformation,yetthey DDBJ, andEMBLhavebeencentralizing laboratories.Organizationsindividual such asNCBI, one gene ofinterest.Historically, genecloningwas done gene function,beginswithafull-lengthcopyofthe a Functional genomics,the developmentand Introduction: rueClones) rueClones) pplication ofexperimentalapproaches toassess ver 24,0 gene atatimethroughpainstakingefforts from cation oftheWntsignalingactivatorleucine-richrepeatinFlightlessinteraction in vitro 0 0 non-redundant full-lengthhumancDNA through coupledtranslationassays. 997 , (Use ofover17,000clones) OriGene (Use of5,000clones,includingOriGene's es GenesThatAmeliorateToxicity Dueto h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: Technologies has (Use ofover10,000OriGene (Use of20,000clones) ysiology TM graft-versus-host diseasemodel. shown tobeextremelyef has beenpioneeredbyseveralgroupsand human transcriptome.Such asystematicapproach it possibletoperformglobalscreeningoftheentire of expression-readyhumanfull-lengthcDNAsmak Most importantly, theavailabilityofalargenumber resources onexcitingdownstreamapplications. and allowsscientiststoconcentratetheirefforts and gene; itgreatlyshortens thegene-cloningtimetable clone hasbecomethestandardway ofobtaininga work oftraditionalgenecloning. Today, purchasing a support haverelievedmany scientistsofthetedious community. Ourdependableserviceanddedicated panies toprovide ready-cloned genestotheresearch Beginning in2001, OriGenewascom- oneofthefirst r All TrueClones arematched toannotatedmRNA 5. Genome-scalefunctionalprofi T success story, Novartis scientistsutilized OriGene’s Nat Biotechnol.2003 Mar;21(3):302-7. 8. TIP proteins) Nat Biotechnol.2003Mar;21(3):294-301. glucose homeostasis. 7. AnintegratedfunctionalgenomicsscreeningprogramrevealsaroleforBMP-9in Proc NatlAcadSciUSA.2003Oct14;100(21):12147-52. Proc NatlAcadSciUSA.2003Oct14;100(21):12153-8. proteins) function array) isonesuch tool. genome-scale functionalanalysisinmammaliancells. 6. Identifi regulators ofthe regulators WNT signaling pathway FlagAr this enablingtechnology toresearchers. The releasing severalsuch genearray toolstoprovide eference sequencesfoundinthepublicdomain. rueClone Collectiontoidentifyno , a T cation ofafamilycAMPresponseelement-bindingproteincoactivatorsby -cell factoridentifi ray TM ( F ull- ed usinghigh-throughputscreeningincreases survivalina L ength cDNA ling ofthemammalianAP-1signalingpathway (Use of8,000ESTs encodingputativesecreted (Use of8,000clonesencodingsecreted fecti A ve nnotation of 1-8 (Use of20,000clones) . (Use of20,000clones) In onerecent 1 . OriGene is vel gene . G ene es

3 Ready-Cloned Non-PCR human Full-Length cDNA in CMV vectors TrueClone™ 2. 3’-junction sequencing: The sequence aligns Product Description: downstream of the stop codon. 3. Size verification: Each insert is removed from the What is a TrueClone? vector by restriction digestion and the size is esti- mated via gel electrophoresis. This size is matched TrueClone is the world’s largest collection of full- against the predicted size of the full-length clone. length human cDNA clones, and is available only from OriGene. The TrueClone Collection has the OriGene makes all 5’ sequence data available following key features: through its website to facilitate customer searches. In 1. Comprehensive collection: The TrueClone col- addition, OriGene has sequenced the ORF of more lection currently contains over 24,000 non- than 2,000 TrueClones, including most of the protein ™

e redundant human cDNAs, each corresponding to kinases, and has made this information available on

n a unique transcript. It is by far the largest source our website. The number of ORF sequenced clones o

l of human cDNA clones. OriGene has the will increase steadily in the coming years.

C commitment and the technical strength to clone e every single human gene. u

r 2. Authentic clones: More than 99% of the clones are How is a non-PCR clone different from a T directly isolated from primary cDNA libraries with PCR-based clone? Can PCR be used in no PCR-introduced artifacts. A very small number of TrueClone’s downstream applications? s r clones are generated by PCR and these are all fully o t c

e sequenced to match to their references. These PCR PCR clones may contain mutations that cause v

V clones are noted as such on the OriGene website. downstream experimental deviations. Non-PCR clones

M 3. Expression ready: All genes are directionally reflect the true nature of mRNA gene transcripts. C n i cloned into an expression vector under control of A the CMV promoter, ready to be transfected into It is a well-documented fact that the PCR process N D

c mammalian cells for protein expression. The introduces mutations due to the limited fidelity of Taq h t uniform vector in all clones facilitates high- or other PCR enzymes. When a gene is obtained by g n

e throughput screening approaches. the PCR process from a cDNA pool, especially when L - l l 4. Easy search: OriGene provides several search the transcript is rare, the high replication cycle u F engines on our website for convenient identification causes the accumulation of mutations. However, this n a

m of your gene of interest. Please refer to page 7 to see mutation rate can pale in comparison to the u

h more search information. introduction of mutations due to primer synthesis

R 9 C 5. Quick delivery: Most TrueClones will be delivered errors that can affect 14% of all such PCR clones . P -

n to you as dried, plasmid DNA within 48 hrs in 2-D Even when the final transcripts are sequenced, there o

N bar-coded tubes. is no way to differentiate whether a mutation is due d

e to PCR or is simply a naturally occurring SNP. In n o l addition, very long genes and GC-rich genes can be C - y impossible to PCR amplify.

d How is a full-length cDNA defined a

e in OriGene’s TrueClone collection? R One key feature of TrueClones is that they are Full-length is usually defined as containing the full authentic clones, isolated directly from cDNA open reading frame (ORF) of a gene, but OriGene libraries constructed by a high-fidelity reverse TrueClones contain 5’- and 3’-UTRs as well. Currently transcriptase. When using TrueClones, there is no OriGene’s clones are defined as full-length when need to worry about PCR-introduced artifacts. they satisfy the following three specifications. 1. 5’-junction sequencing: The sequence aligns PCR can be utilized in TrueClone applications. upstream of the initiation ATG codon. Starting with an authentic cDNA clone and knowing

9. Human ORFeome version 1.1: a platform for reverse proteomics. Genome Res. 2004 Oct;14(10B):2128-35.

4 www.origene.com long clones.SincemostcDNA collectionsalloverlap collection, butitalsocontains moreofthedifficult and human full-lengthcDNA clones thanan OriGene provided byOriGene’s TrueClone collectionandMGC. predicted humangenomeandcurrent coverage relationship betweenthe Fig. 1illustratestherelative OriGene’s mission. transcriptome asnon-PCRclonesisandremains recognition. Providing thecompletehuman drug targetcross-reacti the finestsystembiologytoolavailabletoassess the bestsourcetofindtheirgene,butalsoprovides collection notonlypro mammalian genecollection.Ourcomprehensive than twiceasman loci. transcripts covering over 15,000 This ismore clones isOriGene’s TrueClone Collection:~24,000 The largestcommercializ expected tobe1.54 times that,or33,552. number oftranscriptsincludingsplicevariantsis believed tobe21,787(2,188 predicted),theexpected set. some time,pro tobecometheworkinggenomeforquite is likely large scaleimpro The mostrecenthumangenomebuild(#35)boastsa transcript clones? the mostcomplete setofhuman genome? Which commercial source offers How many genes are there inthehuman mutations fromnaturallyoccurring SNPs. product andthentodistinguishany PCR-introduced DNA, itiseasytoverifythesequenceoffinal by havingthesequenceinformationoftemplate reducing thechance ofmutation.Moreimportantly, c larger starting amountsofthetemplateDNA,PCR or afunctionaldomain,forotherapplications.Using PCR toamplifyasegmentoftheclone,eitherORF its sequence,molecularbiologistscansafelyapply an beperformedwithaverylowcyclenumber, While thetotalnumberofgenelociiscur ’ s TrueClone collectionnotonlycontainsmore viding amorestablegenereference vement over allpreviousbuildsand y as thoserepresentedinthe vity vides individual geneusers vides individual , ed collectionofcDNA h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: drug actionandantigen y rently other genes andSpliceV *Number ofTranscripts including:Genes,PredictedPseudo- than anyothersource. length cDNAclonesrepresentingagreaternumberoftranscripts coverage ofOriGeneT Comparison ofthepredictednumberhumantranscriptsand 1 Fig. >33,000 transcripts(21,787loci)* ariants Human GenomeBuild35 rueClone andMGC.OriGenehasmorefull 24,000 OriGene 12,242 (MGC) 26,200 (RefSeq)

5 Ready-Cloned Non-PCR human Full-Length cDNA in CMV vectors TrueClone™ 6 Ready-Cloned Non-PCR human Full-Length cDNA in CMV vectors TrueClone™ J for malesexualdifferentiation. 11. Expressioncloningandregulationofsteroid 5alpha-reductase,anenzymeessential J hydroxylase, abileacidbiosyntheticenzyme. 10. Cloning,structure,andexpressionofthe mitochondrial cytochromeP-450sterol26- transfected intoHelacellsandtheCA independent experiments,thesamequantityofplasmidDNAwas the promotersinpCMV6andpCDNA3.1vectors.Inthree pCDNA3.1-based plasmids.CA Comparison oftransgeneexpressionlevelsinpCMV6-and i.4 Fig. The comparisonaboveisbaseduponthoselargegenes. over 3800uniquegenes,ofwhich200arelargerthan4kbinlength. 2002 9:727-30.Inourevaluation,theDruggableGenomeconsistsof AL, andGroom,CR,TheDruggableGenome, D 2 Fig. i.3 Fig. Biol Chem.1989Sep 25; 264(27):16249-55. Biol Chem.1989May15;264(14):8222-9. ruggable GenomeextractedfrominformationprovidedbyHopkins, gene Amp resistance ColE1 f1 ori pCMV6-XL4 4707 bp cmv promoter SV40 ori PolyA signal T gene wascloneddownstreamof MCS T activity wasscored. Nat RevDrugDiscov. # Sma I Not I Xba I Sal I#* Hind III EcoRV Kpn I Bgl II EcoR I# Not I Sac I T7 Promoter *Lost uponcloning www Cloning sites .or ig ene.com mammalian celllinesandtransgenicmice. heterologousgeneexpressioninavarietyof driving transcriptionalpromotercapableof eukaryotic ments aredirectionallyinser • Russell’s laboratory plasmid was originallyobtainedfromDr. David uniform expressionscreeningmethods. The vector allowingfor cloned intoaseriesofpCMV6vectors, All ofthecDNAswithin TrueClone collectionare expression vectors? and how dothey compare to other What vectors are employed by TrueClones, genes.(Fig.2) these 200 a hasabout27ofthese commercial reagentsuppliers cDNAs.Oneofthelarger about 120 ofthese200 The resultofthisanalysisisasfollows:OriGenehas that have an ORFgreaterthan4kb. difficult toisolateclonesinthisdruggable genome clones (ORFsizeat200 lessthan 3kb),welooked in theircoverage ofhighlyabundantandsmallcDNA • Key Functional Features ofpCMV6vectors: transgene expression.(Fig.4) plasmids pro plasmid, pCDNA3.1(Invitrogen), pCMV-based When comparedwiththepopularexpression to achieve a highleveloftransgeneexpression. workhasbeendone toengineerthevector Extensive diagram totheleft. (Fig.3) bac transcriptional promoterinsteadof T7. The basic (MCS), withtheexceptionthatpCMV-XL6 hasanSP6 with thesamefeaturesandmultiplecloningsite All threeOriGenepCMV6vector Vector Diagram • • nd theMGCcollectionhas17 cDNAsrepresenting cells: Pr Selection mar coli: Selection marker inE. V transient transfections requires co-transfectionfor selection;perfectfor ect kbone ofthevectorseriesispresentedin omoter for invivo expression inmammalian or siz CMV promoter e: vide comparableifnothigherlevelsof 4.7kb k er inmammaliancells 10,11 . The full-lengthcDNAfrag- ted downstreamfroma Ampicillin-resistance s were constructed : None; • Promoter for in vitro cell free system:T7 (for pCMV6- XL4 and pCMV6-XL5) and SP6 for (pCMV6-XL6) • Cloning sites: EcoRI and SalI; while EcoRI is preserved, SalI is destroyed upon cloning • Restriction sites for removing insert: NotI. Two NotI sites are flanking the vector’s cloning sites • Cell lines suitable for transfection: COS, HEK293, Hela, CHO, NIH3T3, Mouse L cell, etc. • Transcription termination and poly-adenylation signals: From human growth hormone (hGH) gene ™

The complete sequence of pCMV6-XL4 has been de- e n posited in Genbank with accession number AF067196. o All vector sequences are available at www.origene.com. l C e u r

What are the utilities of the TrueClone? Fig. 5 T

Antibody validation

TrueClones can be utilized as: s Knock-in Subcloning into r o • Individual clones construct for other expression t c

transgenic vectors for tagged e • Bundled clones v experiment expression • A complete collection V M C n protein i

Individual TrueClones enable a wide spectrum of Transient A expression TrueClone in vivo N gene function studies, as shown in Fig. 5. in cell-free D

protein c system h

expression t

(eg. TNT) g

Bundles of TrueClone can be selected to perform n e L focused screening for ligand binding, protein - l l

Subclone into u interaction, or pathway dissection. The bundle can be Transfection of F

viral vector for mammalian cells n constructed based on gene families, such as protein a virus production m kinases, GPCRs, nuclear hormone receptors, etc, or it (eg. Adenovirus, Producing siRNA by u Lentivirus, etc) h can be based on functional or cellular localization in vitro transcription R

and dicer digestion C P

similarities, such as secreted molecules, membrane - n proteins, etc. OriGene has grouped some key gene o N

families into CloneSets™ to facilitate such needs. Sample applications for individual TrueClone. d e n o l C

The complete TrueClone collection can be used to - y d

perform global screening. The comprehensive nature a e of the TrueClone and its uniform expression vector R platform make it an ideal tool for a system biology approach. Exciting new discoveries12, 13 have been recently made using the TrueClone collection.

How do I search for a gene? 12. Identification of the Wnt signaling activator leucine-rich repeat in Flightless interaction protein 2 by a genome-wide functional analysis. OriGene’s website www.origene.com provides a Proc Natl Acad Sci U S A. 2005 Feb 8;102(6):1927-32. 13. High-throughput Functional Genomics Identifies Genes That Ameliorate Toxicity Due wide choice of search criteria. to Oxidative Stress in Neuronal HT-22 Cells: GFPT2 Protects Cells Against Peroxide Mol Cell Proteomics. 2004 Aug;3 (8):834-40.

ph: 1.888.267.4436 fax: 1.301.340.9254 7 8 Ready-Cloned Non-PCR human Full-Length cDNA in CMV vectors TrueClone™ dif Not allclonesarecreated equally. Genetranscripts Wh please contactCustomerCareat1 submitting apurchase order. To obtainaquotation, available. You such canmake acommitmentby acommitmenttopurchasemake oncethecloneis suc thelargenumberof into ourcloningqueue.Given Form” sothatourcloningteamcanputyourclone encouraged tofillouta “Customer CloningRequest effort. When yoursearch resultisnegative,youare transcript andwecanincorporateyourneedsinthis OriGene isdedicatedtocloneeveryhuman result isnegative? cloning servicewhenever asearch Will OriGene provide a custom ([email protected]). at 888.267 are lookingfor If youhavedifficulty searching whatyou orfinding • • • • • Gene Family Keywords Protein Domain A BLAST Protein Sequence fer greatlyin many aspects,such asmessage h ccession orCatalogNumber y requests, weprioritiz ar or XMwheneveritisavailable. RefSeq referencenumberbeginningwithNM a The mostspecificmethodisbyNCBI Sets™ bygenefamilyfromthisselection. Y search.negative keyword that aBLAST search beperformedafter a results arecommonanditisrecommended thedesiredresult.Falsefail togive negative that shareacommonproteindomain. An effective methodtoextractlistsofgenes to yourgeneofinterest. B searchThe mostsensitive methodisvia ccession number. OriGenegenerallyusesthe ou canviewOriGene’s pre-bundledClone- LAST. match Itgeneratesthemostdefinitive K e by NucleotideSequence, or BLAST by eywords arethemostflexiblebutcanalso .4436 orwritetoS T r ueClones pr , please callourCustomerCare iced differently? e earc those customer h -888-267 Help atOriGene www -4436. s T who eam .or ig ene.com proprietary Rapid-Screen require individualizedeffort. Equippedwiththe Large andrareclonesaredifficult tocloneand categorized withinthisgroup arepricedat$195. transcripts. The majorityofthe TrueClone collection the libraries.MostofclonesinMGCrepresentsuch throughput sequencingofasmallnumberclonesin easebyhigh- clones canbeobtainedwithrelative t Some oftheclonesrepresentshort andveryabundant all cloneusers. obtaining theseclones,whilestillproviding valueto differential difficulty pricingreflectstherelative in produce themdiffer accordingly. OriGene’s distribution. cloningeffortsThe respective neededto abundance, transcriptlength,GCcontent,andtissue dif No. thatcontributeto There arethreefactors is identicalt Will OriGene guarantee thata TrueClone OriGeneprovides purifiedplasmidDNA(200ng) 1. What isprovided whenIorder agene? provides anexcellentvaluetoourcustomers. to expandourcollection. We believeouroffering to applynewtec collection. more comprehensive We arecontinuing other cloningteam,andthuscanprovide amuch clonesthananybeen abletoobtainmoreelusive .Avialofvectorprimer(vp1.5) for5’sequence 4. Acertificate ofanalysisstating yourclone’s3. Acopyofour 2. TrueClone Application Guidewith ranscripts, such asthebeta-actintranscript.Such downstream integrationintotheend-user accurate shipping,andallowsforpotential bot propylene tube. The tubehasa2-Dbarcodeonthe dried ontothebottom ofasiliconized poly- confirmation. specifi stream applications. information regarding DNArecovery anddown- ferences: tom whic cations. o h hnologies toclonemoregenesand a ensures in published r T M technology, OriGenehas ventory integrityand ef er ence? s LIMS. including tagged proteinexpression. facilitatingmultipleapplications, of vectors, arc appropriate replacementclonefromourverylarge reading frame,everyeffort willbemadetosupplyan insertion/deletion thatdisruptstheprotein’s open 3. Cur the expressed protein? TrueClones provide afusedtagto doOriGene For protein purification, 1 an cDNA transcriptsthatencodefull-lengthproteins.If OriGene guaranteesthat 2. deri Promega todevelop a newlineof TrueClone protein expression,OriGenehasteamedupwith their ownlabs. To satisfysuch needsfortagged encouraged toperformthevectorconstructionin supplied withoutanyare fusedtag.Customers enable con . into the curated NCBIR sequencing errors. Infact,lessthanone-halfofthe references containPCR-cloningerrors and/or Alt Reference sequencesare notalways correct. S reference. contain adif verification. Itispossiblethatsome TrueClones 5’- and3‘-endsequencematching andinsert size not yetfullysequenced. We qualifyour clones by polymorphism (SNP). in a TrueClone tobeasinglenucleotide islikely currently allows,andthereforeany such difference a cDNA libraries, TrueClones aretheclosestcopiesto o be a1bpdifference ineach bpofareference 1000 the euchromatic genome,wecanexpectthereto thatpolymorphismsexistin0.1%of Clones. Given NCBI databasereferenceswithOriGene’s True- sequences, andthisistruewhencomparingthe collections willcontainexactlythesamegene y hi ctual humanmRNAtranscriptsthattechnology n rently ingle NucleotidePolymorphisms (SNP’s). vati of ourclonesareshowntocontainamutation/ ve offull-lengthcandidates. ernative splicing. average. Obtaineddirectlyfromhumanprimary ves—the FlexCloneseries. Flexcloneswill T “reviewed, validated”category rueClones are “raw” clonesfromlibraries venient shuf ferent splicepattern thanthe efSeq databaseiscurrently placed Most ofOriGene fl ing ofanORFintoavariety T rueClones areauthentic h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: ’s clonesare . N Some o two Thegenefamily, pathway andfunctionsummary • • • Sequence specificationsfortheOriGeneclone • a on OriGene’s website whenIsearch for What additionalinformation isprovided Please refertopage6formorevectorinformation. engineered onbothsidesofthecloningsites. To liberatetheinsert, useNotI.NotIsiteswere a Sal1. The compatibleendsofXho1andSal1 created l an Xho1siteonthe3’end. The fragmentswere engineered tohaveanEcoR1siteonthe5’endand The cDNApreparedforeach libraryconstructionwas from a TrueClone? sites canbeusedto remove theinsert c Which cloningsites were usedto • provide: resource. When yousearch forageneonoursite,we OriGene isstri igated pre-cutwithEcoR1and intothepCMVvectors reate TrueClones? restriction Which new sitethatcannotbecutwitheither. for yourgene constructs including protein,antibodyandpre-madeshRNA All availableproductsrelatedtothisgene, Rapid-Scan expressionpanels) tissues (dataobtainedbyRT-PCR usingOriGene’s expression levelsofthisgenein24-normal A information abouteac Direct linkstopublicdatabasesformoredetailed clone? 24-tissue expressionprofi ving tobeyourone-stopgenecloning h gene le: R elati ve

9 Ready-Cloned Non-PCR human Full-Length cDNA in CMV vectors TrueClone™ 10 CloneSet: Gene-family based collection TrueClone™ at 1.888.267.4436 fortermsandquotation. To purchase acompleteCloneSet, pleasecontactus Secreted molecules • Membraneproteins • • Lipidkinases • • Phosphatases • OriGene CloneSets™ indevelopmentinclude: single productitemforfocusedfunctionalscreening. scientific interest.CloneSets™ areavailableasa categorization assistsresearchers with focused CloneSets™ totheresearch community. Such mark prehensi OriGene hascreated,byfar, themostcom- • P450 • NHR(NuclearHormonereceptors) • GPCR(G-proteincoupledreceptors) • Protein kinase • Sets™ withinOriGene’s TrueClone collection: families. Currently thereareseveralsuch Clone- CloneSets™ arepre-bundled clonesbasedongene are theutilitiesofaCloneSet™? CloneSets™ doesOriGene have? What What isaCloneSet™?How many based collection Gene-family CloneSet™: Phosphodiesterases P Ion Channel rotease etplace, andisproudtoof ve genefamilycollectionsavailableinthe fer theseimpor www tant .or ig ene.com TC119435 NM_001106 Homo sapiens activin Homosapiensactivin A receptor, typeIIB (ACVR2B) Homosapiensactivin A receptor, typeI(ACVR1) Homosapienszeta-chain (TCR)associated proteinkinase70kDa(ZAP70),transcript variant1 NM_001106 TC1 NM_001105 TC119435 Homosapiensnatriureticpeptidereceptor A/guanylate cyclase A (atrionatriureticpeptidereceptor A) NM_001079 TC119434 growthfactor1receptor(IGF1R) Homosapiensinsulin-like TC107274 NM_000906 Homosapiensfibroblastgrowthfactorreceptor1(fms-relatedtyrosinekinase2,Pfeiffer syndrome) NM_000875 TC119602 TC124152 Homosapiens TEK tyrosinekinase,endothelial(venousmalformations,multiplecutaneous NM_000604 Homosapiensserine/threoninekinase11 (Peutz-Jeghers syndrome)(STK11) TC109227 Homosapiensphosphorylasekinase,gamma 2(testis)(PHKG2),OriGeneuniquevariant1 NM_000459 NM_000455 TC119843 Homosapiensmetproto-oncogene(hepatocytegrowthfactorreceptor)(MET) NM_000294 TC119871 TC119992 HomosapiensJanus kinase3(aproteintyrosinekinase,leukocyte)(JAK3) NM_000245 TC1 TC124046 Homosapiensglucokinase(hexokinase 4,maturityonsetdiabetesoftheyoung2)(GCK),transcript NM_000215 TC1 TC120059 Homosapiensfibroblastgrowthfactorreceptor 3(achondroplasia, thanatophoricdwarfism) (FGFR3), NM_000162 TC109267 NM_000142 growth Homosapiensfibroblastgrowthfactorreceptor 2(bacteria-expressedkinase,keratinocyte TC109231 NM_000141 TC111932 TC1 HomosapienscDNAcloneIMAGE:5092935, partial cds TC1 Homosapiens,Similartoreceptor-interactingT serine-threoninekinase3,cloneMGC:47689 IMAGE: BC052239 TC1 TC107662 Homosapiens,Similartofibroblastgrowthfactorreceptor2(bacteria-expressedkinase,keratinocyte BC041668 TC107755 Homosapiens,Similartoamyotrophic lateralsclerosis2(juvenile)chromosome region,candidate7, BC039243 TC107656 BC038807 Homosapiensleucine-rich repeatkinase2(LRRK2)mRNA,OriGeneuniquevariant TC107753 Homosapiensleucine-rich repeatkinase2(LRRK2)mRNA,OriGeneuniquevariant1 TC1 AY792511 T AY792511 TC124164 HomosapienscDNAFLJ35033fis,cloneOCBBF2016590, weaklysimilartoCELLSURFACE ANTIGEN TC124163 HomosapienscDNAFLJ23725fis,cloneHEP14024 HomosapiensserologicallydefinedbreastcancerantigenNY-BR-96T mRNA,completecds AK092352 HomosapiensmRNAforKIAA1790 protein, partial cds AK074305 TC104797 HomosapiensmRNAforKIAA1360 protein,partial cds AF308302 TC105333 HomosapiensmRNAforKIAA0999protein,partial cds AB058693 TC107661 HomosapiensmRNAforMNK1,completecds AB037781 TC107442 AB023216 TC107655 Description AB000409 TC107660 Accession No. TC107659 No. Cat. Kinase CloneSet 154 M006 HomosapiensBrutonagammaglobulinemia tyrosinekinase(BTK) NM_000061 C115442 Homosapiens,SimilartoKIAA1048 protein,cloneMGC:3535IMAGE:3607681, completecds BC002695 Homosapiensleucine-rich repeatkinase2(LRRK2)mRNA,completecds C123778 AY792511 C124162 1 1 1 1 1 75 C065Homo sapiens,SimilartoKIAA1048 protein,cloneMGC:3535IMAGE:3607681, completecds BC002695 07754 20 91N_024Homosapiensphosphorylasekinase,gamma 2(testis)(PHKG2) NM_000294 9991 9393 31 2998 6664 6 M002 Homo sapiensv-kit Hardy-Zuckerman 4felinesarcomaviraloncogenehomolog(KIT) NM_000222 061 09 NM_000075 Homo sapiens cyclin-dependent kinase 4(CDK4),OriGeneuniquevariant Homosapienscyclin-dependent 1 NM_000075 09 M010 Homosapiensbone morphogeneticprotein receptor, typeIB (BMPR1B) NM_001203 NM_0 NM_0 07 Homosapienscyclin-dependentkinase4(CDK4) 00075 0 0 020 Homo sapiens activin Homosapiensactivin 1(ACVRL1)A receptortypeII-like 020 (NPR1) (FGFR1), OriGeneuniquevariant1 and mucosal)(TEK) variant 1 transcript variant1 syndrome) (FGFR2),transcriptvariant1 factor receptor, craniofacialdysostosis1,Crouzon syndrome,Pfeiffer syndrome,Jackson-Weiss 5767146, completecds syndrome), cloneMGC:32962IMA growth factorreceptor, craniofacialdysostosis1,Crouzon syndrome,Pfeiffer syndrome,Jackson-Weiss completecds clone MGC:46456IMAGE:5200755, 114/A10 PRECURSOR h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: GE:5277896, com 11 CloneSet: Gene-family based collection TrueClone™ 12 CloneSet: Gene-family based collection TrueClone™ C171N_027HomosapiensJanus kinase1(aprotein tyrosine kinase)(JAK1) Homosapiensglycogensynthasekinase 3beta(GSK3B) NM_002227 TC1 Homosapiensglycogensynthasekinase 3beta(GSK3B),OriGeneuniquevariant 2 TC118761 Homosapiensglycogensynthasekinase3beta(GSK3B),OriGeneuniquevariant1 NM_002093 TC1 NM_002093 TC118826 HomosapiensFYNoncogenerelatedtoSRC,FGR, YES (FYN),transcriptvariant1 NM_002093 TC118825 Homosapiensfms-relatedtyrosinekinase4(FLT4), OriGeneuniquevariant1 TC118824 Homosapiensfms-relatedtyrosinekinase4(FLT4), transcriptvariant2 NM_002037 TC1 Homosapiensfibroblastgrowthfactorreceptor4(FGFR4),transcriptvariant1 NM_002020 TC118862 Homosapiensfelinesarcomaoncogene(FES) NM_002020 TC118895 NM_002011 TC118894 Homosapiensv-erb-b2 viraloncogenehomolog3(avian)(ERBB3),transcript erythroblasticleukemia NM_002005 TC111632 TC118883 Homosapienscaseinkinase2,alphaprimepolypeptide(CSNK2A2) NM_001982 TC118918 NM_001896 TC1 Homosapienscaseinkinase1,alpha1(CSNK1A1) TC118969 TC1 NM_001892 TC1 Homosapienscyclin-dependentkinase2 (CDK2),OriGeneuniquevariant1 TC118967 TC1 cycle2,G1toSandG2M(CDC2),transcriptvariant1 Homosapienscelldivision NM_001798 TC1 TC109059 Homosapiensbromodomain,testis-specific (BRDT),transcriptvariant2 NM_001786 TC1 HomosapiensBMXnon-receptortyrosinekinase(BMX) TC111605 HomosapiensBlymphoidtyrosinekinase(BLK) NM_001726 T HomosapiensBlymphoidtyrosinekinase (BLK),OriGeneuniquevariant1 NM_001721 TC110839 NM_001715 TC119060 Homosapiensv-akt murinethymoma viraloncogenehomolog2(AKT2) NM_001715 TC119056 TC119055 Homosapiensactivin A receptor, typeII(ACVR2) NM_001626 TC1 Homosapiensinterleukin-1receptor-associated kinase2(IRAK2) TC119161 NM_001616 TC1 NM_001570 TC119156 Homosapienscaseinkinase1,gamma 2(CSNK1G2) TC110934 proteinkinase14 Homosapiensmitogen-activated (MAPK14), variant1 transcript TC1 Homosapiensconservedhelix-loop-helix ubiquitouskinase(CHUK) NM_001319 T HomosapiensCHK1checkpoint homolog(S.pombe)(CHEK1) NM_001315 TC119302 HomosapiensCHK1checkpoint OriGeneuniquevariant1 homolog(S.pombe)(CHEK1), NM_001278 TC124169 Homosapienscyclin-dependentkinase9(CDC2-relatedkinase)(CDK9) NM_001274 TC119358 Homosapienscyclin-dependentkinase8(CDK8) NM_001274 TC119355 Homosapienscyclin-dependentkinase3(CDK3),OriGeneuniquevariant1 NM_001261 TC119354 NM_001260 TC119344 Homosapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIdelta(CAMK2D), NM_001258 TC119343 HomosapiensBUB1buddinguninhibitedbybenzimidazoles 1homologbeta(yeast)(BUB1B) TC119340 NM_001221 Homosapiensbonemorphogeneticproteinreceptor, typeII(serine/threoninekinase)(BMPR2), NM_001211 TC108757 Description TC119395 NM_001204 Accession No. TC108987 No. Cat. 197 M014 Homosapienscalcium/calmodulin-dependent proteinkinaseIV(CAMK4) NM_001744 C119077 Homosapiensdeath-associatedproteinkinase 3(DAPK3) NM_001348 C119321 86 M019 Homo sapienscaseinkinase1,delta(CSNK1D), OriGeneuniquevariant1 NM_001893 18968 1 1 Homosapiensv-raf murinesarcoma3611 viraloncogenehomolog(ARAF) NM_001654 19127 Homosapiensinterleukin-1receptor-associated kinase1(IRAK1) 1 NM_001569 19139 1 1 08487 Homosapienscaseinkinase2,alpha1polypeptide(CSNK2A1),transcriptvariant2 NM_001895 09127 09060 2397 9024 90 Homo sapiensadrenergic,beta,receptorkinase1(ADRBK1) NM_001619 9158 871 8838 1 6 M025 Homosapiens kinaseinsert domainreceptor(atype IIIreceptortyrosinekinase)(KDR) NM_002253 6 4 NM_0 kinase)(CDK7) Homosapienscyclin-dependentkinase7(MO15 homolog,Xenopuslaevis,cdk-activating NM_001799 NM_0 M015 Homosapiensdiscoidindomainreceptorfamily, member1 (DDR1), transcriptvariant2 NM_001954 NM_0 NM_0 21 Homo sapienshemopoieticcellkinase(HCK) 02110 1(PITSLREproteins)(CDC2L1),transcriptvariant 1 cycle2-like Homosapienscelldivision 01787 02082 0 78Homosapienscyclin-dependentkinase2(CDK2),transcriptvariant1 1798 variant 1 transcript variant3 transcript variant1 Homo sapiensGprotein-coupledreceptorkinase6(GRK6),transcriptvariant2 www .or ig ene.com TC118423 NM_002754 Homo sapiens mitogen-activated protein kinase13 (MAPK13) Homosapiensmitogen-activated protein kinase9(MAPK9),transcriptvariant1 Homosapiensmitogen-activated NM_002754 TC1 protein kinase11 Homosapiensmitogen-activated (MAPK11), transcriptvariant1 TC118423 protein kinase8(MAPK8),transcriptvariant2 Homosapiensmitogen-activated NM_002752 TC1 NM_002751 TC111675 proteinkinase4(MAPK4) Homosapiensmitogen-activated NM_002750 TC118466 HomosapiensproteinkinaseC,zeta (PRKCZ) TC109619 HomosapiensproteinkinaseC,zeta (PRKCZ),OriGeneuniquevariant2 NM_002747 TC1 HomosapiensproteinkinaseC,zeta (PRKCZ), OriGeneuniquevariant1 NM_002744 TC118463 HomosapiensproteinkinaseD1(PRKD1) NM_002744 TC118461 NM_002744 TC118460 NM_002742 TC118459 HomosapiensproteinkinaseC,gamma (PRKCG) TC118457 HomosapiensproteinkinaseC,beta1(PRKCB1),transcriptvariant2 TC1 HomosapiensproteinkinaseC,alpha(PRKCA) NM_002739 TC1 NM_002738 TC112717 NM_002737 TC118454 Homosapiensproteinkinase,cAMP-dependent, catalytic,beta(PRKACB), OriGeneuniquevariant1 TC124082 Homosapiensproteinkinase,cAMP-dependent, catalytic,alpha(PRKACA), transcriptvariant1 TC1 Homosapienspim-1oncogene(PIM1) NM_002731 TC1 NM_002730 TC108498 NM_002648 TC118448 Homosapienspyruvatedehydrogenase kinase,isoenzyme4(PDK4) TC110975 TC1 NM_002612 TC1 Homosapienspyruvatedehydrogenase kinase,isoenzyme1(PDK1),nucleargeneencoding TC118542 TC1 Homosapienspyruvatedehydrogenase kinase,isoenzyme1(PDK1),nucleargene encoding NM_002610 HomosapiensPCTAIRE proteinkinase2(PCTK2) TC118539 NM_002610 kinase2(PAK2) Homosapiensp21(CDKN1A)-activated NM_002595 TC118538 Homosapiensp21/Cdc42/Rac1-activated kinase1(STE20 homolog,yeast)(PAK1) TC118532 Homosapiensneurotrophictyrosinekinase,receptor, type3(NTRK3), OriGeneuniquevariant1 NM_002577 TC1 Homosapiensneurotrophictyrosinekinase,receptor, type3(NTRK3) NM_002576 TC118562 HomosapiensNIMA(neverinmitosisgenea)-relatedkinase3(NEK3),transcript variant 1 NM_002530 TC107950 HomosapiensNIMA(neverinmitosisgenea)-relatedkinase3(NEK3),OriGeneuniquevariant1 NM_002530 TC118579 HomosapiensNIMA(neverinmitosisgenea)-relatedkinase2(NEK2) NM_002498 TC118578 proteinkinase10 Homosapiensmitogen-activated (MAP3K10) NM_002498 TC109481 proteinkinase11 Homosapiensmitogen-activated (MAP3K11) NM_002497 TC109479 NM_002446 TC108482 HomosapiensMAP/microtubuleaffinity-regulating kinase3(MARK3) NM_002419 TC118630 HomosapiensMAP/microtubuleaffinity-regulating kinase3(MARK3),OriGeneuniquevariant1 TC110949 Homosapiensv-yes-1 Yamaguchi NM_002376 sarcomaviralrelatedoncogenehomolog(LYN) T NM_002376 TC118703 Homosapiensv-yes-1 Yamaguchi sarcomaviralrelatedoncogenehomolog(LYN), OriGeneunique NM_002350 TC118702 HomosapiensLIMdomainkinase1(LIMK1),transcriptvariant TC108492 HomosapiensLIMdomainkinase1(LIMK1),transcriptvariant NM_002350 NM_002314 TC108490 Description NM_002314 TC123883 Accession No. TC118711 No. Cat. C118669 NM_002401 Homo sapiens mitogen-activated proteinkinase3(MAP3K3),transcriptvariant2 Homosapiensmitogen-activated NM_002401 C118669 1 HomosapiensproteinkinaseC,iota(PRKCI) NM_002740 1 18455 Homosapiensproteinkinase,cAMP-dependent, catalytic,gamma (PRKACG) NM_002732 18449 1 1 1 1 1 09625 Homosapiensproteinkinase,cAMP-dependent, catalytic,beta(PRKACB), transcriptvariant2 NM_002731 08499 8465 8456 8544 8543 8540 8563 8424 NM_002755 Homo sapiens mitogen-activated protein kinase1(MAP2K1) Homosapiensmitogen-activated NM_002755 NM_0 NM_0 NM_0 Homosapiens3-phosphoinositidedependentproteinkinase-1 (PDPK1) NM_002613 NM_0 NM_0 NM_0 02753 027 027 Homosapiens3-phosphoinositidedependentproteinkinase-1(PDPK1),OriGeneuniquevariant1 02613 0 02578 261 48 Homo sapiens mitogen-activated proteinkinase6(MAPK6) Homosapiens mitogen-activated 48 41 1 mitochondrial protein mitochondrial protein,OriGeneuniquevariant1 variant 1 Homo sapiens mitogen-activated proteinkinase10Homo sapiensmitogen-activated (MAPK10), transcriptvariant 1 Homo sapiensproteinkinaseN1(PKN1),transcriptvariant2 Homo sapienspyruvatedehydrogenase kinase,isoenzyme2(PDK2) Homo sapiensp21(CDKN1A)-acti h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: vated kinase3(PAK3) 13 CloneSet: Gene-family based collection TrueClone™ 14 CloneSet: Gene-family based collection TrueClone™ C184N_066Homosapienscalcium/calmodulin-dependent proteinkinaseI(CAMK1),OriGene unique variant1 protein kinase3(MAP4K3) Homosapiensmitogen-activated NM_003656 TC117844 protein kinase3(MAP4K3),OriGeneunique Homosapiensmitogen-activated NM_003618 TC1 TC117893 NM_003618 Homosapiensdual-specificitytyrosine-(Y)-phosphorylationregulatedkinase2(DYRK2), transcript TC117892 TC1 Homosapiensdual-specificitytyrosine-(Y)-phosphorylationregulatedkinase3(DYRK3), transcript NM_003583 TC109928 cycle7(S.cerevisiae)(CDC7) HomosapiensCDC7celldivision NM_003582 Homosapiens WEE1 homolog(S.pombe)(WEE1) TC117867 Homosapiensvacciniarelatedkinase1(VRK1) NM_003503 TC1 NM_003390 TC117908 Homosapiens TXK tyrosinekinase(TXK) NM_003384 TC117999 Homosapiens TTK proteinkinase(TTK), OriGeneuniquevariant1 TC117994 Homosapiens TTK proteinkinase(TTK) NM_003328 TC1 NM_003318 TC118038 NM_003318 TC118033 protein kinase7(MAP3K7),transcriptvariant Homosapiensmitogen-activated A TC118032 TC1 NM_003188 TC1 70kDa, polypeptide1(RPS6KB1) HomosapiensribosomalproteinS6kinase, TC118119 TC1 5(CDKL5),OriGeneuniquevariant1 Homosapienscyclin-dependentkinase-like NM_003161 TC1 gene a)-relatedkinase4(NEK4) HomosapiensNIMA(neverinmitosis TC118140 HomosapiensSFRSproteinkinase1(SRPK1) NM_003159 TC1 protein kinase4(MAP2K4),OriGeneuniquevariant Homosapiensmitogen-activated NM_003157 TC108474 proteinkinase4(MAP2K4),OriGeneuniquevariant3 Homosapiensmitogen-activated NM_003137 TC118137 proteinkinase4(MAP2K4),OriGeneuniquevariant2 Homosapiensmitogen-activated NM_003010 TC118183 protein kinase4(MAP2K4) Homosapiensmitogen-activated NM_003010 TC118244 proteinkinase4(MAP2K4),OriGeneuniquevariant1 Homosapiensmitogen-activated NM_003010 TC118243 protein kinase12 (MAPK12), Homosapiensmitogen-activated OriGeneuniquevariant1 NM_003010 TC118241 protein kinase12 (MAPK12) Homosapiensmitogen-activated NM_003010 TC118240 HomosapiensRYK receptor-like tyrosinekinase(RYK), transcriptvariant2 NM_002969 TC118239 HomosapiensribosomalproteinS6kinase,90kDa,polypeptide1(RPS6KA1),transcriptvariant NM_002969 TC118306 HomosapiensGprotein-coupledreceptorkinase1(GRK1) NM_002958 TC118305 Homosapiensv-raf-1 viraloncogenehomolog1(RAF1) murineleukemia NM_002953 TC112721 Homosapiensv-raf-1 viraloncogenehomolog1(RAF1),OriGene uniquevariant1 murineleukemia NM_002929 TC118295 HomosapiensPTK9proteintyrosinekinase9(PTK9),OriGeneuniquevariant1 NM_002880 TC118278 HomosapiensPTK9proteintyrosinekinase9(PTK9),transcriptvariant1 NM_002880 TC118323 HomosapiensPTK7proteintyrosinekinase7(PTK7),transcriptvariantPTK7-1 NM_002822 TC118322 Homosapiensproteinkinase, Y-linked NM_002822 (PRKY) TC109663 translationinitiationfactor2-alphakinase2(EIF2AK2) Homosapienseukaryotic NM_002821 TC109662 proteinkinase6(MAP2K6),transcriptvariant1 Homosapiensmitogen-activated NM_002760 TC118391 proteinkinase5(MAP2K5),transcriptvariantB Homosapiensmitogen-activated NM_002759 TC118434 proteinkinase5(MAP2K5),OriGeneuniquevariant1 Homosapiensmitogen-activated NM_002758 TC118433 NM_002757 TC118432 Description NM_002757 TC124173 Accession No. TC109629 No. Cat. 77 M030 Homosapiensserine/threoninekinase6(STK6), transcriptvariant2 NM_003600 17877 1 1 1 1 1 1 1 1 08N_031Homosapienstyrosinekinase2(TYK2) NM_003331 1048 97N_056Homosapiensserine/threoninekinase24(STE20 homolog,yeast)(STK24) NM_003576 7907 Homosapienstransforminggrowthfactor, betareceptorII(70/80kDa)(TGFBR2) Homosapienstecproteintyrosinekinase(TEC) NM_003242 NM_003215 8072 8147 81 81 81 7843 1 41 39 M037 Homosapiensspleentyrosinekinase(SYK) NM_003177 5 NM_0 NM_0 M036 HomosapiensribosomalproteinS6kinase,70kDa,polypeptide 1(RPS6KB1),OriGeneuniquevariant NM_003161 35 Homo sapienscalcium/calmodulin-dependentproteinkinaseI(CAMK1) 03656 031 60 Homo sapiensaurorakinaseC(A variant 1 variant 1 variant 1 www URKC) .or ig ene.com C144N_049Homosapiensdystrophiamyotonica-protein kinase(DMPK) Homosapiensc-srctyrosinekinase(CSK) NM_004409 HomosapiensBUB1buddinguninhibited bybenzimidazoles 1homolog(yeast)(BUB1) TC117404 Homosapiensv-raf murinesarcomaviral oncogenehomologB1(BRAF) NM_004383 TC1 NM_004336 TC117389 Homosapiensbreakpointclusterregion(BCR),transcriptvariant1 NM_004333 TC110841 Homosapiensactivin A receptor, typeIB(ACVR1B), transcriptvariant1 TC117437 NM_004327 TC1 NM_004302 TC117431 Homosapiensmembrane-associatedtyrosine-andthreonine-specificcdc2-inhibitory kinase TC108895 Homosapiensserine/threoninekinase19 (STK19), OriGeneuniquevariant1 TC1 Homosapiensserine/threoninekinase19 (STK19), transcriptvariant1 NM_004203 Homosapiensfms-relatedtyrosinekinase3(FLT3) NM_004197 TC117519 HomosapiensPTK2Bproteintyrosinekinase2beta(PTK2B),transcriptvariant NM_004197 TC109999 NM_004119 TC109998 kinase1(CLK1) HomosapiensCDC-like NM_004103 TC124086 TC109209 HomosapiensnatriureticpeptidereceptorB/guanylate cyclaseB(atrionatriureticpeptidereceptorB)(NPR2) NM_004071 TC1 TC117574 kinase3(CLK3),OriGeneuniquevariant1hclk3 HomosapiensCDC-like NM_003995 TC1 kinase3(CLK3),transcriptvariantphclk3 HomosapiensCDC-like TC117646 Homosapienstyrosinekinase,non-receptor, 1(TNK1) NM_003992 TC1 HomosapiensBRserine/threoninekinase 2(BRSK2) NM_003992 TC109076 proteinkinase14 Homosapiensmitogen-activated (MAP3K14) NM_003985 TC109075 HomosapiensribosomalproteinS6kinase, 70kDa,polypeptide2(RPS6KB2),transcriptvariant1 NM_003957 TC117643 NM_003954 TC101068 NM_003952 TC117658 TC124062 TC1 Homosapienstranscriptionalintermediary factor1(TIF1),transcriptvariant2 T Homosapiensdual-specificitytyrosine-(Y)-phosphorylationregulatedkinase4(DYRK4) TC1 NM_003852 TC1 Homosapiensdual-specificitytyrosine-(Y)-phosphorylationregulatedkinase4(DYRK4), OriGene NM_003845 TC117716 HomosapiensRIOkinase3(yeast)(RIOK3),transcriptvariant1 TC106952 Homosapiensreceptor-interacting serine-threoninekinase2(RIPK2),OriGeneuniquevariant1 NM_003845 Homosapiensreceptor-interacting serine-threoninekinase2(RIPK2) NM_003831 TC106951 Homosapiensreceptor(TNFRSF)-interactingserine-threoninekinase1(RIPK1) NM_003821 TC109987 NM_003821 TC117735 5(cholinesterase-related cycle2-like controller)(CDC2L5), Homosapienscelldivision celldivision NM_003804 TC117734 Homosapiensserine/threoninekinase16 (STK16), transcriptvariant1 TC108466 Homosapienscalcium/calmodulin-dependentserineproteinkinase(MAGUK family)(CASK) NM_003718 HomosapiensMAPkinaseinteractingserine/threonine1(MKNK1) NM_003691 TC109966 10 Homosapienscyclin-dependentkinase(CDC2-like) (CDK10), transcriptvariant1 NM_003688 TC108468 10 Homosapienscyclin-dependentkinase(CDC2-like) (CDK10), OriGeneuniquevariant1 NM_003684 TC117810 NM_003674 TC117862 proteinkinase5(MAPKAPK5),OriGene proteinkinase-activated Homosapiensmitogen-activated NM_003674 TC109952 TC109951 proteinkinase5(MAPKAPK5),transcript proteinkinase-activated Homosapiensmitogen-activated NM_003668 Description TC109944 NM_003668 Accession No. TC109943 No. Cat. C111095 NM_003948 Homo sapiens cyclin-dependent kinase-like 2(CDC2-relatedkinase)(CDKL2) Homosapienscyclin-dependentkinase-like NM_003948 C111095 73 M042 Homosapiensserine/threoninekinase17b (apoptosis-inducing)(STK17B) 1 NM_004226 17533 kinase1(CLK1),OriGene uniquevariant1 HomosapiensCDC-like 1 NM_004071 17573 1 HomosapiensribosomalproteinS6kinase, 70kDa, polypeptide2(RPS6KB2),OriGeneuniquevariant1 NM_003952 17656 1 0851 07962 7 7577 7 HomosapiensribosomalproteinS6kinase,90kDa,polypeptide4(RPS6KA4),transcriptvariant1 NM_003942 7648 433 645 2 NM_0 NM_0 NM_0 NM_0 NM_0 04329 31 HomosapiensPRP4pre-mRNAprocessingfactor4homologB(yeast)(PRPF4B),transcriptvariant1 03913 04073 Homo sapiens polo-like kinase 3(Drosophila)(PLK3) Homosapienspolo-like 04073 kinase2(CLK2),transcriptvariant1 HomosapiensCDC-like 03993 04384 Homo sapiensbonemorphogeneticproteinreceptor, typeIA(BMPR1A) (PKMYT1), transcriptvariant1 unique variant1 transcript variant1 unique variant1 variant 1 Homo sapienscaseinkinase1,gamma 3(CSNK1G3) h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 15 CloneSet: Gene-family based collection TrueClone™ 16 CloneSet: Gene-family based collection TrueClone™ TC110878 NM_005228 Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral(v-erb-b) Homosapiensepidermalgrowthfactorreceptor (erythroblasticleukemia oncogene Homosapienscolony stimulatingfactor 1 receptor, viral(v-fms) formerlyMcDonoughfelinesarcoma NM_005228 TC110878 Homosapiensv-akt murinethymoma viral oncogenehomolog1(AKT1) NM_005211 TC116882 Homosapiensadrenergic,beta,receptorkinase2(ADRBK2) NM_005163 TC1 Homosapiensv-abl viraloncogenehomolog1(ABL1), transcript varianta Abelson murineleukemia TC116883 NM_005160 TC1 NM_005157 TC116916 (PRKX) Homosapiensproteinkinase,X-linked TC116914 kinase1(Drosophila) (PLK1) Homosapienspolo-like TC1 orphanreceptor1(ROR1) Homosapiensreceptortyrosinekinase-like NM_005044 TC1 HomosapiensJanus kinase2(aproteintyrosinekinase)(JAK2) NM_005030 TC116959 Homosapiensguanylate cyclase2C(heat stableenterotoxin receptor)(GUCY2C) NM_005012 TC110978 NM_004972 TC117005 Homosapiensdeath-associatedproteinkinase1(DAPK1) NM_004963 TC117059 TC117052 HomosapiensRho-associated,coiled-coil containingproteinkinase2(ROCK2) NM_004938 TC1 TC110866 Homosapiens TAO NM_004850 kinase2(TAOK2) TC1 kinase17a Homosapiensserine/threonine (apoptosis-inducing)(STK17A) TC117098 NM_004783 TC1 NM_004760 TC117141 Homosapiensdoublecortin 1(DCAMKL1) andCaMkinase-like TC117160 NM_004734 TC1 Homosapiensdual-specificitytyrosine-(Y)-phosphorylationregulatedkinase1B(DYRK1B), transcript TC108525 HomosapiensLATS, largetumorsuppressor, homolog1(Drosophila)(LATS1)” TC1 NM_004714 proteinkinase3(MAPKAPK3) protein kinase-activated Homosapiensmitogen-activated NM_004690 TC117223 TC117200 Homosapienstransforminggrowthfactor, betareceptorI(activin kinase,53kDa) A receptortypeII-like NM_004635 TC1 HomosapiensribosomalproteinS6kinase, 90kDa,polypeptide3(RPS6KA3) TC117238 HomosapiensribosomalproteinS6kinase, 90kDa,polypeptide3(RPS6KA3),OriGeneuniquevariant1 NM_004612 protein kinase2(MAP4K2) Homosapiensmitogen-activated NM_004586 TC108520 orphanreceptor2(ROR2) Homosapiensreceptortyrosinekinase-like NM_004586 TC111006 kinase(ILK) Homosapiensintegrin-linked NM_004579 TC111005 NM_004560 TC117289 Homosapiensv-erb-b2 viraloncogenehomolog2,neuro/glioblastomaderived erythroblasticleukemia NM_004517 TC117279 HomosapiensEPHreceptorB6(EPHB6) TC117313 HomosapiensEPHreceptorB4(EPHB4) NM_004448 HomosapiensEPHreceptorB3(EPHB3) NM_004445 TC125233 HomosapiensEPHreceptorB1(EPHB1) NM_004444 TC117358 HomosapiensEPHreceptor A7 (EPHA7) NM_004443 TC117357 HomosapiensEPHreceptor A5 (EPHA5),transcriptvariant1 NM_004441 TC117356 HomosapiensEPHreceptor A4 (EPHA4) NM_004440 TC117355 HomosapiensEPHreceptor A2 (EPHA2) NM_004439 TC108415 HomosapiensEPHreceptor A2 (EPHA2) NM_004438 TC111626 NM_004431 TC117354 Description NM_004431 TC121913 Accession No. TC117346 No. Cat. 1 1 1 Homosapienscyclin-dependentkinase5(CDK5) 1 NM_004935 17039 1 1 1 proteinkinase6(MAP3K6) Homosapiensmitogen-activated NM_004672 11727 1 1 0899 97N_010Homo sapiensadrenergic,beta,receptorkinase 2(ADRBK2),OriGeneuniquevariant1 NM_005160 6917 6928 71 71 7227 2674 NM_005204 Homo sapiens mitogen-activated proteinkinase kinase8(MAP3K8) Homo sapiensmitogen-activated NM_005204 2674 1 28 32 59 NM_0 NM_0 proteinkinase2(MAPKAPK2),transcript protein kinase-activated Homosapiensmitogen-activated NM_004759 NM_0 M050 Homosapiensbromodomaincontaining2(BRD2) NM_005104 NM_0 051 45 HomosapiensFK506bindingprotein12-rapamycin associatedprotein1(FRAP1) 04958 translationinitiationfactor2-alphakinase3(EIF2AK3) Homosapienseukaryotic 04836 0 4721 09 Homo sapienso variant 1 homolog, avian)(EGFR), transcript variant1 oncogene homolog(CSF1R) variant a (TGFBR1) Homo sapiensmitogen-acti oncogene homolog(avian)(ERBB2),transcriptvariant1 xidative-stress responsive 1(OXSR1) responsive xidative-stress www vated proteinkinase13 (MAP3K13) .or ig ene.com C124N_029Homosapiensproteinkinase,cGMP-dependent, typeII(PRKG2) HomosapiensproteinkinaseC,theta(PRKCQ) NM_006259 TC1 HomosapiensproteinkinaseN2(PKN2) TC116254 HomosapiensproteinkinaseC,eta(PRKCH) NM_006257 TC1 NM_006256 TC116251 Homosapiensproteinkinase, AMP-activated, alpha2catalyticsubunit(PRKAA2) NM_006255 TC108568 Homosapiensproteinkinase, AMP-activated, alpha1catalyticsubunit(PRKAA1),transcriptvariant TC116250 Homosapiensphosphorylasekinase,gamma 1(muscle)(PHKG1) NM_006252 TC1 growthfactorreceptor, Homosapiensplatelet-derived alphapolypeptide(PDGFRA) NM_006251 TC116247 HomosapiensPCTAIRE proteinkinase1(PCTK1),transcriptvariant NM_006213 TC116246 NM_006206 TC116261 NM_006201 TC116256 Homosapiensserine/threoninekinase10 (STK10) TC111664 HomosapiensPTK6proteintyrosinekinase6(PTK6) TC1 HomosapiensPTK6proteintyrosinekinase6(PTK6) NM_005990 TC1 NM_005975 TC116411 NM_005975 TC124087 Homosapiensbranched chain dehydrogenase ketoacid kinase(BCKDK) TC116404 HomosapiensproteinkinaseD3(PRKD3) TC1 Homosapienstyrosinekinase,non-receptor, 2(TNK2),transcriptvariant1 NM_005881 TC1 NM_005813 TC116464 NM_005781 TC116506 Homosapiensserum/glucocorticoid regulatedkinase(SGK),OriGeneuniquevariant1 TC116528 TC1 HomosapiensPTK2proteintyrosinekinase2(PTK2),transcriptvariant NM_005627 TC1 receptortyrosinekinase(MUSK) Homosapiensmuscle,skeletal, TC116599 NM_005607 TC1 HomosapiensIL2-inducible T-cell NM_005592 kinase(ITK) TC116628 TC116680 NM_005546 TC1 Homosapiensv-yes-1 Yamaguchi sarcomaviraloncogenehomolog1(YES1) TC116679 andEGF-like Homosapienstyrosinekinasewithimmunoglobulin-like domains1 (TIE1) NM_005433 TC1 Homosapiensv-src sarcoma(Schmidt-Ruppin A-2) viraloncogenehomolog(avian)(SRC), transcript NM_005424 TC116734 HomosapiensproteinkinaseC,epsilon(PRKCE) TC116728 Homosapienspyruvatedehydrogenase kinase,isoenzyme3(PDK3) NM_005417 Homosapienslymphocyte-specificproteintyrosinekinase(LCK) NM_005400 TC116752 Homosapienslymphocyte-specificproteintyrosinekinase(LCK),OriGeneuniquevariant1 NM_005391 TC116792 HomosapiensGprotein-coupledreceptorkinase5(GRK5) NM_005356 TC110971 NM_005356 TC116770 HomosapienscyclinGassociatedkinase(GAK) NM_005308 TC116769 HomosapiensGardner-Rasheed felinesarcoma viral(v-fgr) oncogenehomolog(FGR) TC110910 Homosapiensfer(fps/fesrelated)tyrosinekinase(phosphoproteinNCP94)(FER) NM_005255 T NM_005248 TC116876 Homosapiensv-erb-a viraloncogenehomolog4(avian)(ERBB4), OriGene erythroblasticleukemia NM_005246 TC116870 HomosapiensEPHreceptor A3 (EPHA3),transcriptvariant1 TC116869 HomosapiensEPHreceptor A1 (EPHA1) NM_005235 NM_005233 TC116863 Description NM_005232 TC109197 Accession No. TC116861 No. Cat. 161 M050 HomosapiensGprotein-coupledreceptorkinase4(GRK4),OriGeneuniquevariant1 NM_005307 C116815 1 (CDC42BPB) HomosapiensCDC42bindingproteinkinasebeta(DMPK-like) NM_006035 1 16371 proteinkinase kinase5(MAP3K5) Homosapiensmitogen-activated Homo sapiensmalegermcell-associatedkinase(MAK) NM_005923 NM_005906 16450 16439 1 1 1 1 1 1 241 15N_045Homosapiensv-akt murinethymoma viraloncogenehomolog3(proteinkinaseB,gamma) (AKT3), NM_005465 0105 6249 6294 651 6597 6659 61 6252 8N_021Homo sapiens serine/threoninekinase3(STE20 homolog,yeast)(STK3) NM_006281 88 79 M056 Homosapienstripartite motif-containing28(TRIM28) NM_005762 5 NM_0 NM_0 NM_0 NM_0 NM_0 NM_0 65 Homo sapiensproteinkinase,cGMP-dependent, typeI(PRKG1) 06258 Homosapienshomeodomaininteractingproteinkinase3(HIPK3) 05734 06254 061 0 05569 5627 82 Homo sapiensdiscoidindomainreceptorfamily, member2(DDR2) Homo sapiensserum/glucocor transcript variant1 variant 1 unique variant1 Homo sapiensproteinkinaseC,delta(PRKCD),transcriptvariant1 H omo sapiensLIMdomainkinase2(LIMK2),transcriptvariant2a h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: ticoid regulatedkinase(SGK) 17 CloneSet: Gene-family based collection TrueClone™ 18 CloneSet: Gene-family based collection TrueClone™ C126N_132Homosapiensnuclearreceptorbinding protein (NRBP) Homosapiensserum/glucocorticoid (SGKL),transcriptvariant 1 regulated kinase-like NM_013392 TC1 TC115246 Homosapiensserinethreoninekinase39(STE20/SPS1 homolog,yeast)(STK39) NM_013257 TC1 HomosapiensribosomalproteinS6kinase,52kDa,polypeptide1(RPS6KC1) TC115312 HomosapiensPFTAIRE proteinkinase1 (PFTK1),OriGeneuniquevariant1 NM_013233 TC1 NM_012424 TC115335 Homosapienscellcyclerelatedkinase(CCRK),transcriptvariant2 NM_012395 TC115380 TC115413 Homosapiensbromodomaincontaining3(BRD3) NM_012119 TC1 TC124172 Homosapiensv-abl viraloncogenehomolog2(arg, Abelson murineleukemia Abelson-related gene) NM_007371 TC1 TC115567 Homosapiensserine/threoninekinase38(STK38) NM_007314 Homosapiensinterleukin-1receptor-associated kinase3(IRAK3) TC115594 HomosapiensCHK2checkpoint homolog(S.pombe)(CHEK2),transcriptvariant1 NM_007271 TC1 NM_007199 TC115629 NM_007194 TC115680 protein kinase1(MAP4K1) Homosapiensmitogen-activated TC110240 Homosapienstestis-specifickinase2(TESK2) Homosapiensproteintyrosinephosphatase typeIVA, member3(PTP4A3),transcriptvariant2 NM_007181 TC1 Homosapienspim-2oncogene(PIM2) NM_007170 TC115668 kinase2(TLK2),OriGeneuniquevariant Homosapienstousled-like NM_007079 TC115660 kinase2(TLK2),OriGeneuniquevariant1 Homosapienstousled-like NM_006875 TC110233 NM_006852 TC115825 NM_006852 TC115812 TC115811 TC1 proteinkinase2(MAP3K2) Homosapiensmitogen-activated T proteinkinase5(MAP4K5),transcriptvariant1 Homosapiensmitogen-activated TC1 NM_006609 TC1 Homosapienscalcium/calmodulin-dependentproteinkinase2,beta(CAMKK2), OriGeneunique NM_006575 TC115980 TC110237 NM_006549 TC116034 Homosapienscalcium/calmodulin-dependentproteinkinase2,beta(CAMKK2),transcript T Homosapiensdual-specificitytyrosine-(Y)-phosphorylationregulatedkinase2(DYRK2), transcript NM_006549 Homosapiensserine/threoninekinase25(STE20 homolog,yeast)(STK25), OriGene1 uniquevariant TC124175 Homosapiensserine/threoninekinase25(STE20 homolog,yeast)(STK25) NM_006482 Homosapiensc-merproto-oncogenetyrosinekinase(MERTK) NM_006374 TC109929 proteinkinase12 (MAP3K12), Homosapiensmitogen-activated OriGeneuniquevariant1 NM_006374 TC111156 Homosapiensvacciniarelatedkinase2(VRK2),OriGeneuniquevariant1 NM_006343 TC111155 Homosapiensvacciniarelatedkinase2(VRK2) NM_006301 TC116132 Homosapiens TYRO3 proteintyrosinekinase(TYRO3) NM_006296 TC116209 Homosapienstestis-specifickinase1(TESK1) NM_006296 TC116203 Homosapiensserine/threoninekinase4(STK4) NM_006293 TC116202 NM_006285 TC108283 Description NM_006282 TC116192 Accession No. TC116189 No. Cat. 115 M064 HomosapiensproteinserinekinaseH1(PSKH1) NM_006742 C101252 Homosapienscalcium/calmodulin-dependentproteinkinase2,beta(CAMKK2), OriGeneunique NM_006549 C116033 1 1 1 1 kinase2(TLK2) Homo sapienstousled-like NM_006852 15810 1 1 1 0861 08453 1 1 5604 NM_007284 Homo sapiens PTK9L protein tyrosine kinase 9-like (A6-relatedprotein)(PTK9L) HomosapiensPTK9Lproteintyrosinekinase9-like NM_007284 5604 5669 HomosapiensFAST kinase(FASTK), transcriptvariant1 NM_006712 5926 5988 5206 NM_014002 Homo sapiens inhibitor of kappa lightpolypeptide geneenhancerinB-cells,kinaseepsilon (IKBKE) Homo sapiensinhibitorofkappa NM_014002 5206 954 5 M035 Homosapiens TANK-binding kinase1(TBK1) NM_013254 251 M035 Homosapiens proteinkinaseN3(PKN3) NM_013355 9 M021 Homosapienscellcyclerelatedkinase(CCRK),OriGeneuniquevariant1 NM_012119 NM_0 NM_0 kinase2(Drosophila)(PLK2) Homosapienspolo-like NM_006622 1 071 2290 Homo sapiens tousled-like kinase1(TLK1) Homosapienstousled-like 2290 81 Homo sapiens mitogen-activated proteinkinase1(MAP4K1),OriGeneunique Homosapiensmitogen-activated 81 variant 1 (ABL2), transcriptvariantb variant 2 variant 1 variant 1 variant 2 www .or ig ene.com C035N_171HomosapiensPXdomaincontainingserine/threonine kinase(PXK) HomosapiensSNF-1 relatedkinase(SNRK) NM_017771 NM_017719 TC100365 HomosapiensMAP/microtubuleaffinity-regulating kinase2(MARK2),transcriptvariant 1 TC114000 TC1 HomosapiensLIMdomainkinase2(LIMK2),transcriptvariant2b NM_017490 TC1 Homosapienssterilealphamotifandleucinezippercontainingkinase AZK (ZAK) TC114124 HomosapiensMst3andSOK1-related kinase (MST4) NM_016733 TC1 NM_016653 TC114149 HomosapiensproteinkinaseD2(PRKD2) NM_016542 TC114182 HomosapiensproteinkinaseD2(PRKD2),OriGeneuniquevariant1 TC114204 Homosapiensvacciniarelatedkinase3(VRK3),OriGeneuniquevariant1 NM_016457 TC1 NM_016457 TC114275 Homosapiens TAO NM_016440 kinase3(TAOK3) TC114274 TC114264 NM_016281 TC1 Homosapiensinterleukin-1receptor-associated kinase4(IRAK4),OriGeneunique variant1 TC114377 TC1 Homosapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIalpha (CAMK2A),transcript NM_016123 TC1 Homosapiens TNNI3 interactingkinase(TNNI3K) TC114467 Homosapienstripartite motif-containing33(TRIM33),transcriptvariantalpha NM_015981 NM_015978 TC111598 Homosapiensfibroblastgrowthfactorreceptor1(fms-relatedtyrosinekinase2,Pfeiffer syndrome) NM_015906 TC114557 TC114584 Homosapiensserine/threoninekinase36(fusedhomolog,Drosophila)(STK36) NM_015850 HomosapiensPAS domaincontainingserine/threoninekinase(PASK) TC114629 (STK38L) Homosapiensserine/threoninekinase38like NM_015690 TC1 Homosapiens AMP-activated proteinkinasefamilymember5(ARK5) NM_015148 TC101100 (CDC42BPA), HomosapiensCDC42bindingproteinkinase alpha(DMPK-like) transcriptvariant A NM_015000 TC111200 Homosapiensmaternalembryonicleucine zipperkinase(MELK) NM_014840 TC100957 HomosapiensSTE20-likekinase(yeast)(SLK) NM_014826 TC114801 Homosapiensunc-51-like kinase2(C.elegans) (ULK2) NM_014791 TC114791 Homosapiensphosphoinositide-3-kinase,regulatorysubunit4,p150 (PIK3R4) NM_014720 TC114824 HomosapiensLATS, largetumorsuppressor, homolog2(Drosophila)(LATS2) NM_014683 TC114874 HomosapiensribosomalproteinS6kinase,90kDa,polypeptide6(RPS6KA6) NM_014602 TC114908 translationinitiationfactor2-alphakinase1(EIF2AK1) Homosapienseukaryotic NM_014572 TC100382 HomosapiensNIMA(neverinmitosisgenea)-relatedkinase6(NEK6) NM_014496 TC120535 Homosapiensserine/threoninekinase23(STK23) NM_014413 TC114987 Homosapiensserine/threoninekinase23(STK23) NM_014397 TC115013 Homosapiensserine/threoninekinase23(STK23) NM_014370 TC115003 Homosapiensheatshock 22kDaprotein8(HSPB8) NM_014370 TC124131 Homosapiensdeath-associatedproteinkinase2(DAPK2) NM_014370 TC124124 Homosapiensbromodomaincontaining4(BRD4),transcriptvariantshort NM_014365 TC115068 kinase4(Drosophila)(PLK4) Homosapienspolo-like NM_014326 TC115063 Homosapiensrenaltumorantigen(RAGE) NM_014299 TC115043 Homosapiensrenaltumorantigen(RAGE), OriGeneuniquevariant1 NM_014264 TC115101 Homosapiensinsulinreceptor-related receptor(INSRR) NM_014226 TC115082 NM_014226 TC115139 Description NM_014215 TC115138 Accession No. TC107297 No. Cat. 1 kinase(NLK) Homosapiensnemolike Homosapiensinterleukin-1receptor-associated kinase4(IRAK4) 1 NM_016231 NM_016123 14352 14468 1 47 M077 Homo sapiensMAPkinaseinteractingserine/threonine kinase2(MKNK2) NM_017572 1 14079 99 M074 HomosapiensEPHreceptorB2(EPHB2),transcript variant1 NM_017449 09198 0272 NM_016513 Homo sapiens intestinal cell (MAK-like) kinase(ICK),transcriptvariant2 Homosapiensintestinalcell(MAK-like) NM_016513 0272 051 4263 4621 9 NM_0 M064 Homosapiensvacciniarelatedkinase3(VRK3) NM_016440 NM_0 1 1 53Homo sapiensBMP2inducible kinase(BMP2K),transcriptvariant2 7593 571 6 Homo sapiensmisshapen-lik variant 1 (FGFR1), transcriptvariant2 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: e kinase 1(zebrafish) (MINK1),transcriptvariant1 19 CloneSet: Gene-family based collection TrueClone™ 20 CloneSet: Gene-family based collection TrueClone™ C026N_344Homosapiensserine/threoninekinase31 (STK31), transcriptvariant1 Homosapiensserine/threoninekinase33 (STK33) NM_031414 protein kinase2(MAP2K2) Homosapiensmitogen-activated TC107236 Homosapienstribbleshomolog1(Drosophila)(TRIB1) NM_030906 TC1 NM_030662 TC100378 Homosapiensalpha-kinase1(ALPK1),OriGeneuniquevariant NM_025195 TC110003 HomosapiensFAST kinase(FASTK), transcript variant3 TC110324 HomosapiensaarFdomaincontainingkinase4(ADCK4) NM_025144 TC1 HomosapiensNIMA(neverinmitosisgenea)-relatedkinase11 (NEK11) NM_025096 TC111013 Homosapienshypothetical proteinMGC8407(MGC8407) NM_024876 TC102414 NM_024800 TC108116 Homosapiensfibroblastgrowthfactorreceptor1(fms-relatedtyrosinekinase2,Pfeiffer syndrome) NM_024046 TC111981 TC112299 NM_023106 growthfactor Homosapiensfibroblastgrowthfactorreceptor2(bacteria-expressedkinase,keratinocyte TC109228 Homosapienshomeodomaininteractingproteinkinase2(HIPK2) Homosapienscaseinkinase1,gamma 1 (CSNK1G1)” NM_023029 NM_022740 TC109238 NM_022048 TC112477 Homosapienstribbleshomolog3(Drosophila)(TRIB3) TC112854 TC1 NM_021158 TC1 Homosapiens WNK lysinedeficientproteinkinase3(WNK3),transcriptvariant1 TC112991 TC1 kinase4(CLK4) HomosapiensCDC-like NM_020922 TC1 kinase4(CLK4),OriGeneuniquevariant1 HomosapiensCDC-like TC107055 Homosapiensreceptor-interacting serine-threonine kinase4(RIPK4),OriGeneuniquevariant1 NM_020666 TC1 Homosapiensanti-Mullerianhormonereceptor, typeII(AMHR2) NM_020666 TC113042 Homosapienscalcium/calmodulin-dependent proteinkinaseIG(CAMK1G) NM_020639 TC113041 Homosapiensezrin-bindingpartner PACE-1 (PACE-1), transcriptvariant1 NM_020547 TC113100 HomosapiensaarFdomaincontainingkinase1(ADCK1) NM_020439 TC113095 kinase7(PAK7), Homosapiensp21(CDKN1A)-activated transcriptvariant1 NM_020423 TC108424 Homosapienschaperone, (S.pombe)(CABC1) ofbc1complexlike ABC1 activity NM_020421 TC113079 kinase 6(PAK6) Homosapiensp21(CDKN1A)-activated NM_020341 TC108612 Homosapiensglycogensynthasekinase3alpha(GSK3A) NM_020247 TC110589 HomosapiensMAP/microtubuleaffinity-regulating kinase1(MARK1) NM_020168 TC111363 Homosapiensamyotrophic lateralsclerosis2(juvenile)chromosome region,candidate2(ALS2CR2) NM_019884 TC113203 Homosapiens T-LAK NM_018650 cell-originatedproteinkinase(TOPK) TC112599 Homosapiensserine/threonine/tyrosinekinase1(STYK1), OriGeneuniquevariant2 NM_018571 TC113408 Homosapiensserine/threonine/tyrosinekinase1(STYK1) NM_018492 TC113432 Homosapiensserine/threonine/tyrosinekinase1(STYK1), OriGeneuniquevariant1 NM_018423 TC113461 Homosapiensserine/threoninekinase32B(STK32B), OriGeneuniquevariant2 NM_018423 TC113506 Homosapiensserine/threoninekinase32B(STK32B), OriGeneuniquevariant1 NM_018423 TC113505 Homosapiensserine/threoninekinase32B(STK32B) NM_018401 TC113504 HomosapiensRIOkinase2(yeast)(RIOK2) NM_018401 TC113493 HomosapiensSCY1-like 2(S.cerevisiae)(SCYL2) NM_018401 TC113492 Homosapienshypothetical proteinFLJ20574 (FLJ20574) NM_018343 TC113491 NM_017988 TC113560 Description NM_017886 TC113782 Accession No. TC108694 No. Cat. 1 1 1 1 1 1 0931 1 Homosapienstribbleshomolog2(Drosophila)(TRIB2) NM_021643 1247 59N_293Homosapiens AXL receptortyrosinekinase(AXL),transcriptvariant1 NM_021913 2559 2980 2978 3047 024 3 NM_0251 NM_021 NM_021 NM_020680 NM_030952 3 HomosapiensribosomalproteinS6kinase,90kDa,polypeptide2(RPS6KA2), transcriptvariant1 HomosapiensribonucleaseL(2’,5’-oligoisoadenylate synthetase-dependent)(RNASEL) 135 133 4Homosapiensalpha-kinase1(ALPK1) 44 (FGFR1), transcriptvariant4 (FGFR2), transcriptvariant1 receptor, craniofacialdysostosis1,Crouzon syndrome,Pfeiffer syndrome,Jackson-Weiss syndrome) Homo sapiensSCY1 Homo sapiens likely orthologHomo sapienslikely ofratSNF1/AMP-activated proteinkinase(SNARK) -lik e 1 www (S. cerevisiae)(SCYL1) 1 .or ig ene.com TC120776 NM_145259 Homo sapiens activin Homosapiensactivin A receptor, typeIC (ACVR1C), OriGeneuniquevariant2 protein kinase7(MAP2K7) Homosapiensmitogen-activated NM_145259 protein kinase3(MAP2K3),transcriptvariant B Homosapiensmitogen-activated TC120776 Homosapiensserine/threoninekinase32A(STK32A) NM_145185 TC1 NM_145109 TC109633 (FLJ25006) Homosapienshypothetical proteinFLJ25006 NM_145001 TC109628 Homosapiensmegakaryocyte-associatedtyrosinekinase(MATK), transcriptvariant 1 TC100039 Homosapiensamyotrophic lateralsclerosis2(juvenile)chromosome region,candidate 7(ALS2CR7) NM_144610 TC1 Homosapienscaseinkinase1,delta(CSNK1D),transcriptvariant2 NM_139355 TC120750 proteinkinase8(MAPK8),transcriptvariant1 Homosapiensmitogen-activated NM_139158 TC100071 NM_139062 TC120591 NM_139049 TC108197 Homosapiensmyosin IIIB(MYO3B) TC120589 proteinkinase10 Homosapiensmitogen-activated (MAPK10), transcriptvariant2 TC1 proteinkinase10 Homosapiensmitogen-activated (MAPK10), transcriptvariant3 NM_138995 TC1 NM_138982 TC111522 NM_138980 TC109627 TC109626 TC1 TC1 Homosapienssrc-relatedkinaselacking C-terminalregulatorytyrosineandN-terminalmyristylation Homosapiensmyosin, lightpolypeptidekinase(MYLK),transcriptvariant5 TC1 Homosapiensmyosin, lightpolypeptidekinase(MYLK),transcriptvariant1 NM_080823 NM_053030 TC120354 NM_053025 TC109471 Homosapiensserine/threoninekinase22C(spermiogenesisassociated)(STK22C) TC109468 TC1 Homosapiensendoplasmicreticulumtonucleussignalling2(ERN2) NM_052841 TC1 Homosapiensmyosin lightchain muscle(MYLK2) kinase2,skeletal TC120138 NM_033266 TC1 Homosapienstripartite motif-containing33(TRIM33),transcriptvariantbeta NM_033118 TC101381 HomosapiensPCTAIRE proteinkinase1(PCTK1),OriGeneuniquevariant TC101725 HomosapiensPCTAIRE proteinkinase1(PCTK1),transcriptvariant2 NM_033020 TC1 HomosapiensFAST kinase(FASTK), transcriptvariant4 NM_033019 TC124171 (MASTL) Homosapiensmicrotubuleassociatedserine/threonine kinase-like NM_033018 TC101858 Homosapiensserine/threoninekinase19 (STK19), transcriptvariant2 NM_033015 TC109561 kinase1(PINK1) HomosapiensPTENinducedputative NM_032844 TC101836 Homosapienshypothetical proteinFLJ23356(FLJ23356) NM_032454 TC103147 Homosapienshypothetical proteinFLJ23356(FLJ23356) NM_032409 TC124174 NM_032237 TC108012 Homosapiensserine/threoninekinase22D(spermiogenesisassociated)(STK22D) NM_032237 TC124141 HomosapiensSer/Thr-like kinase(MGC4796) TC105614 Homosapiensgermcellassociated2(haspin)(GSG2) NM_032028 T HomosapiensRIOkinase1(yeast)(RIOK1),transcriptvariant NM_032017 TC106635 1(RPS6KL1) HomosapiensribosomalproteinS6kinase-like NM_031965 TC107277 NM_031480 TC111461 HomosapiensMAP/microtubuleaffinity-regulatingkinase 4 NM_031464 TC110673 Description TC107535 NM_031417 Accession No. TC107258 No. Cat. 167 M023 Homosapiensserine/threonineproteinkinaseSSTK (SSTK) NM_032037 C106670 1 1 0 proteinkinase 1(MAPK1),transcriptvariant2 Homosapiensmitogen-activated NM_138957 09616 24170 NM_139014 Homo sapiens mitogen-activated proteinkinase 14 Homosapiensmitogen-activated (MAPK14), transcriptvariant4 NM_139014 20584 24170 HomosapiensNIMA(neverinmitosisgenea)-relatedkinase7(NEK7) NM_133494 20526 20556 20 20 2037 1 1 0 489 529 1 1 1 90 43 86 NM_145259 Homo sapiens activin Homo sapiens activin A receptor, typeIC(ACVR1C), OriGeneuniquevariant1 NM_145259 86 6 NM_0331 M030 Homosapiensserine/threoninekinase22B(spermiogenesis associated) (STK22B) HomosapiensaarFdomaincontainingkinase 2(ADCK2) NM_053006 NM_052853 NM_1 NM_1 NM_033550 NM_1 48 Homosapienshomeodomaininteractingproteinkinase4(HIPK4) 44685 39033 30436 1 HomosapiensNIMA(neverinmitosisgenea)-related kinase9(NEK9) 6 Homo sapiensmitogen-acti variant 2 Homo sapiensdual-specificitytyrosine-(Y)-phosphorylationregulatedkinase1A(DYRK1A), transcript sites (SRMS) Homo sapiens (MARK4) h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: TP53 regulatingkinase(TP53RK) vated proteinkinase7(MAPK7),transcriptvariant1 21 CloneSet: Gene-family based collection TrueClone™ 22 CloneSet: Gene-family based collection TrueClone™ C068U24 Human tyrosinekinasereceptorp145TRK-B (TRK-B) mRNA,completecds U12140 TC107658 kinase7(PAK7), Homosapiensp21(CDKN1A)-activated transcriptvariant2 TC1 Homosapienscaseinkinase2,alpha1polypeptide(CSNK2A1),OriGeneuniquevariant TC1 Homosapienscaseinkinase2,alpha1polypeptide(CSNK2A1),transcriptvariant3 NM_177990 TC1 NM_177560 TC107077 HomosapiensU2AFhomologymotif(UHM)kinase1(UHMK1) NM_177560 TC108395 TC108394 Homosapienshypothetical proteinFLJ40852(FLJ40852),OriGeneuniquevariant1 NM_175866 TC1 Homosapiensserine/threoninekinase32C(STK32C) TC101352 HomosapiensSNF1-like kinase(SNF1LK) NM_173677 TC1 NM_173575 TC101143 Homosapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIgamma (CAMK2G), NM_173354 TC101117 TC101272 Homosapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIgamma (CAMK2G), NM_172171 TC109012 NM_172170 TC100737 Homosapienscalcium/calmodulin-dependent proteinkinase(CaMkinase)IIgamma (CAMK2G), TC1 Homosapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIgamma (CAMK2G),transcript NM_172170 TC100734 NM_172170 TC100733 Homosapienscalcium/calmodulin-dependent proteinkinase(CaMkinase)IIdelta(CAMK2D),transcript TC1 Homosapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIbeta (CAMK2B), transcript NM_172115 TC109009 Homosapienscalcium/calmodulin-dependent proteinkinase(CaMkinase)IIbeta(CAMK2B),transcript NM_172081 TC109006 Homosapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIalpha(CAMK2A),OriGene NM_172078 TC109004 Homosapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIalpha (CAMK2A), NM_171825 Homosapiensserum/glucocorticoid regulatedkinase2(SGK2),OriGeneuniquevariant1 TC109001 Homosapiensserum/glucocorticoid regulatedkinase2(SGK2),transcriptvariant1 NM_171825 HomosapiensPTK2proteintyrosinekinase2(PTK2),transcriptvariant1 NM_170693 TC109000 Homosapienscalcium/calmodulin-dependentproteinkinaseID(CAMK1D),transcript variant2 NM_170693 TC110121 Homosapienshypothetical proteinMGC42105 (MGC42105) NM_153831 TC110120 HomosapiensproteinkinaseLYK5 (LYK5), NM_153498 transcriptvariant3 TC101236 (PDIK1L),OriGeneuniquevariant1 HomosapiensPDLIM1interactingkinase1like NM_153361 TC100851 (PDIK1L) HomosapiensPDLIM1interactingkinase1like NM_153335 TC100346 Homosapienshomeodomaininteractingproteinkinase1(HIPK1),transcriptvariant2 NM_152835 TC100826 Homosapienshypothetical proteinFLJ34389(FLJ34389) NM_152835 TC100784 Homosapiensdoublecortin 2(DCAMKL2) andCaMkinase-like NM_152696 TC100783 Homosapienshypothetical proteinFLJ32685(FLJ32685) NM_152649 TC111874 Homosapienscaseinkinase1,epsilon(CSNK1E),transcriptvariant1 NM_152619 TC108101 proteinkinase4(MAP4K4),transcriptvariant2 Homosapiensmitogen-activated NM_152534 TC100617 proteinkinase7(MAP3K7),transcriptvariantB Homosapiensmitogen-activated NM_152221 TC108071 proteinkinase6(MAP3K6),transcriptvariant2 Homosapiensmitogen-activated NM_145686 TC100654 NM_145331 TC100241 Description NM_145319 TC100191 Accession No. TC110026 No. Cat. 74 M129 Homo sapiensSFRSproteinkinase2(SRPK2), transcriptvariant2 Homo sapiensNIMA(neverinmitosisgene a)- relatedkinase8(NEK8) NM_182691 07542 NM_178170 07239 07143 07027 0 Homosapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIgamma (CAMK2G), NM_172170 00735 08250 1 296 NM_1 NM_1 NM_1 M142 HomosapiensaarFdomaincontainingkinase5(ADCK5) NM_174922 78564 Homo sapienscaseinkinase2,alpha1polypeptide(CSNK2A1),transcriptvariant 77559 721 27 transcript variant1 OriGene uniquevariant3 OriGene uniquevariant1 variant 3 variant 4 variant 5 variant 2 unique variant1 transcript variant2 OriGene uniquevariant2 Homo sapiensnuclearreceptorbindingprotein 2(NRBP2) variant 1 Homo sapienscalcium/calmodulin-dependentproteinkinase(CaMkinase)IIdelta(CAMK2D),transcript www .or ig ene.com C191N_046Homosapiensgonadotropin-releasinghormone receptor(GNRHR) Homosapienscalcium-sensingreceptor (hypocalciuric hypercalcemia 1,severeneonatal NM_000406 TC1 Homosapiensthyroid stimulatinghormone receptor(TSHR) TC119911 Homosapiensparathyroid hormonereceptor1(PTHR1) NM_000388 Homosapiensgastric inhibitorypolypeptidereceptor(GIPR) NM_000369 TC119946 NM_000316 TC119936 Homosapiensfolliclestimulatinghormonereceptor(FSHR),transcriptvariant1 NM_000164 TC119966 HomosapiensendothelinreceptortypeB(EDNRB),transcriptvariant1 TC110906 NM_000145 TC1 Homosapiensadrenergic,beta-3-,receptor(ADRB3) NM_000115 TC109246 TC111113 NM_000025 TC1 TC117219 Database:coreGene:ENSG00000181109 Clone:AC109341 Contig:AC109341.7.1.202761 HomosapiensGprotein-coupledreceptor (GPR103) mRNA,completecds TC1 Chr:11 ENST00000317625 TC107900 Description AF411117 TC1 Accession No. TC105790 No. Cat. HomosapiensNIMA(neverinmitosisgenea)-relatedkinase1(NEK1) Homosapiensserine/threonineproteinkinase TAO1 homolog(KIAA1361) XM_291107 TC1 Homosapiensapoptosis-associatedtyrosinekinase(AATK) TC107093 XM_290796 TC1 XM_290778 TC107123 HomosapienssimilartoMAP/ERKkinase5;apoptosissignalregulating[Homosapiens] TC107122 TC1 PREDICTED:HomosapiensEphA6(EPHA6) XM_210040 Homosapienshypothetical geneLOC130382 (LOC130382) mRNA TC107128 XM_114973 TC1 XM_065695 TC107090 HomosapiensDKFZP434C131 protein(DKFZP434C131) TC107663 proteinkinase1(MAP3K1) PREDICTED:Homosapiensmitogen-activated TC1 HomosapiensKIAA0781protein(KIAA0781) XM_044630 T Homosapienssimilartomyosin lightchain kinase(MLCK)(LOC91807) XM_042066 TC105253 PREDICTED:Homosapienshypothetical proteinBC007901 (LOC91461) XM_041314 TC116731 PREDICTED:Homosapiensmicrotubuleassociatedserine/threoninekinase3(MAST3) XM_040819 TC116431 lightpolypeptidegeneenhancerinB-cells,kinasebeta(IKBKB) Homosapiensinhibitorofkappa XM_038576 TC107120 XM_038150 TC107086 lightpolypeptidegeneenhancerinB-cells,kinase beta(IKBKB), Homosapiensinhibitorofkappa XM_032491 TC104537 TC120031 lightpolypeptidegeneenhancerinB-cells,kinase beta(IKBKB), Homosapiensinhibitorofkappa XM_032491 Homosapienssyntrophinassociatedserine/threoninekinase(SAST) TC120053 proteinkinase9(MAP3K9) Homosapiensmitogen-activated XM_032491 XM_032034 TC120042 Description XM_027237 TC103895 Accession No. TC107115 No. Cat. GPCR CloneSet 139 M075 PREDICTED: HomosapiensKIAA1765 protein(KIAA1765) XM_047355 C113998 52 M005 Homo sapiens argininevasopressinreceptor 2(nephrogenicdiabetesinsipidus)(AVPR2) Homosapiensadrenergic,beta-2-,receptor, surface(ADRB2) NM_000054 15220 NM_000024 16997 91 M002 Homo sapiens5-hydroxytryptamine (serotonin) receptor1A(HTR1A) NM_000524 19816 06281 07099 07082 071 proteinkinase3(MAPK3) Homosapiensmitogen-activated 071 XM_055766 05033 20 082 8X_086Homosapienssimilartop21-activated proteinkinaseI(LOC283806) XM_208846 18 21 NM_0 XM_21 BC0 XM_291 XM_290898 64 Homosapiens,Similartoolfactoryreceptor, family2,subfamily A, member4,cloneIMAGE:4424116 16940 0 1 0 3 304 6 Homosapiensglucagonreceptor(GCGR) 160 25 hyperparathyroidism) (CASR) Basepair:5712017 Status:pseudogene (LOC286417) OriGene uniquevariant2 OriGene uniquevariant1 Homo sapienshypothetical proteinMGC43306(MGC43306) Homo sapiensKIAA0472protein(KIAA0472) Homo sapiensL h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: OC284084 (LOC284084) 23 CloneSet: Gene-family based collection TrueClone™ 24 CloneSet: Gene-family based collection TrueClone™ C053N_086Homosapiens5-hydroxytryptamine (serotonin) receptor1F(HTR1F) Homosapiens5-hydroxytryptamine (serotonin) receptor1E(HTR1E) Homosapiens5-hydroxytryptamine (serotonin) receptor1D(HTR1D) NM_000866 NM_000865 TC108583 HomosapienshistaminereceptorH1(HRH1) NM_000864 TC119614 Homosapiensglutamatereceptor, metabotropic8(GRM8) TC119613 Homosapiensglutamatereceptor, metabotropic 7(GRM7),transcriptvariant1 NM_000861 TC1 Homosapiensglutamatereceptor, metabotropic 5(GRM5) NM_000845 TC119662 NM_000844 TC110911 Homosapiensglutamatereceptor, metabotropic 3(GRM3) NM_000842 TC119649 TC119648 Homosapiensglutamatereceptor, metabotropic1(GRM1) NM_000840 TC1 Homosapiensgrowthhormonereleasingreceptor(GHRHR) TC119645 HomosapiensdopaminereceptorD5(DRD5) NM_000838 TC1 NM_000823 TC119643 HomosapiensdopaminereceptorD4(DRD4),OriGeneuniquevariant1 NM_000798 TC119635 HomosapiensdopaminereceptorD2(DRD2),transcriptvariant1 TC119696 HomosapiensdopaminereceptorD1(DRD1) NM_000797 TC1 NM_000795 TC124065 NM_000794 TC119693 Homosapienscholinergic receptor, muscarinic2(CHRM2),transcriptvariant4 TC119692 TC1 NM_000739 TC1 HomosapiensbradykininreceptorB1(BDKRB1) TC110855 TC1 Homosapiensargininevasopressinreceptor1A(AVPR1A) NM_000710 TC1 HomosapiensangiotensinIIreceptor, type2(AGTR2) TC119719 HomosapiensangiotensinIIreceptor, type1(AGTR1), transcriptvariant1 NM_000706 TC1 Homosapiensadrenergic,beta-1-, receptor(ADRB1),OriGeneuniquevariant1 NM_000686 TC110836 Homosapiensadrenergic,alpha-2C-,receptor (ADRA2C) NM_000685 TC119766 Homosapiensadrenergic,alpha-2C-,receptor (ADRA2C),OriGeneuniquevariant1 NM_000684 TC108918 Homosapiensadrenergic,alpha-2B-,receptor(ADRA2B) NM_000683 TC119765 Homosapiensadrenergic,alpha-2B-,receptor (ADRA2B) NM_000683 TC124091 Homosapiensadrenergic,alpha-2A-,receptor(ADRA2A) NM_000682 TC124067 Homosapiensadrenergic,alpha-1A-,receptor(ADRA1A),transcriptvariant1 NM_000682 TC107904 Homosapiensadrenergic,alpha-1B-,receptor(ADRA1B) NM_000681 TC124044 Homosapiensadrenergic,alpha-1D-,receptor(ADRA1D) NM_000680 TC119761 Homosapiensadenosine A3 receptor(ADORA3) NM_000679 TC108910 Homosapiensadenosine A2b receptor(ADORA2B) NM_000678 TC110821 Homosapiensadenosine A2a receptor(ADORA2A) NM_000677 TC119760 Homosapiensadenosine A1 receptor(ADORA1) NM_000676 TC119759 Homosapienschemokine (C-Cmotif)receptor2(CCR2),transcriptvariantB NM_000675 TC119758 Homosapienschemokine (C-Cmotif)receptor2(CCR2),transcriptvariant A NM_000674 TC119757 Homosapiensinterleukin8receptor, alpha(IL8RA) NM_000648 TC119756 HomosapiensbradykininreceptorB2(BDKRB2) NM_000647 TC109082 Homosapiens5-hydroxytryptamine (serotonin)receptor2A(HTR2A) NM_000634 TC109079 Homosapienschemokine (C-Cmotif)receptor5(CCR5) NM_000623 TC119771 Homosapiensmelanocortin 2receptor(adrenocorticotropic hormone)(MC2R) NM_000621 TC119794 NM_000579 TC119793 Description NM_000529 TC110858 Accession No. TC119819 No. Cat. 94 M004 Homosapiensglutamatereceptor, metabotropic4(GRM4) NM_000841 19647 1 1 1 1 1 1 241 22572 64N_089Homosapiensglutamatereceptor, metabotropic2(GRM2) NM_000839 9644 Homosapienscholinergic receptor, muscarinic4(CHRM4) Homosapienscholinergic receptor, muscarinic3(CHRM3) NM_000741 NM_000740 9737 9736 9735 971 961 5N_077HomosapiensdopaminereceptorD4(DRD4) NM_000797 55 2 7 NM_0 NM_0 NM_0 NM_0 0 Homosapienscholinergic receptor, muscarinic1(CHRM1) 00738 0 0 83Homo sapiens5-hydroxytryptamine (serotonin) receptor1B(HTR1B) 0863 HomosapiensbradykininreceptorB1(BDKRB1) 0710 0707 Homo sapiensargininevasopressinreceptor1B(A www .or ig ene.com VPR1B) C104N_072Homosapienscalcitoninreceptor(CALCR) Homosapienscomplementcomponent 5 receptor1(C5aligand) (C5R1) NM_001742 NM_001736 TC119074 Homosapiensinterleukin8receptor, beta(IL8RB) TC119072 TC1 Homosapienshypocretin (orexin)receptor 1(HCRTR1) NM_001557 TC1 HomosapiensGprotein-coupledreceptor39(GPR39) TC119177 HomosapiensGprotein-coupledreceptor32(GPR32) NM_001525 TC1 NM_001508 TC119185 Homosapienschemokine (C-X-Cmotif) receptor 3(CXCR3) NM_001506 TC119213 Homosapiensgamma-aminobutyric acid (GABA)Breceptor, 1(GABBR1),transcriptvariant TC119212 Homosapiensfrizzledhomolog2(Drosophila)(FZD2) NM_001504 TC1 NM_001470 TC119210 NM_001466 TC109253 Homosapiensendothelialdifferentiation, lysophosphatidicacidG-protein-coupledreceptor, 2(EDG2), TC119233 TC1 Homosapienschemokine (C-X3-Cmotif)receptor1(CX3CR1) NM_001401 TC119263 Homosapienschemokine (C-Cmotif)receptor1(CCR1) NM_001337 TC1 polypeptide1(pituitary)receptortypeI(ADCYAP1R1) Homosapiensadenylate cyclaseactivating TC119314 Homosapiensthromboxane A2 receptor(TBXA2R),transcriptvariant2 NM_001295 TC1 Homosapienstachykinin receptor1(TACR1), transcriptvariantlong NM_001118 TC119287 Homosapienstachykinin receptor2(TACR2) NM_001060 TC119444 NM_001058 TC111034 NM_001057 TC119455 Homosapienssomatostatinreceptor3(SSTR3) TC119454 TC1 Homosapienssomatostatinreceptor1(SSTR1) NM_001051 TC1 HomosapiensprostaglandinI2(prostacyclin)receptor(IP)(PTGIR) TC119447 NM_001049 TC1 HomosapiensprostaglandinEreceptor4(subtypeEP4)(PTGER4) NM_000960 TC119481 HomosapiensprostaglandinEreceptor 3 (subtypeEP3)(PTGER3),OriGeneuniquevariant1 TC119563 HomosapiensprostaglandinEreceptor 2 (subtypeEP2),53kDa(PTGER2) NM_000958 TC1 HomosapiensprostaglandinEreceptor 1 (subtypeEP1),42kDa(PTGER1) NM_000957 TC119561 HomosapiensprostaglandinD2receptor (DP)(PTGDR) NM_000956 TC111682 factorreceptor(PTAFR) Homosapiensplatelet-activating NM_000955 TC119560 Homosapiensoxytocin receptor(OXTR) NM_000953 TC119559 Homosapiensopioidreceptor, mu1(OPRM1),transcriptvariantMOR-1 NM_000952 TC101345 Homosapiensopiatereceptor-like 1(OPRL1),transcriptvariant2 NM_000916 TC119557 NM_000914 TC119610 Homosapiensneuropeptide Y receptor NM_000913 Y2 (NPY2R) TC119609 Homosapiensneuropeptide Y receptor Y1 (NPY1R) TC109521 NM_000910 T Homosapiens5-hydroxytryptamine (serotonin)receptor7(adenylate cyclase-coupled)(HTR7), NM_000909 TC119605 Homosapiens5-hydroxytryptamine (serotonin)receptor6(HTR6) TC119604 Homosapiens5-hydroxytryptamine (serotonin)receptor4(HTR4),transcriptvariantb NM_000872 Homosapiens5-hydroxytryptamine (serotonin)receptor2C(HTR2C) NM_000871 TC119618 NM_000870 TC119617 Description NM_000868 TC119616 Accession No. TC119615 No. Cat. 190 M001 Homosapiensopioidreceptor, 1(OPRK1) kappa NM_000912 C119606 98 M012 Homo sapienshypocretin (orexin)receptor2 (HCRTR2) NM_001526 19187 1 1 1 1 1 1 1 1 99 M010 Homo sapiensbrain-specificangiogenesisinhibitor 3(BAI3) NM_001704 1 19090 21N_055HomosapiensGprotein-coupledreceptor30(GPR30) NM_001505 9211 9229 9262 9288 9450 9449 9446 9562 9065 NM_0 Homosapiensformyl peptidereceptor-like transcriptvariant1 1(FPRL1), NM_001462 NM_0 NM_0 NM_0 NM_0 NM_0 NM_0 0 Homosapiensendothelialdifferentiation, sphingolipidG-protein-coupledreceptor, 1(EDG1) 01400 0 Homosapienssomatostatinreceptor5(SSTR5) Homosapienssomatostatinreceptor4(SSTR4) 01053 01052 0 0 1 1 Homosapienssomatostatinreceptor2(SSTR2) 1050 0959 727 Homo sapiens bombesin-like receptor3(BRS3) Homosapiens bombesin-like 727 296 Homo sapiensc transcript variant1 Homo sapiensprostaglandinFreceptor(FP)(PTGFR) transcript varianta h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: hemokine bindingprotein2(CCBP2) 25 CloneSet: Gene-family based collection TrueClone™ 26 CloneSet: Gene-family based collection TrueClone™ TC124135 NM_004624 Homo sapiens vasoactive intestinalpeptide receptor1(VIPR1) Homosapiensvasoactive intestinalpeptide receptor1(VIPR1),OriGeneuniquevariant 1 Homosapiensvasoactive Homosapienscorticotropin releasinghormone receptor1(CRHR1) NM_004624 NM_004624 TC124135 peptide2receptor (GLP2R) Homosapiensglucagon-like NM_004382 TC117230 Homosapiensendothelialdifferentiation, sphingolipidG-protein-coupledreceptor, 5(EDG5) TC110860 HomosapiensGprotein-coupledreceptor50(GPR50) NM_004246 TC1 HomosapienspyrimidinergicreceptorP2Y, G-proteincoupled,6(P2RY6), transcript variant4 NM_004230 TC111108 NM_004224 TC117485 HomosapienscoagulationfactorII(thrombin)receptor-like 2(F2RL2) NM_004154 TC117532 TC109533 Homosapienscomplementcomponent3areceptor1(C3AR1) NM_004101 TC1 HomosapiensGprotein-coupledreceptor, familyC,group5,member A (GPCR5A) TC117592 neurotransmitter Homosapiensputative receptor(PNR) NM_004054 TC1 NM_003979 TC117601 HomosapienscoagulationfactorII(thrombin)receptor-like 3(F2RL3) NM_003967 TC117639 Homosapienschromosome 17 openreadingframe35(C17orf35) TC117662 Homosapiensendothelialdifferentiation, G-protein-coupledreceptor6(EDG6) NM_003950 TC1 NM_003876 TC117654 NM_003775 TC117689 HomosapiensGprotein-coupledreceptor65(GPR65) TC117757 TC1 NM_003608 TC1 Homosapiensfrizzledhomolog1(Drosophila) (FZD1) TC117880 TC1 Homosapiensfrizzledhomolog5(Drosophila)(FZD5) NM_003505 TC1 Homosapienschemokine (C-X-Cmotif)receptor4(CXCR4),transcriptvariant2 TC117910 intestinalpeptidereceptor2(VIPR2) Homosapiensvasoactive NM_003468 TC1 Homosapiensthyrotropin-releasing hormonereceptor(TRHR) NM_003467 TC117952 HomosapiensretinalGproteincoupled receptor (RGR),OriGeneuniquevariant1 NM_003382 TC117951 HomosapienspyrimidinergicreceptorP2Y, G-proteincoupled,4(P2RY4) NM_003301 TC117992 HomosapienspurinergicreceptorP2Y, G-proteincoupled,1(P2RY1) NM_002921 TC118062 Homosapiensneurotensinreceptor1(highaffinity) (NTSR1) NM_002565 TC118351 HomosapiensneuromedinBreceptor(NMBR) NM_002563 TC118600 Homosapiensmelanocortin 1receptor(alphamelanocytestimulatinghormonereceptor)(MC1R) NM_002531 TC118599 HomosapiensMAS1 oncogene(MAS1) NM_002511 TC110963 peptide1receptor(GLP1R) Homosapiensglucagon-like NM_002386 TC118568 peptide1receptor(GLP1R) Homosapiensglucagon-like NM_002377 TC118656 HomosapiensDuffy bloodgroup(FY) NM_002062 TC118704 Homosapiensformyl peptidereceptor-like 2(FPRL2) NM_002062 TC124060 Homosapiensformyl peptidereceptor1(FPR1) NM_002036 TC118878 HomosapienscoagulationfactorII(thrombin)receptor(F2R) NM_002030 TC110900 Homosapiensendothelinreceptortype A (EDNRA) NM_002029 TC118858 Homosapienscannabinoidreceptor2(macrophage)(CNR2) NM_001992 TC118857 Homosapienschemokine (C-Cmotif)receptor7(CCR7) NM_001957 TC118924 Homosapienschemokine (C-Cmotif)receptor3(CCR3),transcriptvariant1 NM_001841 TC118901 HomosapiensCD97antigen(CD97),transcriptvariant2 NM_001838 TC118984 HomosapiensCD97antigen(CD97),OriGeneuniquevariant1 NM_001837 TC118981 NM_001784 TC118980 Description NM_001784 TC109040 Accession No. TC109039 No. Cat. 73 M042 Homo sapiensgrowthhormonesecretagoguereceptor(GHSR),transcriptvariant1b NM_004122 17536 1 1 1 1 1 1 1 1 55N_002Homosapienschemokine-like receptor1(CMKLR1) NM_004072 7575 Homosapienschemokine (C-Cmotif)receptor-like 2(CCRL2) NM_003965 7661 Homosapiensleucine-rich repeat-containingGprotein-coupledreceptor5(LGR5) Homosapiensgalanin receptor3(GALR3) NM_003667 NM_003614 7852 7889 791 791 7963 7 497 1 2 NM_0 M030 Homosapiensfrizzledhomolog9(Drosophila) (FZD9) NM_003508 M030 Homosapiensfrizzledhomolog6(Drosophila) (FZD6) NM_003506 NM_0 04248 03485 Homo sapiensGprotein-coupledreceptor 10 (GPR10) Homo sapiensGprotein-coupledreceptor68(GPR68) www .or ig ene.com C143N_092Homosapienspancreaticpolypeptidereceptor 1(PPYR1) Homosapiensmelatoninreceptor1A(MTNR1A) Homosapiensmelanocortin 5receptor(MC5R) NM_005972 NM_005958 TC116403 Homosapiensopioidreceptor, sigma1(OPRS1), transcriptvariant1 NM_005913 TC116399 Homosapienscalcitoninreceptor-like (CALCRL) TC116446 HomosapienspurinergicreceptorP2Y, G-protein coupled,5(P2RY5) NM_005866 TC1 HomosapiensGprotein-coupledreceptor64(GPR64) NM_005795 TC111748 NM_005767 TC116534 HomosapiensGprotein-coupledreceptor55(GPR55) NM_005756 TC116518 TC108549 Homosapienschemokine (C-Cmotif)receptor4(CCR4) NM_005683 TC1 HomosapiensGprotein-coupledreceptor51(GPR51) TC116557 Homosapiensgastrin-releasing peptidereceptor(GRPR) NM_005508 TC1 NM_005458 TC116695 HomosapiensGprotein-coupledreceptor42(GPR42) NM_005314 TC116745 HomosapiensGprotein-coupledreceptor41(GPR41) TC116819 HomosapiensGprotein-coupledreceptor40(GPR40),OriGeneuniquevariant1 NM_005305 TC1 NM_005304 TC116812 NM_005303 TC116810 HomosapiensGprotein-coupledreceptor34(GPR34) TC108542 TC1 NM_005300 TC1 HomosapiensGprotein-coupledreceptor24(GPR24) TC116807 TC1 HomosapiensGprotein-coupledreceptor 22(GPR22) NM_005297 TC1 HomosapiensGprotein-coupledreceptor21(GPR21) TC116803 HomosapiensGprotein-coupledreceptor20(GPR20) NM_005295 TC1 HomosapiensGprotein-coupledreceptor18 (GPR18) NM_005294 TC116801 HomosapiensGprotein-coupledreceptor 17 (GPR17) NM_005293 TC110909 HomosapiensGprotein-coupledreceptor 15 (GPR15) NM_005292 TC116800 HomosapiensGprotein-coupledreceptor12 (GPR12) NM_005291 TC102869 HomosapiensGprotein-coupledreceptor 8(GPR8) NM_005290 TC116799 HomosapiensGprotein-coupledreceptor7(GPR7) NM_005288 TC116846 HomosapiensGprotein-coupledreceptor6(GPR6) NM_005286 TC116845 Homosapienschemokine (Cmotif)receptor1(XCR1) NM_005285 TC116844 HomosapiensGprotein-coupledreceptor4(GPR4) NM_005284 TC116841 HomosapiensGprotein-coupledreceptor3(GPR3) NM_005283 TC116840 HomosapiensGprotein-coupledreceptor1(GPR1) NM_005282 TC116839 HomosapienscoagulationfactorII(thrombin)receptor-like 1(F2RL1) NM_005281 TC116837 Homosapiensendothelialdifferentiation, sphingolipidG-protein-coupledreceptor, 3(EDG3) NM_005279 TC116836 Homosapienschemokine (C-Cmotif)receptor8(CCR8) NM_005242 TC116835 HomosapiensangiotensinIIreceptor-like 1(AGTRL1) NM_005226 TC116867 Homosapiensparathyroid hormonereceptor2(PTHR2) NM_005201 TC116857 HomosapiensEpstein-Barr virusinducedgene2(lymphocyte-specificGprotein-coupled receptor)(EBI2) NM_005161 TC116904 HomosapiensGprotein-coupledreceptor44(GPR44) NM_005048 TC116918 1(GPR37L1) HomosapiensG-proteincoupledreceptor37like NM_004951 TC116961 Homosapiensendothelialdifferentiation, lysophosphatidicacidG-protein-coupled receptor, 4(EDG4) NM_004778 TC117047 NM_004767 TC117171 Description NM_004720 TC117166 Accession No. TC117226 No. Cat. 65 M058 HomosapiensGprotein-coupledreceptor52(GPR52) NM_005684 16558 1 1 1 1 1 1 1 1 56N_062HomosapiensGprotein-coupledreceptor56(GPR56),transcriptvariant1 NM_005682 6556 HomosapiensGprotein-coupledreceptor43(GPR43) NM_005306 6813 (GPR37) HomosapiensGprotein-coupledreceptor37(endothelintypeB-like) HomosapiensGprotein-coupledreceptor35(GPR35) NM_005302 NM_005301 2677 6808 6805 6804 6802 6445 NM_0 NM_0 NM_0 NM_0 0591 59 HomosapiensGprotein-coupledreceptor31(GPR31) HomosapiensGprotein-coupledreceptor25(GPR25) 05299 05298 05296 2 Homo sapiensmelanocortin 4receptor(MC4R) Homo sapiensGprotein-coupledreceptor23(GPR23) h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 27 CloneSet: Gene-family based collection TrueClone™ 28 CloneSet: Gene-family based collection TrueClone™ C123N_189HomosapiensleukotrieneB4receptor2 (LTB4R2) HomosapiensGprotein-coupledreceptor 27(GPR27) HomosapiensGprotein-coupledreceptor 85(GPR85) NM_019839 NM_018971 TC113233 Homosapiensurotensin2receptor(UTS2R) NM_018970 TC113278 HomosapiensGprotein-coupledreceptor, familyC,group5,memberD(GPRC5D) TC113277 Homosapiensleucine-rich repeat-containing Gprotein-coupledreceptor4(LGR4) NM_018949 TC1 HomosapiensGprotein-coupledreceptor77(GPR77) NM_018654 TC113346 NM_018490 TC113412 Homosapiensfrizzledhomolog3(Drosophila)(FZD3) NM_018485 TC111332 TC113456 Homosapiensrelaxin3receptor1(RLN3R1) NM_017412 TC1 Homosapienschemokine (C-Cmotif)receptor-like 1(CCRL1),transcriptvariant2 TC107940 HomosapiensGprotein-coupledreceptor83(GPR83) NM_016568 TC1 NM_016557 TC114218 HomosapiensGprotein-coupledreceptor, familyC,group5,memberB(GPRC5B) NM_016540 TC111283 Homosapienscannabinoidreceptor1(brain)(CNR1),transcriptvariant TC114203 Homosapienslatrophilin3(LPHN3) NM_016235 TC1 NM_016083 TC114355 NM_015236 TC111611 HomosapienspurinergicreceptorP2Y, G-proteincoupled,10 (P2RY10), transcriptvariant1 TC108169 TC1 NM_014499 TC1 Homosapiensopsin3(encephalopsin,panopsin)(OPN3) TC110395 TC1 HomosapiensGprotein-coupledreceptor132 (GPR132) NM_014322 TC1 HomosapiensGprotein-coupledreceptor 171 (GPR171) TC115039 Homosapiensolfactoryreceptor, family2,subfamilyC,member1(OR2C1) NM_013345 TC1 Homosapiensolfactoryreceptor, family1,subfamilyF, member1(OR1F1) NM_013308 TC115294 Homosapiensneurotensinreceptor2(NTSR2) NM_012368 TC115273 Homosapienslatrophilin2(LPHN2) NM_012360 TC115401 Homosapiensfrizzledhomolog4(Drosophila)(FZD4) NM_012344 TC115400 Homosapiensendothelialdifferentiation, lysophosphatidicacidG-protein-coupledreceptor, 7(EDG7) NM_012302 TC115397 Homosapienscholinergic receptor, muscarinic5(CHRM5) NM_012193 TC115441 HomosapiensangiotensinIIreceptor, type1(AGTR1), transcriptvariant2 NM_012152 TC115479 HomosapiensGprotein-coupledreceptor161 (GPR161) NM_012125 TC115507 Homosapiensadrenomedullinreceptor(ADMR) NM_009585 TC115522 HomosapiensGprotein-coupledreceptor45(GPR45) NM_007369 TC115571 Gproteincoupledreceptor(GPR) Homosapiensputative NM_007264 TC108456 Homosapiensfrizzledhomolog10 (Drosophila)(FZD10) NM_007227 TC115624 HomosapiensGprotein-coupledreceptor75(GPR75) NM_007223 TC115646 Homosapienscysteinyl leukotrienereceptor1(CYSLTR1) NM_007197 TC115645 Homosapienschemokine (C-X-Cmotif)receptor6(CXCR6) NM_006794 TC115678 Homosapiensneuropeptide Y receptor NM_006639 Y5 (NPY5R) TC115852 HomosapiensGprotein-coupledreceptor19 (GPR19) NM_006564 TC115965 Homosapienstubulin,beta3(TUBB3) NM_006174 TC116043 HomosapiensneuromedinUreceptor1(NMUR1) NM_006143 TC116290 HomosapiensGprotein-coupledreceptor109B (GPR109B) NM_006086 TC116271 NM_006056 TC116313 Description NM_006018 TC116382 Accession No. TC116358 No. Cat. 33 M078 Homo sapiensGprotein-coupledreceptor172B (GPR172B) NM_017986 13833 1 1 1 1 1 1 1 1 13N_162Homosapienschemokine (C-Cmotif)receptor10 (CCR10) NM_016602 4153 HomosapiensGprotein-coupledreceptor89(GPR89) NM_016334 4323 HomosapienspurinergicreceptorP2Y, G-protein coupled,14 (P2RY14) HomosapiensGprotein-coupledreceptor58(GPR58) NM_014879 NM_014626 4730 4958 50 2625 5222 3275 1 M043 Homosapienscelldeath-inducingDFFA-like effector b(CIDEB) NM_014430 8 NM_0 NM_0 NM_0 1 47 HomosapiensGprotein-coupledreceptor160 (GPR160) 14373 1 8969 3447 Homo sapiensG-proteincoupledreceptor 173 (GPR173) Homo sapiensegf-lik e module containing,mucin-lik www .or ig ene.com e, hormonereceptor-like 2(EMR2),transcriptvariant1 C232N_888Homosapiensoxoglutarate receptor1(OXGR1) (alpha-ketoglutarate) HomosapiensGprotein-coupledreceptor 82(GPR82) NM_080818 NM_080817 TC120362 Homosapiensendothelialdifferentiation, lysophosphatidicacidG-protein-coupled receptor, 2(EDG2), TC120361 HomosapiensGprotein-coupledreceptorMRGX4(MRGX4) TC1 NM_057159 HomosapiensGprotein-coupledreceptorMRGX2(MRGX2) NM_054032 TC109187 HomosapiensGprotein-coupledreceptor101 (GPR101) TC120224 Homosapienstraceaminereceptor5(TRAR5) NM_054030 TC1 NM_054021 TC120221 Homosapienssuccinatereceptor1(SUCNR1) NM_053278 TC120214 Homosapienssuccinatereceptor1(SUCNR1) TC120211 HomosapiensGprotein-coupledreceptor128 (GPR128) NM_033050 TC1 Homosapiensseventransmembranedomainprotein(NIFIE14) NM_033050 TC123076 HomosapiensGprotein-coupledreceptor81(GPR81) NM_032787 TC108023 NM_032635 TC103581 HomosapiensGprotein-coupledreceptor54(GPR54) NM_032554 TC104225 TC104525 HomosapiensGprotein-coupledreceptor61(GPR61) NM_032551 TC1 Homosapienschemokine (C-Cmotif)receptor6(CCR6),transcriptvariant2 TC104503 Homosapienschemokine (C-Cmotif)receptor9(CCR9),transcriptvariant A NM_031936 TC1 HomosapiensGprotein-coupledreceptor63(GPR63) NM_031409 TC106692 Homosapiensolfactoryreceptor, family51,subfamilyE,member2(OR51E2) NM_031200 TC107635 NM_030784 TC107947 NM_030774 TC109480 Homosapiens5-hydroxytryptamine (serotonin)receptor5A(HTR5A) TC109424 TC1 HomosapienspurinergicreceptorP2Y, G-proteincoupled,13 (P2RY13), transcriptvariant1 NM_024012 TC1 HomosapienspurinergicreceptorP2Y, G-proteincoupled,12 (P2RY12), transcript variant1 TC112321 NM_023914 TC1 HomosapiensEGF, latrophilinandseventransmembranedomaincontaining1(ELTD1) NM_022788 TC112338 HomosapiensG-proteincoupledreceptor88(GPR88) TC110612 HomosapiensGprotein-coupledreceptor, familyC,group5,memberC(GPRC5C),transcriptvariant1 NM_022159 TC1 Homosapiensgamma-aminobutyric acid(GABA)Breceptor, 1(GABBR1),transcriptvariant3 NM_022049 TC112783 Homosapiensgamma-aminobutyric acid(GABA)Breceptor, 1(GABBR1),transcriptvariant2 NM_022036 TC107967 Homosapiensleucine-rich repeat-containingGprotein-coupledreceptor7(LGR7) NM_021904 TC110534 HomosapienshistaminereceptorH4(HRH4) NM_021903 TC112876 Homosapiensvomeronasal 1receptor(VN1R1) NM_021634 TC109254 HomosapiensGprotein-coupledreceptor126 (GPR126) NM_021624 TC112908 NM_020633 TC112901 Homosapienscysteinyl leukotrienereceptor2(CYSLTR2) NM_020455 TC113097 HomosapiensGprotein-coupledreceptor84(GPR84) TC101276 HomosapiensneuromedinUreceptor2(NMUR2) NM_020377 T Homosapiensmelanocortin 3receptor(MC3R) NM_020370 TC113111 NM_020167 TC108695 Homosapiens5-hydroxytryptamine (serotonin)receptor7(adenylate cyclase-coupled)(HTR7), NM_019888 TC113202 Homosapiensgenerich cluster, A gene(GRCA),OriGeneuniquevariant1-2 TC113222 NM_019860 Description NM_019858 TC109327 Accession No. TC110388 No. Cat. 132 M000 HomosapiensGprotein-coupledreceptor92(GPR92) NM_020400 C113123 1 0451 04391 08034 08833 08305 20223 24092 20259 2521 4 NM_054031 NM_033663 NM_032553 NM_032503 NM_0307 NM_024531 NM_02391 NM_022304 NM_078481 60 5 transcript variant2 Homo sapiensGprotein-coupledreceptorMRGX3(MRGX3) Homo sapiensdopaminereceptorD3(DRD3),transcriptvariante Homo sapiensendothelialdifferentiation, sphingolipidG-protein-coupledreceptor, 8(EDG8) transcript variantb Homo sapiensGprotein-coupledreceptor174 (GPR174) Homo sapiensGprotein-coupledreceptor1 Homo sapiensGprotein-coupledreceptor1 Homo sapiensGprotein-coupledreceptor87(GPR87) Homo sapienshistaminereceptorH2(HRH2) Homo sapiensCD97antigen(CD97),transcript variant1 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 45 (GPR1 72A (GPR172A) 45) 29 CloneSet: Gene-family based collection TrueClone™ 30 CloneSet: Gene-family based collection TrueClone™ TC107789 XM_352045 Homo sapiens similar to putative G-protein coupledreceptor(LOC376035) Homosapienssimilartoputative Homosapienssimilartoseventransmembranehelixreceptor(LOC375963) HomosapienssimilartoOlfactoryreceptor 2A1(LOC346528) XM_352045 PREDICTED:HomosapiensGprotein-coupled receptor149 (GPR149) XM_352008 TC107789 XM_294318 TC107899 HomosapienssimilartoOlfactoryreceptor52L1(LOC338751) XM_293580 TC107098 TC107092 HomosapiensGprotein-coupledreceptor 153 (GPR153) XM_291977 TC1 PREDICTED:HomosapiensGprotein-coupledreceptor125 (GPR125) TC107109 Homosapienssimilartoseventransmembranehelixreceptor(LOC283193), OriGene uniquevariant1 XM_291419 TC1 XM_291111 TC107084 G-proteincoupledreceptor(LOC159948) Homosapienssimilartoputative XM_210196 TC107094 HomosapienssimilartoOlfactoryreceptor 52I2(LOC143502) TC107107 Homosapienssimilartoseventransmembrane helixreceptor(LOC143497) XM_089955 TC1 XM_089863 TC107788 XM_084536 TC107106 HomosapienssimilartoOlfactoryreceptor2D3(LOC120775) TC107105 TC1 XM_062285 TC1 Homosapienssimilartoseventransmembranehelixreceptor(LOC128373) TC107104 TC1 HomosapienspurinergicreceptorP2YG-proteincoupled11 (P2RY11) mRNA XM_060958 TC1 HomosapiensleukotrieneB4receptor(LTB4R) TC107081 HomosapienspurinergicreceptorP2Y, G-proteincoupled,8(P2RY8) XM_049496 TC1 Homosapienscholecystokinin Breceptor(CCKBR) NM_181657 TC107787 HomosapienspurinergicreceptorP2Y, G-proteincoupled,2(P2RY2), transcriptvariant1 NM_178129 TC107310 Homosapienstraceaminereceptor4(TRAR4) NM_176875 TC107139 Homosapienstraceaminereceptor3(TRAR3) NM_176072 TC106974 HomosapiensGprotein-coupledreceptor 97(GPR97),OriGeneuniquevariant1 NM_175067 TC109532 HomosapiensGprotein-coupledreceptor 97(GPR97) NM_175057 TC101263 HomosapiensGprotein-coupledreceptor114 (GPR114) NM_170776 TC101264 HomosapiensGprotein-coupledreceptor161 (GPR161) NM_170776 TC100902 HomosapiensGprotein-coupledreceptor26(GPR26) NM_153837 TC100901 HomosapiensGprotein-coupledreceptor155 (GPR155) NM_153832 TC100887 Homosapiensolfactoryreceptor, family51,subfamilyE,member1(OR51E1) NM_153442 TC100531 Homosapiensoxoeicosanoid (OXE) receptor1(OXER1) NM_152529 TC100361 HomosapiensGprotein-coupledreceptorMRGX1(MRGX1) NM_152430 TC100645 HomosapiensMAS-related GPR,memberF(MRGPRF) NM_148962 TC100589 1(GPR73L1) HomosapiensGprotein-coupledreceptor73-like NM_147199 TC100553 HomosapiensGprotein-coupledreceptor73(GPR73) NM_145015 TC100284 HomosapiensGprotein-coupledreceptor146 (GPR146), OriGeneuniquevariant1 NM_144773 TC100046 Homosapienstraceaminereceptor1(TRAR1) NM_138964 TC100222 HomosapiensGprotein-coupledreceptor62(GPR62) NM_138445 TC120613 HomosapiensGprotein-coupledreceptor78(GPR78) NM_138327 TC120462 NM_080865 TC120694 Description NM_080819 TC108414 Accession No. TC120365 No. Cat. 1 78 M239 Homo sapiensGprotein-coupledreceptor148 (GPR148) XM_293092 07089 071 071 04550 071 071 07898 2665 16 XM_096782 Homo sapiens putative leukocyte platelet-activating factorreceptor(HUMNPIIY20) leukocyteplatelet-activating Homosapiensputative XM_096782 16 8X_984Homosapienssimilartoseventransmembrane helix receptor(LOC341130) XM_291874 08 03 7X_683HomosapiensG-proteincoupledreceptor2(GPCR2) XM_066873 27 M019 HomosapienssimilartoOlfactoryreceptor13C5 (LOC138799) XM_071093 XM_061 XM_061 XM_051 1 Homosapienssimilartoseventransmembranehelixreceptor(LOC119686) 618 555 522 Homo sapienssimilartoGprotein-coupledreceptor26(LOC119586) Homo sapiensGprotein-coupledreceptor(RDC1) www .or ig ene.com C182N_024Homosapiensnuclearreceptorsubfamily 2,groupF, member6(NR2F6) Homosapiensnuclearreceptorsubfamily 1,groupD,member2(NR1D2) NM_005234 NM_005126 TC116862 receptor, activated Homosapiensperoxisome proliferative alpha(PPARA), variant5 transcript TC101015 TC1 Homosapiensretinoicacidreceptorresponder(tazaroteneinduced)3(RARRES3) NM_005036 TC1 Homosapiensestrogen-relatedreceptorbeta(ESRRB) TC116987 Homosapiensestrogen-relatedreceptoralpha(ESRRA) NM_004585 TC1 NM_004452 TC117294 Homosapiensnuclearreceptorsubfamily1,groupI,member2(NR1I2),transcriptvariant1 NM_004451 TC123865 Homosapiensnuclearreceptorsubfamily1,groupI,member2(NR1I2),OriGeneuniquevariant1 TC108253 Homosapiensnuclearreceptorsubfamily5,group A, member2(NR5A2),OriGeneuniquevariant1 NM_003889 TC1 Homosapiensnuclearreceptorsubfamily5,group A, member2(NR5A2),transcript variant2 NM_003889 TC109997 Homosapiensnuclearreceptorsubfamily2,groupC,member2(NR2C2) NM_003822 TC109996 NM_003822 TC117737 NM_003298 TC117736 TC118058 TC1 TC1 Homosapiensthyroid hormonereceptor, viral(v-erb-a) alpha(erythroblasticleukemia oncogene TC1 NM_003250 HomosapiensRAR-relatedorphanreceptor A (RORA),transcriptvariant3 TC118079 TC1 Homosapiensnuclearreceptorsubfamily 4,group A, member1(NR4A1),transcript variant1 NM_002943 TC1 Homosapiensarylhydrocarbon receptor(AHR) TC109741 Homosapiensestrogen-relatedreceptorgamma (ESRRG),transcriptvariant1 NM_002135 TC1 Homosapiensestrogenreceptor2(ERbeta) (ESR2) NM_001621 TC118806 Homosapiensestrogenreceptor2(ERbeta)(ESR2),OriGeneuniquevariant1 NM_001438 TC119159 Homosapiensretinoicacidreceptor, gamma (RARG) NM_001437 TC119217 Homosapiensretinoicacidreceptor, beta(RARB),transcriptvariant1 NM_001437 TC119216 Homosapiensretinoicacidreceptor, alpha(RARA) NM_000966 TC119215 Homosapiensprogesteronereceptor(PGR) NM_000965 TC119569 NM_000964 TC119567 Homosapiensnuclearreceptorsubfamily 0,groupB,member1(NR0B1) NM_000926 TC119566 TC123962 NM_000475 TC1 Homosapienshepatocytenuclearfactor4,alpha(HNF4A),transcriptvariant2 TC119849 HomosapiensvitaminD(1,25-dihydroxyvitamin D3)receptor(VDR) Homosapiensnuclearreceptorsubfamily3,groupC,member1(glucocorticoid receptor) (NR3C1) NM_000457 T Homosapiensestrogenreceptor1(ESR1) NM_000376 TC123863 Homosapiensestrogenreceptor1(ESR1) NM_000176 TC119941 Homosapiensestrogenreceptor1(ESR1) NM_000125 TC120032 NM_000125 TC120774 Homosapiensandrogenreceptor(dihydrotestosterone receptor;testicularfeminization;spinaland NM_000125 TC123956 Description TC123890 NM_000044 Accession No. TC114220 No. Cat. Nuclear Hormone Receptor CloneSet 194 M006 Homosapiensthyroid hormonereceptor, viral(v-erb-a) beta(erythroblasticleukemia oncogene NM_000461 C119844 76 M047 Homo sapiensPPAR bindingprotein(PPARBP), OriGeneuniquevariant1 NM_004774 17168 1 Homo sapiensthyroid hormonereceptor, viral(v-erb-a) alpha(erythroblasticleukemia oncogene 1 NM_003250 18080 1 1 12 M052 Homo sapiensnuclearreceptorsubfamily1, groupI,member3(NR1I3) NM_005122 1 11129 08472 097 38 M000 Homosapiensnuclearreceptorsubfamily3,groupC,member2(NR3C2) NM_000901 23888 7545 Homosapiensnuclearreceptorsubfamily2,groupE,member1(NR2E1) NM_003269 8089 8299 8329 6941 42 NM_0 NM_0 NM_0 M043 Homosapienshepatocytenuclearfactor4,gamma (HNF4G) NM_004133 NM_0 NM_0 051 HomosapiensRAR-relatedorphanreceptor A (RORA),OriGeneuniquevariant1 02943 03297 25 HomosapiensretinoidXreceptor, alpha(RXRA) 02957 02889 23 Homo sapiensnuclearreceptorsubfamily 1,groupH,member4(NR1H4) homolog, avian)(THRA),OriGeneuniquevariant1 homolog, avian)(THRA),transcriptvariant2 homolog 2,avian)(THRB) bulbar muscularatrophy; Kennedy disease)(AR) Homo sapiensnuclearreceptorsubfamily2,groupC,member1(NR2C1) Homo sapiensretinoicacidreceptorresponder(tazaroteneinduced)2(RARRES2) h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 31 CloneSet: Gene-family based collection TrueClone™ 32 CloneSet: Gene-family based collection TrueClone™ C228N_020Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member1(KCNJ1), transcript Homosapienspotassiumvoltage-gated channel, Isk-relatedfamily, member1(KCNE1) TC1 NM_000220 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, member 1(episodicataxia NM_000219 TC122218 TC121930 Homosapiensglycinereceptor, alpha1 (startle disease/hyperekplexia, stiff mansyndrome)(GLRA1), NM_000217 TC122128 Homosapiensgap(connexin 32,Charcot-Marie-Tooth junctionprotein,beta1,32kDa neuropathy, NM_000171 Homosapiensgap junctionprotein,alpha1,43kDa(connexin43)(GJA1) TC123992 Homosapienscyclicnucleotidegated channel alpha1(CNGA1) NM_000166 Homosapienschloride channel Dentdisease)(CLCN5) 5(nephrolithiasis2,X-linked, NM_000165 TC120085 NM_000087 TC120084 Homosapienscholinergic receptor, nicotinic,epsilonpolypeptide(CHRNE) NM_000084 TC122040 Homosapienscholinergic receptor, nicotinic, alphapolypeptide1(muscle)(CHRNA1) TC100001 NM_000080 TC1 Homosapiensvoltage-dependent calciumchannel beta-4asubunitmRNA,complete cds NM_000079 TC123958 TC122073 AY054985 TC1 TC122167 Cat. Ion ChannelCloneSet Homosapienssimilartonuclearreceptorsubfamily1,groupD,member1(LOC151155) receptor, activated Homosapiensperoxisome proliferative delta(PPARD), transcriptvariant2 XM_092480 receptor, activated Homosapiensperoxisome proliferative gamma (PPARG), transcriptvariant1 TC107087 receptor, activated Homosapiensperoxisome proliferative gamma (PPARG), transcriptvariant3 NM_177435 TC1 HomosapiensRAR-relatedorphanreceptor A (RORA),transcriptvariant1 NM_138712 TC109596 HomosapiensretinoidXreceptor, beta(RXRB) NM_138711 TC124177 Homosapiensnuclearreceptorsubfamily 1,groupD,member1(NR1D1) NM_134261 TC108192 Homosapiensnuclearreceptorsubfamily2,groupF, member2(NR2F2) NM_021976 TC123126 Homosapiensnuclearreceptorsubfamily 2,groupE,member3(NR2E3),transcriptvariant1 NM_021724 TC112839 Homosapiensthyroid hormonereceptorinteractor4(TRIP4),OriGeneuniquevariant2 NM_021005 TC112578 Homosapiensthyroid hormonereceptorinteractor4(TRIP4),OriGeneuniquevariant1 NM_016346 TC108069 Homosapiensnuclearreceptorsubfamily1,groupH,member2(NR1H2) NM_016213 TC114329 Homosapiensnuclearreceptorsubfamily1,groupH,member2(NR1H2),OriGeneuniquevariant1 NM_016213 TC114428 Homosapiensnuclearreceptorsubfamily4,group A, member3(NR4A3),transcriptvariant1 NM_007121 TC114427 HomosapiensretinoidXreceptor, gamma (RXRG),transcriptvariant1 NM_007121 TC115735 HomosapiensRAR-relatedorphanreceptorB(RORB) NM_006981 TC115734 Homosapiensprogesteronereceptormembranecomponent1(PGRMC1) NM_006917 TC115804 progesteronereceptor, Homosapiensunactive 23kD(TEBP) NM_006914 TC115782 Homosapiensprogesteronereceptormembranecomponent2(PGRMC2) NM_006667 TC115780 Homosapiensnuclearreceptorsubfamily4,group A, member2(NR4A2),transcript variant1 NM_006601 TC115946 Homosapiensnuclearreceptorsubfamily1,groupH,member3(NR1H3) NM_006320 TC115976 Homosapiensnuclearreceptorsubfamily1,groupH,member3(NR1H3),OriGeneuniquevariant2 NM_006186 TC111151 Homosapiensnuclearreceptorsubfamily1,groupH,member3(NR1H3),OriGeneuniquevariant1 NM_005693 TC116298 Homosapiensnuclearreceptorsubfamily2,groupF, member1(NR2F1) NM_005693 TC116564 NM_005693 TC116563 Description NM_005654 TC116562 Accession No. TC116616 No. Cat. 22070 22546 23864 23920 o ceso o Description Accession No. No. NM_0 Homosapienscholinergic receptor, nicotinic,alphapolypeptide1(muscle)(CHRNA1) NM_000079 X7 NM_0 4497 0 0 03Homosapienschloride channel muscle(Thomsendisease,autosomaldominant)(CLCN1) 1,skeletal 0083 0220 variant rom-k1 with m OriGene uniquevariant1 (GJB1) X-linked) H.sapiens mRNAforth variant rom-k1 Homo sapienspotassium in yok ymia) (KCNA1) yroid hormonereceptorbeta-2isoform www w ardly -rectifying channel, subfamilyJ, member 1(KCNJ1),transcript .or ig ene.com C169N_089Homosapiensglutamatereceptor, ionotrophic, AMPA 4(GRIA4) Homosapiensglutamatereceptor, ionotrophic, AMPA 3(GRIA3),transcriptvariant flop Homosapiensglutamatereceptor, ionotropic, AMPA 1(GRIA1) NM_000829 NM_000828 TC119639 Homosapiensglycinereceptor, beta(GLRB) NM_000827 TC122080 TC119638 Homosapiensgamma-aminobutyric acid(GABA) A receptor, delta(GABRD) NM_000824 TC1 Homosapiensgamma-aminobutyric acid(GABA) A receptor, beta3(GABRB3),transcript variant1 TC119636 NM_000815 TC1 NM_000814 TC122576 Homosapiensgamma-aminobutyric acid(GABA) A receptor, alpha6(GABRA6),OriGeneuniquevariant1 TC110903 Homosapiensgamma-aminobutyric acid(GABA) A receptor, alpha6(GABRA6) TC1 Homosapiensgamma-aminobutyric acid(GABA) A receptor, alpha5(GABRA5) NM_000811 TC1 Homosapiensgamma-aminobutyric acid(GABA) A receptor, alpha4(GABRA4) NM_000811 TC122150 Homosapiensgamma-aminobutyric acid(GABA) A receptor, alpha3(GABRA3) NM_000810 TC119627 NM_000809 TC119626 Homosapiensgamma-aminobutyric acid(GABA) A receptor, alpha1(GABRA1) NM_000808 TC119625 TC119670 Homosapienscholinergic receptor, nicotinic,betapolypeptide4(CHRNB4),OriGeneuniquevariant2 NM_000806 TC1 TC119668 Homosapienscholinergic receptor, nicotinic,betapolypeptide2(neuronal)(CHRNB2) NM_000750 TC1 TC122142 NM_000748 TC1 TC119699 Homosapienscholinergic receptor, nicotinic,alphapolypeptide7(CHRNA7) TC1 Homosapienscholinergic receptor, nicotinic,alphapolypeptide5(CHRNA5),OriGeneuniquevariant1 NM_000746 TC1 Homosapienscholinergic receptor, nicotinic,alphapolypeptide5(CHRNA5) TC122081 NM_000745 TC1 Homosapienscholinergic receptor, nicotinic,alphapolypeptide2(neuronal)(CHRNA2) NM_000745 TC108445 Homosapienscalciumchannel, voltage-dependent, gamma subunit1(CACNG1) TC122164 Homosapienscalciumchannel, voltage-dependent, beta4subunit(CACNB4), transcriptvariant2 NM_000742 TC1 Homosapienscalciumchannel, voltage-dependent, beta3subunit(CACNB3), OriGeneuniquevariant1 NM_000727 TC123917 Homosapienscalciumchannel, voltage-dependent, beta3subunit(CACNB3) NM_000726 TC122189 Homosapienscalciumchannel, voltage-dependent, beta2subunit(CACNB2), transcriptvariant1 NM_000725 TC122048 Homosapienscalciumchannel, voltage-dependent, beta1subunit(CACNB1), transcriptvariant1 NM_000725 TC119727 Homosapienscalciumchannel, voltage-dependent, beta1subunit(CACNB1), transcriptvariant1 NM_000724 TC122090 Homosapienscalciumchannel, voltage-dependent, alpha2/deltasubunit1(CACNA2D1) NM_000723 TC124059 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member11 NM_000723 (KCNJ11) TC124040 Homosapienscytochrome b-245,betapolypeptide(chronic granulomatousdisease)(CYBB) NM_000722 TC123891 Homosapiensaquaporin1(channel-forming integralprotein,28kDa)(AQP1), transcriptvariant2 NM_000525 TC124161 Homosapienssodiumchannel, nonvoltage-gated 1,beta(Liddlesyndrome)(SCNN1B) NM_000397 TC123976 NM_000385 TC122091 Homosapienssodiumchannel, voltage-gated, type V, alpha(longQTsyndrome3)(SCN5A),transcript NM_000336 TC122157 Homosapienspolycystickidneydisease2(autosomaldominant)(PKD2) TC119979 NM_000335 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member2(KCNH2), NM_000297 TC124054 TC110976 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member1(KCNJ1),transcript NM_000238 Description TC123972 NM_000220 Accession No. TC123921 No. Cat. 1 1 Homosapiens cholinergic receptor, nicotinic, deltapolypeptide(CHRND) 1 NM_000751 19700 1 09261 22056 221 22573 2407 221 9629 9628 9669 67N_086Homo sapiensglutamatereceptor, ionotropic, AMPA 2(GRIA2) NM_000826 9637 38 60 4 M001 Homosapiensgamma-aminobutyric acid(GABA) A receptor, beta1(GABRB1) NM_0 NM_000812 NM_0 Homosapienscholinergic receptor, nicotinic,betapolypeptide1(muscle)(CHRNB1),OriGeneunique NM_000747 NM_0 NM_0 NM_0 NM_0 M001 Homosapiensgamma-aminobutyric acid(GABA) A receptor, gamma 2(GABRG2),transcriptvariant NM_000816 0 Homosapiensgamma-aminobutyric acid(GABA) A receptor, alpha2(GABRA2) 00807 0 0 0 0 081 0750 Homosapienscholinergic receptor, nicotinic,betapolypeptide1(muscle)(CHRNB1) 0747 07 0 7 6Homosapienscholinergic receptor, nicotinic,alphapolypeptide7(CHRNA7) 46 43 3 Homo sapienscholinergic receptor, nicotinic,alphapolypeptide3(CHRNA3) Homo sapiensg variant 1 Homo sapienscholinergic receptor, nicotinic,betapolypeptide4(CHRNB4),OriGeneuniquevariant1 variant 2 transcript variant1 variant rom-k1 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: amma-aminobutyric acid(GABA) A receptor, beta2(GABRB2),transcriptvariant 33 CloneSet: Gene-family based collection TrueClone™ 34 CloneSet: Gene-family based collection TrueClone™ C006N_022Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member13 (KCNJ13), OriGene Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member10 (KCNJ10) Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member6(KCNJ6) NM_002242 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member3(KCNJ3) NM_002241 TC101096 Homosapienspotassiumvoltage-gated channel, subfamilyG,member1(KCNG1), transcriptvariant1 NM_002240 TC118741 NM_002239 TC118770 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, member 6(KCNA6) NM_002237 TC118769 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, member 5(KCNA5) TC121929 NM_002235 TC1 NM_002234 TC118766 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, member4(KCNA4) TC123964 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, member3(KCNA3) Homosapiensglutamatereceptor, 5(GRIK5) ionotropic,kainate NM_002233 TC1 NM_002232 TC123916 Homosapiensglycinereceptor, alpha2(GLRA2) NM_002088 TC118765 Homosapiensgap junctionprotein,alpha4,37kDa(connexin37)(GJA4) TC120401 Homosapiensgamma-aminobutyric acid(GABA)receptor, rho2(GABRR2) NM_002063 TC1 NM_002060 TC110908 NM_002043 TC118876 Homosapienschloride channel 3(CLCN3), transcriptvariantb TC123929 TC1 NM_001829 TC1 Homosapienscyclicnucleotidegated channel alpha3(CNGA3),OriGeneuniquevariant1 TC110856 TC1 Homosapienschloride intracellularchannel 2(CLIC2),OriGeneuniquevariant1 NM_001298 TC1 Homosapienschloride intracellularchannel2 (CLIC2) TC119289 Homosapienschloride intracellularchannel1 (CLIC1) NM_001289 TC1 Homosapienschloride channel 7(CLCN7), OriGeneuniquevariant1 NM_001289 TC122039 Homosapienschloride channel 7(CLCN7) NM_001288 TC119325 Homosapienschloride channel 6(CLCN6),transcriptvariantClC-6a NM_001287 TC119324 Homosapienschloride channel 6(CLCN6), transcriptvariantClC-6a NM_001287 TC122065 Homosapienschloride channel, familymember1(CLCA1) calciumactivated, NM_001286 TC108053 Homosapienschloride channel, familymember1(CLCA1) calcium activated, NM_001286 TC124176 cation channel Homosapiensamiloride-sensitive 2,neuronal(ACCN2), transcriptvariant2 NM_001285 TC122134 cation channel Homosapiensamiloride-sensitive 1,neuronal(degenerin)(ACCN1), transcriptvariant2 NM_001285 TC124035 Homosapienssodiumchannel, nonvoltage-gated 1,gamma (SCNN1G) NM_001095 TC123906 Homosapienssodiumchannel, nonvoltage-gated 1alpha(SCNN1A) NM_001094 TC108885 Homosapienssodiumchannel, voltage-gated, typeI,beta(SCN1B),transcriptvarianta NM_001039 TC124011 NM_001038 TC119543 Homosapienspotassiumchannel tetramerisationdomaincontaining11 (KCTD11) Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member2(KCNJ2) NM_001037 TC119542 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member5(KCNJ5) NM_001002914 TC119540 Homosapiens5-hydroxytryptamine (serotonin)receptor3A(HTR3A),transcriptvariant2 NM_000891 TC121957 Homosapiensglutamatereceptor, ionotropic,N-methyl D-aspartate 2B(GRIN2B) NM_000890 TC119591 Homosapiensglutamatereceptor, 3(GRIK3),OriGeneuniquevariant2 ionotropic,kainate NM_000869 TC119590 Homosapiensglutamatereceptor, 3(GRIK3),OriGeneuniquevariant1 ionotropic,kainate NM_000834 TC122578 Homosapiensglutamatereceptor, 1(GRIK1),transcriptvariant ionotropic,kainate NM_000831 TC119642 Homosapiensglutamatereceptor, 1(GRIK1),OriGeneuniquevariant ionotropic,kainate NM_000831 TC122147 NM_000830 TC119640 Description NM_000830 TC122079 Accession No. TC111634 No. Cat. 1 1 1 23963 221 23926 21 23987 9328 87 Homo sapienschloride channel 4(CLCN4) NM_001830 8976 946 67 7N_003Homosapiensglycinereceptor, alpha2(GLRA2),OriGeneuniquevariant1 NM_002063 77 NM_0 M023 Homosapienspotassiumvoltage-gated channel, subfamilyF, member1(KCNF1) NM_002236 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, member5(KCNA5), NM_002234 Homosapiensgamma-aminobutyric acid(GABA)receptor, rho1(GABRR1),OriGeneuniquevariant NM_002042 NM_0 NM_0 18 HomosapiensFXYDdomaincontainingiontransport regulator2(FXYD2),transcriptvarianta 01680 0 0 50Homosapiensglutamatereceptor, ionotropic,delta2(GRID2) 1510 1 293 Homo sapiensc unique variant1 OriGene uniquevariant1 hloride channel, 1A(CLNS1A) nucleotide-sensitive, www .or ig ene.com C213N_069Homosapienschloride intracellularchannel 3(CLIC3) NM_004669 Homosapienstransientreceptorpotential cationchannel, subfamilyC,member6 (TRPC6),OriGene TC122133 Homosapienssodiumchannel, voltage-gated, typeII,beta(SCN2B) TC1 NM_004621 Homosapienscholinergic receptor, nicotinic,alphapolypeptide6(CHRNA6) NM_004588 TC122148 Homosapiensvitelliformmaculardystrophy (Bestdisease,bestrophin)(VMD2),OriGene uniquevariant1 TC122684 NM_004198 TC1 NM_004183 TC124153 Homosapiensgap junctionprotein,beta 2,26kDa(connexin26)(GJB2) TC122132 Homosapienspotassiumchannel, subfamily K,member5(KCNK5) NM_004004 TC1 NM_003740 TC122666 Homosapiensvoltage-dependent anionchannel 2(VDAC2) TC124159 Homosapiensvoltage-dependent anionchannel 1(VDAC1) NM_003375 TC1 NM_003374 TC117988 Homosapienstransientreceptorpotentialcationchannel, subfamilyC,member3(TRPC3),OriGene TC117987 Homosapienstransientreceptorpotential cationchannel, subfamilyC,member1(TRPC1) TC1 Homosapienssodiumchannel, nonvoltage-gated 1,delta(SCNN1D) NM_003305 NM_003304 TC124002 Homosapienssodiumchannel, nonvoltage-gated 1,delta(SCNN1D),OriGeneuniquevariant1 NM_002978 TC121934 HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, 7(P2RX7),OriGeneuniquevariant1 TC122139 HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, 7(P2RX7),transcriptvariant1 NM_002978 TC1 HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, 5(P2RX5),transcript variant1 NM_002562 TC118315 NM_002562 TC122064 NM_002561 TC118597 HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, 4(P2RX4),transcriptvariant1 TC109527 HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, 3(P2RX3) NM_002560 TC1 Homosapienspotassiumvoltage-gated channel, delayed-rectifier, subfamilyS,member3(KCNS3) NM_002559 TC122124 TC123980 channel, Homosapienspotassiumintermediate/smallconductancecalcium-activated subfamilyN, NM_002252 TC1 TC118715 channel, Homosapienspotassiumintermediate/small conductancecalcium-activated subfamilyN, NM_002250 TC121952 channel, Homosapienspotassiumintermediate/small conductancecalcium-activated subfamilyN, NM_002250 TC122055 channel, Homosapienspotassiumlargeconductancecalcium-activated subfamilyM,alphamember1 NM_002248 TC124003 channel, Homosapienspotassiumlargeconductancecalcium-activated subfamilyM,alphamember1 NM_002247 TC122078 channel, Homosapienspotassiumlargeconductancecalcium-activated subfamily M,alphamember1 NM_002247 Homosapienspotassiumchannel, subfamilyK,member3(KCNK3) TC122094 Homosapienspotassiumchannel, subfamilyK,member1(KCNK1) NM_002247 NM_002246 TC122141 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member15 (KCNJ15), transcript NM_002245 TC118713 TC110937 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member13 (KCNJ13), OriGene NM_002243 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member13 (KCNJ13) TC118712 NM_002242 Description NM_002242 TC122057 Accession No. TC122174 No. Cat. 1 1 1 1 38 M037 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, betamember1(KCNAB1), NM_003471 23984 23988 221 2 1 7 7547 8 1 045 41 594 945 1 7 6 NM_0 NM_0 NM_0 NM_0 M046 Homosapienschloride channel 2(CLCN2) NM_004366 NM_0 NM_0 04621 0337 02560 02978 04137 Homo sapiens potassium large conductance calcium-activated channel, Homosapienspotassiumlargeconductancecalcium-activated subfamilyM,beta member1 04137 02558 Homosapiensvoltage-dependent anionchannel 1(VDAC1) 4 Homo sapienstransientreceptorpotential cationc unique variant1 transcript variant2 unique variant1 variant 1 Homo sapienspurinergicreceptorP2X,ligand-gated ionchannel, 4(P2RX4),OriGeneunique member 4(KCNN4) member 4(KCNN4),OriGeneuniquevariant1 member 1(KCNN1) (KCNMA1), OriGeneuniquevariant1 ( (KCNMA1), OriGeneuniquevariant3 variant 2 unique variant2 Homo sapienssodiumc (KCNMB1) Homo sapienspurinergicreceptorP2X,lig KCNMA1), OriGeneuniquevariant2 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: hannel, non voltage-gated 1,delta(SCNN1D),OriGeneunique variant2 and-gated ionchannel, 1(P2RX1) hannel, subfamilyC,member6(TRPC6) 35 CloneSet: Gene-family based collection TrueClone™ 36 CloneSet: Gene-family based collection TrueClone™ C128N_139Homosapiensmonocytetomacrophage differentiation-associated (MMD) Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member 4(KCNH4) NM_012329 TC1 NM_012285 TC111208 Homosapienspotassiumvoltage-gated channel, subfamilyG,member2(KCNG2), OriGeneunique TC122182 HomosapiensKCNE1-like (KCNE1L) TC1 NM_012283 NM_012282 TC122179 Homosapienschloride channel, familymember4(CLCA4) calciumactivated, TC122784 Homosapienstransientreceptorpotentialcationchannel, subfamily A, member1(TRPA1) TC1 Homosapiensglutamatereceptor, ionotropic, N-methyl D-aspartate 1(GRIN1),transcriptvariantNR1-3 NM_012128 TC1 NM_007332 TC123966 HomosapiensNADPHoxidase 1(NOX1), transcriptvariantNOH-1L NM_007327 TC124028 TC115601 Homosapienschloride channel, familymember2(CLCA2) calciumactivated, NM_007052 TC1 Homosapienstranslocaseofoutermitochondrial membrane40homolog(yeast) (TOMM40) TC123944 NM_006536 TC1 NM_006114 TC116023 Homosapienscalciumchannel, voltage-dependent, alpha2/deltasubunit2(CACNA2D2), transcript TC116336 HomosapiensFXYDdomaincontaining iontransport regulator3(FXYD3),transcriptvariant1 TC1 Homosapiens ATP-binding cassette, NM_006030 sub-familyC(CFTR/MRP),member4(ABCC4) Homosapiens ATP-binding cassette, NM_005971 sub-familyC(CFTR/MRP),member4(ABCC4) TC124025 NM_005845 TC116402 NM_005845 TC124178 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, member10 (KCNA10) TC121947 TC1 NM_005549 TC1 1,orphanreceptor(P2RXL1),OriGeneuniquevariant1 HomosapienspurinergicreceptorP2X-like TC124007 TC1 Homosapiensgap junctionprotein,alpha8,50kDa(connexin50)(GJA8), OriGeneuniquevariant1 NM_005446 TC1 TC123978 NM_005267 TC1 HomosapiensFXYDdomaincontainingiontransport regulator1(phospholemman)(FXYD1), TC123931 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member9(KCNJ9) T Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member8(KCNJ8) NM_005031 NM_004983 TC121958 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member4(KCNJ4),transcript NM_004982 TC117023 TC117022 Homosapienspotassiumvoltage-gated channel, Shal-relatedsubfamily, member3(KCND3),OriGene NM_004981 TC123960 Homosapienspotassiumvoltage-gated channel, Shaw-related subfamily, member4(KCNC4), NM_004980 Homosapienspotassiumvoltage-gated channel, Shaw-related subfamily, member1(KCNC1) TC122175 Homosapienspotassiumvoltage-gated channel, Shab-relatedsubfamily, member1(KCNB1) NM_004978 NM_004976 TC111648 Homosapiensgamma-aminobutyric acid(GABA) A receptor, epsilon(GABRE),OriGeneunique NM_004975 TC124010 Homosapienspotassiumchannel, subfamilyK,member6(KCNK6) TC117021 cationchannel Homosapiensamiloride-sensitive 3(ACCN3), transcriptvariant1 NM_004961 NM_004823 TC124000 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, betamember3(KCNAB3), NM_004769 TC117126 Description TC111730 NM_004732 Accession No. TC122181 No. Cat. 127 M059 Homo sapienscholinergic receptor, nicotinic,gamma polypeptide(CHRNG) NM_005199 C122072 1 1 Homo sapiensvoltage-dependent anionchannel 3(VDAC3), OriGeneuniquevariant1 NM_005662 16623 1 1 221 23959 23953 Homosapiensvoltage-dependent anionchannel 3(VDAC3) NM_005662 22051 22088 241 22037 1 0362 5436 6025 3 M057 Homosapienspotassiumvoltage-gated channel, Isk-relatedfamily, member3(KCNE3) NM_005472 131 3N_126HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, 2(P2RX2),OriGeneunique variant1 NM_012226 53 54 NM_0 Homosapienscalciumchannel, voltage-dependent, gamma subunit2(CACNG2) NM_006078 N N NM_0 Homosapienscalciumchannel, voltage-dependent, gamma subunit3(CACNG3) NM_006539 M021 Homosapiensphosphatidylinositol transfer protein,cytoplasmic 1(PITPNC1),transcript variant1 NM_012417 NM_0 _047Homosapiensgap junctionprotein,alpha7, 45kDa(connexin45)(GJA7) M_005497 M_0 1 1 75 HomosapiensNADPHoxidase 1(NOX1), transcriptvariantNOH-1L 07052 56 Homosapiensgap junctionprotein,beta5(connexin31.1) (GJB5) 05268 2281 2283 variant 1 variant 2 transcript varianta variant 2 unique variant1 transcript variant1 variant 1 OriGene uniquevariant1 Homo sapienspotassiumv Homo sapienspotassiumv www oltage-gated channel, Shal-relatedsubfamily, member2(KCND2) oltage-g ated c .or hannel, subfamilyG,member2(KCNG2) ig ene.com C287N_177Homosapienstransientreceptorpotential cationchannel, subfamily V, member1 (TRPV1),transcript TC1 Homosapienstransientreceptorpotentialcationchannel, subfamily V, member1(TRPV1),transcript NM_018727 TC123887 Homosapienstransientreceptorpotentialcationchannel, subfamily V, member1(TRPV1),transcript NM_018727 cationchannel Homosapiensamiloride-sensitive 4,pituitary(ACCN4), transcript variant 1 TC123895 NM_018727 NM_018674 TC122126 Homosapienstransientreceptorpotentialcationchannel, subfamily V, member6(TRPV6) TC122197 Homosapienssodiumchannel, voltage-gated, typeIII,beta(SCN3B),OriGeneunique variant1 NM_018646 TC1 NM_018400 TC120633 TC122106 Homosapienscalciumchannel, voltage-dependent, alpha2/delta3subunit(CACNA2D3), OriGene TC1 TC1 Homosapienstwoporesegmentchannel 1 (TPCN1),OriGeneuniquevariant NM_018398 TC113489 Homosapienstransientreceptorpotential cationchannel, subfamilyM,member4(TRPM4) NM_017901 TC1 TC122156 cation channel Homosapiensamiloride-sensitive 5,intestinal(ACCN5) NM_017636 TC1 Homosapienschloride intracellularchannel 5(CLIC5) TC123991 Homosapienspotassiumchannel, subfamilyK,member4(KCNK4),transcriptvariant1 NM_017419 TC1 Homosapienssolutecarrier family15, member3(SLC15A3) NM_016929 TC122137 HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, 2(P2RX2),transcriptvariant3 NM_016611 TC114142 Homosapienstransientreceptorpotentialcationchannel, subfamilyC,member4(TRPC4) NM_016582 TC122061 NM_016318 TC114228 NM_016179 TC122193 TC114411 TC1 T Homosapiensglutamatereceptor, ionotropic,N-methyl D-aspartate-like 1A(GRINL1A),OriGene TC1 Homosapiensglutamatereceptor, ionotropic,N-methyl D-aspartate-like 1A(GRINL1A) TC1 HomosapiensMid-1-related chloride channel 1(MCLC) NM_015532 HomosapiensMid-1-related chloride channel 1(MCLC),OriGeneuniquevariant2 NM_015532 TC122109 HomosapiensMid-1-related chloride channel 1(MCLC),OriGeneuniquevariant NM_015127 TC121941 HomosapiensKvchannel interactingprotein1(KCNIP1) NM_015127 TC122089 NM_015127 TC122186 channel, Homosapienspotassiumlargeconductancecalcium-activated subfamilyM,betamember4 NM_014592 TC111199 TC114946 channel, Homosapienspotassiumlargeconductancecalcium-activated subfamilyMbetamember3 NM_014505 TC108188 channel, Homosapienspotassiumlargeconductancecalcium-activated subfamilyMbetamember3 NM_014407 Homosapienscalciumchannel, voltage-dependent, gamma subunit4(CACNG4) TC123923 Homosapienspotassiumchannel, subfamily V, member1(KCNV1) NM_014407 Homosapienspotassiumchannel, subfamilyK,member2(KCNK2) NM_014405 TC123934 Homosapiensgamma-aminobutyric acid(GABA) A receptor, pi(GABRP) NM_014379 TC122095 HomosapiensFXYDdomaincontainingiontransport regulator5(FXYD5),transcriptvariant2 NM_014217 TC115023 Homosapienschloride intracellularchannel 4(CLIC4) NM_014211 TC122082 NM_014164 TC115134 Description NM_013943 TC115114 Accession No. TC115226 No. Cat. C122207 NM_016112 Homo sapiens polycystic kidney disease 2-like 1(PKD2L1) Homosapienspolycystickidneydisease2-like NM_016112 C122207 1 Homosapienstransientreceptorpotentialcationchannel, subfamily V, member2(TRPV2) NM_016113 14461 1 1 39 M085 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member16 (KCNJ16), OriGene NM_018658 23999 21 Homosapienstwoporesegmentchannel 1(TPCN1) 241 NM_017901 22209 22085 22840 1 3490 3285 6 M059 Homo sapienstransmembrane4superfamilymember11 (plasmolipin)(TM4SF11) NM_015993 264 4 M089 Homosapienscalciumchannel, voltage-dependent, alpha2/delta3subunit(CACNA2D3) NM_018398 942 60 NM_0 NM_0 NM_0 1(PKD2L1) Homosapienspolycystickidneydisease2-like NM_016112 NM_0 1 Homosapiensmucolipin3(MCOLN3) 18298 1 1 8992 7581 840 0 variant 1 Homo sapienspotassium channel tetramerisation domaincontaining5(KCTD5),OriGene unique variant 2 variant 2 variant 2 unique variant1 unique variant1 Homo sapienscholinergic receptor, nicotinic,alphapolypeptide9(CHRNA9) unique variant1 (KCNMB4) (KCNMB3), transcriptvariant4 ( Homo sapienssodiumchannel, voltage-gated, typeIII,beta(SCN3B) KCNMB3), OriGeneuniquevariant1 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 37 CloneSet: Gene-family based collection TrueClone™ 38 CloneSet: Gene-family based collection TrueClone™ C214N_340Homosapienspotassiumchannel, subfamily K,member17 (KCNK17) Homosapienspotassiumchannel, subfamily K,member17 (KCNK17) NM_031460 TC1 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member 6(KCNH6), NM_031460 TC122154 TC123004 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member 6(KCNH6), NM_030779 HomosapiensKvchannel interactingprotein 4(KCNIP4),transcriptvariant1 TC122060 Homosapienshypothetical proteinFLJ12242 (FLJ12242) NM_030779 NM_025221 TC123918 Homosapienstransientreceptorpotentialcationchannel, subfamilyM,member 8 (TRPM8) NM_024681 TC111844 TC122966 NM_024080 TC1 TC112270 Homosapienspotassiumchannel tetramerisationdomaincontaining15 (KCTD15), OriGeneunique TC1 TC1 Homosapiensgap junctionprotein,beta3,31kDa(connexin31)(GJB3),transcriptvariant1 NM_024076 TC112315 Homosapienspotassiumchannel, subfamilyK,member15 (KCNK15), OriGeneuniquevariant1 NM_024009 TC1 TC112319 Homosapienspotassiumchannel, subfamilyK,member13 (KCNK13), OriGeneuniquevariant1 NM_022358 TC1 HomosapiensFXYDdomaincontaining iontransport regulator7(FXYD7),OriGeneuniquevariant1 TC122205 HomosapiensFXYDdomaincontainingiontransport regulator6(FXYD6) NM_022054 TC1 HomosapiensFXYDdomaincontainingiontransport regulator6(FXYD6),OriGeneuniquevariant1 NM_022006 TC112856 Homosapiensgamma-aminobutyric acid(GABA) A receptor, epsilon(GABRE),transcriptvariant2 NM_022003 TC112568 Homosapiensglutamatereceptor, 2(GRIK2),transcriptvariant1 ionotropic,kainate NM_022003 TC112567 NM_021984 TC122169 NM_021956 TC123967 TC121951 Homosapiensgamma-aminobutyric acid(GABA) A receptor, beta3(GABRB3),transcriptvariant2 TC1 NM_021912 TC1 TC109260 channel, Homosapienspotassiumintermediate/smallconductancecalcium-activated subfamilyN, Homosapienspotassiumchannel, subfamilyK,member10 (KCNK10), transcriptvariant1 TC1 Homosapienstumornecrosisfactor, alpha-inducedprotein1(endothelial)(TNFAIP1) NM_021614 cyclicnucleotide-gated Homosapienshyperpolarization activated potassiumchannel 1(HCN1) NM_021161 TC112899 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member12 (KCNJ12) NM_021137 TC110477 NM_021072 TC112982 Homosapienstransientreceptorpotentialcationchannel, subfamilyM,member 3 (TRPM3), NM_021012 TC122166 Homosapienshyperpolarizationcyclicnucleotide-gated activated potassiumchannel 3(HCN3) TC124157 Homosapiensconnexin-36(CX36) NM_020952 Homosapienstweetyhomolog1(Drosophila)(TTYH1),OriGeneuniquevariant NM_020897 TC121953 Homosapiensgap junctionprotein,alpha12, 47kDa(GJA12) NM_020660 TC121938 Homosapienscholinergic receptor, nicotinic,alphapolypeptide10 (CHRNA10) NM_020659 TC122104 Homosapienstransientreceptorpotentialcationchannel, subfamilyC,member7(TRPC7) NM_020435 TC122214 cationchannel Homosapiensamiloride-sensitive 2,neuronal(ACCN2), transcriptvariant1 NM_020402 TC122118 Homosapienspotassiumvoltage-gated channel, KQT-like subfamily, NM_020389 member5(KCNQ5) TC123975 Homosapienstransientreceptorpotentialcationchannel, subfamily V, member5(TRPV5) NM_020039 TC113118 NM_019842 TC122113 Description NM_019841 TC122099 Accession No. TC122108 No. Cat. 24 M033 Homosapienspotassiumchannel tetramerisation domaincontaining14 (KCTD14) 1 NM_023930 12346 09579 23954 221 221 221 Homosapiensgap junctionprotein,alpha3,46kDa(connexin46)(GJA3), OriGeneunique variant1 NM_021954 23942 22077 221 230 90 8N_206Homosapienspotassiumchannel tetramerisationdomaincontaining15 (KCTD15) NM_024076 85 68 52 0 M019 Homosapienscalcium channel, voltage-dependent, gamma subunit7(CACNG7) NM_031896 NM_024505 NM_024080 moietyX)-typemotif9(NUDT9),transcriptvariant 1 Homosapiensnudix(nucleosidediphosphatelinked NM_024047 NM_022055 NM_021 M010 HomosapiensFXYDdomaincontainingiontransport regulator1(phospholemman)(FXYD1),transcript NM_021902 91 2 v H OriGene uniquevariant1 transcript variant1 Homo sapiensNADPHo unique variant1 Homo sapienstransientreceptorpotentialcationc variant 1 Homo sapienspotassiumc member 2(KCNN2),OriGeneuniquevariant1 transcript variant1 variant b ariant 1 omo sapiensg amma-aminobutyric acid(GABA) xidase, EFhandcalcium-bindingdomain5(NOX5) www hannel, subfamilyK,member12 (KCNK12) .or ig ene.com A hannel, subfamilyM,member8(TRPM8),OriGene receptor, beta3(GABRB3),OriGeneunique TC1 Homosapienstransientreceptorpotentialcationchannel, subfamily V, member4 (TRPV4),transcript TC1 TC1 HomosapiensKvchannel interactingprotein 4(KCNIP4),OriGeneuniquevariant 1 NM_147204 Homosapienscalciumchannel, voltage-dependent, gamma subunit6(CACNG6), transcriptvariant2 TC123940 Homosapienscalciumchannel, voltage-dependent, gamma subunit6(CACNG6), transcriptvariant1 NM_147181 TC1 NM_145815 TC122145 Homosapienstransientreceptorpotentialcationchannel, subfamily V, member3(TRPV3) NM_145814 TC122178 HomosapiensFXYDdomaincontainingiontransport regulator5(FXYD5),transcriptvariant1 TC124006 NM_145068 TC1 NM_144779 TC122191 HomosapiensCHRNA7(cholinergic receptor, nicotinic,alphapolypeptide7, exons 5-10) andFAM7A TC122083 TC1 HomosapiensCHRNA7(cholinergic receptor, nicotinic,alphapolypeptide7, exons 5-10) andFAM7A NM_139320 TC124168 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member5(KCNH5), NM_139320 Homosapiensmegalencephalic leukoencephalopathy withsubcortical cysts1(MLC1),transcriptvariant2 TC122054 NM_139318 Homosapienspotassiumvoltage-gated channel, Shaw-related subfamily, member2(KCNC2),transcript NM_139202 TC122059 Homosapienstwoporesegmentchannel 2(TPCN2),OriGeneuniquevariant TC120679 NM_139137 NM_139075 TC109363 Homosapienspotassiumchannel tetramerisationdomaincontaining12 (KCTD12) TC122136 TC1 NM_138444 TC1 Homosapienspotassiumchannel, subfamilyK,member10 (KCNK10), transcriptvariant2 TC120461 TC1 Homosapienspotassiumvoltage-gated channel, subfamilyG,member4(KCNG4),transcriptvariant2 NM_138317 TC1 TC121923 NM_133490 TC1 Homosapiens5-hydroxytryptamine (serotonin)receptor3,familymemberC(HTR3C),OriGeneunique TC123125 T Homosapiens5-hydroxytryptamine (serotonin)receptor3,familymemberC(HTR3C), OriGeneunique NM_130770 Homosapienspotassiumvoltage-gated channel, Isk-relatedfamily, member4(KCNE4) TC122044 Homosapienscationchannel, spermassociated2(CATSPER2), transcriptvariant1 NM_130770 Homosapienspotassiumchannel, subfamilyK,member7(KCNK7),transcriptvariant A NM_080671 TC122110 NM_054020 TC123112 NM_033347 TC111509 Homosapiensgamma-aminobutyric acid(GABA) A receptor, gamma 3(GABRG3),OriGeneunique TC122210 Homosapienshypothetical proteinFLJ12770 (FLJ12770) T NM_033223 Homosapienspotassiumchannel tetramerisationdomaincontaining10 (KCTD10), OriGeneunique NM_032174 TC101325 Homosapienspotassiumchannel tetramerisationdomaincontaining10 (KCTD10) TC106147 NM_031954 Homosapienspotassiumchannel tetramerisationdomaincontaining10 (KCTD10), OriGeneunique NM_031954 TC122202 TC106747 Homosapienscalciumchannel, voltage-dependent, gamma subunit7(CACNG7), OriGeneunique NM_031954 Description TC122144 NM_031896 Accession No. TC122107 No. Cat. 126 M134 Homosapiensglutamatereceptor, ionotropic,N-methyl-D-aspartate 3A(GRIN3A) NM_133445 C122066 Homosapiensgamma-aminobutyric acid(GABA) A receptor, gamma 3(GABRG3) NM_033223 C122076 1 06 M123 Homo sapiensvitelliformmaculardystrophy 3(VMD2L3) 2-like Homo sapienshypothetical proteinFLJ31322 (FLJ31322) NM_152439 00666 NM_152387 00579 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member8(KCNH8) NM_144633 00185 23234 Homosapienstwoporesegmentchannel 2(TPCN2) Homosapienstwoporesegmentchannel 2(TPCN2),OriGeneuniquevariant1 NM_139075 NM_139075 22042 22067 2221 2207 23935 22063 0645 4 6 NM_1 NM_1 HomosapiensSH3KBP1bindingprotein1(SHKBP1) Homosapienspotassiumchannel, subfamilyK,member10 (KCNK10), transcriptvariant3 NM_138392 NM_138318 NM_1 NM_1 471 4581 3 52387 3497 3HomosapiensKvchannel interacting protein4(KCNIP4),transcriptvariant 83 4 variant 2 Homo sapienscalciumc (family withsequencesimilarity7A,exons A-E) fusion(CHRFAM7A), transcriptvariant1 (family withsequencesimilarity7A,exons A-E) fusion(CHRFAM7A), transcriptvariant1 OriGene uniquevariant1 variant 2 Homo sapienspotassiumchannel, subfamily V, member2(KCNV2) variant 1 variant 2 variant 1 variant 2 variant 1 variant 1 Homo sapiensh h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: ypothetical proteinFLJ31 hannel, voltage-dependent, gamma subunit6(CACNG6), transcriptvariant1 322 (FLJ31 322), OriGeneuniquevariant1 39 CloneSet: Gene-family based collection TrueClone™ 40 CloneSet: Gene-family based collection TrueClone™ C212N_715HomosapiensKvchannel interactingprotein 2(KCNIP2),transcriptvariant6 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member 7(KCNH7), NM_173195 HomosapiensFXYDdomaincontaining iontransport regulator4(FXYD4),OriGene uniquevariant1 TC122112 NM_173162 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member5(KCNH5), NM_173160 TC122143 TC101212 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member 5(KCNH5), NM_172376 TC122092 Homosapienscalciumchannel, voltage-dependent, alpha2/deltasubunit4(CACNA2D4), transcript NM_172376 TC111240 NM_172364 TC123965 TC1 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, betamember2(KCNAB2), TC1 Homosapienspotassiumvoltage-gated channel, KQT-like subfamily, member2(KCNQ2),transcript NM_172130 Homosapienscationchannel, spermassociated 2(CATSPER2), OriGeneuniquevariant2 TC123941 Homosapienscationchannel, spermassociated 2(CATSPER2), OriGeneuniquevariant1 NM_172109 NM_172097 TC122047 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member2(KCNH2), NM_172097 TC122172 TC122127 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member2(KCNH2), NM_172057 TC109366 Homosapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member2(KCNH2), NM_172057 TC124103 NM_172056 TC123313 channel, Homosapienspotassiumlargeconductance calcium-activated subfamilyMbetamember3 TC1 channel, Homosapienspotassiumlargeconductance calcium-activated subfamilyMbetamember3 NM_171829 TC123933 channel, Homosapienspotassiumintermediate/smallconductancecalcium-activated subfamilyN, NM_171828 TC123922 NM_170782 TC124009 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member14 (KCNJ14), transcript HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, uniquevariant1 2(P2RX2),OriGene T NM_170720 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member1(KCNJ1),transcript NM_170683 TC122206 TC122195 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member1(KCNJ1),transcript NM_153767 TC123939 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member1(KCNJ1), transcript NM_153767 TC122199 NM_153765 Homosapienspotassiumchannel tetramerisationdomaincontaining6(KCTD6) TC124158 Homosapiensvitelliformmaculardystrophy2(VMD2L2),OriGeneuniquevariant1 2-like Homosapiensgap junctionprotein,beta4(connexin30.3)(GJB4) NM_153331 T Homosapiensgap junctionprotein,beta4(connexin30.3)(GJB4) NM_153274 TC100338 Homosapienspotassiumchannel tetramerisationdomaincontaining7(KCTD7) NM_153212 TC122213 NM_153212 TC122098 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member4(KCNJ4),transcript NM_153033 TC123292 Description TC100993 NM_152868 Accession No. TC123919 No. Cat. 124 M104 Homosapienspotassiuminwardly-rectifying channel, subfamilyJ, member16 (KCNJ16), transcript NM_170742 C122146 Homosapienspotassiumvoltage-gated channel, Shaw-related subfamily, member2(KCNC2), NM_153748 C109364 09907 221 23979 1 M125 Homosapienspotassiumvoltage-gated channel, shaker-related subfamily, betamember1(KCNAB1), NM_172159 1 NM_1 NM_1 72056 721 59 transcript variant2 transcript variant2 transcript variant2 variant 1 transcript variant3 transcript variant2 variant 5 OriGene uniquevariant1 transcript variant3 transcript variant2 transcript variant2 Homo sapienspotassiumvoltage-gated channel, subfamilyH(eag-related),member2(KCNH2), (KCNMB3), transcriptvariant2 (KCNMB3), transcriptvariant1 member 3(KCNN3),OriGeneuniquevariant1 variant 3 variant 2 variant rom-k5 variant rom-k5 variant rom-k3 transcript variant3 variant 1 transcript variant3 Homo sapienspotassiumv www oltage-gated channel, shaker-related subfamily, betamember1(KCNAB1), .or ig ene.com C188N_049Homosapienscytochrome P450,family 1, subfamily A, polypeptide1(CYP1A1) NM_000499 TC119858 Homosapienscytochrome P450,family 2, subfamilyD,polypeptide6(CYP2D6) TC1 Homosapienscytochrome P450,family 17, subfamily NM_000106 A, polypeptide1(CYP17A1) TC1 TC104446 Description NM_000102 TC1 Accession No. TC102224 No. Cat. P450 CloneSet TC1 TC1 Homosapienshyperpolarizationcyclicnucleotide-gated activated potassiumchannel 3(HCN3),OriGene TC1 XM_086565 PREDICTED:Homosapienspotassiumchannel, subfamily T, member1(KCNT1) TC122071 TC1 Homosapienscalciumchannel, voltage-dependent, beta2subunit(CACNB2), transcriptvariant6 XM_029962 TC1 Homosapienscalciumchannel, voltage-dependent, beta2subunit(CACNB2), transcriptvariant7 TC123990 Homosapienscalciumchannel, voltage-dependent, beta1subunit(CACNB1), transcriptvariant3 NM_201571 TC1 Homosapienspotassiumchannel tetramerisationdomaincontaining1(KCTD1),OriGeneuniquevariant NM_201570 TC122200 Homosapienspotassiumchannel tetramerisationdomaincontaining1(KCTD1) NM_199248 TC122187 Homosapiensaquaporin1(channel-forming integralprotein,28kDa)(AQP1), transcriptvariant1 NM_198991 TC121950 moietyX)-typemotif9(NUDT9),transcriptvariant2 Homosapiensnudix(nucleosidediphosphatelinked NM_198991 TC122075 Homosapiensglutamatereceptor, ionotrophic, AMPA 3(GRIA3),OriGeneuniquevariant1 NM_198098 TC121140 Homosapiensphosphatidylinositoltransferprotein,cytoplasmic1(PITPNC1),transcriptvariant2 NM_198039 TC121943 Homosapiensligand-gated ionchannel subunit(LGICZ) NM_181894 TC107729 Homosapienspotassiumchannel tetramerisationdomaincontaining13 (KCTD13) NM_181671 TC122130 Homosapienscationchannel, spermassociated3(CATSPER3) NM_180990 TC122192 HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, uniquevariant1 7(P2RX7),OriGene NM_178863 TC122050 Homosapiensglutamatereceptor, 2(GRIK2),OriGeneuniquevariant1 ionotropic,kainate NM_178019 TC107237 Homosapiensglutamatereceptor, 1(GRIK1),transcriptvariant2 ionotropic,kainate NM_177427 TC123945 HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, 4(P2RX4),transcriptvariant3 NM_175768 TC122097 Homosapienssodiumchannel, voltage-gated, typeIV, beta(SCN4B) NM_175611 TC109282 HomosapienspurinergicreceptorP2X,ligand-gated ionchannel, 2(P2RX2),transcriptvariant NM_175568 TC121962 Homosapienschloride channel 3(CLCN3),OriGeneuniquevariant1 NM_174934 TC108426 Homosapienschromosome 1 6openreadingframe69(C6orf69),OriGeneuniquevariant NM_174873 TC123982 Homosapienschromosome 6openreadingframe69(C6orf69),OriGeneuniquevariant2 NM_173872 TC122102 Homosapienschromosome 6openreadingframe69(C6orf69) NM_173562 TC122103 Homosapiensgamma-aminobutyric acid(GABA) A receptor, gamma 1(GABRG1) NM_173562 TC122096 NM_173562 TC122121 Description NM_173536 TC124180 Accession No. TC101135 No. Cat. 03335 27 R004 PREDICTED:Homosapienstransientreceptorpotentialcationchannel, subfamilyC,member2 PREDICTED:Homosapiensmucolipin2(MCOLN2) XR_000147 XM_371263 22173 23930 21 22041 21 221 23879 20793 931 935 35 NM_20 XM_291 XM_086565 XM_04361 NM_0 NM_0 NM_0 0 0 0 1 14Homosapienscytochrome P450,family1,subfamilyB,polypeptide1(CYP1B1) 0104 16Homosapienscytochrome P450,family2,subfamily D,polypeptide6(CYP2D6),OriGeneunique 0497 0106 095 572 PREDICTED:Homosapiensglutamatereceptor, ionotropic,delta1(GRID1) 3 (TRPC2), miscRNA PREDICTED: Homosapienssimilartoglutamatereceptor unique variant1 Homo sapiensh Homo sapienscalciumc (LOC339970) encoding mitochondrial protein Homo sapienscytoc variant 1 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: yperpolarization activated cyclicnucleotide-gatedyperpolarization activated potassiumchannel 3(HCN3) hrome P450,family11, subfamilyB,polypeptide1(CYP11B1), nuclear gene hannel, v oltage-dependent, beta2subunit(CACNB2), OriGeneuniquevariant1 , ionotropic, N-meth yl D-aspar tate-lik e 1A 41 CloneSet: Gene-family based collection TrueClone™ 42 CloneSet: Gene-family based collection TrueClone™ C282N_023Homosapienscytochrome P450,family 4, subfamilyF, polypeptide8(CYP4F8) Homosapienscytochrome P450,family 4, subfamilyF, polypeptide8(CYP4F8) Homosapienscytochrome P450,family 46, subfamily A, polypeptide1(CYP46A1) NM_007253 TC1 Homosapienscytochrome P450,family 46, subfamily A, polypeptide1(CYP46A1) NM_007253 TC120812 Homosapienscytochrome P450,family 7, subfamilyB,polypeptide1(CYP7B1) NM_006668 TC123877 NM_006668 TC122753 NM_004820 TC120806 TC117125 Homosapiensthromboxane A synthase1(platelet,cytochrome P450,family5,subfamily A) (TBXAS1), TC1 TC1 HomosapiensP450(cytochrome) oxidoreductase (POR) NM_001061 TC109823 Homosapiensprocollagen-proline,2-oxoglutarate 4-dioxygenase (proline4-hydroxylase), alpha NM_000941 TC1 TC100401 NM_000917 Homosapienscytochrome P450,family 4, subfamilyF, polypeptide3(CYP4F3) TC110967 NM_000896 TC1 Homosapienscytochrome P450,family27, subfamilyB,polypeptide1(CYP27B1), nucleargeneencoding TC119595 TC1 Homosapienscytochrome P450,family27, subfamily A, polypeptide1(CYP27A1),nucleargeneencoding NM_000785 TC123873 Homosapienscytochrome P450,family26,subfamily A, polypeptide1(CYP26A1), OriGeneuniquevariant1 NM_000784 TC119685 NM_000783 TC1 TC109141 Homosapienscytochrome P450,family7, subfamily A, polypeptide1(CYP7A1) T Homosapienscytochrome P450,family4,subfamilyB,polypeptide1(CYP4B1) NM_000780 TC1 Homosapienscytochrome P450,family4,subfamily A, polypeptide11 (CYP4A11), OriGeneuniquevariant1 TC123882 NM_000779 TC1 Homosapienscytochrome P450,family3,subfamily A, polypeptide5(CYP3A5) NM_000778 TC119683 Homosapienscytochrome P450,family2,subfamilyJ, polypeptide2(CYP2J2) TC119682 Homosapienscytochrome P450,family2,subfamilyF, polypeptide1(CYP2F1),OriGeneuniquevariant2 NM_000777 TC1 Homosapienscytochrome P450,family2,subfamilyF, polypeptide1(CYP2F1),OriGeneuniquevariant NM_000775 TC120801 Homosapienscytochrome P450,family2,subfamilyE,polypeptide1(CYP2E1) NM_000774 TC119679 Homosapienscytochrome P450,family2,subfamilyC,polypeptide18 (CYP2C18) NM_000774 TC120804 Homosapienscytochrome P450,family2,subfamilyC,polypeptide9(CYP2C9) NM_000773 TC120795 Homosapienscytochrome P450,family2,subfamilyB,polypeptide6(CYP2B6) NM_000772 TC119678 Homosapienscytochrome 3,subfamily P450,family A, polypeptide7(CYP3A7) NM_000771 TC120796 NM_000767 TC119677 Homosapienscytochrome 2,subfamily P450,family A, polypeptide7(CYP2A7),transcriptvariant1 NM_000765 TC119674 Homosapienscytochrome 2,subfamily P450,family A, polypeptide6(CYP2A6) TC110865 Homosapienscytochrome 2, subfamily P450,family A, polypeptide6(CYP2A6),OriGeneuniquevariant1 NM_000764 T Homosapienscytochrome 1, subfamily P450,family A, polypeptide2(CYP1A2) NM_000762 TC120800 Homosapienscytochrome P450,family21,subfamily A, polypeptide2(CYP21A2) NM_000762 TC120818 NM_000761 TC119672 Homosapienscytochrome P450,family21,subfamily A, polypeptide2(CYP21A2),OriGeneunique NM_000500 TC119671 Description TC120802 NM_000500 Accession No. TC119859 No. Cat. 138 M008 Homosapienscytochrome P450,family26,subfamily A, polypeptide1(CYP26A1),transcriptvariant NM_000783 C123884 Homosapienscytochrome 2,subfamily P450,family A, polypeptide7(CYP2A7),transcriptvariant1 NM_000764 C124911 98 M008 Homosapienscytochrome P450,family51,subfamily A, polypeptide1(CYP51A1) NM_000786 19686 1 08802 20807 23875 2081 23897 20788 2081 23885 9684 4 7 NM_0 M018 Homosapienscytochrome P450,family 4,subfamilyF, polypeptide2(CYP4F2) NM_001082 NM_0 NM_0 NM_0 NM_0 NM_0 NM_0 NM_0 0 Homosapiensprocollagen-proline,2-oxoglutarate 4-dioxygenase (proline4-hydroxylase), alpha 00917 0 Homosapienscytochrome P450,family11, subfamily A, polypeptide1(CYP11A1), nucleargeneencoding 00781 0 0 04391 07253 91HomosapiensprostaglandinI2(prostacyclin)synthase(PTGIS) 0961 0783 0779 0778 transcript variant TXS-I polypeptide I(P4HA1) polypeptide I(P4HA1),OriGeneuniquevariant1 mitochondrial protein mitochondrial protein Homo sapienscytoc mitochondrial protein Homo sapienscytochrome P450,family4,subfamilyB,polypeptide1(CYP4B1),OriGeneuniquevariant Homo sapienscytochrome P450,family4,subfamily A, polypeptide11 (CYP4A11) variant 1 Homo sapienscytoc Homo sapienscytoc hrome P450,family26,subfamily A, polypeptide1(CYP26A1),transcriptvariant hrome P450,family8,subfamilyB,polypeptide1(CYP8B1) hrome P450,family4,subfamilyF www .or ig ene.com , polypeptide 8(CYP4F8),OriGeneunique variant 1 C286X_905Homosapienssimilarto25-hydroxyvitamin D-1alphahydroxylase, mitochondrial precursor Homosapienshypothetical proteinLOC285440 (LOC285440) PREDICTED:Homosapienscytochrome P450, family4,subfamily A, polypeptide22(CYP4A22) XM_291005 XM_209612 TC123886 Homosapienscytochrome P450,family2,subfamilyB,polypeptide7pseudogene1(CYP2B7P1)on XM_208213 TC120790 Homosapienscytochrome P450,family2,subfamilyU, polypeptide1(CYP2U1) TC120791 NR_001278 Homosapienscytochrome1 (CYP4X1) P450,family4,subfamilyX,polypeptide NM_183075 TC106908 Homosapienscytochrome P450,family4,subfamilyX,polypeptide1(CYP4X1),OriGeneuniquevariant TC120792 Homosapienscytochrome P450,family20,subfamily A, polypeptide1(CYP20A1),transcriptvariant NM_178033 TC1 Homosapienscytochrome P450,family19, subfamily A, polypeptide1(CYP19A1), transcriptvariant2 NM_178033 TC120798 Homosapienscytochrome P450,family2,subfamilyC,polypeptide8(CYP2C8),transcript variantHp1-2 NM_177538 TC107078 NM_031226 TC107001 Homosapienscytochromefamily 2,subfamilyC,polypeptide8(CYP2C8),OriGene unique P450, NM_030878 TC107980 Homosapienscytochrome P450,family2,subfamilyS,polypeptide1(CYP2S1),OriGeneuniquevariant TC120816 Homosapienscytochrome P450,family2,subfamilyR,polypeptide1(CYP2R1) NM_030878 Homosapienscytochrome P450,family4,subfamilyF, polypeptide12 NM_030622 (CYP4F12) TC109139 Homosapienscytochrome P450,family4,subfamilyF, polypeptide12 NM_024514 (CYP4F12) TC109968 Homosapienscytochrome P450,family4,subfamilyF, polypeptide11 NM_023944 (CYP4F11) TC120811 Homosapienscytochrome P450,family26,subfamilyB,polypeptide1(CYP26B1),OriGeneuniquevariant NM_023944 TC122941 Homosapienscytochrome P450,family26,subfamilyB,polypeptide1(CYP26B1) NM_021187 TC120808 Homosapienscytochrome P450,family2,subfamily W, polypeptide1(CYP2W1) NM_019885 TC112952 Homosapienscytochrome P450,family3,subfamily A, polypeptide4(CYP3A4),transcriptvariant1 NM_019885 TC120809 Homosapienscytochromesubfamily P450,family39, A, polypeptide1(CYP39A1) NM_017781 TC120799 NM_017460 TC120787 Description NM_016593 TC120794 Accession No. TC114150 No. Cat. 2387 4 NM_1 781 34 (VD3 1Ahydroxylase) (P450C1alpha)(P450VD1-alpha) (LOC339761) (Calcidiol 1-monooxygenase) (25-OHD-1alpha-hydroxylase) (25-hydroxyvitamin D(3)1-alpha-hydroxylase) chromosome 19 Homo sapienscytochrome P450,family4,subfamilyZ,polypeptide1(CYP4Z1) variant 1p1-2 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 43 CloneSet: Gene-family based collection TrueClone™ 44 www.origene.com HuSH™ Premade shRNA expression panels

Kinase shRNAs

Nuclear hormone receptor shRNAs

Signal molecule shRNAs pRS vectors HuSH™—Premade shRNA expression panels

Product Listing Cat. No. Price

HuSH™ shRNA panels TRXXXXXX 380

Introduction: ™

H As a cellular defense mechanism, host cells process (siRNA) or short hairpin RNA (shRNA). Experiments

S double-stranded RNA into small interfering RNA have indicated that both siRNA and shRNA are also u (siRNA), which then targets homologous RNAs for far more potent than hammerhead ribosome H destruction1. RNAi occurs through a series of steps ribozymes based approaches3. In mammalian cells, involving the generation of small interfering RNAs RNA interference (RNAi) can be triggered by 21- s l

e (siRNAs) in vivo via the action of a specific RNAase III base-pair siRNA that causes strong, yet transient, n 4 a endonuclease Dicer.The resulting siRNAs mediate the inhibition of gene expression on specific genes . p

n degradation of their complementary RNA by o i s

s association of the siRNA with a nuclease complex to These siRNAs can be generated in vitro and e r

p form what is called the RNA-Induced Silencing transfected into mammalian cells, resulting in x

e Complex (RISC). In the next step, an unwinding of the effective suppression of the intended genes. A

N siRNA occurs which activates RISC. It is the activated Unfortunately, such suppression is typically R h

s RISC that binds to the target mRNA and finally leads transient. By contrast, vector-expressing short

e 2

d to the loss of expression of the gene it coded . hairpin RNA (shRNA) can suppress gene expression a (5,6)

m over a prolonged period . The unique advantages e r

P RNAi technology can be implemented mainly with of the plasmid-based shRNA approach are listed either small interference double stranded RNA below.

Features Plasmid based vectors Synthetic siRNA

Antibiotic resistance for selection Yes No

Monitor cell transfection efficiency Yes No

Cost per gene Moderate High

Gene inhibition studies Long term Short term

Stable cell line production Yes No

Effective delivery of siRNA into hard to transfect cells Yes No

1. Unlocking the potential of the human genome with RNA interference. 4. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2004 Sep 16;431(7006):371-8. Nature. 2001 May 24;411(6836):494-8.

2. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 5. A system for stable expression of short interfering RNAs in mammalian cells. nucleotide intervals. Science. 2002 Apr 19;296(5567):550-3. Cell. 2000 Mar 31;101(1):25-33. 6. Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. 3. siRNAs: applications in functional genomics and potential as therapeutics. Genes Dev. 2002 Apr 15;16(8):948-58. Nat Rev Drug Discov. 2004 Apr;3(4):318-29.

46 www.origene.com in humancells toachieve stableandreliablegene (shor shRNA With theHuSHshRNAexpression vectors, recognition andcleavethetarget mRNA. will findthetargetmRNAthrough specificsequence RISC complexes.Onceinthecomplexes,they andincorporatedinto is tobeprocessedbyDicers, following thehairpinsequences. The resultingshRNA sequence toensuretheterminationoftranscription trac human U6promotertoexpresstheshRNA. A poly-T HuSH plasmidsutilize themostcommonlyused functions havebeenvalidated. selection mark cassette andtheselectionmarker. Boththe viral integrationsitesflankingthegenesilencing puromycin selectablemarker, andapairofretro- more. Inaddition,thepRSplasmidcontainsa capable ofinhibitingthetargetgenesby70%or average, morethan25%oftheshRNAtestedare protein, luciferaseandHER2oncogene.On knoc OriGene expression oftargetgenes. shown tobeableef and a10-nucleotide loop.Such astructurehasbeen formation ofashort hairpinRNAwitha21bpstem sequence inmammaliancellsresultsthe nation sequence. The expressionoftheinsert complement sequence,andatranscriptiontermi- another 21basepairgene-specificreverse specific sequences,a10 bpinterveningsequence, contain aU6promoter, 21basepair(bp)gene- cells. OriGenegene-specificsilencingplasmids the insert DNAsequencesintransfectedmammalian HuSH plasmidsweredesignedtoeffectively express expression plasmids? What are HuSH™shRNA Product Description k k-down theexpressionofgreenfluorescence t-hairpin RNA) canbeexpressedcontinuously is added immediatelydownstreamofthehairpin ’ s HuSH plasmidshavebeenshownto er andtheretro fecti ph: vely knoc 1 .888.267 viral integration k-down the .4436 f ax: 1 Enable stablecelllineproduction .30 Puromycin Non-exhaustible supplyofDNA Ready-to-transfect constructs Multiple vector optimized/dosed inhibition 1 .340.9254 More effective delivery ADVANTAGES R marker forselection marker s to ac hieve 47 Premade shRNA expression panels HuSH™ silencing. By establishing stable cell lines with effective shRNA expression vectors, one can perform long term gene silencing studies, eliminating the need to synthesize siRNA, repeat transfection, and validate, as well as eliminating the experimental variation frequently associated with siRNA.

The HuSH backbone pRS vector (Fig. 1):

• Designed for long-term gene silencing studies • MMLV LTR sequences for establishing stable cell lines via retroviruses ™ • Puromycin resistant marker for easy selection of H infected or transfected cells S

u • U6 polymerase III promoter for shRNA expression H

s Why should I buy a HuSH mammalian l e

n shRNA expression plasmid rather a p than a synthetic siRNA? n o i s s

e HuSH plasmids offer researchers an alternative to r p

x inhibiting target genes. There are several advantages e

A to this expression plasmid based approach:

N Fig. 1 R 1. Long-term gene silencing: h

s shRNA oligos The length of gene silencing can be longer as the e d

a plasmid continuously expresses the shRNA of the

m Bbs I

e plasmid. In contrast, synthetic siRNAs either get r BamH I Hind III P Sal I diluted during cell division or are degraded. U6 promoter SV40 early promoter 2. Drug-selectivity: Eco R I Puro When the transfection efficiency is limited, one can select plasmid-transfected cells with puromycin to Cla I ensure efficient gene silencing. pRS 3. Retroviral capacity: 5‘ LTR 3‘ LTR One can obtain stable cell lines either through plas- 5522 bp mid transfection or viral infection via a packaging cell line. 4. Inexhaustible supply: Ampicillin The plasmids can be amplified and thus represent pBS Ori an unlimited source for future experiments. Not I

pRS plasmid map. The shRNA oligos will be cloned between What is the U6 promoter? BamHI and BbsI, immediately downstream of U6 promoter. A puromycin selection marker is present. Both 5’ and 3’ LTRs are The pRS plasmid contains the human U6 promoter from MMLV and used to generate retroviruses in appropriate that has been used extensively to express shRNAs in packaging cells. mammalian cells through RNA Poll III. This promoter

48 www.origene.com vector protein toverifythefunctionality oftheshRNA blot analysisusinganantibody ag cell lysatescanbeobtained andusedforwestern cell linewithFuGene6. Three daysafter transfection, The plasmidscanthenbetransfectedintoatarget competent an aliquotofeach ofthesuppliedplasmidsinto OriGene recommendsthatresearchers transfect first Ho in >70%inhibitionofthetargetgenes. resulted approximately 25-30%oftheshRNAvectors Based onexperimentsconductedatOriGene, shRNA expression vectors pergene? Why doesOriGene provide upto 8 matched against thetargetgenes. verified throughDNAsequenceanalysisand All shRNAsequencesintheexpressionvector sequences for specificgenes? How doesOriGene verify theshDNA following theshRNAsequences. leads totranscriptionterminationimmediately A How doesthetranscription terminate? provided. corresponding locationsofthetargetgenesare target genesequences.Boththesequencesand DNA sequenceanalysisandmatched against the e restriction enzymedigestionapproach. All shRNA cDNA ofthetargetgenesthrougharandom The shDNAinserts weregenerateddirectlyfromthe inserted downstream ofU6promoter? What isthegene specificshDNA knock-down experiments. has beenvalidatedintheHuSHplasmidviagene immediately after theshRNAsequences. This dT can obtainatleastonefunctionalshRNAvector. virtuallyshRNA expressionvectors ensuresthatone xpression cassette sequenceswereverifiedvia stretch of5thymidine nucleotides(dT w s. should Iusethepr E. coli cells andperformaDNAmini-prep. ph: oducts? 1 .888.267 ainst thetarget 5 ) is attached T esting 8 .4436 f s were 5 cells line( into aPhoenixhelperfreeamphotropicpackaging example, theplasmidcanbetransientlytransfected retro packaging celllinescanbeusedto generate with passagesasneeded. Alternatively, retroviral be selectedwith0.5ug/mlpurom days after transfection,thetransfectedHEKcellscan with afunctionallyvalidatedshRNAplasmid. Two approaches. targetHEKcellscan be transfected First, Stable celllinescanbegeneratedusingtwodifferent functional shRNAexpression vector? How canIcreate astablecelllinewith puromycin (0.5ug/ml). selected outwithculturemediacontaining removed fromtheplatesviatrypsin,platedand Yes. Two daysafter transfection,thecellscanbe transfected cells? Can Iselectfor thepRS plasmid transfected cells. need tobeselectedexperimentallyintransiently shRNAexpressionplasmids The functionallyactive e How doIchoose theright shRNA are sequence verifi OriGene guaranteesallshRNA expressioncassettes g What doesOr to any humanexpressedsequence. sequence fromgreenfluorescenceprotein,unrelated for thispurpose;theinserted cassette containsa known asinterferonresponse.pRS-Conw gene specific,andisnotduetothenon-specificeffect that theeffect vectoris ofaspecificshRNA expression For shRNAexperiments,itisimportant todemonstrate empty pRS-Con used? F cell linescanbeestablishedfollowingdrugselection. filtered, andusedtoinfectthetargetcelllines.Stable transfection, thecellculturesupernatantiscollected, ax: or whatpur xpression vector for gene silencing? ar ds t viruses forstablecelllinegeneration.Inone 1 .30 o ht 1 its shRNAexpr .340.9254 tp://www pose isthe iGene guar ed. The pRSexpression plasmid .orbig en.com/ ession plasmids? ant ycin o ee withr ). T wo daysaf ver oneweek as designed e - ter 49 Premade shRNA expression panels HuSH™ 50 Premade shRNA expression panels HuSH™ i.2 Fig. www .origene.com • Keywords • AccessionorCatalogNumber • NucleotideSequence, Protein Sequence • properties ofthetargetgenes. The search criteriaare: website http://www.origene.com/rna/ basedonthe HuSH productscanbesearched onOriGene’s Application ofHuSHproductsisillustratedinFig.2. are usedingeneratingthestablecelllines. lik cassette andtoinfectthetargetcells.Itismuch more retroviruses containingtheshRNAhairpinexpression that aretrovirual packaging celllineisusedtogenerate purom generated viaplasmidtransfectionfollowedby While itispossiblethatstablecelllinescanbe cell linesforlong-termgenesilencing. use eitherintransientstudiesorgeneratingstable experiments andselecttheappropriateconstructsto tions oftheshRNAexpressionconstructsintransient verifythefunc- is stronglyrecommendedthatusers As istoensureoptimizedtors inhibitedgeneexpression. panel foreach targetgene. The multiplicityofthevec- For allHuSHproducts,3-8 constructs areprovided asa Signalmolecules • Nuclearhormonereceptors • Protein kinases • Currently HuSHproductsarefocusedon HuSH plasmids: Product Application: protein, luciferaseandhumanHER2oncogene. gene silencingstudiesagainst greenfluorescence havebeentestedforproducingshRNAin vectors Gene F ely thattheshRNAwillbeexpressedifretro the shRNAconstructsareonlysequenceverified,it ycin drugselection,itishighlyrecommended amily viruses HuSH™—Premade shRNA expression panels

Cat# GeneID/LocusID description price

TR200002 90 HuSH ACVR1 shRNA Constructs against activin A receptor, type I 380

TR200003 91 HuSH ACVR1B shRNA Constructs against activin A receptor, type IB 380

TR200004 157 HuSH ADRBK2 shRNA Constructs against adrenergic, beta, receptor kinase 2 ) 380

TR200005 207 HuSH AKT1 shRNA Constructs against v-akt murine thymoma viral oncogene homolog 1 380

TR200006 369 HuSH ARAF1 shRNA Constructs against v-raf murine sarcoma 3611 viral oncogene homolog 1 380

TR200007 659 HuSH BMPR2 shRNA Constructs against bone morphogenetic protein receptor, type II (serine/threonine kinase) 380 ™

TR200008 660 HuSH BMX shRNA Constructs against BMX non-receptor tyrosine kinase 380 H

TR200009 676 HuSH BRDT shRNA Constructs against bromodomain, testis-specific 380 S

TR200010 695 HuSH BTK shRNA Constructs against Bruton agammaglobulinemia tyrosine kinase 380 u H TR200011 780 HuSH DDR1 shRNA Constructs against discoidin domain receptor family, member 1 380

TR200012 815 HuSH CAMK2A shRNA Constructs against calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha 380 s

TR200013 818 HuSH CAMK2G shRNA Constructs against calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma 380 l e

TR200014 984 HuSH CDC2L1 shRNA Constructs against cell division cycle 2-like 1 (PITSLRE proteins) 380 n a p

TR200015 1017 HuSH CDK2 shRNA Constructs against cyclin-dependent kinase 2 380 n o i

TR200016 1018 HuSH CDK3 shRNA Constructs against cyclin-dependent kinase 3 380 s s e

TR200017 1019 HuSH CDK4 shRNA Constructs against cyclin-dependent kinase 4 380 r p x

TR200018 1020 HuSH CDK5 shRNA Constructs against cyclin-dependent kinase 5 380 e

TR200019 1022 HuSH CDK7 shRNA Constructs against cyclin-dependent kinase 7 (MO15 homolog, Xenopus laevis, cdk- 380 A N

activating kinase) R h s TR200020 1111 HuSH CHEK1 shRNA Constructs against CHK1 checkpoint homolog (S. pombe) 380 e d

TR200021 1195 HuSH CLK1 shRNA Constructs against CDC-like kinase 1 380 a m

TR200022 1198 HuSH CLK3 shRNA Constructs against CDC-like kinase 3 380 e r P TR200023 1326 HuSH MAP3K8 shRNA Constructs against mitogen-activated protein kinase kinase kinase 8 380

TR200024 1436 HuSH CSF1R shRNA Constructs against colony stimulating factor 1 receptor, formerly McDonough feline 380 sarcoma viral (v-fms) oncogene homolog

TR200025 1452 HuSH CSNK1A1 shRNA Constructs against casein kinase 1, alpha 1 380

TR200026 1453 HuSH CSNK1D shRNA Constructs against casein kinase 1, delta 380

TR200027 1455 HuSH CSNK1G2 shRNA Constructs against casein kinase 1, gamma 2 380

TR200028 1456 HuSH CSNK1G3 shRNA Constructs against casein kinase 1, gamma 3 380

TR200029 1457 HuSH CSNK2A1 shRNA Constructs against casein kinase 2, alpha 1 polypeptide 380

TR200030 1760 HuSH DMPK shRNA Constructs against dystrophia myotonica-protein kinase 380

TR200031 2041 HuSH EPHA1 shRNA Constructs against erythropoietin-producing hepatoma A1 380

TR200032 2042 HuSH EPHA3 shRNA Constructs against erythropoietin-producing hepatoma A3 380

TR200033 2043 HuSH EPHA4 shRNA Constructs against erythropoietin-producing hepatoma A4 380

TR200034 2044 HuSH EPHA5 shRNA Constructs against erythropoietin-producing hepatoma A5 380

TR200035 2050 HuSH EPHB4 shRNA Constructs against erythropoietin-producing hepatoma B4 380

TR200036 2051 HuSH EPHB6 shRNA Constructs against erythropoietin-producing hepatoma B6 380

TR200037 2064 HuSH ERBB2 shRNA Constructs against v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, 380 neuro/glioblastoma derived oncogene homolog (avian)

TR200038 2065 HuSH ERBB3 shRNA Constructs against v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 380

TR200039 2185 HuSH PTK2B shRNA Constructs against PTK2B protein tyrosine kinase 2 beta 380

Product offering is subject to change. Refer to www.origene.com for the most updated information.

ph: 1.888.267.4436 fax: 1.301.340.9254 51 52 Premade shRNA expression panels HuSH™ R00258 uHPKQsRACntut gis rti iaeC ht 380 380 380 380 380 380 proteinkinase6 HuSHMAPK6shRNAConstructs against mitogen-activated 380 380 380 HuSHPRKCQshRNAConstructs against proteinkinaseC,theta HuSHPRKCHshRNAConstructs against proteinkinaseC,eta 5597 P 380 HuSHPRKCGshRNAConstructs against proteinkinaseC,gamma 380 TR200084 5588 TR20 HuSHPRKCB1shRNAConstructs against proteinkinaseC,beta1 5583 TR200082 HuSHPRKACG shRNAConstructs against proteinkinase,cAMP-dependent, catalytic,gamma 5582 TR200081 HuSHPRKACB shRNAConstructs against proteinkinase,cAMP-dependent, catalytic,beta TR200080 HuSHPRKAA1shRNAConstructs against proteinkinase, AMP-activated, alpha1catalyticsubunit 5579 TR20 kinase1(Drosophila) HuSHPLKshRNAConstructsagainst polo-like 380 5568 TR200078 5567 380 TR200077 380 5562 380 TR200076 HuSHPCTK1shRNAConstructsagainst PCTAIRE proteinkinase1 380 5347 380 TR200075 HuSHPAK3 shRNAConstructsagainstkinase3 p21(CDKN1A)-activated TR200074 HuSHPAK1 shRNAConstructsagainst p21/Cdc42/Rac1-activated kinase1(STE20 homolog,yeast) TR20 5127 TR20 5063 TR200071 380 5058 TR200070 380 HuSHNEK2shRNAConstructsagainst NIMA(neverinmitosisgenea)-relatedkinase2 TR200069 380 TR20 HuSHMYLKshRNAConstructsagainst myosin, lightpolypeptidekinase TR20 380 380 4751 TR20 HuSHMAKshRNAConstructsagainst malegermcell-associatedkinase 380 TR200065 HuSHLIMK2shRNAConstructsagainst LIMdomainkinase2 4638 TR20 HuSHLIMK1shRNAConstructs against LIMdomainkinase1 TR200063 380 HuSHLCKshRNAConstructsagainst lymphocyte-specificproteintyrosinekinase 4117 T 3985 TR200061 3984 380 TR200060 3932 HuSHJAK1 shRNAConstructs against 380 Janus kinase1(aproteintyrosinekinase) TR200059 380 HuSHITKshRNAConstructs against IL2-inducible TR200058 T-cell kinase HuSHIRAK2shRNAConstructs against interleukin-1receptor-associated kinase2 TR20 380 kinase HuSHILKshRNAConstructs against integrin-linked 380 3716 TR20 380 lightpolypeptidegeneenhancerinB-cells,kinasebeta HuSHIKBKBshRNAConstructs against inhibitorofkappa 3702 TR200055 HuSHHCKshRNAConstructs against hemopoieticcellkinase 380 3656 TR200054 HuSHGSK3BshRNAConstructs against glycogensynthasekinase3beta 3611 TR200053 HuSHMKNK2shRNAConstructsagainst MAPkinaseinteractingserine/threonine2 3551 TR200052 HuSHGPRK5shRNAConstructsagainst Gprotein-coupledreceptorkinase5 380 3055 TR200051 2932 TR200050 HuSHFRAP1shRNAConstructsagainst FK506bindingprotein12-rapamycin associatedprotein1 2872 TR200049 HuSHFLT4 shRNAConstructsagainst fms-relatedtyrosinekinase4 2869 380 TR200048 HuSHFGRshRNAConstructsagainst Gardner-Rasheed felinesarcomaviral(v-fgr) oncogenehomolog TR200047 HuSHFGFR4shRNAConstructsagainst fibroblastgrowthfactorreceptor4 2475 T 2324 HuSHFGFR1shRNAConstructsagainst fibroblastgrowthfactorreceptor1(fms-relatedtyrosinekinase2, TR200045 2268 HuSHFESshRNAConstructsagainst felinesarcomaoncogene TR200044 2264 TR200043 TR200042 2260 description 2242 GeneID/LocusID TR200041 TR200040 Cat# roduct of 206 10HS AK hN osrcsaantMPmcouueafiiyrgltn iae3380 HuSHMARK3shRNAConstructsagainst MAP/microtubuleaffinity-regulating kinase3 4140 R200062 380 HuSHFYNshRNAConstructsagainst FYNoncogenerelatedtoSRC,FGR, YES 2534 R200046 0 0256 uHPK hN osrcsaantprvt eyrgns iae sezm 380 380 0 380 HuSHPDK2shRNAConstructsagainst pyruvatedehydrogenase kinase,isoenzyme2 5164 0 HuSHDDR2shRNAConstructsagainst discoidindomainreceptorfamily, member2 0072 HuSHNTRK3 shRNAConstructsagainst neurotrophictyrosinekinase,receptor, type3 4921 4916 0068 0067 0 380 0 HuSHKITshRNAConstructsagainst v-kit Hardy-Zuckerman 4felinesarcomaviraloncogenehomolog 3815 0057 0 083 079 073 066 064 056 fering issubjecttoc 5581 521 4882 4750 3791 5590 8 hange. R HuSH PRKCEshRNAConstructsag HuSH PFTK1shRNAConstructsag 380 receptor B) HuSH NPR2shRNAConstructsagainst natriureticpeptidereceptorB/guanylate cyclaseB(atrionatriureticpeptide HuSH NEK1shRNAConstructsag HuSH KDRshRNAConstructsag Pfeiffer syndrome) uHPKZsRACntut gis rti iaeC ea380 HuSH PRKCZshRNAConstructsagainst proteinkinaseC,zeta VEGF receptor efer towww .origene.com forthe most updatedinformation. www ainst kinaseinser ainst NIMA(neverinmitosisgenea)-relatedkinase1 is FAR rti iae1380 ainst PFTAIRE protein kinase1 is rti iaeC pio 380 ainst proteinkinaseC,epsilon .origene.com t oanrcpo atp I eetrtrsn iae KR, 380 domain receptor(atypeIIItyrosinekinase)(KDR), price 380 R019110HS G2sRACntut gis eu/lccriodrgltdkns 380 380 380 380 380 380 HuSH BCKDKshRNAConstructsagainst branched chain dehydrogenase kinase alpha-ketoacid 380 HuSH SGK2shRNAConstructsagainst serum/glucocorticoid regulatedkinase2 380 HuSHMELKshRNAConstructs against maternalembryonicleucinezipperkinase lightpolypeptidegeneenhancerinB-cells,kinaseepsilon HuSHIKBKEshRNAConstructs against inhibitorofkappa P 380 10295 HuSHMAP3K13 shRNAConstructs againstproteinkinase13 mitogen-activated 10110 380 380 TR200130 9833 TR200129 HuSHPRPF4BshRNAConstructs against PRP4pre-mRNAprocessingfactor4homologB(yeast) 380 9641 TR200128 380 HuSHSTK19 shRNAConstructs against serine/threoninekinase19 380 9175 TR200127 HuSHRIOK3shRNAConstructs against RIOkinase3(yeast) 380 TR200126 380 8899 TR20 HuSHCASK shRNAConstructs against calcium/calmodulin-dependentserineproteinkinase(MAGUK family) 8859 TR200124 HuSHMKNK1shRNAConstructs against MAPkinaseinteractingserine/threonine1 380 8780 380 TR200123 HuSHCDK10 shRNAConstructs against10 cyclin-dependentkinase(CDC2-like) 380 TR200122 proteinkinase5 HuSHMAPKAPK5shRNAConstructsagainstproteinkinase-activated mitogen-activated 8573 TR20 HuSHCDC42BPA shRNAConstructsagainst CDC42bindingproteinkinasealpha(DMPK-like) 8569 TR200120 380 380 8558 TR200119 proteinkinase3 HuSHMAPKAPK3shRNAConstructs againstproteinkinase-activated mitogen-activated 380 8550 TR200118 8476 380 TR200117 HuSH TYK2 shRNAConstructs againstkinase 2 tyrosine 380 380 TR200116 HuSH TXK shRNAConstructsagainst TXK tyrosinekinase 7867 TR20 HuSH TTK shRNAConstructsagainst TTK proteinkinase TR200114 7297 380 HuSH TR20 TEK shRNAConstructs against TEK tyrosinekinase,endothelial(venousmalformations,multiple 7294 380 TR200112 7272 HuSHSYK shRNAConstructsagainst spleentyrosinekinase TR200111 380 HuSH AURKC shRNAConstructs against aurorakinaseC TR200110 7010 5 HuSHCDKL5shRNAConstructsagainst cyclin-dependentkinase-like 380 TR200109 HuSHSTK6 shRNAConstructsagainst serine/threoninekinase6 380 6850 TR20 HuSHSTK4 shRNAConstructsagainst serine/threoninekinase4 380 6795 TR200107 HuSHNEK4shRNAConstructsagainst NIMA(neverinmitosisgenea)-relatedkinase4 380 380 6792 TR200106 HuSHSRPK2shRNAConstructs against SFRSproteinkinase2 380 6790 TR200105 HuSHSRPK1shRNAConstructsagainst SFRSproteinkinase1 6789 380 TR200104 HuSHSGKshRNAConstructs against serum/glucocorticoid regulatedkinase 6787 TR200103 HuSHRPS6KB2shRNAConstructsagainst ribosomalproteinS6kinase,70kDa,polypeptide2 380 6733 TR200102 HuSHRPS6KB1shRNAConstructsagainst ribosomalproteinS6kinase,70kDa,polypeptide1 6732 TR200101 HuSHRPS6KA3shRNAConstructsagainst ribosomalproteinS6kinase,90kDa,polypeptide3 380 380 6446 380 TR200100 HuSHBRD2shRNAConstructs against bromodomaincontaining2 6199 380 TR200099 HuSHRNASEL shRNAConstructsagainst ribonucleaseL(2’,5’-oligoisoadenylate synthetase-dependent) 6198 TR200098 HuSHRAF1shRNAConstructsagainst v-raf-1 viraloncogenehomolog1 murineleukemia 6197 TR200097 HuSHRAGE shRNAConstructs against renaltumorantigen 380 6046 TR200096 HuSHPTK9shRNAConstructsagainst PTK9proteintyrosinekinase9 6041 TR200095 HuSHPTK6shRNAConstructsagainst PTK6proteintyrosinekinase6 5894 TR200094 HuSHPRKRshRNAConstructsagainst proteinkinase,interferon-inducibledoublestrandedRNAdependent 5891 TR200093 proteinkinase5 HuSHMAP2K5shRNAConstructsagainst mitogen-activated 5756 TR200092 HuSHMAPK10 shRNAConstructsagainstproteinkinase10 mitogen-activated 5753 TR200091 proteinkinase9 HuSHMAPK9shRNAConstructsagainst mitogen-activated 5610 TR200090 proteinkinase7 HuSHMAPK7shRNAConstructsagainst mitogen-activated 5607 TR200089 5602 TR200088 5601 description TR200087 5598 GeneID/LocusID TR200086 TR200085 Cat# roduct of 0 0 0 0 0 1 1 1 1 1 1 1 08 25 21 44HS YK hN osrcsaantda-pcfiiytrsn-Y-hshrlto euae iae3380 HuSHDYRK3 shRNAConstructsagainst tyrosine-(Y)-phosphorylation dual-specificity regulatedkinase3 8444 5 3 fering issubjecttoc 6885 7 04HS A36sRACntut gis ioe-ciae rti iaekns iae6380 proteinkinase6 HuSHMAP3K6shRNA Constructsagainst mitogen-activated 9064 87 443 7HS IK hN osrcsaantrcpo-neatn eietroiekns 380 HuSHRIPK2shRNA Constructsagainst receptor-interacting serine-threoninekinase2 67 hange. R cutaneous andmucosal) HuSH MAP3K7shRNAConstructsag HuSH efer towww ph: VRK1 shRNAConstructsag 1 .origene.com forthe most updatedinformation. .888.267 .4436 f is acnarltdkns 380 ainst vacciniarelatedkinase1 ainst mitogen-acti ax: vated proteinkinase7 1 .30 1 .340.9254 price 380 53 Premade shRNA expression panels HuSH™ 54 Premade shRNA expression panels HuSH™ R016826HS A hN osrcsaantlmhct lh-iae380 380 380 380 380 380 380 380 HuSH SNARKshRNAConstructsagainst ortholog likely ofratSNF1/AMP-activated protein kinase 380 HuSH LAKshRNAConstructsagainst lymphocyte alpha-kinase 380 HuSH NEK11 shRNAConstructsagainst NIMA (neverinmitosisgenea)-relatedkinase 11 P 81788 380 protein shRNAConstructsagainst Predicted kinase:KIAA2002 HuSH KIAA2002 380 80216 TR200177 HuSHSTK33 shRNAConstructsagainst serine/threoninekinase33 TR200176 380 HuSHKIAA1361 shRNAConstructsagainst serine/threonineproteinkinase TAO1 homolog 79858 TR20 380 79834 TR200174 kinase4 HuSHCLK4shRNAConstructsagainst CDC-like 65975 380 TR200173 57551 TR200172 HuSHPACE-1 shRNAConstructsagainst ezrin-bindingpartner PACE-1 TR200171 HuSHPAK7 shRNAConstructsagainst kinase7 p21(CDKN1A)-activated 57396 TR20 HuSH ADCK1 shRNAConstructsagainst aarFdomaincontainingkinase1 TR200169 57147 TR20 HuSHPAK6 shRNAConstructsagainstkinase6 p21(CDKN1A)-activated 57144 TR200167 380 380 HuSHRIOK2shRNAConstructsagainst T-LAK cell-originatedproteinkinase 57143 TR200166 HuSHFLJ10074 shRNAConstructsagainst RIOkinase2(yeast) 380 TR200165 380 56924 TR20 380 55872 380 TR200163 HuSHSNRKshRNAConstructsagainst SNF-1 relatedkinase 55781 TR200162 TR200161 380 TR20 HuSH JIKshRNAConstructsagainst STE20-like kinase 54861 380 TR20 380 TR200158 HuSHPIK3R4shRNAConstructsagainst phosphoinositide-3-kinase, regulatorysubunit4,p150 TR20 HuSHNRBPshRNAConstructsagainst nuclearreceptorbindingprotein 51347 TR20 380 HuSHpknbetashRNAConstructsagainst proteinkinaseN3(PKN3) 380 TR200155 380 HuSH TRB2 shRNAConstructsagainst tribbleshomolog2(Drosophila) 30849 TR20 HuSHH11 shRNAConstructsagainst heatshock 27kDaprotein8(HSPB8) 29959 380 380 TR200153 HuSHPRKD2shRNAConstructsagainst proteinkinaseD2 29941 380 TR200152 HuSHKIAA0472shRNAConstructsagainst receptor interactingproteinkinase5(RIPK5) 28951 TR200151 380 HuSHCCRKshRNAConstructsagainst cellcyclerelatedkinase(CCRK) 26353 TR200150 380 HuSHBRD4shRNAConstructsagainst bromodomaincontaining4(BRD4) 25865 TR200149 380 HuSHKIAA0303shRNAConstructsagainst Predicted kinase:KIAA0303protein(KIAA0303) 25778 TR200148 HuSH PASK 380 shRNAConstructsagainst PAS domaincontainingserine/threoninekinase(PASK) 23552 TR200147 HuSHKIAA0561shRNAConstructsagainst PREDICTED: microtubuleassociatedserine/threoninekinase3 23476 TR200146 HuSHPTK9LshRNAConstructsagainst(A6-relatedprotein) PTK9L proteintyrosinekinase9-like 23227 380 TR200145 HuSH STK38 shRNAConstructsagainst serine/threoninekinase38 23178 TR200144 380 HuSHCHEK2shRNAConstructsagainst CHK2checkpoint homolog(S.pombe) 23031 TR200143 HuSH PTP4A3shRNAConstructsagainst proteintyrosinephosphatasetypeIVA, member3 380 11344 TR200142 HuSHPIM2shRNAConstructsagainst pim-2oncogene 11329 TR200141 HuSH TLK2 shRNAConstructsagainstkinase2 tousled-like 11200 TR200140 HuSHFASTK shRNAConstructsagainst FAST kinase 11156 TR200139 HuSHCAMKK2shRNAConstructsagainst calcium/calmodulin-dependentproteinkinase2,beta 11040 TR200138 HuSHSTK25 shRNAConstructsagainst serine/threoninekinase25(STE20 homolog,yeast) 11011 TR200137 HuSHMERTK shRNAConstructsagainst c-merproto-oncogenetyrosinekinase 10922 TR200136 HuSH TESK2 shRNAConstructsagainst testis-specifickinase2 10645 TR200135 10494 TR200134 10461 description TR200133 10420 GeneID/LocusID TR200132 TR200131 Cat# roduct of 0 10540HS CL hN osrcsaantSY-ie1(.crvsa)380 HuSHSCYL1 shRNAConstructsagainst SCY1-like 1 (S.cerevisiae) 57410 0170 0 0 0 0 0 0 0 1 6 77 uHCM1 hN osrcsaantclimcloui-eedn rti iaeI 380 380 380 380 HuSHCAMK1GshRNAConstructsagainst calcium/calmodulin-dependentproteinkinaseIG 57172 HuSHCABC1shRNAConstructsagainst chaperone, (S.pombe) ofbc1complexlike ABC1 activity 168 56997 HuSHDKFZp761P1010 shRNAConstructsagainst protein kinaseSTYK1 164 HuSHHSA250839 shRNAConstructsagainst serine/threoninekinase32B 55359 55351 160 159 1 1 1 75 57 56 54 fering issubjecttoc 79934 16 uHMT hN osrcsaantMt n O1rltdkns 380 380 HuSH ANKRD3 shRNAConstructsagainst receptor-interacting serine-threoninekinase4 HuSHMST4 shRNAConstructsagainst Mst3andSOK1-related kinase 54101 51765 51 231 hange. R HuSH HuSH efer towww VRK3 shRNAConstructsag DK hN osrcsaantar oancnann iae4380 ADCK4 shRNAConstructsagainst aarFdomaincontainingkinase4 .origene.com forthe most updatedinformation. www is acnarltdkns 380 ainst vacciniarelatedkinase3 .origene.com price 380 R02479 uHTR hN osrcsaanttl-iercpo 380 380 380 380 380 380 HuSH TLR3 shRNAConstructs againstreceptor3 toll-like 380 HuSHRXRGshRNAConstructs against retinoidXreceptor, gamma HuSHRARRES2shRNAConstructs against retinoicacidreceptorresponder2 P 7098 380 HuSHRARBshRNAConstructs against retinoicacidreceptor, beta 6258 TR200224 1) HuSHPTENshRNAConstructs against phosphataseandtensinhomolog(mutatedinmultipleadvancedcancers 380 380 380 TR200223 HuSHPSEN1shRNAConstructs against presenilin1(Alzheimerdisease3) 5919 TR20 5915 TR200221 HuSHMST1R shRNAConstructs against macrophagestimulating1receptor 5728 380 TR200220 380 5663 TR200219 HuSHERBB4shRNAConstructsagainst v-erb-a viraloncogenehomolog4 erythroblasticleukemia 380 HuSH ABCF1 shRNAConstructs against ATP-binding cassette, sub-familyF(GCN20),member1 TR200218 380 4486 TR20 HuSHEEF2KshRNAConstructsagainst elongation factor-2 kinase TR200216 380 2066 TR20 HuSHRHOBTB1shRNAConstructs against Rho-relatedBTBdomaincontaining 23 380 TR200214 HuSHNR1D1shRNAConstructs against nuclearreceptorsubfamily1,groupD,member1 29904 TR200213 HuSHNR1I2shRNAConstructs against nuclearreceptorsubfamily1,groupI,member2 TR200212 380 9886 380 380 TR20 9572 TR200210 HuSH TP53 shRNAConstructsagainst tumorproteinp53(Li-Fraumeni syndrome) 380 8856 TR200209 TR200208 380 TR20 380 HuSHPPARBP shRNAConstructsagainst PPAR bindingprotein 7157 TR20 380 380 TR200205 HuSHNR4A1shRNAConstructsagainst nuclearreceptorsubfamily4,group A, member1 TR20 HuSHESRRBshRNAConstructsagainst estrogen-relatedreceptorbeta 5469 380 380 TR20 HuSHESR2shRNAConstructsagainst estrogenreceptor2 380 380 TR200202 HuSHEGFR shRNAConstructsagainst epidermalgrowthfactorreceptor 3164 380 TR20 HuSHDNMT3BshRNAConstructsagainst DNA(cytosine-5-)-methyltransferase 2103 380 380 HuSH TR200200 ALK shRNAConstructs against anaplasticlymphomakinase 2100 HuSHNR0B1shRNAConstructsagainst nuclearreceptorsubfamily0,groupB,member1 TR200199 380 1956 TR200198 HuSHLOC340371 shRNAConstructsagainst Predicted kinase:LOC340371 1789 TR200197 380 Constructsagainst HuSHNEK8shRNA NIMA(neverinmitosisgenea)-relatedkinase8 238 380 TR200196 HuSHSTK32C shRNAConstructsagainst serine/threoninekinase32C 190 TR200195 HuSHNRKshRNAConstructsagainst Nikrelatedkinase 340371 TR200194 HuSH ADCK5 shRNAConstructsagainst aarFdomaincontainingkinase5 284086 380 TR200193 HuSHFLJ34389shRNAConstructsagainst Predicted kinase:FLJ34389 282974 TR200192 380 HuSHMGC42105 shRNAConstructsagainst Predicted kinase:MGC42105 203447 TR200191 HuSHMYO3B shRNAConstructsagainst myosin IIIB(MYO3B) 203054 380 TR200190 HuSH ACVR1C shRNAConstructsagainst activin A receptor, 197259 typeIC TR200189 HuSHHAKshRNAConstructsagainst heart alpha-kinase(HAK) 167359 TR200188 HuSH LYK5 shRNAConstructsagainst proteinkinaseLYK5 (LYK5) 140469 TR200187 HuSHLOC91461 shRNAConstructsagainst Predicted kinase:LOC91461 130399 TR200186 HuSH MYLK2shRNAConstructsagainst myosin lightchain muscle kinase2,skeletal 115701 TR200185 HuSH FLJ14813 shRNAConstructsagainst microtubuleassociatedserine/threoninekinase-like 92335 TR200184 HuSHRIOK1shRNAConstructsagainst RIOkinase1(yeast) 91461 TR200183 1 HuSH RPS6KL1shRNAConstructsagainst ribosomalproteinS6kinase-like 85366 TR200182 84930 TR200181 83732 description TR200180 83694 GeneID/LocusID TR200179 TR200178 Cat# roduct of 0222 2756 uHPAAsRACntut gis eoioepoieaieatvtdrcpo,apa380 HuSHPPARA receptor, shRNAConstructs against activated peroxisome proliferative alpha 5465 0217 021 021 0207 0206 0204 0203 020 06 uHN13sRACntut gis ula eetrsbaiy1 ru ,mme 380 HuSHNR1H3shRNAConstructsagainst nuclearreceptorsubfamily1,groupH,member3 10062 1 1 98HS RC hN osrcsaantncerrcpo ufml ,gopC ebr1380 HuSHNR3C1shRNAConstructsagainst nuclearreceptorsubfamily3,groupC,member1 2908 5 fering issubjecttoc 36HS RH hN osrcsaantncerrcpo ufml ,gopH ebr2380 380 HuSHNR1H2shRNAConstructsagainst nuclearreceptorsubfamily1,groupH,member2 HuSHNR2C2shRNAConstructsagainst nuclearreceptorsubfamily2,groupC,member2 7376 7182 6096 57 4929 5920 47 hange. R uHPK hN osrcsaantPK rti yoiekns 380 HuSH RORBshRNAConstructsag HuSH PTK2shRNAConstructsagainst PTK2proteintyrosinekinase2 HuSH NR4A2shRNAConstructsag HuSH RARRES3shRNAConstructsag efer towww ph: 1 .origene.com forthe most updatedinformation. .888.267 .4436 f is A-eae rhnrcpo 380 ainst RAR-relatedorphanreceptorB ainst nuclearreceptorsubfamily4,group ainst retinoicacidreceptorresponder3 ax: 1 .30 1 .340.9254 A, member2 price 380 380 55 Premade shRNA expression panels HuSH™ 56 Premade shRNA expression panels HuSH™ R02016 uHEF osrcsaantEFtasrpinfco 380 380 380 380 HuSHE2F1Constructsagainst E2Ftranscriptionfactor1 380 380 HuSHDAPK1 Constructsagainst death-associatedproteinkinase1 1869 TR200270 HuSHCSNK1EConstructs against caseinkinase1,epsilon 380 TR20 kinase3(Drosophila) HuSHPLK3Constructsagainst polo-like 1612 TR20 HuSHCDKN2DConstructs against cyclin-dependentkinaseinhibitor2D(p19, inhibitsCDK4) 380 TR200267 380 1454 380 TR20 HuSHCDK9Constructsagainst cyclin-dependentkinase9(CDC2-relatedkinase) 1263 380 HuSHCCNE1Constructsagainst cyclinE1 TR200265 1032 HuSHCCND3Constructsagainst cyclinD3 TR200264 380 TR200263 1025 TR20 380 HuSH AR Constructsagainst androgenreceptor(dihydrotestosterone receptor;testicularfeminization; 898 TR200261 380 896 TR200260 HuSH AKT2 Constructsagainst v-akt murinethymoma viraloncogenehomolog2 TR200259 TR20 367 HuSHLOC149420 380 shRNAConstructsagainst caseinkinase TR200257 380 HuSHIRAK4shRNAConstructsagainst interleukin-1receptor-associated kinase4 208 TR20 HuSHSTK16 shRNAConstructsagainst serine/threoninekinase16 380 380 TR200255 HuSHNR2C1shRNAConstructsagainst nuclearreceptorsubfamily2,groupC,member1 149420 380 TR20 HuSH TLR4 shRNAConstructsagainstreceptor4 toll-like 51135 TR200253 8576 380 TR200252 7181 TR200251 HuSH TEC shRNAConstructsagainst tecproteintyrosinekinase 380 7099 TR200250 TR200249 receptortyrosinekinase HuSHMUSKshRNAConstructsagainst muscle,skeletal, 380 TR20 HuSHFGFR3shRNAConstructsagainst fibroblastgrowthfactorreceptor3 380 7006 380 TR20 TR200246 HuSHNR1D2shRNAConstructsagainst nuclearreceptorsubfamily1,groupD,member2 4593 TR20 HuSHNCOA1 shRNAConstructsagainst1 nuclearreceptorcoactivator 380 2261 380 TR200244 HuSHNCOA3 shRNAConstructsagainst3 nuclearreceptorcoactivator TR200243 HuSHLRTLR2 shRNAConstructsagainstreceptor2 toll-like 9975 TR20 HuSHPPARG receptor, shRNAConstructsagainst activated peroxisome proliferative gamma 8648 TR200241 380 HuSHNR3C2shRNAConstructs against nuclearreceptorsubfamily3,groupC,member2 380 8202 380 TR200239 HuSHMLH1shRNAConstructs against mutLhomolog1coloncancer 7097 TR200238 380 HuSHHNF4AshRNAConstructs against hepatocytenuclearfactor4,alpha 380 5468 TR200237 4306 HuSHHIF1AshRNAConstructsagainst hypoxia-inducible factor1,alphasubunit(basichelix-loop-helix TR200236 4292 HuSHEPHA2shRNAConstructs against EphA2 TR200235 3172 HuSHMAPK14 shRNAConstructsagainstproteinkinase1 mitogen-activated TR200234 HuSH ADAM10 shRNAConstructsagainst adisintegrinandmetalloproteinasedomain10 TR200233 3091 HuSHZNF335shRNAConstructsagainst zincfingerprotein335 1969 TR200232 HuSHNR1H4shRNAConstructsagainst nuclearreceptorsubfamily1,groupH,member4 1432 TR200231 HuSH TRIP4 shRNAConstructsagainst thyroid hormonereceptorinteractor4 102 TR200230 HuSHRPS6KA5shRNAConstructsagainst ribosomalproteinS6kinase,90kDa 63925 TR200229 9971 TR200228 9325 description TR200227 9252 GeneID/LocusID TR200226 TR200225 Cat# P roduct of 2811 uHDP3Cntut gis et-soitdpoenkns 380 HuSHDAPK3 Constructsagainst death-associatedproteinkinase3 1613 0269 0268 2611 uHDPCntut gis et-soitdpoen380 HuSHDAP Constructsagainst death-associated protein 1611 0266 0262 0258 0256 0254 0248 0247 0245 0242 fering issubjecttoc 00HS DNBCntut gis ylndpnetkns niio B(1,ihbt D4 380 HuSHCDKN2BConstructsagainst cyclin-dependentkinase inhibitor2B(p15, inhibitsCDK4) 1030 81 351 1 7068 7067 591 79705 1 56 725 uHCM2 osrcsaantclimcloui-eedn rti iae(a iae Ibt 380 HuSHCAMK2BConstructsagainst calcium/calmodulin-dependentproteinkinase(CaMkinase)IIbeta 6 6 hange. R HuSH HuSH HuSH HuSH HuSH LRRK1shRNAConstructsag spinal andbulbarmuscularatrophy; Kennedy disea HuSH RARGshRNAConstructsag transcription factor) HuSH DHPSConstructsag efer towww HBsRACntut gis hri omn eetr ea380 380 THRB shRNAConstructsagainst thyroid hormonereceptor, beta THRA shRNAConstructsagainst thyroid hormonereceptor, alpha P osrcsaantayodbt A)peusrpoen(rtaenxnI,Azemrdsae 380 APP Constructsagainst protein(proteasenexin-II, amyloid beta(A4)precursor Alzheimer disease) ADRBK1 Constructsag .origene.com forthe most updatedinformation. www ainst deo ainst adrenergic,beta,receptorkinase1 is eiocai eetr am 380 ainst retinoicacidreceptor, gamma ainst leucine-ric yyuiesnhs 380 xyhypusine synthase .origene.com h repeat kinase1 price 380 380 380 380 380 R03650 uHMPK osrcsaantmtgnatvtdpoenkns iae3380 380 380 380 380 proteinkinase3 HuSHMAP2K3Constructs against mitogen-activated proteinkinase2 HuSHMAP2K2Constructs against mitogen-activated proteinkinase1 HuSHMAP2K1Constructs against mitogen-activated 380 380 HuSHPRKD1Constructsagainst proteinkinaseD1 P 380 5606 HuSHPKN2Constructsagainst proteinkinaseN2 5605 TR200316 5604 TR200315 HuSHPPARD receptor, Constructsagainst activated peroxisome proliferative delta 5587 TR200314 HuSHPGRConstructsagainst progesteronereceptor 5586 TR200313 HuSHPEPDConstructsagainst peptidaseD 380 TR200312 380 5467 TR20 HuSHPCTK2Constructsagainst PCTAIRE proteinkinase2 5241 TR200310 orphanreceptor1 HuSHROR1Constructsagainst receptortyrosinekinase-like 5184 TR200309 HuSHNTRK2 Constructsagainst neurotrophictyrosinekinase,receptor, type2 380 TR200308 380 HuSHNOS3Constructsagainst nitricoxide synthase3(endothelialcell) 5128 380 TR20 380 lightpolypeptidegeneenhancerinB-cellsinhibitor, HuSHNFKBIBConstructsagainst nuclearfactorofkappa beta 380 4919 TR200306 380 380 4915 TR200305 HuSHMAP3K11 Constructsagainstproteinkinase11 mitogen-activated 380 4846 TR200304 4793 TR200303 HuSHMARK1Constructsagainst MAP/microtubuleaffinity-regulating kinase1 TR200302 HuSHMAFConstructsagainst v-maf musculoaponeuroticfibrosarcomaoncogenehomolog(avian) 4296 TR20 380 against HuSHSMAD7Constructsagainst SMAD,mothers DPPhomolog7(Drosophila) 380 380 TR200300 against HuSHSMAD1Constructsagainst SMAD,mothers DPPhomolog1(Drosophila) 380 4139 TR20 HuSHLRP5Constructsagainst lowdensitylipoproteinreceptor-related protein5 4094 TR200298 4092 TR200297 4086 380 TR200296 HuSHIRAK1Constructsagainst interleukin-1receptor-associated kinase1 4041 TR200295 380 380 TR200294 growthfactor1receptor HuSHIGF1RConstructsagainst insulin-like TR20 HuSHHSPB1Constructsagainst heatshock 27kDaprotein1 3654 TR20 TR200291 HuSHGRIA2Constructsagainst glutamatereceptor, ionotropic, AMPA 2 3480 380 TR20 HuSHGRK6Constructsagainst Gprotein-coupledreceptorkinase6 3315 TR200289 HuSHGRK4Constructsagainst Gprotein-coupledreceptorkinase4 TR200288 HuSHGAKConstructsagainst cyclinGassociatedkinase 380 2891 TR20 HuSHFOXO1A Constructs against forkheadbox O1A(rhabdomyosarcoma) 2870 TR200286 380 2868 HuSHFGFR2Constructsagainst fibroblastgrowthfactorreceptor2(bacteria-expressedkinase,keratinocyte TR200285 380 2580 HuSHETS2Constructsagainst v-ets erythroblastosisvirusE26oncogenehomolog2(avian) TR200284 2308 HuSHESRRAConstructsagainst estrogen-relatedreceptoralpha TR200283 HuSHESR1Constructsagainst estrogenreceptor1 TR200282 2263 HuSHEPORConstructsagainst erythropoietinreceptor 2114 TR200281 HuSHEPHB3Constructsagainst EPHreceptorB3 2101 TR200280 HuSHEPHB1Constructsagainst EPHreceptorB1 2099 TR200279 HuSHEPHA8Constructsagainst EPHreceptor A8 2057 TR200278 HuSHEPHA7Constructsagainst EPHreceptor A7 2049 TR200277 HuSHMARK2Constructsagainst MAP/microtubuleaffinity-regulating kinase2 2047 TR200276 HuSHELK1Constructsagainst ELK1,memberofETSoncogenefamily 2046 TR200275 2045 TR200274 2011 description TR200273 2002 GeneID/LocusID TR200272 TR200271 Cat# roduct of 031 0307 030 0299 0293 0292 0290 0287 1 1 fering issubjecttoc 51 421 3726 3725 3645 2931 5585 4790 70 7 hange. R HuSH PDPK1Constructsag HuSH JUNBConstructsag HuSH JUNConstructsag HuSH INSRRConstructsag HuSH GSK3AConstructsag HuSH PKN1Constructsagainst proteinkinaseN1 380 HuSH NFKB1ConstructsagainstlightpolypeptidegeneenhancerinB-cells1(p105) nuclearfactorofkappa HuSH MAP3K5Constructsag growth factorreceptor, craniofacialdysost efer towww ph: 1 .origene.com forthe most updatedinformation. .888.267 is -u acm iu 7ocgn ooo ain 380 ainst v-jun sarcomavirus17 oncogenehomolog(avian) ainst junBproto-oncogene ainst insulinreceptor is -hshioiiedpnetpoenkns- 380 ainst 3-phosphoinositidedependentproteinkinase-1 ainst glycogensynthasekinase3alpha ainst mitogen-acti .4436 f vated proteinkinase5 ax: rltdrcpo 380 -related receptor 1 .30 1 .340.9254 price 380 380 380 380 380 380 380 380 380 380 380 380 380 57 Premade shRNA expression panels HuSH™ 58 Premade shRNA expression panels HuSH™ R031264HS AK osrcsaantdahascae rti iae2380 380 380 380 380 HuSH DAPK2 Constructsagainst death-associated proteinkinase2 380 HuSH MAST1 Constructsagainst microtubule associated serine/threoninekinase1 23604 380 TR200361 HuSH CARD4Constructsagainst caspaserecruitment domainfamily, member4 TR20 380 HuSH TRIB1 Constructsagainst tribbleshomolog1(Drosophila) 22983 TR20 380 HuSH ACK1 ConstructsagainstCdc42-associated kinase1 activated TR200358 10392 380 TR20 HuSHCDC42BPBConstructsagainst CDC42bindingproteinkinasebeta(DMPK-like) 10221 TR200356 HuSH TAOK2 Constructsagainst TAO kinase2 380 10188 TR200355 HuSHGTF3C5Constructsagainst generaltranscriptionfactorIIIC,polypeptide5,63kDa TR200354 9578 TR20 HuSHLATS1 Constructsagainst LATS, largetumorsuppressor, homolog1(Drosophila) 380 9344 TR200352 380 9328 TR200351 380 TR200350 HuSH TNFRSF11A Constructsagainst tumornecrosisfactorreceptorsuperfamily, member11a, ofNFKB activator 9113 TR20 TR200348 380 TR20 HuSH TNK1 Constructsagainst tyrosinekinase,non-receptor, 1 8792 TR20 TR200345 HuSHBAT4 Constructsagainst HLA-Bassociatedtranscript4 TR20 8711 380 TR20 HuSH WEE1 Constructsagainst WEE1 homolog(S.pombe) TR200342 HuSH VDR Constructsagainst vitaminD(1,25-dihydroxyvitamin D3)receptor 380 7918 TR20 HuSH TYRO3 Constructsagainst TYRO3 proteintyrosinekinase 380 TR200340 380 HuSH TNFAIP3 Constructsagainst tumornecrosisfactor, alpha-inducedprotein3 380 380 7465 380 T 380 380 7421 TR200338 HuSH TIE Constructsagainst tyrosinekinasewithimmunoglobulinandepidermalgrowthfactorhomologydomains 7301 TR200337 7128 HuSH TR200336 TGFBR1 Constructsagainst transforminggrowthfactor, betareceptorI(activin A receptortypeII-like 380 HuSHNR2F2Constructsagainst nuclearreceptorsubfamily2,groupF,TR200335 member2 380 7075 HuSHSTK11TR20 Constructsagainst serine/threoninekinase11 (Peutz-Jeghers syndrome) HuSHSTAT5BTR200333 Constructsagainst oftranscription5B signaltransducerandactivator 380 7046 380 HuSHSTAT5A Constructsagainstoftranscription5A signaltransducerandactivator 7026 TR200332 380 HuSHSRFConstructsagainst serumresponsefactor(c-foselement-bindingtranscriptionfactor) 6794 TR200331 HuSHSRCConstructsagainst v-src sarcoma(Schmidt-Ruppin A-2) viraloncogenehomolog(avian) 6777 TR200330 HuSHMAPK12 Constructsagainstproteinkinase12 mitogen-activated 6776 TR200329 HuSHRYK Constructsagainst RYK receptor-like tyrosinekinase 6722 TR200328 380 6714 TR200327 HuSHRXRAConstructsagainst retinoidXreceptor, alpha 6300 TR200326 HuSHRPS6KA1Constructsagainst ribosomalproteinS6kinase,90kDa,polypeptide1 6259 TR200325 HuSHRORAConstructsagainst RAR-relatedorphanreceptor A TR200324 6256 HuSHRETConstructsagainst retproto-oncogene(multipleendocrineneoplasiaandmedullarythyroid carcinoma1, T 6195 380 HuSHRB1Constructsagainst retinoblastoma1(includingosteosarcoma) TR200322 6095 HuSHRARRES1Constructs against retinoicacidreceptorresponder(tazaroteneinduced)1 TR200321 TR200320 5979 Hirschsprung disease) 5925 description TR200319 5918 GeneID/LocusID TR200318 TR200317 Cat# P 203 55HS A7 osrcsaantzt-hi TR soitdpoenkns 0D 380 HuSHZAP70Constructsagainst zeta-chain (TCR)associatedproteinkinase70kDa 380 7535 R200339 HuSHRXRBConstructsagainst retinoidXreceptor, beta 6257 R200323 roduct of 39203HS NKCntut gis RF n C neatn iae380 HuSH TNIK Constructsagainst TRAF2 andNCKinteracting kinase 23043 0360 0359 37173HS E6Cntut gis IA(ee nmtssgn )rltdkns 380 HuSHNEK6 Constructsagainst NIMA(neverinmitosis genea)-relatedkinase6 10783 380 0357 380 0353 HuSHPKMYT1Constructsagainst membrane-associatedtyrosine-andthreonine-specificcdc2-inhibitorykinase HuSHRPS6KA4Constructsagainst ribosomalproteinS6kinase,90kDa,polypeptide4 0349 9088 8986 0347 380 0346 0344 0343 0341 HuSHNR2E1Constructsagainst nuclearreceptorsubfamily2,groupE,member1 7101 0334 fering issubjecttoc 05 uHTI2 osrcsaanttiatt oi-otiig2 380 HuSH TRIM28 Constructs against tripartite motif-containing28 10155 9261 8772 871 8536 23235 7 hange. R uHMPAK osrcsaantmtgnatvtdpoenkns-ciae rti iae2380 380 proteinkinase2 HuSH MAPKAPK2Constructsagainstproteinkinase-activated mitogen-activated HuSH FADD Constructsagainst Fas (TNFRSF6)-associatedviadeathdomain HuSH CAMK1Constructsag uHTADCntut gis NRFAascae i et oan380 HuSH TRADD Constructsagainst TNFRSF1A-associated viadeathdomain kinase, 53kDa) HuSH SIK2Constructsag efer towww .origene.com forthe most updatedinformation. ainst salt-inducibleserine/threoninekinase 2 www ainst calcium/calmodulin-dependentproteinkinaseI .origene.com price 380 380 380 P 380 380 380 380 380 380 380 380 -Locus_ID 9284 HuSHNPIPConstructsagainst NM_006985 HuSHLMTK3Constructsagainst lemurtyrosinekinase3 380 HuSH TP53RK Constructsagainst TP53 regulatingkinase 380 HuSHKIAA1765 Constructsagainst KIAA1765 protein 9284 HuSHMGC8407Constructsagainst hypothetical proteinMGC8407 114783 TR200374 kinase1 HuSH PINK1Constructsagainst PTENinducedputative 380 112858 TR200373 HuSHFLJ10769 Constructsagainst hypothetical proteinFLJ10769 85443 TR200372 HuSHBMP2KConstructsagainst BMP2induciblekinase 79012 TR200371 HuSHRNF31Constructsagainst ringfingerprotein31 65018 TR200370 HuSHZAKConstructsagainst sterilealphamotifandleucinezippercontainingkinase AZK 55739 TR200369 HuSHCRK7Constructsagainst CDC2-relatedproteinkinase 55589 TR200368 HuSHHRIConstructsagainst heme-regulatedinitiationfactor2-alphakinase 55072 TR200367 HuSHLATS2 Constructsagainst LATS, largetumorsuppressor, homolog2(Drosophila) 51776 TR200366 51755 TR200365 27102 description TR200364 26524 GeneID/LocusID TR200363 TR200362 Cat# roduct of fering issubjecttoc hange. R efer towww ph: 1 .origene.com forthe most updatedinformation. .888.267 .4436 f ax: 1 .30 1 .340.9254 price 380 380 59 Premade shRNA expression panels HuSH™ 60 pRS vector HuSH™ Once aspecifi inhibitory function. the targetgeneandtoselectonlyoneswith to determinetheeffect against oftheshRNA vectors HEK293, withtheshRNAvectorandtargetgene cells. in transientlytransfected functionality ofthevectors istovalidatethe step usingshRNAvectors reduce thetargetgeneexpressionby>70%. The first areexpectedto about 25-30%oftheshRNAvectors Due tothebiologicalcomplexityofRNAi,only shRNA plasmids. commended. OriGeneonlysellssequenceverified 150 verification oftheshRNAinsert ishighlyre- error ratesassociatedwitholigosynthesis,sequence 150 – areannealedandinsertedoligo pairs intotheBamHI Oligos ag production, shRNAexpressionandgenesilencing. production, puromycin selection,stablecellline The vectorsystemhasbeenvalidatedforretrovirus TR20002 clone intheirownshDNAsequences. also provides theblankpRSvectorforresearchers TR20001 to Other thanthepremadeshRNAplasmids,OriGene Introduction: Cat.No. pRS-Luc-v1 (shRNA)plasmid pRS-GFP-v1 (shRNA)plasmid p Product Listing pRS vector containing supernatant toinfectthetarget cells. into aretroviral packaging celland byusingthevirus lines canbeestablishedby transfectingtheplasmid Srtoia eeslnigvco R00 150 TR20003 RS retroviral genesilencingvector BbsI sitesofthepRSplasmid.Duetosignificant W e ainst targetgenesaredesignedandthe recommend toco-transfectcells,i.e., c shRNA vector(s)isselected, stable cell www .or ig ene.com i.1 Fig. • Inhibitingtheexpression of thetargetgenes • CloningofshRNAoligos • Applications stable celllinesexpressingthefunctionalshRNA. Puromycin isaddedtotheinfectedcellsforselecting 5‘ packaging cells. from MML puromycin selectionmarkerispresent. Both5’and3’LTRs are BamHI andBbsI,immediatelydownstream ofU6promoter. A pRS plasmidmap.TheshRNAoligos willbeclonedbetween A Generating stablecelllines LT mpi R c i l li n V Eco RI and usedtogenerateretrovirusesin appropriate U6

prom Not I Bam o te r 5522 H I pRS shRNA o

bp ligos SV40 ea Price pBS Ori rl y pro Pu Hind III Sal I mo ro te Bbs I r 3‘

LT R Cla I pRS-NegCon-v1 Product content:10 ugofpRS-luc-v1and10 ugof luciferase expression Applications: Positive controlfortheinhibition of canbeobserved (Fig.3). luciferase activity pRS-luc-v1, approximately 90%inhibitionofthe cells co-transfectedwithaluciferaseplasmidand resulting intheinhibitionoftargetgene.InHEK short-haripin RNA(shRNA)from theU6promoter, transfected intomammaliancells,itexpressesa plasmid carrying luciferase sequence. When Transfection grade purifiedmammalianexpression Firefly luciferase(Luc)shRNAexpressionplasmid. P pRS-Luc-v1 (shRNA)plasmid pRS-NegCon-v1 Product content:10 ugofpRS-luc-v1and10 ugof EGFP expression Applications: Positive controlfortheinhibitionof (Fig. 2). and westernblotanalysiswithGFPspecificantibody can bedetectedusingbothfluorescencemicroscopy gene. SignificantinhibitionoftheGFPexpression promoter, resultingintheinhibitionoftarget expresses ashort-haripin RNA(shRNA)fromtheU6 q mammalian expressionplasmidcarrying GFPse- expression plasmid. Transfection gradepurified Enhanced greenfluorescentprotein(EGFP) shRNA Product Description pRS-GFP-v1 (shRNA)plasmid uence. When transfectedintomammaliancells,it roduct Description h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: i.2 Fig. i.3 Fig. antibody. fluorescence microscopeandonWestern blotwithaGFPspecific Three daysaftertransfection,thecellswereanalyzedona v1 at1:100ratio(B),eGFPandNegCont-v1(C)usingFuGene6. transfected withplasmidscarryingeGFP(A),andshRNA-GFP- shRNA plasmidpRS-GFP-v1plasmid.HEK293cellswere (PE) onVictor 3platereader(PE). Three daysaftertransfection,thecells wereanalyzedwithBritelite shRNA-Luc-v1 at1:100ratio,eGFPand NegCont-v1usingFuGene6. transfected withplasmidscarryingLuciferase (Pos.Cont.),Lucand shRNA plasmidpRS-Luc-v1plasmid. HEK293cellswere 61 pRS vector HuSH™ 62 www.origene.com Full-Length cDNA cloning

Rapid-Screen™ arrayed cDNA libraries

Rapid-Screen™ Longest-CloneSM services

Sure-RACE™ 5’-RACE Kit

Yeast two-hybrid expression cDNA libraries 64 Rapid Screen™ arrayed cDNA libraries Full-length cDNA cloning 2) isolatecDNAclonesofgenes whosemajorsitesofexpressionhavenotbeenfully described. ua etsLS10 925 925 LTS-1001 925 1) increasethec 925 who areinterestedinsimultaneousmulti-tissuescreens to: 100 925 The LSI-1001 925 925 LMU-1001 detected onthemasterplate,e.g. 925 “RAB-5A”] prefi All sub-platesfortheabove libraries[Sub-platesaredesignatedbythelibrary’s LLU-1001 925 Sub-Plat LLI-1001 Human Testis 925 LKD-1001 LPBL-1001 Human Spleen LHT-1001 Human Smallintestine LCO-1001 muscle Human Skeletal Human Placenta LLFB-1001 Human Peripheral bloodleukocytes Human Lung Human Liver Human Kidney Human Heart Cat.No. Human Colon Human Brain(fetal) H Human (Master plates) Product Listing Rapid Screen™ arrayed cDNAlibraries mnBan(dl)LB10 925 LAB-1001 uman Brain(adult) complete thirteen humanand/or six mousecDNAlibrarypanelsareavailableforlicensingtoinvestigators x followed bythenumber(column)andlet es hances ofidentifying “full-length” cDNAclonesthat arepresentinmorethanonetissue,or www.origene.com ter (row)ofthepositi LLPC-1 LP10 925 LLSP-1001 ve well(s) 0 0 1 Price 925 vi analyses, andultimatelytodiscover itsfunctionin cDNA inordertoperformsequenceandexpression identified, thenextstepistoclonefull-length Genome Sequencing Projects. Onceageneis of sequenceinformationbeingproducedbythe sequence tag(EST) discovery, aswellthewealth lag. Untilnow percent ofthem. There areseveralreasonsfor this cDNA cloneshavebeenobtainedforlessthan50 human geneshavealreadybeentagged,full-length Although ithasbeensuggestedthatmostofthe a ri aut A-01 925 925 925 925 RAB-1001 in largepar Gene identificationisincreasingatarapidpace,due MTM-1001 Introduction: 100 925 MTS-1001 MLI-1001 925 925 detected onthemasterplate,e.g. “RAB-5A”] prefi All sub-platesfortheabove libraries[Sub-platesaredesignatedbythelibrary’s Sub-Plates MEA-1001 Rat Brain(adult) MEB-1001 MAB-1001 Rat (Master plates) Mouse Thymus Mouse Testis Mouse Liver Cat.No. Mouse Embryo(19-day) Mouse Embryo(12.5-day) Mouse Brain(adult) Mouse (Master plates) Product Listing has laggedbehind thetechnology fortaggingthe full-length libraries fromwhic More importantly, the technology forconstructing very labor v o. x followed bythenumber(column)andlet -intensi t , to tec obtaining afull-lengthclone hasbeen ve, timeconsumingandexpensi hnologies suc h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: h clones areisolated h as expressed ter (row)ofthepositi ve. were designedasafast,inexpensi more easilyligated intoavectorthanlargercDNAs. structures andthatsmaller-sized cDNAsaremuch transcribe mRNAswithextensi to thefactthatithasbeendifficult toreverse to datehavearelati place.Forgenes inthefirst example,mostlibraries the variouscDNA inserts after PCRscreen, theveryfirst primer screening isPCR-based,vector andgene-specific screening procedurethatis PCRbased.Sincethe libraries ar made fasterandmoreeconomical byhavingthe parately intothevector different size-fractions andthenligating themse- isolatingdouble-strandedcDNAsof improved byfirst clone full-lengthcDNAs. The libraryqualitywas The Rapid-Screen™ Arrayed cDNALibraryPanels* s can beusedin concert todeterminethesize of rayed in96-wellplatesand developinga ve well(s) vely lowaverageinser . The cloningprocesshasbeen ve, andeasyw ve secondary Price t siz e, due ay to 65 Rapid Screen™ arrayed cDNA libraries Full-length cDNA cloning 66 Rapid Screen™ arrayed cDNA libraries Full-length cDNA cloning with onlythree96-wellPCRs be immediatelytransfected Can identifylongestclone Isolate largecDNAclones probes orlabor-intensive “Full-length” clonescan even beforeitsisolation No messy radioactive No messyradioactive into mammaliancells Libraries designedto contain largeinserts Final cloneisnota ADVANTAGES PCR product colony lifts www.origene.com formants thathadnotbeenamplifi Sub-Plates weregeneratedwithprimarytrans- the MasterPlatewereeach independently-derived, the Plate. To guaranteethatclonesfromdifferent wellsin Sub-Plate werethenpooledtogeneratetheMaster andthewellsfromeachPlates weregeneratedfirst which may losespecificclones).Instead,theSub- wellsfromthe MasterPlate(aprocess of individual bydilution Sub-Plate, theSub-Plateswerenotderived Master Platewillberepresentedintheappropriate To ensurethataclonedetectedinspecificwellthe clonefromtheSub-Platewell. the positive 96 singlecoloniesbyPCRleadstotheidentificationof well(s)hasbeenidentified. once apositive Analysis of plasmid DNA,thecellscanbedilutedandplatedout plate containsglycerolstocks ofE.coliinstead Plate ar all 5,0 corresponding 96-well “Sub-Plate(s),” which contains products, thesecondPCRanalysisiscarried outinthe positi clones.Havingidentifiedthe plasmid DNAfrom5,000 96-well “Master Plate,” whereeach wellcontains cDNA clone. PCRanalysisisperformedina The first require justthreesetsofPCRstoidentifythedesired designed forEST to “full-length” gene cloningand cDNALibraryPanels were The Rapid-Screen™ How doesRapid-Screen™ work? Product Description: *U.S. Patent #6,316,193 clone ofany geneofinterest foundinthelibraries. Rapid-Screen™ cDNAlibrariesandprovide thelongest taneously screenalltwelvehumanorsixmouse service isalsooffered, inwhich OriGenewill simul- then findoutwhich, ifany, arefull-length. A screening thus eliminatingtheneedtoisolatemany clonesand ve well(s)bygelelectrophoresisofthereaction 0 0 rayed atonly50clonesperwell.Sincethis clones fromthepositi ve welloftheMaster ed. Table 1* clones, alargeaverageinsert size allowsfor size (Table 1).Inadditiontohelpingfindfull-length themamuchthereby giving largeraverage insert with moreclonesfromthelarge-sized fraction, allowed theRapid-Screen™ librariestobespiked ligation reactionswerethen determined(Fig.1). This insert sizes ofrandomclonesfromthevarious competition forinsertion bysmallercDNAs. The were independentlyligated tothevectorminimize low-melt agarose gelandthevarioussize-fractions u by restrictionenzyme digestionfollowedbygelelectrophoresis. *Data forthistable wereobtainedbyrandomlypicking 48colonies perlibrary, preparingplasmid DNAfromeach, andanalyzingtheinserts Brain (adult) Rat Thymus Testis Liver Embryo (19-day) Embryo (12.5-day) Brain (adult) Mouse Testis Spleen Small intestine muscle Skeletal Placenta P Lung Liver Kidney Hear Colon Brain (fetal) Brain (adult) Human LIBRARY stranded cDNAs(synthesized frompoly A longer thanaverage-sized cDNAclones,double- they areintendedforresearchers searching for that theyareuser-friendly andcost-effective. Since the developmentofthesearrayed cDNApanels,so A What was doneto obtainlarge inserts? eripheral bloodleukocytes sing oligo (dT) primers) weresize-fractionatedsing oligo(dT)primers) ina great dealofforesighthasbeenincorporatedinto t h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: A VERAGE SIZE(kb) + 2.5 2.4 2.6 2.5 3.6 2.4 3.2 2.0 2.9 2.9 2.8 2.4 3.2 3.5 3.5 3.5 3.5 3.2 2 1.8 RNA .6

Number of colonies 0 2 4 6 8 10 12 1 4 i.1 Fig. 0 .5 . . . . 6 5 4.5 4 3.5 3 2.5 2 1.5 1 SIZE RANGE 0.5-10.0 0.9-10.0 0.6-10.0 0.8-3.2 0.8-3.7 0.6-5.5 0.5-6.0 0.4-6.5 0.8-6.5 0.9-6.0 0.6-8.0 0.5-6.5 0.9-5.0 1 1.0-9.0 1 1 1.2-8.0 1.0-6.5 2.0-7.0 .0-5.0 .0-6.0 .0-9.0 % > 2 1.5 -2.5kbfraction .5 -5kbfraction 5kb fraction INSERTS 89 97 94 99 94 91 82 98 91 84 92 82 91 95 88 94 93 98 96 90 kb 67 Rapid Screen™ arrayed cDNA libraries Full-length cDNA cloning 68 Rapid Screen™ arrayed cDNA libraries Full-length cDNA cloning PRODUCT COMPONENTS F One 96-wellMasterPlate our sheetsofaluminum (enough materialfor 5’-vector primer foil sealingtape 5 screens) www.origene.com ColEl pCMV6-XL4 (Fig.2),avector-derived 5’PCR primer directionally-cloned intotheCMVexpressionvector abundant inthecell.SincecDNAswere finding thatlongertranscriptstendtobeless duetothegeneral screening offewermembers i.2 Fig. Ori interest (seeFig.4). primertoidentifythelongestcDNAcloneof reverse can beusedinconjunctionwithagene-specific3’ proper transcriptionaltermination. hormone polyaden a which expressionoftheinsert willdrive ifitcontains Moreover, theplasmidcontainsCMVpromoter, replication forpropagation inmammaliancells. plasmid, pCMV6-XL4,containstheSV40 originof mammalian cellsforexpressionstudies. The library sequenced, itcanbedirectlytransfectedinto Once afull-lengthclonehasbeenisolatedand mammalian cells? Can theclonesbeexpressed in translational start site.Finally, thehumangrowth SV40 Ori Ampicillin pCMV6-XL4 ylation signalispresenttoef hGH pol MCS y A Sma I f1 Ori M13 re T7 promoter Sac I v erse fect promoter CMV Product Use 1 order correspondingSub-Plate. agarose geltoidentifypositivewell(s); specific primers;runsamplesinan Plate (5,000clones/well)using2gene- Perform 96-wellPCRontheMaster 3 DNA sequencing. by restrictionenzymedigestionand miniprep DNA;analyzeplasmidDNA positive colony;growcellsandprepare samples inanagarosegeltoidentify using sameprimersasabove;run Perform PCRson96individualcolonies h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 2 to obtainsinglecolonies. plate positivewellonanLBamp to identifypositivewell(s);diluteand Plate; runsamplesinanagarosegel using sameprimersasforMaster on theSub-Plate(50clones/well) Perform 96-wellPCR 69 Rapid Screen™ arrayed cDNA libraries Full-length cDNA cloning 1 70 Rapid Screen™ arrayed cDNA libraries 2 Full-length cDN3 A cloning 4 5 6 7 A C B 8 i.3 Fig. i.4 Fig. 9 1 1 10 1112 A 2 2 B 3 3 Pool 1 C 4 4 D 5 5 E 6

Pool 4 F 6 7 G 7 8 H 8

Pool 9 9 9 10 10 11 11 www.origene.com 12 12 H G F E D C B A — — — — kb 1.5 3.5 5.5 0.5 and 9(40,0 pair (panel clones in pools1,4 A) revealedpositive in Fig.4,PCRanalysisusingagene-specificprimer- proceeding totheirisolation.Intheexampleshown low-abundance ahigh-abundancetranscript. versus technique whenworking witha ismostinformative mustbehighlyspecific. specific primers The pooling well,bothgene- fromanindividual than only5,000 independentclonesperpool,rather 40,000-60,000 one caveattothisapproach isthatsincethereare and itislocatedinwellE9oftheMasterPlate. The shown inFig.3,thereisasingleclonethislibrary Intheexample using twogene-specificprimers. through H. These 20poolscanbeanalyzed byPCR clones/pool) ofDNAcanbemadefromrows A columns 1through12, and/oreightpools(60,000 ( DNA fromeach welloftheMasterPlate,twelvepools wells intheMasterPlatecanbemade.Using5µLof simultaneous PCRs,thenpoolsofDNAfromthe If itisnotpossibleordesirabletoperform96 Is a96-well PCRnecessary? Product Application wish todeterminetheirinser clonesaredetected,onemay If multiplepositive det Can thesize ofthelongest clonebe length. isolation. The 6.5-kbclonesturnedouttobefull- in theother the insert sizes tobe6.5kbintwoclonesand4.5 three clones).Inthisexample,onecoulddetermine the extentofdownstreamsequences(1.5 kbinall 3’ vectorprimer(panelC)alloweddeterminationof Similarly, useofthe5’gene-specificprimerwith (5.5 kbintwooftheclonesand3.5other). determination oftheextentupstreamsequences the 3’gene-specificprimer(panelB)allowed simultaneous analysisusingthe5’vectorprimerand directionally clonedintothelibraryvector, 40,000 clones/pool)ofDNAcanbemadefrom 40,000 er mined withoutfi 0 0 , clones/pool). Sincetheinser even beforeproceedingtotheir rst isolatingit? t siz es before ts were (5,000 clones/pool) andtheshorter formintwowells. (5,000 shor longer transcriptwas moreabundantthanthe Plate nowtodetecttwo alternati waspair ofgene-specificprimers usedonaMaster a fragments, amoreef R spliced tr clone different forms ofanalternatively- Can Rapid-Screen™ beusedto enzymes testedaresuitable. fragments arebeingamplified,thenany ofthethree an efficient Taq DNApolymerase.Ifonlysmall experiments demonstratetheimpor fragments witha7-min extensiontime. These used, butitcouldsuccessfullyamplifyallfour two ofthefragmentswhena3-minextensiontimewas extension timewas used.Enzyme3partially amplified amplify the2.5-and3.0-kbfragmentswhena7-min with a3-minextensiontime,butitcouldsuccessfully Enzyme 2was notabletoamplify any ofthefragments 7-min extension timeexperimentwas notnecessary. the fragmentsusingonlya3-minextensiontime,so to 8.0kbinlength.Enzyme1was abletoamplifyallof a clones/well),each containing Master Platewells(5,000 a enzymes (labeled1,2and3),witheithera3-min(top)or important. Fig.5illustratestheuseofthreedifferent choice oftheappropriate Taq DNApolymeraseis 3’ gene-specificprimertoidentifylongclones,the When the5’vectorprimerisusedinconjunctionwitha “ What factors are important when spliced formscanbedesigned). thatdifferentiatespecific primers betweenthetwo splicing hasalreadybeencharacterized, thengene- rather thantotruncatedtranscripts(ifthealternative is sometimesat the 5’vectorprimerplus3’gene-specific The detectionofdifferent-sized fragmentsbyusing transcript islessabundantthanitsparenttranscript. alternatively-spliced transcripts,evenifthedesired transcripts ofapar apid-S og PCRisusedwithRapid-Screen™? long” single positive clonewithinsertsingle positive sizes rangingfrom2.5 longer extensiontimeisrequired. 7-min (bottom) extensiontime,onfourselected ter form;the formerappearedinthree wells creen™ panelscanbeusedtoclone anscr tributable toalternati ipt? ticular gene.Inthisinstance, the fi cient Taq DNApolymeraseand/or h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: As showninFig.6,a T o tance ofc amplify longer vely ve splicing -spliced hoosing i.5 Fig. i.6 Fig. MM 1 2 n n Enz3 Enz2 Enz 1 3 4 5 M 6 7 8 9 10 1112 71 Rapid Screen™ arrayed cDNA libraries Full-length cDNA cloning 72 Rapid-Screen™ Longest-CloneSM services Full-length cDNA cloning Initially How isthescreen performed? assure thepresenceofafull-lengthclone. most representationsofaparticular genedoesnot representation. Inotherwords,thelibrarywith librariesmayresult indistortionsindividual in in star known tobeabundantinacertain tissue,differences example, eventhoughaparticular transcriptmaybe probability ofisolatingafull-lengthclone.F million mousesize-selected clones,increasesthe containing atotalofeither6-millionhumanor3- 300 several tissues,thescreeningofamulti-tissuepanel, selected library. Sincemostgenesareexpressedin subsequent isolationofthe 3900 Arrayed cDNALibraryPanel* (Super-Plate), and tissue humanora6-tissuemouseRapid-Screen™ 3900 OriGene offers customized screeningofeithera12- What istheScr RSPD-001 P MRSS-001 HRSS-001 Cat.No. Primer DesignandSynthesis Mouse LibraryScreening Service Human LibraryScreening Service Product Listing Rapid-Screen™ Longest-Clone are found,thecustomerwill notbec can beidentifiedinany ofthelibraries.Ifnoclones designed byOriGene,todetermine whetherclones primer service willbe terminated.However, iftheinitial roduct Description s, eitherprovided bythecustomeror , ting RNAqualityorincDNAyieldfor PCR willbeperformedusing gene-specifi eening Service? “longest clone” fromthe harged andthe www.origene.com or c *U.S. Patent #6,316,193 liver, testis,andthymus. Brain (adult),embryo(12.5-day), embryo(19-day), cur What are thesixmouselibraries small intestine,spleen,andtestis. muscle, peripheralbloodleukocytes(PBL),placenta, Brain (adult),brain(fetal),heart, kidney, liver, lung, currently available? What ar pro stained agarose geldetailingtheanalyseswillbe clone, andaphotographofanethidiumbromide- aliquot ofthepurifiedDNA,abacterialstock ofthe both itsintegrityandthesize ofthecDNAinsert. An purified DNApreparedfromtheclonetoconfirm enzyme andPCRanalyseswillbeperformedon is noneedtoprovide multipleclones.Restriction clone fromthelibrarieswillbeisolated.Hence,there cDNA cloneswillbedeterminedandthelongest screening issuccessful,thentherelati vided tothecustomer. r SM ently available? services e the tw elv e human libraries ve siz Price es ofthe absent infetalbrain,li thisexample,thecDNA ofinterestwas screen. In shows theresultsofatypicalhumanSuper-Plate isolated fromthelibraryinwhich itisfound.Fig.1 P Fig. 4oftheRapid-Screen™ Arrayed cDNALibrary in combinationwiththe3’gene-specificprimer(see will bedeterminedusingthe5’vector-specific primer the case,thenwellcontaininglongestclone However Plate screen,thereisnocharge forthescreen. pools/library). IfnoclonesaredetectedintheSuper clones/pool,eight combined intopools(60,000 human orallsixofthemousepanelshavebeen which each oftheeightrowsfromalltwelve S stepintheRapid-Screen™The first Longest-Clone Ho (only ifdeemedappropriate). incomplete cDNAusedtogeneratethePCRprimers target mRNA,and(iii)sequenceofEST or Northern blotting, (ii)expectedsitesofexpression includes (i)expectedsize oftargetmRNAbasedon 3. Informationonthetargetgene(optional). This control. and willbeusedasapositive the PCRprimersequenceswerebased,isrequired 2. Positive controlDNA. A cDNAclone,uponwhich charge. and synthesizeforanadditional specificprimers r base-pairs. ideally beabout500 This informationis withinthecDNAshould forward primers andreverse required. The distancebetweenthepositionsof are (3’)genespecificprimers two contiguousreverse 1. Set Oneforward ofexonic PCRprimers. (5’)and t What materials needto beprovided for kidney detected inlowabundance inadultbrain,heart, intestine. in highabundancelung, placenta,andsmall equired priortothescreening.OriGenecandesign his service? anels section). creening S w , is theinitialscr muscle, PBL,andtestis. , if positi ervice in The longestclonewillthenbe ves aredetected,which isusually v olves aSuper een perf ver ph: , The cDNAw and spleen.Itw 1 882743 a:1.301.340.9254.888.267.4436 fax: or -Plate screen,in med? as found as S M - i.1 Fig. 1 1 2 PBL Muscle Lung Li Kidne Hear Brain (fetal) Brain (adult) 2 8 4567 3 v er 4 3 812 4567 3 t y 1 Intestine Placenta Spleen Small Testis 34 23 73 Rapid-Screen™ Longest-CloneSM services Full-length cDNA cloning 74 Rapid-Screen™ Longest-CloneSM services Full-length cDNA cloning i.2 Fig. M 1 2 3 4 M — — — — — k 1 2 4 8 0.4 www.origene.com b a andpurifiedplasmidDNA.Fig.2showssuchprimers enzyme mappingandbyPCR,usingvector-specific of thecDNAinsert willbedeterminedbyrestriction analysis. The size identity willbeconfirmedbyPCR Once thelongestcDNAclonehasbeenisolated,its t What characterizations are performed on Rapid-Screen™ Longest-Clone fir Before ordering,itisrecommendedthatcustomer Further Information primer (lane4). a the 5’endofclonewas determinedbyPCRusing and a3’vector-specific primer(lane3). The lengthof determined byPCRusinga5’gene-specificprimer (lane 2). The lengthofthe3’endclonewas toconfirmtheidentityofclone specific primers the vector. PCRwas performedusingtwogene- The upperbandistheinsert whilethelowerbandis Not I,which cutsoneithersideoftheinsert (lane1). Purified plasmidDNAofthe clonewas digestedby clone thatwas obtainedby theScreening Service. [email protected]. 301-340-3188, orcontactusbye-mailat Please calltoll-freeat888-267 he isolated clone? n 5’ vector-specific primeranda3’gene-specific st contactOriGeneforfur analysis byagarose gelelectrophoresis foran8-kb ther detailsaboutthe -4436 (U S M Screening Service. .S. only)orat s os ueRC™PnlMA-0 495 620 MRAB-101 HRAA-101 Cat.No. (4 completepanels) Mouse Sure-RACE™ Panel (4 completepanels) Human Sure-RACE™ Panel Product Listing Sure-RACE™ 5’-RACE kit scan 24 individual humanor scan 24individual Broad spectrumoftissues: Simultaneous analysisof transcripts andalternate detect raretranscripts alternatively-spliced AD High sensitivity: High sensitivity: RNA start-sites mouse tissues V ANT A h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: GES sequences. products withdifferent N-terminalaminoacid alternate 5’ex number ofgeneshavealsobeenfoundtoutilize transcriptional promoters. As well,anincreasing tissue-specific ordevelopmentalstage-specific alternate RNAstar number ofgeneshavebeenidentifiedthatutilize is designedwiththerecognitionthatanincreasing have beenarrayed inmulti-wellplates. Sure-RACE™ RACE™ panelscontaindouble-strandedcDNAsthat mouse tissuesanddevelopmentalstages. humantissuesor24 of transcriptsfrom24individual panel whic OriGene hasnowdevelopedaPCR-readyRACE To expandtheutilitiesofRACE technology, expressed regionsofgenes. clones andyieldingfull-lengthsequencesof useful forcompletingthemissingpor amplification ofcDNAends,hasbeenpar RACE technology, aPCR-basedapproach forrapid representing themRNA5’endsaremissing. The Introduction whic Traditional cDNAlibrariesfrequentlyyieldclones h are incompleteandwheresequences h will allowsimultaneous5’endanalysis ons, sometimesresultinginprotein t-sites resultingfromtheuseof tions ofcDNA Price The Sure- ticularly 75 Sure-RACE™ 5’-RACE kit Full-length cDNA cloning 76 Sure-RACE™ 5’-RACE kit Full-length cDNA cloning 5’ADP1..ADP2..GGGGGGGGGGGH 5’ADP1..ADP2..GGGGGGGGGGG i.1 Fig. 3’CCCCCCCCCCC 3’CCCCCCCCCCC 3’CCCCCCCCCCC 3’ 5 5’ ’ fig.SR-1 A AAAAAA ’ 3 AAAAAAAAAAAAA T TTTTTTTTTTTTTCTCG AAAAAAAAAAAAAAG A S dCTP tailing D AAAAAA ’ 3 AAAAAAAAAAAAA econd strand synthesis ual cyclingsynthesis T TTTTTTTTTTTTTCTCG A AAAAAAA3’ 3 AAAAAAAAAAAAAA AAAAAA ’ 3 AAAAAAAAAAAAA TTTTTTTTTTTTTTCTCG VTTTTTTTTTTTTTTCTCG AG 5’ AG CTC 3’ www AG 5’ AG 5’ AG 5’ .or ig ene.com produce atailof1 terminal transferasereactionwas optimized to “tailed” attheir3’endswithdCTP(seeFig.1). To cDNAswere avoid sequenceloss,thefirst-strand nucleotides. in thelossof5’endsequences20-200 which results involves the “blunting” ofthecDNAs, Con ensure theef secondary structures,w enzyme, which facilitatesread-throughofRNA enzyme andlow-processivity/high-thermostability each ofthepoly A the selectionofhigh-qualitymRNAs. The integrityof Development oftheSure-RACE™ Panels began with Product Description RA tissues anddifferent developmentalstages. The from 24majorhumantissues or24majormouse The Sure-RA fragments primedbyoligo(dG)andnic DNA ligase was addedtofacilitatejoiningof the mRNAandtoallowinternalpriming.Finally, T4 error rate. Additionally, RNaseHwas addedtonick synthesis toreducethenucleotide-incorporation coli DNApolymeraseIwas usedforsecond-strand cDNA molecules.Escherichiaends ofthefirst-strand adaptor-oligo(dG) primertotheoligo(dC)tailat3’ cDNA synthesiswas initiatedbytheannealingofan 75 synthesis withthermostable Tth DNApolymeraseat with MMLV RT at42°C,followedbyasecondroundof synthesis was performedusingstandardprocedures overcome thisproblem.Specifically, theinitialcDNA successfully usedadual-cyclingprocedureto transcribed.OriGenehas ends maynotbereverse ofthestartingrepresentative mRNAsinthattheir5’ resulting single-strandedcDNAsmaynotbe transcriptase(RT).reverse As aconsequence,the cDNAsynthesisusingstandard during first-strand secondary structureswhich mayactasstrongstops It iswell-establishedthatmRNAshavecomplex intactness wereusedforcDNAsynthesis. probe. OnlymRNAsthatfulfilledstringentcriteriaof blot analysisusingß-actincDNAasthehybridization ° CE-ready cDNAs areprovided intwo C. Cyclingofhigh-processi ventional double-strandedcDNAsynthesis fi CE™ panelswerecarefully assembled ciency ofthereaction. + RNA was determinedbyNorthern 2-1 5 as repeatedasecondtimeto dC residues.Second-strand vity/low-thermostability k ed mRNA. The the secondrounduses specific primertoenrich cDNAs,and forthespecific specificity ofthegenespecificprimer cycles inthesecondround(nested)PCR. The round, followedby30-35 performed inthefirst specific target(s). About 20PCRcyclesareroutinely nested gene-specificprimertofurther amplifythe The fi Sure-RACE™ isperformedusingtworoundsofPCR. Sure-RACE™ panels. the PCRproductsgeneratedbyhumanormouse fromdirectsequencingof this informationisderived factor. with nonidenticalaminoacidsequences. downstream ex exon exons butalternate oranidenticalfirst first splicings atthe5’end,such astheuseofalternate stages; and[3]pro different tissuesoratdifferent developmental RNA start-sites eitherwithinthesametissue,in structures; [2]allowtheidentificationofalternate which arerareorhavecomplexsecondary probability ofcompletingthe5’endstranscripts Sure-RACE™ increasethe panelswill:[1]markedly designedbytheinvestigator,specific primers the provided withthekitandtwocontiguousgene- the twocontiguousadaptor-specific primers By simplyperforminganestedPCRanalysis,using Product Use observed RACE products. ofthe the findingsandassuranceofspecificity panels areprovided perordertoallowreplicationof are arrayed in48-well(6x8wells)PCRplates.Four analysis ofbothrareandabundanttranscripts. They concentrations (5xand1x),toaccommodatethe r st rounduses ons, whic vide evidenceforalternateRNA Adaptor P Adaptor P h h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: may resultinproteins rimer 1andagene- rimer 2anda s An is acritical y or allof PRODUCT COMPONENTS 24 mouseRACE-ready cDNAs Four identical48-wellPCR dilutions of24humanor Adaptor primers forPCR Adaptor primers plates containingtwo F transfer Control primer ree sampleofDNA Quanti-Ladder™ rin receptor s for 77 Sure-RACE™ 5’-RACE kit Full-length cDNA cloning 78 Sure-RACE™ 5’-RACE kit Full-length cDNA cloning Product Use 5 Preparea48-wellPCRmastermixincluding 1 for DNAsequenceanalysisorcloning. photography andelutebandsofinterest Document theresultsbyimaging/ Sure-RACE™ panel. a Adaptor Primer1andgene-specificprimer1; liquot thesolutionintoeachwellof www DiluteprimaryPCRand 3 .or gene-specifi Adaptor Primer2and second 48-wellplateusing perform secondaryPCRin 2 ig primary PCR. proceed with thermal cyclerand Place theplateintoa ene.com c primer 2. Uponcompletion ofthesecondaryPCR, 4 gel electrophoresis. analyze thereactionproductsbyagarose can beusedtoanalyz panel areillustratedhere. The Sure-RACE™ panel of theinterleukin1receptor antagonistmRNA. The transcripts. Figure6shows ananalysisifthe5’end Examples ofapplicationstheMouseSure-RA order indicatedinFig.5. are arrayed ina48-well(6x8wells) PCRplateinthe analysis ofbothrareandabundanttranscripts. two concentrations(5xand1x)toaccommodatethe CD1 mice. The RACE-ready cDNAsareprovided in Webster miceandthebreasttissuesfromoutbred adult tissueswerepreparedfromoutbredSwiss 24 majortissuesanddevelopmentalstages. The MouseSure-RACE™ panelwas assembledfrom MouseSure-RACE™ Panel B. x a accommodate theanalysisofbothrareand provided intwoconcentrations(5xand1x)to 24 majortissues. The RACE-ready cDNAsare The HumanSure-RACE™ panel was assembledfrom HumanSure-RACE™ Panel A. Product Application somewhat heterogeneous5’ends. conformationsand kb transcriptwithextensive telangiectasia (A extensi 5’-end sequencesoflongandraretranscriptswith The Sure-RACE™ panelcanbeusedtocompletethe detectable. one-fifth, thelatter componentsbecameless When thetemplateconcentrationwas reducedto fromcDNAswithtruncated5’ends. were derived minor componentsofheterogeneoussizes which appropriate size invirtually everytissue,aswell results showasinglemajorcomponentofthe expressed transferrin receptorgene(Fig.3). The the 5’endsequencesoftranscriptsfromhighly- The HumanSure-RACE™ panel was usedtoanalyze bundant transcripts. They arearrayed ina48-well(6 8 wells) PCRplateintheorderindicatedFig.2. ve secondarystructure(Fig.4). TM) geneencodesanubiquitous1 e the 5’endsequencesof h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: The ataxia They CE™ The 92 22 24 24 23 23 18 22 18 22 17 17 16 16 20 15 20 15 19 14 19 14 13 13 1 1 7 7 2- H G D C B A F E 92 22 24 23 22 20 19 1 92 22 24 23 18 22 17 16 20 15 19 14 13 1 1 7 7 41 61 18 17 16 15 14 3 2 2 8 8 H G D C B A F E 123456 2 1 1 2 2 8 8 21 3 3 9 9 2 6. 5. 4. 3. 2. 1. 6. 5. 4. 3. 2. 1. 1 i.3 Fig. i.2 Fig. Fig. Fig. Colon Liver Spleen Kidney Heart Brain Liver Thymus Spleen Kidney Heart Brain 23456 21 3 3 9 9 01 12 11 11 10 10 4 4 13 1415161718192021222324 1 5 4 01 12 11 11 10 10 4 4 31 51 71 92 12 2324 19202122 1718 13 141516 1 2 5 5 2 5 5 Fig. SR-7 3 12. 11. 10. 9. 8. 7. 3 12. 11. 10. 12 6 6 4 9. 8. 7. Placenta Testis Stomach Muscle Small Intestine Lung 12 6 6 4 Skin Testis Lung Muscle Small Intestine Stomach 5 SR-10 5 4 4 8 8 2 2 4 4 8 8 2 2 6 6 Uterus Ovary Pancreas Adrenal Gland Thyroid Gland Pituitary Gland 7 92 22 24 23 22 20 19 92 22 24 23 18 22 17 16 20 15 19 14 1 13 92 22 24 24 23 23 18 22 18 22 17 17 16 16 20 15 20 15 19 14 19 14 13 13 1 1 7 7 7 7 7 1 1 41 61 18 17 16 15 14 3 01 12 11 10 9 8 7 8 8 01 12 11 10 9 8 7 18. 17. 16. 15. 14. 13. 2 2 8 8 8 8 2 2 9 9 2 18. 17. 16. 15. 14. 13. 2 1 1 0 112 10 11 21 10 3 3 9 9 Embryo 9.5day Embryo 8-9day Prostate Gland Uterus Salivary Gland Adrenal Gland 21 9 9 3 3 011 10 01 12 11 10 11 4 4 01 12 11 11 10 10 4 4 12 5 5 24. 23. 22. 21. 20. 19. 5 5 1 5 1 5 1 5 1 5 5 1x 5x 1x 1x 5x 1x 5x 1x 5x 1x 5x 12 x x x x x x x x Mammary Gland Fat Fetal Liver Fetal Brain PBL Prostate Gland x 6 6 12 24. 23. 22. 21. 20. 19. 6 6 Fig. SR-10 Breast/Involuting Breast/Lactating Breast/Pregnant Breast/Virgin Embryo 19day Embryo 12.5day 79 Sure-RACE™ 5’-RACE kit Full-length cDNA cloning 80 Sure-RACE™ 5’-RACE kit Full-length cDNA cloning i.6 Fig. i.7 Fig. 1 13 1415161718192021222324 13 1415161718192021222324 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 10 10 11 11 www 12 12 5X 5X .or ig ene.com e useofdifferentmakes 5’exons toregulateits (Fig. 7). The fibroblastgrowthfactor1(FGF-1) gene alternate 5’exons thatareutilized indifferent tissues differentially-spliced transcriptsthatcontain The Sure-RACE™ panelcan alsobeusedtoidentify size inmosttissues. results showasinglemajorbandoftheappropriate xpression. J11Usedfor testingtheabilityofLexA fusionproteintoenter thenucleus Contains1LexA bindingsiteupstreamoftheLacZreporter gene; leastsensitive pJK101 Contains 2LexA bindingsitesupstream ofLacZreporter gene;lesssensitive pRB1840 Contains8LexA bindingsitesupstreamofLacZreporter gene;mostsensitive pJK103 pSH18-34 UsedforfusingLexA totheC-terminusratherthanN-terminusofbait LacZ Plasmids Galactose-inducibleexpressionof HAtag-targetprotein pNLexA Galactose-inducibleexpressionof NLS-B42-HAtag-targetprotein(Fig.2onPage 84) pJG4-6 pJG4-5 ForexpressionofLexA-bait fusionprotein(Fig.2onPage constitutive 84) pE pEG202 Expr KC8 testinginamatingassay Usedforspecificity 1800 E. Contains0LexA bindingsitesupstreamofLEU2reporter gene;controlstrain RFY206 Contains2LexA bindingsitesupstream ofLEU2reporter gene;leastsensitive EGY40 Contains4LexA bindingsitesupstream ofLEU2reporter gene;lesssensitive EGY188 Contains6LexA bindingsitesupstreamofLEU2reporter gene;mostsensitive DKT-100 EGY194 Cat.No. EGY48 Yeast Strains includes allitemsbelow DupLEX-A™ yeasttwo-hybrid system Product Listing DupLEX-A™ yeast two-hybrid system 22NSForexpressionofLexA-NLS-bait fusionprotein constitutive G202-NLS coli ession Plasmids Str ains trp - strain forreco ph: 1 882743 a:1.301.340.9254.888.267.4436 fax: very ofplasmids Price 81 DupLEX-A™ yeast two-hybrid system Full-length cDNA cloning 82 DupLEX-A™ yeast two-hybrid system Full-length cDNA cloning domains. Neitherdomaincan acti separable DNAbindingand transcriptionalacti proteinshave some transcriptionalactivator Pioneered byFieldsandSong in1989 hence whattheirfunction(s)maybe. into which biochemical pathway theybelong, and what protein(s)theyinteractwithmayprovide insight specific roletheyplayinthecell.However, knowing type ofanalysisdoesnotpro proteins such askinasesorphosphatases,butthis gene productsmaybeassignedtospecifi Based upontheirtranslatedsequences,individual genes whosefunctionshaveyettobedetermined. discovery isproviding researchers withamultitudeof interact withoneanother molecular componentsinvolved anddefinehowthey pathw yeast two-h for detectingprotein-proteininteractionsinvivo. The Nature. 1989Jul20;340(6230):245-6. 1. Anovelgeneticsystem todetectprotein-proteininteractions. One objecti Introduction Primer for PCRandsequencinginpJG4-5 3’ Target Primer Primer for PCRandsequencinginpJG4-5 5’ Target Primer Primer forsequencingvector-insert junctioninpEG202 5’ BaitPrimer B42-HAtag-targetfusionproteinwhich interactswithpBAITfusionprotein Primers LexA-bait fusionproteinwhich interactswithpTARGET fusionprotein pTARGET target control;doesnotinteract withpositive Negative pBAIT target Negativecontrol;doesnotinteractwithpositive pLexA-Max reporter Positive control;activates genesonitsown pRHFM1 pSH17-4 Control Plasmids al . in 1993 ay orprocessistodetermineallofthe 2 , the yeasttwo-hybrid systemisamethod ve ofstudyingapar ybrid systemreliesonthefindingthat . The increasingpaceofgene vide informationonwhat ticular bioc vate transcription 1 and Gyuris c www.origene.com classes of hemical vation et transformed. The yeastGal4proteinandtheE. be geneticallymodifiedeasily reporter gene. Yeast can isusedsinceiteukaryotic, bind toitsbindingsiteandacti isreconstitutedandcan transcriptional activator protein. Ifthetwoproteinsinteract,then domainoftheactivator transcriptional activation binding domainandtheotherwith proteins canbetestedbyfusingonewiththeDNA acti on itsownandmustbetetheredtoanother tissues, andcelllinesforscreening bytheyeasttwo- Cell. 1993Nov19;75(4):791-803. 2. Cdi1,ahumanG1and Sphaseproteinphosphatasethatassociates withCdk2. been constructedfromman with thespecificbaitbeing tested.Librarieshave expression librariesforproteinsthatwillinteract greatest utilityhasbeeninscreeningcDNA interactions betweentwoknownproteins,butits The yeasttwo-hybrid systemcanbeusedtotestfor systems. have beenusedtodevelopsuch yeasttwo-hybrid that LexA protein aretwotranscriptionalactivators vate transcription.Interactionbetweentwo y vate transcriptionofa dif ferent org , and canbe anisms, coli hybrid system. The chances of successfully finding an interacting partner rely heavily on choosing the ADVANTAGES g right tissue or cell-type for the protein of interest, as of the DupLEX-A™ System over n well as on the quality of the library itself. The yeast other LexA or Gal4-based yeast i two-hybrid systems n

two-hybrid system and variations thereof are o l

becoming increasingly popular tools in gene c discovery and functional studies. Ability to eliminate false positives A since target protein expression N is inducible D c

Product Description h t g The DupLEX-A™ Yeast Two-Hybrid System exploits n

the fact that an E. coli transcriptional activation Ability to screen potentially toxic e l -

domain, B42, and an E. coli DNA binding protein, target proteins l l LexA, can activate transcription of a reporter when u

LexA is bound to its DNA recognition sequence and F is also tethered to the B42 activation domain. Neither the LexA protein nor the B42 activation domain m e alone can activate transcription. The two-hybrid Reporters with varying sensitivities t s y system involves fusing the LexA protein with a bait are available so that baits which s d i protein “X” and the B42 activation domain with a activate transcription on their own can r b y target protein “Y” and co-expressing them in yeast potentially still be assayed by using h - containing a reporter gene with LexA binding sites a less sensitive reporter o w t inserted into its promoter. If “X” and “Y” interact, t s a then the B42 activation domain is anchored to the e y

promoter of the reporter gene through the LexA ™ A protein and transcriptional activation of the reporter - X E can be detected (Fig. 1). In the DupLEX-A™ system, Allows co-immunoprecipitation L p “X” is the bait and “Y” is a library of proteins. of interacting proteins using antibodies u D to HA tag or LexAp

Fig. 1

Easy assays are available to determine whether or not a particular bait protein can enter the yeast nucleus and bind LexA operators

Libraries are unamplified and are provided in the form of ready-to-use DNA

ph: 1.888.267.4436 fax: 1.301.340.9254 83 84 DupLEX-A™ yeast two-hybrid system Full-length cDNA cloning i.2 Fig. pBR322 pUC ori E GAA TTCCCGGGGATC CGTCGACCATGGCGGCCGCTCGAGTCGACCTGCAGC co RIBamHISalINcolNotXho ori ADH prom Amp R Amp R Amp R GAL prom T EoVEoIXhoI EcoRI ATG EcoRV nucl. local.B42acidblobdomainHAtag LexA (10.2 kb) pEG202 HA tag (6.4 kb) pJG4-5 B42- ADH t erm ADH ter m TRP1 HIS3 2 micron 2 www.origene.com micron library DNAispro rest. frozen away, andplasmidDNAwas fromthe purified the plates,pooled,analiquotw bacterial transformants,thecellswerescrapedfrom DupLEX-A™ system. After platingtheprimary domainexpressionvectorusedinthe activation between theEcoRIandX cDNA was synthesized andcloneddirectionally Hybrid System kit.For each library, oligo(dT)-primed available forusewiththeDupLEX-A™ Yeast Two- listofcDNAlibraries OriGene hasanextensive hybrid systemlibraries DupLEX-A™ yeasttwo- vector pJG4-5areshowninFig.2. The baitvectorpEG202 andthetargetorlibrary screening strategies. cDNA clonesusingconventional nucleicacid-based be usedasstandardplasmidlibrariesforisolationof to complementtheyeasttwo-hybrid system,mayalso It shouldbenotedthattheselibraries,whiledesigned and prostatecancertissuescelllines. made onconstructinglibrariesfromseveralbreast organisms. Inaddition,aspecialemphasishasbeen human, rat,andmousetissues,aswellfromwhole The listoflibrariesincludesthosemadefromspecific additional DNA,ifneeded. also provided which canbereadilyusedtoprepare A amplified. Moreover, theprovided libraryDNAhasneverbeen perform thelaborioustaskoflibraryDNAisolation. froz Appro en E. coli ximately 1 glycerol stoc vided. 0 0 Thus theresearc µ g hoI k of purifi of theplasmidlibraryis sites ofpJG4-5,the as removed and ed, ready-to-use her neednot Yeast two-hybrid expression cDNA libraries g n i

Product Listing n o l

RNA Source # of Indt. Insert Size Cat. No. Price c Clones Range A N

Human D c

6 Human Fetal Brain* 3.5 x 10 0.2 – 1.6 kb DLH-101 1250 h (Frontal Cortex, 22-week) t g n Human Fetal Kidney 3.0 x 106 0.2 – 2.0 kb DLH-106 1250 e l - l Human Liver (Adult) 1.1 x 107 0.3 – 4.8 kb DLH-100 1250 l u F Human Fetal Liver 8.6 x 106 0.4 – 2.5 kb DLH-105 1250 s

6 e i

Human Ovary(Adult) 4.0 x 10 0.4 – 6.1 kb DLH-114 1250 r a r b i l Human PBL 1.0 x 107 0.3 – 2.5 kb DLH-104 1250 A

(Peripheral Blood Leukocytes) N D c

6 n HeLa Cell* Line 9.6 x 10 0.3 – 3.3 kb DLH-103 1250 o i s s e r

Jurkat T-cell Line 5.7 x 106 0.3 – 4.0 kb DLH-115 1250 p x e d i 6 r MG63 Cell Line 3.0 x 10 0.3 – 2.5 kb DLH-118 1250 b y

(Osteosarcoma Cell Line) h - o w 6 t

WI-38 Cell Line 5.7 x 10 0.4 – 5.0 kb DLH-102 1250 t s

(Human Lung Fibroblast)* a e

(Serum-starved) Y

SKOV3 Cell Line 5.0 x 106 0.2 – 2.3 kb DLH-111 1250 (Ovarian Cancer Cell Line)

Mouse

Mouse Brain (Adult) 6.1 x 106 0.3 – 1.7 kb DLM-100 1250

Mouse Embryo (Whole, 19-day) 1.0 x 107 0.2 – 2.5 kb DLM-110 1250

Mouse Liver (Adult) 9.5 x 106 0.3 – 3.2 kb DLM-102 1250

Mouse Ovary (Adult) 4.0 x 106 0.3 – 1.5 kb DLM-103 1250

Mouse Skeletal Muscle (Adult) 7.2 x 106 0.4 – 3.5 kb DLM-111 1250

Mouse Spleen (Adult) 1.0 x 107 0.2 – 2.5 kb DLM-101 1250

ph: 1.888.267.4436 fax: 1.301.340.9254 85 86 Yeast two-hybrid expression cDNA libraries Full-length cDNA cloning nM R1 receptor negative) (Involuting) os rsae oml3.7x10 Mouse Prostate, Normal 2.9x10 LNCaP Cell(T LNCaP Cell(Untreated) 4.8x10 Human Prostate, Tumor 6.4x10 Human Prostate, Normal 1.0 x10 Prostate-specific 1.0 x10 Mouse Breast,Normal Mouse Breast,Normal 1.0 x10 Mouse Breast,Normal Mouse Breast,Normal 1.0 x10 SKBR3 Cell(Estrogen- 1.0 x10 MCF7 Cell(Estrogen-treated) MCF7 Cell(S MCF7 Cell 8.2x10 Breast-specific 8.0x10 4.5x10 Rat Thymus (Adult) 1.0 x10 Rat Testis (Adult) Cat.No. Rat Brain(Adult) Insert Size Rat Adipocyte #ofIndt. Rat RNA Source (Pooled from8adults) (Lactating) (Pregnant, 12-Day) (V (Estrogen-Depleted) (9 week-oldZucker rat) (Pooled from8adults) irgin) 881) erum-grown) reated with30 lnsRange Clones 4.6 x1 6.3 x10 5.4 x1 1 .0 x10 0 0 7 7 7 7 7 7 7 6 6 6 6 6 6 6 6 6 6 www.origene.com . . bDH121250 DLH-112 1250 1250 1250 0.6 –4.5kb DLR-100 1250 DLR-101 DLR-102 0.3 –4.5kb 0.5 –4.0kb DLR-103 0.3 –3.4kb 0.4 –5.0kb . . bDM141250 1250 DLM-104 1250 0.3 –4.0kb DLH-109 0.3 –2.3kb DLH-108 0.3 –2.0kb 0.2 –2.0kb 1250 DLM-105 1250 0.4 –3.1kb 1250 DLM-107 0.4 –5.3kb 0.4 –5.5kb DLH-113 0.5 –4.0kb 0.4 –4.6kb 0.4 –3.5kb . . bDH171250 DLH-107 0.3 –1.7 kb . . bDM161250 DLM-106 0.4 –7.0 kb L-0 1250 DLM-108 DLH-1 DLH-1 DLH-1 1 1 1 0 1250 1250 6 7 Price 1 250 amplified. and werecitedinnumerouspublications libraries hasbeenutilizedbyscientists extensively DupLEX-A Yeast Two-Hybrid System kit,these cDNA libraries. componentofOriGene’sAs apivotal OriGene pro Introduction ***The S.cerevisiaelibraryisfromstrainS288C,withinsertsclonedintotheEcoRIsiteofpJG4-5. are moreinformativethanlargerinsertsintheyeasttwo-hybridsystemscreen.Evenso,therepresenttheselibraries. **The averagesizeoftheinsertswascalculatedbyrestrictiondigestionanalysisplasmidDNAfrom48randomly-chosencolonieseachlibrary. Pleasenotethatsmallerinserts * 5.8x10 MDBK Cell(Bovine Kidney) 4.0x10 1.8 x10 3.8x10 S. cerevisiae***(Genomic) Cat.No. D. melanogaster (Adult) Insert Size C. elegans (Adult) #ofIndt. Other RNA Source Moreo perform thelaborioustaskoflibraryDNAisolation. purified fromtherest. Thus theresearchers neednot removed andfrozen away andtheplasmidwas scraped fromtheplates,pooled,analiquotw primary bacterialtransformants,thecellswere used intheDupLEX-Asystem. After plating the domain expressionvector (Fig. 1),theactivation directionally betweenEcoRIandXhoIsiteofpJG4-5 from highqualitymRNAsandcloneduni library, oligo(dT)-primerdcDNAwas synthesized The librariesmarkedwithasingleasterisk(*)wereamplifiedanadditionaltimeandplasmidDNAwaspurifiedfromthere-amplifiedcells. ver , the pro vides anextensi vided libraryDNAhasneverbeen ph: ve listofexpression lnsRange Clones 1 882743 a:1.301.340.9254.888.267.4436 fax: 6 6 6 6 1-11 . F or eac as h - . . bDY101250 1250 DLY-100 0.3 –4.0kb DLCE-100 0.2 –3.6kb . . bDB-0 1250 1250 DLBK-100 0.3 –1.7 kb DLDM-100 0.3 –1.8 kb i.1 Fig. pUC ori Amp R Amp R GAL prom A G cR cR XhoI EcoRI TG EcoRV nucl. local.B42acidblob domain HAtag HA tag (6.4 kb) pJG4-5 B42- ADH term TRP1 Price 2 micron 87 Yeast two-hybrid expression cDNA libraries Full-length cDNA cloning 88 Yeast two-hybrid expression cDNA libraries Full-length cDNA cloning bone andsmoothmuscledevelopment. J nucleus. 6. p57Kip2regulatesactindynamicsbybinding andtranslocatingLIM-kinase1tothe J 5. Murinetenascin-W J immune activationbysignalingthroughtoll-like receptor3. 4. SmallinterferingRNAsmediatesequence-independentgenesuppressionandinduce Mol BiolCell.2004Jul;15(7):3106-13. Akt inepithelialcells. 3.Ribosomal S6kinaseasamediatorofkeratinocytegrowthfactor-induced activationof Mol BiolCell.2004Nov;15(11):4926-37. 2. GIPCrecruitsGAIP(RGS19)toattenuatedopamineD2receptorsignaling. Nucleic AcidsRes.2004Dec14;32(22):6519-30. 1. CoordinatedfunctionsofWSS1,PSY2andTOF1intheDNAdamageresponse. purified fromtherest. removed andfrozen away, andplasmidDNAwas scraped fromtheplates,pooled,analiquotwas primary bacterialtransformants,thecellswere EcoRI andXhoIsitesofpJG4-5. After platingthe synthesized andcloneddirectionallybetweenthe For each library, oligo(dT)-primedcDNAwas Product Description: lines. several breastandprostatecancertissuescell has beenmadeonconstructinglibrariesfrom w human, rat,andmousetissues,aswellfrom The listoflibrariesincludesthosemadefromspecific screening strategies. clones usingconventional nucleicacid-based standard plasmidlibrariesforisolationofcDNA two-hybrid system,theselibrariescanbeusedas In addition,whiledesignedtocomplementtheyeast library DNAisolation.Moreo the researcher neednotperformthelaborioustaskof purifi additional DNA,ifneeded. also pro A DNA hasneverbeenamplified. Biol Chem.2003Dec 26;278(52):52919-23. Cell Sci.2004Feb1;117(Pt4):571-81. Immunol. 2004Jun1;172(11):6545-9. hole organisms. Inaddition, aspecialemphasis frozen E.coliglycerolstock oftheplasmid libraryis ed, ready vided whic : a -to-use libraryDNAispro novel mammaliantenascinexpressedinkidney andatsitesof h can bereadilyusedtoprepare Appro ver , ximately 1 the pro vided library vided. Thus www.origene.com 0 0 µ g of Proc NatlAcadSciU SA.2003Apr29;100(9):5211-6. protein 4:apotentiallinkbetweengenomesurveillance andapoptosis. 11. Fas-associateddeathdomainproteininteracts withmethyl-CpGbindingdomain J histatin 5. 10. CandidaalbicansSsa1/2pisthecellenvelope bindingproteinforhumansalivary Hum MolGenet.2003Sep15;12(18):2359-68. conserved proteincontainingaNifU-likedomain. 9. TheLaforadiseasegeneproductlaforininteractswithHIRIP5,aphylogenetically J phosphatase targetingsubunits. 8. PDZDomain-mediatedinteractionofinterleukin-16precursorproteinswithmyosin J transcriptional regulationofthericeWxgene. 7. AninteractionbetweenaMYCproteinandanEREBPisinvolvedin screening strategies. cDNA clonesusingconventional nucleicacid-based be usedasstandardplasmidlibrariesforisolationof to complementtheyeasttwo-hybrid system,canalso It shouldbenotedthattheselibraries,whiledesigned Biol Chem.2003Oct24;278(43):42190-9. Biol Chem.2003Aug1;278(31):28553-61. Biol Chem.2003Nov28;278(48):47803-11. Largest selectionofcDNAlibraries specifically forbreastandprostate Several librariesdesigned for library DNAplusbacterial Supplied asready-to-use TRP1 two-h ADVANTAGES cancer researc glycerol stock -compatible yeast ybrid systems h Gene expression

Rapid-Scan™: PCR-based gene expression profiling panel

Real-Time-Scan™: Real-Time PCR-based gene expression profiling panel

Northern Blot

Multiple-Choice™ cDNAs

Blue-Ribbon™ Poly A+ and Total RNAs 90 Rapid-Scan Gene expression (48 Tissues) (48 Tissues) rspiaTsu ai-cnPnl(2PrsSae)DC-0 375 675 550 675 520 675 DSCC-101 NSCF-101 Human MSCB-101 TSCE-101 Drosophila Rapid-ScanTissue Panel (12 Parts/Stages) Mouse BrainRapid-Scan Panel BSCD-101 (48Parts/Stages) Cat.No. Mouse Rapid-ScanTissue Panel (24 Tissues) HSCA-101 (24 Normals/Tumors) Human BreastCancerRapid-Scan Panel Human BrainRapid-Scan Panel (12 Parts) Human Rapid-ScanTissue Panel (24 Tissues) Product Listing Rapid-Scan T issue R New! eal-T ime R apid-S can P nlHC-0 <)680 anel HSCR-101 (<5) www .or ig ene.com SR11(–0 575 HSCR-101 (5–10) SR11(1)500 HSCR-101 (>10) Price .Widertissuespectrum:48inReal-time panel 2. Real-time PCRplatformcompatible 1. over theconventional Rapid-Scan isasfollows. real-time PCR. panel The advantageofReal-Time principle, yetthecDNAtemplatewas normalized by Rapid-Scan expression, OriGenelaunched thenew to pro To advantageofReal-TimePCRtechnology take and be accommodatedbyuseofNor tification andsizingoftranscriptaredesired,thiscan of transcriptaccumulation.Ifmoreexactquan andprovide aquicksensitive readoutaboutthesites The Rapid-Scan GeneExpressionPanels arehighly analysis oftheproductsinanagarose gel. followedbyelectrophoretic gene-specific primers, hours. All thatisrequireda48-or96-well PCRusing expression profileforanygeneinjustthree given tec developmental stages. mRNA accumulationinthevarioustissuesand facilitate semi-quantitati reaction willbewithinthelinearrangeand,hence, well PCRplate. This ensuresthattheamplification diluted over a4-lograngeandarrayed ina48-or96- internal standard. The cDNAswerethenserially- represented, andhavebeennormalized usingan assure thatlowabundanceandlongtranscriptsare cDNAshavebeentestedto first-strand Individual gene orEST fromeitherhuman, mouseorDrosophila. expressionprofileofany"comprehensive" cloned tissues and/ordevelopmentalstages,togeneratea quality, fromdifferent cDNAsderived first-strand Rapid-Scan™ isaPCR-basedsystem,usinghigh- Introduction .Simplifiedprocedure:nomore agarose gel 4. 3. vs. 24tissuesincon electrophoresis andgelimaging steps. level More accuratequantification ofgeneexpression hnique, onecangenerateacomprehensi vide moreaccurateprofilingofgene panel. This panelisbasedonthesame ventional panel ve determinationofrelative With thisnon-radioacti h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: thern RNABlots. Real-Time ve ve - alternatively-spliced transcripts with newly-launched 48-tissue Simultaneous examinationof man Real-time PCR compatibility Simultaneous analysisof Fast andnon-radioactive developmental stages y Highly sensiti semi-quantitative ADVANTAGES dif human panel ferent tissuesand/or ve and 91 Rapid-Scan Gene expression 92 Rapid-Scan Gene expression time PCR. 1ng) ofcDNA ispro therefore onlyoneconcentration of(approximately cDNA w high-quality cDNAsfrom48 humantissuesandthe S Real-Time Rapid-Scan isanewmemberoftheRapid- (normalized against rp49). actin), and1 48 mousebrainparts andstages (normalized against 24 majormousetissues(normalized against actin), (normal/tumor) samples(normalized against actin), (normalized against actin),24humanbreastcancer (normaliz Panels arecurrently available:24humantissues Six con subsequently arrayed ina48-or96-wellPCRplate. approximately 1pg. The dilutedcDNAswere 1x), withthelowestconcentration(1x)being 100x, 10xof fourconcentrations(labeled1000x, and transcript. Eac an equi subjected tonormalization,such thattheyallcontain cDNAsfromeachThe first-strand tissue werethen transcripts ofselectedrareandlongmRNAs. contamination andtocontaincompletereverse cDNAs wereconfirmedtobefreeofgenomicDNA andMMLVprimers transcriptase.Individual reverse synthesize cDNA,usingoligo(dT) first-strand RNA integrity. The poly A examined byNorthern blothybridization toconfirm selection. The recovered poly A Total RNAwas isolatedandsubjectedtooligo(dT) individuals. were pooled,wheneverpossible,frommultiple o 12 Drosophilatissuesandstages. To avoid detection mouse tissues,48brainparts andstages,or breast cancer(normal/tumor)samples,24major human tissues,12 humanbrainparts, 24human assembled byselectingeither24frequently-studied Rapid-Scan™ GeneExpressionPanels were Product Description: f can family individual differencesindividual ingeneexpression,tissues valent concentrationofacontrolrever as normaliz ventional R ed . There isnoneedforserial dilution It isareal-timePCRreadyassemblyof ag h 2 cDNA w ainst actin),12 humanbrainparts Drosophila tissuesandstages ed ag vided. The customer cansimply apid-S as dilutedinw ainst beta-actinusingreal- + can™ GeneExpression RNA was thenusedto + RNA was then ater toaseries www .or se ig ene.com profile across48tissueswithminimalhand-ontime. andobtainanaccurategeneexpression primers add thereal-timePCRmixwithgenespecific dried, serially-diluted, PCR-ready, or 96-wellPCRplatescontaining PRODUCT COMPONENTS Two identicalRapid-Scan™ 48- Two cover sheets adhesive for sealingthePCRplates Primers fordetectionof first-strand cDNAs first-strand control cDNA Product Use 4 given gene. complete expressionprofilefora minimal amountoftimetoobtaina Panels areeasytouseandrequirea The Rapid-Scan™GeneExpression imaging/photography. Document theresultsby h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 3 1 electrophoresis. the reactionproductsbyagarosegel Upon completionofthePCR,analyze PCR plate. into eachwelloftheRapid-Scan™ interest andaliquotthesolution specific primersforthecDNAof master mixincludingtwogene- Prepare a48-wellor96-wellPCR Placetheplate 2 PCR. proceed with cycler and into athermal 93 Rapid-Scan Gene expression 94 Rapid-Scan Rapid-Scan Gene expression D C B A i.3 Fig. 1234567891011 1000X i.2 Fig. 1000X 1000X 1000X 1000X 1000X 1000X 100X 100X 10X F 10X 1X 1X g 1 ig. 5. SubstantiaNig 4. Hippocampus 3. Cerebellum 2. 1. F 6. CaudateNucleus H G F E D C B A T emporal Lobe rontal Lobe 8. SmallIntestine 7 6. Colon 5. Liver 4 3. Kidney 2 1. Brain . . . 31 51 71 92 12 324 23 22 21 20 19 18 17 16 15 14 13 Heart Spleen Lung M 01 12 11 10 9 8 7 6 5 4 3 2 1 1 2 3 4 5 6 ra 7 8 9 10 1112131415161718192021222324 1 Gland 14. Thyroid 13. Salivary Gland 1 11. Testis 1 16. P 2. Placenta 0. Stomach 9. Muscle 5. Adrenal Gland a ncreas 12. SpinalCord 11. Medulla 10. P 9. Hypothalamus 8. 7. Am Thalamus ons ygdala 24. F 2 22. BoneMarrow 21. PBL 2 19. ProstateGland 1 17. Ovary 8. Uterus 0. Skin 3. F e etal Brain tal Liver www 1 10x 100x 1 1 10x 1 1 PTPN1 PRSS3 TG AMPD1 MA α x 000x x 00x 000x actin 12 -actinin 2 G 1x 10x 100x 1000x .or ig ene.com muscle, th phosphate deaminase1(isoform1)(AMPD1)onlyin detected onlyinadultbrain,adenosinemono states. Myelin-associatedglycoprotein(MA known genesinvarioustissuesordifferentiation generate expressionprofilesofselectedpreviously- The HumanR muscleandheart,skeletal butalsoinbrain. 2 accumulationofthemuscle-specifica-actinin relative The Rapid-Scan™ panelwas usedtodeterminethe distribution inall24humantissues(Fig.2). with theRapid-Scan™ panels)showsequivalent provided Amplification ofactincDNA(usingprimers normalized usingactin as aninternalcontrol. different cDNAshavebeen tissues,thefirst-strand To facilitatecomparisonoftranscriptaccumulationin order indicatedinFig.1. The cDNAswerearrayed ina96-wellPCRplatethe from24differentconsists ofcDNAsderived tissues. The HumanRapid-Scan™ GeneExpressionPanel Panel Rapid-Scan™ HumanTissue A. Product Application gel (Fig.4). and thePCRproductswere separatedinanag the humandopaminereceptor familywereanalyz transcript levelsofagenefamily. of Three members This panelw indicated inFig.3. actin andarrayed ina48-wellPCR plateintheorder two indi brain parts. The RNAwas preparedandpooledfrom Panel from12 different consistsofcDNAsderived GeneExpression The HumanBrainRapid-Scan™ B only inprostategland. pancreas, andproteintyrosinephosphatase(PTPN1) serine protease3(mesotrypsin)(PRSS3)onlyin . transcript, which isdetectedpredominantlyin ua ri ai-cn Panel Human Brain Rapid-Scan™ viduals. yroglobulin (TG)onlyinth as usedtodeterminetherelati The cDNAswerenormaliz apid-S can™ panelw as usedto yroid gland, ed against G) w arose ed ve as - 1 1000X 1000X 000X 10X 6 tissues. Incontrast,theexpression ofgenes4,5,and tumor tissuesandundetectable innormalbreast and almostundetectablein normalbreasttissues. Genes 1,2,and3wereup-regulatedinman panel. (Fig.6) related inbreastcancerwas examinedusingthis mal andtumortissues. gene expressionofacandidatebetweennor- This panelisdesignedtoexaminethechange in in Fig.5. ar breast. The cDNAswerenormalized against actinand tissues werefrompatientswithcarcinomaofthe and microdissectedtoremove fattissues. The tumor tissues wereobtainedbyreductionmammaplasty normal and12-tumor breasttissues. The normal Expression P The HumanBreastCancerRapid- Scan™ Gene Rapid-Scan™ HumanBreast Cancer C. levels ofactinineac observed. The resultsalsodemonstrateequivalent nucleus, verifyingresultsthathavebeenpreviously the D1receptorwas onlyexpressedinthecaudate at varyinglevelsofaccumulation.Ontheotherhand, The D2receptoralsoshowedbroaddistributionbut less equallevelsinallofthebrainparts examined. The D5dopaminereceptorwas presentatmoreor i.4 Fig. were down-regulatedinman rayed ina96-wellPCRplatetheorderindicated 1 2 anel consistsofcDNAsderi 3 P 4 anel h normaliz 5 The expressionof6genes 6 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: y ed tissue. 7 breast tumortissues 8 9 ved from1 10 11 12 10 1112 y breast 2- D D D1 actin 5 2 1000 X 1000 X 1000 X 1000 X 1000 X 1000 X 1000 X 1000 X H G D A C B E F i.6 Fig. M i.5 Fig. 1 123456789101112 1 41 61 81 02 22 24 23 22 21 20 19 18 17 16 15 14 3 2 12. Normal Breast12 12. Normal 11. Nor 10. Nor 9. Nor Breast8 8. Normal Breast7 7. Normal Breast6 6. Normal Breast5 5. Normal Breast4 4. Normal Breast3 3. Normal Breast2 2. Normal Breast1 1. Normal 3 4 5 mal Breast11 mal Breast10 mal Breast9 6 7 8 9 10 1112M 13 1415161718192021222324 24. BreastCancer12 23. BreastCancer11 22. BreastCancer10 21. BreastCancer9 20. BreastCancer8 19. BreastCancer7 18. BreastCancer6 17. BreastCancer5 16. BreastCancer4 15. BreastCancer3 14. BreastCancer2 13. BreastCancer1 1x 10x 100x 1000x 1 10x 1 1000x Gene 6 Gene 5 Gene 4 Gene 3 Gene 2 Gene 1 actin x 00x 95 Rapid-Scan Gene expression 96 Rapid-Scan Gene expression 1000 X 1000 X 1000 X 100 X 100 X 100 X 10 X 10 X 10 X 1 1 1 X X X D A H G C B E F 2 1 3 8 7. Stomach 6. Liver 5. Thymus 4. Spleen M . . . . 1 123456789101112 Small Intestine Heart Brain Kidney 41 61 81 02 22 24 23 22 21 20 19 18 17 16 15 14 3 1 2 3 4 5 6 7 8 9 10 1112M13141516171819202122232 1 15. Uterus 14. Pancreas Gland 13. Adrenal 12. Skin 1 1 6. ProstateGland 0. Lung 1. Testis 9 . Muscle Fig Fig. 7 Fig. . 8 2 23. Breast/Lactating 22. Breast/Pregnant 21. Breast/Virgin 20. Embryo/19day 1 1 1 4. Breast/Involuting 9. Embryo/12.5day 8. Embryo/9.5day 7. Embryo/8.5day www 4 1x 1 1 1 1 10x 100x 1 EST Skin-specific Tbx20 a ctin 0x 00x 000x x 000x .or ig ene.com specific ES in embryoatdifferent stagesofgestation. The skin- expressed inabundanceheart andatalowerlevel heart-specific gene(Tbx20)was foundtobe gene (Tbx20)andaskin-specificEST sequence. The the expressionprofilesforamouseheart-specific The MouseRapid-Scan™ panelwas usedtoconfirm shown inFig.8demonstratesuch anapplication. to confirmtissue-specificexpression. The results the expressionprofileofanuncharacterized EST or panelisaneffective tooltoobtain The Rapid-Scan™ P normalized against actinandarrayed ina96-well tissues fromoutbredCD1mice. The cDNAswere from outbredSwiss Webster mice,andthebreast or developmentalstages. The adulttissueswere from24differentconsists ofcDNAsderived tissues The MouseRapid-Scan™ GeneExpressionPanel Panel Rapid-Scan™ MouseTissue D. functions. potentialgene providing cluestounderstanding demonstrates theusefulness ofthispanelin restricted tothespinalcord. spinal cord.However, inadults,itsexpression is brain par In embryonicstages,Hox3.1 isexpressedinmany Hox3.1 areshownin Fig.10. dopamine receptorDD3andHo mouse DLX-5(DrosophilahomologDistal-less5), This panelhasbeenusedtoprofiletheexpressionof in Fig.9. ar mice. The cDNAswerenormalized against actinand tissues wereharvestedfromOutbredNIHS brain parts developmentalstages. atfive The brain Panel from48mouse consistsofcDNAsderived The MouseBrainRapid-Scan™ GeneExpression Panel MouseBrain Rapid-Scan™ E. embryos. not onlyinskin,butalsostomach andinday19 CR plateintheorderindicatedFig.7. rayed ina96-wellPCRplatetheorderindicated ts withahighlevelofexpressioninthe T sequence w as foundtobeexpressed This pieceofdata x3.1 . The resultsof wiss D A H G C B detected inthe adultmalehead. The male-specific internal controltonormaliz pared from tissues anddevelopmentalstages. The RNAwas pre- P GeneExpression The DrosophilaRapid-Scan™ Panel Rapid-Scan™ Drosophila Tissue F. encoding aribosomalprotein, w developmentally regulated, therefore,rp49,thegene The expressionoftheactingenesinDrosophilais The resultsareshowninFig.12. sites ofexpressionhavealreadybeenestablished. to confirmtheexpressionprofilesofgeneswhose plate intheorderindicatedFig.11. This was used strain. The cDNAswerethenarrayedPCR ina48-well E F anel consistsofcDNAsderi 10. Spinalcord 12. P 11. F Embry E E 13. Entorhinalcor i.9 Fig. 4. Spinalcord 3. Rhombencephalon 9. Medulla 8. Pons 7. Midbrain 6. Diencephalon 5. Telencephalon 2. Mesencephalon 1. Telencephalon/ 3 2 1 mbryo day 15 mbryo day 13 123456789101112 73839404142434445464748 24 23 22 21 20 52627282930313233343536 19 18 17 16 15 14 3 (Hindbrain) ( Diencephalon Midbrain) osterior cor rontal cor o da y 18 te te x Drosophila melanogaster te x x 1 1 16. Striatum 15. Hippocampus bulb 14. Olfactory 31. Cerebellum 30. Hypothalamus 29. 28. Striatum 27. Hippocampus bulb 26. Olfactory 25. Entorhinalcortex 24. Posterior cortex 23. Frontal cortex Postnatal day 7 2 2 2 19. Midbrain 2. Spinalcord 1. Medulla 8. Hypothalamus 0. Pons 7. Fruitless Thalamus Thalamus e h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: eac ved from12 different transcript was only h The alternatively- Drosophila cDNA. 48. Spinalcord 47. Medulla 46. Pons 45. Midbrain 44. Cerebellum 43. Hypothalamus 42. Thalamus 41. Striatum 40. Hippocampus bulb 39. Olfactory 3 3 3 Adult 5week 3 34. Medulla 33. Pons 32. Midbrain as usedan 8. Entorhinal 5. Spinalcord 7. Posterior cortex 6. Frontal cortex cortex Canton S 100x 1 100x 1 1 1 1 1000x 000x 000x 00x 000x 00x D A C B 1000X 1000X 1000X 1000X 1000X 1000X 1000X i.11 Fig. and inadulthead, butnotinadultbody detected inwholeembryos, starting from4hours, present infemaletissues. in the3rdinstarandmale tissues,andisnot spliced maleformofDoublesex was detectedmainly 1 i.12 Fig. 23456789101112 3 3 25-36 2 1 13-24 7-48 7-48 5-36 3-24 1 1 1 -12 -12 6. 2ndInstar 5. 1stInstar 4. Embryo/12–24hr 3. Embryo/8–12hr 2. Embryo/4–8hr 1. Embryo/0–4hr 2 i.10 Fig. 3 4 5 6 The 7 Eyeless 8 12. Female Body 11. MaleBody 10. Female Head 9. MaleHead 8. Pupae 7. 3rdInstar 9 10 1112 transcript w . 1 1000x 1 1000x 1 1000x 1 1000x 00x 00x 00x 00x (female form) Doub (male for Doublesex (male form) F Ultrabithorax Eyeless Antennapedia Bicoid as r uitless 1x 10x 100x 1000x lese m) x 97 Rapid-Scan Gene expression 98 Real-Time-Scan Gene expression D C B A D C B A i.13 Fig. 12 Hear 11 F 10 Esophagus FIG. 1 9 8 7 6 5 4 3 2 1 1234567891011 o o o Row D Row C Row B Row A A Epididymis Cer Brain Decending part Decending part Bone marrow Bile duct Bronchus Colon of duodenum 2 a drenal Gland t vix 3 t 14 4 5 6 7 8 24 Opticner 23 Nasalmucosa 22 Muscle 2 2 1 16 Larynx 1 14 Intracranialartery 13 Intestine(Small) 19 L 18 Lung 1 7 5 0 (peripheral blood) 9 Mammary gland Mammary Liver Kidney Lymphocytes y 10 1112131415161718192021222324252627282930313233343536373839404142434445464748 mph node v e 3 33 Rectum 3 31 Placenta 30 Pituitar 2 28 Parathyroid 2 26 Oviduct 25 Ov 36 Skin 35 Seminalvesicles 2 4 9 7 Prostate Salivary Gland Pericardium Pancreas a ry y 4 43 Ureter 42 4 40 Thymus 3 38 Stomach 37 Spleen 4 45 Uterus 48 47 Vagina 4 6 1 9 www.origene.com T Thyroid Testis V Urinary bladderUrinary Uvula o ena Ca nsil v a 1 2 3 mucosa andskin.Prostate specificantigen,kallikrein envelope 2B(LCE2B)was detectedonlyinnasal parathyroid. Skin-specificgene,Latecornified Thyroglobulin was detectedonlyinthryroidand known geneinvarioustissues(Fig.14, Panel B-D). generate expressionprofilesofselectedpreviously- the humanReal-TimeRapid-Scan Panel was usedto To validatethepanelforspecificityandsensitivity, distribution inall48humantissues.(Fig.14, Panel A) with theRapid-Scan panelsshowsequivalent provided Amplification ofactincDNA(usingprimers r cDNAshavebeennormalizedThe first-strand by plate intheorderindicatedFig.13. tissues. The cDNAswerearrayed ina96wellPCR Panel from48different consistsofcDNAsderived The HumanReal-TimeRapid-Scan geneExpression HumanReal-Time Rapid-ScanPanel F. eal-time PCRusingbeta-actinasaninternalcontrol. (KLK3) w as detectedonlyinprostate. KLK3 LCE2B thyroglobulin Beta-actin Nor intheindustry,workhorse RNAblothybridization or transcript andisonly semi-quantitative. The not pro expression analysis. Though often laborious, Uterus, Skin) (Salivary Gland,Pancreas, Adrenal Gland,Ovary, Tissues Northern Blot—6 Urinary Bladder, Uterus) Prostate, SalivaryGland, Testis, Thymus, Thyroid, (Brain, Duodenum,Esophagus,Pancreas, PBL, N C (Brain, Lung,Heart, Muscle,Stomach, SmallIntestine, Tissues Northern Blot—12 Nor a oa N ltS-00710 to measurespecifi Panel andtime-efficient isahighlysensitive system analysis. While theRapid-Scan™ GeneExpression SB-2040 stepforfunctional interest isanessentialfirst Identification oftissueswhich expressageneof Introduction (F Nor Rat Total RNABlot Rat Poly A Mouse P Human Poly A Cat.No. Human Poly A Human Poly A Product Listing Northern blot Li (Brain, Lung,Heart, Muscle,Stomach, SmallIntestine, Northern Blot—12 Major Tissues Small Intestine,Li (Brain, Thymus, Lung,Heart, Muscle,Stomach, Cerebellum, Midbrain,Pons, Medulla,Spinal Cord) Hippocampus, OlfactoryBulb,Striatum, Thalamus, olon, Liver, Kidney, Spleen, Testis, Placenta) rhr lt—1 Tissues orthern Blot—12 ver rontal Cor thern Blot—1 thern Blot—1 thern blot , Kidney vide informationaboutthe size of the oly + N ltR-00640 RB-2030 RNA Blot tex, P A , + ting, hasbeenwidelyused forgene pen ets hms Skin) Spleen, Testis, Thymus, + + + RNA Blot N ltIIH-12415 725 HB-1102 725 HB-2011 HB-2010 RNA BlotIII RNA BlotII RNA BlotI osterior Cor ver 2 2 c Major Tissues Brain Parts transcript accumulation,itdoes , Kidney h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: , tex, EntorhinalCor pen ets Skin) Spleen, Testis, tex, method, isolatedtotalorpoly data, andalternateRNAsplicing.Inthestandard script size, RNAquantification,cross-hybridization of Northern blotting provides, other thandetermination mRNA species inthevarioustissues. then performedtodetermine therelati immobilized RNAwithalabelednucleicacidprobeis transferred ontoasolidsupport. Hybridization ofthe of tissuesareseparatedby gelelectrophoresisand sites ofexpression,informationregarding tran- MB-2020 A + RNA fromavariety ve levelsofan Price 640 99 Northern Blot Gene expression 100 Northern Blot Gene expression Proc NatlAcadSciU SA.2004Sep28;101(39):14126-31. embryonic lethality. 5. Targeted disruptionoftheWalker-Warburg syndromegenePomt1inmouseresults in J 4. Expressionofslc5a8inkidneyanditsrole Na(+)-coupledtransportoflactate. Proc NatlAcadSciUSA.2004Nov30;101(48):16831-6. mice. 3. dsufunctionsinaMYO5A-independentpathway tosuppressthecoatcolorofdilute J 2. AtargetedmutationofNkd1impairsmousespermatogenesis. J capable ofblockingcellularproliferation. 1. CloningandcharacterizationofmouseE2F8,anovelmammalianE2Ffamilymember poly A quality controlprocess. Approximately 2µgof the RNAusedinblotsisassuredthrougharigid of organism, tissue,andtype ofRNA. The integrityof membranes offered inavarietyofchoices, interms The Northern Blotsarepremade,ready-to-hybridize Product Description publications. citation listbelowisonlyasmallsampleofsuch in many publicationsinpeer-reviewed journals. The quality andreliabilityhasbeenvalidatedbycitations Northern blotstotheresearch community. Itshigh Since 1997, OriGenehasbeenproviding pre-made rat 12-major tissueblot,andarat12-brain part blot. OriGene alsooffers amouse12-major tissueblot,a tissues (BlotIandBlotII)orsixIII). OriGene of fortranscriptsize determination. RNA markers tissue samplemayvaryslightly ribosomal RNA.Signalintensityforactinacrosseac levelsof were adjustedtoreflectequivalent amounts ofactinmRNA,whiletotalRNAsamples tissue w irradiation. Loading ofthepoly A byUV light membrane, andcovalently crosslinked transferred ontoapositively-charged nylon were separatedinadenaturingagarose gel, Biol Chem.2004Oct22;279(43):44522-32. Biol Chem.2005Jan28;280(4):2831-9. Biol Chem.2005Feb18. + RNA or20µgoftotalpertissuesample as adjustedtoreflectappro fer s human RNAblotspreparedfrom1 . Eac + RNA fromeach h ximately equal blot contains www .or h 2 ig ene.com J early markerofthymocytepositiveselection. 9. AninhibitoryIgsuperfamilyproteinexpressed bylymphocytesandAPCsisalsoan J reticulum-associated acyl-CoA:lysocardiolipin acyltransferase (ALCA 8. Anovelcardiolipin-remodelingpathwayrevealed byageneencodinganendoplasmic J activation. 7. TNAP, anovelrepressorofNF-kappaB-inducingkinase,suppresses NF-kappaB Mol CellBiol.2004Sep;24(17):7548-58. 6. Neonatallethality Immunol. 2004May15;172(10):5931-9. Biol Chem.2004Jul23;279(30):31727-34. Biol Chem.2004Aug20;279(34):35975-83. Double-purified poly A+ RNAand T rusted byscientistsandpro 12-tissue Northern forhuman, , dwarfism, andabnormalbraindevelopmentinDmbx1mutantmice. rigorous QCstandards by numerouscitations More RNAthanother Everyday lowprice commercial blots ADVANTAGES mouse andrat ven T1) inmouse. Product Use

Northern Blots eliminate the laborious need to isolate, separate and transfer

tissue RNA. Quality Northern blots are n o

obtained by following standard i s

hybridization conditions and using a s

labeled nucleic acid probe. e r p

1 Pre-hybridization x e e n e G t o l B n r e h t r o N 2 Hybridization with probe

3 Washing of blot 4 Autoradiography/phosphorimaging

ph: 1.888.267.4436 fax: 1.301.340.9254 101 102 Northern Blot Gene expression BlotIII:6-tissuepoly A • highly enriched polyA OriGene’s pre-madeNorthern arepreparedwith BlotI:12-tissue poly A • tissues areprovided. Three different blotscovering 22clinicallyrelevant stripped, andre-hybridized tooneofthree a As anindicationofthequalityNor that cross-h probe. (Muscleandhear HB2010 andHB2011 was hybridized with beta-actin normalized byactinexpressionlevel.InFig1, purified byoligo-dTaf Fig. The humanblotsarepreparedfrompolyA HumanNorthern Blots A. Product Application actinin 2(panelC). (panel A), carbonicanhydrase (panel B),and in length)(Fig.2). DNAprobes(eachlabeled, PCR-derived, about0.5kb BlotII:12-tissue poly A • human 12-tissue hybridized, blotIwas successively bladder, uterus) gland,testis,thymus,salivary thyroid, urinary duodenum, esophagus,pancreas,PBL,prostate, adrenal gland,ovary, gland,uterus,skin) salivary colon, stomach, testis,placenta) kidney, lung,smallintestine,muscle,spleen,liver, 1

Cat#: Brain ybridiz HB2010 Lung

Heart e Muscle The threeprobesusedwereactin with beta-actinprobe).

Stomach + finity columns. t + RNA. The RNAwas double + + RNA blot(brain,heart, contain shor RNA blot(pancreas, Small Intestine RNA blot(brain,

Liver

Kidney

Spleen ter alphaactin

Testis All blotsare thern blots, www Thymus + RNAs. Skin 32 .or α alpha-actin P- beta-actin - ig ene.com β species. transcript sizes andcross-hybridization ofmRNA andprovide informationabout are quantitative thantheRapid-Scansensitive panels,Northern blots h 3 as thatofthe4.2-kb detected. Moreover, closely-related sequences,such that ofcarbonicanhydrase (panelB),areeasily abundance andtissue-specifictranscripts,such as intact actinmRNA( equallevelsof All 12-tissues RNAscontainrelatively A C B -actin intheothertissues)(panel A). Low ybridization oftheprobe(panelC). Though less Cat#: transctipts, canbedetectedthroughcross- i.2 Fig.

Brain HB2011

Duodenum

Esophagus

Pancreas α α PBL -actin inheart andmuscle, -actinin 2and2.9-kb,

Prostate

Salivary Gland

Testis, Thymus

Thyroid

Urinary Bladder

Uterus α -actinin — — — — 1.8 kb 2.4 kb 2.9 kb 4.2 kb actin, towhic against other genesinadditionto “housekeeping” transcript signalstobeeffectively normalized equal acrosstheblot. intact RNAandthattheactinsignalisgenerally The resultsdemonstratethattheblotcontainsfully A2 (panelD). binding proteinCab45a(panelC),andphospholipase were actin(panel A), GAPDH(panelB),acalcium- genes(Fig.3). “housekeeping” The fourprobesused about 0.5kbinlength),which representfourdifferent three hybridized, stripped,andre-hybridized tooneof a As anindicationofthequalityNorthern blots, 12-major tissuepoly A • 12 majortissues. The mouseblotsarepreparedfrompoly A MouseNorthern Blots B. thus leadingtoare-normalizationofthesignal. signal ratioofactintoeitherthesetranscriptsand phospholipase mRNA canbemeasuredagainst GAPDH, standardiz spleen, stomach, testis,thymus) kidney, liver, lung,muscle,skin,smallintestine, mouse 12-major tissueblotwas successively 32 P-labeled, DNAprobes(each PCR-derived, ed. The relati h A2, orCab45a,bysimplyusingthe the poly Also, itispossibleforspecifi ve abundanceofaspecific + RNA (brainheart, A h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: + RNA ontheblotw + RNA from as c D C B A i.3 Fig. — — — — — 2.3 5.0 2.4 1.2 1.8 kb kb kb kb kb 103 Northern Blot Gene expression 104 Northern Blot Gene expression a When therat12 major-issue blotwas hybridized with 12 brain-part totalRNAblot(frontalcortex, • The ratblotsarepreparedfromeitherpoly A RatNorthern Blots C. intactness ofeach oftheRNAs. equal RNAloadingineach ofthelanesand 12 major-tissue poly A • different brainparts. from variousmajortissuesortotalRNA 3 medulla, spinalcord) thalamus, cerebellum,midbrain,pons, hippocampus, olfactorybulb,striatum, posterior cortex, entorhinalcortex, i thymus, lung,heart, muscle,stomach, small 2 ntestine, liver, kidney, spleen,testis,skin) P-labeled actinprobe(Fig.4),theresultshows Olfactory Bulb Olfactory Frontal Cortex + RNA blot(brain, Striatum Thalamus Hippocampus www + RNA .or Midbrain ig Entorhinal Cortex ene.com P i.4 Fig. osterior Cortex Pons Cerebellum Medulla Spinal Cord — 1.8 kb (Stomach, SmallIntestine,Muscle,Lung, Testis, Skin) ua lcnaC-04295 295 295 295 CH-1014 295 295 CH-1012 295 CH-1008 CH-1006 CH-1005 CH-1003 CH-1002 Human Placenta Human Peripheral BloodLeukocytes Human Ovary Human Muscle Human Lung 395 Human Liver Human Kidney Human Heart 395 Human Brain CR-1101 Human First-Str 395 (Stomach, SmallIntestine,Muscle,Lung, Testis, Skin) R 395 (Brain, Hear Rat cDNASet Multiple-Choice™First-Strand 1 CM-1101 395 Mouse Multiple-Choice™Fir CH-1103 (Brain, Heart, Kidney, Spleen, Thymus, Liver) cDNASetMouse Multiple-Choice™First-Strand 1 CH-1102 Fetal Muscle,Fetal Spleen) (Fetal Brain,Fetal Kidney, Fetal Testis, Fetal Liver, cDNASetHuman Multiple-Choice™First-Strand 3 Cat.No. (Small Intestine,Muscle,Lung,Prostate, Testis, CH-1101 Ovary) cDNASetHuman Multiple-Choice™First-Strand 2 B (Brain, Heart, Kidney, Spleen,Liver, Peripheral cDNASetHuman Multiple-Choice™First-Strand 1 Multiple-Choice™ cDNAsets(10 reactions) Product Listing Multiple-Choice™ cDNAs at lood Leukocytes) Multiple-Choice™ Fir t, Kidney and cDNA(30r , Spleen, tSrn DASt2C-12395 CR-1102 st-Strand cDNASet 2 ph: st-Strand cDNAS Th ymus, Liver) 1 882743 a:1.301.340.9254.888.267.4436 fax: eactions) et 2 CM-1 CH-1 H10 295 CH-1001 0 0 395 102 9295 09 Price 105 Multiple-Choice™ cDNAs Gene expression 106 Multiple-Choice™ cDNAs Gene expression os tmc M10 295 295 295 295 CM-1007 295 CM-1004 295 CM-1012 295 CM-1008 CM-1010 CM-1006 CM-1003 295 Mouse Stomach 295 Mouse Spleen Mouse SmallIntestine 295 Mouse Skin 295 Mouse Muscle CH-1017 295 295 Mouse Lung CH-1020 Mouse Liver 295 CH-1018 Mouse Kidney 295 Mouse Hear CH-1016 Mouse Brain CH-1015 CH-1011 295 295 Mouse First-Str CH-1013 Human Fetal Testis CH-1004 Human Fetal Spleen Human F CH-1010 CH-1007 Human Fetal Liver Human Fetal Kidney Human Fetal Brain Human Testis Human Stomach Cat.No. Human Spleen Human SmallIntestine Human Prostate Product Listing etal Muscle M10 295 CM-1002 t and cDNA(30reactions) www.origene.com CM-1 CM-1 CH-1 0 0 0 295 001 9295 19 9295 09 Price a tmc R10 295 295 295 CR-1007 295 295 CR-1012 295 CR-1008 295 295 CR-1010 CR-1006 R 295 CR-1003 R 295 CR-1002 Rat Stomach CR-1001 R Rat SmallIntestine Rat Skin CM-1005 CM-1011 R Rat Lung Rat Liver Rat Kidney Rat Heart Cat.No. Rat Brain Rat First-Strand cDNA(30reactions) Mouse Thymus Mouse Testis Product Listing tTyu R10 295 CR-1005 at Thymus at at Spleen at Muscle etsC-01295 CR-1011 Testis ph: 1 882743 a:1.301.340.9254.888.267.4436 fax: R10 295 CR-1004 CR-1 0 09 Price 295 107 Multiple-Choice™ cDNAs Gene expression 108 Multiple-Choice™ cDNAs Gene expression 0.5 - 1.0 - 1.6 - kb i.1 Fig. Oligo(dT)-primed reverse transcribed Oligo(dT)-primed reverse Available assetsof six cDNAs Synthesized fromhighquality Brain included Control PCRprimers

Heart ADVANTAGES

Kidney Actin poly A Spleen

Thymus +

Liver RNA

Brain

Heart Cytochrome P450 Liver-Specific Kidney

www.origene.com Spleen

Thymus

Liver Product Description s cDNAanditssubsequent Choice™ First-Strand previously identified.PCRamplificationofMultiple- homologous genesfromdifferent species,andgenes ofamulti-genefamily,used toclonemembers today’s molecularbiologist. This technique canbe Amplification ofcDNAbyPCRisanessentialtoolfor Introduction li the ratMultiple-Choice™cDNASet 1,whereas,the an actinsignalisdetectableineach cDNAsampleof desired sequence.For example,asshowninFig.1, for PCR,itresultsinspecificamplificationofthe When Multiple-Choice™cDNAisusedasatemplate Product Application • Set ofsix-tissue cDNAs • two formats: Multiple-Choice™ First-Strand cDNAisavailable in poly A cDNAissynthesizedChoice™ First-Strand from cDNA preparedfromhuman,mouseorrat.Multiple- Multiple-Choice™ cDNAisaPCR-ready, first-strand transcriptase thatfav organism. mRNA eitherinasingletissueoracrosstissuesan ideal forthecharacterization spliced ofalternatively cDNAisalso interest. Multiple-Choice™First-Strand panel oftissuesfortheexpressionyourgene by eliminatingtheneedtoconstructandscreena from the liver cDNAsample. from theliver 2-10 ng/µL. products. Itispro ubcloning canoften savetimeandreducethecost ver Indi -specifi vidual tissuecDNA + RNA, usinganoligo(dT)primerandareverse c cytoc hrome P450canonlybeamplifi vided ataconcentrationof or s the productionoflong ed ua pen oa,20µ H-04245 245 HT-1004 245 245 HT-1007 Human Stomac HT-1013 Human Spleen,poly Human Spleen,total,250µg 245 HT-1008 Human SmallIntestine,poly Human SmallIntestine,total,250µg Human Placenta,poly A Human Placenta,total,250µg 245 HT-1005 Human Muscle,poly A Human Muscle,total,250µg 245 Human Lung,poly A Human Lung,total,250 245 HT-1002 Human Liver, poly A Human Liver, total,250µg HT-1015 Human Kidney, poly A Human Kidney HT-1001 Human Heart, poly A Human Heart, total,250µg Human Colon,poly A Cat.No. Human Colon,total,250µg Human Brain,poly A Human Brain,total,250µg Human Blue-Ribbon™RNA Product Listing Blue-Ribbon™ Poly A , h, total,250 total, 250 + + + + A , , + , , , 5 + 5 + 5 + 5 , , 5 , + µ gH-05320 µg HM-1005 5 gH-09320 µg HM-1009 5 gH-01320 µg HM-1001 5 gH-02320 µg HM-1002 , gH-05320 HM-1015 µg g µ 5 gH-03320 µg HM-1003 µ gH-08320 µg HM-1008 g g gH-03320 µg HM-1013 µ ph: A g + , 5 1 µ 882743 a:1.301.340.9254.888.267.4436 fax: g + and total RNA M10 320 HM-1 HM-1007 T10 245 HT-1003 HT HT -1 11 245 -1014 0 245 009 0 04 Price 320 109 Blue-Ribbon™ Poly A+ and total RNA Gene expression 110 Blue-Ribbon™ Poly A+ and total RNA Gene expression os tmc,ttl 5 g T10 145 MT-1007 145 145 145 MT-1008 Mouse Stomach, total,250 µg 145 MT-1012 Mouse Spleen,poly Mouse Spleen,total,250 MT-1009 Mouse SmallIntestine,poly A Mouse SmallIntestine,total,250µg MT-1010 Mouse Skin,poly A Mouse Skin,total,250µg 145 Mouse Muscle,poly A Mouse Muscle,total,250µg 145 Mouse Lung,poly A Mouse Lung,total,250µg MT-1002 Mouse Liver, poly A 245 Mouse Li MT-1001 Mouse Kidney, poly A Mouse Kidney Mouse Heart, poly A HT-1011 Mouse Heart, total,250µg Mouse Brain,poly A Mouse Brain,total,250µg Mouse Blue-Ribbon™RNA Cat.No. A poly Human Testis, Human Testis, total,250µg Human Stomach, poly A Product Listing ver , total, 250 , total, 250 + + , + + + A , , + , , 5 , 5 + 5 + 5 + 5 , , 5 , gM-02165 µg MM-1012 gM-06145 MT-1006 µg gM-06165 MM-1006 µg 5 gM-00165 MM-1010 µg 5 gM-01165 µg MM-1001 5 gM-02165 µg MM-1002 + gH-01320 µg HM-1011 , µ µ gM-03165 µg MM-1003 µ gM-09165 µg MM-1009 5 T10 145 MT-1003 g g g gH-04320 µg HM-1014 + , 5 gM-08165 µg MM-1008 www.origene.com M10 165 MM-1004 MT -1 0 145 004 Price a pen oa,20µ R-04145 145 145 RT-1004 145 RT-1008 145 RT-1012 145 Rat Spleen,total,250µg RT-1009 Rat SmallIntestine,poly A RT-1010 Rat SmallIntestine,total,250µg Rat Skin,poly A 145 RT-1006 Rat Skin,total,250µg R 145 Rat Muscle,total,250µg Rat Lung,poly A RT-1002 Rat Lung,total,250µg R 145 RT-1001 Rat Liver,µg total,250 Rat Kidney, poly A 145 R Rat Heart, poly A MT-1005 Rat Heart,µg total,250 Rat Brain,poly A MT-1011 Rat Brain,total,250µg Rat Blue-Ribbon™RNA A poly Mouse Thymus, Cat.No. Mouse Thymus, total,250µg M Mouse Testis, total,250µg Mouse Stomach, poly A Product Listing at Muscle,poly at Liver, poly A at Kidney ueTsi, oy A poly ouse Testis, , total, 250 + + , + + + , A , , , 5 5 + 5 5 + 5 , , gR-02165 µg RM-1012 gR-06165 RM-1006 µg 5 gR-00165 RM-1010 µg + gR-01165 µg RM-1001 5 gR-02165 µg RM-1002 , µ gR-03165 µg RM-1003 5 µ + g , g + gM-01165 µg MM-1011 , 5 5 gM-05165 µg MM-1005 + , gM-07165 µg MM-1007 ph: 5 gR-08165 µg RM-1008 1 882743 a:1.301.340.9254.888.267.4436 fax: M10 165 RM-1009 R -03145 T-1003 Price 111 Blue-Ribbon™ Poly A+ and total RNA Gene expression 112 Blue-Ribbon™ Poly A+ and total RNA Gene expression high-quality poly A total RNAusingoligo(dT). The isolationmethodyields • AllRNAischecked byagarose gelelectrophoresis • Quality Contr 145 Both totalRNAorpoly A Product Description 145 145 RT-1005 synthesis Blue-Ribbon™ including Northern blotanalysis,RT-PCR, andcDNA useful inavarietyofmolecularbiologytechniques RNA preparationsfromanimaltissuescanbevery RT-1011 Introduction RT-1007 A poly Rat Thymus, Rat Thymus, total,250µg A poly Rat Testis, Cat.No. Rat Testis,µg total,250 R Rat Stomach, total,250µg Rat Spleen,poly A Product Listing and poly A high molecularweightmRNAisintact.BothtotalRNA denaturing agarose gelelectrophoresistoensurethat electrophoresis. P bands asdeterminedbydenaturingagarose gel RNA containsintact28Sand18S ribosomalRNA tissues toensurethehighestqualityproducts. Total RNA isisolateddirectlyfromfreshorquick-frozen from 1 rat tissues. available aspreparedfromeitherhuman,mouse,or at Stomach, poly A with actin Each lotofRNAisNorthern blotted andprobed 2 major tissuesofhuman,mouse,orrat. + RNA aresuppliedinDEPC-treated water. ol + , oly + 5 , + + , 5 + gR-01165 µg RM-1011 RNA. The RNAisexaminedby , 5 A gR-04165 µg RM-1004 5 gR-05165 µg RM-1005 + gR-07165 µg RM-1007 + RNA isisolatedfromintact T RNA samplesareavailable otal andP oly A www.origene.com + RNA are Total • Total RNA(250µg) • Blue-Ribbon™ RNAisa Poly A High qualitytotalRNAorpoly A + RNA (5 Choice of12 major tissues Human, mouse,orrat ADVANTAGES µg) v ailable intw o f Price ormats: + RNA Miscellaneous molecular tools Pre-validated antibodies

Protein collections

Quanti-Ladder™: Broad range DNA size marker (200bp-10kb) with quantity reference

Millennium™ marker: Broad range RNA size marker (0.5kb-9kb)

Rapid-Load™: Innovative PCR compatible loading buffer 114 Pre-validated antibodies Misc. molecular tools GeneFamily • • Protein Domain • AccessionorCatalogNumber • • All antibodiescanbesearched by: customer’s evaluation. body, theQCdataispostedonwebsitefor nohistoc immunoprecipitation, immunocytoc of applications,includingELISA, westernblotting, c ically bybothprotein Production purification(typ- beginswithextensive monitoring. expression andactivity convenient andreliable sets oftoolsforgene validated forspecificityandsensitivity, provide the (GPCR). coupled receptors These antibodies,pre- coverage isfocusedonproteinkinasesandG quality standards.Currently OriGene’s antibody thatadheretothehighest obtained fromsuppliers The OriGene Antibody Collectionshavebeen Introduction Pre-validated Antibodies hromatography) followedbytestingonawiderange K Nucleotide Sequence, Protein Sequence eywords hemistry andfl ow A cytometry and peptideaf hemistry . F or each anti- www.origene.com , immu finity - interactions. andothertypesofprotein-protein enzyme activity diagnose diseasestatesortissuetypes. approachessemi-quantitative thatare usedto types aswellproteinexpressionlevels. antibody binding. Antibodies candifferentiate cell sections ortissuesamplescanbeaddressedby can thenbeusedtoprobethesemembranes. specifi host ofsolid-surfacemembranes. separated throughSDS-PAGE andtransferred toa substrate interactions.One canneutraliz steric interferencewithinbinding sitesorpointsof the functionofproteinsorotherantigensthrough Western Blots: specifications. product applications. Pleaseconsulttheindividual listed below. Notallantibodies arequalifiedforall thevarietyofapplications recognition alsodrives Additionally, ofdetectionforantibody thesensitivity well exploitedinlaboratoryexperimentation. The specificityoftheantibody-antigen interactionis Product Application Functional studies: Flow cytometry: istry (IC): Immunohistochemistry (IHC)orImmunocytochem- (RAI): Immunopr given sample(RAI). given identification /quantificationofantigenswithina permits boththepurificationofantigens(IP)and types inperipheralbloodsamples. particularly usefulinthediagnosis ofdifferent cell recognition ofantibodiestotheseantigens. This is surface proteinscanbecountedviathespecific The bindingofantibodiestoantigensinsolution c recognition ofproteinsinlimitingamounts The molecularcharacterization ofpathology ecipitation (IP)orRadioimmunoassa Proteins fromcellularextracts canbe Cells presentingspecificcell- Antibodies canbeusedtoblock Antibodies forthe These are e both y Sp. CrossR A009IS1Atbd 0 L(0W)WI H abtHMRPlcoa 150 Polyclonal 150 Monoclonal 350 150 HMR 150 350 Monoclonal polyclonal Rabbit Polyclonal 150 polyclonal WIPIHC Polyclonal ALL 100 µL(10 WB) Mouse 150 ALL 150 WIPIC Mouse ALL Polyclonal HRMiMk Polyclonal Rabbit Rabbit Rabbit 0.2 milligrams WIPIC Rabbit WIPIC HMR(C)(Hm) 100 µL (10 WB) IHC Rabbit W 150 100µL (10 MR(H) WB) P IHC IRS-1 Antibody Rabbit Monoclonal 100 µL(10 WB) Beta-Gal (14B7) MousemAb TA201039 WIC 150 1mg/ml 150 TA201038 Monoclonal 150 1mg/ml 100 µL(10 WB) His-Tag (27E8)MousemAb Polyclonal W T Polyclonal His-Tag Polyclonal Antibody TA201036 100µL (10 WB) Prokineticin Receptor 2(GPR73B) TA201035 ALL 300 Peptide Glucagon-Like 1Receptor Rabbit TA200263 polyclonal TA200113 HMR HMRMk H WIPIC Chk1 Antibody T Rabbit Rabbit Mouse TA201034 0.2milligrams WIPIHC eEF2 Antibody 150 150 T IP W WIC Synapsin Antibody 100µL (10 TA201032 WB) Polyclonal Polyclonal 100µL (10 WB) 100 µL(10 TA201031 WB) 150 T Rabbit 150 175 Myc-Tag (9B11) MousemAb T Polyclonal Monoclonal Polyclonal 150 Skb1HsMethyltransferase Antibody TA201028 150 HMR IHC HER2/ErbB2(44E7)MousemAb TA201027 Polyclonal Rabbit H Polyclonal HER2/ErbB2 Antibody TA201026 Rabbit 300 HMRMk HMRMk HMRMk TA201025 mg/ml 1 Rabbit Rabbit polyclonal Thyrotropin-Releasing HormoneReceptor (TRH-R) Rabbit T W 150 WIPIHCIC 350 WEIHCICF HMRMk TA200111 W Rabbit WIHC Polyclonal 100µL (10 WB) HMR 150 polyclonal 100 µL(10 100 µL(10 WB) WB) T Rabbit (10µL 100 WB) 100µL (10 WB) 150T Polyclonal WIPIC 150 T 150 WIPIC Polyclonal 100µL (10 S6RibosomalProteinWB) (5G10) Polyclonal Rabbit mAb T HMRMk 150 Polyclonal 100µL (10 S6RibosomalProtein Antibody WB) Rabbit TA201022 Rabbit Polyclonal TA201021 HMR WIHCIC 150 Presenilin 2 Antibody HMRMk T Rabbit Rabbit IHC Rabbit DAP5 Antibody 100 µL(10 WB) TA201019 Polyclonal 475 150 HMR DAP3 Antibody TA201018 H 195 Monoclonal Price* Rabbit 150 IHC HistoneDeacetylase6(HDAC6) Antibody Rabbit HMR TA201017 Polyclonal W Monoclonal 1mg/ml W Rabbit WSTF Antibody TA201016 Polyclonal Type 100 µL(10 WB) HMRMk Parkin Antibody 100µL (10TA201015 WB) WIHCIC SpCross W Reactivity Rabbit 1mg/ml W TA201014 WIPIHCIC Host 100 µL(10 WB) GProtein-Coupled Receptor 100 µL(10 TM7XN1/GPR56 WB) T 100 µL(10 WB) Application H NeurotensinReceptor 100 µL(10 TypeWB) 1 TA200061 M Mouse H HistoneDeacetylase4(HDAC4) Antibody Rabbit TA200491 H Mouse HistoneDeacetylase1(HDAC1) Antibody TA201011 Rabbit Format PKD/PKCmu Antibody TA201010 W WIP XIAP Antibody TA201009 W WIP µL(30 300 WB) 100 µL(10 Lamin WB) A/C Antibody TA201008 100 µL(10 WB) IL-1beta 100µL (10 Antibody WB) TA201007 BID(7A3)MousemAb(HumanSpecific TA201006 BID(7A3)MousemAb(HumanSpecific TA201005 BID Antibody (MouseSpecific) TA201004 BID Antibody (HumanSpecific) Description TA201003 TA201002 # Cat. 201 lcgnLk etd eetr1m/lICRbi oylnl350 polyclonal 150 Polyclonal Rabbit HMR Rabbit IHC WIPIHC 100 µL(10 WB) 1mg/ml 150 Monoclonal 350 Peptide Glucagon-Like 1Receptor polyclonal A200112 DynaminI/II Antibody H A201033 Mouse WIHC A20 Rabbit A20 100 µL(10 WB) IHC 300 EGF Receptor (1F4)MousemAb polyclonal 1mg/ml A201024 A20 GProtein-Coupled Receptor GPR58 A20 A200270 A20 Rabbit IHC,ICC A20 1mg/ml Melanocortin 4Receptor (MC4R) A200085 A20 roduct of 09DP nioy10µ 1 B PRbi oylnl150 Polyclonal HMR Rabbit WIP 100 µL(10 WB) DAP1 Antibody 1 1029 1 1 1 16GPoenCuldRcpo P3 gm H abtplcoa 250 polyclonal Rabbit IHC 1mg/ml GProtein-Coupled Receptor GPR31 0106 0 030 023 020 037 1 05 fering issubjecttoc eacti G D E Caspase-1 HA-T vity K GF R ARPP rti-ope eetrGR11m/lICRbi oylnl350 polyclonal Rabbit IHC 1mg/ml Protein-Coupled Receptor GPR31 g(E)Muemb10µ 1 B PICI os L oolnl150 Monoclonal ALL Mouse WIP IHC ICF 100 µL(10 WB) ag (6E2)MousemAb cpo nioy10µ 1 B PICI abtHMRPlcoa 150 Polyclonal HMR Rabbit WIPIHC ICF 100 µL(10 WB) eceptor Antibody ey: H=HumanM=Mouse Mi=MinkMk=Monk -32 2 nioy10µ 1 B H abtHMRPlcoa 150 Polyclonal HMR Rabbit WIHC 100 µL(10 WB) Antibody A ntibody hange. R estricted availability to international customers. Referestricted availability to internationalcustomers. website forthemostupdatedinformation. h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: ey R=Rat C=Chicken Hm=HamsterX=Xenopus Z=ZebraFish 1 0µ 1 B CRbi oylnl150 Polyclonal M Rabbit WIC µL(1000 WB) 115 Pre-validated antibodies Misc. molecular tools 116 Pre-validated antibodies Misc. molecular tools Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A007BxAtbd 0 L(0W)WI abtHMRM oylnl150 150 150 Polyclonal Polyclonal 150 Polyclonal Polyclonal 150 HMRMk Polyclonal Rabbit 150 HMR Rabbit Polyclonal H HM WIP Rabbit Rabbit 150 100 µL(10 WB) W 150 HM WIPIHCF 150 Polyclonal HMRMk Rabbit W 100 µL(10 Polyclonal WB) Polyclonal 100 µL(10 WB) Rabbit 100µL (10 WB) WIC WIP 150 100 µL(10 WB) 150 HMkMR HMR 150 P Tyrosine Hydroxylase Antibody 100 µL(10 WB) Rabbit Rabbit 150 Polyclonal HMR Polyclonal FADD Monoclonal Antibody (HumanSpecific) TA201079 Rabbit 150 Polyclonal Bax Antibody TA201078 WIHC WIP TA201077 Polyclonal 150 100µL (10 Lck WB) Antibody T 100 µL(10 W WB) HMRMk 250 150 Polyclonal TA201075 Rabbit 350 All 100 µL(10 WB) polyclonal Polyclonal All HistoneH2B Antibody HMR T Rabbit Mouse polyclonal Syk Antibody Rabbit TA201073 HM(R) WIP HMRMk Rabbit WIPIC TA201072 100µL (10 Rabbit WIC WB) T WIP HMRMk 100 µL(10 WB) 150 IKKgamma Antibody T Rabbit WIP 0.2milligrams 100 µL(10 WB) IKKbeta Antibody TA201069 Polyclonal WIP 100 µL(10 WB) TA201068 Rabbit 100 µL(10 WB) Chk2 Antibody 150 W Rabbit 150T 150 Alpha-Synuclein Antibody TA201066 Polyclonal 100 µL(10 Polyclonal WB) Polyclonal IHC 150 TA201065 HMR IHC GST (26H1)MousemAb T Rabbit Polyclonal 150 GST Antibody TA201063 1mg/ml Polyclonal PRK2 Antibody HMRMk HMRMk TA201062 1mg/ml HMR Rabbit PAK3 Rabbit Antibody W TA201061 Rabbit 350 150 200 PAK2 Antibody TA201060 150 100 µL(10 HMR WB) 350 WIPIC PAK1/2/3 Antibody WIPIHC polyclonal Polyclonal TA201059 polyclonal Rabbit Monoclonal W GProtein-Coupled Receptor C5L2 polyclonal TA201058 100 µL(10 WB) 100 µL(10 WB) HR 100µL (10 TA200356 WB) Rabbit WIP GlucagonReceptor 150 T 150 WIPIHC HM(R) TA200351 100 µL(10 WB) Polyclonal 150 Polyclonal Rabbit T 100 µL(10 WB) H Polyclonal PP1alpha Antibody T Rabbit Mouse Rabbit WIHC HistoneH2A Antibody TA201055 Rabbit HMRMk p27Kip1 Antibody TA201054 100 µL(10 WB) 150 150 Rabbit Paxillin Antibody IHC TA201053 IHC HMRMk H(R) W Monoclonal Monoclonal AMPK-alpha Antibody IHC Rabbit Rabbit WIHCIC TA201052 100 µL(10 WB) TA201051 100µL (10 WB) 1mg/ml EstrogenReceptor alpha(62A3)MousemAb 1mg/ml WIHC T 1mg/ml Vav W Antibody TA201049 100 µL(10 WB) PPARgamma Antibody TA201048 HMk ALL 100µL (10 WB) GProtein-Coupled Receptor JEG18 Mouse Mouse TA201047 GProtein-Coupled Receptor JEG18 TA200336 WIHCIC WIPIC Vasopressin V1B Receptor TA200333 100 µL(10 WB) PLCbeta3 Antibody TA200301 0.2milligrams TA201046 beta-Amyloid Antibody T APP Antibody TA201044 TA201043 HSP27(G31)MousemAb T MBP(8G1)MousemAb TA201041 TA201040 C 217 a-0(92 abtmb10µ 1 B PICFRbi oolnl150 Monoclonal 150 Polyclonal HM Rabbit HMR WIPIHCF Rabbit 100 µL (10 WB) WIPIC 100 µL(10 WB) A20 350 polyclonal Zap-70(99F2)Rabbit mAb A201071 A20 IKKalpha Antibody A201067 Rabbit A20 IHC 150 1mg/ml Monoclonal GProtein-Coupled Receptor C5L2 HMRMk Mouse A200355 150 150 WIPIHCIC Polyclonal A20 Polyclonal 100 µL(10 WB) A20 H(M)(R) HMR Rabbit Rabbit p53(1C12) MousemAb A201050 W W 100 µL(10 WB) 100 µL(10 WB) VEGF Receptor 2 Antibody A201045 Shc Antibody A201042 A20 roduct of t ecito omtApiainHs pCosRatvt yePrice* Type SpCross Reactivity Host Application Format Description # at. 1 1 1 1 1 1 07 070 064 057 056 07 4 c-LAtbd 0 L(0W)WI H abtHMRM oylnl150 Polyclonal HMRMk Rabbit WIPIHC 100µL (10 WB) Bcl-xL Antibody 6 fering issubjecttoc y nioy10µ 1 B PICRbi oylnl150 Polyclonal HMR Rabbit WIPIHC 100 µL(10 WB) 150 Lyn Antibody Polyclonal IKK epsilon HMRMk Rabbit WIHCIC 100 µL(10 WB) Histone Deacetylase3(HDAC3) Antibody P Histone H4 K nioy10µ 1 B PICRbi kPlcoa 150 Polyclonal HMRMk Rabbit WIPIHC 100 µL(10 WB) AK1 Antibody Antibody Antibody hange. R estricted availability to internationalcustomer www.origene.com 0 L(0W)WI abtHPlcoa 150 Polyclonal H Rabbit WIP 100 µL(10 WB) 150 Polyclonal HMRMk Rabbit WIPIHCIC 100 µL(10 WB) s. Refer towebsiteforthemostupdatedinformation. Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A013GPoenCuldRcpo P3 gm H abtplcoa 350 200 polyclonal 350 polyclonal 300 polyclonal 250 polyclonal polyclonal Rabbit 350 Rabbit 350 300 polyclonal Rabbit IHC,ICC polyclonal polyclonal Rabbit IHC Rabbit IHC 300 IHC 1mg/ml 1mg/ml 300 polyclonal IHC polyclonal 350 1mg/ml P G Protein-Coupled Receptor SLT/MCH2 Rabbit 1mg/ml 350 polyclonal GProtein-Coupled Receptor GPR34 TA200202 Rabbit Rabbit 1mg/ml 350 Gastric InhibitoryPolypeptide Receptor polyclonal TA200123 250 IHC polyclonal TA200122 IHC IHC Gastric InhibitoryPolypeptide Receptor polyclonal T Rabbit 300 TA200120 Rabbit 1mg/ml 300 Alpha1c-Adrenoceptor polyclonal T 300 1mg/ml 1mg/ml Platelet ReceptorActivating Homolog(H963) IHC polyclonal TA200118 Rabbit 300 polyclonal IHC TA200117 Rabbit polyclonal T Rabbit IHC 1mg/ml GProtein-Coupled Receptor GPR3 T Rabbit 200 1mg/ml Prostaglandin EReceptor EP2 IHC TA200114 300 polyclonal IHC TA200020 300 Rabbit 300 1mg/ml polyclonal MetabotropicGlutamateReceptor 8 IHC T 300 Rabbit polyclonal 1mg/ml polyclonal Rabbit MetabotropicGlutamateReceptor 8 IHC,ICC TA200017 polyclonal 300 1mg/ml IHC,ICC TA200016 Rabbit IHC,ICC 1mg/ml GProtein-Coupled Receptor GPR8 polyclonal IHC,ICC, T W 1mg/ml GProtein-Coupled Receptor GPR61 TA200200 1mg/ml GProtein-Coupled Receptor GPR32 TA200190 Rabbit 1mg/ml 1mg/ml GProtein-Coupled Receptor GPR82 Rabbit TA200189 IHC,ICC MetabotropicGlutamateReceptor 3 Rabbit TA200258 Rabbit 150 MetabotropicGlutamateReceptor 3 Rabbit TA200014 Monoclonal 150 IHC IHC,ICC MetabotropicGlutamateReceptor 2 150 TA200013 150 Rabbit IHC,ICC Monoclonal 1mg/ml IHC TA200012 Monoclonal Monoclonal 150 DopamineReceptor D1 IHC,ICC T 1mg/ml 1mg/ml Monoclonal 150 TA200010 150 1mg/ml 1mg/ml HMR Polyclonal T Mouse Polyclonal 1mg/ml Muscarinic Acetylcholine Receptor M3 T 150 HMR HR 150 Adenosine A2a Receptor HM TA200007 Mouse Mouse WIHC Polyclonal Mouse C-CChemokineReceptor 2(CCR2) Polyclonal TA200006 WIPIHCIC WIPIHCF 150 H Interleukin8Receptor A 100 µL(10 WB) TA200005 HMR Monoclonal 100 µL (10 Mouse WB) 100 µL(10 WB) WIHC HMR BradykininB2Receptor TA200004 Rabbit Rabbit HMRHmMk TA200003 100 µL(10 WIPIHCFIC WB) Rabbit Beta-2 HMR Adrenoceptor WIP T WIP 100 µL(10 Rabbit WB) CyclinD3(DCS22)MousemAb TA200001 100 µL(10 WB) 100 µL(10 CyclinD1(DCS6)MousemAb WB) HMk TA201091 W WIPIC Rabbit cdk7(MO1)MousemAb TA201090 100 µL(10 WB) cdk4(DCS156) MousemAb 100µL (10 WB) TA201089 p18 INK4C(DCS118) MousemAb TA201088 W HistoneDeacetylase7(HDAC7) Antibody TA201087 100 µL(10TA201086 WB) c-Abl Antibody T cPLA2 Antibody TA201084 TA201083 MLK3 Antibody T (6E4)MousemAb Survivin TA201081 TA201080 C 201 -T eetr1m/lICRbi oylnl250 polyclonal 350 polyclonal Rabbit Rabbit IHC IHC 1mg/ml A20 1mg/ml 300 Platelet ReceptorActivating Homolog(H963) polyclonal A200116 A20 5-HT4Receptor A200018 300 Rabbit polyclonal A20 IHC 1mg/ml Rabbit 150 MetabotropicGlutamateReceptor 1 IHC,ICC Polyclonal A200011 A20 1mg/ml A20 150 Polyclonal H Rabbit WIPIHC EndothelinBReceptor HM(R) 100 µL(10 WB) A200002 Rabbit WIP 100 µL(10 WB) Bcl-2 Antibody A201085 PLCgamma1 Antibody A201082 A20 roduct of t ecito omtApiainHs pCosRatvt yePrice* Type SpCross Reactivity Host Application Format Description # at. 0 0 0 0 0 0 1 1 1 0 0 0 1 1 1GsrcIhbtr oyetd eetr1m/lICRbi oylnl250 polyclonal Rabbit IHC 1mg/ml GastricInhibitoryPolypeptide Receptor 21 5Mtbtoi ltmt eetr31m/lIC C abtplcoa 300 polyclonal Rabbit IHC,ICC 1mg/ml MetabotropicGlutamateReceptor 3 15 09 08 rti-ope eetrGR51m/lICRbi oylnl350 polyclonal Rabbit IHC 1mg/ml GProtein-Coupled Receptor GPR35 9 5 fering issubjecttoc eiocAi-nue RI/AG)1m/lIC C abtplcoa 250 polyclonal Rabbit IHC,ICC 1mg/ml Retinoic Acid-Induced 3(RAI3/RAIG1) oaieRcpo 11m/lIC C abtplcoa 300 polyclonal Rabbit IHC,ICC 1mg/ml Dopamine Receptor D1 Muscarinic ctlhln eetrM gm H abtplcoa 300 polyclonal Rabbit IHC 1mg/ml Acetylcholine Receptor M3 hange. R estricted availability to internationalcustomer h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: s. Refer towebsiteforthemostupdatedinformation. 117 Pre-validated antibodies Misc. molecular tools 118 Pre-validated antibodies Misc. molecular tools Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A036Fize- FD)1m/lICRbi oylnl350 350 polyclonal polyclonal 300 polyclonal 300 Rabbit polyclonal Rabbit 300 IHC Rabbit polyclonal 200 300 IHC polyclonal polyclonal IHC 300 1mg/ml 1mg/ml Rabbit polyclonal 300 1mg/ml P Rabbit polyclonal IHC T T 300 Rabbit Rabbit C-C ChemokineReceptor 3(CCR3) T IHC 1mg/ml polyclonal Frizzled-9 (FZD9) IHC,ICC TA200153 Rabbit 300 Frizzled-9 (FZD9) 300 TA200376 IHC 250 1mg/ml polyclonal 300 TA200375 polyclonal 1mg/ml C-CChemokineReceptor 3(CCR3) Rabbit polyclonal T IHC polyclonal TA200152 1mg/ml 350 CXCChemokineReceptor 5(CXCR5) T IHC polyclonal GProtein-Coupled Receptor GPR75 Rabbit 1mg/ml TA200150 TA200175 T Rabbit 1mg/ml IHC Rabbit CXCChemokineReceptor 3(CXCR3) 200 T Rabbit Rabbit Tachykinin Receptor 1 TA200149 polyclonal Muscarinic Acetylcholine Receptor M5 IHC TA200148 IHC 1mg/ml IHC 250 Rabbit TA200147 IHC 300 T 300 polyclonal 200 1mg/ml Muscarinic polyclonal Acetylcholine Receptor M2 T 1mg/ml 300 IHC polyclonal 1mg/ml polyclonal 350 TA200144 1mg/ml 300 Cysteinyl polyclonal Leukotriene Receptor 1(CysLT1) T polyclonal Rabbit Cysteinyl polyclonal Leukotriene Receptor 1(CysLT1) TA200142 1mg/ml 250 TA200141 Purinergic Receptor P2Y8 250 T IHC polyclonal Rabbit Purinergic Receptor P2Y8 TA200209 Rabbit polyclonal 350 Peptide Glucagon-Like 2Receptor 300 Rabbit TA200208 Rabbit polyclonal TA200140 1mg/ml Rabbit ICC polyclonal Rabbit 350 IHC T Rabbit 300 IHC IHC T polyclonal IHC,ICC polyclonal IHC T 1mg/ml 300 1mg/ml Rabbit IHC Proteinase-ActivatedReceptor 4 T 1mg/ml polyclonal 1mg/ml Rabbit Vasoactive IntestinalPolypeptide Receptor 1 TA200135 1mg/ml 1mg/ml Vasoactive IntestinalPolypeptide Receptor 1 TA200132 Rabbit IHC 1mg/ml Rabbit Vasoactive IntestinalPolypeptide Receptor 2 TA200131 IHC Vasoactive IntestinalPolypeptide Receptor 2 IHC,ICC TA200134 Rabbit Tachykinin Receptor 2 TA200133 Rabbit 1mg/ml IHC PAEL Receptor (GPR37) TA200130 1mg/ml IHC,ICC 1mg/ml Tachykinin Rabbit Receptor 2 IHC TA200129 Thromboxane A2 Receptor (TBXA2R) 1mg/ml TA200128 Thromboxane A2 Receptor (TBXA2R) TA200127 IHC 1mg/ml 1mg/ml GProtein-Coupled Receptor GPR45 TA200126 NeurotensinReceptor Type 2(NTR2) TA200125 GProtein-Coupled Receptor SLT/MCH2 TA200124 1mg/ml TA200207 Lysophosphatidic Acid Receptor GProtein-Coupled Receptor SLT/MCH2 TA200205 TA200203 C A20 A20 350 polyclonal A20 A20 Rabbit A20 A20 IHC A20 1mg/ml A20 Peptide Glucagon-Like 2Receptor A200139 A20 A20 A20 205 rti-ope eetrRC gm H abtplcoa 350 polyclonal 350 polyclonal Rabbit Rabbit IHC IHC 1mg/ml 1mg/ml GProtein-Coupled Receptor RDC1 A200156 GProtein-Coupled Receptor GPR39 A20 A200154 roduct of t ecito omtApiainHs pCosRatvt yePrice* Type SpCross Reactivity Host Application Format Description # at. 0 34Bmei eetrSbye3(R3 gm H abtplcoa 300 polyclonal 200 polyclonal Rabbit IHC 1mg/ml Rabbit BombesinReceptor Subtype3(BRS3) IHC 0374 0 1mg/ml 200 GProtein-Coupled Receptor GPR87/GPR95 300 polyclonal 300 0174 polyclonal 0 polyclonal 0 Rabbit 0 Rabbit Rabbit 0 IHC IHC IHC 1mg/ml 021 1mg/ml 1mg/ml Proteinase-ActivatedReceptor 4 Proteinase-ActivatedReceptor 4 0138 Proteinase-ActivatedReceptor 4 0137 0136 5 X hmkn eetr5(XR)1m/lICRbi oylnl300 polyclonal 300 polyclonal Rabbit 300 polyclonal IHC Rabbit 1mg/ml IHC CXCChemokineReceptor 5(CXCR5) Rabbit 151 1mg/ml IHC GProtein-Coupled Receptor GPR87/GPR95 173 1mg/ml Muscarinic Acetylcholine Receptor M5 146 1 1 1 5Msaii ctlhln eetrM gm H abtplcoa 300 polyclonal Rabbit IHC 1mg/ml Muscarinic Acetylcholine Receptor M2 45 43 55 0 fering issubjecttoc Muscarinic G G P2Y9/LPA4/GPR23 P P rotein-Coupled R rotein-Coupled R ctlhln eetrM gm H abtplcoa 200 polyclonal Rabbit IHC 1mg/ml Acetylcholine Receptor M2 hange. R eceptor GPR1 cpo P3 gm H abtplcoa 350 polyclonal Rabbit IHC 1mg/ml eceptor GPR39 estricted availability to internationalcustomer 31m/lICRbi oylnl350 polyclonal Rabbit IHC 1mg/ml 03 www.origene.com s. Refer towebsiteforthemostupdatedinformation. A026CCCeoieRcpo CR)1m/lICRbi oylnl200 350 polyclonal polyclonal 200 250 polyclonal polyclonal 350 350 350 polyclonal polyclonal 350 polyclonal Rabbit 350 polyclonal Rabbit polyclonal IHC Rabbit Rabbit IHC 350 Rabbit Rabbit 1mg/ml IHC IHC 350 polyclonal Rabbit 1mg/ml 350 polyclonal Rabbit R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish IHC IHC polyclonal Rabbit Product offering issubjecttochange. Restricted Refer availabilitytointernationalcustomers. towebsiteforthemostupdatedinformation. 1mg/ml mg/ml 1 IHC C-CChemokineReceptor 2(CCR2) IHC G Protein-Coupled Receptor RDC1 TA200206 mg/ml 1 IHC 1mg/ml Muscarinic Acetylcholine Receptor M2 TA200204 250 250 1mg/ml GProtein-Coupled Receptor SALPR/GPCR135 TA200201 Rabbit polyclonal 1mg/ml polyclonal TA200199 300 Rabbit 1mg/ml GProtein-Coupled Receptor GPR63(PSP24 Beta) T 300 Rabbit polyclonal IHC G Protein-Coupled Receptor GPR7 TA200197 polyclonal GProtein-Coupled Receptor GPR7 IHC TA200196 350 Rabbit Protein A 250 IHC TA200195 IHC,ICC polyclonal 1mg/ml TA200194 polyclonal 1mg/ml Rabbit Protein A 1mg/ml T 350 1mg/ml TA200192 350 350 polyclonal Rabbit GProtein-Coupled Receptor GPR6 T IHC polyclonal polyclonal 350 Rabbit (EMR2) GProtein-Coupled Receptor GPR82 200 TA200188 GProtein-Coupled Receptor GPR82 polyclonal TA200257 IHC polyclonal Rabbit TA200256 1mg/ml IHC Rabbit T 250 1mg/ml EGF-Like Module-Containing IHC 250 350 Rabbit 1mg/ml IHC GProtein-Coupled Receptor GPR48 polyclonal TA200187 Rabbit polyclonal Rabbit polyclonal T-Cell Death-AssociatedGene8(GPR65) TA200186 300 1mg/ml 300 T-Cell Death-AssociatedGene8(GPR65) IHC Rabbit TA200185 Rabbit 200 1mg/ml polyclonal GProtein-Coupled Receptor GPR86/GPR94/P2Y13 IHC IHC TA200184 polyclonal 350 IHC,ICC polyclonal IHC,ICC TA200183 200 polyclonal 1mg/ml GProtein-Coupled Receptor GPR72 T 300 polyclonal 1mg/ml 1mg/ml TA200181 Rabbit 1mg/ml polyclonal 1mg/ml Rabbit Rabbit T GProtein-Coupled Receptor GPR40 T IHC,ICC GProtein-Coupled Receptor GPR40 IHC TA200178 Rabbit IHC Rabbit GProtein-Coupled Receptor GPR75 TA200177 Rabbit P2Y12 Platelet ADP Receptor Rabbit TA200176 200 1mg/ml IHC 1mg/ml Rabbit MasProto-Oncogene TA200170 IHC 300 1mg/ml polyclonal IHC Rabbit TA200167 polyclonal IHC GProtein-Coupled Receptor LOC51210 T IHC 1mg/ml GProtein-Coupled Receptor GPR43 1mg/ml TA200165 IHC 1mg/ml Chemokine(Cmotif)XCReceptor 1(CCXCR1) TA200172 1mg/ml GProtein-Coupled Receptor SLC/MCH1 TA200171 1mg/ml GProtein-Coupled Receptor SLC/MCH1 TA200169 1mg/ml Rabbit GProtein-Coupled Receptor LOC51210 TA200168 Rabbit Latrophilin-3 TA200164 TA200163 IHC Thyrotropin (TSH)Receptor T IHC Thyrotropin (TSH)Receptor TA200161 TA200160 1mg/ml Chemokine(C-Cmotif)Receptor-Like 1(CCRL1) T 1mg/ml Chemokine(C-Cmotif)Receptor-Like 1(CCRL1) TA200158 TA200157 C 209 rti gm H abtplcoa 350 polyclonal 350 Rabbit polyclonal IHC mg/ml 1 Rabbit IHC A20 300 polyclonal 1mg/ml Protein A A200193 GProtein-Coupled Receptor GPR6 A200191 350 polyclonal Rabbit IHC A20 1mg/ml Rabbit GProtein-Coupled Receptor GPR15 IHC A200182 350 300 1mg/ml A20 polyclonal polyclonal A20 MasProto-Oncogene Rabbit Rabbit A200166 IHC,ICC IHC 1mg/ml 1mg/ml GProtein-Coupled Receptor GPR105 A200162 Thyrotropin (TSH)Receptor A200159 t ecito omtApiainHs pCosRatvt yePrice* Type SpCross Reactivity Host Application Format Description # at. 0 0254 0 0 1 1 1 98 80 79 eorpcAdPltoi 1m/lIC C abtplcoa 200 polyclonal G Rabbit IHC,ICC 1mg/ml Retrovirus Receptor (XPR1) Xenotropic And Polytropic G G Mucin-Lik P rti-ope eetrGR21m/lICRbi oylnl250 polyclonal Rabbit IHC 1mg/ml Protein-Coupled Receptor GPR72 P oenCuldRcpo AP/PR3 gm H abtplcoa 350 polyclonal Rabbit IHC 1mg/ml rotein-Coupled Receptor SALPR/GPCR135 oenCuldRcpo 2 gm H abtplcoa 350 polyclonal Rabbit IHC 1mg/ml rotein-Coupled Receptor G2A e R eceptor 2 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 119 Pre-validated antibodies Misc. molecular tools 120 Pre-validated antibodies Misc. molecular tools Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A002PotgadnERcpo P gm H abtplcoa 300 polyclonal 300 200 polyclonal polyclonal Rabbit 350 250 polyclonal polyclonal 300 IHC Rabbit Rabbit 300 polyclonal polyclonal IHC 1 mg/ml 250 IHC 300 polyclonal polyclonal 350 1mg/ml 350 Rabbit 1mg/ml Rabbit polyclonal polyclonal P 200 Prostaglandin EReceptor EP4 Rabbit IHC polyclonal TA200022 IHC Rabbit Neuropeptide Y Receptor Type 1 T IHC TA200019 Xenotropic And Polytropic 1mg/ml Rabbit IHC 300 Rabbit 1mg/ml Alpha1-Fetoprotein Transcription Factor (NR5A2) TA200247 300 300 polyclonal GProtein-Coupled Receptor GPR64(HE6) Rabbit TA200246 300 1mg/ml Rabbit polyclonal IHC polyclonal IHC TA200064 1mg/ml polyclonal Rabbit T IHC IHC T 1mg/ml 1mg/ml Proteinase-ActivatedReceptor 2 T IHC OpioidReceptor, Mu1(OPRM1) TA200243 1mg/ml 300 300 1mg/ml Rabbit TA200239 Retinoid-Related Receptor Orphan polyclonal polyclonal Rabbit Rabbit 350 1mg/ml OpioidReceptor, Mu1(OPRM1) Rabbit TA200238 350 polyclonal GProtein-Coupled Receptor IHC TG1019 TA200237 IHC polyclonal Muscarinic Acetylcholine IHC Receptor M4 TA200236 IHC 350 TA200234 350 1mg/ml polyclonal T 300 1mg/ml 1 mg/ml Encephalopsin polyclonal 200 T Rabbit Rabbit polyclonal 300 1mg/ml Lysophosphatidic Acid Receptor Edg2/LPA1 TA200229 300 polyclonal polyclonal Lysophosphatidic Acid Receptor Edg2/LPA1 IHC,ICC Rabbit TA200228 polyclonal IHC Leukotriene B4Receptor BLT2 Rabbit TA200227 Leukotriene B4Receptor BLT2 TA200226 IHC 350 1mg/ml TA200225 Rabbit IHC 1mg/ml polyclonal T Rabbit 350 350 Rabbit T 350 1mg/ml Rabbit polyclonal IHC polyclonal T Rabbit 250 1mg/ml polyclonal Rabbit IHC T IHC 350 Xenotropic And Polytropic polyclonal IHC 250 Vasopressin V1B Receptor IHC 1mg/ml TA200253 polyclonal Price* IHC Somatostatin Receptor Type 3 1mg/ml TA200251 polyclonal 1mg/ml Rabbit Somatostatin Receptor Type 3 TA200249 Type 1mg/ml 1mg/ml ChemokineReceptor FKSG80/GPR81 TA200248 Rabbit 1mg/ml SpCross Reactivity Rabbit ChemokineReceptor FKSG80/GPR81 TA200223 IHC Rabbit Host Gonadotropin-Releasing HormoneReceptor IHC,ICC TA200222 Application Rabbit Formyl Peptide Receptor 1(FPR1) TA200221 IHC Rabbit GalaninReceptor GalR3 IHC 1mg/ml TA200220 Rabbit 1mg/ml IHC TA200219 GalaninReceptor GalR3 Format IHC 1mg/ml TA200218 1mg/ml Prostate-Specific GProtein-Coupled IHC 1mg/ml GProtein-Coupled Receptor GPR35 TA200217 1mg/ml GProtein-Coupled Receptor GPR146 TA200216 1mg/ml GProtein-Coupled Receptor GPR54 TA200215 GProtein-Coupled Receptor GPR54 TA200214 GProtein-Coupled Receptor GPR54 TA200213 GProtein-Coupled Receptor GPR54 Description TA200212 TA200211 # Cat. 206 rti-ope eetrGR4(E)1m/lICRbi oylnl350 300 polyclonal polyclonal Rabbit Rabbit 200 IHC IHC polyclonal 1mg/ml 1 mg/ml 200 GProtein-Coupled Receptor GPR64(HE6) polyclonal A200063 Rabbit Proteinase-Activated Receptor 2 A20 350 A200244 200 polyclonal IHC polyclonal Rabbit 1mg/ml Muscarinic Acetylcholine IHC Receptor M4 Rabbit A200233 Rabbit A20 1mg/ml IHC IHC 1mg/ml Leukotriene B4Receptor BLT2 1mg/ml Follicle-Stimulating HormoneReceptor (FSHR) A200224 MelatoninReceptor Type 1A(MT1) A200235 A200232 A20 A20 roduct of 01PotgadnE eetrE31m/lICRbi oylnl300 polyclonal Rabbit IHC 1mg/ml Prostaglandin E2Receptor EP3 0021 0 350 polyclonal Rabbit 0230 IHC 1mg/ml MelatoninReceptor Type 1A(MT1) 0231 062 fering issubjecttoc Encephalopsin Retrovirus Receptor (XPR1) G Alpha (ROR Alpha/NR1F1) R Receptor (PSGR) etro P rotein-Coupled R virus Receptor (XPR1) hange. R eceptor estricted availability to internationalcustomer MX1GR61m/lICRbi oylnl350 polyclonal Rabbit IHC 1mg/ml TM7XN1/GPR56 www.origene.com 1 mg/ml s. Refer towebsiteforthemostupdatedinformation. IHC R abbit polyclonal 350 Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A000GPoenCuldRcpo P41m/lIC C abtplcoa 350 350 polyclonal polyclonal 350 350 polyclonal polyclonal Rabbit Rabbit 350 350 polyclonal IHC,ICC polyclonal 350 IHC 350 350 polyclonal Rabbit 1mg/ml P polyclonal polyclonal Rabbit 1mg/ml 350 IHC,ICC IHC polyclonal T G Protein-Coupled Receptor GPR4 Rabbit T Rabbit G Protein-Coupled Receptor GPR4 TA200060 1mg/ml 1mg/ml 300 TA200059 Rabbit IHC IHC GProtein-Coupled Receptor GPR44(CRTH2) T 300 polyclonal Rabbit 300 Rabbit 350 TA200055 polyclonal polyclonal polyclonal IHC T 1mg/ml Rabbit 1mg/ml IHC IHC T Purinergic Receptor P2Y6 T 300 1mg/ml Receptor Chemokine-Like 1(CMKLR1) IHC TA200051 300 1 mg/ml 1mg/ml GProtein-Coupled Receptor GPR3 polyclonal TA200049 Rabbit polyclonal TA200110 1mg/ml Rabbit GProtein-Coupled Receptor GPR49 Rabbit T IHC,ICC Rabbit 350 GProtein-Coupled Receptor GPR49 300 TA200047 300 350 PyrimidinergicReceptor P2Y4 TA200046 polyclonal polyclonal IHC IHC 300 350 IHC GProtein-Coupled Receptor GPR72 polyclonal 300 1mg/ml polyclonal TA200373 300 polyclonal TA200371 polyclonal Rabbit polyclonal polyclonal T Rabbit 1mg/ml 1mg/ml 1mg/ml CXCChemokineReceptor 4(CXCR4) IHC,ICC T 350 TA200044 IHC Formyl Peptide Receptor-Like 2(FPRL2) T polyclonal 350 Rabbit Rabbit 1mg/ml Formyl Peptide Receptor 1(FPR1) TA200042 Rabbit Rabbit polyclonal TA200041 Rabbit Rabbit 1mg/ml Rabbit 300 Endothelin A Receptor Rabbit IHC T IHC 300 IHC IHC TA200039 polyclonal IHC,ICC CannabinoidReceptor 1(CB1) 300 IHC IHC T polyclonal IHC 350 C-CChemokineReceptor 1mg/ml 7(CCR7) 1mg/ml TA200037 polyclonal Rabbit 1mg/ml 1mg/ml Brain-Specific Angiogenesis Inhibitor3(BAI3) polyclonal TA200036 1mg/ml 350 1mg/ml Parathyroid 1mg/ml HormoneReceptor 2(PTHR2) Price* TA200035 1mg/ml Rabbit Brain-Specific Angiogenesis Inhibitor3(BAI3) polyclonal IHC TA200057 Type GProtein-Coupled Receptor GPR30 TA200034 Rabbit IHC SphingolipidReceptor Edg3/S1P3 SpCross Reactivity TA200033 Rabbit 1mg/ml Proteinase-ActivatedReceptor 3 Host TA200058 Rabbit Application GABA(B)Receptor 1 IHC TA200050 Rabbit 1mg/ml GABA(B)Receptor 1 IHC TA200032 TA200031 IHC Rabbit Format 1mg/ml IHC T Estrogen-Related Receptor 1mg/ml IHC,ICC TA200029 1mg/ml Estrogen-Related Receptor 1mg/ml SphingolipidReceptor Edg1/S1P1 TA200028 1mg/ml SphingolipidReceptor Edg1/S1P1 TA200027 C-CChemokineReceptor 1(CCR1) TA200026 Prostaglandin F2-AlphaReceptor TA200025 Prostaglandin F2-AlphaReceptor Description TA200024 TA200023 # Cat. 205 aahri omn eetr2(TR)1m/lICRbi oylnl300 polyclonal 300 polyclonal Rabbit IHC Rabbit IHC,ICC 1mg/ml Parathyroid HormoneReceptor 2(PTHR2) 1mg/ml A200056 Lysophosphatidic Acid Receptor Edg4/LPA2 A200054 A20 300 A20 polyclonal A20 Rabbit IHC,ICC A20 A20 1mg/ml A20 300 polyclonal A20 CannabinoidReceptor 1(CB1) A200038 Rabbit IHC 1mg/ml Formyl Peptide Receptor-Like Receptor 1(FPRL1) A200030 206 rkntcnRcpo GR3)1m/lICRbi oylnl350 polyclonal Rabbit IHC 1mg/ml Prokineticin Receptor 2 (GPR73B) A200265 A20 roduct of 0 02Prnri eetrPY gm H,ICRbi oylnl350 polyclonal Rabbit IHC,ICC 350 polyclonal 1mg/ml Purinergic Receptor P2Y6 0 Rabbit 0052 IHC 0 1mg/ml Purinergic Receptor P2U2(GPR91) 0272 0 0 0 065 4 hmkn-ieRcpo CKR)1m/lICRbi oylnl350 polyclonal 300 polyclonal Rabbit IHC 053 1mg/ml Rabbit Receptor 1(CMKLR1) Chemokine-Like IHC 048 1mg/ml CXCChemokineReceptor 4(CXCR4) 045 043 0 40 fering issubjecttoc Thrombin R Gamma (ERRGamma/NR3B3) Gamma (ERRGamma/NR3B3) Calcitonin R V F orm asoacti yl P ve IntestinalP pieRcpo-ie2(PL)1m/lIC C abtplcoa 350 polyclonal Rabbit IHC,ICC 1mg/ml eptide Receptor-Like 2(FPRL2) eceptor eceptor hange. R Lk eetr1m/lIC C abtplcoa 350 polyclonal Rabbit IHC,ICC 1mg/ml Receptor -Like lppieRcpo gm H abtplcoa 300 polyclonal Rabbit IHC 1mg/ml olypeptide Receptor 1 estricted availability to internationalcustomer h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 1 mg/ml s. Refer towebsiteforthemostupdatedinformation. IHC abtplcoa 300 polyclonal Rabbit 121 Pre-validated antibodies Misc. molecular tools 122 Pre-validated antibodies Misc. molecular tools Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A019Apa1-deoetr1m/lICRbi oylnl300 polyclonal 350 350 polyclonal polyclonal 300 300 Rabbit polyclonal 350 polyclonal polyclonal IHC Rabbit Rabbit 200 polyclonal 1mg/ml IHC IHC 350 Rabbit 350 polyclonal Rabbit 350 1mg/ml Rabbit polyclonal 1mg/ml 350 350 IHC polyclonal 250 350 IHC polyclonal polyclonal P Alpha 1d-Adrenoceptor IHC Rabbit polyclonal polyclonal GProtein-Coupled Receptor GPR30 1mg/ml TA200109 IHC,ICC 1mg/ml TA200108 Rabbit 1mg/ml G Protein-Coupled Receptor GPR2/CCR10 T Rabbit GProtein-Coupled Receptor GPR2/CCR10 TA200104 Rabbit 1mg/ml Latrophilin-3 TA200103 IHC Rabbit Rabbit GProtein-Coupled Receptor GPR22 TA200102 IHC Rabbit Rabbit TA200098 300 IHC IHC,ICC GProtein-Coupled Receptor GPR75 T 1mg/ml IHC IHC,ICC polyclonal TA200269 1mg/ml IHC PutativeNeurotransmitter Receptor (PNR) T 1mg/ml 1mg/ml 300 Chemokine(C-Cmotif)Receptor-like 2(CCRL2) TA200267 1mg/ml 1mg/ml 300 polyclonal TA200096 1mg/ml 300 300 polyclonal T polyclonal polyclonal 350 Neuropeptide Y Receptor Type 5 T 300 Rabbit Neuropeptide Y Receptor Type polyclonal 5 TA200093 polyclonal Neuropeptide Y Receptor Type 4 TA200092 Latrophilin-2 TA200091 IHC 350 Rabbit TA200101 350 350 polyclonal Latrophilin-2 Rabbit T 350 polyclonal polyclonal Rabbit Rabbit TA200099 1mg/ml IHC,ICC IHC 350 polyclonal T Rabbit IHC,ICC polyclonal 350 Rabbit T 350 IHC T polyclonal 1mg/ml 1mg/ml 350 Melanocortin 1Receptor polyclonal (MC1R) IHC T 1mg/ml IHC polyclonal Lysophosphatidic Acid Receptor Edg7/LPA3 TA200086 Rabbit 1mg/ml 350 TA200081 Rabbit Rabbit 350 1mg/ml polyclonal SphingolipidReceptor Edg5/S1P2 Rabbit T 350 1mg/ml 300 IHC polyclonal SphingolipidReceptor Edg5/S1P2 TA200083 Rabbit polyclonal IHC IHC Lysophosphatidic Acid Receptor Edg7/LPA3 polyclonal TA200082 Price* IHC Rabbit GProtein-Coupled Receptor GPR20 350 TA200080 Rabbit 1mg/ml Adenosine A1 Receptor IHC TA200079 Rabbit Type polyclonal IHC,ICC 1mg/ml 1mg/ml GProtein-Coupled Receptor GPR86/GPR94/P2Y13 TA200078 1mg/ml SpCross Reactivity IHC TA200077 Rabbit Host 1mg/ml IHC GProtein-Coupled Receptor AGR9 T Rabbit 1mg/ml Application IHC,ICC GProtein-Coupled Receptor AGR9 Rabbit TA200072 Rabbit 1mg/ml IHC,ICC GProtein-Coupled Receptor GPR86/GPR94/P2Y13 TA200071 1mg/ml IHC,ICC GProtein-Coupled Receptor GPR48 TA200076 Format 1mg/ml Rabbit GProtein-Coupled Receptor RE2 IHC TA200075 1mg/ml Frizzled-10 (FZD10) TA200073 1mg/ml GProtein-Coupled Receptor HM74 TA200070 IHC 1mg/ml GProtein-Coupled Receptor HM74 TA200069 GProtein-Coupled Receptor HM74 TA200068 CalcitoninReceptor-Like Receptor TA200067 1mg/ml GProtein-Coupled Receptor GPR26 TA200066 PutativeNeurotransmitter Receptor (PNR) Description TA200337 TA200266 # Cat. 209 hmkn CCmtf eetrlk CR2 gm H abtplcoa 350 200 polyclonal polyclonal 250 polyclonal Rabbit Rabbit IHC,ICC IHC Rabbit 250 1mg/ml 1mg/ml polyclonal Chemokine(C-Cmotif)Receptor-like 2(CCRL2) IHC A200097 G Protein-Coupled Receptor GPR75 A200268 1mg/ml Rabbit A20 A20 IHC 350 Latrophilin-2 polyclonal 1mg/ml A200100 A20 Prostaglandin F2-AlphaReceptor A20 A200088 A20 Rabbit IHC A20 1mg/ml GProtein-Coupled Receptor GPR48 A200074 A20 roduct of 0 04Nuoetd eetrTp gm H,ICRbi oylnl250 polyclonal 250 polyclonal Rabbit IHC,ICC 1mg/ml Rabbit Neuropeptide Y Receptor Type 5 0 IHC 0094 1mg/ml Neuropeptide Y Receptor Type 4 0090 0 0 0 1 095 089 087 084 07 fering issubjecttoc itmn 1Rcpo gm H abtplcoa 300 polyclonal Rabbit IHC 1mg/ml Histamine H1Receptor P Neuropeptide M Sphingolipid R rolactin R elanocor tin 1R eleasing HormoneR Y hange. R eceptor Edg5/S1P2 eetrTp gm H abtplcoa 350 polyclonal Rabbit IHC 1mg/ml Receptor Type 4 cpo M1)1m/lICRbi oylnl200 polyclonal Rabbit IHC 1mg/ml eceptor (MC1R) estricted availability to internationalcustomer cpo GR0 gm H abtplcoa 250 polyclonal Rabbit IHC 1mg/ml eceptor (GPR10) www.origene.com 1 mg/ml s. Refer towebsiteforthemostupdatedinformation. IHC, ICC abtplcoa 200 polyclonal Rabbit A032VspesnVBRcpo gm H abtplcoa 300 polyclonal 250 250 polyclonal 350 polyclonal 300 300 Rabbit polyclonal polyclonal 300 polyclonal polyclonal IHC Rabbit Rabbit 1mg/ml 250 Rabbit polyclonal 300 IHC Rabbit Rabbit IHC IHC,ICC polyclonal Rabbit T IHC 1mg/ml IHC 250 Vasopressin V1B Receptor T 1mg/ml 1mg/ml IHC polyclonal TA200302 250 GProtein-Coupled Receptor GPR27(SREB1) 1mg/ml T 1mg/ml Rabbit GProtein-Coupled Receptor G2A polyclonal TA200299 1mg/ml 250 GProtein-Coupled Receptor G2A TA200298 Rabbit IHC,ICC 250 polyclonal TA200297 350 GProtein-Coupled Receptor D6 polyclonal T 350 polyclonal IHC C-CChemokineReceptor 8(CCR8) 200 TA200295 1mg/ml Rabbit polyclonal BradykininB1Receptor 200 TA200294 polyclonal TA200293 polyclonal Rabbit 1mg/ml Retinoic Acid-Induced 3(RAI3/RAIG1) IHC T 350 TA200288 Rabbit polyclonal IHC T Rabbit 1mg/ml C-CChemokineReceptor 6(CCR6) Rabbit T IHC Rabbit TA200287 300 Rabbit 1mg/ml IHC T 300 Rabbit 350 IHC Vomeronasal 350 1Receptor 1(VN1R1) polyclonal T IHC 250 1mg/ml polyclonal polyclonal TA200282 IHC polyclonal 1mg/ml GProtein-Coupled Receptor GPR48 polyclonal T IHC Rabbit 1mg/ml 250 TA200291 1mg/ml Vomeronasal 1Receptor 1(VN1R1) 1mg/ml 300 T polyclonal 350 IHC Vomeronasal 1Receptor 1(VN1R1) 1mg/ml 300 TA200283 polyclonal 300 polyclonal GProtein-Coupled Receptor EX33 TA200280 Rabbit polyclonal polyclonal GProtein-Coupled Receptor EX33 TA200279 Rabbit Rabbit 1mg/ml Rabbit 350 TA200278 Rabbit IHC GProtein-Coupled Receptor GPR85(SREB2) IHC,ICC T polyclonal IHC TA200276 IHC Rabbit 5-HT1FReceptor Price* IHC T 1mg/ml Rabbit 1mg/ml 5-HT1FReceptor Rabbit TA200274 1mg/ml Rabbit Type 1mg/ml IHC TA200273 Rabbit mg/ml 1 SpCross Reactivity T IHC IHC GProtein-Coupled Receptor GPR35 Host T IHC IHC Rabbit Application 1mg/ml GProtein-Coupled Receptor MRGX2 TA200262 Vasopressin V2 Receptor 1mg/ml TA200261 1mg/ml Vasopressin V2 Receptor 1mg/ml TA200260 IHC 1mg/ml Format MetabotropicGlutamateReceptor 7 TA200259 Beta-2Adrenoceptor TA200255 Somatostatin Receptor Type 5(SSTR5) TA200252 1mg/ml TA200250 Retinoid-Related Orphan OxytocinReceptor TA200245 OxytocinReceptor TA200242 TA200241 Retinoid-Related Orphan Description TA200240 # Cat. Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish P 200 rtni-IRcpo GR4 gm H abtplcoa 300 polyclonal Rabbit IHC 250 polyclonal 1mg/ml 250 polyclonal Urotensin-II Receptor (GPR14) A200300 Rabbit 350 polyclonal Rabbit IHC A20 IHC,ICC 1mg/ml 1mg/ml 350 A20 Rabbit polyclonal GProtein-Coupled Receptor GPR48 Retinoic Acid-Induced 3(RAI3/RAIG1) A200292 IHC A200289 300 250 polyclonal A20 polyclonal 1mg/ml A20 Rabbit A20 GProtein-Coupled Receptor GPR52 IHC A200284 Rabbit Rabbit 1mg/ml IHC GProtein-Coupled Receptor GPR85(SREB2) IHC A200277 1mg/ml A20 1mg/ml Cysteinyl Leukotriene Receptor 2(CysLT2) Prokineticin Receptor 1(GPR73A) A200271 A200264 200 rtni-IRcpo GR4 gm H abtplcoa 300 polyclonal Rabbit IHC 1mg/ml Urotensin-IIReceptor (GPR14) A20 A200303 roduct of 0304 26GPoenCuldRcpo 61m/lICRbi oylnl300 polyclonal Rabbit IHC 1mg/ml GProtein-Coupled Receptor D6 200 0296 polyclonal 0290 Rabbit 0286 0285 IHC 0281 1mg/ml 5-HT1FReceptor 0275 fering issubjecttoc - hmkn eetr6(C6 gm H abtplcoa 300 polyclonal Rabbit IHC 1mg/ml C-C ChemokineReceptor 6(CCR6) G G V Receptor Beta(RORBeta/NR1F2) Receptor Beta(RORBeta/NR1F2) P2Y1 omeronasal 1R rti-ope eetrGR4(RH)1m/lIC C abtplcoa 300 polyclonal Rabbit IHC,ICC 1mg/ml Protein-Coupled Receptor GPR44(CRTH2) P oenCuldRcpo P4 CT2 gm H,ICRbi oylnl200 polyclonal Rabbit IHC,ICC 1mg/ml rotein-Coupled Receptor GPR44(CRTH2) 2 Platelet ADP R hange. R eceptor 1(VN1R1) cpo gm H,ICRbi oylnl350 polyclonal Rabbit IHC,ICC 1mg/ml eceptor estricted availability to internationalcustomer h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 1 gm H abtplcoa 250 polyclonal Rabbit IHC mg/ml s. Refer towebsiteforthemostupdatedinformation. 123 Pre-validated antibodies Misc. molecular tools 124 Pre-validated antibodies Misc. molecular tools Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A035Bt- deoetr1m/lICRbi oylnl300 polyclonal 300 300 polyclonal polyclonal 200 Rabbit 200 polyclonal 250 200 Rabbit polyclonal Rabbit IHC polyclonal polyclonal IHC IHC mg/ml 1 300 mg/ml 1 Rabbit 1mg/ml polyclonal 250 Rabbit Rabbit Rabbit polyclonal 250 IHC 250 IHC 250 P polyclonal Beta-3 Adrenoceptor IHC IHC polyclonal polyclonal TA200345 1mg/ml 250 Beta-3Adrenoceptor T 1mg/ml Rabbit Frizzled-1 (FZD1) 350 polyclonal TA200343 1mg/ml 1mg/ml TA200341 Rabbit polyclonal T IHC GProtein-Coupled Receptor GPRC5B IHC,ICC Rabbit T Endothelin A Receptor Rabbit TA200335 Rabbit Endothelin A Receptor TA200334 1mg/ml IHC 1mg/ml Endothelin A Receptor TA200332 Rabbit IHC IHC Melanocortin 2Receptor (ACTH Receptor) TA200331 Rabbit TA200327 1mg/ml 350 GProtein-Coupled Receptor GPR35 IHC T 1mg/ml 1mg/ml GProtein-Coupled Receptor 300 GPR86/GPR94/P2Y13 polyclonal TA200325 IHC 200 TA200364 polyclonal 1mg/ml 350 T polyclonal AdrenomedullinReceptor L1 250 1mg/ml T polyclonal 300 300 AdrenomedullinReceptor L1 TA200323 polyclonal GProtein-Coupled Receptor GPR18 TA200322 polyclonal polyclonal TA200321 Rabbit 250 Endothelin Type BReceptor-Like 200 Rabbit TA200330 polyclonal polyclonal Rabbit 350 IHC T Rabbit IHC polyclonal IHC,ICC T Rabbit 250 Rabbit T Rabbit 1mg/ml polyclonal IHC Prolactin Releasing HormoneReceptor (GPR10) 200 T 350 1mg/ml 1mg/ml IHC,ICC IHC 200 TA200319 polyclonal 300 IHC polyclonal Rabbit Rabbit T polyclonal 250 1mg/ml polyclonal ComplementComponent5aReceptor 1 T 1mg/ml 1mg/ml polyclonal IHC,ICC 350 C-CChemokineReceptor 8(CCR8) TA200313 Rabbit Price* IHC 1mg/ml GastricInhibitoryPolypeptide Receptor polyclonal TA200312 GastricInhibitoryPolypeptide Receptor Type TA200311 Rabbit 1mg/ml IHC TA200310 1mg/ml SpCross Reactivity Rabbit Rabbit Host Rabbit Purinergic Receptor P2Y1 IHC T Rabbit Application IHC,ICC 1mg/ml Purinergic Receptor P2Y1 TA200315 Rabbit SphingolipidReceptor Edg8/S1P5 IHC TA200314 IHC Rabbit 1mg/ml Purinergic Receptor P2Y1 IHC TA200309 Format 1mg/ml IHC GProtein-Coupled Receptor GPR25 TA200308 1mg/ml Lysophosphatidic Acid Receptor Edg4/LPA2 TA200307 1mg/ml IHC 1mg/ml GProtein-Coupled Receptor GPR72 TA200306 1mg/ml GProtein-Coupled Receptor GPR86/GPR94/P2Y13 TA200370 GProtein-Coupled Receptor GPR32 1mg/ml TA200367 Melanocortin 4Receptor (MC4R) TA200366 Somatostatin Receptor Type 4 TA200342 NeurotensinReceptor Type 2(NTR2) Description TA200340 TA200305 # Cat. 205 rti-ope eetrGR21m/lICRbi oylnl350 polyclonal 350 A20 polyclonal A20 Rabbit 300 IHC polyclonal 1mg/ml A20 Rabbit GProtein-Coupled Receptor GPR52 IHC A20 350 Rabbit A200358 polyclonal 1mg/ml IHC Endothelin Type BReceptor-Like 1mg/ml Follicle-Stimulating HormoneReceptor (FSHR) A200329 Rabbit A200328 A20 A20 IHC A20 A20 1mg/ml OlfactoryReceptor, Family 2, A200318 A20 roduct of 0344 0339 0338 300 300 polyclonal polyclonal 0326 Rabbit Rabbit 0363 IHC IHC 1mg/ml 1mg/ml NeuromedinUReceptor 1(GPR66) DopamineReceptor D4(DRD4) 0324 0320 031 031 rsalni eetrE41m/lIC C abtplcoa 200 200 polyclonal polyclonal Rabbit Rabbit IHC,ICC IHC,ICC 1mg/ml 1mg/ml Prostaglandin EReceptor EP4 Prostaglandin EReceptor EP4 7 6 fering issubjecttoc G G Alpha 2c-Adrenoceptor G Protein 2(ETBR-LP-2) P Subfamily A, Member4(OR2A4) ea3Arncpo gm H abtplcoa 200 polyclonal Rabbit IHC mg/ml 1 Beta-3 Adrenoceptor rotein 2(ETBR-LP P P P oenCuldRcpo PCB1m/lICRbi oylnl350 polyclonal Rabbit 350 polyclonal IHC 1mg/ml rotein-Coupled R rotein-Coupled Receptor GPRC5B Rabbit IHC 1mg/ml rotein-Coupled Receptor GPR25 hange. R -2) eceptor GPRC5B estricted availability to internationalcustomer www.origene.com 1 1 mg/ml mg/ml s. Refer towebsiteforthemostupdatedinformation. IHC IHC abtplcoa 200 R polyclonal Rabbit abbit oylnl350 polyclonal A039Etoe-eae eetrApa gm H abtplcoa 350 polyclonal 350 polyclonal 350 polyclonal 350 250 polyclonal polyclonal 250 Rabbit polyclonal Rabbit IHC 350 Rabbit IHC polyclonal Rabbit 1mg/ml Rabbit IHC R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish 1mg/ml Product offering issubjecttochange. Restricted Refer availabilitytointernationalcustomers. towebsiteforthemostupdatedinformation. Rabbit 250 IHC IHC 350 1mg/ml Estrogen-Related Receptor Alpha polyclonal 250 polyclonal IHC TA200389 Rabbit 1mg/ml polyclonal 1 mg/ml T 300 GProtein-Coupled Receptor GPR43 T 1mg/ml polyclonal TA200423 IHC 300 GProtein-Coupled Receptor GPR26 T polyclonal NuclearReceptor SHP(NR0B2) TA200397 Rabbit 350 Rabbit SREB3 TA200387 1mg/ml polyclonal TA200386 Rabbit Retinoid-Related Receptor Orphan Gamma 200 IHC IHC TA200385 polyclonal 350 Rabbit 5-HT1EReceptor IHC T 350 polyclonal TA200416 1mg/ml 350 Rabbit 1mg/ml polyclonal T 300 IHC Retinoid-Related Receptor Orphan Gamma polyclonal 250 1mg/ml polyclonal Rabbit TA200384 350 350 IHC polyclonal Retinoid-Related Receptor Orphan Gamma 1mg/ml polyclonal polyclonal TA200383 350 Rabbit IHC 1mg/ml T polyclonal Rabbit HepatocyteNuclearFactor 4Gamma Rabbit IHC TA200381 1mg/ml Rabbit 250 HepatocyteNuclearFactor 4Gamma Rabbit IHC 300 250 SREB3 Rabbit TA200380 IHC,ICC polyclonal IHC 1mg/ml polyclonal Rabbit 250 Rabbit TA200379 350 polyclonal IHC,ICC IHC 1mg/ml polyclonal polyclonal T 1mg/ml Rabbit 1mg/ml IHC IHC 350 GProtein-Coupled Receptor GPR27(SREB1) 350 1mg/ml T 1mg/ml 250 Frizzled-4 (FZD4) TA200372 IHC polyclonal polyclonal Alpha2c-Adrenoceptor 1mg/ml 1mg/ml polyclonal TA200368 Rabbit Price* Rabbit BombesinReceptor Subtype3(BRS3) TA200365 Rabbit EBV-Induced Gene2 1mg/ml TA200369 Type Rabbit Rabbit IHC EBV-Induced Gene2 TA200362 IHC SpCross Reactivity IHC IHC,ICC TA200361 Host Frizzled-6 (FZD6) IHC T Application 1mg/ml Rabbit Rabbit Prostacyclin Receptor TA200359 1mg/ml Rabbit 1mg/ml 1mg/ml Frizzled-5 (FZD5) TA200357 1mg/ml GProtein-Coupled Receptor GPR92/GPR93 IHC,ICC TA200354 IHC IHC Format Frizzled-5 (FZD5) TA200353 GProtein-Coupled Receptor GPR17 TA200352 1mg/ml GProtein-Coupled Receptor GPR17 1mg/ml 1mg/ml TA200348 GlucagonReceptor TA200347 GlucagonReceptor TA200350 GProtein-Coupled Receptor GPR105 TA200349 ApelinReceptor (APJ/AGTRL1) TA200422 NeuromedinUReceptor 2 Description TA200420 TA200346 # Cat. 201 plnRcpo AJATL)1m/lIC C abtplcoa 350 350 polyclonal polyclonal Rabbit Rabbit IHC,ICC A20 IHC A20 1 mg/ml 1mg/ml ApelinReceptor (APJ/AGTRL1) A200419 ApelinReceptor (APJ/AGTRL1) 350 A200412 polyclonal A20 Rabbit IHC,ICC A20 1mg/ml A20 Frizzled-6 (FZD6) A200360 A20 0388 0425 041 350 polyclonal Rabbit IHC 0382 1mg/ml GProtein-Coupled Receptor MRGX3 0378 0377 plnRcpo AJATL)1m/lIC C abtplcoa 350 polyclonal Rabbit IHC, ICC 1mg/ml ApelinReceptor (APJ/AGTRL1) 0 (SNSR1/SNSR2) G R (SNSR1/SNSR2) G (ROR Gamma/NR1F3) (ERR Alpha/NR3B1) (ROR Gamma/NR1F3) (ROR Gamma/NR1F3) (ROR Gamma/NR1F3) (HNF4 Gamma/NR2A2) (HNF4 Gamma/NR2A2) Nuclear R etinoid-R rti-ope eetrGR gm H abtplcoa 350 polyclonal Rabbit IHC 1mg/ml Protein-Coupled Receptor GPR8 P rotein-Coupled R eceptor SHP(NR0B2) elated OrphanR eceptor MRGX3 h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: eceptor Gamma 1 1 1 mg/ml gm H abtplcoa 250 polyclonal Rabbit IHC mg/ml mg/ml IHC IHC abtplcoa 250 polyclonal Rabbit R bi oylnl350 polyclonal abbit 125 Pre-validated antibodies Misc. molecular tools 126 Pre-validated antibodies Misc. molecular tools Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A045MPKns hshts MP/S-)1m/lICRbi oylnl250 polyclonal 250 250 250 polyclonal 250 300 polyclonal polyclonal polyclonal polyclonal Rabbit IHC Rabbit Rabbit Rabbit 350 350 Rabbit Rabbit 1mg/ml IHC polyclonal polyclonal P 250 IHC IHC MAPKinasePhosphataseX(MKPX/JSP-1) IHC IHC polyclonal 300 1mg/ml TA200435 250 Protein Tyrosine PhosphataseEpsilon (PTPRE) 1mg/ml T polyclonal 1mg/ml 200 1mg/ml Protein Tyrosine PhosphataseEpsilon (PTPRE) TA200432 1mg/ml polyclonal polyclonal Protein 350 Tyrosine Phosphatase Alpha (PTPRA) 350 TA200431 Rabbit Rabbit 350 TA200430 polyclonal polyclonal T polyclonal IHC,ICC Rabbit Melatonin-Related Receptor T IHC TA200424 250 Rabbit T 1mg/ml IHC Rabbit EGF-Like (EMR2) Module-ContainingMucin-Like polyclonal 250 Rabbit 1mg/ml GProtein-Coupled Receptor GPR63(PSP24Beta) TA200418 IHC IHC,ICC polyclonal FLJ20442 Rabbit Rabbit TA200417 350 1mg/ml GProtein-Coupled Receptor GPR63(PSP24Beta) IHC Rabbit TA200434 350 polyclonal TA200415 1mg/ml 1mg/ml IHC IHC polyclonal IHC 1mg/ml T 350 EGF-Like Rabbit Module-Containing Mucin-Like 300 GProtein-Coupled Receptor 1mg/ml GPR15 polyclonal 1mg/ml TA200413 350 Rabbit 300 1mg/ml TA200411 polyclonal IHC polyclonal Interleukin8Receptor B(CXCR2) T 250 polyclonal Rabbit GProtein-Coupled Receptor GPR128 IHC TA200464 polyclonal Rabbit Protein PhosphataseMGC1136 TA200463 1mg/ml Protein PhosphataseMGC1136 IHC 350 TA200428 1mg/ml NuclearReceptor Rev-ErbA Alpha (NR1D1) TA200427 IHC Rabbit polyclonal 250 350 TA200408 Rabbit 1mg/ml polyclonal Rabbit T polyclonal Rabbit ErbA-Related IHC Protein EAR2(NR2F6) T 1mg/ml 200 Rabbit 350 TA200403 IHC IHC ErbA-Related Protein EAR2(NR2F6) polyclonal T IHC polyclonal 1mg/ml Price* GProtein-Coupled Receptor GPRC5D TA200401 IHC Rabbit 1mg/ml TA200400 1mg/ml Type Photoreceptor-Specific NuclearReceptor 1mg/ml Rabbit Rabbit SpCross Reactivity TA200406 1mg/ml Photoreceptor-Specific IHC NuclearReceptor Host GProtein-Coupled Receptor LGR7 TA200405 Application IHC IHC GProtein-Coupled Receptor LGR7 Rabbit TA200399 Rabbit 1mg/ml ErbA-Related Protein EAR2(NR2F6) TA200398 TA200396 Format 1mg/ml IHC Retinoid-Related 1mg/ml Receptor Orphan Alpha IHC TA200395 Retinoid-Related Receptor Orphan Beta 1mg/ml TA200394 1mg/ml Estrogen-Related Receptor Alpha TA200393 T Estrogen-Related Receptor Alpha NuclearReceptor SHP(NR0B2) Description TA200391 TA200390 # Cat. 202 -T eetr1m/lICRbi oylnl300 polyclonal 200 polyclonal Rabbit IHC Rabbit IHC,ICC 1mg/ml 350 1mg/ml polyclonal 200 polyclonal MetabotropicGlutamate Receptor 2 A20 A200426 5-HT6 Receptor 350 A200421 Rabbit polyclonal IHC,ICC Rabbit 1mg/ml EGF-Like (EMR2) Module-ContainingMucin-Like IHC A200414 Rabbit 1mg/ml IHC A20 1mg/ml 5-HT1BReceptor ErbA-Related Protein EAR2(NR2F6) A200407 350 A200404 polyclonal A20 Rabbit IHC 1mg/ml GProtein-Coupled Receptor GPCR150 A200392 A20 roduct of 0433 0429 0409 0 0 rti-ope eetrGR5 gm H abtplcoa 350 polyclonal Rabbit IHC 1mg/ml GProtein-Coupled Receptor GPRC5D 402 fering issubjecttoc P G Receptor 2 Receptor 2 R (PNR/NR2E3) (PNR/NR2E3) (ROR Alpha/NR1F1) (ROR Beta/NR1F2) (ERR Alpha/NR3B1) (ERR Alpha/NR3B1) P rotein rotein eceptor 2(EMR2) P rotein-Coupled R T yoiePopaaeEsln(TR)1m/lICRbi oylnl250 polyclonal Rabbit IHC 1mg/ml Tyrosine PhosphataseEpsilon(PTPRE) rsn hshts lh PPA gm H abtplcoa 250 polyclonal Rabbit IHC 1mg/ml yrosine Phosphatase Alpha (PTPRA) hange. R eceptor GPCR1 estricted availability to internationalcustomer 50 www.origene.com 1 mg/ml s. Refer towebsiteforthemostupdatedinformation. IHC abtplcoa 350 polyclonal Rabbit Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A044Guao eetr1m/lICRbi oylnl250 250 polyclonal 350 300 polyclonal polyclonal polyclonal Rabbit 300 Rabbit 250 350 polyclonal Rabbit Rabbit polyclonal IHC polyclonal 250 300 IHC 350 polyclonal polyclonal IHC IHC polyclonal 1mg/ml 1mg/ml 1mg/ml 1mg/ml 350 Rabbit Rabbit polyclonal Rabbit P IHC Rabbit C-CChemokineReceptor 7(CCR7) Rabbit T IHC Rabbit Glucagon Receptor IHC TA200475 Glucagon Receptor TA200474 IHC 1mg/ml IHC GlucagonReceptor TA200473 350 IHC 1mg/ml 1mg/ml GrowthHormoneReleasing HormoneReceptor TA200472 polyclonal 300 Rabbit TA200471 350 1mg/ml 1mg/ml GrowthHormoneReleasing HormoneReceptor 1mg/ml polyclonal T polyclonal Gastrin-Releasing Peptide Receptor TA200469 250 IHC 250 NeuromedinBReceptor TA200468 polyclonal GProtein-Coupled Receptor GPR101 TA200467 polyclonal 250 1mg/ml TA200466 polyclonal Rabbit BradykininB1Receptor T 250 TA200462 Rabbit IHC,ICC Rabbit GProtein-Coupled Receptor TM7SF1 T polyclonal 350 TA200460 300 IHC,ICC Rabbit IHC T 300 1mg/ml polyclonal polyclonal Rabbit T 300 IHC,ICC polyclonal Rabbit T 1mg/ml polyclonal 1mg/ml IHC 350 GProtein-Coupled Receptor GPR1 T 1mg/ml Rabbit IHC Parathyroid HormoneReceptor 1(PTHR1) TA200455 polyclonal 350 GProtein-Coupled Receptor GPR1 TA200454 1mg/ml 250 Misshapen/NIK-Related Kinase(MINK/MAP4K6) polyclonal TA200453 Rabbit Rabbit 350 IHC 250 1mg/ml GProtein-Coupled Receptor polyclonal GPR1 TA200452 Rabbit 300 polyclonal polyclonal TA200451 Rabbit NIMA(NeverInMitosisGene A)-Related IHC IHC polyclonal 1mg/ml IHC TA200449 Serum/Glucocorticoid Regulated Kinase-Like Rabbit IHC 350 1mg/ml TA200448 1mg/ml polyclonal Rabbit 1mg/ml T Price* IHC Rabbit 250 1mg/ml CDC2-Related Protein Kinase7(CRK7) Rabbit T Rabbit Type polyclonal IHC SphingolipidReceptor Edg6/S1P4 TA200450 Rabbit SpCross Reactivity IHC 1mg/ml Macrophage-Stimulating1Receptor (MST1R/Ron) TA200447 IHC IHC Host SphingolipidReceptor Edg6/S1P4 TA200446 Application 1mg/ml IHC Alpha1b-Adrenoceptor TA200442 1mg/ml Rabbit TA200441 1mg/ml 1mg/ml Format 1mg/ml T Rabbit IHC Estrogen-Related Receptor Beta TA200444 Estrogen-Related Receptor Beta IHC 1mg/ml Alpha1b-Adrenoceptor TA200443 Adenosine A3 Receptor TA200440 Adenosine A3 Receptor TA200439 1mg/ml GProtein-Coupled Receptor GPR55 TA200438 MAPKinasePhosphataseX(MKPX/JSP-1) Description TA200437 TA200436 # Cat. 206 ula eetrRvEb lh N11 gm H abtplcoa 250 polyclonal 250 polyclonal 250 polyclonal Rabbit Rabbit IHC A20 Rabbit IHC IHC,ICC 1mg/ml 300 Nuclear Receptor Rev-ErbA Alpha (NR1D1) 1mg/ml polyclonal 1mg/ml A200465 MAPKinasePhosphatase X(MKPX/JSP-1) 350 A200461 polyclonal GProtein-Coupled Receptor TM7SF1 A200459 A20 A20 Rabbit 250 A20 Rabbit IHC polyclonal IHC 1mg/ml 1mg/ml Rabbit NeurotensinReceptor Type 1 A200490 Lysophosphatidic Acid Receptor IHC A200480 1 mg/ml Estrogen-Related Receptor Beta A200445 A20 roduct of 0477 48GPoenCuldRcpo MS11m/lIC C abtplcoa 350 polyclonal 0470 Rabbit IHC,ICC 1mg/ml GProtein-Coupled Receptor TM7SF1 0458 0457 0456 fering issubjecttoc Growth HormoneR G A Thrombospondin Type 1Motif, 5(ADAMTS5) Kinase 6(NEK6) (SGKL/SGK3) P (ERR Beta/NR3B2) (ERR Beta/NR3B2) (ERR Beta/NR3B2) P rnri eetrPY01m/lICRbi oylnl250 polyclonal Rabbit IHC 1mg/ml urinergic Receptor P2Y10 2Y9/LPA4/GPR23 Disintegrin-lik rti-ope eetrGR21m/lICRbi oylnl350 polyclonal Rabbit IHC 1mg/ml Protein-Coupled Receptor GPR12 hange. R e and Metalloproteasewith eleasing HormoneR estricted availability to internationalcustomer h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: cpo gm H abtplcoa 250 polyclonal Rabbit IHC 1mg/ml eceptor 1 mg/ml s. Refer towebsiteforthemostupdatedinformation. IHC R abbit oylnl350 polyclonal 127 Pre-validated antibodies Misc. molecular tools 128 Pre-validated antibodies Misc. molecular tools Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A013VS nioy10µ 1 B H abtHM oylnl150 Polyclonal 150 Monoclonal 150 150 150 Polyclonal Polyclonal 150 HMk Polyclonal HMRMk Rabbit Mouse Polyclonal 150 WIHC HMRMk Polyclonal WIP Rabbit HMMk 100 µL(10 WB) 100 µL(10 150 R WB) Rabbit HM(R) Rabbit Rabbit Polyclonal W 150 150 WIC HMR 100 µL (10 WB) Polyclonal Rabbit Polyclonal W 100 µL(10 WB) W HMR(Hm) WIPIHC P (10µL 100 WB) 150 Rabbit Met(25H2)MousemAb 100 µL (10 WB) 100 µL(10 WB) VASP Antibody TA201114 Polyclonal HMR TA201113 HMk W Rabbit AuroraB/AIM1 Antibody 150 T 150 Rabbit Aurora A/AIK Antibody Monoclonal HMiMkMR 175 TA201111 100µL (10 WB) Polyclonal Rabbit C/EBPbeta(LAP) Antibody TA201110 WIC Monoclonal WIHC C/EBPbetaAntibody TA201109 100µL (10 WB) 100µL (10 WB) TA201108 WIC 300 PDK1 Antibody T HMR 100 µL(10 HMRMk WB) polyclonal Mouse TA201106 Rabbit 300 MAPKAPK-2 H Antibody T WIPIHCF Rabbit NF-kappaB p105/p50 Antibody polyclonal TA201104 100 µL(10 WB) 350 WIP TA201103 350 polyclonal T 100µL (10 WB) 350 300 W 150 NAK Antibody polyclonal T 300 polyclonal polyclonal p95/NBS1 Antibody 100 µL(10 WB) TA201100 Polyclonal Rabbit polyclonal SUV39H1HistoneMethyltransferase Antibody TA201099 Akt1(2H10) MousemAb TA201098 Rabbit 350 IHC TA201097 HMkMR 250 Akt2(5B5)Rabbit mAb T polyclonal Rabbit Rabbit 250 IHC TA201095 polyclonal Rabbit WIPIHCIC 1mg/ml 300 T Rabbit polyclonal Rabbit 100 µL(10 IHC WB) T polyclonal Rabbit 1mg/ml IHC T 200 200 IHC IHC 200 HistoneDeacetylase5(HDAC5) Antibody T IHC polyclonal 1mg/ml polyclonal Somatostatin Receptor Type 2 TA201012 polyclonal Rabbit 350 1mg/ml 200 350 TA200500 1mg/ml Rabbit 1mg/ml Somatostatin Receptor 350 Type polyclonal 1 T polyclonal polyclonal 200 Rabbit 1mg/ml GProtein-Coupled Receptor GPR19 IHC TA200498 polyclonal Rabbit polyclonal GProtein-Coupled Receptor GPR19 IHC TA200497 Price* C-CChemokineReceptor 9(CCR9) IHC TA200496 1mg/ml C-CChemokineReceptor 9(CCR9) IHC TA200495 Rabbit Rabbit Type Rabbit 1mg/ml PACAP Receptor Type 1 IHC,ICC, TA200494 W SpCross Reactivity 1mg/ml IHC, TA200493 W Rabbit Rabbit Host Rabbit 1mg/ml MetabotropicGlutamateReceptor 7 IHC T Application Rabbit 1mg/ml MetabotropicGlutamateReceptor 7 IHC,ICC TA200489 Rabbit 1mg/ml MetabotropicGlutamateReceptor 7 IHC TA200488 IHC IHC,ICC 1mg/ml MetabotropicGlutamateReceptor 4 TA200487 IHC Format 1mg/ml MetabotropicGlutamateReceptor 2 TA200486 1mg/ml MetabotropicGlutamateReceptor 2 1mg/ml TA200485 1mg/ml MetabotropicGlutamateReceptor 1 1mg/ml TA200484 GProtein-Coupled Receptor GPR17 TA200483 MetabotropicGlutamateReceptor 1 TA200482 C-CChemokineReceptor 7(CCR7) TA200481 Purinergic Receptor P2Y10 TA200476 Purinergic Receptor P2Y10 Description TA200479 TA200478 # Cat. 210 K nioy10µ 1 B PI abtHMPlcoa 150 Polyclonal 150 Polyclonal HM Rabbit HR Rabbit WIPIC 100 µL(10 WB) WIC 100 µL(10 WB) 150 Monoclonal PKR Antibody HMRHm A201107 Mouse LKB1 Antibody 150 A201105 IPIC Monoclonal 100 µL(10 WB) A20 A20 HMk Mouse 350 WIPIHC Akt(5G3)MousemAb polyclonal 100 µL(10 WB) A201096 A20 p21 Waf1/Cip1 (DCS60)MousemAb A20 A201092 A20 Rabbit IHC A20 1mg/ml GProtein-Coupled Receptor GPR18 A200492 A20 roduct of 11IFIRcpo lh nioy10µ 1 B PICI abtHMRPlcoa 150 Polyclonal 150 Polyclonal HMR Rabbit WIPIHCIC H M R 100µL (10 Rabbit WB) WIP 100 µL(10 WB) IGF-I Receptor alpha Antibody 1 1101 Akt2 Antibody 1094 1 1 1 0499 1 1 093 0 1 02 1 md nioy10µ 1 B PI abtHMRPlcoa 150 Polyclonal HMR Rabbit WIPIC 100 µL(10 WB) Smad2 Antibody 2 3 fering issubjecttoc NF S lh-ornAtbd 0 L(0W)WI abtHPlcoa 150 Polyclonal H Rabbit WIC 100 µL(10 WB) Smac/Diablo MousemAb Alpha-Fodrin Antibody omatostatin R -k pa 6 nioy10µ 1 B abtHMRPlcoa 150 Polyclonal HMR Rabbit W 100 µL(10 WB) appaB p65 Antibody hange. R eceptor T estricted availability to internationalcustomer ype 1 www.origene.com 0 L(0W)WI CMueHMncoa 150 Monoclonal H Mouse WIPIC 100 µL(10 WB) 1 gm H abtplcoa 300 polyclonal Rabbit IHC mg/ml s. Refer towebsiteforthemostupdatedinformation. Sp. CrossR A019BkAtbd 0 L(0W)WI CRbi kPlcoa 150 Polyclonal 150 Polyclonal 150 HMk Polyclonal Rabbit 150 150 WIPIC HMR Polyclonal HMkMR(X) Polyclonal Rabbit 150 Rabbit 100µL (10 WB) Polyclonal 150 WIPIHC 150 Polyclonal 100 µL(10 150 WB) W 150 HHm HRMk Polyclonal Polyclonal Rabbit 100 µL(10 WB) Polyclonal Rabbit HMkMR WIPEIHC 150 Rabbit 150 HMRMk WIPIC 150 Polyclonal 100 µL(10 WB) Rabbit P WIPIHC Polyclonal 100 µL(10 HMR(C) WB) Bak Antibody HMRMk Polyclonal 100 µL(10 HM Rabbit WB) Rabbit TA201159 Rabbit SHP-2 150 Antibody W T 150 HMRMk TA201157 Polyclonal 150 100µL (10 WB) W HM W Rabbit Pin1 Antibody T W HMR Polyclonal Rabbit Polyclonal 100 µL(10 WB) TA201155 100 µL(10 Rabbit WB) WIHCIC 100 µL(10 WB) GRB10 Antibody T WIPIC 100 µL(10 WB) 150 eEF2k Antibody TA201153 WIHC 100 µL(10 WB) HMRMk Mst1 Antibody HM TA201152 HMkMR Polyclonal 100 µL(10 WB) Rabbit Rabbit MyosinLightChain2 Antibody Rabbit TA201151 Nicastrin Antibody TA201150 150 WIHC WIHC WIC TA201149 Polyclonal Tuberin 150 Antibody T 100 µL(10 WB) 150 100 µL(10 WB) 100 µL(10 WB) BLNK Antibody HM TA201147 Polyclonal Polyclonal Rabbit 150 eIF4B Antibody TA201146 CD19 150 Antibody TA201145 Polyclonal 150 NPM Antibody WIP TA201144 150 Polyclonal 150 H Polyclonal TA201143 HMkMR 100 µL(10 WB) Polyclonal Rabbit Connexin43 Antibody HM Rabbit T Polyclonal Rabbit Cortactin Antibody TA201141 150 CrkII Antibody WIP WIHC 150 TA201140 M HMRHmMk Polyclonal HM 150 TA201139 WIP Rabbit Rabbit 100 Polyclonal µL(10 100 µL(10 WB) WB) Rabbit T H Polyclonal HMR 100 µL(10 WB) Rabbit T WIHC Rabbit WIP T WIP 150 100 µL(10 WB) c-Kit 150Antibody 100µL (10 HMRMk WB) WIPIC T HMR 100 µL(10 WB) Polyclonal Rabbit W HMRMk Rabbit Monoclonal TA201134 100 µL(10 WB) Rabbit 150 T 100 µL(10 WIPIHC WB) 150 Stathmin Antibody T Monoclonal WIHCIP 100 µL(10 WB) W ALK Antibody Polyclonal TA201131 Price* 100 µL(10 WB) Jak1 Antibody HRHm TA201130 150 100 µL(10 WB) Mouse 150 H Ras-GRF1 Antibody Type TA201129 Monoclonal Rabbit Cofilin Antibody TA201128 Polyclonal SpCross Reactivity Pyk2 Antibody TA201127 WIHCIC WF HMR H Host SGK Antibody Mouse TA201126 Application Rabbit 100 µL(10 100µL (10 WB) WB) Blk Antibody TA201125 HMR WIHCIC PAK4 WIPIC Antibody TA201124 Mouse Rabbit Gab1 Antibody W Format TA201123 100µL (10 WB) Etk Antibody TA201122 WIHCIC WIHC 100 µL(10 WB) AndrogenReceptor Antibody TA201121 100 µL(10 WB) 100µL (10 WB) CrkL(32H4)MousemAb TA201120 TA201119 Progesterone Receptor (6A1) PDGFReceptor beta Antibody TA201118 Ezrin/Radixin/Moesin Antibody TA201117 cdk6(DCS83)MousemAb Description TA201116 TA201115 # Cat. A20 150 A20 Polyclonal 275 H(M)(R) Monoclonal Rabbit A20 WIP 100 µL(10 WB) M(H) Rabbit A20 W FGFReceptor 1 Antibody 100 µL(10 WB) Phospho-FLT3 (Tyr589/591) (30D4)Rabbit mAb A201138 A201137 A20 A20 A20 A20 A20 roduct of 16G10Atbd 0 L(0W)WRbi kPlcoa 150 Polyclonal HMRMk Rabbit W 100 µL(10 WB) GP130 Antibody 1156 1 150 Polyclonal 1 HMiMkMR 150 Rabbit Polyclonal WIHCIC 100 µL(10 WB) HMRMiMk 1 Rabbit W 100µL (10 WB) CytokineReceptor Commonbeta-Chain Antibody Rad17 Antibody 1136 1135 1 1 18GKAtbd 0 L(0W)WI H CRbi kPlcoa 150 Polyclonal HMRMk Rabbit WIPIHCIC 100µL (10 WB) GCK Antibody 1158 5 G-eaRcpo nioy10µ 1 B H abtHM oylnl150 Polyclonal HMiR Rabbit WIHC 100 µL(10 WB) TGF-beta Receptor I Antibody 154 150 150 Polyclonal Polyclonal 1 HMRMk Rabbit HMRMk Rabbit WIP 1 100µL (10 WB) W 100 µL(10 WB) Erk5 Antibody CaMKII Antibody 133 132 48 42 fering issubjecttoc eacti rsnln1Atbd 0 L(0W)WI abtHRM M oylnl150 Polyclonal HRMk(M) Rabbit WIP µL (10 200 WB) Presenilin 1 Antibody Btk Monoclonal Antibody vity K Antibody ey: H=HumanM=Mouse Mi=MinkMk=Monk hange. R estricted availability to international customers. Referestricted availability to internationalcustomers. website forthemostupdatedinformation. h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: ey R=Rat C=Chicken Hm=HamsterX=Xenopus Z=ZebraFish 0 L(0W)WRbi oylnl150 Polyclonal HM Rabbit W 100 µL(10 WB) 129 Pre-validated antibodies Misc. molecular tools 130 Pre-validated antibodies Misc. molecular tools Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A025HK nioy10µ 1 B PRbi oylnl150 Polyclonal 150 150 Polyclonal 150 Polyclonal Polyclonal HM HMRHmMk Rabbit 150 Rabbit Polyclonal HMR WIP 150 150 Rabbit W H 100 µL(10 WB) Polyclonal Polyclonal Rabbit 100 µL(10 WB) WIP MR 100µL (10 WB) Rabbit 150 150 W HMR(X) HMRMk 150 Rabbit Polyclonal Rabbit Polyclonal 100 µL(10 WB) Polyclonal W WIHC 150 P 150 WIP HPK1 Antibody 150 100 µL(10 WB) 100 µL(10 WB) Polyclonal Polyclonal Ran Antibody TA201205 100 µL (10 WB) Polyclonal HMR HMk 150 TA201204 Rabbit Rabbit A-Raf HM Antibody T Polyclonal Rabbit p44 MAPKinase(Erk1) Antibody TA201202 HMRMk HMRMk WIHC IRAK Antibody Rabbit TA201201 R(H)(M) Rabbit W ATP-Citrate Lyase Rabbit Antibody 100 µL(10 WIP TA201200 WB) 150 100 µL(10 WB) TA201199 WIP 100 µL(10 WB) WIP M(H) Myt1 Antibody 150 T WIP Polyclonal Rabbit 100 µL(10 WB) 100µL (10 WB) TA201197 Polyclonal 100 µL(10 WB) PI3Kinasep110 alpha Antibody T WIPIC 150 PI3Kinasep110 gamma Antibody TA201195 100 µL(10 WB) Polyclonal TA201194 H(M) T 150 Rabbit HMR CDCP1 Antibody T 150 Rabbit Polyclonal AMPKbeta1 Antibody TA201191 WIHCF 150 M(H)(R) Polyclonal 150 MKK7 Antibody TA201190 Rabbit 150 100 µL(10 Polyclonal WB) WIP EGR1 150 Antibody TA201189 HMRHmMk Polyclonal 150 150 Polyclonal Rabbit TA201188 100 µL(10 HMRMk(C)(Hm)(X)(Z) Polyclonal WB) HMRHmMk Polyclonal Polyclonal ROR2 Antibody Rabbit T W Rabbit 150 TA201186 HMRMk WIP 100 µL(10 HMkMR WB) Polyclonal Rabbit T WIHC Rabbit 100µL (10 WB) W T 150 150 150 100 µL(10 WB) WIPIHC T 100 µL(10 WIP HM WB) H Polyclonal Polyclonal Polyclonal TCL1 Antibody H T 150 Rabbit Rabbit 100 µL(10 WB) 100 µL(10 WB) Rabbit CaMKIV Antibody HMR TA201181 150 150 Polyclonal WIPIHC Rabbit TA201180 150 Polyclonal Polyclonal Troponin 150 I Antibody W T 100 µL(10 HMRMk WB) HM(R) W WFIC GProtein alphaSubunit Antibody Polyclonal Rabbit TA201178 Polyclonal Rabbit 100µL (10 WB) HMkR(M) H GRK2 Antibody TA201177 100 µL(10 WB) 100µL (10 WB) Price* Rabbit Rabbit GRB2 Antibody WIHC TA201176 HMkMR WIP Ras Antibody HMR TA201175 Rabbit Type 100 µL(10 HMkMR WB) WIHC R-Ras Rabbit Antibody TA201174 100 µL(10 WB) Rabbit W SpCross Reactivity HMR 100 µL(10 TA201173 WB) Rabbit WIP Host IGFBP-2 100 µL(10 Antibody WB) T WIP Application p56Dok-2 100 µL(10Antibody WB) TA201171 W 100 µL(10 WB) p62Dok Antibody TA201170 W 100 µL(10 WB) Bcr Antibody TA201169 Format 100 µL(10 WB) PLCgamma2 Antibody TA201168 ILK1 Antibody TA201167 MMP-9 Antibody TA201166 LIMK2 Antibody TA201165 LIMK1 Antibody TA201164 PLD1 Antibody TA201163 Mst4 Antibody TA201162 LSP1 Antibody Description TA201161 TA201160 # Cat. 219 I iaep5Atbd 0 L(0W)WRbi oylnl150 Polyclonal 150 Polyclonal HMR Rabbit HMRMk Rabbit W 100 µL(10 WB) WIHC 100 µL(10 WB) 150 150 Monoclonal Polyclonal PI3Kinasep85 Antibody A201198 Cytochrome c Antibody HM(Hm) HMkMR A201196 Mouse Rabbit WICF A20 W 100 µL(10 WB) A20 100 µL(10 WB) 150 Polyclonal CyclinB1(V152) MousemAb A201187 HMkMR A20 Rabbit Mst3b Antibody A20 A201183 A20 WIP 100 µL(10 WB) A20 Mst2 Antibody A201172 A20 roduct of 12Te A3)Muemb10µ 1 B PMueHMncoa 150 Monoclonal 150 H Polyclonal Mouse WIP 100 µL(10 WB) M(H) Rabbit W 100 µL(10 WB) (AB33)MousemAb Tie2 1 1192 ROR1 Antibody 1185 1 1 1 1 1 1 1 1 203 93 84 8 79 2 fering issubjecttoc Apaf-1 150 Polyclonal HMRMk Rabbit BCL6 W 100 µL(10 WB) PDE5 Antibody Akt3 MMP nioy10µ 1 B PRbi oylnl150 Polyclonal HMR Rabbit WIP 100 µL(10 WB) Antibody - Antibody 2 nioy10µ 1 B abtHMRM oylnl150 Polyclonal HMRMk Rabbit W 100 µL(10 WB) Antibody Antibody hange. R estricted availability to internationalcustomer www.origene.com 0 L(0W)WRbi R oylnl150 Polyclonal HM(R) Rabbit W 100 µL(10 WB) 0 L(0W)WRbi oylnl150 Polyclonal H Rabbit W 100 µL(10 WB) s. Refer towebsiteforthemostupdatedinformation. A021Sa1Atbd 0 L(0W)WI abtHMRPlcoa 150 Polyclonal 175 150 HMR Monoclonal Polyclonal 150 Rabbit 150 Polyclonal Polyclonal 150 WIPF 150 150 HMRMk Polyclonal HMRMk 100 µL(10 Monoclonal WB) Rabbit Polyclonal Rabbit HMRMk WIPIHC HMR Rabbit WIP Rabbit 100 µL (10 WB) HMRMk WIPIHCICF HMR Mouse 100 µL(10 WB) Rabbit WIP HMR WIPIHCFIC 100 µL(10 WB) 150 Rabbit 100 150 µL(10 WB) 100 µL (10 WB) 150 Polyclonal WF Stat1 Antibody Polyclonal 150 Polyclonal c-Jun (60A8)Rabbit mAb TA201251 W 100 µL(10 150 WB) Polyclonal TA201250 100 µL(10 Polyclonal WB) HMRMk(C)(Z) 150 SEK1/MKK4 Antibody HMRMk T Rabbit HMRMk Rabbit Stat3(124H6) MousemAb TA201248 Polyclonal Rabbit Stat3 Antibody TA201247 WIHC MR(H) WIHC MEK2 Antibody TA201246 M(H)(R) 150 Rabbit WIHC HM(R)(C)(X) 100 µL(10 WB) 150 Rabbit TA201245 100 µL(10 WB) Rabbit Polyclonal MEK1/2 Antibody 100 µL(10 WB) T WIPIHCF WIPF Polyclonal TA201243 100 µL(10 WB) 100 µL(10 WB) cdc2 Antibody T W 150 p42MAPKinase(Erk2) Antibody TA201241 150 100 µL(10 Polyclonal WB) HMR TA201240 150 Polyclonal HMR 150 Rabbit T Rabbit Polyclonal HSP90 Antibody 150 Polyclonal T HSP70 Antibody WIP TA201237 HMRMk Polyclonal PCTAIRE 1 Antibody 150 TA201236 Rabbit W 100 µL(10 WB) 150 HMR Cox2 Antibody TA201235 Polyclonal 150 HMRMk Rabbit HM(R) Monoclonal 100µL (10 WB) 150 TA201234 Rabbit Rabbit H(M)(Mk) SMC1 Antibody Polyclonal W T 150 Polyclonal Rabbit WIPIHC TA201232 100 µL(10 W WB) Polyclonal T W 100 µL(10 WB) 150 100 µL(10 WIC WB) T HM 150 150 100 µL(10 WB) H Rabbit T Polyclonal 100 µL(10 150 WB) HMR Mouse Polyclonal Max Antibody Polyclonal T H Rabbit 150 Polyclonal Pim-1 Antibody HMR Rabbit TA201227 150 W Rabbit Polyclonal TA201226 WF 150 WIPF HMRMk Integrinbeta3 Antibody T Polyclonal 100µL (10 WB) Rabbit 100 µL(10 WB) Polyclonal HR(M) WIHC 100 µL(10 W HMMk Bmf WB) Antibody TA201224 Rabbit Rabbit Mad-1 Antibody WIHCIC HMR TA201223 100 µL(10 100 µL(10 WB) WB) Price* Rabbit JNK2 Antibody TA201222 WIPIHC 100 µL(10 WB) HMRMk p73 Antibody 150 TA201221 H Type R(H)(M) W Rabbit 100µL (10 WB) Cyclin A (BF683)MousemAb Rabbit Monoclonal TA201220 WIP Rabbit SpCross Reactivity 100 µL(10 WB) WIPIHC TA201219 100 Host µL(10 WB) A1/Bfl-1 Antibody T WIC 100 µL(10 Application WB) CTMP Antibody W TA201217 HRMi(M) 100 µL(10 WB) DNA-PK Antibody TA201216 Mouse 100 µL(10 WB) Bik Antibody TA201215 Format Bim Antibody TA201214 WIP TFII-I Antibody TA201213 MAP2 Antibody 100 µL(10 WB) TA201212 Daxx Antibody TA201211 Bok Antibody TA201210 IRS-2 Antibody TA201209 Tpl2 Antibody TA201208 PTPmu(BK2)MousemAb Description TA201207 TA201206 # Cat. Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish P 214 E1Atbd 0 L(0W)WRbi kPlcoa 150 Polyclonal HMRMk 150 Rabbit Monoclonal W 100 µL(10 WB) HMk Mouse 150 WIPIHCIC Polyclonal 100 µL(10 WB) 150 Polyclonal MEK1 Antibody HMR Rabbit A201244 cdc2 (POH1)MousemAb HMRMk A201242 WF Rabbit 100 µL(10 WB) WIP A20 A20 100 µL(10 WB) 150 Polyclonal p15 INK4B Antibody A201233 A20 VHR Antibody HMR A20 Rabbit A201229 WIPIHCIC A20 100 µL(10 WB) A20 AIF Antibody A201218 A20 roduct of 28p44 A iaeAtbd 0 L(0W)WICFRbi mZPlcoa 150 Polyclonal 150 HMRHmZ Rabbit Polyclonal WIHCF µL(20 200 WB) HMR Rabbit WIPF p44/42MAPKinase Antibody 1 100 µL(101238 WB) PKAC-alpha Antibody 1231 1 1 1 1 249 239 230 228 225 fering issubjecttoc p42 MAPKinase(3A7)MousemAb Filamin R TRAF2 c-J KIP nAtbd 0 L(0W)WRbi oylnl150 Polyclonal HMR Rabbit W 100 µL(10 WB) un Antibody Antibody Antibody A nioy10µ 1 B PRbi kPlcoa 150 Polyclonal HMRMk Rabbit WIP 100 µL(10 WB) Antibody hange. R estricted availability to internationalcustomer h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: 1 150 Polyclonal HMRMk Rabbit W 100 µL(10 WB) 1 0 0 0 0 L(0W)WICFMueHMRH oolnl150 Monoclonal HMRHm Mouse WIHCF µL (10 WB) 150 Polyclonal HMR Rabbit W µL (10 WB) s. Refer towebsiteforthemostupdatedinformation. 131 Pre-validated antibodies Misc. molecular tools 132 Pre-validated antibodies Misc. molecular tools Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish A027PoTFapaAtbd 0 L(0W)WRbi R oylnl150 150 Polyclonal Monoclonal 150 Polyclonal 150 HM(R) Polyclonal Rabbit 150 150 H H(M)(R) Polyclonal Polyclonal 150 Mouse Rabbit W 150 Polyclonal HMR 150 Monoclonal 100µL (10 WB) Rabbit W WIPIHCICF W Polyclonal HMRMk Rabbit HMR 100 µL(10 100 µL(10 WB) WB) 100 µL(10 WB) HMRHmMk Rabbit WIPIHC Mouse H HMRMk 100 µL(10 WB) 150 WIHC WIPIHC P Rabbit Rabbit Pro-TGF-alpha Antibody 150 Polyclonal 100 µL(10 100µLWB) (10 WB) Caspase-3(3G2)MousemAb TA201297 150 WIHC Polyclonal 150 150 TA201296 W Polyclonal Caspase-3 Antibody 100 µL(10 T WB) Polyclonal Polyclonal eNOS Antibody 100 µL(10 TA201294 WB) Beta-Catenin Antibody TA201293 PTEN(26H9)MousemAb R HMR TA201292 Rabbit Rabbit TA201291 HMR PARP M Antibody T Rabbit H Rabbit WIC TA201289 WF Rabbit 150 cdc25C Antibody T WIHC 100 µL(10 WB) 100 µL(10 WB) WIHC 150 150 Smad5 Antibody TA201287 Polyclonal 150 100 µL(10 WB) WF TA201286 Polyclonal 100 µL(10 Polyclonal WB) Polyclonal 150 T 100 µL(10 WB) Caspase-9 Antibody (Rat Specific) HMRMk(C) Polyclonal T Rabbit Caspase-9 Antibody (MouseSpecific) HMR(X)(Z) TA201283 150 Rabbit Caspase-9 Antibody (HumanSpecific) TA201282 HMRMk HRMk Polyclonal 150 Caspase-7 Antibody Rabbit HMRCHm TA201281 Rabbit 175 WIHCIC W Rabbit WIPIHCIC 150 TA201280 Polyclonal Monoclonal 100 µL(10 WB) FKHR Antibody WIPIC T 100 µL (10 WB) 100 µL(10 Polyclonal WB) WIPF TA201278 100 µL(10 WB) HMRZ 150 T HMRMiMk 100 µL(10 WB) Rabbit HMRMk Rabbit Polyclonal T Rabbit 150 T WICF 175 HMR Monoclonal RSK1/RSK2/RSK3 Antibody T WIP Monoclonal Rabbit 100 µL(10 WB) GSK-3beta Antibody TA201273 W 150 100 µL(10 WB) TA201272 HMR 150 150 150 150 100µL (10 Bad Antibody WB) Polyclonal HRMk(M) T Rabbit 150 W Monoclonal Polyclonal Mouse p53 Antibody 150 Polyclonal HMRMk Polyclonal WIPIHCIC TA201270 Polyclonal Rabbit 100 µL(10 Akt WB) Antibody TA201269 Polyclonal WIPIHC 100 µL(10 Price* WB) SAPK/JNK (56G8)Rabbit mAb TA201268 WIPIHC HMRMk 150 100µL (10 WB) SAPK/JNK Antibody TA201267 Rabbit Type HMRMk Monoclonal 100 µL (10 HMR WB) IkappaB-epsilon Antibody HMR TA201266 Rabbit HMR HMRC SpCross Reactivity Mouse WIPIHC HMRMk Rabbit TA201265 Rabbit Rabbit Host Rabbit (112B2) IkappaB-alpha MousemAb T 100µL (10 WB) WIPIHCIC Application WIPF WIHCF WIP IkappaB-alpha Antibody WIPICF TA201263 WIHC 100 µL(10 WB) MKK3 Antibody 100 100 µL(10µL (10 WB) WB) 100 µL(10 TA201262 WB) HM 100 µL(10 WB) 100 µL(10 WB) ATF-2 (20F1)Rabbit mAb TA201261 Mouse Format p38MAPKinasealpha Antibody WIPIHCIC TA201260 p38MAPKinase(5F11) MousemAb TA201259 100 µL(10 WB) p38MAPKinasedelta Antibody TA201258 p38MAPKinase Antibody TA201257 p70S6Kinase Antibody TA201256 CREB Antibody TA201255 Elk-1 Antibody TA201254 Stat1(9H2)MousemAb Description TA201253 TA201252 # Cat. 219 TNAtbd 0 L(0W)WI abtHMRH kPlcoa 150 Polyclonal 150 Polyclonal HMRHmMk Rabbit HMkMR WIP Rabbit 100µL (10 150 WB) WIHC Polyclonal 100 µL(10 WB) 150 HMR Polyclonal Rabbit PTEN Antibody A201290 cdc25B Antibody W HMR A201288 100 µL(10 WB) Rabbit A20 WIP A20 100 µL(10 WB) 150 AFX Antibody Polyclonal A201279 A20 Stat6 Antibody A20 HMR A201275 Rabbit A20 WIHC A20 100µL (10 WB) beta IkappaB Antibody A201264 A20 roduct of 24Sa1Atbd 0 L(0W)WRbi kPlcoa 150 Polyclonal HMk Rabbit W 150 100 µL(10 WB) Polyclonal HMRMk Rabbit WIPIHCIC Smad1 Antibody 100 µL(10 WB) 1 1284 4E-BP1 Antibody 1277 1 1 1 1 295 285 27 27 271 4 6 fering issubjecttoc Smad4 Stat5 Rb (4H1)MousemAb Caspase-3 (8G1 -y nioy10µ 1 B PI abtHMRPlcoa 150 Polyclonal HMR Rabbit WIPIC 100 µL(10 WB) c-Myc Antibody nioy10µ 1 B PRbi oylnl150 Polyclonal HM Rabbit WIP 100 µL(10 WB) Antibody Antibody hange. R )Rbi oolnlAtbd 0 L(0W)WI CRbi oolnl175 Monoclonal HMR Rabbit WIP IC 100 µL (10 WB) 0) Rabbit Monoclonal Antibody estricted availability to internationalcustomer www.origene.com 1 1 0µ 1 B abtHMRM oylnl150 Polyclonal HMRMk Rabbit W µL(1000 WB) 0 0 L(0W)WI H CMueHRM oolnl150 Monoclonal HRMk Mouse WIPIHCIC µL (10 WB) s. Refer towebsiteforthemostupdatedinformation. Sp. Cross Reactivity Key: H=Human M=Mouse Mi=Mink Mk=Monkey R=RatSp. CrossReactivity Key: H=HumanM=Mouse Mi=MinkMk=Monkey C=Chicken Hm=HamsterX=XenopusZ=ZebraFish P 150 150 Polyclonal Polyclonal 150 150 Polyclonal HMRMk 150 Polyclonal 195 Rabbit 150 Monoclonal Polyclonal HMR Polyclonal Rabbit Price* W HMR HMRZ Type Rabbit Rabbit 100 µL(10 WB) W SpCross Reactivity HMR WIHC H Host H 100 µL(10 WB) WIP Rabbit Mouse Application Rabbit 100 µL(10 WB) 100 µL(10 WB) WIPF WIP W Format 100µL (10 WB) 100µL (10 WB) 100 µL(10 WB) MEF2C Antibody Caspase-6 Antibody TA201304 Caspase-10 Antibody TA201303 Caspase-8(1C12) MousemAb TA201302 eIF4E Antibody TA201301 DFF45/DFF35 Antibody TA201300 eIF2alpha Antibody Description TA201299 TA201298 # Cat. roduct of fering issubjecttoc hange. R estricted availability to internationalcustomer h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: s. Refer towebsiteforthemostupdatedinformation. 133 Pre-validated antibodies Misc. molecular tools 134 Protein collections Misc. molecular tools Enzymatic Assays: samples aremadeaccessible throughthiswebsite. transcript repository. These high-qualityprotein pro OriGene haspartnered withquality,protein human necessary toproduceandtesttheactualprotein. sequence, inordertotestcellularfunction,itis required informationtoblueprinttheprotein Whereas ahumangenetranscriptsuppliesthe Product Application GeneFamily • Keywords • Protein Domain • • NucleotideSequence, Protein Sequence • searc On ourwebsite,theproteinspro interest beplacedontheprioritylist. encouraged toemailandrequestthattheirproteinof are customer's bulkproteinneeds.Customers proteins everydayforourcatalogandtoaddress protein producer, preparingfunctional isactively OriGene, throughitspartnership withanexpert transcription andcancerrelatedproteins. and baculoviral systemsandhasproducedover 100 OriGene's manufacturerprimarilyutilizes bacterial different systemsthathavebeenwellcharacterized. can beoverexpressed inandpurifiedfromseveral andoncology.ceptors proteins Functionally active mostly associatedwithtranscription,nuclearre- f purified recombinantproteinsforscientisttoper- The OriGeneProtein Collection containsover 100 Introduction Protein collections catalyz orm protein-basedapplications. The proteinsare Accession orCatalogNumber vider hed bythefollowingcriteria, e s reactions ofinterest insearch ofsubstrate who deri Protein enzymescanbeusedto ve valuefromOriGeneslarge vided canbe www .or ig ene.com reporter geneassays. regulation canbeassessedthroughoff-the-shelf second messenger of specialized assaysmeasuringfluctuationsin cellular functionoftheseproteinsthroughavariety binding assays,theresearcher canuncover the Functional Studies: Western BlotsandSDS-PAGE: Protein BindingStudies: tograph These stepsinvolve useofconventional chroma- decided basedonprotein structureandproper proteins withauniqueprotein tag),whic purification (requiredtofurther purifyrecombinant function(s). tags thatdonotinterferewiththeprotein new plasmidscontainingoneormoreoftheprotein purification. Initialsynthesisinvolves thecreationof proteins tonearhomogeneityuponinitial histidine, FLAG ormyc, toincreasepurityofthe revolves aroundutilizing proteintagsincluding6- related proteins. The proteinpurificationstrategy proteins withafocusontranscriptionandcancer bacterial andbaculo from through OriGeneareprimarilyderived have beenwellc and purifiedfromseveraldifferent systemsthat Functionally proteinsareover expressedin active Quality Control for thispurpose. The proteinsavailablethroughOriGenearesuitable best identifiedthroughtheuseofapurifiedprotein. proteins rateofmigration(Mr)throughSDS-PAGE is analysis, andvarioustypesofaffinity chromatography. p interactions. This typeofstudyistraditionally todetermineitsbiologicallyrelevant protein iskey protein kinasestotesttheirphosphorylationactivity. enzymes activity. OriGeneprovides many quality andinhibitionofthe to assessbothactivation specificity. The researcher canalsousesuch assays erformed throughgel-shift assays,ELISA plate y, fast performanceliquidchromatography This isfollowedbyasecondstepof s haracteriz calcium orcamp. In additiontoenzymaticor viral systemstoproduce Having aproperlyfolded ed. P The identificationofa roteins pro T ranscriptional h will be vided ty . P004N_025EF1 RA-)TasrpinFco 50 Tewl yeEF1(eiu -3)wsepesdi 310 ThewildtypeE2F-1 (residue1-437) was expressedin 5000 Product offering issubjecttochange. See ourwebsite forthemostupdatedinformation. E2F-1, (RBAP-1) Transcription Factor 204 TP20 NM_005225 Recombinant PPAR isisolatedfromanEcolistrain 10000 TP200014 237 PPAR beta(delta)(Peroxisome proliferator- TP20 Recombinant FGF1was expressedinabaculovirus 5000 NM_006238 TP200012 FGF-1 (acidicfibroblastgrowthfactor) TP20 NM_000800 TP200010 534 TP20 Thewildtypehuman VHL protein(213 aminoacids) 12500 268 VHLvon Hippel-Lindautumorsuppressor TP20 Thewildtypehuman VHL protein(213 aminoacids) 5000 620 NM_000551 VHLvon Hippel-Lindautumorsuppressor TP200007 ThewildtypehumanCTF1protein(499aminoacids) 310 12500 CTF1CCAAT-Box-Binding Transcription Factor NM_000551 ThewildtypehumanCTF1protein(499aminoacids) 5000 TP200006 CTF1CCAAT-Box-Binding Transcription Factor Recombinant humanRPB5isisolatedfromanEcoli X12492 25000 205 TP200005 Recombinant humanRPB5isisolatedfromanEcoli X12492 10000 RNApolII-hRPB5(RNApolymeraseII, TP200004 NM_032940 RNApolII-hRPB5(RNApolymeraseII, TP200003 NM_032940 TP200002 C Product Listing proteins. QualityismonitoredbySDS-PAGE. (HPLC) basedtechniques toachieve highlypurified (FPLC) and/orhigh-pressureliquidchromatography t cnDsrpinUi orePrice* Source Unit Description Accn # at. 03N_028PA eadla Prxsm rlfrtr 50 RcmiatPA sioae rma oisri 407 Recombinant PPAR isisolatedfromanEcolistrain 25000 PPAR beta(delta)(Peroxisome proliferator- NM_006238 410 0013 IsolatedfromanEcolistrainthatcarries thecoding 25000 0 TFIIB(Transcription Factor IIB) NM_001514 0009 0 0 1 M052 2-,(BP1 rncito atr 20 Tewl yeEF1(eiu -3)wsepesdi 620 ThewildtypeE2F-1 (residue1-437) was expressedin 12500 E2F-1, (RBAP-1) Transcription Factor NM_005225 015 1 M000 G- aii bols rwhfco)150 eobnn G1wsepesdi auoiu 473 Recombinant FGF1was expressedinabaculovirus 12500 FGF-1 (acidicfibroblastgrowthfactor) NM_000800 011 0 08 NM_0 0 1 51 FI TasrpinFco I)100 sltdfo nEcl tanta are h oig 205 Isolated fromanEcolistrainthatcarries thecoding 10000 TFIIB(Transcription Factor IIB) 4 n bmdao baculovirus incombinationofan systemand purified baculovirus systemand purified incombinationofan thatcarries thecodingsequenceofhumanPPAR and Rb-mediator thatcarries thecodingsequenceofhumanPPAR and Rb-mediator receptor,activated betaisotype) receptor,activated betaisotype) protein (R strainthatcarries thecodingsequenceofhuman protein (R strainthatcarries thecodingsequenceofhuman 1 1 p33 subunit) p33 subunit) RcmiatPoenfo netCls was expressedinbaculovirus systemandpurifiedby was expressedinbaculovirus systemandpurifiedby (Recombinant Protein fromInsectCells) (Recombinant Protein fromInsectCells) h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: ecombinant P was expressedinbaculovirus systemandpurified ecombinant Protein fromInsectCells) rotein fromInsectCells) RNase activity. and containnodetectableprotease,DNase, Proteins arepurifiedgreater than95%homogeneous af affinity columnandFPLCchromatography. beta underthecontrolofa beta underthecontrolofa T7 promoter. combination withFPLCchromatography. system andpurifiedbyanaffinity columnin promoter (5). sequence forhuman under non-denaturingcondition. using anaf w using anaf using anaf 410 using anaf RPB5 underthecontrolofa T7 promoter. RPB5 underthecontrolofa T7 promoter. combination withFPLCc system andpurifiedbyanaffinity columnin promoter (5). sequence forhuman under non-denaturingcondition. as expressedinbaculo fi nity columnandFPLCc finity columnandFPLCchromatography fi fi fi nity columnandFPLCc nity columnandFPLCc nity columnandFPLCc TFIIB underthecontrolof T7 TFIIB underthecontrolof virus systemandpurifi hromatograph hromatograph T7 promoter hromatograph hromatograph hromatograph y . . y . T7 ed y y y . . 135 Protein collections Misc. molecular tools 136 Protein collections Misc. molecular tools P000N_094AFS2 SR1o R3afo oi 100 h ua S/F idtp rti rsde-4) 215 Thehuman ASF/SF2 wildtypeprotein(residue1-248) 10000 Product offering issubjecttochange. See ourwebsite forthemostupdatedinformation. 407 ASF/SF2, (SFRS1orSRp30afromEColi) Recombinant LXRisisolatedfromanEcolistrainthat 25000 204 NM_006924 LXR-beta(Liver-X Receptor, betaisoform) Recombinant LXRisisolatedfromanEcolistrainthat 10000 TP200030 310 NM_007121 LXR-beta(Liver-X Receptor, betaisoform) ThewildtypeBRCA1(1-1863 residues)isexpressedin TP200029 2000 NM_007121 TP200028 BRCA1, Tumor SuppressorProtein TP20 NM_007296 TP200026 205 p55subunitof TP20 TFIIA isisolatedformastrainofEcoli 10000 TFIIA(Transription Factor IIA,reconstituted) 515 Price* NM_004492 TP200024 Recombinant p52protein(wildtype,333amino 25000 258 TP20 Recombinant p52protein(wildtype,333amino TP20 10000 p52, Transcriptional Coactivator NM_021144 473 TP200021 Source p52, Transcriptional Coactivator Unit Recombinant RXRbetaisexpressedinbaculovirus 237 258 Recombinant c-myc was 12500 expressedinabacterial 12500 NM_021144 RXRbeta(Retinoid XReceptor, betaisoform) Recombinant RXRbetaisexpressedinbaculovirus TP200020 Recombinant c-myc was expressedinabacterial 5000 5000 NM_021976 RXRbeta(Retinoid XReceptor, betaisoform) TP200019 NM_021976 c-Myc(protooncogene) TP200018 Description NM_002467 c-Myc(protooncogene) TP200017 NM_002467 Accn TP200016 # Cat. 07N_026BC1 uo upesrPoen 00 h idtp RA 116 eius sepesdi 620 ThewildtypeBRCA1(1-1863 residues)isexpressedin 5000 BRCA1, Tumor SuppressorProtein NM_007296 0027 0 410 205 p55subunitof TFIIA isisolatedformastrainof 25000 TFIIA-p55(Transription Factor IIA,p55subunit) p55subunitof TFIIA isisolatedformastrainof 10000 NM_015859 TFIIA-p55 (Transription Factor IIA,p55subunit) 0023 NM_015859 0022 025 NM_0 49 FI Tasito atrIA eosiue)200 5 uui fTIAi sltdfr tano oi 410 p55subunitof TFIIA isisolatedformastrainof Ecoli 25000 TFIIA(Transription Factor IIA,reconstituted) 04492 r-RASlcn atrwas byanaffinity expressed in EColiandpurified Pre-mRNA SplicingFactor baculovirus system andpurifiedbyanaffinity column baculovirus system andpurifiedbyanaffinity column and Transcription Factor and Transcription Factor www .or ig ene.com TFIIA gsubunitunderthecontrolof T7 promoter. that containsthecodingsequenceforhuman p12 subunitof TFIIA isisolatedfromastrainofEcoli column. under thecontrolofa carries thecodingsequenceofhumanLXRbeta under thecontrolofa T7 promoter. carries thecodingsequenceofhumanLXRbeta in combinationwithFPLCc in combinationwithFPLCchromatography. p55 of that containsthecodingsequenceofhuman E E of anaf of bythecombination T7 promoterandpurified the codingsequenceofhumanp52undercontrol acids) isisolatedfromanEcolistrainthatcarries an affinity columnandFPLCchromatography. of bythecombinationof T7 promoterandpurified the codingsequenceofhumanp52undercontrol acids) isisolatedfromanEcolistrainthatcarries combination withFPLCchromatography. 515 system andpurifiedbyanaffinity columnin combination withFPLCchromatography. system andpurifiedbyanaffinity columnin combination withFPLCchromatography s combination withFPLCchromatography system andpurifiedbyanaffinity columnin p55 of TFIIA underthecontrolof T7 promoter(3). that containsthecodingsequenceofhuman p55 of p55 of TFIIA w TFIIA gsubunitunderthecontrolof T7 promoter. that containsthecodingsequenceforhuman TFIIA was reconstitutedasdescribedin(5). p1 ystem andpurifiedbyanaffinity columnin coli thatcontainsthecodingsequenceofhuman coli thatcontainsthecodingsequenceofhuman 2 subunit of TFIIA isisolatedfromastrainofEcoli TFIIA underthecontrolof TFIIA underthecontrolof TFIIA underthecontrolof as reconstituteddescribedin(5). finity columnandFPLCchromatography. T7 promoter hromatograph T7 promoter(3). T7 promoter(3). T7 promoter(3). . y . P005N_063LRLD(ie- eetr iadbnig 50 RcmiatLRLDi sltdfo nEcl 389 Recombinant LXR-LBDisisolatedfromanEcoli 25000 Product offering issubjecttochange. See ourwebsite forthemostupdatedinformation. LXR-LBD(Liver-X Receptor, ligand binding 407 NM_005693 Recombinant LXRisisolatedfromanEcolistrain TP200045 25000 410 LXR-alpha(Liver-X Receptor, alphaisoform) TP20 Recombinant p14.5 isisolatedfromanEcolistrain NM_005693 25000 TP200043 RNApolII-hRPB9(RNApolymeraseII, TP20 NM_006233 TP200041 TP20 205 Recombinant PC4protein(serine127 mutations, 10000 TP20 PC4-mt(Positive Cofactor4,serinemutations) NM_006713 TP200038 Price* 410 TP20 Recombinant PC4protein(wildtype,127 amino 25000 205 TP20 PC4(Positive Cofactor4,wildtype) Recombinant PC4protein(wildtype,127 amino 10000 NM_006713 Source Unit TP200035 PC4(Positive Cofactor4,wildtype) 620 Thehuman ASF/SF2 wildtypeprotein(residue1-248) NM_006713 12500 310 ASF/SF2, (SFRS1orSRp30afromBaculovirus) TP200034 429 Thehuman ASF/SF2 wildtypeprotein(residue1-248) NM_006924 5000 Thehuman ASF/SF2 wildtypeprotein(residue1-248) ASF/SF2, (SFRS1orSRp30afromBaculovirus) TP200033 25000 Description NM_006924 ASF/SF2, (SFRS1orSRp30afromEColi) TP200032 NM_006924 Accn TP200031 # Cat. 0 0 0 0 205 Recombinant PC4protein(mutantF77P, 127 amino 10000 0 PC4-mt(Positive Cofactor4,F77Pmutant) NM_006713 0036 044 042 040 039 037 NM_0 NM_0 NM_0 NM_0 410 Recombinant PC4protein(mutantF77P, 127 amino 25000 PC4-mt(Positive Cofactor4,F77Pmutant) NM_006713 05693 05693 06233 0671 3 rncitoa ociao aminoacids)isisolatedfromanEcolistrainthat 410 Recombinant PC4protein(serinemutations,127 25000 Transcriptional Coactivator PC4-mt (Positive Cofactor4,serinemutations) oan strainthatcarries thecodingsequenceofhuman domain) thatcarries thecodingsequenceofhumanRPB9 p14.5 subunit) aminoacids)isisolatedfromanEcolistrainthat Transcriptional Coactivator acids)isisolatedfromanEcolistrainthatcarries the Transcriptional Coactivator was expressedinbaculovirus systemandpurifiedby was byanaffinity expressedinEColiandpurified Pre-mRNA SplicingFactor P Pre-mRNA SplicingFactor domain) LXR-LBD (Li LXR- alpha(Li p1 RNA polII-hRPB9(RNApolymeraseII, rncitoa ociao acids)isisolated fromanEcolistrainthatcarries the Transcriptional Coactivator rncitoa ociao acids)isisolatedfromanEcolistrainthatcarries the acids)isisolated fromanEcolistrainthatcarries the Transcriptional Coactivator Transcriptional Coactivator emN piigFco was expressedinbaculovirus systemandpurifiedby re-mRNA SplicingFactor 4.5 subunit) h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: ver ver XRcpo,lgn idn 100 eobnn X-B sioae rma oi 195 Recombinant fromanEcoli LXR-LBDisisolated 10000 -X Receptor, ligand binding XRcpo,apaioom 00 RcmiatLRi sltdfo nEcl tan 204 Recombinant LXRisisolatedfromanEcolistrain 10000 -X Receptor, alpha isoform) 00 Rcmiatp45i sltdfo nEcl tan 205 Recombinant p14.5 isisolatedfromanEcolistrain 10000 chromatography. control of carries thecodingsequenceofhuman PC4underthe alpha underthecontrolofa that carries thecodingsequenceofhumanLXR under thecontrolofa chromatography. control of T7 promoterandpurifiedbyconventional car c T7 promoterandpurifiedbyconventional coding sequenceofhumanPC4underthecontrol chromatography. T7 promoterandpurifiedbyconventional coding sequenceofhumanPC4underthecontrol chromatography. an affinity columnincombinationwithFPLC column. c T7 promoterandpurifiedbyconventional coding sequenceofhumanPC4underthecontrol T7 promoterandpurifi coding sequenceofhumanPC4underthecontrol LXR underthecontrolofa T7 promoter. strain thatcar under thecontrolofa T7 promoter. that car chromatography. an affinity columnincombinationwithFPLC chromatography. LXR alphaunderthecontrolofa T7 promoter. that car LXR underthecontrolofa hromatography. hromatograph ries thecodingsequenceofhumanPC4under ries thecodingsequenceofhumanRPB9 ries thecodingsequenceofhuman T7 promoterandpurifiedbyconventional ries thecodingsequenceofhuman y . T7 promoter. ed bycon T7 promoter T7 promoter. ventional . 137 Protein collections Misc. molecular tools 138 Protein collections Misc. molecular tools P001N_026Tp HmnDATpioeaeI(idtp)150 h idtp N oosmrs rti 75 515 P DNAtopoisomerase Iprotein(765 Thewildtype 258 12500 Topo IHumanDNA Topoisomerase I(wild type) 473 NM_003286 ThewildtypeDNAtopoisomerase Iprotein(765 5000 Thewildtypehuman TR alpha1was Topo expressedin 237 IHumanDNA Topoisomerase I(wildtype) TP200061 12500 534 Thewildtypehuman NM_003286 TR alpha1was expressedin ThewildtypehumanBcl-10 TR-alpha1(Thyroid proteinwas HormoneReceptor, expressedin 268 5000 15000 TP200060 NM_003250 ThewildtypehumanBcl-10 proteinwas expressed TR-alpha1(Thyroid HormoneReceptor, 6000 TP200059 NM_003250 Bcl-10 (BCellLymphoma 10) TP200058 NM_003921 Bcl-10 (BCellLymphoma 10) TP200057 NM_003921 TP200056 TP20 TP20 Price* TP20 TP20 410 TP20 TherecombinantproteinsarepurifiedfromanEcoli 25000 TP20 205 TFIIE(Transcription Factor IIE,alpha+ Source fromanEcoli Therecombinantproteinsarepurified Unit 10000 NM_002095 TP200049 TFIIE(Transcription Factor IIE,alpha+ 205 NM_002095 TP200048 TherecombinantproteinispurifiedfromanEcoli 10000 Description TFIIEalpha,p56(Transcription Factor IIE, T NM_005513 Accn TP200046 # Cat. roduct offering issubjecttochange. See ourwebsiteforthemost updatedinformation. 204 M051 FI lh,p6(rncito atrIE 50 Tercmiatpoeni uie rma oi 410 TherecombinantproteinispurifiedfromanEcoli 25000 TFIIEalpha,p56(Transcription Factor IIE, NM_005513 P200047 0 0 205 0 Recombinant p62proteinisisolatedfromanEcoli 10000 0 TFIIH-p62(Transcription Factor IIH,p62 0 NM_005316 0050 055 410 054 Recombinant p62proteinisisolatedfromanEcoli 25000 053 TFIIH-p62(Transcription Factor IIH,p62 052 NM_005316 051 M053 PRapa(eoioepoieao-200 eobnn PRi sltdfo nEcl tan 407 Recombinant PPAR isisolatedfromanEcolistrain 204 NM_0 25000 Recombinant PPAR isisolatedfromanEcolistrain 10000 NM_0 PPAR alpha(Peroxisome proliferator- NM_005036 PPAR alpha(Peroxisome proliferator- NM_005036 49 FI-1 TasrpinFco I, uui)200 1 uui fTIAi sltdfo tano oi410 p12 subunitof TFIIA isisolatedfromastrainofEcoli 25000 205 TFIIA-p12 (Transcription Factor IIA,subunit) p12 subunitof TFIIA isisolatedfromastrainofEcoli 10000 04492 TFIIA-p12 (Transcription Factor IIA,subunit) 04492 lh1ioom baculovirus systemandpurified byanaffinity column baculovirus systemandpurified byanaffinity column alpha1 isoform) alpha1 isoform) strainthatcontainsthecodingsequenceofhuman strainthatcontainsthecodingsequenceofhuman subunit) thatcontains strain thecodingsequenceofhuman beta subunits) thatcontains strain thecodingsequenceofhuman beta subunits) alpha subunit) alpha subunit) ciae eetr lh stp)thatcarries thecodingsequenceofhumanPPAR thatcarries thecodingsequenceofhumanPPAR receptor,activated alphaisotype) receptor,activated alphaisotype) subunit) www .or ig ene.com and purifi amino acids)was expressedinbaculovirus system and purifi amino acids)was expressedinbaculovirus system in combinationwithFPLCchromatography. in combinationwithFPLCc in combinationwithFPLCchromatography. baculovirus systemandpurifiedbyanaffinity column column incombinationwithFPLCc in baculovirus system andpurifiedbyanaffinity under thecontrolofa T7 promoter. strain thatcar by functional TFIIE isreconstitutedasaheterotetramer (5) (cat.#P1005 and and#P1006, respectively) TFIIE aorbsubunitunderthecontrolof T7 promoter by f (5) (cat.#P1005 and and#P1006, respectively) TFIIE aorbsubunitunderthecontrolof T7 promoter p TFIIE asubunitunderthecontrolof T7 promoter (5). TFIIE asubunitunderthecontrolof T7 alpha underthecontrolofa T7 promoter. alpha underthecontrolofa T7 promoter. gamma subunitunderthecontrolof T7 promoter. that containsthecodingsequenceforhuman TFIIA gamma subunitunderthecontrolof T7 promoter. that containsthecodingsequenceforhuman TFIIA under thecontrolofa T7 promoter. strain thatcar c chromatography. unctional TFIIE isreconstitutedasaheterotetramer hromatography. romoter (5). combining bothsubunitsina1:1molarratio. combining bothsubunitsina1:1molarratio. ed byusinganaf ed byusinganaf ries thecodingsequenceofhumanp62 ries thecodingsequenceofhumanp62 fi fi hromatograph nity columnandFPLC nity columnandFPLC hromatograph y . y . P008N_006S3,(FS rSp0)PemN 50 TehmnS3 idtp rti a xrse n258 ThehumanSC35wildtypeproteinwas expressed in 5000 515 SC35,(SFRS2orSRp30b)Pre-mRNA ThemutanthumanBRG1(K798R)was expressedin Product offering issubjecttochange. See ourwebsite forthemostupdatedinformation. 258 12500 620 NM_003016 ThemutanthumanBRG1(K798R)was expressedin BRG1-mt (Brahma-relatedGene1Protein, 5000 TP200078 310 515 ThewildtypehumanBRG1was expressedin NM_003072 BRG1-mt 1Protein, (Brahma-relatedGene 12500 TP200077 Recombinant c-foswas expressed inabaculovirus 258 12500 ThewildtypehumanBRG1was expressedin NM_003072 5000 BRG1(Brahma-relatedGene1Protein, Recombinant c-foswas expressed inabaculovirus TP200076 5000 NM_003072 BRG1(Brahma-relatedGene1Protein, TP200075 NM_003072 c-Fos (protooncogene) TP200074 NM_003131 c-Fos (protooncogene) TP200073 NM_003131 TP200072 515 TP20 Themutant Y723F ofDNAtopoisomeraseIprotein 12500 Topo I(Y723F)HumanDNA Topoisomerase I TP20 Price* 515 NM_003286 TP200069 258 TheN-terminaldomain(NTD) ofhumanDNA 12500 Topo I(N1-197) HumanDNA Topoisomerase I TP20 TheN-terminaldomain(NTD) ofhumanDNA NM_003286 5000 515 Topo I(N1-197) HumanDNA Topoisomerase I TP200067 ThecoredomainofDNAtopoisomeraseIprotein NM_003286 12500 258 Source Topo I(197-651) HumanDNA Topoisomerase Unit I TP200066 ThecoredomainofDNAtopoisomeraseIprotein NM_003286 5000 Topo I(197-651) HumanDNA Topoisomerase I TP200065 NM_003286 258 TP200064 Description TheC-terminaldomainofDNAtopoisomeraseI 5000 Topo I(C651-765) HumanDNA Topoisomerase I T NM_003286 Accn TP200062 # Cat. 206 M038 ooI(6175 HmnDATpioeaeI 20 TeCtria oano N oosmrs 515 TheC-terminaldomainofDNAtopoisomeraseI 12500 Topo I(C651-765) HumanDNA Topoisomerase I NM_003286 P200063 0 0 0 071 258 070 Themutant Y723F ofDNAtopoisomeraseIprotein 5000 Topo I(Y723F)HumanDNA Topoisomerase I NM_003286 068 NM_0 NM_0 39 B TT o idn rti)200 sltdfo nEcl tanta are h oig 410 IsolatedfromanEcolistrainthatcarries thecoding 25000 205 IsolatedfromanEcolistrainthatcarries thecoding 10000 TBP(TATA box BindingProtein) 03194 TBP(TATA box BindingProtein) 03194 piigFco baculovirus systemandpurifiedbyanaffinity column baculovirus systemandpurifiedbyanaffinity column baculovirus systemandpurifiedbyanaffinity column baculovirus byanaffinity systemandpurified column baculovirus byanaffinity systemandpurified Splicing Factor K798R) K798R) wild type) wild type) topoisomeraseIprotein(residue1-197) was expressed (mt (residues197-651) was expressedinbaculovirus (N (residues197-651) was expressedinbaculovirus (NTD) protein(residues651-765) was expressedin (Core Domain) protein(residues651-765) was expressedin (Core Domain) (C terminaldomain) (C terminaldomain) m 73)(Y723F)was expressedinbaculovirus systemand (mt Y723F) D topoisomeraseIprotein(residue1-197) was expressed TD) Y723F) h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: in combinationwithFPLCc in combinationwithFPLCchromatography. in combinationwithFPLCc in combinationwithFPLCchromatography. column incombinationwithFPLCc combination withFPLCchromatography system andpurifiedbyanaffinity columnin combination withFPLCc system andpurifiedbyanaffinity columnin chromatography. purified byusinganaffinity column andFPLC (Y723F) w af in baculovirus system andpurifiedbyusingan affinity columnandFPLCchromatography. in baculovirus systemandpurifiedbyusingan FPLC chromatography. system andpurifiedbyusinganaffinity columnand FPLC chromatography. system andpurifiedbyusinganaffinity columnand c baculovirus systemandpurifiedbyusinganaffinity column andFPLCchromatography. baculovirus systemandpurifiedbyusinganaffinity promoter (3). sequence forhuman TBP underthecontroloff T7 promoter (3). sequence forhuman TBP underthecontroloff T7 purifi chromatography. olumn andFPLCchromatography. fi nity columnandFPLCchromatography. ed byusinganaf as expressedinbaculovirus systemand fi nity columnandFPLC hromatograph hromatograph hromatograph hromatograph y y y . . y . 139 Protein collections Misc. molecular tools 140 Protein collections Misc. molecular tools P007N_006FF2(ai bols rwhfco)150 eobnn G2wsepesdi auoiu 473 Recombinant FGF2was expressedinabaculovirus 237 12500 Recombinant FGF2was expressedinabaculovirus 5000 P FGF-2 (basicfibroblastgrowthfactor) NM_002006 FGF-2 (basicfibroblastgrowthfactor) TP200097 205 NM_002006 Recombinant RAP74 proteinisisolatedfromanEcoli TP200096 10000 TFIIF, RAP74 (Transcription Factor IIF,TP20 515 NM_002096 HMG1was purifiedfromcalfthymus usingseveral 25000 TP200094 TP20 fromCalf HMG1(Native Thymus) 515 195TP20 410 NM_002128 Recombinant c-junwas expressed inabaculovirus 258 TP200091 12500 Recombinant HMG1isisolatedfromanEcolistrain 10000 Recombinant RAD51was expressedinastrainof 205 25000 Recombinant c-junwas expressedinabaculovirus TP20 5000 HMG1(HighMobilityGroup1protein) Recombinant RAD51was expressedinastrainof 10000 TP20 Price* NM_002128 c-Jun (protooncogene) TP200088 NM_002228 c-Jun (protooncogene) TP200087 389 NM_002228 RAD51 Recombinant RXR-LBDisisolatedfromanEcolistrain 25000 TP200086 195 NM_002875 RAD51 Recombinant RXR-LBDisisolatedfromanEcolistrain 10000 TP200085 NM_002875 410 Source RXR-LBD(RXRalpha198-462) Unit TP200084 Recombinant RXRisisolatedfromanEcolistrain NM_002957 205 RXR-LBD(RXRalpha198-462) 25000 TP200083 Recombinant RXRisisolatedfromanEcolistrain NM_002957 515 RXRalpha(Retinoid Xreceptorprotein) 10000 TP200082 ThehumanSC35wildtypeproteinwas expressedin 12500 NM_002957 RXRalpha(Retinoid Xreceptorprotein) TP200081 Description NM_002957 SC35,(SFRS2orSRp30b)Pre-mRNA TP200080 NM_003016 Accn TP200079 # Cat. roduct of 05N_006TIF A7 TasrpinFco I, 50 RcmiatRP4poeni sltdfo nEcl 410 Recombinant RAP74 proteinisisolatedfromanEcoli 25000 TFIIF, RAP74 (Transcription Factor IIF, NM_002096 205 0095 258 TherecombinantproteinispurifiedfromanEcoli 10000 HMG1was purifiedfromcalfthymus usingseveral 10000 TFIIEbeta,p34(Transcription Factor IIE, 0 389 NM_002095 Recombinant HMG1isisolatedfromanEcolistrain 25000 0092 fromCalf HMG1 (Native Thymus) NM_002128 HMG1(HighMobilityGroup1protein) 0090 NM_002128 0089 093 fering issubjecttochange. See ourwebsiteforthemostupdatedinformation. NM_0 29 FI ea 3 TasrpinFco I, 200 h eobnn rti sprfidfo nEcl 410 TherecombinantproteinispurifiedfromanEcoli 25000 TFIIEbeta,p34(Transcription Factor IIE, 02095 a7 uui)strainthatcarries thecodingsequenceofhuman strainthatcarries thecodingsequenceofhuman strainthatcontainsthecodingsequenceofhuman Rap74 subunit) Rap74 subunit) beta subunit) baculovirus systemandpurifiedbyanaffinity column Splicing Factor beta subunit) www .or ig ene.com combination withFPLCchromatography. system andpurifiedbyanaffinity columnin combination withFPLCc system andpurifiedbyanaffinity columnin promoter. RAP7 promoter. RAP74, thesubunitof TFIIF underthecontrolof T7 TFIIE subunitunderthecontrolof T7 promoter(4). steps ofcon steps ofconventional andFPLCchromatography. under thecontrolofa that carries thecodingsequence of thehumanHMG1 under thecontrolofa t combination withFPLCc system andpurifiedbyanaffinity columnin combination withFPLCchromatography system andpurifiedbyanaffinity columnin combination withFPLCchromatography. E combination withFPLCchromatography. E LBD underthecontrolofa T7 promoter. that carries thecodingsequenceofhumanRXR- LBD underthecontrolofa T7 promoter. that carries thecodingsequenceofhumanRXR- protein underthecontrolofa T7 promoter. that carries thecodingsequenceofhuman protein underthecontrolofa T7 promoter. t in combinationwithFPLCchromatography. strain thatcontainsthecodingsequenceofhuman TFIIE subunitunderthecontrolof T7 promoter(4). hat carries thecodingsequenceof thehumanHMG1 hat carries thecodingsequenceofhuman coli andpurifiedbyanaffinity column in coli andpurifiedbyanaffinity columnin 4, thesubunitof ventional andFPLCc TFIIF underthecontrolof T7 promoter T7 promoter. hromatograph hromatography hromatography. . y . T7 P013N_322p5CR[-emnlrgo fp5(EG) 50 Rcmiatp5CRi sltdfo nEcl tan 515 Recombinant p75CTRisisolatedfromanEcolistrain 25000 Product offering issubjecttochange. See ourwebsite forthemostupdatedinformation. 258 p75-CTR[C-terminalregionofp75(LEDGF)] Recombinant p75CTRisisolatedfromanEcolistrain 10000 NM_033222 p75-CTR[C-terminalregionofp75(LEDGF)] TP200113 NM_033222 258 TP200112 270 Recombinant p75protein(wildtype,530amino 10000 TP20 p75, Transcriptional andLens Coactivator Recombinant RARbetawas expressedina 539 5000 NM_033222 TP200110 258 Recombinant RARgamma was expressedina 12500 RAR-beta(Retinoic Acid Receptor, TP20 Recombinant RARgamma was expressedina NM_000966 5000 RAR-gamma (Retinoic Acid Receptor, TP200108 NM_000965 RAR-gamma (Retinoic Acid Receptor, TP200107 620 Price* NM_000965 TP200106 (residues1135-2414) TheC-terminusofp300 was 310 10000 TP20 (residues1135-2414) TheC-terminusofp300 was 4000 (C1135-2414) p300 C-terminus p300 TP20 620 NM_001429 (2414 aminoacidresidues)was Thewildtypep300 389 (C1135-2414) p300 C-terminus p300 TP200103 10000 310 Source Unit NM_001429 Recombinant Dr1isisolatedfromanEcolistrain 195 (2414 aminoacidresidues)was Thewildtypep300 25000 p300 Tumor 4000 SuppressorProtein and TP200102 Recombinant Dr1isisolatedfrom anEcolistrain NM_001429 10000 p300 Tumor SuppressorProtein and TP200101 NM_001429 Dr1(NC2beta19 kDa) TP200100 Description NM_001938 Dr1(NC2beta19 kDa) TP200099 NM_001938 Accn TP200098 # Cat. 19N_096RR ea(eiocAi eetr 150 eobnn A eawsepesdi 539 Recombinant RARbetawas expressedina 12500 0 RAR-beta(Retinoic Acid Receptor, NM_000966 539 0109 270 Recombinant RARalphawas expressedina 12500 Recombinant RARalphawas expressedina 5000 RAR-alpha(Retinoic Acid Receptor, NM_000964 RAR- alpha(Retinoic Acid Receptor, 0105 NM_000964 0104 1 1 1 M032 7,TasrpinlCatvtradLn 200 eobnn 7 rti wl ye 3 mn 515 Recombinant p75protein(wildtype,530amino 25000 p75, Transcriptional andLens Coactivator NM_033222 pteilCl-eie rwhFco acids)isisolatedfromanEcolistrainthatcarries the GrowthFactor Epithelial Cell-Derived eaioom baculovirus systemandpurifiedbyanaffinity column acids)isisolatedfromanEcolistrainthatcarries baculovirus systemandpurifiedbyanaffinity column baculovirus byanaffinity systemandpurified column GrowthFactor Epithelial Cell-Derived baculovirus byanaffinity systemandpurified column beta isoform) baculovirus systemandpurifiedbyanaffinity column beta isoform) baculovirus systemandpurifiedbyanaffinity column gamma isoform) gamma isoform) alpha isoform) alpha isoform) expressedinbaculovirus systemandpurifiedbyan expressedinbaculovirus systemandpurifiedbyan Transcription Factor Transcription Factor h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: combination withFPLCchromatography. T7 promoterandpurifiedbyanaffinity columnin coding sequenceofhumanp75underthecontrol control ofa human LEDGF/p75(aminoacid322-530) under the that carries theC-terminalcodingsequenceof control ofa T7 promoter. human LEDGF/p75(aminoacid322-530)underthe that carries theC-terminalcodingsequenceof combination withFPLCchromatography. of the codingsequenceofhumanp75undercontrol in combinationwithFPLCc in combinationwithFPLCc in combinationwithFPLCc in combinationwithFPLCc in combinationwithFPLCc in combinationwithFPLCc c affinity columnincombinationwith FPLC expressed inbaculovirus systemandpurifiedbyan chromatography. affinity columnincombinationwithFPLC expressed inbaculovirus systemandpurifiedbyan chromatography. affinity columnincombinationwithFPLC chromatography. affinity columnincombinationwithFPLC Dr1 underthecontrolofa T7 promoter. t Dr1 underthecontrolofa T7 promoter. that carries thecodingsequenceofhuman hat carries thecodingsequenceofhuman hromatography. T7 promoterandpurifi T7 promoter. ed byanaffinity columnin hromatograph hromatograph hromatograph hromatograph hromatograph hromatograph y y y y y y 141 Protein collections Misc. molecular tools 142 Protein collections Misc. molecular tools P011N_343S1 CbxBnigPoen(aua 50 NtrlS1fato a uie rmHL el 649 325 NaturalSp1fractionwas purifiedfromHeLacell 5000 NaturalSp1fractionwas purifiedfromHeLacell 515 2000 P Sp1GC-box BindingProtein (Natural 649 258 Recombinant GAL4-Sp1isisolatedfromanEcoli NM_138473 10000 Sp1GC-box BindingProtein (Natural 325 TP200131 Recombinant ERwas expressed inabaculovirus Recombinant GAL4-Sp1isisolatedfromanEcoli 10000 4000 NM_138473 GAL4-Sp1^Q[GAL4(94)+ Recombinant ERwas expressed in abaculovirus TP200130 4000 NM_138473 GAL4-Sp1^Q[GAL4(94)+ TP200129 258 NM_138473 ER(EstrogenReceptor) TP200128 Recombinant GRwas expressedinabaculovirus NM_000125 ER(EstrogenReceptor) 5000 TP200127 620 NM_000125 TP200126 310 ThewildtypepRB(residue1-928) isexpressedin 12500 GR(Glucocorticoid Receptor) TP20 ThewildtypepRB(residue1-928) isexpressedin 5000 NM_000176 pRB(Retinoblastoma protein), Tumor TP200124 NM_000321 pRB(Retinoblastoma protein), Tumor TP200123 Price* NM_000321 550 TP200122 TheC-terminus-deletedp53(aminoacid1-342) was 12500 TP20 275 p53(1-342, C-terminaldeletion) TheC-terminus-deletedp53(aminoacid1-342) was Tumor TP20 5000 550 NM_000546 p53(1-342, C-terminaldeletion) Tumor TP200119 TheC-terminus-deletedp53(aminoacid1-363) was 12500 275 Source Unit NM_000546 p53(1-363, C-terminaldeletion) TheC-terminus-deletedp53(aminoacid1-363) was Tumor TP200118 5000 550 NM_000546 p53(1-363, C-terminaldeletion) Tumor Thewildtypep53(393aminoacidswasTP200117 expressedin 12500 275 NM_000546 Thewildtypep53(393aminoacidswas expressedin p53(wildtype) Tumor SuppressorProtein 5000 TP200116 Description NM_000546 p53(wildtype) Tumor SuppressorProtein TP200115 NM_000546 Accn TP200114 # Cat. roduct of 15N_016G Guootci eetr 20 RcmiatG a xrse nabclvrs 515 Recombinant GRwas expressedinabaculovirus 12500 GR(Glucocorticoid Receptor) NM_000176 0125 410 Recombinant TR isisolatedfromanEcolistrainthat 25000 205 Recombinant TR isisolatedfromanEcolistrainthat TRbeta1(Thyroid HormoneReceptor, 10000 NM_000461 TRbeta1 (Thyroid HormoneReceptor, 0121 NM_000461 0120 fering issubjecttochange. See ourwebsiteforthemostupdatedinformation. rcinprfidfo eaCls nuclear extract byusingwheatgermagglutinin strainthatcarries thecodingsequenceoffused fraction purifi fraction purifiedfromHeLaCells) Sp1(266-51 Sp1(266-516)] carries thecodingsequenceofhuman TR baculovirus systemandpurifiedbyanaffinity column carries thecodingsequenceofhuman TR baculovirus systemand purifiedbyanaffinity column Suppressor Protein, Transcription Factor and P Suppressor Protein, Transcription Factor beta1 isoform) expressedinbaculovirus systemandpurifiedbyan beta1 isoform) expressedinbaculovirus systemandpurifiedbyan Suppressor Protein and Transcription Factor expressedinbaculovirus systemandpurifiedbyan Suppressor Protein and Transcription Factor expressedinbaculovirus systemandpurifiedbyan Suppressor Protein and Transcription Factor baculovirus systemandpurifiedbyanaffinity column Suppressor Protein and Transcription Factor a and Transcription Factor and P dTasrpinFco baculovirus systemandpurifiedbyanaffinity column nd Transcription Factor roliferation F roliferation F 6)] ed fromHeLaCells) acto acto www .or ig ene.com combination withFPLCc in combinationwithFPLCchromatography. affinity chromatography (12). nuclear extractbyusingwheatgermagglutinin affinity chromatography (12). protein underthecontrolofa T7 promoter. system andpurifi combination withFPLCchromatography system andpurifiedbyanaffinity columnin combination withFPLCc system andpurifiedbyanaffinity columnin combination withFPLCc system andpurifiedbyanaffinity columnin alpha1 isoformunderthecontrolofa alpha1 isoformunderthecontrolofa c affinity columnincombinationwith FPLC chromatography. affinity columnincombinationwithFPLC chromatography. affinity columnincombinationwithFPLC chromatography. affinity columnincombinationwithFPLC in combinationwithFPLCchromatography. in combinationwithFPLCchromatography. in combinationwithFPLCchromatography. protein underthecontrolofa T7 promoter. strain thatcar hromatography. ries thecodingsequenceoffused ed byanaf hromatograph hromatograph hromatograph fi nity columnin T7 promoter T7 promoter y y. y . . . Product offering issubjecttochange. See ourwebsite forthemostupdatedinformation. Price* 407 Recombinant PPAR isisolatedfromanEcolistrain Source 204 25000 Unit Recombinant PPAR isisolatedfroman E colistrain PPAR gamma (Peroxisome proliferator- 10000 620 NM_138712 PPAR gamma (Peroxisome proliferator- 310 ThewildtypeSp1protein(785aminoacids)was 12500 TP200135 NM_138712 Sp1GC-box BindingProtein (Recombinant ThewildtypeSp1protein(785aminoacids)was 5000 TP200134 Description NM_138473 Sp1GC-box BindingProtein (Recombinant TP200133 NM_138473 Accn TP200132 # Cat. ciae eetr am stp)thatcarries thecodingsequenceofhuman thatcarries thecodingsequenceofhuman receptor,activated gamma isotype) expressedinbaculovirus systemandpurifiedby receptor,activated gamma isotype) protein purifiedfrominsectcells) p oenprfidfo netcls expressedinbaculovirus by systemandpurified rotein purifiedfrominsectcells) h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: using anaffinity columnandFPLCchromatography. PPAR gamma underthecontrolofa T7 promoter. PPAR gamma underthecontrolofa T7 promoter. using anaffinity columnandFPLCchromatography. 143 Protein collections Misc. molecular tools 144 Quanti-Ladder Misc. molecular tools 0.2, 0.4,0.6,0.8,1 consistsofbands Quanti-Ladder™ DNAMarker P $595 double-stranded DNA. of basepairs to10,000 size standardsrangefrom200 tification andmolecularweightdetermination. The molecular weightmarker, idealforeasyquan- isaready-to-useThe Quanti-Ladder™DNAMarker DNA Marker QLD-1000 Quanti-Ladder™ Cat.No. lanes 1000 Quanti-Ladder™ DNAMarkers, Q Product Listing • lanesequivalent 1mLor200 • formats: blue andxylenecyanolFFisavailableintwo ing buf ispreparedinaload- Quanti-Ladder™ DNAMarker DNA sample. of DNA. This allowsforeasyquantificationofany 5 and easyidentifi toallowquickhave ahigherintensitythantheothers and 1 at-adr N akr,20lnsQD20$150 QLD-200 lanes 200 uanti-Ladder™ DNAMarkers, µL, each bandcorresponds toanexactquantitation 5 roduct Description mL or1 0 fer containingthetrac kilobases. 0 00 lanes equivalent lanesequivalent 00 cation. Usingastandardloadingof The 1 .0, 1 .5, 2.0,2.5,3.0,4.0,5.0,6.0,8.0 .0 and10 bands kilobase-pairs king dyesbromophenol www .or ig ene.com Ideal foreasyquantification 14 DNAbandsforaccurate ranging from0.2to10 kb Easy toremembersiz size determination ADVANTAGES of DNAsamples IE(b)ng/band SIZE (kbp) 0.2 60 0.4 0.6 100 0.8 1.0 20 1.5 25 2.0 30 2.5 40 3.0 50 4.0 60 5.0 80 6.0 8.0 0100 10 20 40 80 15 es Price viewed byethidiumbromidestainingwhen2 concentration of1µg/µL. The bandsareeasily The Millennium™RNAMark nuclease contamination. approximately thesameintensityandisfreeof separated inadenaturingagarose gel. mRNA species.Eac standard curvefordeterminingthesizes ofunknown bands allowstheconstructionofaveryaccurate kilobases. 0.5, 1.0, 1.5, 2.0,2.5,3.0,4.0,5.0,6.0and9.0 The RNAladderconsistsofaseriestranscripts Product Description 9.0 kb,andisidealforNorthern blotprotocols. determination ofsingle-strandedRNAsfrom0.5to to provide easyandaccuratemolecularweight hasbeendeveloped The Millennium™RNAMarker RNA Marker Millennium™ Cat.No. M Product Listing lenu™RAMres 5lnsRM30 $105 RMM-3703 25lanes illennium™ RNAMarkers, This largenumberofwell-separatedRNA h lot containsbandsat h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: er ispro vided ata µ L are Mark accurate size determination autoradiographic detection ranging from0.5to9.0kb Easy ers hybridizeers with Ten RNAbandsfor ADVANTAGES -to-remember siz size (kb) 0.5 1.5 2.5 3 5 1 2 4 6 9 λ DNA for es Price 145 Millennium™ marker Misc. molecular tools 146 Rapid-Load Misc. molecular tools • Rapid-Load™ isavailableintwoformats: PCR. multiple samplessuch aswhenperforminga96-well bacterial colonies.Itisalsoidealforusewith containing standardplasmidDNA,genomicDNAor plasmid DNA,transformedbacterialcoloniesorgeno Fig. 1showsPCRamplificationofhumanb-actinfrom PCRequivalent 25mLor2500 • R 1% agarose gelwith1x TAE runningbuffer. electrophoresis. The reddyemigratesat1.4 kbpina samples andtrac Rapid-Load™ isredincolormakingiteasytoload P $100 eliminates theneedforanextrapipetting step. to addstandardloadingdyethesamples.It directly loadedinanagarose gel.Itisnotnecessary After thereactionproductscanbe thePCRisfinished, interfere withtheperformanceofoverall reaction. presence ofRapid-Load™ inthePCRmixwillnot added toaPCRmixbeforeamplification. The Rapid-Load™ isa5xsampleloadingdyethat is RL-125 PCR Loading Dye Rapid-Load™ Cat.No. Rapid-Load™ PCRLoading Dye,25mL R Product Listing the presence(+)orabsence (-) ofR mic DNA.Each reactionwas performedinduplicate pdLa™PRLaigDe LR-0 $25 RL-105 apid-Load™ PCRLoading Dye,5mL apid-L 5 roduct Description mL or50 oad™ canbeusedinPCRamplifications 0 PCR equi k them inanag valent apid-L arose gelduring oad™. www.origene.com - 0.6 - 1.0 - kb Fig.1 Ideal for96-wellPCR plasmid ADVANTAGES – DNA + Easy touse Saves time bacterial colonies – + genomic – DNA Price + and/or copyrights. product, isstrictlyprohibited. OriGeneproductsmaybeprotectedbypatents,pending patentapplications, resale, modifi All OriGeneproductsarefor research use onlyandarenotintendedfordrug,diagnostic,or humanuse. The CONDITIONS will bea20%restocking feeandshippingcharges willnotbecredited. credit.Intheeventofreturnsduetocustomerorderingerror,their original,intactconditiontoreceive there instructions forreturningthegoodstoCustomerS For returnsduetodamagedproductsormissingcomponents,pleaseobtainan authorizationnumberand OriGene productsmaynotbereturnedwithoutprior authorization fromCustomerService (1-301-340-3188). CREDITS RETURNS AND unless otherwiseindicatedwhentheorderisplaced. arenormallyfilledwithinasingleshipment.Ifthisisnotpossible,partialAll orders shipmentwillbesent P Net 30daysfromthedateofinvoice inU.S. dollars. PAYMENT TERMS OriGene CustomerService. P PRICING By placinganorderwithOriGene,youagreetothefollowing: *For yourconvenience, weaccept VISA 5. Billingaddress 4. Shippingaddress 3. Purchase ordernumberorcreditcard*information 2. Catalognumber, description,andquantityofitemordered 1. placingorder Nameandtelephonenumberofperson Please includethefollowinginformationwhenorderingviafax: 6 Taft Court, Suite100 [email protected] 1-301-340-9254 (24hrs) Address: E-mail: Fax: 1-888-267-4436 (toll-freeinU.S. only) www.origene.com Telephone: E-Commerce: To Order please supply the cardholder name (as it appears onthecard),accountnumber,please supplythecardholdername(asitappears andtheexpiration date. rices aresubjecttoc AR TIAL SHIPMENT cation orduplicationforresale, oran R 1-301-340-3188 (9AM–5PMEST, M–F) ockville, MD20850 hange withoutnotice.F h .8.6.46 fx 1.301.340.9254 1.888.267.4436 fax: ph: ® , MasterCard or current pricinginformationonany product,pleasecontact y other transferforvalueofintact, duplicatedormodifi ® ervice Depar and AmericanExpress tment. The productsmustbereturnedin ® . To orderusingacreditcard, ed 147 Ordering information 148 Ordering information t PCR iscoveredbypatentsissuedtoCetusCorporationandownedlicensedHoffmann-LaRoche,Inc.PurchaseofanyOriGene’s PCR-relatedproducts doesnotconveyalicense 1-301-340-3188, ext.2or1-888-267-4436, ext.2. you experiencedifficulty withany OriGeneproduct,pleasecontact Technical Support promptly at If printed expirationdateorforproductsnotstoredusedaccordingtotheproductusespecificationsgiven. incidental damagesorlossasaconsequenceofproductuse.Nowarranty for productsusedafter isgiven the OriGene provides nootherwarranty, express orimplied,andisnotliableresponsibleforany indirect or receipt. This warranty limitsOriGene’s liabilitytothecostofreplacement the productinquestiononly. free replacementofany within30daysofproduct nonconforming productwillbemadeifOriGeneisnotified OriGene Technologies, Inc.warrants thattheproductwillmeetspecificationslisted. At OriGene’s discretion, LIMITED PRODUCT WARRANTY (toll-free inU.S. only). bycallingOriGeneat1-301-340-3188Please requestquotationsforallcustomandbulkorders or1-888-267-4436 CUSTOM AND BULKORDERS Monday through Thursday, unlessotherwiserequested. viaFederal requiringshipmentondryicearedelivered ExpressPriorityDomestic orders OvernightService, Products areshippedF.O.B. Rockville, Maryland.Shippingcharges areprepaidandaddedtoyourinvoice. SHIPPING o use thePCRprocesscoveredbythesepatents.PurchasersofproductsmustobtainalicensetobeforeperformingPCR. www .or ig ene.com

U.S. Postage PAID 6Taft Court, Suite 100 Rockville, MD 20850