DOCSLIB.ORG

Rice Oryza Sativa L. II

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Rice Oryza Sativa L. II Heredity 63(1989) 171—179 The Genetical Society of Great Britain Received 25 January 1989 Pollination with irradiated pollen in rice Oryza sativa L. II. The second (M2) generation Shin-Foong Chin* and Department of Agriculture, University of Queensland, Geoff H. Gordon St. Lucia, Queensland 4067, Australia. Surviving Ml plants derived from pollination with irradiated pollen were selfed to produce the second (M2) generation. in three quantitative traits, the means and phenotypic frequency distributions of the M2 populations were identical to that of the F2 population. In five major gene traits, all but six of the 244 M2 segregations were in the expected ratios is the F2's. Aberrant segregations produced both excess paternal as well as maternal phenotypes. There was no consistent trend of a "maternal shift" in the M2 generation that may render the technique of irradiated pollination useful by preferentially producing pure breeding maternal materials having a few specific paternal characteristics. Qverall, pollination with irradiated pollen in rice produced mainly normal hybrid progeny with very little heritable variations. These lack of responses in rice may be explained by the fact that rice pollen is relatively insensitive to irradiation on the one hand, and that the pollen genome is less able to accommodate mutational damage on the other hand. Thus, the rice plant is considered less amenable to the application of irradiated pollination as a practical breeding technique. INTRODUCTION all the Ml progeny were either normal hybrid plants indistinguishable from the Fl controls, or Theuse of irradiated pollen to transfer single genes were hemizygous recessive plants in which certain from the pollen parent to the seed parent in cross- dominant paternal alleles were lost. This reduction pollination was first proposed by Pandey (1975). in the transmission of paternal alleles was accom- Subsequently, it was observed that when pollen panied by morphological mutations and sterility. was irradiated, the pollen nuclei were "pulverized" In total, 17,626 rice florets were pollinated with and the resultant nuclear "debris" was discharged irradiated pollen but not a single Ml plant was onto the embryo sac and fused with the egg cells found to contain only one or a few paternal traits Grant et al., 1980). On the basis of these observa- of the pollen parent in a largely maternal genetic tions, Pandey (1980a, b) further proposed that the background. Therefore, "egg transformation" by method of pollinating plants with irradiated pollen irradiated pollen was not shown to have occurred could be used for "egg transformation", defined in the rice plants. is the transfer of limited intact genes rather than It has been suggested that pollination with the total pollen genome to the egg cell. He sug- irradiated pollen may nevertheless be useful in gested that transformation could be the result of practical plant breeding by causing a shift in the diploid parthenogenesis of the egg induced by segregation ratio towards the maternal phenotypes irradiated pollen, followed by the incorporation in the second (M2) generation. This effect was of paternal chromatin during embryogenesis. In the companion paper, we reported the use of irradi- observed in barley, (Powell et al., 1983) and wheat, (Snape et aL, 1983). Compared to backcrossing, ated pollen of the rice cultivar Basmati, having this could be a quicker method to produce pure dominant genetic markers, to pollinate the mater- breeding maternal progeny with a few specific nal cultivar Bellemont, having recessive markers paternal characteristics. This issue of "maternal Chin and Gordon, 1989). In the first generation, shift" will be addressed in this report of the genetic Present address: CSIRO, Division of Plant Industry, GPO consequences of pollination with irradiated pollen Box 1600, Canberra, ACT 2601, Australia. in the M2 generation of rice plants. 172 S -F. CHIN AND G. H. GORDOr' MATERIALS AND METHODS least overnight at 4°C. Hydrolysis and Feulge staining was done as for mitotic studies. M2 and M3 plants Overtwo seasons, a total of 66 M2 families (857) Dataanalysis plants)were field-planted. These M2 families were obtained from selfing the randomly selected Ml Duncan'smultiple comparisons were done on ths plants which were derived from crosses with pollen statistical software SAS (Statistical Analysis Sys given various radiation doses. M2 families were tem, 1982 edition) using the general linear mode planted in randomized single rows consisting of procedure (PROC GLM), Skewness and kurtosi 15 to 20 lants per row. As controls, a total of tests on frequency distributions was done usin 15 F2 families (212 plants) were also grown. M2 the frequency procedure (PROC FREQ) on th and F2 plants were assessed for final plant height, SAS. Chi-square and t-tests were calculated on total tiller number, number of days to anthesis, program written in FORTRAN. Cluster analysi leaf texture, anthocyanin pigmentation on seed was carried out on the computer progran apiculus, seed awning and seed phenol staining 'HACLUS" written by Mr I. H. De Lacy of th reaction. All assessments were done as reported in Department of Agriculture, University of Queens the previous paper of this series. One M2 family land, St. Lucia, Australia. with apparent paternal shift was grown on to M3 generation. All the 15 M2 plants of this family were selfed to produce M3 lines and 20 plants of each RESULTS of the 15 M3 lines were field-grown and scored for leaf texture. These 15 M2 plants were also Quantitative traits examined for meiosis. For meiotic studies, panicles The means and standard error of means of plan were collected when the auricle of the flag leaf had height, tiller number and number of days t reached the same height as the auricle of the pre- anthesis obtained from two seasons of field plant ceding leaf (after De Datta, 1981); Cotlman and ing are shown in table 1. Results of Duncan' Herrera, 1980). Florets with immature pollen were multiple range tests on the means are also shown fixed with Carnoy's fixative (six parts ethanol, Phenotypic frequency distributions of these thre three parts chloroform, one part acetic acid) at phenotypic traits are shown in fig. 1(a) and 1(b) Table I Means and standard error of means of three quantitative traits of F2 and M2 progenies from two seasons of field trial Height (cm) Tiller number Anthesis (days) No. of No. of — Treatment family plant Mean S. E. Mean S. E. Mean S. E. First season Bellemont 4 51 909c 074 53d 042 1192d 113 Basmati 4 56 1517a 300 364a 194 1444a 052 F2 10 113 1352bc 207 225b 110 1359c 106 05 krad 10 121 1383b 241 233b 142 1353c 094 lkrad 10 111 1344bc 193 213bc 100 1317c 095 2 krad 8 102 138th 203 176c 082 1342c 098 4krad 10 121 130Oc 218 225b 174 133Oc 102 6krad 4 37 1382b 312 233b 240 141Ob 159 Second season Bellemont 2 40 967c 125 33c 068 115Oc 078 Basmati 2 40 161la 117 222a 104 140Oa 089 F2 5 99 1436b 213 13'7b 062 1315b 139 5krad 9 179 141Sb 153 ilIb 036 134lb 085 6 krad 3 60 1376b 237 126b 036 1373b 149 8krad 3 46 141Ib 270 116b 077 1336b 180 l0krad 9 80 144Ob 207 137b 071 1326b 149 Means with the same letters are not different at the 5 per cent level of Duncan's multiple range test. IRRADIATED POLLEN IN RICE. II. M2 173 a Kr Height (cm) Tiller(no) Anthesis (days) b BMT BAS BMT BAS BMT BAS 30 80 10 Kr 110 100 SO 180 5 30 Height (cm) Tiller (no) Anthesis (days) Figure 1 (a) Frequency distributions of three quantitative traits of F2 and M2 progeny from the first season of field trial. All means are indicated by arrows and the number of plants are shown on the vertical axes. Bellemont (BMT) is the female parent and Basmati (BAS) the male parent. (b) Frequency distributions of three quantitative traits of F2 and M2 progeny from the second season of field trial. All means are indicated by arrows and the number of plants are shown on the vertical axes. Bellemont (BMT) is the female parent and Basmati (BAS) the male parent. These distributions are tested for departure from gi and g2 are after Sokal and Rohif (1981) as normality by two sample statistics (gi) and (g2) follows:t. =(gl-P1)/Sgiand t. =(g2-P2)/S2, which measure skewness (asymmetry) and kurtosis where P1 and P2, the population parameters, are (peakedness) respectively. Test of significance of equal to zero for a normally distributed population. 174 S-F. CHIN AND G. H. GORDON Table 2 Test of departure from normality on the frequency distributions of F2 and M2 phenotypes. Data were obtained from two seasons of field trial. The two sample statistics (gi) and (g2) test for skewness and kurtosis respectively Height Tiller Anthesis Treatment gi I g2 I gi I g2 I gi t g2 I First season F2 03 ns 00 ns 71R hip —02 ns 14 ns 05 krad 06 ns 10 ns 156R 39Sp 06 ns —01 ns 1 krad 13 ns 06 ns 44R 40p —11 ns 07 ns 2krad 03 ns 02 ns 33R 26p 04 ns —01 ns 4krad —4OL 39p 188R 57•4p —03 ns —02 ns 6krad 07 ns 08 ns 42R Sip 10 ns —1-2 ns Second season F2 —20 ns 12 ns 26R IOip —14 ns 20 ns 5krad —19 ns 12 ns 6OR 49p —1.2 ns —04 ns 6 krad —05 ns 09 ns 47R 53p —10 ns —02 ns 8krad 03 ns —13 ns 23R 22p —13 ns 05 ns l0krad —01 ns —07 ns 38R 24p —12 ns —01 ns A negative significant gi indicates left-skew (L) and a positive significant gi indicates right-skew (R).
Load more

Recommended publications
  • Evaluation of Japonica Rice (Oryza Sativa L.) Varieties and Their Improvement in Terms of Stability, Yield and Cooking Quality by Pure-Line Selection in Thailand
    ESEARCH ARTICLE R ScienceAsia 46 (2020): 157–168 doi: 10.2306/scienceasia1513-1874.2020.029 Evaluation of japonica rice (Oryza sativa L.) varieties and their improvement in terms of stability, yield and cooking quality by pure-line selection in Thailand Pawat Nakwilaia, Sulaiman Cheabuc, Possawat Narumona, Chatree Saensukb, Siwaret Arikita,b, a,b, Chanate Malumpong ∗ a Department of Agronomy, Faculty of Agriculture at Kamphaeng Saen, Kasetsart University, Nakhon Pathom 73140 Thailand b Rice Science Center & Rice Gene Discovery Unit, Kasetsart University, Nakhon Pathom 73140 Thailand c Faculty of Agriculture, Princess of Naradhiwas University, Narathiwat 96000 Thailand ∗Corresponding author, e-mail: [email protected] Received 3 Aug 2019 Accepted 3 Apr 2020 ABSTRACT: Many companies in Thailand have encouraged farmers, especially those in the northern regions, to cultivate DOA1 and DOA2 japonica rice varieties. Recently, the agronomic traits of DOA1 and DOA2 were altered, affecting yield and cooking quality. Thus, the objectives of this study were to evaluate the agronomic traits and cooking quality of DOA1 and DOA2 and those of exotic japonica varieties in different locations, including the Kamphaeng Saen and Phan districts (WS16). DOA2 was improved by pure-line selection. The results showed that the Phan district was better suited to grow japonica varieties than the Kamphaeng Saen district and that DOA2 produced high grain yields in both locations. Furthermore, DOA2 was selected by the pure-line method in four generations, after which five candidate lines, Tana1 to Tana5, were selected for yield trials. The results of yield trials in three seasons (WS17, DS17/18, WS18) confirmed that Tana1 showed high performance in terms of its agronomic traits and grain yield.
    [Show full text]
  • Comparison of Aroma Active and Sulfur Volatiles in Three Fragrant Rice Cultivars Using GC–Olfactometry and GC–PFPD ⇑ Kanjana Mahattanatawee A, , Russell L
    Food Chemistry 154 (2014) 1–6 Contents lists available at ScienceDirect Food Chemistry journal homepage: www.elsevier.com/locate/foodchem Comparison of aroma active and sulfur volatiles in three fragrant rice cultivars using GC–Olfactometry and GC–PFPD ⇑ Kanjana Mahattanatawee a, , Russell L. Rouseff b a Department of Food Technology, Faculty of Science, Siam University, 38 Petchkasem Road, Phasi-Charoen, Bangkok 10160, Thailand b Institute of Food and Agricultural Sciences, Citrus Research and Education Center, University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA article info abstract Article history: Aroma volatiles from three cooked fragrant rice types (Jasmine, Basmati and Jasmati) were characterised Received 13 October 2013 and identified using SPME GC–O, GC–PFPD and confirmed using GC–MS. A total of 26, 23, and 22 aroma Received in revised form 21 December 2013 active volatiles were observed in Jasmine, Basmati and Jasmati cooked rice samples. 2-Acetyl-1-pyrroline Accepted 30 December 2013 was aroma active in all three rice types, but the sulphur-based, cooked rice character impact volatile, Available online 8 January 2014 2-acetyl-2-thiazoline was aroma active only in Jasmine rice. Five additional sulphur volatiles were found to have aroma activity: dimethyl sulphide, 3-methyl-2-butene-1-thiol, 2-methyl-3-furanthiol, dimethyl Keywords: trisulphide, and methional. Other newly-reported aroma active rice volatiles were geranyl acetate, PCA b-damascone, b-damascenone, and A-ionone, contributing nutty, sweet floral attributes to the aroma of Cooked rice Headspace SPME cooked aromatic rice. The first two principal components from the principal component analysis of sulphur volatiles explained 60% of the variance.
    [Show full text]
  • Understanding G × E Interaction of Elite Basmati Rice (Oryza Sativa L.) Genotypes Under North Indian Conditions Using Stability Models - 5863
    Jain et al.: Understanding G × E interaction of elite basmati rice (Oryza sativa L.) genotypes under north Indian conditions using stability models - 5863 - UNDERSTANDING G × E INTERACTION OF ELITE BASMATI RICE (ORYZA SATIVA L.) GENOTYPES UNDER NORTH INDIAN CONDITIONS USING STABILITY MODELS JAIN, B. T.1 – SARIAL, A. K.2 – KAUSHIK, P.3* 1Department of Genetics & Plant Breeding, CCS Haryana Agriculture University, Hisar, Haryana 125001, India 2CSK Himachal Pradesh Krishi Vishvavidyala, Palampur, Himachal Pradesh 176062, India 3Instituto de Conservación y Mejora de la Agrodiversidad Valenciana, Universitat Politècnica de València, Valencia 46022, Spain *Corresponding author e-mail: [email protected], [email protected]; phone: +34-96-387-7000 (Received 14th Jan 2019; accepted 6th Mar 2019) Abstract. Information regarding the stability of genotypes is critical in expanding the adaptability of released genotypes. But, this information regarding the basmati (scented) rice genotypes cultivated under north Indian conditions are not well known. Therefore, here we have evaluated the twenty-two basmati rice genotypes for stability, based on important traits, and different production system. Genotypes were evaluated for two consecutive Kharif seasons under open field conditions in a randomized complete block design (RCBD). The genotypes were evaluated under four production systems namely, transplanted rice (TPR), system of rice intensification (SRI), direct seeded rice (DSR) in both settings, i.e. wet DSR (W) and dry DSR (D). The stability of genotypes was determined via Eberhart and Russell model, additive main effects and multiplicative interaction (AMMI), and genotype × environment interaction (GGE) biplot model. The stability and adaptability studied using Eberhart and Russell model, AMMI and GGE biplot identified Basmati-370 as the most stable genotype for biological weight; Pusa RH-10 for filled spikelet; CSR-30 for spikelet Number; and Traori Basmati for test grain weight.
    [Show full text]
  • A Study on the Preparation of Modified Starch from Broken Rice
    J. Myanmar Acad. Arts Sci. 2020 Vol. XVIII. No.1C A STUDY ON THE PREPARATION OF MODIFIED STARCH FROM BROKEN RICE Htet Htet Aung1, Khin Hla Mon2, Ohnmar Kyi3, Mon Mon Maung4,Aye Aye Aung5 Abstract This research was emphasized on the preparation of modified broken rice starch using both acid treatment method and cross-link method. Broken rice (Paw Hsan Hmwe) was collected from Bago Township, Bago Region. The most suitable parameters for the preparation of native starch were 1:8 (w/v) ratio of broken rice to water at 4 hr settling time. The optimum conditions for the preparation of modified broken rice starch by acid treatment were 1 mL of 10% HCl, 1mL of 1% NaOH at reaction temperature 65C for 15 min of reaction time. In cross-link method, the optimum parameters were 5mL of 2.5% sodium tripolyphosphate,5mL of 1% NaOH, 5mL of 5 % HCl at 45C for 10 min. The characteristics of modified starch such as ash, moisture, pH and gelatinization temperature, solubility, swelling power, amylose and amylopectin content were determined. The morphology properties, molecular components and structures of native and modified broken rice were determined with Scanning Electron Microscopy (SEM) and FT-IR Analysis. Keywords: Native starches, acid treatment method, cross-link method Introduction Starch is a basis of food and plays a major role in industrial economy. The most abundant substance in nature is starch. Starch consists of semi crystalline carbohydrate synthesized in plant roots, seeds, rhizomes and tubers. It is a polymer of glucose and consists of two types of glucose polymers such as amylose and amylopectin.
    [Show full text]
  • Applications of an Ecophysiological Model for Irrigated Rice (Oryza Sativa)- Echinochloa Competition
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Agronomy & Horticulture -- Faculty Publications Agronomy and Horticulture Department 1996 Applications of an Ecophysiological Model for Irrigated Rice (Oryza sativa)- Echinochloa Competition John L. Lindquist University of Nebraska-Lincoln, [email protected] Martin Kropff University of Minnesota Follow this and additional works at: https://digitalcommons.unl.edu/agronomyfacpub Part of the Plant Sciences Commons Lindquist, John L. and Kropff, Martin, "Applications of an Ecophysiological Model for Irrigated Rice (Oryza sativa)- Echinochloa Competition" (1996). Agronomy & Horticulture -- Faculty Publications. 617. https://digitalcommons.unl.edu/agronomyfacpub/617 This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Agronomy & Horticulture -- Faculty Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Weed Science Society of America Applications of an Ecophysiological Model for Irrigated Rice (Oryza sativa)-Echinochloa Competition Author(s): John L. Lindquist and Martin J. Kropff Reviewed work(s): Source: Weed Science, Vol. 44, No. 1 (Jan. - Mar., 1996), pp. 52-56 Published by: Weed Science Society of America and Allen Press Stable URL: http://www.jstor.org/stable/4045782 . Accessed: 14/09/2012 10:47 Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at . http://www.jstor.org/page/info/about/policies/terms.jsp . JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms of scholarship.
    [Show full text]
  • (Genetically Modified Organisms (Plants) Genetically Engineered Plants)) Why Create Transgenic Plants?
    Transgenic Plants (Genetically modified organisms (plants) Genetically engineered plants)) Why create transgenic plants? When there is no naturally occurring genetic variation for the target trait. Examples: 1. Glyphosate herbicide resistance in soybean, corn 2.Vitamin A in rice 3.Blue roses What genes to transfer? 1. One gene to a few genes - the CP4 ESPS example 2. Multiple genes - Golden Rice and Applause rose 3. In principle, any gene (or genes) ORIGIN 1 cctttcctac tcactctgga caggaacagc tgtctgcagc cacgccgcgc ctgagtgagg 61 agaggcgtag gcaccagccg aggccaccca gcaaacatct atgctgactc tgaatgggcc 121 cagtcctccg gaacagctcc ggtagaagca gccaaagcct gtctgtccat ggcgggatgc 181 cgggagctgg agttgaccaa cggctccaat ggcggcttgg agttcaaccc tatgaaggag 241 tacatgatct tgagtgatgc gcagcagatc gctgtggcgg tgctgtgtac cctgatgggg 301 ctgctgagtg ccctggagaa cgtggctgtg ctctatctca tcctgtcctc gcagcggctc CP4 EPSPS: The gene conferring resistance to the herbicide Roundup The gene was found in Agrobacterium tumefaciens and transferred to various plants Coincidentally, this organism is also used for creating transgenic plants TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT
    [Show full text]
  • Poaceae: Pooideae) Based on Plastid and Nuclear DNA Sequences
    d i v e r s i t y , p h y l o g e n y , a n d e v o l u t i o n i n t h e monocotyledons e d i t e d b y s e b e r g , p e t e r s e n , b a r f o d & d a v i s a a r h u s u n i v e r s i t y p r e s s , d e n m a r k , 2 0 1 0 Phylogenetics of Stipeae (Poaceae: Pooideae) Based on Plastid and Nuclear DNA Sequences Konstantin Romaschenko,1 Paul M. Peterson,2 Robert J. Soreng,2 Núria Garcia-Jacas,3 and Alfonso Susanna3 1M. G. Kholodny Institute of Botany, Tereshchenkovska 2, 01601 Kiev, Ukraine 2Smithsonian Institution, Department of Botany MRC-166, National Museum of Natural History, P.O. Box 37012, Washington, District of Columbia 20013-7012 USA. 3Laboratory of Molecular Systematics, Botanic Institute of Barcelona (CSIC-ICUB), Pg. del Migdia, s.n., E08038 Barcelona, Spain Author for correspondence ([email protected]) Abstract—The Stipeae tribe is a group of 400−600 grass species of worldwide distribution that are currently placed in 21 genera. The ‘needlegrasses’ are char- acterized by having single-flowered spikelets and stout, terminally-awned lem- mas. We conducted a molecular phylogenetic study of the Stipeae (including all genera except Anemanthele) using a total of 94 species (nine species were used as outgroups) based on five plastid DNA regions (trnK-5’matK, matK, trnHGUG-psbA, trnL5’-trnF, and ndhF) and a single nuclear DNA region (ITS).
    [Show full text]
  • Final Report V1.2 Q01108 12 NOV 07
    Rice LabChip Analysis - Q01108 Adaptation Of DNA Analysis Techniques for the Analysis of Basmati Rice Varieties, Adulterant Varieties and other Fragrant Rice Varieties for use on the Agilent 2100 BioAnalyzer Final Technical Report October 2007 12 June 2006 – 20 June 2007 Katherine Steele and Rob Ogden Page 1 of 27 Table of Contents 1. Executive Summary 3 2. Glossary 5 3. Aims and Objectives of the Investigation 6 3.1 Why is enforcement needed for basmati rice? 6 3.2 Existing basmati rice tests with SSR markers 7 3.3 Alternative marker systems for rice 7 3.4 Aims and Objectives 8 4. Experimental Procedures 9 4.1. Sourcing of standard varieties and DNA extraction 9 4.2. Testing INDEL markers in different rice genotypes 10 4.3. Testing Rim2/Hipa and ISSR markers in different rice genotypes 10 4.4. Optimizing multiplex PCRs for INDELS 10 4.5. Developing a SOP for variety analysis of bulk extracts using the LabChip system 10 4.6. Optimizing existing SSRs for LabChip analysis 11 4.7. Evaluating INDEL markers for quantitative testing 11 5. Results and Discussion 12 5.1 Results with INDEL markers 12 5.2 Results with Rim2/Hipa and ISSR markers 12 5.3 Database of markers 14 5.4 Development of INDEL markers for variety testing 16 5.5 Quantitative analysis 16 5.6 Problems encountered when adapting the tests for the Agilent Bioanalyzer 17 6. Acknowledgements 17 7. References 18 Appendices 20 Page 2 of 27 1. Executive Summary Aromatic basmati rice is sold at a premium price on the world market.
    [Show full text]
  • Genetic Variability and Association Studies on Bpt-5204 Based Rice Mutants Under Saline Stress Soil
    Int.J.Curr.Microbiol.App.Sci (2020) 9(2): 2441-2450 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 9 Number 2 (2020) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2020.902.279 Genetic Variability and Association Studies on Bpt-5204 Based Rice Mutants under Saline Stress Soil C. Prashanth1*, K. Mahantashivayogayya1, J. R. Diwan2, P. H. Kuchanur3 and J. Vishwanath1 1Agricultural Research Station, Gangavati, University of Agricultural Sciences, Raichur - 584104, India. 2Department of Genetics and Plant Breeding, College of Agriculture, University of Agricultural Sciences, Raichur- 584104, India 3Department of Genetics and Plant Breeding, College of Agriculture, Bheemarayangudi, University of Agricultural Sciences, Raichur - 584104, India *Corresponding author ABSTRACT Present investigation was carried out with 12 advanced (M7) mutants developed using gamma rays on two varieties i.e., BPT-5204 and RP Bio-226 along with checks (Gangavati Sona and CSR-22) at Agricultural Research Station Gangavati, Karnataka state, India K e yw or ds during kharif 2018. Analysis of variance revealed highly significant differences among the mutant lines for all morpho-physiological characters under study viz., Days to 50 per cent Variability, BPT- flowering, Plant height, Panicle length, Number of grains per panicle, Panicle weight, 5204 mutants, Association, Productive tillers per hill, Length of flag leaf and Grain yield per plant. Higher magnitude of heritability (broad sense) and genetic advance as percentage of mean were observed for Salinity tolerance in rice number of grains per panicle, productive tillers per hill, spikelet sterility, test weight, grain + + yield per plant, grain yield per ha and Na /K ratio indicating presence of additive gene Article Info action and fixation of genes.
    [Show full text]
  • Oryza Glaberrima Steud)
    plants Review Advances in Molecular Genetics and Genomics of African Rice (Oryza glaberrima Steud) Peterson W. Wambugu 1, Marie-Noelle Ndjiondjop 2 and Robert Henry 3,* 1 Kenya Agricultural and Livestock Research Organization, Genetic Resources Research Institute, P.O. Box 30148 – 00100, Nairobi, Kenya; [email protected] 2 M’bé Research Station, Africa Rice Center (AfricaRice), 01 B.P. 2551, Bouaké 01, Ivory Coast; [email protected] 3 Queensland Alliance for Agriculture and Food Innovation, University of Queensland, Brisbane, QLD 4072, Australia * Correspondence: [email protected]; +61-7-661733460551 Received: 23 August 2019; Accepted: 25 September 2019; Published: 26 September 2019 Abstract: African rice (Oryza glaberrima) has a pool of genes for resistance to diverse biotic and abiotic stresses, making it an important genetic resource for rice improvement. African rice has potential for breeding for climate resilience and adapting rice cultivation to climate change. Over the last decade, there have been tremendous technological and analytical advances in genomics that have dramatically altered the landscape of rice research. Here we review the remarkable advances in knowledge that have been witnessed in the last few years in the area of genetics and genomics of African rice. Advances in cheap DNA sequencing technologies have fuelled development of numerous genomic and transcriptomic resources. Genomics has been pivotal in elucidating the genetic architecture of important traits thereby providing a basis for unlocking important trait variation. Whole genome re-sequencing studies have provided great insights on the domestication process, though key studies continue giving conflicting conclusions and theories. However, the genomic resources of African rice appear to be under-utilized as there seems to be little evidence that these vast resources are being productively exploited for example in practical rice improvement programmes.
    [Show full text]
  • Annual Report 2016-17
    ______________________________________________________Annual Report 2016-17 Annual Report 2016-17 Department of Seed Science and Technology WHERE WISDOM IS FREE UTTAR BANGA KRISHI VISWAVIDYALAYA Pundibari, Cooch Behar, West Bengal-736165 1 ______________________________________________________Annual Report 2016-17 1. BACKGROUND Seed Science and Technology has been established as a full-fledged Department in 2013 bifurcating the Genetics and Plant Breeding department in order to active participation in academic activities to enrich students seed science and technology and provide better service as well as awareness among the farmers of the northern parts of West Bengal about use of quality seed and their production technology. 2. FUNCTIONS Teaching, Research and Extension in the field of Seed Science and Technology 2.1. Teaching Teaching of Undergraduate, Postgraduate and Doctor of Philosophy students. Different courses like Crop Physiology and Principles of Seed Technology for Bachelors‟ and all ICAR approved courses of seed science for Master and Doctoral degree programmes are being offered. 2.2. Research 2.2.1. Research Thrust areas under research programme are o Genetic purity and seed quality o Seed enhancement for unfavourable conditions o Improvement of seed storability o Standardizing processing needs in major field crops o Standardization of seed production technology of individual crop o Use of biotechnological tools for enhancement of seed science in respect of synthetic seed and molecular characterization for genetic purity
    [Show full text]
  • ITCHGRASS (Rottboellia Cochinchinensis) from COSTA RICA1
    Molecular basis for resistance to fluazifop-P-butyl in itchgrass ... 143 MOLECULAR BASIS FOR RESISTANCE TO FLUAZIFOP-P-BUTYL IN ITCHGRASS (Rottboellia cochinchinensis) FROM COSTA RICA1 Base Molecular para Resistência a Fluazifop-P-Butyl em Capim-Camalote (Rottboellia cochinchinensis) da Costa Rica CASTILLO-MATAMOROS, R.2, BRENES-ANGULO, A.2, HERRERA-MURILLO, F.3, and GÓMEZ-ALPÍZAR. L.2 ABSTRACT - Rottboellia cochinchinensis is an annual grass weed species known as itchgrass, or “caminadora” in America´s Spanish speaking countries, and has become a major and troublesome weed in several crops. The application of fluazifop-P-butyl at recommended rates (125 g a.i. ha-1) was observed to be failing to control itchgrass in a field in San José, Upala county, Alajuela province, Costa Rica. Plants from the putative resistant R. cochinchinensis population survived fluazifop-P-butyl when treated with 250 g a.i. ha-1 (2X label rate) at the three- to four-leaf stage under greenhouse conditions. PCR amplification and sequencing of partial carboxyl transferase domain (CT) of the acetyl-CoA carboxylase (ACCase) gene were used to determine the molecular mechanism of resistance. A single non-synonymous point mutation from TGG (susceptible plants) to TGC (putative resistant plants) that leads to a Trp-2027-Cys substitution was found. This Trp-2027-Cys mutation is known to confer resistance to all aryloxyphenoxyproprionate (APP) herbicides to which fluazifop-P-butyl belongs. To the best of our knowledge, this is the first report of fluazifop-P-butyl resistance and a mutation at position 2027 for a Costa Rican R. cochinchinensis population.
    [Show full text]