Differential Expression of Adenosine A3 Receptors Controls Adenosine A2A Receptor-Mediated Inhibition of TLR Responses in Microglia
Total Page：16
File Type：pdf, Size：1020Kb
The Journal of Immunology Differential Expression of Adenosine A3 Receptors Controls Adenosine A2A Receptor-Mediated Inhibition of TLR Responses in Microglia Ce´line van der Putten,* Ella A. Zuiderwijk-Sick,* Linda van Straalen,* Eveline D. de Geus,‡ Leonie A. Boven,‡ Ivanela Kondova,† Ad P. IJzerman,§ and Jeffrey J. Bajramovic1* Microglia activation is a prominent feature in many neuroinflammatory disorders. Unrestrained activation can generate a chronic inflammatory environment that might lead to neurodegeneration and autoimmunity. Extracellular adenosine modulates cellular activation through adenosine receptor (ADORA)-mediated signaling. There are four ADORA subtypes that can either increase (A2A and A2B receptors) or decrease (A1 and A3 receptors) intracellular cyclic AMP levels. The expression pattern of the subtypes thus orchestrates the cellular response to extracellular adenosine. We have investigated the expression of ADORA subtypes in unstimulated and TLR-activated primary rhesus monkey microglia. Activation induced an up-regulation of A2A and a down- regulation of A3 receptor (A3R) levels. The altered ADORA-expression pattern sensitized microglia to A2A receptor (A2AR)- mediated inhibition of subsequent TLR-induced cytokine responses. By using combinations of subtype-specific agonists and antagonists, we revealed that in unstimulated microglia, A2AR-mediated inhibitory signaling was effectively counteracted by A3R-mediated signaling. In activated microglia, the decrease in A3R-mediated signaling sensitized them to A2AR-mediated in- hibitory signaling. We report a differential, activation state-specific expression of ADORA in microglia and uncover a role for A3R as dynamically regulated suppressors of A2AR-mediated inhibition of TLR-induced responses. This would suggest exploration of combinations of A2AR agonists and A3R antagonists to dampen microglial activation during chronic neuroinflammatory conditions. The Journal of Immunology, 2009, 182: 7603–7612. icroglia are macrophage-like resident cells of the sine receptor (ADORA)2-mediated signaling. Documented effects brain. Under inflammatory conditions, microglia be- of adenosine include the inhibition of LPS-induced production of M come activated, as indicated by an altered morphol- proinflammatory cytokines such as TNF-␣ and IL-12 by macro- ogy, the production of inflammatory mediators, and by the in- phages and monocytes and the facilitated production of the anti- creased expression of molecules involved in Ag presentation (1, inflammatory cytokine IL-10 by LPS-treated macrophages (13– 2). Activated microglia are a prominent feature in a wide variety of 15). During periods of high metabolic activity such as ischemia neuroinflammatory disorders where they are attributed roles as and inflammation, extracellular levels of adenosine are strongly APCs as well as effector cells. increased, possibly forming an endogenous brake on inflammation TLR are part of the innate immune system and recognize patho- (16, 17). gen-associated molecular patterns (3, 4). To date, ten members of The cellular response to extracellular adenosine is orchestrated the TLR family have been described for human and nonhuman by the expression pattern of four different ADORA subtypes: A1, primates (5). Ligand binding to TLR leads to cellular activation by A2A,A2B, and A3, which are characterized by their capacity to activation of the transcription factor NF- B, which in turn induces either increase or decrease intracellular cAMP levels (16). A1 and ␣ the production of cytokines such as TNF- and IL-12 (4, 6–8). A3 receptors (A1R and A3R) are coupled to Gi protein signaling Human microglia express mRNA for a broad variety of TLR, and and mediate biological effects opposite to A2A and A2B receptors activation of rhesus monkey microglia via TLR1/2, -2/6, -3, -4, -5 (A2AR and A2BR), which are coupled to Gs protein signaling. Ro- and -8 was recently described to trigger a rapid inflammatory re- dent microglia have been reported to express functional A1,A2A, sponse (9–12). Such a response must be tightly regulated because and A3, but not A2B receptors (18), whereas studies detailing unrestrained TLR signaling can generate a chronic inflammatory ADORA expression profiles on human or nonhuman primate mi- environment that might lead to neurodegeneration. croglia are currently lacking. In addition, little is known about the Several studies have shown that extracellular adenosine modu- dynamics of ADORA expression after TLR-mediated activation lates TLR-mediated activation through G-protein coupled, adeno- and the consequences thereof during chronic inflammatory conditions. *Alternatives Unit and †Animal Science Department, Biomedical Primate Research Centre, Rijswijk, The Netherlands; ‡Department of Immunology, Erasmus MC, Rot- terdam, The Netherlands; and §Division of Medicinal Chemistry, Leiden/Amsterdam Center for Drug Research, Leiden, The Netherlands 2 Abbreviations used in this paper: ADORA, adenosine receptor; A1R, A1 receptor; Received for publication October 9, 2008. Accepted for publication April 14, 2009. A3R, A3 receptor; A2AR, A2A receptor; A2BR, A2B receptor; CGS21680, 2-p-(2- carboxyethyl)phenethylamino-5Ј-N-ethylcarboxamidoadenosine hydrochloride; The costs of publication of this article were defrayed in part by the payment of page DPCPX, 8-cyclopentyl-1,3-dipropylxanthine; IB, inhibitor of NF-B proteins; charges. This article must therefore be hereby marked advertisement in accordance NECA, 5Ј-(N-ethylcarboxamido)adenosine; SCH58261, 7-(2-phenylethyl)-5-amino- with 18 U.S.C. Section 1734 solely to indicate this fact. 2-(2-furyl)-pyrazolo-[4,3-e]-1,2,4-triazolo[1,5-c]pyrimidine; VUF5574, N-(2-me- 1 Address correspondence and reprint requests to Dr. Jeffrey J. Bajramovic, Alterna- thoxyphenyl)-NЈ-[2-(3-pyridinyl)-4-quinazolinyl]-urea. tives Unit, Biomedical Primate Research Centre, Lange Kleiweg 139, 2280 GH Ri- jswijk, The Netherlands. E-mail address: [email protected] Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.0803383 7604 DYNAMIC A3R EXPRESSION CONTROLS A2AR-MEDIATED TLR INHIBITION Table I. Primer and probe sequences Target Forward Primer (5Ј–3Ј) Reverse Primer (5Ј–3Ј) Probe Amplicon Size (bp) Used in A1R CTATGTTTGGCTGGAACAAT GCTGCTTGCGGATTAGGTAG 207 RT-PCR A2AR CTCATGCTGGGTGTCTATTT TGAAGCAGTTGATGATGTGT 193 RT-PCR A2BR ATTTCTTTGGGTGTGTTCTG ACTTGGGCTTATTTTTACCC 252 RT-PCR A3R CTGGAACATGAAACTGACCT GAGTTTGTTCCGAATGATGT 181 RT-PCR -actin GGTCATCACCATTGGCAATGA ACGTCACACTTCATGATGGAGTTG 122 RT-PCR A1R GTCAAGATCCCTCTCCGGTA CCACCACGAAGGAGAGGA GGCTGCTG 91 Real-time RT-PCR A2AR CCAACTACTTCGTGGTGTCG GTAATGGCAAAGGGGATGG GGCGGCGG 73 Real-time RT-PCR A2BR TCTGTGTCCCGCTCAGGT GATGCCAAAGGCAAGGAC TGCTGTCC 89 Real-time RT-PCR A3R GGGTCAAGCTTACCGTCAGA ATGACACCAGCCAGCAAAG GGCCCTGG 84 Real-time RT-PCR GAPDH TCCACTGGCGTCTTCAC GGCAGATGATGACCCTTTT AGCCCCAG 78 Real-time RT-PCR Using primary rhesus monkey microglia, we characterized the Primary cell isolation and culture expression of ADORA subtypes in unstimulated and TLR-acti- Primary microglia were obtained from adult rhesus monkeys at necropsy as vated microglia. Microglia simultaneously up-regulated A2AR and described previously (12). Briefly, tissue samples from prefrontal subcor- ϳ down-regulated A3R expression levels upon TLR-mediated acti- tical white matter were collected, divided into cubes of 3 g, and meninges vation. As a consequence, ADORA-mediated inhibition of subse- and visible blood vessels were removed before mincing the tissue into 3 quent TLR-induced TNF-␣ and IL-12p40/p70 production was cubes of less than 2 mm . Tissue fragments were incubated at 37°C for 20 min in HBSS (Ϯ8 ml/g tissue) containing 0.25% w/v porcine trypsin (Sig- much more potent in activated than in unstimulated microglia. This ma-Aldrich), 0.2 mg/ml EDTA, 1 mg/ml glucose, and 0.1 mg/ml bovine could be attributed to an increase in A2AR-mediated signaling and pancreatic DNase I (Sigma-Aldrich). The supernatant (no centrifugation) involved suppression of NF-B activation. By using combinations was discarded and the pellet was resuspended in microglia medium, i.e., of subtype-specific agonists and antagonists, we revealed that in 1:1 v/v DMEM (high glucose)/HAMF10 (with L-glutamine) with 10% v/v FCS and antibiotic supplement (penicillin 100 U/ml and streptomycin 0.1 unstimulated microglia, A2AR-mediated inhibitory signaling was mg/ml) (all purchased from Life Technologies), washed once, and passed effectively counteracted by A3R-mediated signaling. In activated through a 100-m nylon cell strainer (BD Biosciences). Following cen- ϫ microglia, the decrease in A3R-mediated signaling shifted the bal- trifugation at 300 g for 7 min, the resuspended pellet was subjected to ance toward A R-mediated signaling, sensitizing the cells to in- Percoll gradient centrifugation and hypotonic shock to remove erythro- 2A ϫ 5 hibitory signaling. We report a differential, activation state-specific cytes. Cells were plated at a density of 2.2–2.5 10 /ml in tissue culture- treated 6- or 24-well plates (Corning Costar). After 24 h incubation at 37°C expression of ADORA in microglia and uncover a role for A3Ras in a humidified atmosphere containing 5% CO2, unattached cells and my- dynamically regulated suppressors of A2AR-mediated inhibition of elin debris were removed by washing and replaced by microglia medium TLR-induced responses. These findings contribute significantly to supplemented with Ն4 U recombinant human M-CSF/ml