Association Analysis of BANK1 Gene with Psoriasis in Southern Han Chinese

doi: 10.1111/j.1744-313X.2011.01045.x

Association analysis of BANK1 gene with psoriasis in Southern Han Chinese

X. Zhang*,1, Z. Fei†,1, J. Wan‡, J. Xu§, B. Yu¶ & M. Guan*,§,**

95% CI: 1.05–1.81, P = 0.0203). Overall, our result Summary indicates that polymorphism in BANK1 is associated Psoriasis is a chronic inflammatory skin disease with an with susceptibility to psoriasis in Southern Han Chi- immunogenetic background. This study aimed to deter- nese. mine the association between three functional SNPs of BANK1 (rs10516487, rs17266594 and rs3733197) with psoriasis in Southern Han Chinese population by Introduction determining their frequency in 242 patients with pso- Psoriasis is a common, chronic and inflammatory skin riasis and 317 healthy individuals. The genotype disease, with different kinds of immunological disor- frequencies of the detected polymorphisms were anal- ders. The typical character is described as discrete ery- ysed in relation to the susceptibility of psoriasis. Our thematous plaques covered by a silvery white scale in data show that there is no significant difference in characteristic locations (Navarini & Trueb, 2010). genotype distribution for the three BANK1 SNPs Global incidence of psoriasis is 0.6–4.8%, and in between patients and healthy controls. The AA fre- China, it is 1.23&, possibly due to differences in quency of rs3733197 is significantly higher in patients genetic and environmental factors. Although the path- with psoriasis onset before the age of 23 than in those ogenesis of psoriasis has been attributed to the activa- with late disease onset (P = 0.0069). In addition, tion of dendritic cells, T cells and keratinocytes in the analysis on BANK1 haplotype also suggests a protective psoriatic plaque (Monteleone et al., 2010), the au- role for TGC and CAT haplotype from psoriasis (OR toantibodies are recently found to be present in psori- 0.55, 95% CI: 0.34–0.89; P = 0.0144; OR 0.62, 95% asis and psoriasis arthritis (Tagami et al., 1983; CI: 0.42–0.92; P = 0.0175), whereas CGT haplotype is Leitch & Haslock, 1997; Singh & Singh, 2010), sug- associated with increased risk of the disease (OR 1.38, gesting an effective role of B cells and probably their secreted signalling molecules in this disease progres- sion. B-cell scaffold protein with ankyrin repeats 1

* Central Laboratory, Huashan Hospital, Shanghai Medical College, (BANK 1) is a B-cell-speciﬁc scaffold protein and Fudan University, Shanghai, China, † Department of Traditional Chi- Lyn tyrosine kinase substrate that facilitates the phos- nese medicine, Huashan Hospital, Shanghai Medical College, Fudan phorylation and activation of IP3R by Lyn and sub- University, Shanghai, China, ‡ Shenzhen Key Lab for Translational sequent release of Ca2+ from endoplasmic reticulum Medicine of Dermatology, Shenzhen-PKU-HKUST Medical Center, (Kozyrev et al., 2008). Nonsynonymous SNP Shenzhen, China, § Department of Dermatology, Huashan Hospital, Shanghai Medical College, Fudan University, Shanghai, China, rs10516487 (R61H), branch point-site SNP – Department of Dermatology, Shenzhen Hospital Peking University, rs17266594 and a third variant rs3733197 (A383T) Shenzhen, China, ** Department of Laboratory Medicine, Huashan in the ankyrin domain of BANK1 are functional dis- Hospital, Shanghai Medical College, Fudan University, Shanghai, ease-associated variants that contribute to the suscep- China tibility of several autoimmunity diseases, including Received 27 April 2011; revised 16 August 2011; accepted 15 Sep- SLE (Kozyrev et al., 2008; Chang et al., 2009), RA tember 2011 (Orozco et al., 2009) and systemic sclerosis (Rueda Correspondence: Ming Guan, Department of Laboratory Medicine, et al., 2010). Given important roles of B cells in Huashan Hospital, Shanghai Medical College, Fudan University, 12 Central Urumqi Road, Shanghai, China. Tel: 0086 21 52888048; autoimmune diseases and recent discovery of autoan- Fax: 0086 21 62481061; E-mail: [email protected] tibodies in psoriasis, it would be of interest to inves- Bo Yu, Department of Dermatology, Shenzhen Hospital Peking tigate the link between BANK1 polymorphisms and University, No. 1120, Lian-Hua Road, Fu-Tian District, Shen-Zhen, psoriasis in the genetic homogeneous population of Guangdong, China. Tel: 0086 755 83923333; ext 849; Han Chinese living in Guangdong Province, aiming E-mail: [email protected] to deﬁne whether this gene plays a key role in the 1 X. Zhang and Z. Fei equally contributed to this study. autoimmune disease.

ª 2011 Blackwell Publishing Ltd, International Journal of Immunogenetics 38, 507–512 507 508 X. Zhang et al.

Materials and methods PCR to reach plateau. The reagent contained the fol- lowing: 0.5 U Taq HS (Takara, Shiga, Japan), 2 lL 2+ 10 · PCR Buffer (Mg Free, Takara), 1.5 mM MgCl Patients 2 (Takara), 0.2 mM dNTP mixture (Takara), 0.05 lM The study involved 242 patients with psoriasis and forward primer, 0.5 lM reverse primer, 0.5 lM unla- 317 healthy controls. Patients with psoriasis (158 belled probe, 0.6 lL1· SYTO 9 dye (Invitrogen, men ⁄ 84 women, mean age: 34.43 ± 12.88 years) are Carlsbad, CA, USA) and 40 ng DNA were added to of Han Chinese ethnics living in Guangdong Province. the mix solution and then complemented by water to All patients were diagnosed to have psoriasis by at 20 lL. least two independent dermatologists in the dermatol- The PCR conditions were as follows: initial denatur- ogy department in Shenzhen Hospital Peking Univer- ation at 95C for 2 min, 50 cycles at 94C for 30 s, sity. Detailed clinical records were available for all 58C (60C for rs3733197) for 30 s and 72C for patients, including age, gender, disease onset time and 30 s. PCR products were heated to 95C followed by family disease history. Psoriasis area severity index rapid cooling to 40C to facilitate heteroduplex forma- (PASI) was calculated for every patient. Patients were tion. Melting curve analysis was performed by raising considered to have ‘early-onset’ psoriasis if the onset temperature from 55 to 89C at 0.2C ⁄ s. Genotypes of the disease was at any age younger than 40 years were identified by the melting temperatures indicated and ‘late-onset’ psoriasis if the disease shows up later by peaks on the derivate plots. than age of 40. The control group comprised 317 healthy individuals selected from blood bank donors Statistical analysis to maximize the match for age (185 men ⁄ 132 women, mean age: 37.16 ± 9.88 years), gender and geographic The statistical analysis was performed on SHEsis online origin. This study was approved by the Ethics Com- software (http://analysis.bio-x.cn/myAnalysis.php). The mittee of Shenzhen Hospital Peking University and Hardy–Weinberg equilibrium of the BANK 1 polymor- conducted in accordance with the declaration of Hel- phism was examined by chi-square test. The differences sinki guidelines for ethics in research. All patients gave in genotype and allele frequencies between patients and written informed consent for genetic studies. Charac- controls were also compared, and value of P < 0.05 was teristics of the study participants are shown in considered to be significant. Differences in allele fre- Table 1. quency was quantified by odds ratios (OR) and 95% CI.

BANK 1 single-nucleotide polymorphisms (SNPs) Power calculation genotyping Power was calculated with the ‘Generic Chi-square Genomic DNA was extracted from fresh peripheral test’ module of the ‘Java Applets for Power and Sam- blood. We selected three functional BANK1 SNPs: ple Size’ software (Lenth, 2007) (http://www.divms. rs10516487 (C>T), rs3733197 (G>A) and rs17266594 uiowa.edu/~rlenth/Power/) at the level of significance (T>C). Genotyping of BANK1 SNPs was carried out where a = 0.05, under the prototype data previously by unlabelled probe high-resolution melting (HRM) identified for SLE (Kozyrev et al., 2008). It was con- assay. Probes are C3-blocked on the 3¢-end to prevent firmed that the sample size we chose could provide extension. Sequences of primer and unlabelled probe sufficient power (>80%) to identify a genetic associa- are shown in Table 2. tion with the three polymorphisms. Unlabelled probe HRM analysis was carried out through asymmetric PCR. After asymmetric PCR, a Results large number of superfluous single strand will com- bined with unlabelled probe. As the temperature High-resolution melting analysis with unlabelled probe drops, it will produce two types of melting curve. The part of curve in low melting temperature (Tm) repre- High-resolution melting analysis with unlabelled C3- sents the region of probe and product. The asymmetric blocked probe was used for genotyping. The sensitivity PCR requires five to ten more cycles than conventional and accuracy of HRM were dramatically improved

Table 1. Characteristics of study participants

Early-onset Late-onset Mild Moderate Severe psoriasis psoriasis psoriasis <10 psoriasis 10–20 psoriasis >20 Controls

Total number of subjects 203 39 23 98 121 317 Men, n (%) 126 (62.1) 32 (82.1) 12 (52.2) 62 (63.3) 84 (69.4) 185 (58.4) Women, n (%) 77 (37.9) 7 (17.9) 11 (47.8) 36 (36.7) 37 (30.6) 132 (41.6) Age at enrolment (years), mean (SD) 30.5 (8.9) 55.6 (9.0) 30.8 (8.9) 33.7 (12.7) 35.6 (13.6) 37.2 (9.9) Age at onset of symptoms (years), mean (SD) 23.7 (7.1) 50.1 (8.2) 23.8 (10.8) 28.6 (11.9) 28.2 (12.5)

ª 2011 Blackwell Publishing Ltd, International Journal of Immunogenetics 38, 507–512 Association of BANK1 with psoriasis 509

Table 2. Sequences of primer and unlabelled probe bution for any BANK1 SNPs (rs10516487, rs3733197 and rs17266594) between patients and healthy con- Primer trols. The allele and genotype frequencies are shown SNP name Sequence (5¢–3¢) in Table 3. PASI is a widely used method to charac- rs10516487 Forward ACATTTGTAAGACGTTAAGTTCAGCA terize the severity of the disease (Goedkoop et al., Reverse ATGATATATGAAGAAGATGCTGAGGA 2004). In our study, PASI was used to divide the Probe GAAAAGAGAAATTCTCCAAGCGATA patients with psoriasis into two different levels: level TAACAGGATG 1 = PASI < 20; level 2 = PASI ‡ 20. As shown in rs3733197 Forward GCTTCAATGTTCAGGAGCAA Table 3, the distribution of genotypes of the three Reverse CAGTCTCTTCTACAATATCAAACAGAA Probe CAGACCCCGCACATATTGCTGAAAGG SNPs showed no significant relationship with the PASI CATGGTCA score. No significant difference was observed between rs17266594 Forward AGGACTTTCATAGAGTTTTTCTCTGG the two groups stratified by gender. However, it shows Reverse CATTCCTCAGCATCTTCTTCA significant difference for rs3733197 according to Probe TAATAATTTAACCTGCTGATAGCATTG patient onset age. The frequencies of AA genotype for CAAATAT rs3733197 were significantly higher in patients with a

Underlined nucleotides were the locations of the SNPs detected in disease onset before age 23 than after 23 the assay. (P = 0.0069). using unlabelled probes (Fig. 1, left part). Probes were The association of BANK1 haplotype with psoriasis designed to perfectly match with ancestral allele (allele C, G and T for rs10516487, rs3733197 and Although rs10516487 is in strong linkage disequilib- rs17266594, respectively). The melting temperature of rium with rs17266594, the haplotypes of the two probe ⁄ product duplexes for the other genotype is SNPs do not have signiﬁcant associations with psoria- lower than that of the matched one. Meanwhile, the sis. Then, we assessed the association of the three heterozygosis will have these two kinds of feature. In SNPs. The TGC and CAT haplotypes were found to this way, we were able to discriminate all the geno- have signiﬁcantly lower frequency in psoriasis group types clearly. As shown in Fig. 1, three genotypes (P = 0.0144, 0.0175), indicating a protective effect. (CC, CT and TT) of SNP rs10516487 were accurately On the other hand, CGT haplotype increased in psori- distinguished by the derivative melting curves in the asis group, suggesting that CGT may represent a risk probe region. factor for psoriasis (Table 4).

The association of BANK1 genotype with psoriasis Discussion Distribution of the polymorphism was evaluated in Genetic factors play an important role in aetiology of patient and control groups. SNP frequencies were in psoriasis. Multiple lines of evidences suggested that Hardy–Weinberg equilibrium (P > 0.05). The strong genetic risk factors predispose humans to this autoim- linkage disequilibrium was observed between mune disorder (Liu et al., 2007; Reich & Szepietow- rs10516487 and rs17266594 (D¢ = 0.993, r2 = 0.980). ski, 2007; Roberson & Bowcock, 2010). There is an There was no significant difference in genotype distri- increasing interest to investigate genes that confer a modest level of risk. This is the first study to report an association between BANK1 variants and psoriasis, which was validated in a genetically homogeneous cohort. In the case–control design, we investigated the relationship between human BANK1 functional polymorphisms and psoriasis in southern China. Our results showed that allele and genotype frequencies of the three polymorphisms do not differ between patients and controls. However, our result showed that the CGT (rs10516487, rs3733197 and rs17266594) haplotype is a marker for genetic susceptibility to psoriasis. This finding is also in agreement with a Spain study (Orozco et al., 2009) in which the same haplotype was linked to RA, suggesting an additive effect of BANK1 variants. We also found that the TGC and CAT haplotypes may be protective against Figure 1. Derivative melting curve of rs10516487 by unlabelled psoriasis (P = 0.0144, 0.0175). probe melting analysis. Every melting curve has two derivative peaks at least. The one of low melting temperature represents The frequencies of genotype or allele of the three probe ⁄ product duplex melting transition. The other represents ampli- SNPs were not statistically different in the type 1 con duplex melting transition. psoriasis (early onset, £40 years of age) and type 2

ª 2011 Blackwell Publishing Ltd, International Journal of Immunogenetics 38, 507–512 1 .Zhang X. 510 tal. et

Table 3. Association analysis of BANK 1 SNPs in Chinese psoriasis cases and controls

PASI Onset age Women Men

Psoriasis (%) Controls (%) <20 ‡20 <23 ‡23 Psoriasis Control Psoriasis Control (n = 242) (n = 317) P value (n = 185) P value (n = 57) P value (n = 56) (n = 186) P value (n = 84) (n = 132) P value (n = 158) (n = 185) P value

rs10516487 ª TT 4 (0.017) 7 (0.022) 0.7691 3 (0.016) 0.6015 1 (0.017) 0.8742 2 (0.036) 2 (0.011) 0.3843 1 (0.012) 2 (0.015) 0.9804 3 (0.019) 5 (0.027) 0.6845 01BakelPbihn Ltd, Publishing Blackwell 2011 CT 64 (0.264) 90 (0.284) 46 (0.249) 18 (0.316) 16 (0.286) 48 (0.258) 23 (0.274) 36 (0.273) 41 (0.259) 54 (0.292) CC 174 (0.719) 220 (0.694) 136 (0.735) 38 (0.667) 38 (0.679) 136 (0.731) 60 (0.714) 94 (0.712) 114 (0.722) 126 (0.681) Allele T 72 (0.149) 104 (0.164) 0.4871 52 (0.141) 0.3215 20 (0.175) 0.7631 20 (0.179) 52 (0.140) 0.3119 25 (0.149) 40 (0.152) 0.9389 47 (0.149) 64 (0.173) 0.3902 Allele C 412 (0.851) 530 (0.836) 318 (0.859) 94 (0.825) 92 (0.821) 320 (0.860) 143 (0.851) 224 (0.848) 269 (0.851) 306 (0.827) rs3733197 AA 9 (0.037) 18 (0.057) 0.5570 4 (0.022) 0.1632 5 (0.088) 0.5922 6 (0.107) 3 (0.016) 0.0069 5 (0.060) 5 (0.038) 0.7213 4 (0.025) 13 (0.070) 0.1469 GA 71 (0.293) 93 (0.293) 53 (0.286) 18 (0.316) 15 (0.268) 56 (0.301) 26 (0.310) 39 (0.295) 45 (0.285) 54 (0.292) GG 162 (0.669) 206 (0.650) 128 (0.692) 34 (0.596) 35 (0.625) 127 (0.683) 53 (0.630) 88 (0.667) 109 (0.690) 118 (0.638) Allele A 89 (0.184) 129 (0.203) 0.4128 61 (0.165) 0.1319 28 (0.246) 0.3090 27 (0.241) 62 (0.167) 0.0748 36 (0.214) 49 (0.186) 0.4648 53 (0.168) 80 (0.216) 0.1093 Allele G 395 (0.816) 505 (0.797) 309 (0.835) 86 (0.754) 85 (0.759) 310 (0.833) 132 (0.786) 215 (0.814) 263 (0.832) 290 (0.784) nentoa ora fImmunogenetics of Journal International rs17266594 CC 4 (0.017) 7 (0.022) 0.7325 3 (0.016) 0.5606 1 (0.017) 0.8939 2 (0.036) 2 (0.011) 0.3843 1 (0.012) 2 (0.015) 0.9629 3 (0.019) 5 (0.027) 0.6954 TC 64 (0.264) 91 (0.287) 46 (0.249) 18 (0.316) 16 (0.286) 48 (0.258) 22 (0.262) 36 (0.273) 42 (0.266) 55 (0.297) TT 174 (0.719) 219 (0.691) 136 (0.735) 38 (0.667) 38 (0.679) 136 (0.731) 61 (0.726) 94 (0.712) 113 (0.715) 125 (0.676) Allele C 72 (0.149) 105 (0.166) 0.4443 52 (0.141) 0.2913 20 (0.175) 0.7958 20 (0.179) 52 (0.140) 0.3119 24 (0.143) 40 (0.152) 0.8050 48 (0.152) 65 (0.176) 0.4027 Allele T 412 (0.851) 529 (0.834) 318 (0.859) 94 (0.825) 92 (0.821) 320 (0.860) 144 (0.857) 224 (0.848) 268 (0.848) 305 (0.824) 38 507–512 , Association of BANK1 with psoriasis 511

Table 4. Haplotypes of BANK1 with three SNPs in the order nergic receptors and regulates keratinocyte calcium rs10516487, rs3733197 and rs17266594 flux (Pillai & Bikle, 1992). Previous studies indicated that T cells play a central Haplotype Frequency P value OR (95% CI) Effect role in pathogenesis of psoriasis. However, recent TAC studies also showed the importance of B cells. Johnson Case 0.094 0.1885 1.33 (0.87–2.04) Neutral et al. (2005) reported the presence of anti-dsDNA Control 0.073 antibodies in patients with psoriatic arthritis (PsA). In TGC addition, ANA was found in patients with PsA and Case 0.052 0.0144 0.55 (0.34–0.89) Protection cutaneous psoriatic forms. Disease severity in patients Control 0.091 CAT with psoriasis was correlated with the serum levels of Case 0.085 0.0175 0.62 (0.42–0.92) Protection BAFF (Samoud-El Kissi et al., 2008). BAFF was iden- Control 0.131 tified as a potent B-cell stimulatory molecule associ- CGT ated with systemic autoimmune diseases including Case 0.764 0.0203 1.38 (1.05–1.81) Risk systemic lupus erythematosus and Sjo¨ gren’s syndrome Control 0.704 (Matsushita & Sato, 2005; Moisini & Davidson, 2009). BANK1 may have profound effects on the modulation of B-cell activity and epidermal proliferation and skin barrier formation through Ca2+ mobili- psoriasis (late onset, >40 years of age) cases compared zation in psoriasis, although the precise role of to controls. Nor is there difference between patients of BANK1 remains to be elucidated. different gender. In principle, people of all ages can High-resolution melting-based methods in ‘closed- develop psoriasis. Previous study on the onset of psori- tube’ formats are attractive because they offer several asis in 2400 patients showed a peak incidence at methodological advantages (rapid turnaround time, no 22.5 years of age and a second peak of onset around post-PCR processing steps and smaller risk of contami- age 55 (Freedbery et al., 2003). In this study, we nation hazard) over other conventional gene scanning divided all patients into two groups by the cut-off at methods. However, HRM also carries its limitations in 23 years of age. By analysing further the distribution the low capacity of discriminating the two homozy- of BANK1 polymorphisms in psoriasis subgroups, we gote profiles when Tm difference is small. Unlabelled found that rs3733197 (A383T in ankyrin domain) was probe HRM is superior to conventional HRM in the associated with an increased risk in patients with pso- identification of many small insertions or deletions riasis whose disease onset was earlier than 23 years of and some Class 3 and Class 4 SNPs (7–9% of human age (P = 0.0069). The A383 variant appears to be SNPs) (Wittwer, 2009; Montgomery et al., 2010). By associated with diffuse cutaneous systemic sclerosis introducing an unlabelled probe covering the SNPs, and SLE (Kozyrev et al., 2008; Dieude et al., 2009). the different genotypes can be clearly distinguished. The minor allele 383T of rs3733197 might create a Meanwhile, our study is subject to several limita- site for threonine kinases, which may contribute to the tions. First, the sample size of case and control groups early onset of psoriasis. Despite these associations, is relatively small, although the current number of their functional consequences of these SNPs on B-cell samples could present enough power to detect the pos- regulation and autoimmunity remain to be investi- sible association. Second, the selection of SNPs that gated. Our result provides further evidence that were analysed in this study is on a hypothetical func- patients with different onset age of psoriasis differ in tional basis, and more extensive studies are needed to their genetic background. In addition, an association illustrate the exact role of BANK1 in psoriasis. Third, between the BANK1 polymorphisms and psoriasis in our association analysis, we recruited the case–con- severity was not found. trol samples from Southern Han Chinese; the recent BANK1 association was first identified in Scandina- studies showed that strong genetic variability of Han vian patients with SLE (Kozyrev et al., 2008) and fur- Chinese exists between the Northern Han Chinese and ther replicated in European Americans (Guo et al., the Southern Han Chinese (Chen et al., 2009; Xu 2009; Suarez-Gestal et al., 2009; Orozco et al., 2011) et al., 2009). Therefore, other well-designed studies and Chinese populations (Chang et al., 2009; Guan with different ethnic populations are warranted to ver- et al., 2011). Expression of BANK1 in B cells may sig- ify our findings. nificantly distort intracellular calcium signalling by In conclusion, we show that the rs3733197 geno- releasing Ca2+ from endoplasmic reticulum stores. type is associated with an increased risk of psoriasis at Alteration in B-cell activation may then shift the bal- age <23 years in a South China population. Although ance of proliferation and differentiation in epidermal there is no significant difference in genotype distribu- keratinocytes. Previous study showed the keratinocytes tion for disease severity and gender between patients of psoriatic subjects have an inborn error of calcium with psoriasis and controls, the 3-SNP haplotype anal- metabolism (Karvonen et al., 2000), and the increase ysis found that the major TGC and CAT haplotypes in epidermal proliferation is thought to be due to are protective factors for psoriasis. In addition, we increased release of ATP which in turn activates puri- found a common CGT haplotype that is significantly

ª 2011 Blackwell Publishing Ltd, International Journal of Immunogenetics 38, 507–512 512 X. Zhang et al. associated with psoriasis. Our study proved that Liu, Y., Krueger, J.G. & Bowcock, A.M. (2007) Psoriasis: genetic BANK1 is a new psoriasis genetic susceptibility factor associations and immune system changes. Genes and Immu- for psoriasis in southern Chinese Han population. nity, 8,1. Matsushita, T. & Sato, S. (2005) The role of BAFF in autoimmune diseases. Japanese Journal of Clinical Immunology, 28, Conflict of interest 333. Moisini, I. & Davidson, A. (2009) BAFF: a local and systemic The authors state no conflict of interest. target in autoimmune diseases. Clinical and Experimental Immunology, 158, 155. Monteleone, G., Pallone, F., MacDonald, T.T., Chimenti, S. & References Costanzo, A. (2010) Psoriasis: from pathogenesis to novel ther- apeutic approaches. Clinical Science (London, England: 1979), Chang, Y.K., Yang, W., Zhao, M., Mok, C.C., Chan, T.M., 120,1. Wong, R.W. et al. (2009) Association of BANK1 and TNFSF4 Montgomery, J.L., Sanford, L.N. & Wittwer, C.T. (2010) High- with systemic lupus erythematosus in Hong Kong Chinese. resolution DNA melting analysis in clinical research and diag- Genes and Immunity, 10, 414. nostics. Expert Review of Molecular Diagnostics, 10, 219. Chen, J., Zheng, H., Bei, J.X., Sun, L., Jia, W.H., Li, T. et al. Navarini, A.A. & Trueb, R.M. (2010) Psoriasis. Therapeutische (2009) Genetic structure of the Han Chinese population Umschau, 67, 153. revealed by genome-wide SNP variation. American Journal of Orozco, G., Abelson, A.K., Gonzalez-Gay, M.A., Balsa, A., Pasc- Human Genetics, 85, 775. ual-Salcedo, D., Garcia, A. et al. (2009) Study of functional Dieude, P., Wipff, J., Guedj, M., Ruiz, B., Melcher, I., Hachulla, variants of the BANK1 gene in rheumatoid arthritis. Arthritis E. et al. (2009) BANK1 is a genetic risk factor for diffuse and Rheumatism, 60, 372. cutaneous systemic sclerosis and has additive effects with IRF5 Orozco, G., Eyre, S., Hinks, A., Bowes, J., Morqan, A.W., Wil- and STAT4. Seminars in Arthritis and Rheumatism, 60, 3447. son, A.G. et al. (2011) Study of the common genetic back- Freedbery, I.M., Eisen, A.Z., Wolff, K., Auster, K.F., Goldsmith, ground for rheumatoid arthritis and systemic lupus L.A. & Katz, S.I. (2003) Fitzpatrick’s Dermatology in General erythematosus. Annals of the Rheumatic Diseases, 70, 463. Medicine, 6th edn. McGraw-Hill Professional, New York. Pillai, S. & Bikle, D.D. (1992) Adenosine triphosphate stimulates Goedkoop, A.Y., Kraan, M.C., Picavet, D.I., de Rie, M.A., phosphoinositide metabolism, mobilizes intracellular calcium, Teunissen, M.B., Bos, J.D. et al. (2004) Deactivation of endo- and inhibits terminal differentiation of human epidermal kerat- thelium and reduction in angiogenesis in psoriatic skin and inocytes. The Journal of Clinical Investigation, 90, 42. synovium by low dose infliximab therapy in combination with Reich, A. & Szepietowski, J. (2007) Genetic and immunological stable methotrexate therapy: a prospective single-centre study. aspects of the pathogenesis of psoriasis. Wiadomosci lekarskie, Arthritis Research & Therapy, 6, R326. 60, 270. Guan, M., Yu, B., Wan, J., Zhang, X., Wu, Z., Zhong, Q. et al. Roberson, E.D. & Bowcock, A.M. (2010) Psoriasis genetics: (2011) Identification of BANK1 polymorphisms by unlabelled breaking the barrier. Trends in Genetics, 26, 415. probe high resolution melting: association with systemic lupus Rueda, B., Gourh, P., Broen, J., Agarwal, S.K., Simeon, C., Ort- erythematosus susceptibility and autoantibody production in ego-Centeno, N. et al. (2010) BANK1 functional variants are Han Chinese. Rheumatology (Oxford, England), 50, 473. associated with susceptibility to diffuse systemic sclerosis in Guo, L., Deshmukh, H., Lu, R., Vidal, G.S., Kelly, J.A., Kauf- Caucasians. Annals of the Rheumatic Diseases, 69, 700. man, K.M. et al. (2009) Replication of the BANK1 genetic Samoud-El Kissi, S., Galai, Y., Sghiri, R., Kenani, N., Ben Alaya- association with systemic lupus erythematosus in a European- Bouafif, N., Boukadida, J. et al. (2008) BAFF is elevated in derived population. Genes and Immunity, 10, 531. serum of patients with psoriasis: association with disease activ- Johnson, S.R., Schentag, C.T. & Gladman, D.D. (2005) Autoan- ity. The British Journal of Dermatology, 159, 765. tibodies in biological agent naive patients with psoriatic arthri- Singh, S. & Singh, U. (2010) Prevalence of autoantibodies in tis. Annals of the Rheumatic Diseases, 64, 770. patients of psoriasis. Journal of Clinical Laboratory Analysis, Karvonen, S.L., Korkiamaki, T., Yla-Outinen, H., Nissinen, M., 24, 44. Teerikangas, H., Pummi, K. et al. (2000) Psoriasis and altered Suarez-Gestal, M., Calaza, M., Endreffy, E., Pullmann, R., Ordi- calcium metabolism: downregulated capacitative calcium influx Ros, J., Sebastiani, G.D. et al. (2009) Replication of recently and defective calcium-mediated cell signaling in cultured psori- identified systemic lupus erythematosus genetic associations: a atic keratinocytes. The Journal of Investigative Dermatology, case-control study. Arthritis Research & Therapy, 11, R69. 114, 693. Tagami, H., Iwatsuki, K. & Yamada, M. (1983) Profile of anti- Kozyrev, S.V., Abelson, A.K., Wojcik, J., Zaqhlool, A., Linga stratum corneum autoantibodies in psoriatic patients. Archives Reddy, M.V., Sanchez, E. et al. (2008) Functional variants in of Dermatological Research, 275, 71. the B-cell gene BANK1 are associated with systemic lupus ery- Wittwer, C.T. (2009) High-resolution DNA melting analysis: thematosus. Nature Genetics, 40, 211. advancements and limitations. Human Mutation, 30, 857. Leitch, D.N. & Haslock, D.I. (1997) Psoriatic arthritis and mino- Xu, S., Yin, X., Li, S., Jin, W., Lou, H., Yang, L. et al. (2009) cycline induced autoantibodies. Clinical Rheumatology, 16, Genomic dissection of population substructure of Han Chinese 317. and its implication in association studies. American Journal of Lenth, R.V. (2007) Statistical power calculations. Journal of Ani- Human Genetics, 85, 762. mal Science, 85, E24.

ª 2011 Blackwell Publishing Ltd, International Journal of Immunogenetics 38, 507–512