1 Cannabidiol and Other Cannabinoids Reduce Microglial Activation

Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 Molecular PharmacologyThis article hasFast not Forward.been copyedited Published and formatted. on The February final version 24, may 2011 differ as from doi:10.1124/mol.111.071290 this version. MOL #71290 1

Cannabidiol and other cannabinoids reduce microglial activation in vitro and in vivo:

relevance to Alzheimer’s disease

Ana María Martín-Moreno*, David Reigada*, Belén.G.Ramírez, R. Mechoulam, Nadia

Innamorato, Antonio Cuadrado and María L. de Ceballos

Neurodenegeration Group, Dept. of Cellular, Molecular and Developmental Neurobiology,

Instituto Cajal, CSIC, Doctor Arce, 37, 28002 Madrid, Spain AMM-M, DR, BGR, MLC

Centro de Investigación en Red en Enfermedades Neurodegenerativas (CIBERNED) AMM- Downloaded from

M, DR, BGR, MLC, NI, AC

Institute for Drug Research, Medical Faculty, Hebrew University, Jerusalem 91120, Israel molpharm.aspetjournals.org RM

Departamento de Bioquímica, Instituto de Investigaciones Biomédicas “Alberto Sols”UAM-

CSIC, Facultad de Medicina, Universidad Autónoma de Madrid, Madrid, Spain NI, AC

at ASPET Journals on September 30, 2021

Copyright 2011 by the American Society for Pharmacology and Experimental Therapeutics. Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 2

Running title: Effects of cannabinoids on microglial cell function

Corresponding author: M.L.de Ceballos Neurodenegeration Group, Dept. of Cellular, Molecular and Developmental Neurobiology, Instituto Cajal, CSIC, Doctor Arce, 37, 28002 Madrid, Spain and CIBER de Enfermedades Neurodegenerativas (CIBERNED) Telephone:+34-91 5854716; Fax:+34-915854754; E-mail: [email protected]

Present address: DR Downloaded from Molecular Neuroprotection Group, Experimental Neurology Unit,Paraplejic National Hospital, Finca la Peraleda s/n, 45071 Toledo, Spain.

Present address: BGR molpharm.aspetjournals.org Unidad de Apoyo a la Investigación, Fundación MD Anderson Internacional España, C/Arturo Soria 270, 28033 Madrid, Spain.

Nº text pages 31

Nº Figures 6 at ASPET Journals on September 30, 2021

Nº References 40

Nº words Abstract 238

Nº of words Introduction 658

Nº of words Discussion 1357

Abbreviations: Aβ, β-amyloid peptide; ATP: adenosine triphosphate; AD, Alzheimer’s disease; IL6: interleukin 6; TNF-α, tumor necrosis factor-α Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 3

Abstract

Microglial activation is an invariant feature of Alzheimer’s disease (AD). Interestingly cannabinoids are neuroprotective by preventing β-amyloid (Aβ) induced microglial activation both in vitro and in vivo. On the other hand, the phytocannabinoid cannabidiol (CBD) has shown anti-inflammatory properties in different paradigms. In the present study we compared Downloaded from the effects of CBD with those of other cannabinoids on microglial cell functions in vitro and on learning behaviour and cytokine expression following Aβ intraventricular administration to

mice. CBD, WIN 55,212-2 (WIN), a mixed CB1/CB2 agonist, and JWH-133 (JWH), a CB2 molpharm.aspetjournals.org selective agonist, concentration-dependently decreased ATP-induced (400 µM) increase in

2+ intracellular calcium ([Ca ]i) in cultured N13 microglial cells and in rat primary microglia. In contrast HU-308 (HU), another CB2 agonist, was without effect. Cannabinoid and adenosine at ASPET Journals on September 30, 2021 A2A receptors may be involved in the CBD action. CBD and WIN-promoted primary microglia migration was blocked by CB1 and/or CB2 antagonists. JWH and HU-induced migration was blocked by a CB2 antagonist only. All the cannabinoids decreased LPS-induced nitrite generation, which was insensitive to cannabinoid antagonism. Finally both CBD and WIN, following subchronic administration for three weeks, were able to prevent learning of a spatial navigation task and cytokine gene expression in β-amyloid injected mice. In summary, CBD is able to modulate microglial cell function in vitro and induce beneficial effects in an in vivo model of AD. Given that CBD lacks psychoactivity it may represent a novel therapeutic approach for this neurologic disease. Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 4

INTRODUCTION

Alzheimer’s disease (AD) is characterized by β-amyloid (Aβ) deposition in senile plaques, neurofibrillary tangles, selective neuronal loss along with progressive cognitive deficits. Another invariant feature of the neurologic disease is glial activation, and is considered to be responsible of the ongoing inflammatory condition occurring in AD brain

(Akiyama et al., 2000). Microglial activation is also present in AD experimental models in Downloaded from vivo, such as rats injected with Aβ either focally or intraventricularly, and in transgenic models of the disease (Masliah et al., 1996; Jantzen et al., 2002; Ramírez et al., 2005).

Furthermore, Aβ addition to cultures induces microglial activation, reflected in increased molpharm.aspetjournals.org secretion of toxic species like NO and cytokines (Combs et al., 1999; 2001; Ramírez et al.,

2005). Given that microglial activation may result in neurodegeneration, nowadays it is considered that pharmacological targeting of microglial activity may be a feasible therapeutic strategy for neurodegenerative diseases in general, and for AD in particular. at ASPET Journals on September 30, 2021

Cannabinoids, whether plant derived, synthetic or endocannabinoids, exert their functions through activation of cannabinoid receptors, two of which have been well characterized to date: CB1 and CB2 (Howlett et al., 2002; Piomelli, 2003). Cannabinoids are neuroprotective against excitotoxicity and acute brain damage, both in vitro and in vivo (see reviews by van der Stelt et al., 2002; Mechoulam and Shohami, 2007). Several mechanisms account for the neuroprotection afforded by this type of drugs such as blockade of excitotoxicity, reduction of calcium influx, antioxidant properties of the compounds or enhanced trophic factor support. A decrease in proinflammatory mediators brought about by cannabinoids (Walter and Stella, 2004) may be also involved in their neuroprotection. Indeed several reports have shown that cannabinoids reduce NO and cytokine generation and/or their mRNA expression in microglia cultures (Puffenbarger et al., 2000; Facchinetti et al., 2003;

Waksman et al., 1999). Cannabidiol (CBD), the major plant derived non-psychotropic Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 5 constituent of marijuana, is of potential therapeutic interest in different disease conditions, eg inflammation (Mechoulam et al., 2007). Oral treatment with CBD decreases edema and hyperalgesia in a rat paw model of carrageenan-induced inflammation (Costa et al., 2004). A single dose of the phytocannabinoid reduces tumour necrosis-α (TNF-α) levels in lipopolysaccharide (LPS) injected mice and improves collagen-induced arthritis (Malfait et al., 2000). CBD binds to CB receptors with low affinity (Showalter et al., 1996) and may

exert cannabinoid receptor independent effects as well. For instance, CBD inhibition of the Downloaded from equilibrative nucleoside transporter, which results in enhancement of adenosine signaling through A2A receptors, is involved in its immunossupresive effects (Carrier et al., 2006). molpharm.aspetjournals.org In the context of AD, CBD has shown to be neuroprotective against Aβ addition to cultured cells. Several mechanisms appear to be involved, including CBD reduction of oxidative stress and blockade of apoptosis (Iuvone et al., 2004), tau-phosphorylation inhibition through the Wnt/β-catenin pathway (Esposito et al., 2006a) and the decrease in at ASPET Journals on September 30, 2021 iNOS expression and nitrite generation (Esposito et al., 2006b). We have shown that cannabinoids prevent Aβ-induced neurodegeneration by reducing microglial activation

(Ramírez et al., 2005) and both CB1 and CB2 receptors in microglia participate in such an action. More importantly, cannabinoids prevented microglial activation, loss of neuronal markers and cognitive deficits in Aβ-treated rats (Ramírez et al., 2005). In vivo CBD also suppressed neuroinflammation in mice injected with Aβ into the hippocampus, by inhibiting the increased GFAP and iNOS expression, along nitrite and IL1-β generation (Esposito et al.,

2007). However, previous studies have not investigated the effects of CBD on microglial cell function.

Taken together these results prompted us to study the effects CBD in comparison with other cannabinoids on functions involved in microglial activation, namely intracellular calcium levels, migration and NO generation in cultured microglial cells. To that end we have Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 6

used WIN 55,212-2 (WIN), a mixed CB1/CB2 agonist (Howlett et al., 2002) and JWH-133

(JWH) and HU 308 (HU), as selective CB2 agonists (Huffman et al., 1999; Hanus et al.,

1999). Furthermore, we assessed whether these cannabinoids administered to Aβ-injected mice were able to counteract inflammation and the cognitive deficits.

MATERIALS AND METHODS

Materials Downloaded from

Aß1-40 (NeoMPS, France) was dissolved in PB (1.72 mg/ml) and aged at 37ºC for 24 h (“fibrillar” peptide), being vortexed several times during that period, and aliquots stored at molpharm.aspetjournals.org -80º C until used. The control peptide was not subjected to ageing (“soluble” peptide).

Aggregation of all peptides was confirmed by electron microscopy after staining with 2% uranyl acetate or 1% tungstenic acid. A peptide containing the same eleven amino acids of

Aß25-35 fragment but with a scrambled sequence (SCR; Neosystem, France) was used as at ASPET Journals on September 30, 2021 additional control. The scrambled peptide was dissolved in oxygen free distilled water at a concentration of 2.5 mg/ml and stored at -80º C until used. WIN ((R)-(+)-[2,3-Dihydro-5- methyl-3-(4-morpholinylmethyl)pyrrolo[1,2,3-de]-1,4-benzoxazin-6-yl]-1-naphthalenyl- methanone mesylate) and JWH [(6aR,10aR)-3-(1,1-Dimethylbutyl)-6a,7,10,10a-tetrahydro -

6,6,9-trimethyl-6H-dibenzo[b,d]pyran)] were from TOCRIS, CBD and HU were provided by one of us (RM) and SR141716 (SR1; [N-Piperidino-5-(4-chlorophenyl)-l-(2,

4-dichlorophenyl)-4-methylpyrazole-3-carboxamide]; Rinaldi-Carmona et al., 1994) and

SR144528 (SR2; N-[(1S)-endo-1,3,3-trimethyl bicyclo [2.2.1] heptan-2-yl]-5-(4-chloro-3- methylphenyl)-1-(4-methylbenzyl)-pyrazole-3-carboxamide; Rinaldi-Carmona et al., 1998) were kindly donated by Sanofi-Synthelabo (Montpellier, France). Each of these compounds was dissolved in DMSO at 10 mM concentration and aliquots stored at -80ºC. Before their use, drugs were diluted in appropriate solvent (eg PBS or cell culture medium) and DMSO Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 7 never exceeded 0.1% in cell culture experiments. Cell culture reagents were from Sigma unless otherwise stated. Salts and other reagents were analytical grade from Merck.

Cell cultures and treatments

Primary rat microglial cultures. Primary mixed glial cultures were prepared from neonatal

(P0) rat cortex as described (Ramírez et al., 2005). In brief, mechanically dissociated cortices

2 were seeded onto 75 cm flasks in Dulbecco’s modified Eagle medium (DMEM, Lonza), Downloaded from supplemented with 10% fetal calf serum (FCS, Gibco) and 40 µg/ml gentamicine. Cells were cultured in a humified atmosphere of 5% CO2/95% air at 37ºC and the medium was changed the molpharm.aspetjournals.org day after seeding and once every week afterwards. When confluence was reached, after being cultured for 2-3 weeks, flasks were shaken for 2-3 h at 230 rpm at 37º C, floating cells were pelleted and seeded onto poly-Lys-coated 96-well plates in medium with 0.1 % FCS. The cultures were at least 99% pure, as judged by immunocytochemical criteria. Drugs were added in at ASPET Journals on September 30, 2021 one-tenth of the final volume to maintain aggregation of peptides.

Due to the poor yield of the microglial cultures we took advantage of microglial cell lines

N13 and BV-2 to construct concentration-response curves with the cannabinoids under study.

Subsequently concentrations around the EC50 were assayed in primary microglial cultures.

Furthermore, the involvement of either CB1 or CB2 receptors in the microglial cell functions, difficult to study in vivo, was investigated.

BV-2 microglial cells. The transformed microglial cell line (v-raf/v-mic) was obtained from the

Interlab Cell Line Collection (National Institute for Cancer Research and Advanced

Biotechnology Center, Geneva, Italy).The cells were grown in RPMI 1640 (Sigma) supplemented with 10% fetal calf serum and 2 mM glutamine, detached from the flasks by manual shaking and seeded onto poly-L-Lysine (10 μg/ml) coated plates. Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 8

N13 microglial cells. In other experiments the microglial cell line N13 was used (Righi et al.,

1989). Cells were cultured in RPMI-1640 containinig 10% fetal calf serum (FCS) in F75 flasks and the medium was changed every 2 or 3 days. At confluence the cells were trypsinized

(trypsin–EDTA, Sigma) and seeded onto poly-L-Lysine coated plates in medium containing

0.1% FCS.

2+ Measurement of [Ca ]i. Microglial cells, either N13 cells or primary rat microglia, were

μ plated in 96 well plates (90.000 cells/well in 100 l of medium) in RPMI culture medium Downloaded from with 0.1% FCS for 1 day. After washing twice with Krebs solution (NaCl 105 mM; KCl 5 mM; HEPES-Na 10 mM; NaHCO3 5mM; mannitol 60 mM; sucrose 5 mM; MgCl2 0.5 mM; molpharm.aspetjournals.org CaCl2 1.3 mM pH7.4), the cells were loaded with 50 μl/well of 10 μM Fura-2 containing

0.2% pluronic acid in Krebs solution for 30 minutes and 37ºC. Antagonists were added to the dye solution at final concentration in the corresponding wells. Then the wells were washed twice with Krebs solution and 40 μl were added to each well, adding the antagonist to final at ASPET Journals on September 30, 2021 concentration where appropriate. The intracellular calcium concentration was estimated by alternatively exciting with 340 and 380 nm and measuring the fluorescence emission at 510 nm in a fluorescence plate reader (Fluostar Optima, BMG Labtechnologies, Germany) at

37ºC. After 15 seconds reading, 10 μl of control (Krebs buffer) or a 5 fold concentrated agonist solution was added to each well by means of the injector system, and the fluorescence was measured for additional 1-2 minutes. The ratio of emission levels at 340 and 380 nm was calculated at each time point. The conversion to intracellular calcium concentration was performed using calibrating solutions consisting in 5 μM ionomycin in Krebs buffer (maximal response) or 5 μM ionomycin plus 20 mM EGTA in Krebs buffer (minimal response). In addition, any background signal was subtracted as measured in non loaded wells. The

2+ increase in [Ca ]i was expressed as a percentage of the peak level in comparison with the pre- Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 9

2+ injection baseline according to the following formula: Δ[Ca ]i = [(Peak- Baseline)/Baseline] x 100. In other experiments data were normalized versus the ATP response.

In preliminary experiments it was shown that the reduction of extracellular calcium, without added calcium in the buffer and addition of EGTA 10 mM, decreased the intracellular calcium levels by 50%.

Migration studies in chemotaxis chambers. Chemotaxis through porous membranes was

assessed according to Boyden with some modifications. N13 cells or primary microglial cells Downloaded from

(90,000 cells) were seeded onto the upper compartment of inserts (6.5 mm diameter) with 8 μm porous polycarbonate membranes in 24 well plates (Transwell Costar 3422, Corning Inc, USA). molpharm.aspetjournals.org In preliminary experiments it was confirmed that to obtain a migratory response it was necessary to activate the cells by exposure to LPS for 24 h, in agreement with previous studies (Cui et al., 2002). Under these conditions LPS dose-dependently (1,500-6,000 ng/ml) or the chemotactic peptide fMLP (25-200 nM) induced migration of N13 cells after 3h of its at ASPET Journals on September 30, 2021 addition to the cultures (not shown). Cells were treated by addition of lipopolysaccharide (LPS,

3 μg/ml final concentration; from E. coli 0127:B8, Difco Laboratories, USA) in culture medium to both compartments. After 24 h the medium was changed and the treatments were added to the lower compartment. Three hours later cells were fixed with 4% PF for 30 min and stained with

Coomassie brilliant blue (0.2% in 10% acetic acid/40% methanol). The insert membrane was cut, mounted onto a microscope slide, and cells on the lower face of the filter were counted by phase contrast microscopy by an observer unaware of the treatments (4 fields per condition in triplicate) in an Axiovert Zeiss microscope at x 400 magnification.

Nitrite assay. These experiments were performed with BV-2 cells. Cells were plated (50,000 cells/well in 100 μl medium) onto 96 wells precoated plates in RPMI culture medium containing

0.1% FCS. Following 24 hour the culture cells were treated with LPS (300 ng/ml) alone or with the cannabinoids, and they were cultured for additional 24 hours. In preliminary studies we Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 10 determined the appropriate LPS concentration and incubation time. Nitrite oxide production was

- assessed by the colorimetric Griess reaction (Sigma), that detects nitrite (NO2 ), a stable reaction product of NO and molecular oxygen, in cell cultures supernatants. Eighty µl of each sample were incubated with 80 µl of Griess reagent for 15 minutes and absorbance was measured at 540 nm in a microplate reader. The nitrite concentration was determined from a sodium nitrite standard curve.

Immunocytochemistry Downloaded from

Immunostaining of microglial cell cultures was performed following fixation with paraformaldehyde (4% PF in PB 0.1 M) for 30 min, followed by rinses with PBS as described molpharm.aspetjournals.org (Ramírez et al., 2005). The cells were incubated with the different antibodies overnight at

4ºC. Dilutions of antibodies were as follows: polyclonal anti-CB1 (Dr.K.Mackie, USA),

1:900; polyclonal anti-CB2 (Affinity Bioreagents, USA), 1:900, and biotinylated tomato lectin

(TL; Sigma, USA) 1:150. Development was conducted by the ABC method (Pierce), and at ASPET Journals on September 30, 2021 immunoreactivity was visualized by 3,3’-diaminobenzidine oxidation as chromogen, with nickel enhancement. Omission of primary or secondary antibodies resulted in no immunostaining. Specificity of anti-CB1 and anti-CB2 staining was assessed by preabsorption of the antibodies with the antigenic peptides (kindly given by Dr. K. Mackie, University of

Washington, USA), which completely abolished labeling.

Aβ injected mice. All experiments were performed according to ethical regulations on the use and welfare of experimental animals of EU and the Spanish Ministry of Agriculture, and the procedures had been approved by the bioethical committee of the CSIC.

These animals were used as a partial AD model, which develops glial activation and cognitive deficit in learning a spatial task (Ramirez et al., 2005 ).C57/Bl6 mice of 3 months of age were intraventricularly (icv) injected with 2.5µg of fibrillar Aβ or saline (5 μl). The Hamilton syringe used for icv injections was repeatedly washed with distilled water followed by flushing with 1 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 11 mg/ml BSA solution, which reduces drastically binding to glass. This procedure was performed before every injection. The next day the intraperitoneal treatment with the cannabinoids (CBD

20mg/kg; HU-308, JWH and WIN 0.5 mg/kg) was initiated. During the first week the mice were treated daily, the following two weeks they were treated 3 days/week. Performance in the Morris water maze was conducted at the same time of the day (9.00-14.00 h).To determine spatial learning, rats were trained to find a hidden platform in a water tank of 100 cm of diameter. Four

trials a day with different start positions, each 30 min apart, were conducted for 5 days (Ramírez Downloaded from et al., 2005), and latency to reach the platform was recorded. Cut-off time to find the platform was 60 sec, and mice failing to find the platform were placed on it and left there for 15 sec. Data molpharm.aspetjournals.org acquisition was performed with a video camera (Noldus software, Netherlands). The animals were sacrificed 18 days after the Aβ injection and their brain were dissected, frozen and stored at

-80ºC until assayed.

Analysis of mRNA levels by quantitative real-time PCR at ASPET Journals on September 30, 2021 Total RNA from cortex was extracted using TRIzol reagent according to the manufacturer’s instructions (Invitrogen). To avoid interference with potential genomic DNA amplification, we treated 1 μg of total RNA with 1 μl DNAse I (Invitrogen) plus 1 μl of 10X Buffer (Invitrogen).

The samples were incubated at 37ºC for 15 min. EDTA (25 mM) was added to the mixture and the samples were incubated at 65ºC for 15 min to heat inactivate the DNAse I. Then the samples were incubated at 40ºC for 1 min. The reaction was collected after centrifugation at 10.000 rpm

(pulse) and 1 μg of DNA-free RNA was used for reverse transcription. For cDNA synthesis a total of 1 µg of RNA from the different samples were reverse-transcribed for 75 min at 42°C using 5 U of avian myeloblastosis virus reverse transcriptase (Promega) in the presence of 20 U of RNasin (Promega). The real-time PCR reaction was performed in 25 µl using the fluorescent dye SYBR Green Master mix (Applied Biosystems) and a mixture of 5 pmol of reverse and forward primers. The primers used were for TNF-α forward primer 5’ Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 12

CATCTTCTCAAAATTCGAGTGACAA 3’ and reverse primer 5’

TGGGAGTAGACAAGGTACAACCC 3’ (fragment size 175, 30 cycles for linear range) and for IL-6 forward primer 5’ GAGGATACCACTCCCAACAGACC 3’ and reverse primer 5’

AAGTGCATCATCGTTGTTCATACA 3’ (fragment size141, 30 cycles for linear range).

Quantification was performed on an ABI PRISM 7900 sequence detection system (Applied

Biosystems). PCR cycles proceeded as follows: initial denaturation for 10 min at 95°C, then 40

cycles of denaturation (15 sec, 95°C), annealing (30 sec, 60°C), and extension (30 sec, 60°C). Downloaded from

The melting-curve analysis showed the specificity of the amplifications. Threshold cycle, which inversely correlates with the target mRNA level, was measured as the cycle number at which the molpharm.aspetjournals.org reporter fluorescent emission appears above the background threshold (data not shown). Data analysis is based on the ΔCT method with normalization of raw data to a house-keeping gene (β- actin). All of the PCRs were performed in triplicate.

Statistical analysis. Statistical significance analysis was assessed by using one-way or two-way at ASPET Journals on September 30, 2021 analysis of variance (ANOVA) followed by unpaired Student’s t test (version 5.0, Prism software, GraphPad, USA). A value of p<0.05 was considered significant.

RESULTS

Expression of CB1 and CB2 in microglial cell line N13

N13 cells have been immortalized from primary mice microglial cell cultures, and shown to express microglial markers and release several cytokines upon LPS stimulation, while being capable of FcR-mediated phagocytosis (Righi et al., 1989). Previous evidence has shown that primary microglia and BV-2 microglial cells express both CB1 and CB2 (Walter et al., 2003;

Ramirez et al., 2005). Accordingly, expression of cannabinoid receptor subtypes by N13 microglial cells was assessed by immunocytochemistry and compared with that in cultured Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 13 primary microglia. As expected the N13 cells expressed both receptors (Fig. 1, upper panels).

Immunoreaction was present in the cell membrane and excluded the nuclei. Similar results were obtained in rat microglial cells (Fig. 1, lower panels). Therefore microglial cells should be susceptible of activation by the different cannabinoid agonists selected for the present study.

Cannabinoid agonists inhibit ATP-induced intracellular calcium increase in cultured

microglia Downloaded from

2+ Variations in intracellular calcium concentration ([Ca ]i) underlie several important cell signalling functions and they are involved in microglia activation. Indeed, an increase in molpharm.aspetjournals.org extracellular ATP, released by dying neurons and glia, can interact with purinergic receptors,

2+ increase [Ca ]i and activate microglia (Farber and Kettenmann, 2006). On the other hand, cannabinoid agonists have been shown to inhibit calcium responses in a variety of cells, including glial cells (Mato et al., 2009). at ASPET Journals on September 30, 2021 2+ Indeed we found that ATP increased [Ca ]i in a concentration-dependent manner (10-

400 µM, not shown) in N13 cells, reaching concentrations as high as 700 nM (nearly a 3 fold increase over basal levels) with the highest concentration tested. Intracellular calcium raised almost immediately after adding ATP to the N13 cells (see Fig. 2 C), and after reaching its maximal, even in the presence of ATP, returned to baseline calcium levels.

For the subsequent experiments we selected the ATP concentration of 400 µM that may mimic the high concentrations released by dying neurons and glia (eg pathological

2+ concentrations). Cannabinoids per se did not affect basal [Ca ]i levels when added to the cultures in a wide concentration range (10-1000 nM). However, CBD did reduce ATP-induced

2+ [Ca ]i in a concentration-dependent manner (Fig. 2, A) and the maximal effect attained was a

25% reduction. The effect of CBD in N13 microglia was not changed in the presence of either the CB1 or the CB2 selective antagonists (100 nM, Fig 2, E), which per se showed no effect Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 14

2+ (data not shown). The [Ca ]i response of primary microglia to ATP was different to that observed in N13 cells, since after reaching its peak effect, around 20 sec after its addition to the culture, it was maintained at least for 50 sec (Fig. 2 B and C). Interestingly, the CB2 antagonist fully reversed the CBD effect (Fig. 2, B and F). WIN, reduced ATP-induced intracellular calcium (Fig. 2), and while both antagonists blocked its effect in N13 cells (Fig.

2 E), the CB2 selective agonist fully reversed its effect in microglia (Fig. 2 F). Finally, JWH

also decreased the calcium intracellular levels after ATP addition. This effect was Downloaded from counteracted by the CB2 selective antagonist in primary microglia (Fig. 2 F), although it was

2+ not the case in N13 cells (Fig. 2 E). HU-308 did not change ATP-induced increase in [Ca ]i molpharm.aspetjournals.org at any concentration tested (10-300 nM; not shown).

Previous work has shown that the immunosuppressive effects of CBD involved activation of adenosine receptors, given its blockade of the equilibrative nucleoside transporter (Carrier et al., 2006). To ascertain the possible involvement of a similar at ASPET Journals on September 30, 2021 mechanism responsible for the CBD reduction of ATP-induced calcium responses in microglial cells we examined whether an A2A agonist could mimic the CBD action (Fig 3). In fact CGS21680 (CGS), an A2A agonist (Klotz et al., 1998), decreased at the same extent the

2+ ATP-induce increase in [Ca ]i in N13 and primary microglial cells (Fig. 3 A and B), which was blocked by ZM241385 (ZM), an A2A antagonist (Palmer et al., 1995), that per se had no effect. Of note is that ZM was able to inhibit the CBD effect both in N13 and primary microglial cells (Fig. 3 C and D). Therefore, we have shown that CBD and other cannabinoids counteract the effects of ATP on microglial cells by a mechanism involving both cannabinoid receptor dependent and independent mechanisms.

CBD and other cannabinoids promote microglial cell migration Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 15

The Aβ peptide (Tiffany et al., 2002) and different cannabinoids trigger migration

(Walter et al., 2003) that may subserve a beneficial function as a requisite for phagocytosing aggregated Aβ. Therefore, migration of microglial cells through porous membranes toward the lower chamber containing the compounds was investigated.

The mixed CB1/CB2 agonist WIN and the CB2 selective agonist JWH promoted N13 cell migration (Fig. 4 A and B). Note that in these experiments the cells changed their oval

morphology (Fig. 1) to a fully round morphology, with no lamellipodia (Fig. 4 B). Migration Downloaded from was similarly increased (around 20% compared to controls) by the two agonists (200 nM).

The CB1 selective agonist SR1 did not affect migration, while the CB2 selective antagonist molpharm.aspetjournals.org SR2 induced a partial although statistically significant effect on migration (approximately 10

% increase; Fig. 2, A). The effect of WIN on N13 cells was not altered by either of the cannabinoid antagonists, but full prevention of its migratory effect was obtained when both antagonists were combined. In contrast, the CB2 antagonist completely blocked the response at ASPET Journals on September 30, 2021 induced by JWH, while the CB1 antagonist had no effect (Fig.4 A). Fibrillar Aβ (2 μM) induced microglial migration (20%) in comparison to vehicle treated control cultures (Fig. 4

C) and to those treated with a scrambled peptide, which had no effect. Aβ combined with the cannabinoids exerted a similar effect to that obtained with the agonists alone (not shown).

Primary microglial cells showed a more robust response (2.5 fold compared to controls) upon addition of Aβ, LPS or the cannabinoid agonists (Fig. 4 C). The migratory effect induced by

CBD and WIN was fully reversed by either of the selective antagonists (Fig.4 C). In contrast the migration promoted by JWH and HU, were only inhibited by the CB2 antagonist (Fig. 4

C). Taken together these results indicate that CBD and the other cannabioids promote microglial cell migration in a cannabinoid receptor dependent manner.

NO generation is inhibited by cannabinoids Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 16

Cannabinoids inhibit LPS NO synthase stimulation and NO generation as reflected in nitrate accumulation in the culture media (Waksman et al., 1999). Given that LPS challenge did not generate nitrites in N13 cells, BV-2 microglial cells were used in these experiments.

Nitrite generation, measured in the culture media following LPS stimulation, was concentration-dependently reduced by all the cannabinoids tested (Fig. 5). According to their

IC50 their relative potencies were CBD=HU-308>JWH-133>>WIN (Fig. 5 A). At a

concentration near their IC50 the inhibition of nitrite generation was greater in primary Downloaded from microglia (Fig. 5 C) in comparison with BV-2 cells (Fig. 8 B). Nitrite inhibition by cannabinoids was resistant to the antagonists tested (data not shown) and these results suggest molpharm.aspetjournals.org that this microglial response is independent of cannabinoid receptor activation.

Cannabinoids counteract Aβ-induced cognitive impairment and increased cytokine gene

expression at ASPET Journals on September 30, 2021 Given that several parameters of microglial activation in vitro were affected by CBD and other cannabinoids we sought to determine whether these compounds were able to prevent some features of a pharmacological AD model. First we examined if cognitive impairment of Aβ-injected mice was affected by subchronic treatment. Mice injected with Aβ showed increased latencies to find the hidden platform in comparison with control animals

(SCR+veh). Both CBD, at a dose of 20 mg/kg, and WIN 0.5 mg/kg were able to prevent the cognitive impairment shown by the animals in the Morris water maze (Fig. 6 A). In fact, from the third training day the mice showed a significant reduction in the latency to reach the hidden platform in comparison with Aβ-injected mice, and they behaved similar to the controls (SCR+veh). In contrast, neither JWH-133 nor HU308 ameliorated the cognitive impairment of the animals (Fig. 6 B). Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 17

Gene expression of two different pro-inflammatory cytokines, TNF-α and IL-6, were measured in cerebral cortex of the animals treated with CBD and WIN. CBD did not alter the increased TNF-α gene expression observed in the AD mice model (Fig. 6 C) and WIN partially reduced it. However, the levels of IL-6, which were dramatically increased (6 fold) in the Aβ-injected mice, were markedly decreased by both cannabinoids (Fig. 6 D).

DISCUSSION Downloaded from

Cannabinoids have been shown to be promising agents for the treatment of different molpharm.aspetjournals.org neurodegenerative conditions. In particular, agents that are devoid of psychoactive effects, solely mediated by CB1 receptor interaction, would be interesting for its translation into the Clinic. This is the case of CBD, which has very low affinity for cannabinoid receptors, or CB2 selective agonists. at ASPET Journals on September 30, 2021 Mobilization of intracellular calcium constitutes an important second messenger in cells and in microglia can be considered central for many inflammatory-mediated responses, affecting enzymes, ion channels and gene transcription. In this work we have studied the modulation by cannabinoids of ATP-induced responses in microglial cells in culture. Microglial cells are endowed of different purinergic receptors (Light et al., 2006) which may account for the

2+ concentration-dependent increase in [Ca ]i (Kettenmann et al., 1993; Möller et al., 2000). The identity of the P2 receptors responsible for that increase has not been established in the present study, but P2Y leads to calcium release from intracellular stores while P2X activation results in influx through the cationic ion channel. Interestingly the calcium response was different in the

N13 cell line compared to primary rat microglia. In the first case it caused a desensitizing response, that after reaching its maximum, subsided in around 40 sec in the presence of ATP, but in primary microglial cells the response was sustained. Dying neurons release high amounts of Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 18

ATP, therefore we decided to use those pathological concentrations for subsequent experiments.

CBD and the other cannabinoid agonists, with the exception of HU, decreased ATP-induced

2+ [Ca ]i. both in N13 microglial cells and in primary rat microglia in culture. The effect of the compounds was either independent of cannabinoid receptor activation (eg CBD and JWH in N13 cells), given it was resistant to cannabinoid receptor antagonism, or CB2 receptor mediated (WIN in N13 cells and all compounds in primary microglia). The cannabinoid receptor independence

of the effect of CBD in N13 cells prompted us to investigate a possible A2A receptor mediation. Downloaded from

We found that the A2A selective agonist CGS (Klotz et al., 1998) also reduced the ATP-induced

2+ [Ca ]i to a similar extent and the inhibition elicited by CBD and CGS was blocked by the A2A molpharm.aspetjournals.org selective antagonist ZM (Palmer et al., 1995). Those results indicate that cannabinoid inhibition of the intracellular calcium increase brought about by high concentrations of ATP in microglial cells may be mediated by cannabinoid or A2A receptors.

2+ In some works where micromolar concentrations of cannabinoids enhance [Ca ]i at ASPET Journals on September 30, 2021 2+ ryanodine receptors appear to be involved. Indeed the increase in [Ca ]i induced by ACEA and

JWH-133 was partially blocked by a ryanodine antagonist in RIN insulinoma cells (De

Petrocellis et al., 2007). The involvement of intracellular calcium stores in cannabidiol elevation

2+ of [Ca ]i has also been described in hippocampal cells (neurons and glia) in culture (Drysdale et

2+ al., 2006). Given that we found a decrease by cannabinoids of ATP-induced increase in [Ca ]i and that in microglial cells CB1 (eg in the case of WIN) and/or CB2 antagonists were effective at blocking their effect we have not addressed the involvement of ryanodine receptors.

Activation of microglia by Aβ is associated with chemotactic responses towards it, consistent with the extensive clustering of activated microglia at sites of Aβ deposition in AD brain. Furthermore, Aβ induces migration across porous membranes through the interaction with chemotactic receptors such as the formyl peptide receptors FPR2 and FPR-like 1 receptor, its human counterpart (Cui et al., 2002). Indeed we observed that the Aβ peptide Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 19 induced chemotactic responses in cultured microglia cells. Cannabinoids, whether plant derived or endocannabinoids, have been shown to induce migration of BV-2 microglial cells

(Walter et al., 2003). In the present work the synthetic cannabinoids WIN and JWH promoted migration at similar concentrations in the N13 cell line and their effect was greater in primary microglia. According to the work of Walter et al. (2003) the cannabinoid effects were mediated by CB2 and abnormal cannabidiol receptors. The results of the present work also show the

involvement of CB2 receptors in migration of N13 and primary microglial cells. Indeed the two Downloaded from

CB2 selective agonists JWH and HU promoted it and their effect was completely blocked by the

CB2 selective antagonist, but unchanged by the CB1 selective antagonist, as expected. However, molpharm.aspetjournals.org in our hands CB1 receptor activation was effective as well. In fact, the migration induced by

WIN, a mixed CB1/CB2 agonist not previously tested, and by CBD was prevented by both selective antagonists.

In agreement with previous work that has shown decreased NO generation by microglia at ASPET Journals on September 30, 2021 in the presence of cannabinoids (Waksman et al., 1999) we observed a concentration-dependent decrease in nitrites in the culture media of LPS-stimulated microglia. Although in BV-2 microglial cells CBD and HU appeared to be more potent at decreasing nitrites, in primary microglia all the cannabinoid agonists were equipotent. The effect of cannabinoids were independent of cannabinoid receptor activation, given it was unaltered by the selective antagonists used in the present study.

We and other authors have shown that treatment with cannabinoid agonists and agents that increase endocannabinoid availability, such as the inhibitor of endocannabinoid reuptake

VDM11, are able to prevent Aβ-induced cognitive deficits (Ramírez et al., 2005; van der Selt et al., 2006). Further, in the work by van der Selt et al. (2006) it was found that VDM11 treatment inhibited different glial parameters (COX-2, iNOS, S100β) in hippocampus which were increased by Aβ intracortical injection. In the present work Aβ-injected mice subjected to Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 20 subchronic systemic administration of WIN or CBD showed better performance in the Morris water maze when compared to vehicle treated animals. In this paradigm the two selective CB2 agonists were ineffective in that respect, although JWH prolonged oral administration showed beneficial effects in the transgenic model of AD Tg APP (Martin-Moreno et al., in preparation).

The possible involvement of glial activation modulation was assessed by measuring cytokine gene expression. In mice injected with Aβ both TNF-α and IL-6 expression was markedly

increased. WIN and CBD treatment abolished IL-6 expression increase and WIN partially Downloaded from reduced that of TNF-α. Therefore in an in vivo acute pharmacological model of AD cannabinoids showed beneficial behavioral effects, that appears to be mediated through glial activation molpharm.aspetjournals.org modulation.

The pharmacology of endocannabinoids and phytocannabinoids appear to be increasingly complicated. According to binding studies performed in cells transfected with the CB1 and CB2 human receptors (Showalter et al., 1996) CBD has shown very low affinity (around 2-4 µM). at ASPET Journals on September 30, 2021 However one interesting finding of this work is that CBD exerts several effects on microglial function in the high nanomolar range and at similar concentrations of other cannabinoids tested.

Moreover, many of CBD effects appear to be CB2 receptor mediated. Expression of CB2 receptors in normal brain is negligible and only measurable by quantitative PCR. This fact can explain that the interaction of CBD with CB2 receptors has been unnoticed and unraveled in studies involving microglial cells.

There is no doubt that in AD a pronounced inflammation occurs, in which astrocytes and microglial cells are involved and Aβ, which is central to AD pathology, is at least in part responsible of it. However, the inflammatory response accounts for both detrimental and beneficial effects in the pathology. Indeed activated microglia release toxic molecules, such as

NO and pro-inflammatory cytokines, as initial players, that may induce neurodegeneration. At the same time, these cells release trophic factors, and subsequently migrate to affected brain Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 21 areas and phagocytose dead neurons and Aβ deposits, therefore contributing to neuroprotection.

The resulting outcome of the inflammatory process would be the combination of both effects.

Interestingly cannabinoids appear to differentially regulate those separate cellular events of activated microglial in a positive direction. On the one hand, these compounds effectively counteract Aβ-mediated increase in the pro-inflammatory cytokine TNF-α and the ensuing neurodegeneration, after its administration in vitro and in vivo (Ramírez et al., 2005). In

contrast, as shown here, cannabinoids promote migration, a cellular mechanism that Downloaded from ultimately will allow the removal of the deposited Aβ peptide. Therefore this kind of drugs, with neuroprotective and anti-inflammatory effects (Walter and Stella, 2004) may be of molpharm.aspetjournals.org interest in the prevention of AD inflammation, in particular CB2 selective agonists, which are devoid of psychoactive effects (Hanus et al., 1999). at ASPET Journals on September 30, 2021 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 22

Acknowledgments

We thank Dr. K. Mackie for anti-CB1 antibody and CB1 and CB2 antigenic peptides, Sanofi-

Synthelabo for SR141716 and SR144528, and M. E. Fernández de Molina and S. Plazuelo for excellent technical assistance.

Downloaded from

molpharm.aspetjournals.org

at ASPET Journals on September 30, 2021

Authorship Contribution section

Participated in research design de Ceballos, Mechoulam, Cuadrado

Conducted experiments Martín-Moreno, Reigada, Ramírez, Innamorato

Contributed new reagents or analytic tools Mechoulam

Performed data analysis de Ceballos, Martín-Moreno, Reigada, Ramírez, Innamorato

Wrote or contributed to the writing de Ceballos, Mechoulam, Cuadrado

Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 30, 2021 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 24

REFERENCES

Akiyama H, Barger S, Barnum S, Bradt B, Bauer J, Cole GM, Cooper NR, Eikelenboom P, Emmerling M, Fiebich BL, Finch CE, Frautschy S, Giffin WS, Hampel H, Hull M, Landreth G, Lue L, Mrak R, Mackenzie IR, McGeer PL, O’Banion MK, Pachter J, Pasinetti G, Plata-Salaman C, Rogers J, Rydel R, Shen Y, Strohmeyer R, Tooyoma I, Van Muiswinkel FL, Veerhuis R, Walker D, Webster S, Wegrzyniak B, Wenk G, Wyss-Coray T. (2000) Inflammation and Alzheimer´s disease. Neurobiol Aging 21: 383-421.

Carrier EJ, Auchampach JA, Hillard CJ. (2006) Inhibition of an equilibrative nucleoside Downloaded from transporter by cannabidiol: a mechanism of cannabinoid immunosuppression. Proc Natl Acad Sci USA 103: 7895-7900

molpharm.aspetjournals.org Combs CK, Karlo JC, Kao SC, Landreth GE. (2001) Beta-Amyloid stimulation of microglia and monocytes results in TNFalpha-dependent expression of inducible nitric oxide synthase and neuronal apoptosis. J Neurosci 21: 1179-1188.

Costa B, Colleoni M, Conti S, Parolaro D, Franke C, Trovato AE, Giagnoni G. (2004) Oral anti-

inflammatory activity of cannabidiol, a non-psychoactive constituent of cannabis, in acute at ASPET Journals on September 30, 2021 carrageenan-induced inflammation in the rat paw. Naunyn Schmiedebergs Arch Pharmacol 369:294-299.

Cui Y-H, Le Y, Gong W, Proost P, Van Damme J, Murphy WJ, Wang JM. (2002) Bacterial lipopolysaccharide selectively up-regulates the function of the chemotactic peptide receptor 2 in murine microglial cells. J Immunol 168: 434-442.

Esposito G, De Filipis D, Carnuccio R, Izzo AA, Iuvone T. (2006a) The marijuana component cannabidiol inhibits β-amyloid-induced tau protein hyperphosphorylation through Wnt/β-catenin pathway rescue PC12 cells. J Mol Med 84: 253-258.

Esposito G, De Filipis D, Mauiuri MC, De Stefano D, Carnuccio R, Iuvone T. (2006b) Cannabidiol inhibits nitric oxide synthase protein expression and nitric oxide production in β- amyloid stimulated PC12 neurons through p38 MAP kinase and NFκB involvement. Neurosci Lett 399: 91-95.

Esposito G, Scuderi C, Savani C, Steardo L Jr, De Filippis D, Cottone P, Iuvone T, Cuomo V, Steardo L. (2007) Cannabidiol in vivo blunts beta-amyloid induced neuroinflammation by suppressing IL-1beta and iNOS expression. Br J Pharmacol 151:1272-1279.

De Petrocellis L, Marini P, Matias I, Moriello AS, Starowicz K, Cristino L, Nigam S, Di Marzo V. (2007) Mechanisms for the coupling of cannabinoid receptors to intracellular calcium mobilization in rat insulinoma beta-cells. Exp Cell Res 313: 2993-3004.

Drysdale AJ, Ryan D, Pertwee RG, Platt B. Cannabidiol-induced intracellular Ca2+ elevations in

hippocampal cells. (2006) Neuropharmacology 50: 621-631. Downloaded from

Facchinetti F, Del Giudice E, Furegato S, Passarotto M, Leon A. (2003) Cannabinoids ablate release of TNFα in rat microglial cells stimulated with lypopolysaccharide. Glia 41: 161-168. molpharm.aspetjournals.org Färber K, Kettenmann H. (2006) Functional role of calcium signals for microglial function.Glia 54:656-665.

Hanus L, Breuer A, Tchilibon S, Shiloah S, Goldenberg D, Horowitz M, Pertwee RG, Ross RA, Mechoulam R, Fride E. (1999) HU-308: a specific agonist for CB(2), a peripheral cannabinoid at ASPET Journals on September 30, 2021 receptor. Proc Natl Acad Sci U S A. 96:14228-33.

Howlett AC, Barth F, Bonner TI, Cabral G, Casellas P, Devane W., Herkenha, M, Mackie K, Martin BR, Mechoulan R, Pertwee RG. (2002) International Union of Pharmacology. XXVII. Classification of cannabinoid receptors. Pharmacol Rev 54: 161-202.

Huffman, JW, Liddle, J, Yu, S, Aung, MM, Aboot, ME, Wiley, JL, Martin, BR. (1999) 3-(1’,1’- Dimethylbutyl)-1-deoxy-delta-8-THC and related compounds: synthesis and selective ligands for the CB2 receptor. Bioorg Med Chem Lett 7: 2905-2914.

Iuvone T, Esposito G, Esposito R, Santamaria R, Di Rosa M, Izzo AA. (2004) Neuroprotective effect of cannabidiol, a non-psychoactive component from Cannabis sativa, on beta-amyloid- induced toxicity in PC12 cells. J Neurochem 89:134-41.

Jantzen PT, Connr,KE, DiCarlo,G, Wenk,GL, Wallace GL, Rojiani AM, Coppola D, Morgan D, Gordon MN (2002) Microglial activation and β-amyloid deposit reduction caused by nitric oxide- releasing nonsteroidal anti-inflammatory drug in amyloid precursor protein plus presenilin-1 trangenic mice. J Neurosci 22: 2246-2254. Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 26

Kettenmann H, Banati R, Walz W. (1993) Electrophysiological behaviour of microglia. Glia 7: 93-101.

Klotz KN, Hessling J, Hegler J, Owman C, Kull B, Fredholm BB, Lohse MJ. (1998) Comparative pharmacology of human adenosine receptor subtypes - characterization of stably transfected receptors in CHO cells.Naunyn Schmiedebergs Arch Pharmacol 357:1-9.

Light AR, Wu Y, Hughen RW, Guthrie PB (2006) Purinergic receptors activating rapid

intracellular Ca increases in microglia. Neuron Glia Biol 2:125-138. Downloaded from

Malfait AM, Gallily R, Sumariwalla PF, Malik AS, Andreakos E, Mechoulam R, Feldmann M. (2000) The nonpsychoactive cannabis constituent cannabidiol is an oral anti-arthritic therapeutic in murine collagen-induced arthritis. Proc Natl Acad Sci USA 97: 9561-9566. molpharm.aspetjournals.org

Mato S, Alberdi E, Ledent C, Watanabe M, Matute C.(2009) CB1 cannabinoid receptor-dependent and -independent inhibition of depolarization-induced calcium influx in oligodendrocytes. Glia 57:295-306.

at ASPET Journals on September 30, 2021 Masliah E, Sisk A, Mallory M, Mucke L, Schenk D, Games D. (1996) Comparison of neurodegenerative pathology in transgenic mice overexpressing V717F beta-amyloid precursor protein and Alzheimer´s disease. J Neurosci 16: 5795-5811. Mechoulam R, Peters M, Murillo-Rodriguez E, Hanus LO. (2007) Cannabidiol – recent advances. Chemistry & Biodiversity 4: 1678-1692.

Mechoulam R, Shohami E. (2007) Endocannabinoids and traumatic brain injury. Mol Neurobiol 36: 68-74.

Möller T, Kann O, Verkhartsky A, Kettenmann H. (2000) Activation of mouse microglial cells affects P2 receptor signaling. Brain Res 853: 49-59.

Palmer TM, Poucher SM, Jacobson KA, Stiles GL. (1995). 125I-4-(2-[7-amino-2-[2- furyl][1,2,4]triazolo[2,3-a][1,3,5] triazin-5-yl-amino]ethyl)phenol, a high affinity antagonist radioligand selective for the A2a adenosine receptor. Mol Pharmacol 48:970-4.

Piomelli D. (2003) The molecular logic of endocannabinoid signalling. Nat Rev Neurosci 4: 873- 884. Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 27

Puffenbarger RA, Boothe AC, Cabral GA. (2000) Cannabinoids inhibit LPS-inducible cytokine mRNA expression in rat microglial cells. Glia 29: 58-69.

Ramírez BG, Blázquez C, Gómez del Pulgar T, Guzmán M, de Ceballos ML. (2005) Prevention of Alzheimer´s disease pathology by cannabinoids: neuroprotection mediated by blockade of microglial activation. J Neurosci 25: 1904-1913.

Righi M, Mori L, De Libero G, Sironi M, Biondi A, Mantovani A, Donini SD, Ricciardi-

Castagnoli P. (1989) Monokine production by microglial cell clones. Eur J Immunol 19: 1443- Downloaded from 1448.

Rinaldi-Carmona M, Barth F, Heaulme M, Shire D, Calandra B, Congy C, Martinez S, Maruani J, Neliat G, Caput D, Ferrara, P, Soubrié, P, Brelière, JC, Le Fur, G. (1994) SR141716A, a potent molpharm.aspetjournals.org and selective antagonist of the brain cannabinoid receptor. FEBS Lett 350: 240-44.

Rinaldi-Carmona M, Barth F, Millan J, Derocq JM, Casellas P, Congy C, Oustric D, Sarran M, Bouaboula M, Calandra B, Portier M, Shire D, Breliere JC, Le Fur GL. (1998) SR 144528, the first potent and selective antagonist of the CB2 cannabinoid receptor. J Pharmacol Exp Ther 284: at ASPET Journals on September 30, 2021 644-50. Showalter VM, Compton DR, Martin BR, Abood ME. (1996) Evaluation of binding in a transfected cell line expressing a peripheral cannabinoid receptor (CB2): identification of

cannabinoid receptor subtype selective ligands. J Pharmacol Exp Ther 278:989-999.

Tiffany HL, Lavignes MC, Ciu Y-H, Wang J-M, Leto TL, Gao J-L, Murphy PM. (2002) Amyloid- β induces chemotaxis and oxidant stress by acting at formylpeptide receptor 2, a G protein- coupled receptor expressed in phagocytes and brain. J Biol Chem 276: 23645-23652.

van der Stelt M, Mazzola C, Esposito G, Matias I, Petrosino S, De Filippis D, Micale V, Steardo L, Drago F, Iuvone T, Di Marzo V. (2006). Endocannabinoids and beta-amyloid-induced neurotoxicity in vivo: effect of pharmacological elevation of endocannabinoid levels. Cell Mol Life Sci 63:1410-1424. van der Stelt M, Veldhuis WB, Maccarrone M, Bär PR, Nicolay K, Veldink GA, Di Marzo V, Vliegentahart JFG. (2002) Acute neuronal injury, excitotoxicity, and the endocannabinoid system. Mol Neurobiol 26: 317-346.

Waksman Y, Olson J., Carlisle SJ, Cabral GA. (1999) The central cannabinoid receptor (CB1) mediates inhibition of nitric oxide production by rat microglial cells. J Pharmacol Exp Ther 288: 1357-1366.

Walter L, Franklin A, Witting A, Wade C, Xie Y, Kunos G, Mackie K, Stella N. (2003) Nonpsychotropic cannabinoid receptors regulate microglial cell migration. J Neurosci 23: 1398- 1405.

Walter L, Stella N. (2004) Cannabinoids and neuroinflammation. Brit J Pharmacol 141: 775-785. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 30, 2021 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 29

Footnotes

*These authors contributed equally to the work

This work was supported by the Spanish Ministry of Science and Technology to M.L.C [SAF

2005-02845] and US National Institute on Drug Abuse to R.M. [DA-9789]. B.G.R. was recipient of a fellowship from the Community of Madrid and A.M.M-M. from the Ministry of Science and

Innovation. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 30, 2021 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 30

Legends to Figures

Fig. 1. N13 microglial cells and rat primary microglia express CB1 and CB2 receptors.

Cells were immunostained with anti-CB1 (1:900 dilution) and anti-CB2 antibodies (1:900 dilution). N13 cells: upper panels; primary microglia: lower panels. Initial magnification x 200.

Fig. 2. Cannabidiol (CBD), WIN 52,212-2 (WIN) and JWH-133 (JWH) inhibited the

ATP-induced increase in intracellular calcium in cultured N13 and primary microglial Downloaded from 2+ cells. (A) Concentration-dependent inhibition of ATP-induced increase in [Ca ]i by cannabinoids in N13 cells. The effect of CBD (B; 100 nM), of WIN (C; 400 nM) and of JWH (C; 100 nM) was reverted by SR2 antagonist (100 nM). (E) Effect of cannabinoids on ATP-

2+ molpharm.aspetjournals.org induced increase in [Ca ]i in N13 cells and (F) an primary microglial cells. The antagonist SR2 blocked the effect of WIN in N13 cells and the effect of all cannabinoids in primary microglia. Results are mean±SEM of three independent experiments with multiple well replicates. Statistical analysis was done by one-way ANOVA followed by Student t test; * P<0.05 and ** P< 0.01 vs. ATP and † P<0.05 and ††† P< 0.001 vs. ATP+cannabinoid.

at ASPET Journals on September 30, 2021

Fig. 3. Implication of A2A Adenosine receptor in the effect of CBD on ATP-induced increase in intracellular calcium. Activation of A2A receptor by CGS21680 (CGS, 100 nM) inhibited the ATP-induced increase in intracellular calcium and was reverted by the A2A antagonist ZM241385 (ZM, 1000 nM) in N13 cells (A) and primary microglia (B). The implication of A2A receptors was confirmed by the reversion of CDB effect on intracellular calcium by the ZM antagonist in N13 (C) and primary microglia (D). Results are mean±SEM of three independent experiments with multiple well replicates. Statistical analysis was done by one-way ANOVA followed by Student t test; ** P< 0.01 vs. ATP and † P<0.05, †† P<0.01, ††† P<0.001 vs. ATP+CGS or ATP+CBD.

Fig.4. Cannabinoid agonists promote microglial cell migration. WIN and JWH (200 nM) promoted N13 cell migration (A and B), which was inhibited by the combination of CB1 and

CB2 antagonist (100 nM each), or the CB2 antagonist (SR2) respectively. Cannabinoid agonists promoted primary microglia migration which was blocked by CB1 and/or CB2 antagonism (C). Fib: fibrillar Aβ1-40 (2 µM); CBD: cannabidiol; WIN: WIN 55,212-2; JWH: JWH-133HU: HU-308. Results are mean±SEM of four independent experiments in duplicate. Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. MOL #71290 31

Statistical analysis was done by one-way ANOVA followed by Student t test; ** P< 0.01, ***P<0.001 vs control (no treatment); and † P<0.05 vs the cannabinoid agonist alone.

Fig. 5. Cannabinoid agonists decreased LPS-induced nitrite generation in microglial cells. Cannabinoid agonists concentration-dependently inhibited LPS-induced nitrite generation in BV-2 microglial cells (A). Cannabinoid agonist inhibition of LPS-induced nitrite generation in BV-2 (B) and primary microglial cells (C). Agent concentrations are depicted in the figure. In B and C results are expressed as percentage of control. Nitrite levels

were: BV-2 cells: control 2.47±0.21 and LPS-induced 12.54±0.98 pg/ml; primary microglia: Downloaded from control 3.65± 0.40 and LPS-induced 18.5±1.2. Results are mean±SEM of four independent experiments in duplicate. Statistical analysis was done by one-way ANOVA followed by Student t test; ***P<0.001 vs control (vehicle); and † P<0.05 vs LPS. molpharm.aspetjournals.org

Fig. 6. Cannabidiol (CBD) and WIN 55,212-2 prevented Aβ-induced learning deficit and cytokine expression. Mice received a single Aβ intraventricular injection ((2.5 µg/5 µl) l) and were treated with the cannabinoid agonists daily (see Methods for details). Training in the water maze was conducted during the second week of treatment. CBD and WIN prevented

Aβ-induced cognitive impairment, while HU-308 (HU) and JWH-133 (JWH) were without at ASPET Journals on September 30, 2021 effect (A). WIN and CBD prevented IL-6 increased gene expression induced by Aβ. Results are mean±SEM of 8 mice per group. In the water maze results SEM, which were lower than

15%, were omitted for the sake of clarity. SCR: scrambled peptide; Fib: fibrillar Aβ1-40. Statistical analysis of water maze performance was done by two-way ANOVA followed by Student t test: *P< 0.05 vs SCR treated mice; † P<0.05 vs Aβ injected mice, and of cytokine expression by one-way ANOVA: *P< 0.05 and ***P<0.001 vs SCR and ††† P<0.001 vs Fib.

Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 30, 2021 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 30, 2021 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 30, 2021 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 30, 2021 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 30, 2021 Molecular Pharmacology Fast Forward. Published on February 24, 2011 as DOI: 10.1124/mol.111.071290 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 30, 2021