Rs2476601 T Allele (R620W) Defines High-Risk PTPN22 Type I Diabetes-Associated Haplotypes with Preliminary Evidence for an Additional Protective Haplotype

ORIGINAL ARTICLE rs2476601 T allele (R620W) defines high-risk PTPN22 type I diabetes-associated haplotypes with preliminary evidence for an additional protective haplotype

AK Steck1, EE Baschal1, JM Jasinski1, BO Boehm2, N Bottini3, P Concannon4, C Julier5, G Morahan6, JA Noble7, C Polychronakos8, JX She9, GS Eisenbarth1 and the Type I Diabetes Genetics Consortium 1Barbara Davis Center for Childhood Diabetes, University of Colorado Denver, Aurora, CO, USA; 2Department of Internal Medicine, Ulm University, Ulm, Germany; 3Institute for Genetic Medicine, University of Southern California, Los Angeles, CA, USA; 4Department of Biochemistry and Molecular Genetics and Center for Public Health Genomics, University of Virginia, Charlottesville, VA, USA; 5Ge´ne´tique des Maladies Infectieuses et Autoimmunes, Institut Pasteur, Paris, France; 6Western Australian Institute for Medical Research, The University of Western Australia, Perth, Australia; 7Children’s Hospital Oakland Research Institute, Oakland, CA, USA; 8Department of Human Genetics, The McGill University Health Center, Montreal, Quebec, Canada and 9Center for Biotechnology and Genomic Medicine, Medical College of Georgia, Augusta, GA, USA

Protein tyrosine phosphatase non-receptor type 22 (PTPN22) is the third major locus affecting risk of type I diabetes (T1D), after HLA-DR/DQ and INS. The most associated single-nucleotide polymorphism (SNP), rs2476601, has a C-4T variant and results in an arginine (R) to tryptophan (W) amino acid change at position 620. To assess whether this, or other specific variants, are responsible for T1D risk, the Type I Diabetes Genetics Consortium analyzed 28 PTPN22 SNPs in 2295 affected sib-pair (ASP) families. Transmission Disequilibrium Test analyses of haplotypes revealed that all three haplotypes with a T allele at rs2476601 were overtransmitted to affected children, and two of these three haplotypes showed statistically significant overtransmission (P ¼ 0.003 to P ¼ 5.9E-12). Another haplotype had decreased transmission to affected children (P ¼ 3.5E- 05). All haplotypes containing the rs2476601 T allele were identical for all SNPs across PTPN22 and only varied at centromeric SNPs. When considering rs2476601 ‘C’ founder chromosomes, a second haplotype (AGGGGC) centromeric of PTPN22 in the C1orf178 region was associated with protection from T1D (odds ratio ¼ 0.81, P ¼ 0.0005). This novel finding requires replication in independent populations. We conclude the major association of PTPN22 with T1D is likely due to the recognized non-synonymous SNP rs2476601 (R620W). Genes and Immunity (2009) 10, S21–S26; doi:10.1038/gene.2009.87

Keywords: PTPN22; haplotypes; type I diabetes; T1DGC

Introduction tions.5–9 In a haplotype-based analysis of the PTPN22 locus, the 1858T risk allele (rs2476601) occurred on a single Protein tyrosine phosphatase non-receptor type 22 haplotype that was strongly associated with T1D.10,11 (PTPN22) is the third major locus recognized to affect type Although R620W is a functional variant, it also maps to I diabetes (T1D) risk, after HLA-DR/DQ and the insulin an extended linkage disequilibrium (LD) block containing gene (INS).1,2 The lymphoid-specific phosphatase (LYP) numerous polymorphisms, raising the possibility that encoded by the PTPN22 gene on chromosome 1p13 is an other potential functional variants could be responsible excellent candidate for T1D because it is involved in down- for the association with T1D.8 regulating T-cell activation.3 A single-nucleotide poly- The PTPN22 rs2476601 SNP is also known to be morphism (SNP, rs2476601, C-T) results in a substitution associated with risk of other autoimmune disorders, of arginine (R) by tryptophan (W) residue at LYP codon 620 including Graves’ disease,5,12 rheumatoid arthritis,13 and (R620W) with the tryptophan variant showing greater systemic lupus erythematosus.14 The 1858T variant has inhibition of T-cell receptor signaling.1,4 Of note, this ‘gain recently been reported to affect the progression from of function’ tryptophan variant is associated with T1D risk. preclinical to clinical diabetes in ICA þ individuals15 and Although the minor allele frequency (MAF) of rs2476601 to confer an additive effect on GAD positivity,16 further varies widely across ethnic groups, the association of supporting an early and general function for this variant R620W with T1D has been confirmed in several popula- in autoimmunity. The Type I Diabetes Genetics Consortium (T1DGC) genotyped 2295 affected sib-pair (ASP) families for 28 Correspondence: Dr GS Eisenbarth, Barbara Davis Center for Childhood Diabetes, University of Colorado Denver, Mail Stop SNPs across the PTPN22 region on two genotyping B140, PO Box 6511, Aurora, CO 80045-6511, USA. platforms (Illumina and Sequenom). This collection of E-mail: [email protected] ASP families and genotyping provides a basis to assess rs2476601 T allele (R620W) defines high-risk PTPN22 T1D-associated haplotypes AK Steck et al S22 which specific PTPN22 SNPs and haplotypes are frequently in cases without the HLA DR3/4-DQ8 associated with T1D risk. genotype than in cases carrying the high-risk HLA DR3/4-DQ8 genotype. Frequencies for the T/T genotype were 3.6% in HLA non-DR3/4-DQ8 cases and 3.2% in HLA DR3/4-DQ8 cases. Similarly, the frequen- Results cies for the C/T genotype were 29.9% in HLA non-DR3/ Transmission Disequilibrium Test (TDT) analyses 4-DQ8 cases and 22.5% in HLA DR3/4-DQ8 cases showed that 17 out of the 26 Illumina-typed SNPs were (P ¼ 0.001). significantly associated with T1D. The PTPN22 SNP rs2476601 had the most strong association with T1D, resulting in a relative risk of 1.55 (P ¼ 5.5E-17) Discussion (Figure 1a). TDT analyses using haplotypes of all 27 SNPs (26 Illumina SNPs and 1 Sequenom SNP not typed Despite consistent association observed between the in Illumina) provided a total of 25 haplotypes with PTPN22 1858C/T polymorphism (R620W) and T1D risk frequency 40.1% (Table 1). All three haplotypes with a T in multiple populations, it is difficult to absolutely define allele at rs2476601 were overtransmitted (57–85%, com- the etiologic polymorphism because of strong LD. To pared with the expected of 50%). Further, 2 of these 3 address this question, the coding region of the PTPN22 haplotypes were significantly overtransmitted to affected gene has been sequenced and several novel variants children (P ¼ 0.003 to P ¼ 5.9E-12). Another haplotype identified.10 Haplotype analyses suggested that the had decreased transmission to affected children 1858T risk allele is contained in only one haplotype, (P ¼ 3.5E-05). All T-allele haplotypes were identical for which was strongly associated with T1D. After control- all SNPs across the PTPN22 gene and only varied ling for this haplotype, two other haplotypes were centromeric of PTPN22 in the C1orf178 (chromosome 1 weakly associated with T1D, suggesting that the 1858 open reading frame 178) region. Indeed, the LD plot of SNP or a SNP in strong LD with the 1858 SNP may be this region exhibits strong LD for multiple SNPs, with responsible for the observed association. evidence for two haplotype blocks (Figure 1b). The first In Asians, the 1858T allele has not been observed.6,17 haplotype block includes the telomeric region with the Through extensive sequencing of the PTPN22 coding and RSBN1 (round spermatid basic protein 1) and PTPN22 regulatory regions, a number of other SNPs have been genes and the second haplotype block includes the identified.11,17 A regulatory SNP (À1123G/C; rs2488457) centromeric region with C1orf178. A chromosomal map was shown to be weakly associated with T1D in Japanese of the 28 SNPs in and near PTPN22 gene is shown in and Koreans,17 but it was not associated with disease in Figure 1c. Sardinians.11 Recently, 46 SNPs were genotyped in Allele frequencies of case and control founder chromo- the PTPN22 region in 3000 T1D cases and 2400 controls.18 somes (N ¼ 8598) from the 26 Illumina SNPs are shown In this population, it was concluded that no other in Table 2. To explore the possibility of other PTPN22 PTPN22 SNP was associated with T1D independent of SNPs in addition to rs2476601 having an association with rs2476601. Thus, rs2476601 remains the best candidate as T1D, stratified analyses by rs2476601were performed. the causal variant in this chromosome region in Additional analyses included using all SNPs in a logistic European populations. regression model. Using only PTPN22 rs2476601 ‘C In this T1DGC dataset, we found that all three haplo- allele’ founder chromosomes (N ¼ 6095), the haplotype types having a T allele at rs2476601 were overtrans- AGGGGC, centromeric of PTPN22 in the C1orf178 mitted (57–85%) to affected children. Two of these haplo- region, was significantly associated with protection from types had significant overtransmission (P ¼ 0.003 to T1D (odds ratio (OR) ¼ 0.81, 95% confidence interval P ¼ 5.9E-12), whereas another haplotype (with ‘AGGGGC’ (CI) ¼ 0.72–0.91, P ¼ 0.0005). Another haplotype, in the C1orf178 region) was protective. These data CGAAAC in the C1orf178 region, was associated with are consistent with the possibility that the observed susceptibility to T1D (OR ¼ 1.24, 95% CI ¼ 1.02–1.51, association of PTPN22 with T1D risk may be due to the P ¼ 0.03) (Table 3). For PTPN22 rs2476601 ‘T allele’ non-synonymous SNP, rs2476601, as haplotypes bearing founder chromosomes, the LD was almost complete, the T allele at this SNP are overtransmitted. However, in such that there was minimal effect of other SNPs. this data set, all of these haplotypes have identical SNP Logistic regression analyses in founder chromosomes genotypes across the PTPN22 gene (due to strong LD). revealed that only rs2476601 was associated with Thus, it remains possible that other SNPs may be susceptibility to T1D (OR ¼ 1.27, 95% CI ¼ 1.15–1.41, responsible for the association with T1D. Among Po0.0001) whereas three centromeric SNPs (rs7524200, chromosomes with the low risk 1858C allele, a second rs1217423, and rs1539438) had evidence for protection haplotype in the C1orf178 region centromeric of PTPN22 (OR ¼ 0.11–0.30, 95% CI ¼ 0.01–0.95, P ¼ 0.03–0.04). (AGGGGC) exhibits a strong association with T1D, with The PTPN22 rs2488457 SNP has been earlier associated decreased transmission to patients. This finding requires with T1D. Stratified analyses by rs2476601 did not show replication in independent populations. an independent association of rs2488457 with T1D risk. In these T1DGC ASP families, the PTPN22 rs2476601 T/ For rs2476601 ‘C allele’ founder chromosomes, the MAF T and C/T genotypes were significantly more frequent in (C allele) for rs2488457 was 12.3% in T1D cases and 12% T1D cases carrying lower risk HLA genotypes (that is in non-cases, whereas for rs2476601 ‘T-allele’ chromo- without the HLA-DR3/4-DQ8 genotype), a finding that is somes, the MAF for rs2488457 was 98.9% in cases and consistent with a recent study.18 The PTPN22 rs2476601 100% in non-cases. SNP results in a missense mutation that changes an Analyses performed only in probands indicated that arginine (R) at position 620 to a tryptophan (W) and the PTPN22 T/T and C/T genotypes occurred more abrogates the ability of the molecule to bind to the signaling

Genes and Immunity rs2476601 T allele (R620W) defines high-risk PTPN22 T1D-associated haplotypes AK Steck et al S23

Figure 1 (a) TDT analyses of the 26 Illumina SNPs. Es2476601 is in black, all other SNPs are in grey. (b) LD plot showing strong LD across the complete region for multiple SNPs (Illumina SNPs). The arrow points to rs2476601 (SNP number 9). (c) Chromosomal map of the 28 SNPs in and near the PTPN22 gene. Arrow shows the PTPN22 gene. Rs2476601 is in bold. Squares denote exons and triangles show SNPs.

molecule Csk (c-Src tyrosine kinase).1,3 The lyp-Csk an early and general effect on immune function is the complex down-regulates T-cell receptor signaling, and the finding that the minor tryptophan-encoding allele is T1D-associated variant is reported to result in greater associated with a series of autoimmune disorders, includ- inhibition of T-cell receptor signaling.4,19,20 Consistent with ing rheumatoid arthritis, systemic lupus erythematosus,

Genes and Immunity rs2476601 T allele (R620W) defines high-risk PTPN22 T1D-associated haplotypes AK Steck et al S24 Table 1 TDT of haplotypes with frequencies X0.1% (N ¼ 2280 families)

Haplotype Frequency Transmission % Transmission Untransmission % Untransmission P-value

AAATCGTTCAGGGCGGGCGGCAGGGGC 0.243 827 44.9 1015 55.1 3.50E-05 AAATTGTCCGGGGTGGGCCGCATGAAT 0.201 773 48.6 818 51.4 0.293 GAGGTATTCAAAACTGCTCGCCGGAAC 0.157 682 50.0 681 50.0 1 AAGGTACTTAGGACGCCTCATCGAAAC 0.1275 685 60.6 446 39.4 5.93E-12 AAGGTACTCAGGACGCCTCATCGAAAC 0.0525 244 49.2 252 50.8 0.750 AAGGTACTCAGGACGCCTCATATGAAT 0.0305 147 49.8 148 50.2 1 AAGGTACTCAGGACGCCTCATAGGGGC 0.029 145 48.0 157 52.0 0.523 AGATTGTCCGGGGTGGGCCGCATGAAT 0.0275 145 53.1 128 46.9 0.329 AAGGTACTCAGGACGGCTCATCGAAAC 0.02 92 49.5 94 50.5 0.941 AAATTGTCCAGGGTGGGCCGCATGAAT 0.0145 71 48.3 76 51.7 0.740 AAGGTACTTAGGACGCCTCATCGGAAC 0.014 76 57.1 57 42.9 0.117 AAATCGTTCAGGGCGGGCGGCATGAAT 0.011 58 49.2 60 50.8 0.926 AAGGTACTCAGGACGGGCGGCAGGGGC 0.0105 52 46.4 60 53.6 0.507 GAGGTATTCAAAACTGCTCGCATGAAT 0.007 34 47.9 37 52.1 0.812 GAGGTATTCAAAACTGCTCGCAGGGGC 0.007 29 43.9 37 56.1 0.388 AAATCGTTCAGGGCGGGCGGCCGAAAC 0.0065 29 50.9 28 49.1 1 GAATCGTTCAGGGCGGGCGGCAGGGGC 0.005 25 43.1 33 56.9 0.357 AAATCGTTCAGGGCGGGCGGCCGGAAC 0.004 24 53.3 21 46.7 0.766 AAGGTATTCAAAACTGCTCGCCGGAAC 0.004 17 45.9 20 54.1 0.743 GAGGTATTCAAAATGGGCCGCATGAAT 0.004 16 45.7 19 54.3 0.736 AAATTGTCCGGGGTGGGCCGCCGAAAC 0.003 17 48.6 18 51.4 1 GAGGTATTCAAAACTGCTCGCCGAAAC 0.002 11 39.3 17 60.7 0.345 AAGGTACTTAGGACGCCTCATATGAAT 0.002 17 85.0 3 15.0 0.003 AAATTGTCCGGGGTGGGCCGCAGGGGC 0.002 6 42.9 8 57.1 0.790 GAGGTACTCAAAACTGCTCGCCGGAAC 0.001 14 77.8 4 22.2 0.031 m rs2476601

Abbreviations: SNP, single-nucleotide polymorphism; TDT, Transmission Disequilibrium Test. The three haplotypes with a T allele at rs2476601 are highlighted in bold for the SNPs that are identical across the PTPN22 gene. The arrow points to rs2476601 (SNP number 9).

Table 2 Allele frequencies of case and control chromosomes for the 26 Illumina SNPs (N ¼ 8598)

SNP Genotype MA CaseMA CaseMAF ControlMA ControlMAF OR 95% CI P-value

rs3827733 AG G 1019 16.8 378 17.9 0.93 0.81–1.06 0.25 rs3789602 AG G 180 2.8 50 2.3 1.24 0.9–1.7 0.19 rs1217379 AG G 2876 49.3 869 42.5 1.32 1.19–1.46 1.31E-07 rs6537798 GT G 2884 49.3 873 42.5 1.32 1.19–1.46 1.21E-07 rs3789607 CT C 1434 23.9 642 30.8 0.71 0.63–0.79 1.14E-09 rs2476600 AG A 2887 49.2 875 42.5 1.31 1.19–1.45 1.43E-07 rs1217395 CT C 1682 29.4 467 23.6 1.35 1.2–1.52 1.00E-06 rs1970559 CT C 1442 23.7 530 25.1 0.93 0.83–1.04 0.21 rs2476601 CT T 910 14.7 195 9.1 1.74 1.47–2.04 5.72E-12 rs1775759 AG G 1265 21.6 459 23.0 0.92 0.82–1.04 0.20 rs3765598 AG A 1015 16.7 377 17.8 0.93 0.81–1.05 0.24 rs1217418 AG A 2894 49.4 877 42.6 1.31 1.19–1.45 1.25E-07 rs1217414 CT T 1452 23.9 537 25.4 0.92 0.82–1.03 0.17 rs17510162 GT T 1019 16.7 376 17.7 0.94 0.82–1.06 0.31 rs2488457 CG C 1523 25.5 423 20.1 1.36 1.21–1.54 4.60E-07 rs1235005 CG C 2802 47.8 851 41.4 1.3 1.17–1.44 4.67E-07 rs6665194 CT T 2803 47.9 849 41.4 1.3 1.17–1.44 3.96E-07 rs1217384 CG G 1515 25.1 665 31.5 0.73 0.65–0.81 1.77E-08 rs12566340 AG A 1659 27.9 467 22.3 1.35 1.2–1.52 3.96E-07 rs7529353 CT T 1670 28.1 469 22.4 1.36 1.21–1.53 2.62E-07 rs7524200 AC C 2428 41.1 722 34.7 1.31 1.18–1.45 3.58E-07 rs1217423 GT T 1716 28.5 623 29.6 0.95 0.85–1.06 0.37 rs2358994 AG A 1280 21.2 346 16.3 1.38 1.21–1.58 1.00E-06 rs1539438 AG G 1590 26.6 709 33.8 0.71 0.64–0.79 5.82E-10 rs1217394 AG G 1615 26.9 717 34.0 0.71 0.64–0.79 7.19E-10 rs1217393 CT T 1676 28.3 600 29.1 0.96 0.86–1.07 0.50

Abbreviations: MA, count of minor allele; MAF, minor allele frequency; OR, odds ratio; SNP, single-nucleotide polymorphism. P-values o0.05 are indicated in bold.

autoimmune thyroid disease (either Hashimoto thyroiditis rs2476601 regulates T1D-specific autoimmunity and or Graves’ disease), and T1D with an overall OR for the T strongly affects the progression from preclinical to clinical allele between 1.5 and 1.9.21 Others have shown that diabetes in ICA positive individuals.15

Genes and Immunity rs2476601 T allele (R620W) defines high-risk PTPN22 T1D-associated haplotypes AK Steck et al S25 Table 3 rs2476601 ‘C’ founder chromosomes (N ¼ 6095): de- had a slightly lower call rate of 93–96%) and concordant creased risk from haplotype AGGGGC in block 2 between the two platforms (498% concordance except for 1 SNP which had a 96% concordance rate). All Haplotype Case Control P-value OR 95% CI SNPs were in Hardy–Weinberg equilibrium except for (N ¼ 4399) (N ¼ 1696) one SNP (rs1746860) from the Sequenom platform, which was therefore excluded from all analyses. Of the 28 ATGAAT 1557 (35.4%) 568 (33.5%) 0.17 1.09 0.97–1.23 SNPs, 11 are in the PTPN22 gene, including the non- AGGGGC 1486 (33.8%) 654 (38.6%) 0.0005 0.81 0.72–0.91 CGAAAC 455 (10.3%) 144 (8.5%) 0.03 1.24 1.02–1.51 synonymous R620W SNP, and 9 are in known neighbor- CGGAAC 901 (20.5%) 330 (19.4%) 0.39 1.07 0.93–1.23 ing genes, including 4 in the RSBN1 gene and 5 in the C1orf178 which encodes Bfk, a B-cell lymphoma 2 Stratified analyses by rs2476601 looking at only rs2476601 ‘C’ (BCL2) family member (BFK) with some proapoptotic founder chromosomes (N ¼ 6095). effects that is expressed in both spleen and thymus 23 The order of the SNPs in the haplotypes is the following: rs7524200, (Figure 1c). rs1217423, rs2358994, rs1539438, rs1217394, rs1217393. P-values o0.05 are indicated in bold. Statistical analysis Data quality checks, using standard methods including the PedCheck program, and TDT for individual The association of PTPN22 with T1D is likely due to SNPs using the UNPHASED software (v 2.40). were the non-synonymous SNP rs2476601. All haplotypes performed by the Coordinating Center of the T1DGC. with a T allele at this SNP have identical alleles for all The LD plot and TDT analyses for the haplotypes SNPs telomeric and across the PTPN22 gene. For were computed using Haploview software (http:// haplotypes with the C allele at rs2476601, we provide www.broad.mit.edu/mpg/haploview).24 For the TDT initial evidence for an additional locus influencing T1D. haplotype analyses, we converted the families to trios, by including parents and one single, randomly chosen offspring. We repeated TDT analyses with the second Materials and methods affected offspring to account for the transmissions to the other affected sibling and combined both datasets for Study population analyses. The T1DGC has created a resource base of well- Merlin software (http://www.sph.umich.edu/csg/ characterized families from multiple ethnic groups to abecasis/Merlin)25 was used to phase the SNP genotype facilitate the localization and characterization of T1D data from families into haplotypes. AFBAC (affected susceptibility genes (http://www.t1dgc.org). Genotyp- family-based control) methodology was used to assign ing for the Rapid Response project was performed on case or control status to chromosomes,26 using a VBA 2295 families in nine cohorts. SNPs in 21 candidate genes (Visual Basic for Applications) program developed in- were genotyped on two platforms (Illumina and Seque- house. SAS software version 9.1 (http://www.SAS.com) nom). Details of the sample, quality control, and other was used to perform logistic regression analysis. Results aspects of the data can be found in this volume (Brown 22 were considered significant at ao0.05 without adjust- et al. ). ments for multiple comparisons. The families selected for these analyses consisted mainly of nuclear families with an ASP. This study reports the results for the 28 SNPs genotyped across the PTPN22 region in 9251 individuals, including 5580 Conflict of interest children (4445 (80%) affected, 840 (15%) unaffected, 295 N Bottini is co-inventor on a patent application (PCT/ (5%) unknown status) and 3671 parents (157 (4%) US05/24862) entitled ‘Functional Variant of Lymphoid affected, 2576 (70%) unaffected, 938 (26%) unknown Tyrosine Phosphatase is Associated with Autoimmune status). There was no significant difference by sex (male/ Disorders’. The remaining authors declare no conflict of female ¼ 49.4%). The average age of onset of T1D for interest. cases was 11.5 years (range, 0–71 years) with an average duration of disease of 13 years (range, 0–63 years). The families used in this study were collected from the following T1DGC networks and contributing sites: 9% Acknowledgements Asia-Pacific, 29% European, 35% North American, and This research uses resources provided by the Type I 27% UK/Sardinian. The majority of the subjects were Diabetes Genetics Consortium, a collaborative clinical Caucasian (81%) with 18% unknown ethnicity and 1% study sponsored by the National Institute of Diabetes other (Asian, African American, Pacific Islander). and Digestive and Kidney Diseases (NIDDK), National Institute of Allergy and Infectious Diseases (NIAID), Genotyping National Human Genome Research Institute (NHGRI), The T1DGC has genotyped 2295 ASP families for 28 National Institute of Child Health and Human Develop- SNPs across the PTPN22 region using both Illumina and ment (NICHD), and Juvenile Diabetes Research Founda- Sequenom platforms. A total of 26 SNPs were genotyped tion International (JDRF) and supported by U01 by Illumina GoldenGate technology, whereas 25 SNPs DK062418. Genotyping was performed at the Broad were genotyped by Sequenom MALDI-TOF technology, Institute Center for Genotyping and Analysis is sup- for a total of 23 SNPs genotyped on both platforms. ported by grant U54 RR020278 from the National Center The call rate for all SNPs in both platforms was for Research Resources. BOB was support by the German complete (497% call rate except for 3 SNPs which Research Foundation (DFG: SFB 518 & GrK 1041).

Genes and Immunity rs2476601 T allele (R620W) defines high-risk PTPN22 T1D-associated haplotypes AK Steck et al S26 References polymorphism of protein tyrosine phosphatase PTPN22 with human SLE. Am J Hum Genet 2004; 75: 504–507. 1 Bottini N, Musumeci L, Alonso A, Rahmouni S, Nika K, 15 Hermann R, Lipponen K, Kiviniemi M, Kakko T, Veijola R, Rostamkhani M et al. A functional variant of lymphoid Simell O et al. Lymphoid tyrosine phosphatase (LYP/PTPN22) tyrosine phosphatase is associated with type I diabetes. Nat Arg620Trp variant regulates insulin autoimmunity and Genet 2004; 36: 337–338. progression to type 1 diabetes. Diabetologia 2006; 49: 2 Wellcome Trust Case Control Consortium. Genome-wide 1198–1208. association study of 14,000 cases of seven common diseases 16 Chelala C, Duchatelet S, Joffret ML, Bergholdt R, Dubois- and 3,000 shared controls. Nature 2007; 447: 661–678. LaForgue D, Ghandil P et al. PTPN22 R620W functional 3 Cloutier JF, Veillette A. Cooperative inhibition of T-cell antigen variant in type 1 diabetes and autoimmunity related traits. receptor signaling by a complex between a kinase and a Diabetes 2007; 56: 522–526. phosphatase. J Exp Med 1999; 189: 111–121. 17 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, 4 VangT,CongiaM,MacisMD,MusumeciL,OrruV,ZavattariP Nakanishi K et al. Systematic search for single nucleotide et al. Autoimmune-associated lymphoid tyrosine phosphatase polymorphisms in a lymphoid tyrosine phosphatase gene is a gain-of-function variant. Nat Genet 2005; 37: 1317–1319. (PTPN22): association between a promoter polymorphism and 5 Smyth D, Cooper JD, Collins JE, Heward JM, Franklyn JA, type 1 diabetes in Asian populations. Am J Med Genet 2006; Howson JM et al. Replication of an association between the 140: 586–593. lymphoid tyrosine phosphatase locus (LYP/PTPN22) with 18 Smyth DJ, Cooper JD, Howson JM, Walker NM, Plagnol V, type 1 diabetes, and evidence for its role as a general Stevens H et al. PTPN22 Trp620 explains the association of autoimmunity locus. Diabetes 2004; 53: 3020–3023. chromosome 1p13 with type 1 diabetes and shows a statistical 6 Zheng W, She JX. Genetic association between a lymphoid interaction with HLA class II genotypes. Diabetes 2008; 57: tyrosine phosphatase (PTPN22) and type 1 diabetes. Diabetes 1730–1737. 2005; 54: 906–908. 19 Rieck M, Arechiga A, Onengut-Gumuscu S, Greenbaum C, 7 Ladner MB, Bottini, N Valdes AM, Noble JA. Association of Concannon P, Buckner JH. Genetic variation in PTPN22 the single nucleotide polymorphism C1858T of the PTPN22 corresponds to altered function of T and B lymphocytes. gene with type 1 diabetes. Hum Immunol 2005; 66: 60–64. J Immunol 2007; 179: 4704–4710. 8 Qu H, Tessier MC, Hudson TJ, Polychronakos C. Confirmation 20 Aarnisalo J, Treszl A, Svec P, Marttila J, Oling V, Simell O et al. of the association of the R620W polymorphism in the Reduced CD4(+)T cell activation in children with type 1 protein tyrosine phosphatase PTPN22 with type 1 diabetes diabetes carrying the PTPN22/Lyp 620Trp variant. J Auto- in a family based study. J Med Genet 2005; 42: 266–270. immun 2008; 31: 13–21. 9 Steck AK, Liu SY, McFann K, Barriga KJ, Babu SR, Eisenbarth 21 Criswell LA, Pfeiffer KA, Lum RF, Gonzales B, Novitzke J, GS et al. Association of the PTPN22/LYP gene with type 1 Kern M et al. Analysis of families in the multiple autoimmune diabetes. Pediatr Diabetes 2006; 7: 274–278. disease genetics consortium (MADGC) collection: the PTPN22 10 Onengut-Gumuscu S, Buckner JH, Concannon P. A haplotype- 620W allele associates with multiple autoimmune phenotypes. based analysis of the PTPN22 locus in type 1 diabetes. Diabetes Am J Hum Genet 2005; 76: 561–571. 2006; 55: 2883–2889. 22 Brown WM, Pierce JJ, Hilner JE, Perdue LH, Lohman K, Lu L 11 Zoledziewska M, Perra C, Orru V, Moi L, Frongia P, Congia M et al. et al. and the Type I Diabetes Genetics Consortium. Overview Further evidence of a primary, causal association of the PTPN22 of the Rapid Response data. Genes Immun 2009; 10(Suppl 1): 620W variant with type 1 diabetes. Diabetes 2008; 57: 229–234. S5–S15 12 Velaga MR, Wilson V, Jennings CE, Owen CJ, Herington S, 23 Coultas L, Pellegrini M, Visvader JE, Lindeman GJ, Chen L, Donaldson PT et al. The codon 620 tryptophan allele of the Adams JM et al. Bfk: a novel weakly proapoptotic member of lymphoid tyrosine phosphatase (LYP) gene is a major the Bcl-2 protein family with a BH3 and a BH2 region. Cell determinant of Graves’ disease. J Clin Endocrinol Metab 2004; Death Differ 2003; 10: 185–192. 89: 5862–5865. 24 Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and 13 Begovich AB, Carlton VE, Honigberg LA, Schrodi SJ, visualization of LD and haplotype maps. Bioinformatics 2005; Chokkalingam AP, Alexander HC et al. A missense single- 21: 263–265. nucleotide polymorphism in a gene encoding a protein 25 Abecasis GR, Cherny SS, Cookson WO, Cardon LR. tyrosine phosphatase (PTPN22) is associated with rheumatoid Merlin–rapid analysis of dense genetic maps using sparse arthritis. Am J Hum Genet 2004; 75: 330–337. gene flow trees. Nat Genet 2002; 30: 97–101. 14 Kyogoku C, Langefeld CD, Ortmann WA, Lee A, 26 Thomson G. Mapping disease genes: family-based association Selby S, Carlton VE et al. Genetic association of the R620W studies. Am J Hum Genet 1995; 57: 487–498.

Genes and Immunity