T Cell Proliferation + Allele Is Associated with Alterations in CD4

The CD6 Multiple Sclerosis Susceptibility Allele Is Associated with Alterations in CD4 + T Cell Proliferation

This information is current as David M. Kofler, Christopher A. Severson, Narine of September 27, 2021. Mousissian, Philip L. De Jager and David A. Hafler J Immunol 2011; 187:3286-3291; Prepublished online 17 August 2011; doi: 10.4049/jimmunol.1100626

http://www.jimmunol.org/content/187/6/3286 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2011/08/18/jimmunol.110062 Material 6.DC1 http://www.jimmunol.org/ References This article cites 36 articles, 13 of which you can access for free at: http://www.jimmunol.org/content/187/6/3286.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts Errata An erratum has been published regarding this article. Please see next page or: /content/189/4/2063.full.pdf

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

The CD6 Multiple Sclerosis Susceptibility Allele Is Associated with Alterations in CD4+ T Cell Proliferation

David M. Koﬂer,*,†,‡,1 Christopher A. Severson,‡,1 Narine Mousissian,*,†,‡ Philip L. De Jager,‡,x,1 and David A. Haﬂer*,†,‡,x,1

Genome-wide association studies have revealed a large number of genetic associations with autoimmune diseases. Despite this prog- ress, the mechanisms underlying the contribution of allelic variants to the onset of immune-related diseases remain mostly unknown. Our recent meta-analysis of genome-wide association studies of multiple sclerosis (MS) identified a new susceptibility locus tagged by a single nucleotide polymorphism, rs17824933 (p = 3.8 3 1029), that is found in a block of linkage disequilibrium containing the CD6 gene. Because CD6 plays an important role in maintenance of T cell activation and proliferation, we examined the biologic phenotypes of the risk-associated allele. In this article, we report that the MS susceptibility allele in CD6 is associated with decreased expression of full-length CD6 in CD4+ and CD8+ T cells. As a consequence, proliferation is diminished during long-term Downloaded from activation of CD4+ T cells from subjects with the risk allele. Selective knockdown of full-length CD6 using exon 5-specific small interfering RNA induces a similar proliferation defect of CD4+ T cells from subjects homozygous for the protective allele. Exon 5 encodes for the extracellular binding site of the CD6 ligand ALCAM, which is required for CD6 stimulation. In CD4+ T cells from subjects with the risk allele, exon 5 is consistently underexpressed, thereby providing a mechanism by which the allele affects proliferation of CD4+ T cells. These findings indicate that the MS risk allele in the CD6 locus is associated with altered proliferation of CD4+ T cells and demonstrate the influence of a disease-related allelic variant on important immunological character- http://www.jimmunol.org/ istics. The Journal of Immunology, 2011, 187: 3286–3291.

ultiple sclerosis (MS) is an inflammatory disease of the CD6 is a 130-kDa type 1 transmembrane glycoprotein expressed CNS that shares elements of its genetic architecture on the surface of CD4+ and CD8+ T cells and, to a lesser extent, on with other autoimmune diseases (1). Pathologically, B cells. CD6 stimulation plays an important role in the mainte- M + + there are perivenular infiltrates of CD4 and CD8 T cells in the nance of T cell activation (12–19) because blocking interactions CNS white matter and meninges with demyelinating lesions and between CD6 and its ligand activated leukocyte cell adhesion loss of axons in both white and gray matter (2, 3). There are also molecule (ALCAM) result in diminished proliferation of T cells marked changes in systemic immune function with loss of regu- (12). The ALCAM-binding site is located at the membrane- by guest on September 27, 2021 latory T cell (Treg) function and increases in myelin-reactive proximal scavenger receptor cysteine-rich (SRCR) domain 3 of CD4+ T cells (4–6). Interestingly, unbiased genome-wide associ- CD6 and is present in most of the five intracellular and three ation scans have identified susceptibility loci almost exclusively in extracellular isoforms of CD6 that have been described (20–22). regions containing genes with immune function, including CD6, The CD6Dd3 splice variant, created by excluding exon 5, is CD25, CD40, CD58, HLA A, HLA B, HLA-DRB1, IL2RA, IL7R, lacking the membrane-proximal SRCR domain 3 with the IL12A, IRF8, STAT3, and TNFRSF1A (7–11). The identification of ALCAM-binding site (23). The MS risk allele rs17824933G is susceptibility loci is a major step forward in MS, but we do not yet located in intron 1 of the CD6 gene (7) and is found at a frequency understand how allelic variation influences immune function. This of 44% of subjects of European ancestry from the PhenoGenetic transition remains a major challenge in the understanding of MS Project, a cohort of .1200 healthy subjects recruited from the and of other human autoimmune diseases. Greater Boston Metropolitan area that supports the functional characterization of genetic variation; subjects homozygous for the risk allele (with an rs17824933GG genotype) are found at 7.6% *Department of Neurology, Yale School of Medicine, New Haven, CT 06520; †Department of Immunobiology, Yale School of Medicine, New Haven, CT 06520; frequency in this population. ‡Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and xBroad Institute of Harvard University and Massachusetts Institute of Technology, Materials and Methods Cambridge, MA 02142 Subjects 1D.M.K., C.A.S., P.L.D.J., and D.A.H. contributed equally to this article. The Brigham and Women’s Hospital PhenoGenetic Cohort with a collec- Received for publication March 3, 2011. Accepted for publication July 18, 2011. tion of 1200 healthy control subjects served as basis for subject recruitment This work was supported by the Deutsche Forschungsgemeinschaft (Grant KO 4034/ and sample collection. These subjects were genotyped and had the fol- 1-1 to D.M.K.). lowing characteristics: female/male sex ratio was 60:40%; race distribution Address correspondence and reprint requests to Dr. David A. Hafler, Department of was 14% African American, 12% Asian American, 68% white, and 6% Neurology, Yale School of Medicine, New Haven, CT 06520. E-mail address: david. Hispanic; smoking history was 82% never smokers, 9% former smokers, hafl[email protected] and 9% smokers; mean age was 24.3 y (range, 18–50 y); mean body mass The online version of this article contains supplemental material. index was 22.5 (range, 13–50); and MHC was 51% HLA A2, 20% HLA A3, 23% HLA-DR2, and 20% HLA-DR1 and -DR4. All subjects have Abbreviations used in this article: ALCAM, activated leukocyte cell adhesion molecule; MS, multiple sclerosis; rhALCAM-Fc, recombinant human ALCAM-Fc fusion been comprehensively genotyped for allelic variants related to suscepti- protein; siRNA, small interfering RNA; SNP, single nucleotide polymorphism; bility to autoimmune diseases. The study was conducted in compliance SRCR, scavenger receptor cysteine-rich; Treg, regulatory T cell. with the Declaration of Helsinki. Approval was obtained from the local ethics committee before study initiation, and written informed consent was Copyright Ó 2011 by The American Association of Immunologists, Inc. 0022-1767/11/$16.00 obtained from all patients before performing any study procedures. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1100626 The Journal of Immunology 3287

Primary human lymphocytes were isolated from peripheral blood of Flow cytometry healthy donors by Ficoll gradient, and CD4+ and CD8+ T cells were purified by MACS separation. CD4+ and CD8+ T cells were cultured in RPMI The PE-conjugated and FITC-conjugated anti-CD3, anti-CD4, anti-CD8, 1640 medium, 10% (v/v) FCS (Life Technologies, Paisley, U.K.). and anti-CD6 mAbs were purchased from BD Pharmingen (San Diego, CA). The allophycocyanin-conjugated anti-CD4 mAb was purchased from Genotyping Dako North America (Carpinteria, CA). The goat anti-human IgG Ab and its biotin-, FITC-, and PE-conjugated F(ab9)2 fragment derivatives were Healthy control subjects of the Brigham and Women’s Hospital Pheno- purchased from Dako North America. Living cells were gated using Live/ Genetic cohort were genotyped on the Affymetrix Genome-wide Human Dead fixable dead cell stain kit (Molecular Probes, Eugene, OR). Labeled SNP Array 6.0 (Genechip 6.0) at the Broad Institute’s Center for Geno- cells were analyzed on a FACSCanto cytofluorometer equipped with the typing and processed for quality control using the PLINK software suite. FACS Diva research software (BD Bioscience, San Diego, CA). We applied its standard quality-control pipeline for subjects (genotype success rate .95%, sex concordant, excess interheterozygosity/intra- ELISA assays heterozygosity) and for single nucleotide polymorphisms (SNPs) (Hardy– T cells were cultured in the presence of the anti-CD3 mAb OKT3 (0.5 mg/ . 3 26 . Weinberg equilibrium p 1 10 ; minor allele frequency 0.01, ml) and anti-CD28 mAb 15E8 (0.5 mg/ml). Where indicated, cells were . . 3 29 genotype call rate 0.95; mishap test 1 10 ) to these data. incubated with 1 mg/ml anti-CD6 mAb M-T605 or 1 mg/ml isotype control. After 3 or 6 d, supernatants were collected and cytokine production Searchable genome-wide association was determined by ELISA as previously described (24). Matched pair capture and biotinylated detection Abs for determination of IFN-g (NIB42, The complete results of the genome-wide association analysis are avai- B133), IL-10 (JES3-19F1, JES3-12G8), and IL-13 (JES10-5A2, B69-2) lable to search by SNP id, chromosome, or base pair location on the In- were purchased from BD Bioscience. Recombinant human IFN-g, IL-10, ternational Multiple Sclerosis Genetics Consortium Web site (http://www. and IL-13 were purchased from Chiron (Ratingen, Germany). imsgc.org). Downloaded from CFSE proliferation assay Real-time PCR Freshly isolated CD4+ T cells were labeled with 5 mM CFSE (Invitrogen, Full-length CD6 and the CD6Dd3 isoform were amplified by PCR as Karlsruhe, Germany) for 10 min and washed five times with PBS/FBS. previously described (13). The following primers were used for amplifi- CSFE-labeled CD4+ T cells (5 3 104 cells/well) were cultured in the cation of full-length CD6: 59-TAGTAGTCTAGAAGCCAGAGACAGCT- presence of the anti-CD3 mAb OKT3 (0.5 mg/ml) and anti-CD28 mAb CCAGAC-39 (forward) and 59- TAGTAGGTCGACCGAGATTCCTTGT 15E8 (0.5 mg/ml). Where indicated, cells were incubated with 1 mg/ml

TC-39 (reverse). The CD6Dd3 isoform was amplified using the follow- anti-CD6 mAb M-T605 or 1 mg/ml isotype control. After 3 and 6 d, CSFE http://www.jimmunol.org/ ing primers: 59-TAGTAGTCTAGATTGTCGACATCAGAGCACCAGT- dilution was analyzed by flow cytometry, and the number of cycling and CC-39 (forward) and 59-TAGTAGCTCGAGCGAGATTCCTTGTTCTC- noncycling CFSE-labeled T cells was determined. TATT-39 (reverse). Total CD6 was analyzed using commercial probes (Hs00198752_m1; Applied Biosystems) specific for the exon 1/2 bound- Statistical analysis ary (59-AGGTCATCCATCTCCAGCCCCACCTGACCAGCTCAACA- Unpaired Student t test was used to compare RNA expression, cell pro- CCAGCAGTGCAGAGAGTGAGCTGGCTTCCGGTCC-39), and CD6 liferation, and cytokine production between T cells from donors with CC, isoforms containing exons 8 and 9 were analyzed using commercial probes CG,orGG genotype. Statistical analysis was performed using GraphPad (Hs00945716_m1; Applied Biosystems) specific for the exon 8/9 boundary Prism (GraphPad Software, La Jolla, CA). (59-AAAGAAGTTTTCATGCTGCCCATCCAGGTCCAGGCCCCGCCCC- CTGAG GACTCAGACT-39). Relative fold changes of mRNA expression were calculated by the DDcycle threshold method, and the amount of target Results by guest on September 27, 2021 gene was normalized to GAPDH (Applied Biosystems). In this study, we examined the correlation of the CD6 rs17824933G allele with changes in the immune function of healthy subjects. We Small interfering RNA use healthy subjects to investigate correlations between MS sus- Full-length CD6 expression in CD4+ T cells was selectively knocked down ceptibility alleles and immunophenotype because the phenotype using a transient direct small interfering RNA (siRNA) delivered by and function of immune cells in patients with autoimmune diseases electroporation nucleofection (Amaxa), according to the manufacturer’s are likely to be confounded by immunotherapies or by effects of the instructions. Nonspecific siRNA was used as control. Expression levels of full-length CD6 and the CD6Dd3 isoform were analyzed by real-time inflamed state of autoimmune disease. PhenoGenetic Project sub- PCR. jects are self-reported to be free of autoimmune diseases or chronic infectious diseases; they were genotyped for rs17824933, and 3 [ H]thymidine incorporation subjects were recalled for blood donation based on their genotype. CD4+ T cells were cultured in 96-well, round-bottom tissue culture plates The characteristics of the donors who were recalled for the func- at a density of 2 3 104 cells/well in RPMI 1640 medium, 10% (v/v) FCS tional assays are summarized in Supplemental Table I. (Life Technologies), and stimulated with 4.5-mm polystyrene beads Using real-time PCR, we analyzed the expression pattern of (Dynal/Invitrogen) covalently linked to anti-CD3 Abs (0.5 mg/ml), anti- + + CD28 Abs (0.5 mg/ml), and recombinant human ALCAM-Fc fusion pro- CD6 isoforms in primary CD4 and CD8 T cells obtained from tein (rhALCAM-Fc; 1 mg/ml). Cell proliferation was assessed at day 4 by the donors. The relative expression of the CD6Dd3 isoform is sig- [3H]thymidine incorporation. nificantly higher on CD4+ and CD8+ T cells isolated ex vivo from

FIGURE 1. Relative expression of full-length CD6 and CD6Dd3 in T cells from subjects with different CD6 alleles. A, Relative expression ratio of full-length CD6 to CD6Dd3 in CD4+ T cells from donors homozygous for either the nonrisk allele (rs17824933CC, n = 18) or the MS susceptibility allele (rs17824933GG, n = 16) as analyzed by real-time PCR (p = 0.0073). B, Relative expression ratio of full-length CD6 to CD6Dd3 in CD8+ T cells from donors with the rs17824933CC (n = 10) and rs17824933GG (n = 8) genotypes (p = 0.0018). Unpaired Student t test was used to compare RNA expression levels between T cells from donors with CC, CG,orGG genotype. 3288 MS RISK ALLELE ALTERS CD4+ T CELL PROLIFERATION

We hypothesized that the decreased proliferative response in rs17824933GG subjects was due to the relative increase of the CD6Dd3 splice variant lacking the membrane-proximal SRCR domain 3 with the ALCAM-binding site (23). To directly explore this mechanism, we established a model system with CD4+ T cells exclusively expressing the risk CD6Dd3 isoform without expression of full-length CD6. Expression of isoforms containing exon 5 in CD4+ T cells of subjects with rs17824933CC genotype was specifically inhibited using exon 5-specific siRNA (Fig. 3A), thus increasing the relative proportion of CD6Dd3 to CD6 isoforms; as + FIGURE 2. Proliferation of CD4+ T cells from subjects with different a control, CD4 T cells from the same subjects were transfected CD6 alleles. CD4+ T cells from donors with the nonrisk allele with randomly generated control siRNA, allowing the comparison (rs17824933CC genotype, n = 24), the MS risk allele (rs17824933GG ge- of identical CD4+ T cells differing only in the expression level of notype, n = 9), and heterozygous donors (rs17824933CG genotype, n = 20) CD6 isoforms containing exon 5. Using this model system, we were activated with anti-CD3 and anti-CD28, and proliferation was ana- found that stimulation with a rhALCAM-Fc induced significant lyzed at day 6 by measuring CSFE dilution. Mean value and SEM are lower entry into cell cycle of CD4+ T cells in the context of the shown (*p = 0.01). Unpaired Student t test was used to compare pro- exon 5-specific siRNA construct versus CD4+ T cells derived from liferation between T cells from donors with CC, CG,orGG genotype. the same donor and transfected with control siRNA (p = 0.0111; Downloaded from subjects homozygous for the risk allele (rs17824933GG) when Fig. 3B). These data demonstrate that increasing the relative proportion of the CD6Dd3 isoform in vitro recapitulates the di- compared with the same cells extracted from subjects homozygous GG for the protective allele (rs17824933CC). Although total CD6 ex- minished proliferative capacity of T cells seen in rs17824933 pression does not significantly differ between the different groups subjects who also have an increased proportion of the CD6Dd3 of subjects, the relative expression of full-length CD6 is diminished isoform. + in CD4+ and CD8+ T cells from rs17824933GG subjects (Fig. 1). A We then examined the proliferative response of CD4 T cells http://www.jimmunol.org/ decrease in full-length CD6 mRNA correlates with increased levels to anti-CD3 and anti-CD28 in the context of inhibition of the of CD6Dd3 mRNA (Supplemental Fig. 1). Furthermore, the overall CD6-ALCAM costimulatory pathway, postulating that inhibitory expression of CD6 on the cell surface was analyzed by flow effects would be observed only in subjects expressing high rela- cytometry and does not differ between the two groups of subjects tive amounts of CD6 isoforms with the ALCAM-binding do- + (Supplemental Fig. 2). The expression patterns of other known CD6 main. Specifically, we activated highly purified CD4 T cells from isoforms are not affected by the risk allele (Supplemental Fig. 3). donors with each of the three rs17824933 genotypes for 3 and It has been previously shown that the CD6 ligand, ALCAM, is 6 d with anti-CD3 and anti-CD28 mAbs. The interaction between + inducedonCD4+ T cells after activation, and blocking this in- CD6 on CD4 T cells and its ligand ALCAM on activated PBMCs

teraction with inhibitory anti-CD6 mAb inhibits sustained entry was blocked with the CD6-specific Ab M-T605 as previously by guest on September 27, 2021 into cell cycle (12, 25–30). Thus, we activated highly purified described (12). Although the M-T605 binding domain is located in CD4+ T cells from donors with the rs17824933CC, rs17824933CG, the extracellular SRCR domain 1 and is not close to the ALCAM- or rs17824933GG genotypes for 3 and 6 d with anti-CD3 and anti- binding domain in the extracellular SRCR domain 3, the assembly CD28 mAb. Proliferation of the activated CD4+ T cells was of the CD6 molecule provides an explanation for the prevention of assessed by CSFE dilution. Although no differences in pro- ALCAM binding by M-T605: binding of M-T605 to domain 1 liferation of CD4+ T cells from donors of different genotypes was results in obstruction of the access to the ALCAM-binding site observed on day 3 of activation, a significant decrease in pro- (Fig. 4A) (31). Inhibitory effects were observed only in subjects liferation was observed in CD4+ T cells from rs17824933GG expressing high relative amounts of the CD6 isoforms with the subjects (58.4% proliferation) as compared with rs17824933CC ALCAM-binding domain. Blocking CD6 reduced the proliferation subjects (78.8% proliferation; p = 0.01) at day 6 (Fig. 2). Thus, of CD4+ T cells from rs17824933CC subjects by 27.3%, whereas a simple measure of entry into cell cycle by CD4+ T cells is no effect was seen in CD4+ T cells from subjects with one (0.6% influencedbytheCD6genotype. inhibition; p = 0.0001) or two (0.4% inhibition; p = 0.0001)

FIGURE 3. CD6Dd3 phenotype can be induced in CD4+ T cells from donors with the nonrisk allele. A, Specific knockdown of full-length CD6 in CD4+ T cells from donors with CC genotype. Expression of full-length CD6 is significantly inhibited in a concentration-dependent way after transfection with exon 5-specific siRNA. Randomly generated control RNA was used as control. Mean values and SD are shown (n = 3). B, Proliferation of CD4+ T cells after rhALCAM-Fc activation. CD4+ T cells with CD6Dd3 phenotype were obtained by transfection with exon 5-specific siRNA and compared with full-length CD6-expressing CD4+ T cells from the same donor transfected with control siRNA. Cells were activated with rhALCAM-Fc in combination with anti-CD3 and anti-CD28 for 3 d, and proliferation was measured by [3H] incorporation assay. Unpaired Student t test was used to compare RNA expression levels and proliferation between T cells from donors with different genotypes (n = 3 for each group of genotype). Mean value and SEM are shown (*p = 0.0111). The Journal of Immunology 3289

FIGURE 4. CD6 allele-dependent stimulation of CD4+ T cells. A, Schematic dia- gram showing the interaction between CD6 and ALCAM. Only full-length CD6 binds ALCAM because the membrane proximal ALCAM-binding site is missing in CD6Dd3. The CD6-specific inhibitory Ab M-T605 binds to a membrane distal domain Downloaded from and prevents binding of ALCAM to the membrane proximal domain. B, Inhibition of proliferation by CD6-specific Abs was assessed by flow cytometry analysis of CSFE-labeled CD4+ T cells. Cells were activated with anti-CD3 and anti-CD28, and proliferation was measured on day 6. Three http://www.jimmunol.org/ representative experiments are shown. Each experiment was performed with CD4+ T cells from six different donors (two rs17824933CC, two rs17824933CG, and two rs17824933GG genotypes). C, Mean inhibition of proliferation by CD6-specific Abs in CD4+ T cells with rs17824933CC (n = 24), rs17824933CG (n = 20), and GG rs17824933 (n = 9) genotype. Unpaired by guest on September 27, 2021 Student t test was used to compare T cell proliferation between donors with CC, CG, or GG genotype. Mean value and SEM are shown (*p = 0.0001, **p = 0.0001). D, Mean inhibition of IFN-g secretion by CD6-specific Abs in CD4+ T cells with rs17824933CC (n = 3), rs17824933CG (n =3), and rs17824933GG (n = 3) genotype. Un- paired Student t test was used to compare cytokine secretion of T cells from donors with CC, CG,orGG genotype. Mean value and SEM are shown (*p = 0.0001, **p = 0.0027).

rs17824933G alleles, indicating that proliferation of CD4+ T cells Discussion with CG or GG genotype is not influenced by CD6 stimulation MS is an inflammatory neurodegenerative disease with complex (Fig. 4B,4C). Similar differences were seen in IFN-g production causative factors. The mechanisms underlying the pathogenesis after blocking CD6 on CD4+ T cells from subjects of the different of MS are not yet completely known. Infiltrations of CD4+ and groups of genotype (Fig. 4D). CD8+ T cells in the CNS white matter are involved in the 3290 MS RISK ALLELE ALTERS CD4+ T CELL PROLIFERATION autoinflammatory process (2). Recent data suggest a possible role 5. Venken, K., N. Hellings, K. Hensen, J. L. Rummens, and P. Stinissen. 2010. Memory CD4+CD127high T cells from patients with multiple sclerosis produce for autoreactive Th1 and Th17 cells in mediating tissue in- IL-17 in response to myelin antigens. J. Neuroimmunol. 226: 185–191. flammation and demyelination in the CNS (32). Although there is 6. Dominguez-Villar, M., C. M. Baecher-Allan, and D. A. Hafler. 2011. Identifi- a potential paradox in that the risk allele results in less activa- cation of T helper type 1-like, Foxp3(+) regulatory T cells in human autoimmune + disease. Nat. Med. 17: 673–675. tion of CD4 cells, this may be explained by the presence of 7. De Jager, P. L., X. Jia, J. Wang, P. I. de Bakker, L. Ottoboni, N. T. Aggarwal, + CD4 T cell populations that both induce and suppress immune L. Piccio, S. Raychaudhuri, D. Tran, C. Aubin, et al; International MS Genetics responses. Specifically, there are two major regulatory CD4+ Consortium. 2009. Meta-analysis of genome scans and replication identify CD6, + low hi IRF8 and TNFRSF1A as new multiple sclerosis susceptibility loci. Nat. Genet. T cell populations: Tregs (FOXP3 CD127 CD25 ) and the type 41: 776–782. 1 Treg cells population expressing IL-10. We have described 8. International Multiple Sclerosis Genetics Consortium; Hafler, D. A., defects in both Tregs and type 1 Treg cells in patients with MS (33, A. Compston, S. Sawcer, E. S. Lander, M. J. Daly, P. L. De Jager, P. I. de Bakker, S. B. Gabriel, D. B. Mirel, et al. 2007. Risk alleles for multiple sclerosis iden- 34). Depletion of the Tregs in either experimental animal models tified by a genomewide study. N. Engl. J. Med. 357: 851–862. or in humans with FOXP3 gene deletion results in spontaneous 9. Australia and New Zealand Multiple Sclerosis Genetics Consortium (ANZgene). autoimmune disease. Tregs bind to stromal tissue via CD6 ligation 2009. Genome-wide association study identifies new multiple sclerosis susceptibility loci on chromosomes 12 and 20. Nat. Genet. 41: 824–828. to CD166 that is overexpressed in the endothelium of patients with 10. International Multiple Sclerosis Genetics Conssortium (IMSGC). 2010. IL12A, MS (35); thus, loss of the ALCAM-binding domain could prevent MPHOSPH9/CDK2AP1 and RGS1 are novel multiple sclerosis susceptibility loci. Genes Immun. 11: 397–405. Tregs from entering the CNS, thereby providing a possible 11. International Multiple Sclerosis Genetics Consortium (IMSGC) and Wellcome mechanism by which the risk allele may lead to loss of suppressor Trust Case Control Consortium 2 (WTCCC2). 2011. Genetic risk and a primary immune function. However, direct in vivo experiments will be role for cell-mediated immune mechanisms in multiple sclerosis. Nature. DOI: 10.1038/nature.10251. required to understand which effect ultimately dominates. 12. Zimmerman, A. W., B. Joosten, R. Torensma, J. R. Parnes, F. N. van Leeuwen, Downloaded from We currently do not know what the causal variant may be; and C. G. Figdor. 2006. Long-term engagement of CD6 and ALCAM is essential rs17824933 is simply the best marker for the causal variant in our for T-cell proliferation induced by dendritic cells. Blood 107: 3212–3220. 13. Hassan, N. J., A. N. Barclay, and M. H. Brown. 2004. Frontline: Optimal T cell MS susceptibility analyses. A review of SNPs in linkage dis- activation requires the engagement of CD6 and CD166. Eur. J. Immunol. 34: equilibrium with rs17824933 (r2 . 0.5 in HapMap Caucasians of 930–940. European origin in Utah) did not reveal a variant with a clear 14. Bott, C. M., J. B. Doshi, C. Morimoto, P. L. Romain, and D. A. Fox. 1993. Activation of human T cells through CD6: functional effects of a novel anti-CD6 potential to affect splicing of exon 5. Dedicated fine-mapping monoclonal antibody and definition of four epitopes of the CD6 glycoprotein. http://www.jimmunol.org/ efforts will be needed to identify the set of genetic variation Int. Immunol. 5: 783–792. 15. Gimferrer,I.,M.Calvo,M.Mittelbrunn,M.Farno´s,M.R.Sarrias,C.Enrich,J.Vives, whose effect could be captured by rs17824933. Nevertheless, it is F. Sańchez-Madrid,andF.Lozano.2004.RelevanceofCD6-mediatedinteractionsin clear that this rs17824933 tags a haplotype of CD6 that is asso- Tcellactivationandproliferation.J.Immunol.173:2262–2270. ciated not only with susceptibility to MS but also with evidence of 16. Hassan, N. J., S. J. Simmonds, N. G. Clarkson, S. Hanrahan, M. J. Puklavec, M. Bomb, A. N. Barclay, and M. H. Brown. 2006. CD6 regulates T-cell variation in the expression of CD6 and downstream function. responses through activation-dependent recruitment of the positive regulator The genetic component in MS is indicated by a 20–40% in- SLP-76. Mol. Cell. Biol. 26: 6727–6738. creased relative risk for monozygotic twins of affected individuals 17. Bott, C. M., J. B. Doshi, L. L. Li, S. A. McMurtry, J. L. Sanders, and D. A. Fox. 1994. Transcriptional regulation of CD6 expression on human T lymphocytes by (36). Moreover, siblings of affected individuals exhibit a 15–20% phorbol ester. J. Immunol. 153: 1–9. increased relative risk for development of MS (37). Although 18. Ibań˜ez, A., M. R. Sarrias, M. Farno´s, I. Gimferrer, C. Serra-Page`s, J. Vives, and by guest on September 27, 2021 autoimmune diseases are more likely to be triggered by complex F. Lozano. 2006. Mitogen-activated protein kinase pathway activation by the CD6 lymphocyte surface receptor. J. Immunol. 177: 1152–1159. genetics than by a single genetic variation, not all genes associated 19. Singer, N. G., B. C. Richardson, D. Powers, F. Hooper, F. Lialios, J. Endres, with autoimmune diseases might be causal genes contributing to C. M. Bott, and D. A. Fox. 1996. Role of the CD6 glycoprotein in antigen- specific and autoreactive responses of cloned human T lymphocytes. Immunol- the onset of disease. Deeper insights into the functional con- ogy 88: 537–543. sequences of genetic variations are crucial for the elucidation of 20. Bowen, M. A., G. S. Whitney, M. Neubauer, G. C. Starling, D. Palmer, J. Zhang, how genes contribute to the development of autoimmune diseases. N. J. Nowak, T. B. Shows, and A. Aruffo. 1997. Structure and chromosomal location of the human CD6 gene: detection of five human CD6 isoforms. J. To our knowledge, our results are the first report of a direct re- Immunol. 158: 1149–1156. lationship between disease-associated CD6 SNP and T cell func- 21. Robinson, W. H., H. E. Neuman de Vegvar, S. S. Prohaska, J. W. Rhee, and tion. Extension of this approach to other susceptibility alleles is J. R. Parnes. 1995. Human CD6 possesses a large, alternatively spliced cyto- plasmic domain. Eur. J. Immunol. 25: 2765–2769. required to enable the elucidation of pathways contributing to the 22. Kobarg, J., G. S. Whitney, D. Palmer, A. Aruffo, and M. A. Bowen. 1997. onset of inflammatory diseases. Analysis of the tyrosine phosphorylation and calcium fluxing of human CD6 isoforms with different cytoplasmatic domains. Eur. J. Immunol. 27: 2971– 2980. Acknowledgments 23. Castro, M. A., M. I. Oliveira, R. J. Nunes, S. Fabre, R. Barbosa, A. Peixoto, We thank I. Wood for donor coordination and blood sample collection. M. H. Brown, J. R. Parnes, G. Bismuth, A. Moreira, et al. 2007. Extracellular isoforms of CD6 generated by alternative splicing regulate targeting of CD6 to the immunological synapse. J. Immunol. 178: 4351–4361. Disclosures 24. Bowen, M. A., D. D. Patel, X. Li, B. Modrell, A. R. Malacko, W.-C. Wang, H. Marquardt, M. Neubauer, J. M. Pesando, U. Francke, et al. 1995. Cloning, The authors have no financial conflicts of interest. mapping, and characterization of activated leukocyte-cell adhesion molecule (ALCAM), a CD6 ligand. J. Exp. Med. 181: 2213–2220. 25. Astier, A. L., G. Beriou, T. M. Eisenhaure, S. M. Anderton, D. A. Hafler, and References N. Hacohen. 2010. RNA interference screen in primary human T cells reveals FLT3 as a modulator of IL-10 levels. J. Immunol. 184: 685–693. 1. Maier, L. M., and D. A. Hafler. 2009. Autoimmunity risk alleles in costimulation 26. Pawelec, G., and H. J. Bu¨hring. 1991. Monoclonal antibodies to CD6 prefer- pathways. Immunol. Rev. 229: 322–336. entially stimulate T-cell clones with gamma/delta rather than alpha/beta antigen 2. Traugott, U., E. L. Reinherz, and C. S. Raine. 1983. Multiple sclerosis: distri- receptors. Hum. Immunol. 31: 165–169. bution of T cell subsets within active chronic lesions. Science 219: 308–310. 27. Bowen, M. A., J. Bajorath, A. W. Siadak, B. Modrell, A. R. Malacko, 3. Kornek, B., M. K. Storch, R. Weissert, E. Wallstroem, A. Stefferl, T. Olsson, H. Marquardt, S. G. Nadler, and A. Aruffo. 1996. The amino-terminal C. Linington, M. Schmidbauer, and H. Lassmann. 2000. Multiple sclerosis and immunoglobulin-like domain of activated leukocyte cell adhesion molecule chronic autoimmune encephalomyelitis: a comparative quantitative study of binds specifically to the membrane-proximal scavenger receptor cysteine- axonal injury in active, inactive, and remyelinated lesions. Am. J. Pathol. 157: rich domain of CD6 with a 1:1 stoichiometry. J. Biol. Chem. 271: 17390– 267–276. 17396. 4. Schneider-Hohendorf, T., M. P. Stenner, C. Weidenfeller, A. L. Zozulya, 28. Whitney, G. S., G. C. Starling, M. A. Bowen, B. Modrell, A. W. Siadak, and O. J. Simon, N. Schwab, and H. Wiendl. 2010. Regulatory T cells exhibit en- A. Aruffo. 1995. The membrane-proximal scavenger receptor cysteine-rich do- hanced migratory characteristics, a feature impaired in patients with multiple main of CD6 contains the activated leukocyte cell adhesion molecule binding sclerosis. Eur. J. Immunol. 40: 3581–3590. site. J. Biol. Chem. 270: 18187–18190. The Journal of Immunology 3291

29. Skonier, J. E., D. L. Bodian, J. Emswiler, M. A. Bowen, A. Aruffo, and 33. Costantino, C. M., C. Baecher-Allan, and D. A. Hafler. 2008. Multiple sclerosis J. Bajorath. 1997. Mutational analysis of the CD6 ligand binding domain. and regulatory T cells. J. Clin. Immunol. 28: 697–706. Protein Eng. 10: 943–947. 34. Astier, A. L., and D. A. Hafler. 2007. Abnormal Tr1 differentiation in multiple 30. Alonso, R., V. Huerta, J. de Leon, P. Piedra, Y. Puchades, O. Guirola, G. Chinea, sclerosis. J. Neuroimmunol. 191: 70–78. and E. Montero. 2008. Towards the definition of a chimpanzee and human 35. Cayrol, R., K. Wosik, J. L. Berard, A. Dodelet-Devillers, I. Ifergan, H. Kebir, conserved CD6 domain 1 epitope recognized by T1 monoclonal antibody. Hy- A. S. Haqqani, K. Kreymborg, S. Krug, R. Moumdjian, et al. 2008. Activated bridoma (Larchmt) 27: 291–301. leukocyte cell adhesion molecule promotes leukocyte trafficking into the central 31. Bowen, M. A., A. A. Aruffo, and J. Bajorath. 2000. Cell surface receptors and nervous system. Nat. Immunol. 9: 137–145. their ligands: in vitro analysis of CD6-CD166 interactions. Proteins 40: 420– 36. Oksenberg, J. R., E. Seboun, and S. L. Hauser. 1996. Genetics of demyelinating 428. diseases. Brain Pathol. 6: 289–302. 32. Ja¨ger, A., V. Dardalhon, R. A. Sobel, E. Bettelli, and V. K. Kuchroo. 2009. Th1, 37. Oksenberg, J. R., S. E. Baranzini, S. Sawcer, and S. L. Hauser. 2008. The ge- Th17, and Th9 effector cells induce experimental autoimmune encephalomy- netics of multiple sclerosis: SNPs to pathways to pathogenesis. Nat. Rev. Genet. elitis with different pathological phenotypes. J. Immunol. 183: 7169–7177. 9: 516–526. Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021 The Journal of Immunology

Corrections

Koﬂer, D. M., C. A. Severson, N. Mousissian, P. L. De Jager, and D. A. Haﬂer. 2011. The CD6 multiple sclerosis susceptibility allele is associated with alterations in CD41 T cell proliferation. J. Immunol. 187: 3286–3291.

Some of the funding sources were not included in the grant footnote. The corrected footnote is shown below.

This work was supported by National Institutes of Health Grants P01 AI045757, U19 AI046130, U19 AI070352, and P01 AI039671 (to D.A.H.) and by the Deutsche Forschungsgemeinschaft (Grant KO 4034/1-1 to D.M.K.). D.A.H. is also supported by a Jacob Javits merit award (NS2427) from the National Institute of Neurological Disorders and Stroke and the Nancy Taylor Foundation for Chronic Diseases, Inc. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1290044