bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
1 Urocortin 3 in the posterodorsal medial amygdala mediates psychosocial stress-induced
2 suppression of LH pulsatility in female mice
3 Deyana Ivanova1, Xiao-Feng Li1, Caitlin McIntyre1, Yali Liu2, Lingsi Kong1, and Kevin T
4 O’Byrne1
5 1Department of Women and Children’s Health, Faculty of Life Science and Medicine, King’s
6 College London, UK
7 2Department of Assisted Reproduction, Shanghai Ninth People's Hospital, Shanghai Jiaotong
8 University School of Medicine, Shanghai, People's Republic of China.
9 Short title: MePD Ucn3 mediated stress-induced suppression of LH pulses
10 Key words: psychosocial stress, LH pulsatility, Ucn3, MePD
11 Coressponding author’s contact details: Kevin T O’Byrne ([email protected]),
12 Department of Women and Children’s Health, School of Life Course Sciences, Faculty of Life
13 Science and Medicine, King’s College London, 2.92W Hodgkin Building, Guy’s Campus,
14 London SE1 1UL, UK.
15 Reprint requests: Deyana Ivanova, Department of Women and Children’s Health, School of
16 Life Course Sciences, Faculty of Life Science and Medicine, King’s College London, 2.92W
17 Hodgkin Building, Guy’s Campus, London SE1 1UL, UK.
18 Grants supporting paper: UKRI: BBSRC (BB/S000550/1) and MRC (MR/N022637/1). DI is
19 a PhD student funded by a MRC-DTP studentship.
20 The authors declare there is no conflict of interest.
1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
21 Abstract
22 Exposure to psychosocial stress disrupts reproductive function and interferes with pulsatile
23 luteinising hormone (LH) secretion in mammals. The posterodorsal sub-nucleus of the medial
24 amygdala (MePD) is part of the limbic brain and is an upstream modulator of the reproductive
25 axis as well as stress and anxiety states. Corticotropin releasing factor type-2 receptors
26 (CRFR2) are activated in the presence of psychosocial stress together with an increased
27 expression of the CRFR2 ligand Urocortin3 (Ucn3) in MePD of rodents. We investigate
28 whether Ucn3 signalling in the MePD is involved in mediating the suppressive effect of
29 psychosocial stress exposure on LH pulsatility. Firstly, we administered Ucn3 into the MePD
30 and monitored the effect on pulsatile LH secretion in ovariectomised mice. Next, we delivered
31 Astressin2B, a highly selective CRFR2 antagonist, intra-MePD in the presence of predator
32 odor, 2,4,5-Trimethylthiazole (TMT) and examined the effect on LH pulses. Subsequently, we
33 virally infected ovariectomised Ucn3-cre-tdTomato mice with inhibitory DREADDs targeting
34 the MePD Ucn3 neurons while exposing the mice to TMT or restraint stress and examined the
35 effect on LH pulsatility as well as corticosterone (CORT) release. Administration of Ucn3 into
36 the MePD dose-dependently inhibited pulsatile LH secretion and intra-MePD administration
37 of Astressin2B blocked the suppressive effect TMT on LH pulsatility. Additionally,
38 DREADDs inhibition of MePD Ucn3 neurons blocked TMT and restraint stress-induced
39 inhibition of LH pulses as well as CORT release in the presence of TMT. These results
40 demonstrate for the first time that Ucn3 neurons in the MePD mediate psychosocial stress-
41 induced suppression of the GnRH pulse generator and psychosocial stress-induced CORT
42 secretion. Ucn3 signalling in the MePD plays a fundamental role in modulating the
43 hypothalamic-pituitary-ganadal and hypothalamic-pituitary-adrenal axes, and this brain locus
44 may represent a nodal centre in the crosstalk between the reproductive and stress axes.
2 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
45 Introduction
46 Psychological stress is known to have deleterious effects on reproductive function in mammals,
47 including humans (1). Rodent models of psychosocial stress, such as restraint and predator
48 odor exposure, show reduced luteinizing hormone (LH) pulse frequency (2,3) and LH surge
49 release (4) as well as delayed puberty (5). Kisspeptin (kiss1) neurons located in the arcuate
50 nucleus (ARC) of the hypothalamus are a crucial component of the gonadotropin-releasing
51 hormone (GnRH) pulse generator regulating pulsatile secretion of GnRH to maintain function
52 of the hypothalamic pituitary gonadal (HPG) axis (6–8). These neurons are known as KNDy
53 because they co-express neurokinin B (NKB) and dynorphin A (DYN) and their synchronous
54 activity release pulses of kisspeptin that act on GnRH dendrons in the median eminence to
55 release pulses of GnRH release (9). It has been shown that acute restraint stress rapidly
56 suppresses LH pulses and reduces c-fos in KNDy neurons in mice (10). The underlying neural
57 mechanisms by which psychological stress disrupts the GnRH pulse generator remains to be
58 fully elucidated.
59 The amygdala, a key part of the limbic brain involved in emotional processing is known to
60 modulate the HPG axis, including exerting an inhibitory break on puberty, where lesioning of
61 the amygdala leads to advancement of puberty in female rhesus macaques (11). Moreover,
62 specific lesioning the posterodorsal sub-nucleus of the medial amygdala (MePD) advances
63 puberty in the rat (12). The majority of efferent projections from the MePD are GABAergic
64 and a significant population project to reproductive neural centres in the hypothalamus (13–
65 16). This amygdaloid nucleus is also known to project to the KNDy neural population in the
66 ARC (17,18). Extrahypothalamic kiss1 neuronal populations exist in the MePD and we have
67 recently shown that optogenetic stimulation of these neurons increases LH pulse frequency in
68 mice (19).
3 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
69 The amygdala is also implicated in the neuroendocrine response to stress, activating the
70 hypothalamic pituitary adrenal (HPA) axis and modulating anxiety behaviour. Restraint stress
71 has been seen to increase c-fos expression in the medial amygdala (MeA) (20), and lesioning
72 this nucleus attenuates restraint-induced suppression of pulsatile LH secretion in rats (2).
73 Moreover, the amygdala processes olfactory information and is robustly activated by predator
74 odor (5,21,22). Particularly, the MePD exhibits a distinct firing pattern in the presence of
75 predator odor and multiunit recordings reveal the MePD is activated in response to predator
76 urine exposure (23). Recently, exposure to cat odor was shown to induce a fear response
77 delaying puberty in rats (5). Therefore the MePD may be involved in the integration of
78 anxiogenic signals with the GnRH pulse generator.
79 Urocortin 3 (Ucn3), part of the corticotropin-releasing factor (CRF) superfamily, is a highly
80 specific endogenous ligand for CRF type 2 receptors (CRFR2) (24). A high density of Ucn3
81 and CRFR2 expressing neurons are found in the MePD (25–27). The MePD is part of the
82 mammalian social brain network and selective optogenetic activation of Ucn3 neurons in this
83 region influences social behavior (27). Ucn3 is involved in modulating the stress response and
84 exposure to restraint stress increases MePD Ucn3 mRNA expression in rodents (28). Social
85 defeat, a classical rodent psychosocial stress model, increases CRFR2 expression in the MePD
86 (29).
87 In this study, we aimed to determine whether Ucn3/CRFR2 signalling in the MePD mediates
88 the inhibitory effect of predator odor and restraint stress on pulsatile LH secretion in adult
89 ovariectomised mice. Initially, we determined the effect of intra-MePD administration of Ucn3
90 per se on pulsatile LH secretion. We then investigated whether intra-MePD administration of
91 the highly selective CRFR2 antagonist, Astressin2B, would block predator odor stress-induced
92 suppression of pulsatile LH secretion. Finally, we employed pharmacosynthetic DREADDs
93 (designer receptor exclusively activated by designer drugs) to selectively inhibit Ucn3 neurons
4 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
94 in the MePD of Ucn3-Cre-tdTomato mice aiming to investigate whether endogenous MePD
95 Ucn3 signalling mediates predator odor or restraint stress-induced suppression of LH
96 pulsatility.
97 Methods
98 Mice
99 Female C57Bl6/J mice were purchased from Charles River Laboratories International, Inc.
100 Cryopreserved sperm of Ucn3-cre mice (strain Tg(Ucn3-cre)KF43Gsat/Mmucd; congenic on
101 C57BL/6 background) was acquired from MMRRC GENSAT. Heterozygous transgenic
102 breeding pairs of Ucn3-Cre-tdTomato mice were recovered via insemination of female
103 C57Bl6/J mice at King’s College London. Ucn3-Cre mice were genotyped using PCR for the
104 detection of heterozygosity (primers 5' - 3': Ucn3F – CGAAGTCCCTCTCACACCTGGTT;
105 CreR – CGGCAAACGGACAGAAGCATT). Ucn3-cre-tdTomato reporter mice were
106 generated by breeding Ucn3-cre mice with td-Tomato mice (strain B6.Cg-
107 Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J; congenic on C57BL/6 background) acquired
108 from The Jackson Laboratory, Bar Harbor, ME, USA. The reporter allele encoding tdTomato
109 is expressed upon Cre-mediated recombination to obtain heterozygous Ucn3-cre-tdTomato
110 mice, as previously described (27) (primers 5' - 3': TA Wild type Forward oIMR9020 -
111 AAGGGAGCTGCAGTGGAG; TC Wild type Reverse oIMR9021 -
112 CCGAAAATCTGTGGGAAG; Mutant Reverse WPRE oIMR9103 -
113 GGCATTAAAGCAGCGTATCC; Mutant Forward tdTomato oIMR9105 -
114 CTGTTCCTGTACGGCATGG). Female mice aged between 6-8 weeks and weighing
115 between 19-23 g were singly housed in individually ventilated cages sealed with a HEPA-filter
116 at 25 ± 1 °C in a 12:12 h light/dark cycle, lights on at 07:00 h. The cages were equipped with
5 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
117 wood-chip bedding and nesting material, and food and water ad libitum. All procedures were
118 carried out following the United Kingdom Home Office Regulations and approved by the
119 Animal Welfare and Ethical Review Body Committee at King’s College London.
120 Stereotaxic adeno-associated-virus (AAV) injection and cannula implantation
121 All surgical procedures were carried out under general anaesthesia using ketamine (Vetalar,
122 100 mg/kg, i.p.; Pfizer, Sandwich, UK) and xylazine (Rompun, 10 mg/kg, i.p.; Bayer,
123 Leverkusen, Germany) and with aseptic conditions. Mice were secured in a David Kopf
124 stereotaxic frame (Kopf Instruments, Model 900) and bilaterally ovariectomised (OVX). To
125 assess the effects of Ucn3 and Astressin2B (Ast2B) in the MePD unilateral and bilateral
126 cannula implantation, respectively, was performed using robot stereotaxic system (Neurostar,
127 Tubingen, Germany). The mouse brain atlas of Paxinos and Franklin (30) was used to obtain
128 target coordinates for the MePD (2.30 mm lateral, -1.55 mm from bregma, at a depth of -4.94
129 mm below the skull surface). To reveal the skull a midline incision in the scalp was made, the
130 position of MePD was located and a small hole was drilled in the skull above it. A unilateral
131 or bilateral 26-gauge guide cannula (Plastics One, Roanoke, VA, USA) was targeted to the
132 MePD. Once in position the guide cannula was secured on the skull using dental cement
133 (Super-Bond Universal Kit, Prestige Dental, UK) and the incision of the skin was closed with
134 suture. Ten mice were implanted with a unilateral cannula and 14 mice were implanted with a
135 bilateral cannula. Following a one-week post-surgery recovery period, mice were handled
136 daily to acclimatise to experimental procedures.
137 Intra-MePD bilateral stereotaxic viral injection of the inhibitory adeno-associated-virus
138 carrying the DIO-hM4D, DREADD, construct (AAV-hSyn-DIO-HA-hM4D(Gi)-IRES-
139 mCitrine, 3x1011 GC/ml, Serotype:5; Addgene) was performed for the targeted expression of
140 hM4D-mCitrine in MePD Ucn3 neurons. Initially, Ucn3-Cre-tdTomato mice were secured in
6 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
141 a Kopf stereotaxic frame (Kopf Instruments) and bilaterally OVX. The skull was revealed and
142 two small holes were drilled above the location of the MePD. The same coordinates were used
143 to target the MePD, as described above. AAV-hSyn-DIO-hM4D(Gi)-mCitrine (300 nL) was
144 bilaterally injected, over 10 min, into the MePD using a 2-μL Hamilton micro syringe (Esslab,
145 Essex, UK). The needle was left in position for a further 5 min and lifted slowly over 1 min.
146 Cre-positive mice received the AAV-hM4D injection (test mice) or a control virus AAV-YFP
147 (Addgene) (control mice). The control virus does not contain the DIO-hM4D construct. The
148 mice were left to recover for one week. Ten mice received the AAV-hM4D injection and 5
149 mice received the control AAV-YFP. Following the one-week recovery period, mice were
150 handled daily to acclimatise to experimental procedures for a further 2 weeks.
151 Intra-MePD Ucn3 administration and blood sampling for measurement of LH
152 In order to test the effect of Ucn3 (Cambridge Bioscience, Cambridge, UK) administration into
153 the MePD on LH pulsatility, OVX mice implanted with a unilateral cannula on the right side
154 were subjected to the tail-tip blood collection procedure, as previously described (31). Infusion
155 of drugs and blood sampling were performed between 09:00-13:00 h, where 5 μl blood was
156 collected every 5 min for 2 h 30 min. Unilateral internal cannula (Plastics One) attached to
157 extension tubing (0.58 mm ID, 0.96 mm OD), preloaded with Ucn3 or aCSF as vehicle control,
158 was inserted into the guide cannula. The internal cannula extends 0.5 mm beyond the tip of
159 the guide cannula to reach the MePD. The tubing extended beyond the cage and the distal ends
160 were attached to 10-μl Hamilton syringes (Waters Ltd, Elstress, UK) fitted into a PHD 2000
161 Programmable syringe pump (Harvard Apparatus, Massachusetts, US), allowing for a
162 continuous infusion of the drug at a constant rate. The mice were kept in the cage throughout
163 the experiment, freely-moving with food and water. After a 60 min control blood sampling
164 period, the mice were given an initial bolus injection of Ucn3 at 112.20 fmol or 1.12 pmol in
7 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
165 0.60 μl at a rate of 0.12 μl/min over 5 min, followed by a continuous infusion of 224.40 fmol
166 or 2.24 pmol in 1.20 μl of Ucn3 delivered at a rate of 0.04 μl/min for 30 min. Ucn3 infusions
167 were performed between 60-95 min of the total blood sampling period. Administration of
168 aCSF was performed in the same manner as a control. The study was cross-designed so that
169 mice receive both doses of Ucn3 and aCSF in a random order, with at least 2 days between
170 experiments.
171 Ast2B delivery into the MePD during predator odor-exposure and blood sampling for
172 measurement of LH
173 To test the effect of acute predator odor exposure on LH pulsatility, OVX mice implanted with
174 a bilateral cannula were exposed to 2,4,5-Trimethylthiazole (TMT; synthetic extract of fox
175 urine; Sigma-Aldrich, UK) while blood samples were collected every 5 min for 2 h, as
176 previously described. Experiments were performed between 10:00-13:00 h. After 1 h of
177 controlled blood sampling, 12 μl of TMT (≥98% purity) was pipetted on a small circular piece
178 of filter paper and placed in a petri dish in the centre of the cage, with blood sampling continued
179 for the remainder of the experiment.
180 In order to test whether Ast2B (Tocris Bio-techne, Abingdon, UK) administration into the
181 MePD can block the TMT effect on LH pulsatility, OVX mice implanted with a bilateral
182 cannula were acutely exposed to TMT as described above while Ast2B was delivered into the
183 MePD (as described for Ucn3 infusion above) and blood samples were collected. After a 50
184 min control blood sampling period, mice were given an initial bolus dose of 8.00 pmol Ast2B
185 in 0.50 μl delivered at a rate of 0.10 μl/min over 5 min, followed by a continuous infusion of
186 19.20 pmol Ast2B in 1.20 μl at a rate of 0.05 μl/min for the remaining 65 min of
187 experimentation. At 60 min, mice were exposed to TMT for the remaining 1 h duration of the
188 experiment, as previously described. The administration of Ast2B only was performed in the
8 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
189 same manner excluding TMT exposure, as control. This study was cross-designed, as
190 described above.
191 DREADD inhibition of Ucn3 neurons in the MePD in the presence of TMT or restraint
192 stress and blood sampling for measurement of LH and CORT
193 We used OVX Ucn3-cre-tdTomato mice bilaterally injected with AAV-hM4D-mCitrine virus
194 in the MePD to selectively inhibit Ucn3 neurons, with clozapine-N-oxide (CNO) (Tocris Bio-
195 techne, Abingdon, UK), in the presence of acute TMT-exposure or restraint stress. For LH
196 measurement, blood samples were collected every 5 min for 2 h, as described above. CNO
197 was made fresh on the day of experimentation and administered, i.p. in saline at a dose of 5 mg
198 kg-1, after 30 min of controlled blood sampling for LH measurement. TMT was introduced
199 into the animal’s cage after 60 min of blood sampling and remained in place for the remaining
200 1 h of experimentation, as described above. For experiments involving restraint stress, the
201 animals were placed in a restraint device, after CNO injection (at 30 min), 60 min into blood
202 sampling, with restraint and blood sampling continuing for the remaining 1 h duration of the
203 experiment. On a separate occasion, mice received a saline injection at 30 min and were
204 exposed to either TMT or restraint stress, 60 min into the expetriment. For CORT
205 measurments, 15 μl blood samples were collected on a separate occasion using the tail-tip
206 bleeding procedure and blood samples were stored in tubes containing 5 μl heparinised saline
207 (5 IU ml-1). CNO or saline were injected at the start of the experiment (time point, -30 min),
208 when the first blood sample was collected. TMT was introduced into the cage, as described
209 above, 30 min into the experiment (time point, 0 min) and lasted for 1 h (time point 60 min).
210 Remaining blood samples were collected at 0, 30 and 60 min, with a final sample taken 1 h
211 after the removal of TMT (time point, 120 min). At the end of the experiment, blood samples
212 were centrifuged at 13,000 RPM for 20 min at 20°C and plasma stored at -20°C. All
9 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
213 experiments were performed between 9:00-12:00 h. The mice received CNO or saline in a
214 random order with at least 2 days between experiments for CORT and LH measurment. To
215 control for the effects of the DREADD receptor, the group of Ucn3-cre-tdTomato mice that
216 received the control AAV-YFP, which does not contain the hM4D construct, were
217 administered with CNO in the presence of the stressors and blood samples were collected as
218 described above for CORT and LH measurment. To control for the effects of CNO, control
219 AAV-YFP and DREADD mice were administered CNO alone and blood samples were
220 collected for LH measurement. This study was cross-designed, as described above.
221 Validation of AAV injection and cannula implant site
222 Mice were anaesthetised with a lethal dose of ketamine upon completion of experiments.
223 Transcardial perfusion was performed with heparinised saline for 5 min followed by ice-cold
224 4% paraformaldehyde (PFA) in phosphate buffer (pH 7.4) for 15 min using a pump (Minipuls,
225 Gilson, Villiers Le Bel, France). Brains were collected immediately, fixed in 15% sucrose in
226 4% PFA at 4 °C, left to sink and then transferred to 30% sucrose in phosphate-buffered saline
227 (PBS) and left to sink. Brains were snap-frozen in isopropanol on dry ice until further
228 processing. Every third coronal brain section, 30-μm/section, was collected using a cryostat
229 (Bright Instrument Co., Luton, UK) through-out the MePD region corresponding to -1.34 mm
230 to -2.70 mm from bregma. Sections were mounted on microscope slides, air dried and covered
231 with ProLong Antifade mounting medium (Molecular Probes, Inc. OR, USA). Verification of
232 AAV injection site and cannula placement was performed using Axioskop 2 Plus microscope
233 equipped with Axiovision, version 4.7 (Zeiss) by examining whether cannula reach the MePD
234 for neuropharmacological experiments. For AAV-hM4D-mCitrine injected Ucn3-cre-
235 tdTomato mice we determined whether Ucn3 neurons were infected in the MePD region by
236 merging td-Tomato fluorescence of Ucn3 neurons with mCitrine fluorescence in the MePD.
10 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
237 LH pulse detection and analysis
238 Processing of blood samples was performed using an LH ELISA as previously reported (32).
239 The capture antibody (monoclonal antibody, anti-bovine LHβ subunit, AB_2665514) was
240 purchased from Department of Animal Science at the University of California, Davis. The
241 mouse LH standard (AFP-5306A) and primary antibody (polyclonal antibody, rabbit LH
242 antiserum, AB_2665533) were obtained from Harbour-UCLA (California, USA). The
243 secondary antibody (Horseradish-Peroxidase (HRP)-linked donkey anti-rabbit IgG polyclonal
244 antibody, AB_772206) was purchased from VWR International (Leicestershire, UK). Intra-
245 assay and inter-assay variations were 4.6% and 10.2%, respectively. The ODs of the standards
246 were plotted against the log of the standard concentrations. Non-linear regression was used to
247 fit the points and various parameters were extracted to calculate the concentration of LH
248 (ng/ml) in the blood samples, as previously described (32). The concentration of LH at every
249 time point of blood collection was plotted as a line and scatter graph using Igor Pro 7,
250 Wavemetrics, Lake Oswego, OR, USA. DynPeak algorithm was used for the detection of LH
251 pulses (33).
252 CORT detection
253 We used a commercially available enzyme immunoassay (EIA) kit (DetectX® Corticosterone
254 Enzyme Immunoassay Kit, K014; Arbor Assays, Michigan, USA) to detect levels of CORT
255 hormone in plasma samples, per the manufacturer’s protocol. The kit was stored at 4°C, upon
256 arrival. A microplate reader (BMG Labtech, Aylesbury, UK) was used to read the optical
257 density of each sample at 450 nm.
11 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
258 Statistics
259 For neuropharmacological experiments, female C57Bl6/J mice treated with Ucn3 and Ast2B
260 were compared between groups using a Wilcoxon signed ranks (T) test. For DREADDs
261 experiments, mice administered with saline and CNO were also compared between groups
262 using a Wilcoxon signed ranks (T) test and CNO only data was presented as mean ± SEM.
263 Statistics were performed using Igor Pro 7, Wavemetrics, Lake Oswego, OR, USA. Data was
264 represented as mean ± SEM and +p<0.05, ++p<0.001 and +++p<0.0001 were considered to be
265 significant.
266 Results
267 Intra-MePD administration of Ucn3 dose-dependently suppresses pulsatile LH secretion
268 in adult OVX mice
269 Unilateral Ucn3 delivery into the right MePD suppressed pulsatile LH secretion in a dose-
270 dependent manner. On average the mice treated with both doses of Ucn3 exhibited
271 significantly increased LH pulse interval compared to the pre/post-infusion periods (Fig. 1 B,
272 C, and D; 336.60 fmol, ++p<0.001; n=7; 3.36 pmol, +++p<0.0001; n=10). aCSF had no effect
273 on LH pulse interval (Fig. 1, A and D; n=7). These data are summarized in the figure 1D. All
274 cannulae were correctly placed in the MePD.
275 Effect of CRF-R2 antagonism on TMT-induced suppression of LH pulsatility
276 TMT exposure increased LH pulse interval compared to the control period and non-TMT
277 controls (Fig. 2, A, B and E; pre-TMT vs TMT, +++p<0.0001; n=12). Bilateral delivery of
278 Ast2B, a selective CRFR2 antagonist, into the MePD completely blocked the TMT induced
279 suppression of LH pulsatility (Fig. 2, D and E; TMT+Ast2B vs TMT, ###p<0.0001; n=11).
12 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
280 Delivery of Ast2B alone had no effect on LH pulsatility (Fig. 2, C and E; n=7), as well as no
281 TMT exposure (Fig. 2, A and E; n=6). The results of this experiment are summarised in the
282 figure 2E. These data show that TMT is probably modulating Ucn3/CRFR2 activity in the
283 MePD to mediate its inhibitory effects on GnRH pulse generator frequency. Mice with
284 misplaced cannulae (n=2) were excluded from the analysis.
285 DREADD inhibition of Ucn3 neurons in the MePD blocks the inhibitory effect of TMT
286 exposure on LH pulsatility
287 Bilateral inhibition of MePD Ucn3 neurons via activation of the hM4D receptor with CNO, in
288 OVX Ucn3-Cre-tdTomato mice, completely blocked the suppressive effect of TMT on
289 pulsatile LH secretion compared to controls (Fig. 3, A, B, C and E; control vs CNO, ##p<0.001;
290 DREADD, n=8, control AAV, n=5, saline, n=5). CNO administration in control AAV-YFP
291 injected mice did not block TMT-induced suppression of LH pulsatility (Fig. 3, C; LH pulse
292 interval, pre-TMT 17.29 ± 1.04 min, TMT 51.25 ± 7.18 min, mean ± SEM). Data for saline
293 and control AAV-YFP injected mice were combined as control since there was no significant
294 difference between the two control groups (Fig. 3, A, C and E, controls pre-TMT vs TMT,
295 ++p<0.001). The data from these experiments are summarised in the figure 3E.
296 Administration of CNO alone had no effect on LH pulsatility (Fig. 3, D; LH pulse interval,
297 pre-CNO 17.50 ± 1.44 min, post-CNO 17.79 ± 1.40 min, mean ± SEM; n=4). The results from
298 this study agree with the neuropharmacological data above showing that the inhibitory effect
299 of TMT on pulsatile LH secretion is likely mediated by Ucn3 activity in the MePD. Mice with
300 misplaced injections (n=2) were excluded from the analysis.
301 DREADD inhibition of Ucn3 neurons in the MePD blocks the effect of restraint stress on
302 LH pulsatility
13 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
303 Bilateral DREADD inhibition of MePD Ucn3 neurons in OVX Ucn3-cre-tdTomato mice,
304 completely blocked the inhibitory effect of restraint stress on pulsatile LH secretion compared
305 to saline treated controls (Fig. 4, A, B, C and E; control vs DREADD, ##p<0.001; DREADD,
306 n=7, control AAV, n=5, saline, n=6). CNO administration in control AAV-YFP injected mice
307 did not block TMT-induced suppression of LH pulsatility (Fig. 4, C; pre-restraint 18.67 ± 1.25
308 min, restraint 58.00 ± 2.55 min, mean ± SEM). Data for saline and control AAV-YFP injected
309 mice were combined as control since there was no significant difference between the two
310 control groups (Fig. 4, A, C and E, control pre-restraint vs restraint, ++p<0.001). The results
311 from these experiments are summarised in the figure 4E. Administration of CNO alone had
312 no effect on LH pulsatility (Fig. 4, D; LH pulse interval, pre-CNO 17.50 ± 1.44 min, post-CNO
313 17.79 ± 1.40 min, mean ± SEM; n=4). The data from this study shows that Ucn3 activity in
314 the MePD possibly mediates the effect of restraint stress on pulsatile LH secretion.
315 DREADD inhibition of Ucn3 neurons in the MePD blocks the effect of TMT on CORT
316 release
317 Bilateral DREADD inhibition of MePD Ucn3 neurons in OVX Ucn3-cre-tdTomato mice
318 completely blocked the TMT-induced CORT rise compared to controls at 60 and 120 min
319 measured on a separate occasion to LH pulse sampling (Fig 5, control vs DREADD, +p<0.05;
320 DREADD, n=6, saline, n=6, control AAV, n=3). CNO or saline injections were performed at
321 -30 min, TMT exposure was initiated at 0 min and maintained for 1 h. By 30 min there was an
322 observable rise in CORT for the control group. At 60 min CORT was significantly elevated in
323 the control group compared to the DREADD group (Fig 5, control vs DREADD, +p<0.05 at
324 60 min). CORT remained significantly elevated in the saline group compared to the DREADD
325 group at 120 min (Fig 5, control vs DREADD, +p<0.05 at 120 min). In mice injected with
326 control AAV-YFP, CNO was not able to block the TMT-induced CORT rise, thus data for
14 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
327 saline and control AAV-YFP injected mice were combined together as control, as there was no
328 significant difference between the two control groups (Fig 5, control). These data show that
329 Ucn3 activity in the MePD mediates the effect of TMT on CORT release.
330 Selective expression of DREAD(Gi) in MePD Ucn3 neurons
331 Evaluation of m-Citrine, hM4D, expression in tdTomato labelled neurons from AAV-injected
332 Ucn3-cre-tdTomato mice revealed that 83 ± 5% of MePD Ucn3 neurons expressed hM4D (Fig
333 6, A-F, n=8).
334 Discussion
335 In the present study, we show intra-MePD administration of the stress neuropeptide Ucn3 dose-
336 dependently suppresses GnRH pulse generator frequency. Additionally, acute exposure to
337 predator odor decreased pulsatile LH secretion, an effect that was completely blocked by
338 CRFR2 antagonism with Ast2B in the MePD. Moreover, DREADD inhibition of Ucn3
339 neurons in the MePD blocks acute predator odor and restraint stress-induced inhibition of LH
340 pulses and the rise in CORT secretion. We demonstrate for the first time that acute exposure
341 to psychological stressors, which robustly suppresses the GnRH pulse generator is mediated
342 by Ucn3-CRFR2 neural circuitry in the MePD of OVX mice.
343 Stress exerts a profound inhibitory effect on reproductive function. The amygdala coordinates
344 stress, anxiety and fear states, which regulate pulsatile reproductive hormone release
345 modulating the fertility of species in adverse environments (34). We have previously shown
346 that the MePD is a major regulator of sexual motivation and anxiety behaviour (35) as well as
347 pubertal timing (5,36). Electrophysiological recordings reveal the MePD is activated in
348 response to predator urine (23) or restraint stress (37), which is associated with suppressing LH
349 secretion (4) and LH pulsatility (2). Psychosocial stress decreases c-fos expression in ARC
15 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
350 kiss1 neurons, which is linked to a reduction of pulsatile LH secretion (10). Our aim was to
351 elucidate the neural circuitry within the MePD involved in processing stress and relaying this
352 information to suppress the hypothalamic GnRH pulse generator.
353 Ucn3 and CRFR2 neuronal populations have been identified within the MePD (27). Restraint
354 stress increases Ucn3 mRNA expression (28) and c-fos in the MePD (38) and predator odor
355 activates CRFR2 positive cells in the MeA of rodents (29). In the present study we found that
356 intra-MePD administration of Ucn3 dose-dependently suppresses pulsatile LH secretion and
357 CRFR2 antagonism in the MePD blocks the inhibitory effect of TMT on LH pulsatility. This
358 is consistent with previous studies showing the involvement of CRFR2 signalling in mediating
359 stress signals to the GnRH pulse generator, since central antagonism of CRFR2, using an
360 intracerebroventricular route, blocks the inhibitory effect of stress on LH pulses in rodents (39).
361 Moreover, in-vitro application of CRFR2 agonists decreases GnRH neuronal firing rate (40).
362 We show that inhibiting Ucn3 neurons in the MePD prevents the suppressive effect of acute
363 TMT or restraint stress exposure on pulsatile LH secretion. These findings reveal a novel role
364 for MePD Ucn3 neurons as mediators of diverse psychological stress signals modulating GnRH
365 pulse generator activity.
366 The MePD is of pallidal embryological origin and has a major GABAergic output to key
367 hypothalamic reproductive nuclei (14,41), which might include the ARC (3). Moreover, stress
368 decreases inhibitory GABAergic control within the amygdala leading to enhanced inhibitory
369 efferent output from the amygdala (42,43). Kisspeptin signalling in the MePD regulates GnRH
370 pulse generator frequency (44) and recently we have shown selective optogenetic stimulation
371 of MePD kiss1 neurons increases LH pulse frequency (19). Direct neural projections, of
372 unknown phenotype, extend from the MePD to kiss1 neurons in the ARC (17,18). This
373 connection to the KNDy network might provide a route by which the MePD integrates
374 incoming anxiogenic signals with GnRH pulse generator function. Therefore, we propose that
16 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
375 modulation of the reproductive axis by the MePD may involve a disinhibitory system whereby
376 kiss1 neuron activity in the MePD stimulates inhibitory GABAergic interneurons which in turn
377 inhibit GABAergic efferents from the MePD to the ARC, thus allowing for the observed
378 increase in GnRH pulse generator frequency in response to activation of MePD kiss1 neurons
379 (19). Conversly, reduced kisspeptin signalling in the MePD, as with kisspeptin antagonism,
380 decreases GnRH pulse generator frequency (44).
381 Within the MeA, local Ucn3 fibres overlap with sites expressing CRFR2 (45,46) and MeA
382 Ucn3 neurons have been shown to include an interneuron-like appearance (26) indicating that
383 Ucn3 neurons may connect to and signal via CRFR2 neurons in the MeA. Our
384 neuropharmacological observation and chemogenetic data where antagonism of CRFR2 and
385 inhibition of Ucn3 in the MePD block the effect of TMT on LH pulsatility suggests the activity
386 of both Ucn3 and CRFR2 within the MePD is necessary for mediating the suppressive effects
387 of stress on GnRH pulse generator activity. We know the majority of CRFR2 neurons in the
388 MePD co-express GAD65 and 67 (27), which are required for the synthesis of GABA
389 indicating MePD CRFR2 neurons are likely GABAergic. Based on our findings we propose
390 that stress activated Ucn3 neurons may signal through inhibitory GABAergic CRFR2 neurons
391 upstream to kiss1 neurons in the MePD, thus downregulating kiss1 signalling which in turn
392 decreases GnRH pulse generator frequency. However, we cannot exclude the possibility of
393 alternative routes via which the Ucn3 and CRFR2 neurons in the MePD may modulate GnRH
394 pulse generator activity.
395 We have shown for the first time that TMT increases and maintaines elevated CORT secretion
396 in mice. The TMT-induced rise in CORT was maintained for at least 1-hour after termination
397 of the predator odor stress, indicating prolonged HPA axis activation, which has been observed
398 with prolonged restraint stress in mice (47). This indicates exposure to these psychogenic
399 stressors can lead to prolonged HPA axis activation in mice. CRFR2 knock-out (KO) mice
17 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
400 show an early termination of adrenocorticotropic hormone (ACTH) release in reponse to
401 restraint stress exposure suggesting CRFR2 signalling is important for maintaining HPA axis
402 drive (48). This may provide a potential mechanism by which CRFR2 mediates the prolonged
403 HPA axis activation we observed in response to predator odor. Contrastingly, a commonly
404 held view is that CRFR2 signalling underlies stress-coping mechanisms to counter the stress
405 provoking effects of CRFR1. However, many earlier observsations were based on
406 experimental manipulations lacking absolute region and receptor specificity, which are
407 complicated by compensatory or pleiotropic effects, but the rise in site-specific manipulation
408 of the CRFR1 and CRFR2 receptor signalling in recent reports contradicts the traditional view
409 (49). Furthermore, we show that inhibition of Ucn3 neurons in the MePD not only blocks the
410 suppressive effect of TMT on LH pulsatility, but also prevents the rise in CORT secretion
411 induced by TMT exposure. These data show that Ucn3 signalling in the MePD plays a dual
412 role in modulating GnRH pulse generator activity while interacting with the HPA axis to
413 regulate CORT secretion in response to stress, revealing the MePD as a tenable central hub for
414 integrating incoming anxiogenic signals with the reproductive and stress axes. Our
415 physiological observations will provide valuable parameterisation for our recent mathematical
416 model integrating these neuroendocrine axes (50), adding the MePD Ucn3-CRFR2 system to
417 the network architecture to provide mechanistic details underlying the dynamic relationship
418 between CORT levels and suppression of GnRH pulse generator activity.
419 Central administration of Ucn3 has been shown to increase CRF and vasopressin concentration
420 in the hypothalamus and elevate CORT secretion in mice (51), and augment the HPA axis
421 response to restraint stress in rats (28). TMT increases c-fos mRNA expression in the MeA
422 (52) and restraint stress is shown to increase specifically Ucn3 mRNA expression in the MeA
423 (28). The MeA projects to the paraventricular nucleus (PVN) of the hypothalamus to activate
424 the HPA axis in response to predator odor (22) and lesioning of the MeA eliminates defensive
18 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
425 responses to predator odor in rodents (53). Retrograde tracing has also revealed that the MePD
426 sends stress-activated efferents to the PVN (38). More recently, Ucn3 and CRFR2 positive
427 neurons in the MePD have been shown to receive inputs from and project to the PVN (27),
428 providing a possible direct route for the interaction of MePD Ucn3 with the HPA axis. We
429 show the Ucn3 neuronal population in the MePD is involved in activating the HPA axis in
430 response to predation threat, uncovering a novel functional role for MePD Ucn3 neurons in
431 modulation of the HPA axis during psychosocial stress exposure.
432 Our findings show for the first time that Ucn3-CRFR2 signalling in the MePD mediates the
433 suppressive effect of psychosocial stress on GnRH pulse generator frequency as well as
434 activating the HPA axis. How the Ucn3 and CRFR2 positive neuronal populations in the
435 MePD communicate with the GnRH pulse generator to suppress pulsatile LH secretion and
436 crosstalk with the HPA axis to modulate CORT in response to psychosocial stress remains to
437 be established. Investigating Ucn3 and CRFR2 stress signalling in the limbic brain has
438 furthered our understanding of the neural mechanisms by which stress exerts its inhibitory
439 effects on the reproductive system, providing an important contribution to the field of
440 reproductive nueroendocrinology that may ultimately improve our treatment options for stress-
441 induced infertility.
442 Acknowledgements
443 The authors gratefully acknowledge the financial support from UKRI: BBSRC
444 (BB/S000550/1) and MRC (MR/N022637/1). DI is a PhD student funded by a MRC-DTP
445 studentship at King’s College London.
19 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
446 References
447 1. Li XF, O’Byrne KT. Stress and the Reproductive System. Knobil Neill’s Physiol
448 Reprod Two-Volume Set. 2014;1637–60.
449 2. Lin Y, Li X, Lupi M, Kinsey-Jones JS, Shao B, Lightman SL, O’Byrne KT. The role
450 of the medial and central amygdala in stress-induced suppression of pulsatile LH
451 secretion in female rats. Endocrinology. 2011;152(2):545–55.
452 3. Li X, Shao B, Lin C, O’Byrne KT, Lin Y. Stress-induced inhibition of LH pulses in
453 female rats: Role of GABA in arcuate nucleus. J Mol Endocrinol. 2015;55(1):9–19.
454 4. Wagenmaker ER, Moenter SM. Exposure to acute psychosocial stress disrupts the
455 luteinizing hormone surge independent of estrous cycle alterations in female mice.
456 Endocrinology. 2017;158(8):2593–602.
457 5. Li XF, Adekunbi DA, Alobaid HM, Li S, Pilot M, Lightman SL, O’Byrne KT. Role of
458 the posterodorsal medial amygdala in predator odour stress-induced puberty delay in
459 female rats. J Neuroendocrinol. 2019;31(6):e12719.
460 6. Qiu J, Nestor CC, Zhang C, Padilla SL, Palmiter RD, Kelly MJ, Rønnekleiv OK.
461 High-frequency stimulation-induced peptide release synchronizes arcuate kisspeptin
462 neurons and excites GnRH neurons. Elife. 2016;5:e16246.
463 7. Clarkson J, Han SY, Piet R, McLennan T, Kane GM, Ng J, Porteous RW, Kim JS,
464 Colledge WH, Iremonger KJ, Herbison AE. Definition of the hypothalamic GnRH
465 pulse generator in mice. Proc Natl Acad Sci U S A. 2017;114(47):e10216–23.
466 8. Voliotis M, Li XF, De Burgh R, Lass G, Lightman SL, O’Byrne KT, Tsaneva-
467 Atanasova K. The Origin of GnRH pulse generation: An integrative mathematical-
468 experimental approach. J Neurosci. 2019;39(49):9738–47.
20 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
469 9. Han SY, McLennan T, Czieselsky K, Herbison AE. Selective optogenetic activation of
470 arcuate kisspeptin neurons generates pulsatile luteinizing hormone secretion. Proc Natl
471 Acad Sci U S A. 2015;112(42):13109–14.
472 10. Yang JA, Song CI, Hughes JK, Kreisman MJ, Parra RA, Haisenleder DJ, Kauffman
473 AS, Breen KM. Acute psychosocial stress inhibits lh pulsatility and kiss1 neuronal
474 activation in female mice. Endocrinology. 2017;158(11):3716–23.
475 11. Stephens SBZ, Raper J, Bachevalier J, Wallen K. Neonatal amygdala lesions advance
476 pubertal timing in female rhesus macaques. Psychoneuroendocrinology. 2015;51:307–
477 17.
478 12. Li XF, Hu MH, Hanley BP, Lin YS, Poston L, Lightman SL, O’Byrne KT. The
479 posterodorsal medial amygdala regulates the timing of puberty onset in female rats.
480 Endocrinology. 2015;156(10):3725–36.
481 13. Choi GB, Dong HW, Murphy AJ, Valenzuela DM, Yancopoulos GD, Swanson LW,
482 Anderson DJ. Lhx6 delineates a pathway mediating innate reproductive behaviors
483 from the amygdala to the hypothalamus. Neuron. 2005;46(4):647–60.
484 14. Keshavarzi S, Sullivan RKP, Ianno DJ, Sah P. Functional properties and projections of
485 neurons in the medial amygdala. J Neurosci. 2014;34(26):8699–715.
486 15. Myers B, Mark Dolgas C, Kasckow J, Cullinan WE, Herman JP. Central stress-
487 integrative circuits: forebrain glutamatergic and GABAergic projections to the
488 dorsomedial hypothalamus, medial preoptic area, and bed nucleus of the stria
489 terminalis. Brain Struct Funct. 2014;219(4):1287–303.
490 16. Bian X, Yanagawa Y, Chen WR, Luo M. Cortical-like functional organization of the
491 pheromone-processing circuits in the medial amygdala. J Neurophysiol.
492 2008;99(1):77–86.
21 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
493 17. Moore AM, Coolen LM, Lehman MN. Kisspeptin/Neurokinin B/Dynorphin (KNDy)
494 cells as integrators of diverse internal and external cues: evidence from viral-based
495 monosynaptic tract-tracing in mice. Sci Rep. 2019;9(1):1–5.
496 18. Yeo SH, Kyle V, Blouet C, Jones S, Colledge WH. Mapping neuronal inputs to Kiss1
497 neurons in the arcuate nucleus of the mouse. PLoS One. 2019;14(3):e0213927.
498 19. Lass G, Li XF, de Burgh RA, He W, Kang Y, Hwa‐Yeo S, Sinnett‐Smith LC,
499 Manchishi SM, Colledge WH, Lightman SL OK. Optogenetic stimulation of
500 kisspeptin neurones within the posterodorsal medial amygdala increases luteinising
501 hormone pulse frequency in female mice. J Neuroendocrinol. 2020;32(2):e12823.
502 20. Kubo T, Okatani H, Nishigori Y, Hagiwara Y, Fukumori R, Goshima Y. Involvement
503 of the medial amygdaloid nucleus in restraint stress-induced pressor responses in rats.
504 Neurosci Lett. 2004;354(1):84–6.
505 21. Pineda R, Plaisier F, Millar RP, Ludwig M. Amygdala Kisspeptin Neurons: Putative
506 Mediators of Olfactory Control of the Gonadotropic Axis. Neuroendocrinology.
507 2017;104(3):223–38.
508 22. Takahashi LK. Olfactory systems and neural circuits that modulate predator odor fear.
509 Front Behav Neurosci. 2014;8:72.
510 23. Govic A, Paolini AG. In vivo electrophysiological recordings in amygdala subnuclei
511 reveal selective and distinct responses to a behaviorally identified predator odor. J
512 Neurophysiol. 2015;113(5):1423–36.
513 24. Lewis K, Li C, Perrin MH, Blount A, Kunitake K, Donaldson C, Vaughan J, Reyes
514 TM, Gulyas J, Fischer W, Bilezikjian L. Identification of urocortin III, an additional
515 member of the corticotropin-releasing factor (CRF) family with high affinity for the
516 CRF2 receptor. Proc Natl Acad Sci U S A. 2001;98(13):7570–5.
22 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
517 25. Dedic N, Chen A, Deussing JM. The CRF Family of Neuropeptides and their
518 Receptors - Mediators of the Central Stress Response. Curr Mol Pharmacol.
519 2017;11(1):4–31.
520 26. Deussing JM, Breu J, Kühne C, Kallnik M, Bunck M, Glasl L, Yen YC, Schmidt MV,
521 Zurmühlen R, Vogl AM, Gailus-Durner V. Urocortin 3 modulates social
522 discrimination abilities via corticotropin-releasing hormone receptor type 2. J
523 Neurosci. 2010;30(27):9103–16.
524 27. Shemesh Y, Forkosh O, Mahn M, Anpilov S, Sztainberg Y, Manashirov S,
525 Shlapobersky T, Elliott E, Tabouy L, Ezra G, Adler ES. Ucn3 and CRF-R2 in the
526 medial amygdala regulate complex social dynamics. Nat Neurosci. 2016;19(11):1489–
527 96.
528 28. Jamieson PM, Li C, Kukura C, Vaughan J, Vale W. Urocortin 3 modulates the
529 neuroendocrine stress response and is regulated in rat amygdala and hypothalamus by
530 stress and glucocorticoids. Endocrinology. 2006;147(10):4578–88.
531 29. Fekete ÉM, Zhao Y, Li C, Sabino V, Vale WW, Zorrilla EP. Social defeat stress
532 activates medial amygdala cells that express type 2 corticotropin-releasing factor
533 receptor mRNA. Neuroscience. 2009;162(1):5–13.
534 30. Paxinos G, Franklin KB. Mouse Brain in Stereotaxic Coordinates. Acad Press.
535 2019;5:246.
536 31. McCosh RB, Kreisman MJ, Breen KM. Frequent tail-tip blood sampling in mice for
537 the assessment of pulsatile luteinizing hormone secretion. J Vis Exp. 2018;(137):
538 57894.
539 32. Steyn FJ, Wan Y, Clarkson J, Veldhuis JD, Herbison AE, Chen C. Development of a
540 methodology for and assessment of pulsatile luteinizing hormone secretion in juvenile
23 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
541 and adult male mice. Endocrinology. 2013;154(12):4939–45.
542 33. Vidal A, Zhang Q, Médigue C, Fabre S, Clément F. Dynpeak: An algorithm for pulse
543 detection and frequency analysis in hormonal time series. PLoS One.
544 2012;7(7):e39001.
545 34. Ressler KJ. Amygdala Activity, Fear, and Anxiety: Modulation by Stress. Biol
546 Psychiatry. 2010;67(12):1117–9.
547 35. Adekunbi DA, Li XF, Lass G, Shetty K, Adegoke OA, Yeo SH, Colledge WH,
548 Lightman SL, O’Byrne KT. Kisspeptin neurones in the posterodorsal medial amygdala
549 modulate sexual partner preference and anxiety in male mice. J Neuroendocrinol.
550 2018;30(3):e12572.
551 36. Adekunbi DA, Li XF, Li S, Adegoke OA, Iranloye BO, Morakinyo AO, Lightman SL,
552 Taylor PD, Poston L, O’Byrne KT. Role of amygdala kisspeptin in pubertal timing in
553 female rats. PLoS One. 2017;12(8):e0183596.
554 37. Ma S, Morilak DA. Norepinephrine release in medial amygdala facilitates activation of
555 the hypothalamic-pituitary-adrenal axis in response to acute immobilisation stress. J
556 Neuroendocrinol. 2005;17(1):22–8.
557 38. Van-Hover C, Li C. Stress-activated afferent inputs into the anterior parvicellular part
558 of the paraventricular nucleus of the hypothalamus: Insights into urocortin 3 neuron
559 activation. Brain Res. 2015;1611:29–43.
560 39. Xiao FL, Bowe JE, Lightman SL, O’Byrne KT. Role of corticotropin-releasing factor
561 receptor-2 in stress-induced suppression of pulsatile luteinizing hormone secretion in
562 the rat. Endocrinology. 2005;146(1):318–22.
563 40. Phumsatitpong C, Moenter SM. Estradiol-Dependent stimulation and suppression of
564 gonadotropin-Releasing hormone neuron firing activity by corticotropin-Releasing
24 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
565 hormone in female mice. Endocrinology. 2018;159(1):414–25.
566 41. Pardo-Bellver C, Cádiz-Moretti B, Novejarque A, Martínez-García F, Lanuza E.
567 Differential efferent projections of the anterior, posteroventral, and posterodorsal
568 subdivisions of the medial amygdala in mice. Front Neuroanat. 2012;6(33):1–26.
569 42. Liu ZP, Song C, Wang M, He Y, Xu XB, Pan HQ, Chen WB, Peng WJ, Pan BX.
570 Chronic stress impairs GABAergic control of amygdala through suppressing the tonic
571 GABAA receptor currents. Mol Brain. 2014;7(1):1–4.
572 43. Zhang X, Ge TT, Yin G, Cui R, Zhao G, Yang W. Stress-induced functional
573 alterations in amygdala: Implications for neuropsychiatric diseases. Front Neurosci.
574 2018;12:367.
575 44. Comninos AN, Anastasovska J, Sahuri-Arisoylu M, Li X, Li S, Hu M, Jayasena CN,
576 Ghatei MA, Bloom SR, Matthews PM, O’Byrne KT. Kisspeptin signaling in the
577 amygdala modulates reproductive hormone secretion. Brain Struct Funct.
578 2016;221(4):2035–47.
579 45. Cavalcante JC, Sita LV, Mascaro MB, Bittencourt JC, Elias CF. Distribution of
580 urocortin 3 neurons innervating the ventral premammillary nucleus in the rat brain.
581 Brain Res. 2006;1089(1):116–25.
582 46. Li C, Vaughan J, Sawchenko PE, Vale WW. Urocortin III-immunoreactive projections
583 in rat brain: Partial overlap with sites of type 2 corticotrophin-releasing factor receptor
584 expression. J Neurosci. 2002;22(3):991–1001.
585 47. Yang JA, Hughes JK, Parra RA, Volk KM, Kauffman AS. Stress rapidly suppresses in
586 vivo LH pulses and increases activation of RFRP-3 neurons in male mice. J
587 Endocrinol. 2018;239(3):339–50.
588 48. Coste SC, Kesterson RA, Heldwein KA, Stevens SL, Heard AD, Hollis JH, Murray
25 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
589 SE, Hill JK, Pantely GA, Hohimer AR, Hatton DC. Abnormal adaptations to stress and
590 impaired cardiovascular function in mice lacking corticotropin-releasing hormone
591 receptor-2. Nat Genet. 2000;24(4):403–9.
592 49. Henckens MJAG, Deussing JM, Chen A. Region-specific roles of the corticotropin-
593 releasing factor-urocortin system in stress. Nat Rev Neurosci. 2016;17(10):636–51.
594 50. Zavala E, Voliotis M, Zerenner T, Tabak J, Walker JJ, Li XF, Terry JR, Lightman SL,
595 O’byrne K, Tsaneva-Atanasova K. Dynamic Hormone Control of Stress and Fertility.
596 Front Physiol. 2020;11:598845.
597 51. Bagosi Z, Csabafi K, Karasz G, Jászberényi M, Földesi I, Siska A, Szabó G, Telegdy
598 G. The effects of the urocortins on the hypothalamic-pituitary-adrenal axis -
599 similarities and discordancies between rats and mice. Peptides. 2019;112:1–13.
600 52. Day HEW, Masini C V, Campeau S. The pattern of brain c-fos mRNA induced by a
601 component of fox odor, 2,5-dihydro-2,4,5-Trimethylthiazoline (TMT), in rats, suggests
602 both systemic and processive stress characteristics. Brain Res. 2004;1025(1–2):139–
603 51.
604 53. Martinez RC, Carvalho-Netto EF, Ribeiro-Barbosa ÉR, Baldo MVC, Canteras NS.
605 Amygdalar roles during exposure to a live predator and to a predator-associated
606 context. Neuroscience. 2011;172:314–28.
607
26 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
608 Figure 1. Dose-dependent suppression of pulsatile luteinising hormone (LH) secretion by
609 unilateral intra-posterodorsal medial amygdala (MePD) infusion of Urocortin 3 (Ucn3) in adult
610 ovariectomised (OVX) C57Bl6/J female mice. Representative LH pulse profile with (A) aCSF,
611 (B) 336.60 fmol in 1.80 l or (C) 3.36 pmol in 1.80 l of Ucn3 infusion for 35 min administered
612 between 60-95 min of the total blood sampling period. (D), Summary of LH pulse interval for
613 the 60 min pre-infusion control period (0-60 min), 35 minute aCSF/Ucn3 infusion period (60-
614 95 min) and 55 min post-infusion recovery period (95-150 min). LH pulses detected by the
615 DynePeak algorithm are indicated with an asterisk located above each pulse on the
616 representative LH pulse profiles. ++p<0.001, +++p<0.0001 Ucn3 vs pre-treatment control
617 period; #p<0.05, ###p<0.0001 Ucn3 vs aCSF at the same time point; n=7-10 per group.
618 Figure 2. Acute 2,4,5-Trimethylthiazole (TMT)-exposure suppresses pulsatile luteinising
619 hormone (LH) secretion and Astressin2B (Ast2B) delivery into the posterodorsal medial
620 amygdala (MePD) completely blocks the TMT effect on LH pulsatility in adult ovariectomised
621 (OVX) C57Bl6/J female mice. Representative LH pulse profile with (A) control non-TMT (B)
622 TMT-exposure (C) 27.2 pmol in 1.7 l of Ast2B infusion alone (D) 27.2 pmol in 1.7 l + TMT
623 Ast2B infusion. (E), Summary of LH pulse interval for the pre-TMT control period (0-50
624 min), Ast2B infusion (50-120 min) and TMT exposure (60-120min). LH pulses detected by
625 the DynePeak algorithm are indicated with an asterisk located above each pulse on the
626 representative LH pulse profiles. ++p<0.001 pre-TMT vs. TMT; ##p<0.001 TMT vs. no TMT
627 and 16 μM Ast2B; ###p<0.0001 TMT vs TMT+16 μM Ast2B; n=6-12 per group.
628 Figure 3. Bilateral DREADD inhibition of posterodorsal medial amygdala (MePD)
629 Urocortin3 (Ucn3) neurons blocks the suppressive effect of 2,4,5-Trimethylthiazole (TMT) on
630 luteinising hormone (LH) pulsatility in adult ovariectomised (OVX) Ucn3-Cre-tdTomato
631 female mice. Representative LH pulse profiles showing the effects of (A) Saline (30 min into
27 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
632 the pre-TMT control blood sampling period) and TMT-exposure for AAV-hM4D injected
633 mice, (B) clozapine-N-oxide (CNO) (administered, i.p. in saline at a dose of 5 mg kg-1, 30 min
634 into the pre-TMT control blood sampling period) and TMT-exposure (60 min into blood
635 sampling) for AAV-hM4D injected mice, (C) CNO and TMT-exposure for control AAV-YFP
636 injected mice, (D) CNO alone (administered, i.p. in saline at a dose of 5 mg kg-1, 30 min into
637 the control blood sampling period) for control AAV-YFP and AAV-hM4D injected mice. E),
638 Summary of LH pulse interval for the pre-TMT control period (1 h) and TMT-exposure period
639 (1 h). LH pulses detected by the DynePeak algorithm are indicated with an asterisk located
640 above each pulse on the representative LH pulse profiles. ++p<0.001 pre-TMT vs TMT for
641 control group; ##p<0.001 control vs. DREADD; n=5-10 per group.
642 Figure 4. Bilateral DREADD inhibition of Urocortin 3 (Ucn3) neurons in the posterodorsal
643 medial amygdala (MePD) blocks the inhibitory effect of restraint stress on luteinising hormone
644 (LH) pulsatility in adult ovariectomised (OVX) Ucn3-cre-tdTomato female mice.
645 Representative LH pulse profiles showing the effects of (A) saline (30 min into the pre-restraint
646 control blood sampling period) and restraint for AAV-hM4D injected mice, (B) clozapine-N-
647 oxide (CNO) (administered, i.p. in saline at a dose of 5 mg kg-1, 30 min into the pre-restraint
648 control blood sampling period) and restraint for AAV-hM4D injected mice, (C) CNO and
649 restraint for control AAV-YFP injected mice, (D) CNO alone (30 min into the control blood
650 sampling period) for control AAV-YFP and AAV-hM4D injected mice. (E), Summary of LH
651 pulse interval for the pre-restraint control period (1 h) and restraint period (1 h). LH pulses
652 detected by the DynePeak algorithm are indicated with an asterisk located above each pulse on
653 the representative LH pulse profiles. **p<0.001 pre-restraint vs. restraint for control group;
654 #p<0.001 control restraint vs. CNO restraint; n=7-11 per group.
28 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
655 Figure 5. Bilateral DREADD inhibition of Urocortin 3 (Ucn3) neurons in the posterodorsal
656 medial amygdala (MePD) blocks the 2,4,5-Trimethylthiazole (TMT)-induced rise in
657 corticosterone (CORT) in adult ovariectomised (OVX) Ucn3-cre-tdTomato female mice.
658 CORT secretion time-course for mice injected with clozapine-N-oxide (CNO), administered,
659 i.p. in saline at a dose of 5 mg kg-1, at the start of the experiment and exposed to TMT, lasting
660 for 1 h, followed by a 1 h recovery period (60-120 min) for the DREADD group (blue line,
661 squares) and control group (red line, circles). CNO or saline were administered at -30 min.
662 TMT-exposure was initiated at 0 min and terminated at 60 min. +p<0.05 control vs. DREADD
663 group at 60 min and 120 min; n=6-9 per group.
664 Figure 6. Expression of AAV-hM4D(Gi)-mCitrine in posterodorsal medial amygdala (MePD)
665 Urocortin3 (Ucn3) neurons. (A-F) Representative dual fluorescence photomicrographs of the
666 MePD from a Ucn3-cre-tdTomato female OVX mouse injected with AAV5-hSyn-DIO-HA-
667 hM4D(Gi)-IRES-mCitrine. Ucn3 neurons labelled with m-Citrine (A) and tdTomato (C)
668 appear yellow/orange (E). (B), (D) and (F) are a higher power view of (A), (C) and (E)
669 respecitively. Scale bars represent A, C, E 100 m and B, D, F 25 m; OT, Optic tract (blue
670 line).
29 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is Figure 1. made available under aCC-BY-NC-ND 4.0 International license.
A B aCSF Ucn3 (336.6fmol) 8 8 * * * * * * * 6 * 6 * * * * * **** 4 4 2 2
LH (ng/ml) LH 0 (ng/ml) LH 0 0 40 80 120 160 0 40 80 120 160 Time (min) Time (min)
Pre C D aCSF/Ucn3 ### Ucn3 (3.36pmol) 60 Post 10 # +++ 50 ++ 8 * ** * 40 6 * * * * * 30 4 (min) 20 2 10 LH (ng/ml) LH 0 0 0 40 80 120 160 interval pulse LH wawaCSFvaewv1aew9v2aew0v2aew1v2aew2v2aew Ucn33v2aew4v2aew5v2aew6v2aew7v2aew8v2aew9 Ucn3v3aew0v3ae1v3e233 336.6 3.36 Time (min) fmol pmol bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is Figure 2. made available under aCC-BY-NC-ND 4.0 International license. A B 8 No TMT 6 TMT * 6 * * * * * * * 4 * 4 * * * 2 2
LH (ng/ml) LH 0 (ng/ml) LH 0 0 40 80 120 0 40 80 120 Time (min) Time (min)
C D Ast2B (27.2pmol) Ast2B (27.2pmol) 12 12 TMT * * * * * * * * * 8 * * * 8 * * 4 4
LH (ng/ml) LH 0 (ng/ml) LH 0 0 40 80 120 0 40 80 120 Time (min) Time (min) E Pre 80 ### +++ noTMT/ 60 TMT/Ast2B 40 (min) 20 0 LH pulse interval pulse LH wawvaewnov3ae5wv3ae6wv3ae7TMTwv3ae8wv3ae9wv4ae0wv4aeAst2B1wv4ae2wv4ae3wv4ae4wv4ae5w Ast2Bv4ae6v4e748 TMT +TMT bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is Figure 3. made available under aCC-BY-NC-ND 4.0 International license.
ABTMT TMT CNO 12 Saline 15 * * * * * * 8 * 10 * * * * 4 * 5
LH (ng/ml) LH LH (ng/ml) LH 0 0 0 40 80 120 0 40 80 120 Time (min) Time (min)
CD 12 CNO TMT 12 CNO * * * * * 8 * 8 * * * * * 4 4
LH (ng/ml) LH LH (ng/ml) LH 0 Control Virus 0 0 40 80 120 0 40 80 120 Time (min) Time (min) E Pre-TMT 80 ++ TMT 60 ## 40 (min) 20 0 LH pulse interval pulse LH waControlve3w0ave3w1ave3w2ave3CNOw3ave3w4ave35 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is Figure 4. made available under aCC-BY-NC-ND 4.0 International license. ABRestraint Restraint Saline 16 * 12 CNO * * * 12 * * 8 * * 8 * 4 4
LH (ng/ml) LH LH (ng/ml) LH 0 0 0 40 80 120 0 40 80 120 Time (min) Time (min)
CDRestraint CNO CNO 16 * 12 *** * * * 12 * * 8 * * 8 4 4
LH (ng/ml) LH 0 Control Virus (ng/ml) LH 0 0 40 80 120 0 40 80 120 Time (min) Time (min)
E Pre-Restraint 80 ++ Restraint 60 ## 40 (min) 20
LH pulse interval pulse LH 0 wave24Controlwave25wave26wave27wave28 CNOwave29 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.20.449139; this version posted June 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Figure 5. DREADD TMT Control 500 + + 400 300 200 100
CORT (ng/ml) CORT 0 -300 30 6090 120 Time (min) Figure 6.
A C E
OT OT OT
OT B OT D OT FF