Protection of Washed and Pasteurized Shell Eggs against Fungal Growth by Application

of Natamycin-Containing Shellac Coating

THESIS

Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in

the Graduate School of The Ohio State University

By

Yang Song

Graduate Program in Food Science and Technology

The Ohio State University

2016

Master's Examination Committee:

Dr. Ahmed Yousef, Advisor

Dr. Dennis R. Heldman

Dr. Luis Rodriguez-Saona

Copyrighted by

Yang Song

2016

Abstract

Mold contamination of commercial shell eggs can potentially cause significant economic loss to the egg industry during storage. Studies indicated that molds from varies sources can propagate on commercial eggs when storage condition is less ideal.

The current egg processing procedures such as commercial washing and pasteurization can weaken the egg shell, which is the primary defense of egg content, and expose processed eggs to contaminations. Generally, processed eggs are coated with mineral oil to overcome this problem. However, oil application is not very effective when used to protect eggs against mold contamination during storage. The food grade anti-fungal agent natamycin can be used to improve egg defense against mold contamination; however, direct application on egg surface will cause it to lose activity rapidly. Therefore, incorporation of natamycin and a food-grade coating is necessary to extend its anti-fungal effectiveness. As a food-grade coating, shellac can retain egg quality better compare to other coating materials; moreover, it can also serve as a matrix for natamycin to treat egg surface. Research is needed to investigate whether natamycin can remain effective in shellac coating; determine the minimum inhibitory concentration (MIC) of natamycin in shellac coating against typical mold contaminants, and whether the natamycin-shellac coating is effective when used on commercial washed eggs and pasteurized eggs.

ii

The main objective of this research were (i) to assess natamycin efficacy on molds isolated from contaminated eggs using agar plates; and (ii) to evaluate the anti- fungal effectiveness of natamycin-shellac coating when applied on commercially washed eggs and mild heat/ ozone pasteurized eggs.

Natural mold species were isolated from contaminated eggs, and identified using polymerase chain reaction (PCR) method with ITS primers. Identification results revealed three mold contaminants on shell eggs, these are: Cladosporium romotenellum,

Penicillium commune, and Mucor hiemalis. Identified mold species were used to inoculate potato dextrose agar (PDA) plates, and the MIC of natamycin-shellac coating were tested with prepared test disks. Test disks were soaked in natamycin-shellac coating mixture, which were prepared by mixing natamycin suspension (1mg per 1 ml methanol) and shellac coating (1:4 weight/weight ratio of shellac in ethyl alcohol) at different concentrations (12.5, 25, 50, 100, 200, 400, and 800 µg natamycin/ml (mixture suspension). The efficacy of natamycin-shellac coating at different concentrations was measured by inhibition zone on PDA plates after 5 days of incubation. Identification results revealed three mold contaminants on shell eggs, these are: Cladosporium romotenellum, Penicillium commune, and Mucor hiemalis. Results suggest that natamycin-shellac coating inhibits the tested molds at these threshold concentrations of natamycin: Mucor, 97.7 µg/ml; Cladosporium, 51.6 µg/ml; and Penicillium, 44.9 µg/ml.

iii

Shellac-containing natamycin was tested on proceed shell eggs. Inhibitory concentration was adjusted based on preliminary tests and related published data. A formulation of natamycin-shellac coating was finalized to contain natamycin concentration at 400 µg/ml. Studied eggs were prepared into three groups: eggs that received no coating (control), eggs that were coated with only shellac (treatment one), and eggs that were coated with shellac containing 400 µg/ml of natamycin (treatment two). Each group of eggs were inoculated with mold spores and stored at 25°C for 18 days, and mold populations were enumerated on different days by plating on PDA plates.

The same experimental set up was repeated in triplicates on eggs inoculated with Mucor,

Cladosporium and Penicillium. Growth of molds on shell eggs were fitted with the logistic model, and kinetic parameters were estimated and compared. Statistical analysis showed that natamycin-coated eggs had significant antifungal effects compare to other treatments. Under the influence of natamycin, estimated overall mold growth was significantly reduced (Tukey test, p<0.05), maximum specific growth rates were significantly lower (Tukey test, p<0.05), and mold growth lag time was significantly increased (Tukey test, p<0.05) on both washed and pasteurized egg. This study illustrated that shellac coating can be used as a carrier for natamycin to create an effective protection against mold contaminations on washed and pasteurized egg surface, hence extend their shelf-life and minimize economic loss associated with moldy eggs.

iv

Acknowledgments

I would like to offer my sincerest thanks to my advisor Dr. Ahmed Yousef for believing in me, offering me a second chance to pursue my goals. His guidance, discipline, and encouragements are the most valuable instructions that helped me become a better scientist. I am very blessed and very thankful to have Dr. Yousef as my advisor.

To my committee member: Dr. Dennis Heldman, thank you for your teaching in food engineering class. You spiked my interest in modeling and provided invaluable advises to me. To my other committee member: Dr. Luis Rodriguez-Saona, thank you for your suggestions and lectures. You once told me to pursue the career that I truly love, and you helped me fall in love with food science.

I would also like to thank the past and current members of the Yousef lab members: Dr. Jin-Gab Kim, Dr. En Huang, Dr. Baosheng Liu, Dr. Ismet Ozturk, Dr. Rui

Li, David Kasler, Xu yang, Mustafa Yesil, Greg Culbertson, Nathan Morrison, Michelle

Gerst, Ebrahim El-Khtab, Emily Holman, and Walaa Hussein for their precious friendship and constructive criticism. Special thanks go to Dr. En Huang, Xu Yang,

David Kasler and Mustufa Yesil for their encouragements and helps during my experiment. None of this research would have been possible if they didn’t help me.

To my parents, thank you so much for your understanding and support to my education, it’s the best experience and wealth that you showed me.

v

Vita

September 25, 1983 ...... Born, Guangzhou, Guangdong, China

2002...... New Mexico Military Institute

2006...... B.S. Biological Science, The Ohio State

University

Fields of Study

Major Field: Food Science and Technology

vi

Table of Contents

Abstract…………………………………………………………………………………..ii

Acknowledgements………………………………………………………………………v

Vita………………………………………………………………………………………vi

List of figures…………………………………………………………………………....xi

List of tables…………………………………………………………………………….xiv

Chapter 1 : Literature Review ...... 1

1.1 Mold ...... 1

1.1.1 Introduction ...... 1

1.1.2 Fungi taxonomy and nomenclature ...... 2

1.1.3 Ecology of fungi contamination...... 4

1.1.4 Mold isolation, enumeration and identification ...... 7

1.2 Egg ...... 13

1.2.1 Introduction ...... 13

1.2.2 Structure ...... 15

1.2.3 Egg processing ...... 17

1.3 Edible coating ...... 22 vii

1.3.1 Introduction ...... 22

1.3.2 Types of edible coating ...... 23

1.3.3 Related regulations...... 25

1.3.4 Edible film antifungal efficacy ...... 25

1.3.5 Advantage and disadvantage of edible coating ...... 29

1.4 Natamycin ...... 29

1.4.1 Introduction ...... 29

1.4.2 Natamycin application history and regulation ...... 31

1.4.3 Natamycin toxicity ...... 32

1.4.4 Natamycin application in edible films ...... 33

1.5 Modeling ...... 34

1.5.1 Comparison of microorganism growth curve ...... 34

1.5.2 Mathematical modeling of microbial growth ...... 37

1.6 Reference ...... 41

Chapter 2 : Isolation and identification of mold contaminants on shell eggs and assessment of natamycin efficacy in shellac coating when treating isolated molds ...... 57

2.1 Abstract ...... 57

viii

2.2 Introduction ...... 58

2.3 Materials and Methods ...... 60

2.3.1 Egg selection ...... 60

2.3.2 Mold isolation ...... 61

2.3.3 Mold identification...... 61

2.3.4 Preparation of coating solution ...... 63

2.3.5 MIC study ...... 64

2.3.6 Testing natamycin-containing shellac on shell eggs ...... 65

2.3.7 Data analysis ...... 65

2.4 Results ...... 65

2.4.1 Identification of mold contaminants ...... 65

2.4.2 Minimum inhibition concentration for natamycin in shellac solution ...... 66

2.4.3 Minimum inhibitory concentration of natamycin on shell eggs ...... 70

2.5 Discussion ...... 70

2.6 Conclusions ...... 75

2.7 Reference ...... 76

ix

Chapter 3 : Antifungal effectiveness of natamycin-shellac coating when applied on commercially washed eggs and mild heat/ozone pasteurized eggs ...... 79

3.1 Abstract ...... 79

3.2 Introduction ...... 80

3.3 Materials and methods ...... 82

3.3.1 Materials ...... 82

3.3.2 Preparation of fungal inoculum ...... 83

3.3.3 Coating preparation and application ...... 84

3.3.4 Egg inoculation ...... 85

3.3.5 Microbiological analysis ...... 86

3.3.6 Modeling ...... 86

3.3.7 Statistical analysis ...... 88

3.4 Results ...... 88

3.5 Discussion ...... 102

3.5.1 Antifungal effectiveness on commercial washed eggs ...... 102

3.5.2 Antifungal effectiveness on pasteurized eggs ...... 106

3.6 Conclusion ...... 110

x

3.7 Reference ...... 112

Appendix……………………………………………………………………………….115

A. Calculation of Natamycin Minimum Inhibitory Concentration When Applied

on Shell Eggs.

List of Reference…………………………………………………………………… 117

xi

List of Figures

Figure 1.1 Examples of (a) Non-septate mycelium, and (b) septate mycelium. (Pitt &

Hocking, 2009) ...... 3

Figure 1.2 Examples of streaking isolation techniques. From left to right: three phase streaking and lawn streaking (Pitt and Hocking, 1977)...... 7

Figure 1.3 Structural demonstration of different regions in fungi rDNA (Vilgalys lab,

Duke University, http://sites.biology.duke.edu/fungi/mycolab/primers.htm)...... 12

Figure 1.4 Diagram of laying hen’s reproductive tract. There are two parts: (a) ovary, and

(b) oviduct (Schmidt, 2004)...... 14

Figure 1.5 Hen’s egg structure (Hincke et al., 2012)...... 15

Figure 1.6 Structure of egg shell (Hincke et al., 2012)...... 16

Figure 1.7 Commercial egg processing procedures before marketing...... 19

Figure 1.8 The chemical structure of natamycin...... 30

Figure 1.9 Example of lag phase, exponential phase, and stationary phase on a hypothetical growth curve. Lag phase: from point (a) to point (b); exponential phase: from point (b) to point (c); stationary phase: from point (c) on...... 36

Figure 2.1 Examples of isolated mold colonies from contaminated eggs ...... 61

Figure 2.2: Inhibition zone of natamycin-coated disks on Penicillium inoculated on PDA plates. Natamycin concentration were: (from left to right): 400, 200, 100, and 50 µg/ml.

...... 66

xii

Figure 2.3: Inhibition zones (mm) at different natamycin concentrations (μg/ml) in shellac-coated disks against Mucor hiemalis on PDA plates...... 67

Figure 2.4: Inhibition zones (mm) at different natamycin concentrations (μg/ml) in shellac-coated dsiks against Cladosporium ramotenellum on PDA plates...... 68

Figure 2.5 Inhibition zones (mm) at different natamycin concentrations (μg/ml) in shellac-coated disks against Penicillium commune on PDA plates...... 69

Figure 2.6 Examples of mold contaminations on shellac-coated eggs that contained different concentrations of natamycin. Natamycin concentrations (from left to right): 100,

200, and 400 µg/ml)...... 70

Figure 2.7 Molecular phylogenetic tree of Mucor, Cladosporium, and Penicillium generated by Maximum Likelihood method (MEGA® 6.06; Tamura et al., 2013)...... 72

Figure 3.1 Examples of regular eggs vs. coated eggs. (Eggs from left to right: no coating, shellac coating)...... 85

Figure 3.2 Modeling example of Mucor hiemalis growth using logistic model on commercially-washed eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 2 data)...... 89

Figure 3.3 Modeling example of Cladosporium ramotenellum growth using logistic function on commercially-washed eggs that were uncoated (control), shellac-coated

(treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 3 data).

...... 91

xiii

Figure 3.4 Modeling example of Penicillium commune growth on commercially-washed eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 3 data)...... 93

Figure 3.5 Modeling example of Mucor hiemalis growth on pasteurized eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 3 data)...... 95

Figure 3.6 Modeling example of Cladosporium ramotenellum growth on pasteurized eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin- containing shellac (treatment 2). (Trial 3 data)...... 98

Figure 3.7 Growth of Penicillium commune on pasteurized eggs that were uncoated

(control), shellac-coated (treatment 1), and coated with natamycin-containing shellac

(treatment 2, Trial 1 data)...... 100

Figure 3.8 Gompertz modeling example of Penicillium commune growth on commercially-washed eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 3 data)...... 104

Figure 3.9 Modeling example of Cladosporium ramotenellum growth on pasteurized eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin- containing shellac (treatment 2). (Trial 3 data)...... 108

xiv

List of Tables

Table 1.1 Potential mold/yeast spoilage in different foods at varies water activity...... 5

Table 1.2 US standards for quality of shell eggs...... 20

Table 1.3 Studies of incorporating antimicrobial agents into edible packaging materials.

...... 26

Table 1.4 Terminology used in mathematical modeling of microbial growth (Sinigaglia,

Corbo, & Bevilacqua, 2012)...... 37

Table 1.5 Examples of sigmoidal models and their related modified forms...... 39

Table 1.6 Selection of models based on the number of kinetic parameters (Zwietering et al., 1990)...... 40

Table 2.1 PCR reaction composition for mold identification...... 62

Table 2.2 PCR reaction thermal cycler conditions for mold identification...... 63

Table 3.1 Comparison of Mucor growth kinetic parameters1 on commercially washed eggs...... 90

Table 3.2 Comparison of Cladosporium growth kinetic parameters1 on commercial washed egg samples...... 92

Table 3.3 Comparison of Penicillium growth kinetic parameters1 on commercial washed egg samples...... 94

Table 3.4 Comparison of Mucor growth kinetic parameters1 on pasteurized egg samples.

...... 97

xv

Table 3.5 Comparison of Cladosporium growth kinetic parameters1 on pasteurized egg samples...... 99

Table 3.6 Comparison of Penicillium growth kinetic parameters1 on pasteurized egg samples...... 102

Table 3.7 Comparison of Penicillium growth kinetic parameters1 on commercial washed egg samples...... 105

Table 3.8 Comparison of Cladosporium growth kinetic parameters1 on pasteurized egg samples...... 109

xvi

Chapter 1 : Literature Review

1.1 Mold

1.1.1 Introduction

Mold is not a scientific taxon in biological taxonomy; it is a generic term for many types of filamentous fungi. Fungi species are eukaryotic and can range from unicellular organisms such as yeast to multicellular organisms such as mushrooms

(Galagan, Henn, Ma, Cuomo, & Birren, 2005). Some of the food spoilage fungi can produce mycotoxin. The demand for in-depth study about mycotoxin has not become urgent until alimentary toxic aleukia killed thousands of people in former Soviet Union in

1940s, and “Turkey X” disease killed more than 100,000 turkeys in Great Britain

(Blunden et al., 1991). In addition to the safety risks that fungi has caused to humans, food loss due to fungi contamination around the world is very substantial. For example, it was estimated that mold spoilage of food in Australia alone cost AU$10 billion annually

(Pitt & Hocking, 2009). Spoilage molds, and associated spoiled foods, include

Cladosporium herbarumon on refrigerated meat, Penicillium roquefortion on cheeses, and Xeromyces bisporus on fruit cake (Pitt & Hocking, 2009). Therefore, understandings the taxonomy, nomenclature, ecology contamination, and methods to isolate, enumerate, andidentify fungi can assist greatly in improving the effectiveness of antifungal treatments against food spoilage molds.

1

1.1.2 Fungi taxonomy and nomenclature

Taxonomy is a study to classify discovered organisms, while nomenclature is a study to assign names to each organism that has been classified (Edward & Freundt,

1956). Classification or naming of the organisms follows the hierarchical rule: kingdom contains subkingdoms, subkingdom contains classes, class contains orders, order contains families, family contains genera, and genus contains species (Bovee & Jahn, 1966). As a separate kingdom, fungi used to be classified based on morphological traits such as hyphae structure and spore type as observed through microscopic examination (Guarro,

Gené, & Stchige, 1999). When molecular identification was introduced to fungi taxonomy, nomenclature system was evolved to accommodate the new findings (Binz &

Kligi, 1999). One such change is the combination of Ascomycotina and Deuteromycotina

(Taylor, 1995), and the three major subkingdoms of fungi have now became:

Zygomycotina, Ascomycotina and Basidiomycotina (Pitt & Hocking, 2009). Within the three, most food spoilage molds can be categorized into the subkingdoms of

Zygomycotina and Ascomycotina (Pitt & Hocking, 2009).

The use of molecular identification methods have helped mycologist in classifying fungus, however, due to limitation of gene bank, microscopic examination of fungal culture is still a very common practice to differentiate morphological traits between different mold samples. Zygomycotina is morphologically unique in three ways:

1. Fungi belongs to Zygomycotina tends to have a shorter growth spawn, often

named as “spread mold”. Isolates can fill a normal petri-dish within 3-5 days

(Vilgalys et al., 2012). 2

2. The mycelium of the fungi in Zygomycotina often are non-septate, i.e., mycelia

are missing the cross wall structure that prevents exchange of nulei. Figure 1 has

demonstrated the trait (Pitt & Hocking, 2009).

3. Zygomycotina fungi reproduce with sporangiospores, which usually located at the

end of a long hypha ( Guarro, Gené & Stchigel, 1999).

Figure 1.1 Examples of (a) Non-septate mycelium, and (b) septate mycelium. (Pitt &

Hocking, 2009)

In conclusion, the rapid growth nature makes Zygomycotina common spoilage molds on fresh food surface when products are not properly stored (Moss, 2008).

Ascomycotina is another frequent food spoilage fungi. Different from

Zygomycotina, Ascomycotina mycelium is septate, and grows slower (Pitt & Hocking,

2009). The spores of this subkingdom is unique as well. Known as the ascospores, it is

3

generally contained and spread by a structure called ascocarp (Jones & Moss, 1978).

Ascospores are sexual spores. Ascomycotina can also produce asexual spores called conidia (Pitt & Hocking, 2009). From the food quality and safety point of view, these fungi are highly hazardous since not only they can spoil food, many of them can produce mycotoxins when conditions are right (Frisvad et al., 2004). For example, aflatoxins produced by Aspergillus which belongs to subkingdom Ascomycotina, is a toxic and carcinogenic compound that can cause abdominal pain, vomiting, edema, liver damage, mental impairment, even death when taking in high amount in short time (Chang &

Hamilton, 1982). It can also cause growth and development impairment and liver cancer after prolonged exposure to the toxin (Chang & Hamilton, 1982).

1.1.3 Ecology of fungi contamination

In many cases, food itself and its related surroundings are the ecosystem for food spoiling microorganisms. Many microorganisms will have enough nutrients to support their growth when in contact with food. Factors that may determine food spoilage condition, such as water activity, pH, temperature (both processing and storage), nutrient status, and oxygen availability is considered in this section.

By definition, water activity (aw) is the ratio of partial water vapor pressure of the product and saturated water vapor pressure of water (Mathlouthi, 2001). The correlation between aw and the ability of microorganism to grow has been explored half a century ago (Scott, 1957). Fungi manage to survive in a broader range of aw in comparison to spoilage bacteria. Figure 1.1 has listed some examples.

4

Table 1.1 Potential mold/yeast spoilage in different foods at varies water activity.

Water Foods Molds Yeasts activity 1.00 Vegetables Many molds Many yeasts Meat, milk fruits 0.95 Bread Basidiomycetes Basidiomycetes Most soil fungi 0.90 Ham Mucorales Fusarium Most ascomycetes 0.85 Dry Salami Rhizopus, Cladosporium Zygosaccharomyces Aspergillus flavus rouxii Xerophilic Penicillia

0.80 Aspergillus flavus Zygosaccharomyces Xerophilic bailii Penicillia 0.75 Jam Xerophilic Debaryomyces Salt fish Aspergillus hansenii Fruit cake Wallemia Eurotium 0.70 Confectionery Chrysosporium Dried fruit Eurotium halophilicum dry grains 0.65 Xeromyces bisporus Zygosaccharomyces rouxii a modified from data of Pitt & Hocking, 2009. Water activities shown for the estimated minimum requirement for mold/yeast growth based on literature data (Pitt & Hocking, 2009).

Mold/yeast food spoilage can out compete bacteria food spoilage with their ability to survive at a broader spectrum of pH (Pitt & Hocking, 2009). When most bacteria (with

5

the exception of lactic acid bacteria) have difficulties to grow at pH below 5, most fungi are not affected within the pH range between 3-8 (Wheeler, Hurdman, & Pitt, 1991).

Temperature can influence fungi spoilage during processing and storage.

Although many heat processing are standardized based on bacteria and bacteria spore inactivation, fungi and fungal spores are likely to be destroyed as well (McKee, 1995).

Some heat resistant fungal spores may survive pasteurization, yet they can cause food spoilage less frequently than bacterial spores (Pitt & Hocking, 2009). Mold and yeast contamination are a major threat to food quality during food storage. Food products are mostly stored at ambient, refrigeration, and freezing temperatures. At ambient temperature, foods are likely to be contaminated by mold and yeast, as long as no inhibitory factors that can hinder fungi growth are absent (Richard, 2007). Food may last longer at refrigeration temperature, yet fungal species such as Fusarium, Cladosporium,

Penicillium, and Thamnidium can still contaminate products when given time and right moisture condition since the lowest temperatures for certain fungal growth can occur at temperatures as low as -7 °C to 0 °C (Pitt & Hocking, 1977). As a result, temperature control and humidity control are equally important when preventing mold/yeast spoilage.

Oxygen availability is essential for food spoilage by molds (Powers & Berkowitz,

1990). However, oxygen concentration within food substrate is more important factor to mold growth than the atmospheric oxygen concentration. Hocking indicated that several food spoilage fungi are barely inhibited under nitrogen atmospheres (Hocking, 1990).

More importantly, certain mold species, such as Mucor, Rhizopus, and Fusarium are capable of causing fermentative spoilage (Pitt and Hocking, 1977). Mucor, Rhizopus, and

Amylomyces used as started culture in Asian alcoholic beverage can ferment grains under 6

anaerobic conditions (Holzapfel, 2002). In general, presence of oxygen is still the root cause for many mold spoilage, however, knowing the identity of the molds in food can help with contamination prevention due to the difference in oxygen requirements between varies molds.

1.1.4 Mold isolation, enumeration and identification

1.1.4.1 Mold isolation

The purpose of isolation is to obtain pure fungi cultures that can be used for identification (Gerloff, Fitzgerald, & Skoog, 1950). The most common isolation technique is three-phase streaking and lawn streaking. Figure 1.2 illustrates the examples of three phase streaking and law streaking.

Figure 1.2 Examples of streaking isolation techniques. From left to right: three phase streaking and lawn streaking (Pitt and Hocking, 1977).

7

Streaking isolation method is derived from bacteria isolation technique; therefore, it can be easily applied for yeast culture due to similar morphological traits. Although it is not as effective, mold isolation can be achieved using the same streaking technique.

Due to the superior size of mold colonies, purity can often be checked by uniformity in appearance of the colony (Janisiewicz & Roitman, 1988). Mold isolation can also be accomplished by the different growth rate of tested mold. After all, mold enumeration plates can serve as a good starting point for mold isolation, since good separation between different mold colonies can be expected on plates receiving higher dilution (Pitt and Hocking, 1977).

1.1.4.2 Mold enumeration

The degree of bacterial spoilage on food can often be determined by quantifying the number of colony forming units on petri dish. Although similar enumeration methods may still effective when quantifying yeast population, quantification of filamentous mold can be more difficult (Pitt and Hocking, 1977). Uneven homogenization of vegetative hyphae, and mold sporulation can all significantly impact the final counts of the colony forming units (CFU) on agar plate. As a result, varieties of mold enumeration techniques were developed in order to accommodate such situations. Direct plating, which directly places food samples on the surface of solidified media, is the most direct way to detect mold presence and number of molds (Mislivec & Bruce, 1977). Yet, the practice is limited by the size of food particles; hence it is often used for foods such as grains and nuts (Mislivec & Bruce, 1977). Dilution plating is one of the most common enumeration method for mold spoiled food. Similar to bacteria enumeration, food products are first sampled, then homogenized, and finally plated on media at serial dilutions (Mislivec & 8

Bruce, 1977). Dilutions are usually recommended at a ratio of 1:10, and homogenization process should be well controlled in order to minimize the uneven breakage of vegetative mold mycelium (Pitt and Hocking, 1977). Similar to dilution plating, spiral plate count is another enumeration method derived from the CFU counting procedures. Instead of using the traditional pour plating or spread plating method, spiral plate count uses an automated dispenser that inoculates the plate in a spiral fashion, hence saves plating time

(Manninen, Fung, & Hart, 1990). However, this method still share the same problems as the traditional dilution plating methods.

Against the difficulties of obtaining a perfectly homogenized mold sample, other enumeration techniques were developed in attempt to acquire more accurate mold counts in spoiled foods. One of such approach is the estimation of fungal biomass, which is often represented by mycelial dry weight (Notermans, Heuvelman, Egmond, Paulsch, &

Besling, 1986). Although mycelial dry weight is the best quantification unit that can be used to determine the degree of mold growth, it is often difficult to measure in food

(Notermans et al., 1986). There are other chemical or biochemical techniques derived from the similar concept. Chitin assay (Donald and Mirocha, 1977), and ergosterol assay

(Newell, Arsuffi, & Fallon, 1988) are both useful method for quantifying fungal growth, since both chitin and ergosterol are unique fungal components that exist in fungi cell envelop, which can be correlated to hyphal extension. However, detection of chitin or ergosterol is a complex and time-consuming procedure that requires advanced machineries; therefore, most food industries cannot afford them (Pitt and Hocking, 1977).

Impedimetry and condcutimerty is another way of measuring fungal biomass (Jarvis et al.

1983). This method is based on the change of medium impedance and conductance due to 9

metabolites generation during fungi propagation (Jarvis et al. 1983). Such mechanism can rapidly conclude fungal contamination results when mold species are well defined and testing environment are strictly controlled, yet the requirements for fixing test condition has limited its use in food mycology application (Huang et al. 2003). Adenosine triphosphate (ATP) has also been recommended as an alternative way of measuring biomass via the correlation between viable fungi counts and ATP concentration (Patel &

Williams, 1985). Since ATP is not unique to fungi, food contamination results yielded from this method will demand additional test for confirmation (Easter, 2003). In conclusion, dilution plate methods is still a good procedure of enumerating mold and measuring the degree of contaminations when considering cost, machinery, and time.

1.1.4.3 Mold identification

Knowing the identity of mold contaminants can provide useful information for food mycologist to treat food spoilage problem more effectively. Currently, mold can be identified with microscopic method, fungal volatiles method, and molecular methods (Pitt and Hocking, 1977). Among them, microscopic method is a more traditional approach.

Although most mold colonies can be seen by naked eyes, its structural can be carefully examined and compared using the microscope. Detail structures of mold are often viewed under microscope using prepared wet mounts. Microscopic structures such as hyphae and spore are observed and recorded for documentation purpose. Staining of the mold structures can assist the visual examination process. One of the many stains that are used in food mycology is lactofuchsin (Carmichael, 1955). In addition to microscopic data, colony diameter, colony color, and mycelium shape can all be used when identifying

10

mold. The collected observations can be compared to published data, and matching result will help to identity the unknown mold.

Microscopic identification appears to be subjective, therefore, other methods are developed in order to accommodate and confirm mold identification results. The more novel methods are fungal volatile detection method and immunological technique. Fungal volatiles detection method is well explored in fungal deterioration and mycotoxin production in food products such as grains (Pitt and Hocking, 1977). Gas sensor is used to translate chemical or bio chemical inputs into electrical signal, which can be interpreted as different volatiles or odors generated by different molds (Gardner and

Bartlett, 1994). Once mold deterioration or mycotoxin formation happened, this method can effectively identify the contaminants in a timely manner (Tognon et al., 2005), however, these methods have many limitations.

Molecular identification method on fungi species, have reshaped the taxonomy of fungi kingdom. Molecular identification relies heavily on DNA sequence analysis results and comparison to the data in gene bank (Pitt and Hocking, 1977). DNA sequence analysis is done using specific primers that is designed from ribosomal DNA (rDNA)

(Pitt and Hocking, 1977). For example, the target region of yeast identification can be the

D1/D2 domain of the 26s rDNA (Kurtzman et al., 2003), and the target region of mold identification can be internal transcribed spacer (ITS) region of rDNA (van der Vossen et al., 2003). Figure 1.3 shows the structural relations between these regions.

11

Figure 1.3 Structural demonstration of different regions in fungi rDNA (Vilgalys lab,

Duke University, http://sites.biology.duke.edu/fungi/mycolab/primers.htm).

Upon obtaining the identification results from different molds, food mycologist can use analytical software to generate a phylogenetic tree based on gene similarities

(Tamura, Stecher, Peterson, Filipski, & Kumar, 2013). Phylogenetic tree is a diagram that visually presents the potential evolutionary relationships between all the identified molds.

Each joined branch that formed a node on phylogenetic tree indicates a potential shared

“common ancestor”. If the distance of first shared “common ancestor” between two mold species is short, the two mold species share more genetic similarities compare to the ones that had longer distance of first joint “common ancestor” (Tamura et al., 2013). Molds that shared similar genes are likely to share similar strength and weakness, by understanding such correlation, food mycologist can selectively target certain spoilage mold species when necessary (Tamura et al., 2013). Molecular identification method has gained tremendous popularity over the past three decades; however, results are only as 12

accurate as the current available gen bank data (Pitt and Hocking, 1977). As more and full genome sequences of different molds become available, the accuracy of this test method is expected to be improved.

1.2 Egg

1.2.1 Introduction

Egg is a major agricultural product, and an excellent source of protein and other nutrients, such as lipids, vitamins, and minerals (Windhorst, 2007). As its nutrient value has been recognized by consumers, egg production has expanded over 200% worldwide over the past 35 years due to the increasing demands (Windhorst, 2007). Egg industry has significant economic impact in U.S as well. According to USDA data, 223 million eggs were laid every day in 2014 (USDA, 2016). Other than food application, eggs have been used in bioactive components extraction (Schmidt, 2004). Compounds such as lysozyme, avidin, ovotransferrin, ovomucin, and phospholipids can all be extracted from eggs

(Schmidt, 2004).

The white eggs and brown shell eggs that consumers have seen in US market come from two different breeds (Schmidt, 2004). White leghorn can lay white shell eggs while Rhode Island Red can lay brown shell eggs (Schmidt, 2004). Although the egg shell color is different, the egg formation path is similar. There are two parts of hen’s reproductive organ, ovary and oviduct.

13

Figure 1.4 Diagram of laying hen’s reproductive tract. There are two parts: (a) ovary, and

(b) oviduct (Schmidt, 2004).

Figure 1.4 shows the basic parts of hen’s reproductive tract. From ovary, clusters of follicles can form an immature yolk, which is dropped into oviduct (Burley &

Vadehra, 1989). The average lengthen of the oviduct is between 40-80 cm. When yolk

14

passes through the duct, other portions of eggs are secreted and attached to the yolk, and by the end of the process, an egg with shell is formed (Burley & Vadehra, 1989).

1.2.2 Structure

Avian eggs can be defined by three main components, the shell, the albumen, and the yolk, these components contribute 9.5%, 63%, and 27.5% of total egg weight, respectively (Cotterill & Geiger, 1977). Figure 1.5 demonstrated the sectional diagram of an egg.

Figure 1.5 Hen’s egg structure (Hincke et al., 2012).

In an egg, yolk is surrounded by albumen, and both egg and albumen are protected by egg shell (Hincke et al., 2012). Nutritious value of eggs come from its yolk and albumen.

15

Egg albumen contains different layers that can be recognized visually; the more viscous part is referred to as thick albumen, and the less viscous part is the referred to as the thin albumen (Burley & Vadehra, 1989). The viscosity difference is mainly due to the difference in ovomucin content (Okubo et al., 1997). The twisted spiral part (Figure 1.5) is also part of egg albumen named chalaza. The composition of yolk on the other hand, is relatively simpler compare to egg white. When the majority part of the yolk is yellow yolk, there is only less than 2% of egg yolk is white yolk (Okubo et al., 1997). Although yellow yolk can be further divided into deep yellow yolk and light yellow yolk

(Romanoff & Romanoff, 1949), the difference is hardly detected by naked eye. The nutritious content of avian egg has to be protected, and egg shell is the primary defense system. It can be divided into four major sections: cuticle, shell, external membrane, and internal membrane (Hincke et al., 2012).

Figure 1.6 Structure of egg shell (Hincke et al., 2012).

16

As Figure 1.6 reviews, egg shell is porous to allow the exchange of respiratory gases and water, yet it’s tough to provide mechanical protection for the content (Hincke et al.,

2012). The out most layer, cuticle is a thin organic layer that mainly consisted of protein

(Hincke et al., 2012). Although its average thickness is only about 10 µm, the cuticle can contribute to water loss prevention and protection against intrusion of microorganism

(Board & Hall, 1973). However, cuticle can be easily removed during washing process, hence careless egg washing will often expose the eggs to microorganism contamination

(Belyavin & Boorman, 1980).

1.2.3 Egg processing

1.2.3.1 Egg washing

In the U.S., all commercial eggs has to be washed, graded, packaged, and stored before marketing as table eggs or receive further processing (USDA, 2000). The main purpose of washing is to remove stains, dirt, or other surface debris to prevent microorganism contamination and promote product appearance (USDA, 2000).

Commercial washing steps usually include washing, rinsing, sanitizing and drying

(USDA, 2000). Although soaking was part of the processing in older egg washing protocol, it is not permitted anymore in order to avoid the risk of microorganism invasion

(USDA, 2000). The modern egg washing protocols recommended that eggs should be sprayed with water-containing sanitizer along with a detergent (USDA, 2000). During washing, water temperature shall be controlled at 32.2 °C, and shall be at least 11°C warmer than egg temperatures, since colder washing environment can create vacuum to induce microorganisms into eggs (USDA, 2000). It is also critical that washing water has 17

to be changed at least every 4 hours or as often as needed in order to maintain the sanitary effects of the process (Galis et al., 2013). Following washing, eggs are rinsed and sanitized with water as warm as washing water; sanitation water contains sanitizer. The choice of sanitizers varies, but usually chlorine-based compound such as sodium hypochlorite at concentration between 50 µg/ml to 200 µg/ml is preferred (USDA, 2000).

18

Figure 1.7 Commercial egg processing procedures before marketing.

19

Figure 1.7 has illustrated steps of a current commercial egg processing protocol. As discussed earlier, washed eggs have to be graded, packaged and stored before they can be marketed to consumers.

1.2.3.2 Egg grading

Egg grading is done via candling, which is a technique to monitor the conditions inside of eggs without breaking the shell (Vaclavik & Christian, 2008). As its name implied, candling uses candlelight to examine egg interiors. Currently, industrial scale machinery can complete this process with automated detection. Grading is a sorting process that groups the eggs with similar qualities together, and the standards of the sorting usually involve characteristics such as exterior quality, interior quality, size, and weight of the eggs (USDA, 2000).

Table 1.2 US standards for quality of shell eggs.

Quality Remarks AA Unbroken shell Air cell less than 1/8'' in depth and clear Firm whites and yolk with no apparent defect A Unbroken shell Air cell 3/16'' in depth Egg white clear and reasonably firm and yolk free from apparent defects B Slightly abnormal shell Air cell should not exceed 3/8'' in depth Clear egg white but slightly weak Yolk slightly flattened

Courtesy of USDA (2000), non-copyrighted material.

20

Table 1.2 has summarized the US standards for egg grading, which is based on interior quality factors such as conditions of white and yolk, size of the air cell, and exterior quality factors such as cleanness of the shell, soundness of the shell (USDA,

2000). Although not listed, egg weight was another important factor when determining the final grade of an egg.

1.2.3.3 Egg packaging and storage

Advanced machinery has shortened the time of egg packaging significantly. After grading, eggs can be conveyed to automated packaging machine, where graded eggs can be placed into designated cartons accordingly. Once packaged, eggs are transported and stored. Food and Drug Administration (FDA) has regulated that all commercially washed eggs have to be stored in environment of maximum ambient temperature at 7.2 °C (FDA,

2009). Contrary to US regulations, EU commission regulations not only restrict commercial eggs from being washed, they also specify that commercial eggs should be store at constant temperature and should not be refrigerated before sale (EC, 2008).

1.2.3.4 Further processing of eggs (pasteurization)

As egg demands increases, value-added egg processing such as pasteurization has gained popularity over the past few decades. By definition, pasteurized eggs are eggs that have been treated to achieve a minimum of 5 logs Salmonella reduction within the shell

(Perry et al., 2011). Currently the pasteurized shell eggs are commercialized by National

Pasteurized Eggs, Inc. (http://www.safeeggs.com/). The company pasteurizes eggs by submerging them into two warm water baths (54.4 °C - 60 °C) for about 5 hours and transferring them into a cold water bath (7.2°C) (Zeidler, 2002). Pasteurized eggs are 21

coated with food-grade wax for storage protection. An alternative pasteurization method with the use of ozone and heat can significantly reduce heating time without compromising process lethality. Eggs only need to be heated at 57 °C for 40 mins, then followed by vacuum (50.8 kPa) and gaseous ozone treatment (ozone concentration at

160g/m3) under pressure (187.5 kPa). Using this process, reduction of Salmonella

Enteritidis population by (5-log) can be achieved (Perry & Yousef, 2013). Other non- thermal treatments such as electrolyzed water, irradiation, microwave, ultraviolet light, pulsed light, gas plasma, and ultra sounds have also been investigated and explored

(Galis et al., 2013).

Pasteurized eggs are particularly popular when used in hospital and nursing home, since children, elders, pregnant women, or immune compromised population can benefit greatly from such product. In addition, since avian influenza virus shared similar D-value with Salmonella (Thomas & Swayne, 2007), egg pasteurization process can effectively eliminate the threat from bird flu as well. As a result, pasteurized eggs can be expected to be more popular in Asian markets. However, compare to commercial washed eggs, shell of pasteurized eggs can be more brittle due to the extra processing; hence development of novel coating materials can assist such product and benefit the industry and consumers.

1.3 Edible coating

1.3.1 Introduction

Edible coatings are novel packaging materials that consisted of natural and biodegradable substances, thus they can contribute to both food and environment protections (Debeaufort, Quezada-Gallo, & Voilley, 1998). By definition, edible coating 22

(EC) is different from edible film (EF), due to their application procedures. EC is a thin layer of edible material that is usually applied on food by immersion or spraying in a form of liquid (Falguera, Quintero, Jiménez, Muñoz, & Ibarz, 2011). EF, on the other hand, is applied on food by wrapping after a solid sheet of edible material is formed

(McHugh, 2000). EC can be made of different materices such as carbohydrate, protein, lipid, organic compounds, or multicomponent mixture (Vieira, Da Silva, Dos Santos, &

Beppu, 2011). Similar to synthetic packaging, varieties of edible packaging materials exist to fulfill different functional demands from food industry. EC formulations can be modified to extend shelf life via protection from mechanical, physical, chemical, and microbiological damage to the product. They can also contribute in food sensory enhancement, such as improvement of texture (flexibility, tension), appearance (color, brightness, and opacity), and aroma (smell, flavor). With correct choice of materials, EC can possess excellent barrier properties against water vapor pressure, oxygen, or carbon dioxide (Caner, 2005). Many EC materials tend to become brittle and fragile upon drying, and its formulation development are still difficult and empirical; as a result, industrial applications are limited (Caner, 2005). Fundamental researches is necessary to present and unveil the potentials of edible packaging; over the years, a number of works in regards to choice of materials, regulations, antimicrobial enhancements, and potential applications have been studied. A few of the results were concluded and presented in this literature review.

1.3.2 Types of edible coating

Edible coatings are formulated with edible packaging materials that includes wax, carbohydrate, triglycerides or fatty acid, protein, natural fossil resins, etc (Campos, 23

Gerschenson, & Flores, 2011). Wax is one of the coating material that has the longest history of actual application as edible film (Guilbert 1986). Candelilla wax, and new blends of candelilla wax with mesquite gum can be used in fruit preservation due to its low water vapor permeability (Bosquez-Molina, Guerrero-Legarreta, & Vernon-Carter,

2003). Carbohydrate-based edible packaging materials had a long history of human consumption as well (Kester and Fennema, 1986). Hydroxypropyl methyl cellulose

(HPMC) coating is often used in lightly processed agricultural product (Baldwin,

Nisperos-Carriedo, & Baker, 1995), while chitosan is another polysaccharide edible coating that can be used on fruits (Han, Lederer, McDaniel & Zhao, 2005). Due to its hydrophobicity, coconut oil, refined fish oil, soybean oil, sunflower oil, and others can all be used as edible coatings (Vieira et al., 2011). When applied in combination with other water soluble edible coating to form bilayer or multi-layer coatings, mixture of packaging advantages can be achieved while water vapor permeability can be suppressed (Kamper

& Fennema, 1984). Protein based edible coating is gaining popularity since it could provide better mechanical strength while maintaining excellent gas and volatile barrier properties (Seydim & Sarikus, 2006). Milk proteins, especially whey protein isolates have been researched extensively for its potential application on confectioneries

(Debeaufort et al., 1998). However, protein based edible coatings tend to have poor water vapor permeability, and is usually required to be used with other packaging materials to achieve the ideal packaging condition (Chen, 1995). On the other hand, edible packaging materials derived from natural fossil resins tend to be good water vapor and gas barrier, and provide mechanically strong structure for protected product (Bourtoom, 2008).

24

Shellac is a good representative from this group; its broad spectrum of applications covers both food and pharmaceutical coating.

1.3.3 Related regulations

Coating can be in direct contact with the food product or can be part of the packaging without directly touching the food base. Should edible packaging be considered as food additive, or an actual part of the food, is a question still under debate.

Despite the dispute, several compounds had a long history of safe use as coating materials. For example, shellac has been used to coat fruits, vegetables, confections, and even medicines as capsule since the 20th century (Hagenmaier & Shaw, 1991). Till now, more application possibilities such as cut apple and potatoes, have been explored with the use of shellac as edible coating (Baldwin, Nisperos, Chen, & Hagenmaier, 1996).

1.3.4 Edible film antifungal efficacy

One of the advantages of edible coating is its potential in incorporating different antimicrobial agents for protection against spoilage pathogenic microorganisms

(Appendini & Hotchkiss, 2002). The commonly used antimicrobials include: organic acids, chitosan, nisin, plant extracts and essential oils (Campos et al., 2011). Interactions between antimicrobial agents, the packaging materials and the actual food components are important factors to be considered when incorporating a antimicrobial agent into a new edible coating onto a food (Appendini & Hotchkiss, 2002). Table 1.3 lists antimicrobial study results when mixed with different edible packaging materials

(Campos et al., 2011).

25

Table 1.3 Studies of incorporating antimicrobial agents into edible packaging materials.

Food Efficacy Antimicrobial Target Packaging Determination Effects Observed Reference and dosage Microorganism Materials Method Organic Acid Malic, Citric, Whey Protein Listeria Film disk Antimicrobial activity: (Pintado, lactic monocytogenes agar diffusion Malic > citric > lactic Ferreira, & acids (3% w/w) assay Sousa, 2009) Sorbic acid and Whey Protein Listeria Film disk Both L. monocytogenes and E. coli Benzoic acid monocytogenes, agar diffusion O157:H7 were inhibited at all levels (0.5, 0.75, 1.0, 1.5 assay of acids.

26 (Cagri, w/v) Escherichia coli Salmonella typhimurium was only

Ustunol, & O157:H7, inhibited at concentrations above Ryser, 2001) 0.75% w/v Salmonella. typhimurium Chitosan Chitosan (1% w/v) Chitosan Aspergillus niger Inhibition zone Different molds measurement reacted to (Ziani, Alternaria alternata on inoculated agar inhibition effects Fernández- plates differently. Pan, Royo, & Rhizopus oryzae But overall inhibition Mate, 2009) results were observed Chitosan Sweet potato Escherichia coli, Film disk Both E coli and S. aureus were (Shen, Wu, (5, 10, 15% w/w) starch agar diffusion inhibited by chitosan Chen, & Zhao, Staphylococcus assay 2010) aureus Continued

Table 1.3 (continued) Food Efficacy Antimicrobial Target Packaging Determination Effects Observed Reference and dosage Microorganism Materials Method Nisin Nisin Cellulose, Micrococcus luteus Film disk Developed formulation (104 IU/ml) carragenan, and agar diffusion showed antimicrobial (Cha, chitosan assay activity Cooksey, Chinnan, & Park, 2003) Nisin Gelatin or Listeria Plate count from Nisin appeared to be more effecitve (1.2 x 104 IU/ml corn zein monocytogenes inoculated film disk in corn zein film than gelatin film

27 (Campos et

al., 2011)

Nisin Tapioca starch Listeria innocua Plate count from Nisin antimicriobial effectiveness (Sanjurjo, (2000, 3000,5000 inoculated film disk was observed at lowest Flores, IU/ml) concentraion tested Gerschenson, & Jagus, 2006) Plant extracts and Essential oil Thyme, clove, and Chitosan Listeria Film disk Antimicrobial activity: cinnamon monocytogenes, agar diffusion Thyme essential oil > clove > (Hosseini, essential oils (0.5, Staphylococcus assay cinnamon Razavi, & 1.0, 1.5% v/v) aureus, Mousavi, Salmonella 2009) enteritidis

Continued

Table 1.3 (continued)

Food Efficacy Antimicrobial Target Packaging Determination Effects Observed Reference and dosage Microorganism Materials Method Rosemary, Chitosan, Film disk Olive and rosemary oleoresins had oleoresin, olive, Cellulose or Squash natural agar diffusion antimicrobial activity capsicum, garlic, casein isolate microflora assay (Ponce, Roura, onion, and Listeria del Valle, & cranberry monocytogenes Moreira, oleoresins (1% Mesophilic aerobic 2008) w/w) bacteria

Oregano, Whey protein Lactobacillus Film disk Rosemary oil had no antimicrobial 28 rosemary and isolate plantarum agar diffusion effects while oregano oil was most garlic Candelilla wax Salmonella assay effective at essential oils (1, 2, enteritidis 2% level. Garlic oil was effective 3, 4% w/v) Escherichia coli only at 3% and 4% level. (Seydim & O157:H7 Sarikus, 2006) Listeria monocytogenes Staphylococcus aureus

The use of antimicrobials that are generally recognized as safe (GRAS) by FDA is gaining significant popularities over the years (Devlieghere, Vermeiren, & Debevere,

2004). Substances such as natamycin, which has GRAS status and antifungal effects can be further explored.

1.3.5 Advantage and disadvantage of edible coating

There are advantages and disadvantages associate with use of edible packaging materials. Advantages include:

1. The application of edible coating on fruits and vegetables can reduce the post-

harvest lost (Campos et al., 2011).

2. Sensory qualities and slow oil migrations in chocolate can be preserved better in

confections coated with edible coatings (Baker, Baldwin, & Nisperos-Carriedo,

1994).

3. Edible coating application on poultry, meat fish and seafood can also delay the

water lost process during storage, and extend product shelf life (Debeaufort et

al., 1998).

However, several disadvantages of edible packaging are noted:

1. The cost of using edible film.

2. The added cost to the food product.

3. Regulatory issue, since there is no “edible coating” function listed under FDA

GRAS regulation codes.

1.4 Natamycin

1.4.1 Introduction 29

Also known as pimaricin, natamycin is produced by Streptomyces natalensis which was first discovered in a soil sample in 1950s (FDA 1998). In general,

Streptomyces natalensis can be found in the soil from all around the world, and it is considered as a non-pathogenic organism. As a result, natamycin was Generally

Recognized as Safe (GRAS) by FDA since 1982 (FDA, 1998). The chemical structure of natamycin has been listed in Figure 1.8.

Figure 1.8 The chemical structure of natamycin.

The chemical formula of natmycin is C33H47NO13, and its molecular weight is

665.7. As shown in Figure 1.8, natamycin is composed with a pyranose and a lactone ring that formed by 25 carbons (FDA, 1998). When purified and dried, natamycin appeared to be yellow, odorless powder. Natamycin is usually used in form of liquid suspension, yet its solubility varied in different solvents. Almost completely insoluble in 30

water (at most 40 ppm), natamycin is soluble in glacial acetic acid and can dissolve up to 1000 ppm in methanol (Stark, 2003). The antifungal activity of natamycin can be reduce under the influence of light or acidic environment (Brik, 1976). However, when stored under 20 °C in dark of environment pH between 6.5 and 7.5, natamycin can last almost three years without losing its antifungal capacity (Brik 1994). It has been known for a long time that natamycin inhibits fungi growth by interfering with ergosterol presented in fungi membranes. Recent study further indicated that natamycin binding with ergosterol can prevent essential amino acids and glucose from entering fungi cells

(Te Welscher, 2012), yet its exact mechanism of action is still under investigation.

Natamycin is effective against a long list of molds and yeasts at low concentration (MIC at 10 ppm) (Dekker, 2012), moreover, it does not compromise the sensory attributes of treated food products due to its odorless nature (Dekker, 2012).

1.4.2 Natamycin application history and regulation

Natamycin has a long history of safe use both internationally and domestically in many foods, particularly in dairy products, as an antifungal agent. Compare to other preservatives, natamycin has been proven to be more effective against molds. Klis

(1959) has indicated that natamycin possessed 50-100 times more antifungal activity compared to sorbic acid when used in cheese. Shahani (1973) reported that natamycin can prevent mycotoxin formation at concentration below minimum inhibitory concentration, but such effect cannot be observed with other preservatives such as sorbic acid, benzoic acid and propionic acids. Since its discovery in 1950s, natamycin was quickly used on cheese surface to prevent undesired mold growth. In 1960s, natamycin became the most recognized food additive to be used for cheese surface treatment 31

worldwide (Brik, 1994). In many cases, surface treatment does not mean natamycin is consumed with the product, but the approval of natamycin application in shredded and grated cheese from US and Canada in 1982 proves that natamycin can be safely consume with food (FDA, 1998). Other than cheese, use of natamycin can also be observed in yogurt and sausage. According to FDA regulations, the maximum level of natamycin cannot exceed 20 ppm in the final product when used as a surface treatment.

The regulated dosage is well accepted internationally as well; for example, Canada also regulated natamycin dosage at 20 ppm, while both China and South Africa regulated natamycin at a lower dosage of 10 ppm (FDA, 2014).

1.4.3 Natamycin toxicity

Fu and others have pointed out that natamycin is not absorbed and distributed well enough from animal or human guts, therefore, systemic toxicity is not likely to be developed via digestive tract (Fu et al., 2013). When acute oral toxicity of natamycin was examined with rats and rabbits, it showed low order of acute toxicity in both animals. (Levinskas, Ribelin, & Shaffer, 1966). Sub-chronic and chronic toxicity of natamycin were also studied on rats and dogs. At low dosage such as 50 -70 mg/kg body weight per day, natamycin had no effect on body weight, body growth, nor clinical disease developed in animal tissues (Levinskas et al., 1966). Even though slight growth retardation and body weight loss were observed at much higher natamycin oral administration level (above 250 ppm body weight per day), such dosage is unlikely to be consumed by human (Levinskas et al., 1966). Natamycin was not considered as a carcinogen via the carcinogenicity studies on rats as well. Both male and female rats were subjected to natamycin treatment at different concentration for 2 years, yet the 32

animals remained in good health with survival ability unaffected (Levinskas et al.,

1966). Most of the toxicity tests were executed with animal study, yet observations in humans after oral natamycin treatment agreed with animal study results. Although symptoms such as nausea, vomiting, and diarrhea occurred at individuals received 600-

1000 mg/kg body weight per day level, no signs of systemic mycoses were observed for individuals who took less than 600 mg/kg body weight per day natamycin (Newcomer et al., 1960). Over all, natamycin toxicity was minor at current regulation dosage.

1.4.4 Natamycin application in edible films

Natamycin can be incorporated in many edible films to serve as antifungal packaging in order to extend product shelf life. Although natamycin is effective against most mold contaminants that could result in food spoilage, direct application of natamycin on food surface via spraying, dipping or coating without proper matrix will cause natamycin quickly lose its antifungal activity due to the partial denaturation of active compound and rapid absorption within the protected food (Ouattara, Simard,

Piett, Bégin, & Holley, 2000). On the other hand, many edible films have excellent barrier properties and better environmental perceptions, yet most importantly, these novel materials possess the potential of being the carriers for many antimicrobial substances (Campos et al., 2011). As a result, natamycin and edible film incorporation have been widely explored and researched.

According to several studies, natamycin remained effective against fungi at a constant released rate when used in different types of edible films. For example, when natamycin was mixed with whey protein isolates (WPI) based film, the developed formulation had inhibitory effect against Penicillium commune and Penicillium 33

chrysogenum (Pintado, Ferreira, & Sousa, 2010). Natamycin was tested in alginate/pectin based films, which was proved to possess good compatibility and low diffusion coefficient (slow release rate) of natamycin (Bierhalz, Da Silva, &

Kieckbusch, 2012). Previous examples were data generated from agar plates, and no food system was used for actual application study, yet studies with real food also revealed similar results. Fajardo used chitosan based edible film as a carrier for natamycin on cheese samples. Although the overall cheese shelf-life was reduced due to insufficient gas barrier properties, yet natamycin was proven to be effective when used against Aspergillus niger, and such effect lasted till the end of product shelf life (Fajardo et al., 2010).

1.5 Modeling

1.5.1 Comparison of microorganism growth curve

Food spoilage happens when population of contaminating microorganism increase over time (Wang, Larese-Casanova, and Webster, 2015). When plotting the microorganism population versus time, a typical trend is observed. Such trend line can be referred as microorganism growth curve. (Wijtzes et al., 1995). Overall, factors such as nutrient, water activity, oxygen, pH, and time are the factors that can impact microorganism growth (Theys et al., 2008)).

When nutrients are the limiting factor to microorganism growth, population propagation follows two assumptions: (1) initially, nutrient availability had no or limited influence on maximum population because the population size is so small compared to the amount of nutrients in the surrounding, (at this stage, growth rate tend to increase 34

and reach a maximum value), (2) After population reached certain size, nutrient availability has impact on maximum population because the population size increases to the maximum supporting capacity of the amount of nutrients in the surrounding (at this stage, growth rate tend to decrease until it reaches zero, and population size increase and remain at a constant level) (Sinigaglia, Corbo, & Bevilacqua, 2012). Under such assumptions, growth curve can be estimated as a sigmoidal trend line over time, which can be modeled by several mathematical functions.

Sigmoidal growth curve can be divided into three phases: lag phase, exponential phase, and stationary phase (Swinnen et al., 2004). Lag phase is the stage during which microorganisms are adapting to the new environment without propagation. Exponential phase represents the stage that the microorganisms are multiplying, and stationary phase describes the stage that the microorganism population remains at a relatively constant level (Swinnen et al, 2004). When population is expressed as a function of time by using a mathematical model, kinetic parameters, such as lag time, specific growth rate, and maximum growth population can be estimated and used to quantify the conditions in those three phases (Dalgaard & Koutsoumanis, 2001).

Based on the concepts described earlier, comparison of the growth curves can be done in two steps. The first step is to choose a mathematical model to fit the experimental data of microbial growth and defined the lag phase, exponential phase, and stationary phase with kinetic parameters. The models used in this step are “empirical models” (Sinigaglia, Corbo, & Bevilacqua, 2012). Figure 1.9 shows an example of the three phases of a hypothetical growth curve.

35

Figure 1.9 Example of lag phase, exponential phase, and stationary phase on a hypothetical growth curve. Lag phase: from point (a) to point (b); exponential phase: from point (b) to point (c); stationary phase: from point (c) on.

Once model constants are assigned, the estimated kinetic parameters can be incorporated or derived from second set of functions, which can relate kinetic parameters to actual biological variables. These set of functions are referred to as

“phenomenological models” (Sinigaglia, Corbo, & Bevilacqua, 2012).

36

Table 1.4 Terminology used in mathematical modeling of microbial growth (Sinigaglia, Corbo, & Bevilacqua, 2012).

Models Description Ad hoc mathematical expressions employed to fit a set or sets of experimental data and used for interpolation. No physical Empirical meaning is assigned to their parameters.

These models are constructed for the sole purpose of studying the evolution of microbial systems quantitatively and are used to Phenomenological investigate general trends and patterns.

Derived from a set of assumptions anchored in basic principles Fundamental and fundamentals of the described phenomenon.

The basis of this model is that we do not really know what actually happens at the cellular level, but we can monitor the Probabilistic overall manifestation of the process at the population level, thus reporting the results as probability.

Population These models are based on rate or balance equations constrained dynamic by preservation laws.

The derived kinetic parameters can be compared with statistical analysis, as a result, growth curve differences can be revealed and discussed (Dalgaard &

Koutsoumanis, 2001). Such growth curve comparison method is comprehensive. When evaluating the effectiveness of an inhibitory substance, modeling comparison method can provide hints about inhibition mechanism of the substances as well. For example,

Dalgaard and Koutsoumanis (2001) compared the maximum specific growth rate and lag times from 176 growth curves data using Richard, Gompertz, and logistic models to evaluate the impacts of growth conditions on microorganisms.

1.5.2 Mathematical modeling of microbial growth

37

There are varies mathematical models that can be used to describe microbial growth curve (López et al., 2004). Polynomial regression analysis was widely used to generate models that can fit experimental data. Even though the continuous and smooth nature of polynomial curves can mimic the growth trending well, yet each polynomial regression is unique to one set of data. Lack of universality is one of the major weakness of this modeling approach (Davey, 1989). Another popular way of modeling microbial growth is the use of sigmoidal functions. Mathematical functions such as logistic function, Gompertz function, Richards function, Schnute functions, and Weibull functions can all generate a sigmoidal curve to mimic the microbial growth (López et al.,

2004). Results from statistical evaluation of models for microbial growth indicated that

Richards and Weibull models seemed to generate sigmoidal curves that can best fit experimental data (López et al., 2004). However, the kinetic parameters from these models were generated from a pure empirical approach, the kinetic parameters from the mathematical functions have to contain biological meanings in order to describe growth curve (Zwietering et al, 1990). Based on the definition of each phase, biological kinetic parameters can be derived from the parameters of the mathematical functions, and substituting them in the formula (Zwietering et al, 1990). Table 1.5 has listed several examples:

38

Table 1.5 Examples of sigmoidal models and their related modified forms.

When using the modified equations from Table 1.5 to fit experimental data, modified function from logistic model and Gompertz model appeared to fir the growth data better compare to other modified function (Zwietering et al, 1990). Therefore, the use of logistic or Gompertz model should be sufficient to describe growth data.

Another factor for model choice relates to the number of parameters a model can associate with. Based on the concept of different models, different number of kinetic parameters is used to define the sigmoidal curve; Table 1.5 has summarized the number of kinetic parameters that different models can obtain.

39

Table 1.6 Selection of models based on the number of kinetic parameters (Zwietering et al., 1990).

Number of Models kinetic parameters Gompertz 3 Richards 4 Logistic 3 Linear 2 Quadratic 2 Rth power 2 Exponential 3

As a result, Gompertz and Logistic functions remain as popular choices when comparing microbial growth curve via modeling (Zwietering et al., 1990)

40

1.6 Reference

Appendini, P., & Hotchkiss, J. H. (2002). Review of antimicrobial food packaging.

Innovative Food Science and Emerging Technologies, 3(2), 113–126.

doi:10.1016/S1466-8564(02)00012-7

Baker, R. A., Baldwin, E. A., & Nisperos-Carriedo, M. O. (1994). Edible coatings and

films for processed foods. In J.M. Krochta, E. A. Baldwin, & M. O. Nisperos-

Carriedo (Eds). Edible coatings and films to improve food quality. Lancaster,

PA. Technomic Publ.

Baldwin, E. A, Nisperos-Carriedo, M. O., & Baker, R. A. (1995). Use of edible coatings

to preserve quality of lightly (and slightly) processed products. Critical Reviews

in Food Science and Nutrition, 35(6), 509–524.

doi:10.1080/10408399509527713

Baldwin, E. A., Nisperos, M. O., Chen, X., & Hagenmaier, R. D. (1996). Improving

storage life of cut apple and potato with edible coating. Postharvest Biology and

Technology, 9(2), 151–163. doi:10.1016/S0925-5214(96)00044-0

Bell, D. D., Weaver, W. D., & North, M. O. (2002). Commercial chicken meat and egg

production (5th ed). Norwell, MA: Kluwer Academic.

Belyavin, C.G., Boorman, K.N.(1980. The influence of the cuticle on egg-shell strength.

British Poultry Science, 21, 295–298.

Bierhalz, A. C. K., Da Silva, M. A., & Kieckbusch, T. G. (2012). Natamycin release

from alginate/pectin films for food packaging applications. Journal of Food

Engineering, 110(1), 18–25. doi:10.1016/j.jfoodeng.2011.12.016

Binz, P. A., & Kägi, J. H.R. (1999). Metallothionein: molecular evolution and 41

classification. In C. D. Klaassen (Ed.), Metallothionein IV (pp. 7-13). Basel:

Birkhä user Verlag.

Blunden, G., Roch, O. G., Rogers, D. J., Coker, R. D., Bradburn, N., & John, A. E.

(1991). Mycotoxins in food. Medical laboratory sciences, 48(4), 271–282.

Board, R.G., & Hall, N.A. (1973). The cuticle: a barrier to liquid and particle penetration

of the shell of the hen’s egg. British Poultry Science 14 (1): 69-

97.doi:10.1080/00071667308415999

Bosquez-Molina, E., Guerrero-Legarreta, I., & Vernon-Carter, E. J. (2003). Moisture

barrier properties and morphology of mesquite gum-candelilla wax based edible

emulsion coatings. Food Research International, 36(9-10), 885–893.

doi:10.1016/S0963-9969(03)00097-8

Bourtoom, T. (2008). Edible films and coatings : characteristics and properties.

International Food Research Journal, 15(3), 237–248.

Bovee, E. C., & Jahn, T. L. (1966). Mechanisms or Movement in Taxonomy or

Sarcodina . III . Orders , Suborders , Families , ana Subramilies in tne Superorder

Lobida. Systematic Biology, 15(3), 229–240.

Brik, H. (1976). New high-molecular decomposition products of natamycin (pimaricin)

with intact lactone-ring. The Journal of antibiotics, 29(6), 632-637.

http://doi.org/10/7164/antibiotics.29.632

Brik, H. (1994) Natamycin. Analytical Profiles of Drug Substances, 10, 513-561. doi:

10.1016/S0099-5428(08)60650-4

Burley, R.W., & Vadehra, D.V. (1989) The Avian Egg: Chemistry and Biology. New

York: Wiley. 42

Cagri, A., Ustunol, Z., & Ryser, E. T. (2001). Antimicrobial, Mechanical, and Moisture

Barrier Properties of Low pH Whey Protein‐based Edible Films Containing p‐

Aminobenzoic or Sorbic Acids. Journal of Food Science, 66(6), 865-870.

doi:10.1111/j.1365-2621.2001.tb15188.x

Campos, C. A., Gerschenson, L. N., & Flores, S. K. (2011). Development of Edible

Films and Coatings with Antimicrobial Activity. Food and Bioprocess

Technology, 4(6), 849–875. doi:10.1007/s11947-010-0434-1

Caner, C. (2005). The effect of edible eggshell coatings on egg quality and consumer

perception. Journal of the Science of Food and Agriculture, 85(11), 1897–1902.

doi:10.1002/jsfa.2185

Carmichael, J.W. (1955). Lacto-fuchsin: a new medium for mounting fungi. Mycologia

47(4), 611.

Cha, D. S., Cooksey, K., Chinnan, M. S., & Park, H. J. (2003). Release of nisin from

various heat-pressed and cast films. LWT - Food Science and Technology, 36(2),

209–213. doi:10.1016/S0023-6438(02)00209-8

Chang, C. F., & Hamilton, P. B. (1982). Increased severity and new symptoms of

infectious bursal disease during aflatoxicosis in broiler chickens. Poultry

Science, 61(6), 1061–1068. doi: 10.3382/ps.0611061

Chen, H. (1995). Functional properties and applications of edible films made of milk

proteins. Journal of Dairy Science, 78(11), 2563–2583. doi:10.3168/jds.S0022-

0302(95)76885-0

Cotterill, O.J., & Geiger, G.S. (1977) Egg product yield trends from shell eggs. Poultry

Sciences 56(3): 1027–1031. doi: 10.3382/ps.0561027 43

Dalgaard, P., & Koutsoumanis, K. (2001). Comparison of maximum specific growth

rates and lag times estimated from absorbance and viable count data by different

mathematical models. Journal of Microbiological Methods, 43(3), 183-196.

doi:10.1016/S0167-7012(00)00219-0

Davey, K. R. (1989). A predictive model for combined temperature and water activity

on microbial growth during the growth phase. Journal of Applied Bacteriology,

67(5),483-488. doi:10.1111/j.1365-2672.1989.tb02519.x

Debeaufort, F., Quezada-Gallo, J.A., & Voilley, A. (1998). Edible Films and Coatings:

Tomorrow’s Packagings: A Review. Critical Reviews in Food Science and

Nutrition, 38(4), 299–313. doi:10.1080/10408699891274219

Dekker A. (2012), Effect of sorbate and Natamycin on US yogurt starter cultures and

yeast inhibition. Unpublished internal DFS study (#00058521).

Devlieghere, F., Vermeiren, L., & Debevere, J. (2004). New preservation technologies:

Possibilities and limitations. International Dairy Journal, 14(4), 273–285.

doi:10.1016/j.idairyj.2003.07.002

Donald, W. W., & Mirocha, C. J. (1977). Chitin as a measure of fungal growth in soured

corn and soybean seed. Cereal Chemistry, 54(3), 466-474.

Easter, M. (2003). Hygiene monitoring in support of food safety–a review of methods

and industry trends. Acedido em Janeiro, 12, 2008.

Edward, D. G., & Freundt, E. A. (1956). The classification and nomenclature of

organisms of the pleuropneumonia group. Journal of General Microbiology, 14,

197–207.

European Commission (EC). (2008). Commission Regulation (EC) No 589/2008 of 23 44

June 2008 laying down detailed rules for implementing Council Regulation (EC)

No 1237/2007 as regards marketing standards for eggs. Official Journal of the

European Union L163/6:6.

Fajardo, P., Martins, J. T., Fuciños, C., Pastrana, L., Teixeira, J. A., & Vicente, A. A.

(2010). Evaluation of a chitosan-based edible film as carrier of natamycin to

improve the storability of Saloio cheese. Journal of Food Engineering, 101(4),

349–356. doi:10.1016/j.jfoodeng.2010.06.029

Falguera, V., Quintero, J. P., Jiménez, A., Muñoz, J. A., & Ibarz, A. (2011). Edible films

and coatings: Structures, active functions and trends in their use. Trends in Food

Science and Technology, 22(6), 292–303. doi:10.1016/j.tifs.2011.02.004

Food and Drug Administration (1998) Food additives permitted for direct addition to

food for human consumption: Natamycin (pimaricin), Final rule, Fed. Reg., Vol

63, No 230, 66015

Food and Drug Administration (2014) GRAS Notification for the Use of Natamycin in

Yogurt.

Frisvad, J. C., Frank, J. M., Houbraken, J. A. M. P., Kuijpers, A. F., & Samson, R. A.

(2004). New ochratoxin A producing species of Aspergillus section

Circumdati. Studies in Mycology, 50(1), 23-43.

Fu, C., Liu, T., Li, L., Liu, H., Chen, D., & Tang, F. (2013). The absorption, distribution,

excretion and toxicity of mesoporous silica nanoparticles in mice following

different exposure routes. Biomaterials, 34(10), 2565–2575.

doi:10.1016/j.biomaterials.2012.12.043

Galagan, J. E., Henn, M. R., Ma, L. J., Cuomo, C. A., & Birren, B. (2005). Genomics of 45

the fungal kingdom: Insights into eukaryotic biology. Genome Research, 15(12),

1620–1631. doi:10.1101/gr.3767105

Galiş, A. M., Marcq, C., Marlier, D., Portetelle, D., Van, I., Beckers, Y., & Théwis, A.

(2013). Control of Salmonella contamination of shell eggs—Preharvest and

postharvest methods: A review. Comprehensive Reviews in Food Science and

Food Safety, 12(2), 155-182.doi:10.1111/1541-4337.12007

Gardner, J. W., & Bartlett, P. N. (1994). A brief history of electronic noses. Sensors and

Actuators B: Chemical, 18(1), 210-211. doi:10.1016/0925-4005(94)87085-3

Gerloff, G. C., Fitzgerald, G. P., & Skoog, F. (1950). The isolation, purification, and

culture of blue-green algae. American Journal of Botany, 216-218.

Guarro, J., Gené, J., & Stchigel, A. M. (1999). Developments in fungal taxonomy.

Clinical microbiology reviews, 12(3), 454-500.

Guilbert, S., Gontard, N., & Cuq, B. (1995). Technology and applications of edible

protective films. Packaging Technology and Science, 8(6), 339-346.

DOI: 10.1002/pts.2770080607

Hagenmaier, R. D., & Shaw, P. E. (1991). Permeability of Shellac Coatings to Gases

and Water Vapor. Journal of Agricultural and Food Chemistry, 39(5), 825-

829.doi:10.1021/jf00005a001

Han, C., Lederer, C., McDaniel, M., & Zhao, Y. (2005). Sensory evaluation of fresh

strawberries (Fragaria ananassa) coated with chitosan‐based edible

coatings. Journal of Food Science, 70(3), S172-S178. doi: 10.1111/j.1365-

2621.2005.tb07153.x

Hincke, M. T., Nys, Y., Gautron, J., Mann, K., Rodriguez-Navarro, A. B., & McKee, M. 46

D. (January 01, 2012). The eggshell: Structure, composition and

mineralization. Frontiers in Bioscience, 17(4), 1266-1280.

Hocking, A. D. (1990). Responses of fungi to modified atmospheres. In E. Highley, H.

J. Banks, & B. R. Champ, Eds. Fumigation and Controlled Atmosphere Storage

of Grain: Proceedings of an International Conference, Singapore, 14-18

February 1989. (pp 70–82). Canberra: Australian Centre for International

Agricultural Research.

Holzapfel, W. H. (2002). Appropriate starter culture technologies for small-scale

fermentation in developing countries. International Journal of Food

Microbiology, 75(3), 197–212. doi:10.1016/S0168-1605(01)00707-3

Hosseini, M. H., Razavi, S. H., & Mousavi, M. A. (2009). Antimicrobial, physical and

mechanical properties of chitosan-based films incorporated with thyme, clove

and cinnamon essential oils. Journal of Food Processing and Preservation,

33(6), 727–743. doi:10.1111/j.1745-4549.2008.00307.x

Huang, J.C., Yang, J.W., Lai, W. D., Song, M. D., Feng, D., & Lin, J. Y. (2003).

Impedance method for rapid detection of total counts of bacteria and fungi in

bottled purified water. Journal of AOAC International, 86(4), 719-721.

Janisiewicz, W. J., & Roitman, J. (1988). Biological control of blue mold and gray mold

on apple and pear with Pseudomonas cepacia. Phytopathology, 78(12), 1697-

1700.

Jarvis, B., Seiler, D. A. L., Ould, A. J. L., & Williams, A. P. (1983). Observations on the

enumeration of moulds in food and feedingstuffs. Journal of Applied

Bacteriology, 55(2), 325-336. doi: 10.1111/j.1365-2672.1983.tb01329.x 47

Jones, E. B. G., & Moss, S. T. (1978). Ascospore appendages of marine ascomycetes:

An evaluation of appendages as taxonomic criteria. Marine Biology, 49(1), 11–

26. doi:10.1007/BF00390726

Kamper, S. L., & Fennema, O. (1984). Water vapor permeability of edible bilayer films.

Journal of Food Science, 49(6), 1478–1481.doi: 10.1111/j.1365-

2621.1984.tb12825.x

Kester, J.J., & Fennema, O.R. (1986). Edible films and coatings: a review. Food

Technology, 40(12), 47-59.

Klis, J. B., Witter, L. D., & Ordal, Z. J. (1959). The effect of several antifungal

antibiotics on the growth of common food spoilage fungi. Food

Technology, 13(2), 124-128.

Koninklijke Nederlandsche Gist- en Spiritus-Fabriek N.V. (KNG&SF) (1957)

Werkwijze ter bereiding van een antibioticum met behulp van een Streptomyces-

soort. NL Octrooi no 87323

Kurtzman, C. P., & Robnett, C. J. (2003). Phylogenetic relationships among yeasts of

the ‘Saccharomyces complex’determined from multigene sequence

analyses. FEMS yeast research, 3(4), 417-432. DOI:

http://dx.doi.org/10.1016/S1567-1356(03)00012-6

Levinskas, G. J., Ribelin, W. E., & Shaffer, C. B. (1966). Acute and chronic toxicity of

pimaricin. Toxicology and applied pharmacology, 8(1), 97-109.

doi:10.1016/0041-008X(66)90105-0

48

López, S., Prieto, M., Dijkstra, J., Dhanoa, M. S., & France, J. (2004). Statistical

evaluation of mathematical models for microbial growth. International journal of

food microbiology, 96(3), 289-300. doi:10.1016/j.ijfoodmicro.2004.03.026

Manninen, M. T., Fung, D. Y. C., & Hart, R. A. (1990). Spiral system and laser colony

scanner for enumeration of microorganisms. Journal of food safety, 11(3), 177-

187. DOI: 10.1111/j.1745-4565.1990.tb00049.x

Mathlouthi, M. (2001). Water content, water activity, water structure and the stability of

foodstuffs. Food Control, 12(7), 409–417. doi:10.1016/S0956-7135(01)00032-9

McHugh, T. H. (2000). Protein-lipid interactions in edible films and coatings.

Food/Nahrung, 44(3), 148–151. doi:10.1002/1521-

3803(20000501)44:3<148::AID-FOOD148>3.0.CO;2-P

McKee, L. H. (1995). Microbial contamination of spices and herbs: A review. LWT -

Food Science and Technology, 28(1), 1–11. doi:10.1016/S0023-6438(95)80004-

2

Mislivec, P. B., & Bruce, V. R. (1977). Incidence of toxic and other mold species and

genera in soybeans. Journal of Food Protection®, 40(5), 309-312. Avaiblable

from

http://www.ingentaconnect.com/content/iafp/jfp/1977/00000040/00000005/art00

005

Moss, M. O. (2008). Fungi, quality and safety issues in fresh fruits and vegetables.

Journal of Applied Microbiology, 104(5), 1239–1243. doi:10.1111/j.1365-

2672.2007.03705.x

Newcomer, V. D., Sternberg, T. H., Wright, E. T., Reisner, R. M., McNall, E. G., & 49

Sorensen, L. J. (1960). The treatment of systemic mycoses with orally

administered pimaricin: preliminary report. Annals of the New York Academy of

Sciences, 89(1), 240-246. DOI: 10.1111/j.1749-6632.1960.tb20145.x

Newell, S. Y., Arsuffi, T. L., & Fallon, R. D. (1988). Fundamental procedures for

determining ergosterol content of decaying plant material by liquid

chromatography. Applied and Environmental Microbiology, 54(7), 1876–1879.

Retrieved from http://aem.asm.org/content/54/7/1876.short

Notermans, S., Heuvelman, C. J., Van Egmond, H. P., Paulsch, W. E., & Besling, J. R.

(1986). Detection of mold in food by enzyme-linked immunosorbent

assay. Journal of Food Protection®, 49(10), 786-791. Retrieved from

http://www.ingentaconnect.com/content/iafp/jfp/1986/00000049/00000010/art00

004#expand/collapse

Okubo T, Akachi S, Hatta H (1997) Structure of hen eggs and physiology of egg laying.

In: T.Yamamoto, L.R. Juneja, H, Hatta, M. Kim M (Eds). Hen Eggs: Their Basic

and Applied Science. Boca Raton, FL: CRC Press

Ouattara, B., Simard, R. E., Piett, G., Bégin, A, & Holley, R. A. (2000). Inhibition of

surface spoilage bacteria in processed meats by application of antimicrobial films

prepared with chitosan. International Journal of Food Microbiology, 62(1-2),

139–148. doi:10.1016/S0168-1605(00)00407-4

Patel, P. D., & Williams, A. P. (1985). A note on estimation of food spoilage yeasts by

measurement of adenosine triphosphate (ATP) after growth at various

temperatures. Journal of Applied Bacteriology, 59(2), 133-136.

DOI: 10.1111/j.1365-2672.1985.tb03311.x 50

Perry, J. J., Rodriguez-Saona, L. E., & Yousef, A. E. (2011). Quality of Shell Eggs

Pasteurized with Heat or Heat-Ozone Combination during Extended Storage.

Journal of Food Science, 76(7), 437-444. doi:10.1111/j.1750-3841.2011.02294.x

Perry, J. J., & Yousef, A. E. (2013). Factors affecting thermal resistance of Salmonella

enterica serovar enteritidis ODA 99-30581-13 in shell egg contents and use of

heat-ozone combinations for egg pasteurization. Journal of Food Protection,

76(2), 213–219. doi:10.4315/0362-028X.JFP-12-324

Pintado, C. M., Ferreira, M. A., & Sousa, I. (2009). Properties of whey protein–based

films containing organic acids and nisin to control Listeria

monocytogenes. Journal of Food Protection®, 72(9), 1891-1896. Retrieved from

http://www.ingentaconnect.com/content/iafp/jfp/2009/00000072/00000009/art00

012

Pintado, C. M., Ferreira, M. A., & Sousa, I. (2010). Control of pathogenic and spoilage

microorganisms from cheese surface by whey protein films containing malic

acid, nisin and natamycin. Food Control, 21(3), 240-246.

doi:10.1016/j.foodcont.2009.05.017

Pitt, J. I., & Hocking, A. D. (2009). Fungi and food spoilage (Vol. 519). New York:

Springer.

Pitt, J. I., & HOCKING, A. D. (1977). Influence of solute and hydrogen ion

concentration on the water relations of some xerophilic

fungi. Microbiology,101(1), 35-40. doi: 10.1099/00221287-101-1-35

Ponce, A. G., Roura, S. I., del Valle, C. E., & Moreira, M. R. (2008). Antimicrobial and

antioxidant activities of edible coatings enriched with natural plant extracts: In 51

vitro and in vivo studies. Postharvest Biology and Technology, 49(2), 294–300.

doi:10.1016/j.postharvbio.2008.02.013

Powers, E. M., & Berkowitz, D. (1990). Efficacy of an oxygen scavenger to modify the

atmosphere and prevent mold growth on meal, ready-to-eat pouched

bread. Journal of Food Protection®, 53(9), 767-771. Retrieved from

http://www.ingentaconnect.com/content/iafp/jfp/1990/00000053/00000009/art00

009

Richard, J. L. (2007). Some major mycotoxins and their mycotoxicoses-An overview.

International Journal of Food Microbiology, 119(1-2), 3–10.

doi:10.1016/j.ijfoodmicro.2007.07.019

Romanoff, A. L., & Romanoff, A. J. (1949). The avian egg. New York: J. Wiley.

Sanjurjo, K., Flores, S., Gerschenson, L., & Jagus, R. (2006). Study of the performance

of nisin supported in edible films. Food Research International, 39(6), 749–754.

doi:10.1016/j.foodres.2006.01.016

Schmidt, K. A. (2004). Food Processing: Principles and Applications, 1–10.

Scott, W. J. (1957). Water Relations of Food Spoilage Microorganisms. Advances in

Food Research, 7(C), 83–127. doi:10.1016/S0065-2628(08)60247-5

Seydim, A. C., & Sarikus, G. (2006). Antimicrobial activity of whey protein based

edible films incorporated with oregano, rosemary and garlic essential oils. Food

Research International, 39(5), 639–644. doi:10.1016/j.foodres.2006.01.013

Shahani K.M., Bullerman L.B., Barahart H.M. and Hortung T.E. (1973), Effect of an

antifungal, pimaricin, upon the retardation of food spoilage and incidence of

toxins. Proc. 1st International Congress for Bacteriology, 2, 41. 52

Shen, X. L., Wu, J. M., Chen, Y., & Zhao, G. (2010). Antimicrobial and physical

properties of sweet potato starch films incorporated with potassium sorbate or

chitosan. Food Hydrocolloids, 24(4), 285–290.

doi:10.1016/j.foodhyd.2009.10.003

Sinigaglia, M., Corbo, M. R., & Bevilacqua, A. (2012). Modeling microbial growth. In

V. M. Gómez-López (Ed).Decontamination of fresh and minimally processed

produce (pp. 529-539). Oxford, UK: Blackwell.

DOI: 10.1002/9781118229187.ch28

Stadelman, W.J. (1995). Egg production practices. In: Stadelman, W.J., Cotterill, O.J.

(Eds). Egg Science and Technology (4th ed), (pp.9-37). New York: Food

Products Press.

Stark, J. (2003). Natamycin, an effective fungicide for food and beverages in natural

antimicrobials for the minimal processing of foods. In S. Roller (Ed.), Natural

antimicrobials for the minimal processing of foods (pp. 82-97). Cambridge, UK:

Woodhead Publishing.

Swinnen, I. A. M., Bernaerts, K., Dens, E. J., Geeraerd, A. H., & Van Impe, J. F. (2004).

Predictive modelling of the microbial lag phase: a review. International journal

of food microbiology, 94(2), 137-159. doi:10.1016/j.ijfoodmicro.2004.01.006

Theys, T. E., Geeraerd, A. H., Verhulst, A., Poot, K., Van Bree, I., Devlieghere, & Van

Impe, J. F. (2008). Effect of pH, water activity and gel micro-structure, including

oxygen profiles and rheological characterization, on the growth kinetics of

Salmonella Typhimurium. International journal of food microbiology, 128(1),

67-77. doi:10.1016/j.ijfoodmicro.2008.06.031 53

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6:

Molecular evolutionary genetics analysis version 6.0. Molecular Biology and

Evolution, 30(12), 2725–2729. doi:10.1093/molbev/mst197

Taylor, J. W. (1995). Making the Deuteromycota redundant: a practical integration of

mitosporic and meiosporic fungi. Canadian Journal of Botany, 73(S1), 754–759.

doi:10.1139/b95-319

Te Welscher, Y. M., van Leeuwen, M. R., de Kruijff, B., Dijksterhuis, J., & Breukink,

E. (2012). Polyene antibiotic that inhibits membrane transport proteins.

Proceedings of the National Academy of Sciences, 109(28), 11156-11159. doi:

10.1073/pnas.1203375109

Thomas, C., & Swayne, D. E. (2007). Thermal inactivation of H5N1 high pathogenicity

avian influenza virus in naturally infected chicken meat. Journal of Food

Protection®, 70(3), 674-680.

Tognon, G., Campagnoli, A., Pinotti, L., Dell'Orto, V., & Cheli, F. (2005).

Implementation of the electronic nose for the identification of mycotoxins in

durum wheat (Triticum durum). Veterinary research communications, 29, 391-

393.doi: 10.1007/s11259-005-0089-y

United States Department of Agriculture (USDA). (2000). Egg-Grading Manual.

Agricultural Handbook, (75), 12.

USDA. (2016). Egg market news report. Retrieved from

https://www.ams.usda.gov/mnreports/pybshellegg.pdf

Vaclavik, V., & Christian, E. W. (2008). Essentials of food science (3rd ed.). New York,

NY: Springer. 54

Van der Vossen, J. M. B. M., Rahaoui, H. A. K. I. M., De Nijs, M. W. C. M., & Hartog,

B. J. (2003). PCR methods for tracing and detection of yeasts in the food

chain. In T. Boekhout; & V. Roberts (Eds.). Yeasts in food (pp. 123-138).

Hamburg: Behr's Verlag.

Verhulst, P. F. (1838). Notice sur la loi que la population suit dans son accroissement.

Correspondance Mathématique et Physique Publiée par A. Quetelet, 10, 113-

121.

Vieira, M. G. A., Da Silva, M. A., Dos Santos, L. O., & Beppu, M. M. (2011). Natural-

based plasticizers and biopolymer films: A review. European Polymer Journal,

47(3), 254–263. doi:10.1016/j.eurpolymj.2010.12.011

Vilgalys, R., Smith, M., Talbot, J., Branco, S., Smith, D., & Gilbertson, R. L. (2012).

Newsletter of the Mycological Society of America, 63(June), 277–304.

Wang, Q., Larese-Casanova, P., & Webster, T. J. (2015). Inhibition of various gram-

positive and gram- negative bacteria growth on selenium nanoparticle coated

paper towels. International Journal of Nanomedicine, 10, 2885–2894.

http://doi.org/10.2147/IJN.S78466

Wheeler, K. A., Hurdman, B. F., & Pitt, J. I. (1991). Influence of pH on the growth of

some toxigenic species of Aspergillus, Penicillium and Fusarium. International

Journal of Food Microbiology, 12(2), 141–149. doi:10.1016/0168-

1605(91)90063-U

Windhorst, H.W. (2007). Changes in the structure of global egg production. World's

Poultry Science Journal, 23(6), 24–25.Retrieved from

http://www.worldpoultry.net/PageFiles/23639/001_boerderij-download- 55

WP6839D01.pdf

Wijtzes, T., De Wit, J. C., Van't, R., & Zwietering, M. H. (1995). Modelling bacterial

growth of Lactobacillus curvatus as a function of acidity and temperature.

Applied and environmental microbiology, 61(7), 2533-2539. Retrieved from

http://aem.asm.org/content/61/7/2533.short.

Yamamoto, T., Juneja, L.R., Hatta, H., Kim, M. (eds). (1997). Hen Eggs: Their Basic

and Applied Science. Boca Raton, FL: CRC Press.

Zeidler, G. (2002). Further-processing eggs and egg products. In: D. Bell, W. D.

Weaver, & M. O. North (Eds). Commercial Chicken Meat and Egg Production

(5th ed), (pp.1163-1197). Norwell, Mass: Kluwer Academic Publishers.

Ziani, K., Fernández-Pan, I., Royo, M., & Mate, J. I. (2009). Antifungal activity of films

and solutions based on chitosan against typical seed fungi. Food Hydrocolloids,

23(8), 2309–2314. doi:10.1016/j.foodhyd.2009.06.005

Zwietering, M. H., Jongenburger, I., Rombouts, F. M., & Van't Riet, K. (1990).

Modeling of the bacterial growth curve. Applied and environmental

microbiology, 56(6), 1875-1881.

56

Chapter 2 : Isolation and identification of mold contaminants on shell eggs and assessment of natamycin efficacy in shellac coating when treating isolated molds

2.1 Abstract

Stored eggs that have been naturally contaminated by molds were selected for study. Surface mold colonies and debris on egg shell were collected by submerging eggs individually in 100 ml of 0.1% peptone water. Washings were serially diluted and spread- plated on potato dextrose agar (PDA). Isolated mold colonies with distinct morphologies were further purified and identified using Polymerase Chain Reaction (PCR) method with

Inter Transcribed Spacer (ITS) primers. Identification results revealed three predominant mold contaminants on shell eggs: Cladosporium romotenellum, Penicillium commune, and Mucor hiemalis. The mold isolates were tested for sensitivity to natamycin which was incorporated into a shellac solution. Natamycin (1mg per 1 ml methanol) was mixed with shellac solution (1:4 w/w ratio shellac in ethyl alcohol) at the following concentrations: 12.5, 25, 50, 100, 200, 400, and 800 µg natamycin/ml (mixture). Filter- paper testing disks were soaked into different natamycin-shellac mixtures, and prepared disks were used for inhibition zone testing on pre-inoculated PDA plates. After 5 days of incubation on PDA plates, the efficacy of natamycin-shellac coating at different concentrations was indicated by inhibition zone (mm), which is half the difference between inhibition area diameter and testing disk

57

diameter. Sensitivity testing results suggest that natamycin-shellac mixture inhibitsMucor at natamycin concentration as low as 97.7 µg/ml, and the mixture may start to inhibit

Cladosporium and Penicillium at concentrations of 44.9 µg/ml and 51.6 µg/ml respectively. These findings showed that natamycin maintained its antifungal activity when mixed with shellac, and its antifungal activities could be observed at low concentration levels. Considering these results, natamycin application dosage in shellac coating on an egg that weighs 60 grams is 3 mg natamycin/kg egg, which was lower than the maximum FDA-recommended natamycin application dosage for food surface treatment (20 mg/kg).

2.2 Introduction

Production of hen’s eggs is one of the largest, well-regulated food industries in the U.S (USDA, 2000). It was estimated that 223 million eggs were laid every day in

2014 to accommodate both domestic and international demands (USDA, 2016). USDA also projected that the per capita consumption of eggs will increase from 248 eggs in

2009 to 266 eggs in 2016 (USDA 2016). As a result, there are strict guidelines for egg grading and quality monitoring. The growth of mold on the exterior of the shell eggs occasionally happens, and this could compromise the quality of eggs (Romanoff and

Romanoff 1949). According to the U.S standards of quality, moldy eggs, which can be detected by observing (i) mold spots on the shell, (ii) mold growth in checked areas of shell, or (iii) internal mold contamination when viewed under the candling light, are considered “loss eggs” (USDA, 2000). According to eggs exporting data, nearly 1.8% of

58

shell eggs were estimated as “loss eggs”, which resulted in almost 6.35 million cases of exporting eggs in 2015 (USDA 2016).

Compared to other foodborne hazards, mold contamination is often underestimated in the food industry. Fungi contamination could lead to both mycosis, which is caused by the direct exposure to fungi, and mycotoxicosis, which results from consumption of mycotoxins secreted by fungi (Bennett, Klich, & Mycotoxins, 2003).

Common mycoses symptoms include eye irritation, skin irritation, asthma and hypersensitive pneumonitis in cases of kids (WHO, 2011). On the other hand, many mycotoxins can cause acute toxicity, which can yield immediate symptoms, while others cause chronic effects and may cause cancer (Bennett et al., 2003).

Commercial eggs can be stored for 3 to 5 weeks (USDA 2016). During this period, failed temperature control (no refrigeration), or humidity control, can accelerate egg surface moldiness (Gulich & Fitzgarald, 1964). One way to protect the eggs is to strengthen its defense by coating the egg shell. Novel coating materials, such as shellac can retain egg qualities during storage (Caner, 2005). Despite egg quality retention afforded by coatings, it is assumed that coated eggs are still prone to mold contamination during storage (Caner, 2005). However, in the process of shellac preparation, some antifungal agents can be introduced into the mixture to enhance the mold inhibition ability of the resulting coating (Nicholson, 1991).

Natamycin is an excellent choice for antifungal agent that may have potential application on variety of foods since it is Generally Recognized as Safe (GRAS) by Food and Drug Administration (FDA, 2014). As a metabolite of Streptomyces natalensis, it is believed that natamycin can bind ergosterol and inhibit fungi membrane activities (Te 59

Welscher et al., 2008). Its effectiveness in treating molds and yeasts have been studied and proven since 1980s, and its application in dairy products such as cheese and yogurts were well recognized and accepted in 1990s (FDA, 2014). However, effective dosage of natamycin in shellac coating and its potential application to eggs were rarely explored.

The concentration of natamycin used in shellac to be applied on egg surface is ideally limited to the lowest possible amount necessary to accomplish the intended effect.

Natamycin’s minimum inhibitory concentration (MIC) can be determined with direct food application (Fajardo et al., 2010). However, there are practical problems related to determining MIC of natamycin against molds on shell eggs. Estimations of MIC can provide clues about the antifungal activities; hence, it can be used as a first step before further exploration in the actual food matrix (Pedersen, 1992). This investigation is an attempt to identify the mold contaminants on shell eggs surface, and assessing the efficacy of natamycin in shellac when used against the recovered mold contaminants.

2.3 Materials and Methods

2.3.1 Egg selection

Moldy eggs were obtained from isolated container located in a laboratory refrigerator; these eggs were held for long-term storage. Most of the stored eggs had visual mold contamination on the surface. Mold contaminants possessed different pigments, and the predominant ones were black, teal, and brown. Since the pigments could come from either spores or mycelium, further identification was necessary to determine the exact mold contaminants.

60

2.3.2 Mold isolation

Moldy eggs were submerged individually in 100 ml of 0.1% peptone water

(BPW; Difco, Sparks, MD), gently rubbed with the interior of whirl-pak bag (VWR,

Radnor, PA) for one minute until all debris were detached. The surface contaminants were hand homogenized for another one minute while avoiding egg breakage. Serial dilutions of the homogenized suspension were performed and plated onto potato dextrose agar (PDA; Oxoid, Hampshire, England) plates, then plates were incubated at 25ºC for 5 days. Isolated mold colonies on the incubated plates were streaked on fresh PDA plates, and plates were incubated for 5 days at 25 ºC. From prepared mold colonies, mold spores were collected and stored in 0.05% tween 80 (Fisher Scientific, Fair Lawn, NJ) for further inoculation on eggs. Mold mycelia were collected for mold identification using

Polymerase Chain Reaction (PCR) method.

Figure 2.1 Examples of isolated mold colonies from contaminated eggs

2.3.3 Mold identification

Isolated mold colonies (Figure 2.1) were identified using PCR method. The DNA templates of targeted molds were extracted using mechanical/thermal combined method 61

(Yu & Morrison, 2004; Lu, Schmidt & Jensen, 2005). Briefly, mold mycelia were beaten with glass beads followed by thermal lysis at 100 ⁰C. Target mold mycelia were transferred into autoclaved centrifuge tubes that contained 200µl nuclease-free water

(QIAGEN, Hilden, Germany) and 0.5 grams -mm glass beads (VWR, Radnor, PA). Mold cells were physically lysed for 3 minutes using bead beating machine (Biospec, Sarasota,

FL), set at high vibration speed. Centrifuge tubes contents were submerged into boiling water-bath for 15 minutes. The heated mycelia were centrifuged for one minute at 16,168 x g, then 20µl of supernatant were collected as DNA template. The target DNA sequence was amplified by selected primers during the PCR process. As one of the most widely sequenced DNA region in fungi, Internal Transcribed Spacer (ITS) region was the targeted sequence. Therefore, ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS4

(TCCTCCGCTTATTGATATGC) primers were used for mold identification (King,

Preston, & Croft, 2001). PCR reactions were carried out using the conditions described in

Table 2.1 and Table 2.2.

Table 2.1 PCR reaction composition for mold identification.

Component Volume/reaction Final concentration 10 X PCR buffera 5 µl 1 x dNTP mix (10mM each) 2 µl 200 µM of each dNTP ITS1-F 1 µl 0.1-0.5 µM ITS4 1 µl 0.1-0.5 µM Taq DNA Polymerase 0.5 µl 2.5 nits/reaction Nuclease-free Water 40 µl - DNA template 2 µl - Total volume 50 µl a Buffer contains 15 mM MgCl2

62

Table 2.2 PCR reaction thermal cycler conditions for mold identification.

Steps Temp Time Initial Denaturation 94°C 3 mins Denaturation 94°C 1 min Annealing 52°C 1 min Extension 72°C 2 mins Repeat (30) Go back to denaturation step Final Extension 72°C 10 mins Refrigeration 4°C ∞

PCR products were separated by electrophoresis using agarose gel (Fisher

Scientific, Fair Lawn, NJ). A 2-log-ladder (New England Biolabs, Ipswich, MA) was used for reference purpose, and all electrophoresis results were examined under gel- documentation station (ChemDoc XRS: Bio RAD, Hercules, CA). Once PCR results were confirmed, all products were purified using a commercial DNA purification kit

(QIAprep®Spin Miniprep Kit: QIAGEN, Hilden, Germany). The purified product was sequenced at the Plant Microbe Genomic Facility of The Ohio State University (OSU).

Sequencing results were matched with known sequences in DNA database

(http://blast.ncbi.nlm.nih.gov/Blast.cgi), and the mold isolates were identified.

2.3.4 Preparation of coating solution

Ethanol shellac solution (20% w/w ratio) was prepared according to U.S. patent

9.113,640 B2. This was accomplished by dissolving 20 grams of shellac (Mantrose-

63

Haeuser, Westport, CT) in 80 grams of 95% ethanol (Fisher Scientific, Fair Lawn, NJ) on magnetic stirring hot plate. The solution was stirred with mild heat for over 3 hours.

The anti-fungal agent, natamycin (Sigma-Aldrich, Santa Clara, CA) was prepared at 1000 parts per million (ppm) in methanol by dissolving 30 mg of natamycin powder into 30ml of methanol. In order to estimate a suitable concentration for application study, shellac coating with different natamycin concentrations was preapred. By adjusting the ratio between shellac and natamycin solutions, shellac coating with natamycin concentrations at 12.5 µg/ml, 25 µg/ml, 50 µg/ml, 100 µg/ml, 200 µg/ml, 400 µg/ml, and

800 µg/ml were prepared.

2.3.5 MIC study

The antifungal efficacy of natamycin at different concentrations in shellac solution against tested mold was determined by measuring the inhibition zone (mm).

Filter-paper testing disks were dipped individually into shellac coating suspension with different natamycin concentrations. One disk corresponded to one natamycin concentration, and disks coated with shellac without any natamycin served as control.

Disks were prepared in duplicates, and isolated mold spores were spread on PDA plates

(Oxoid, Hampshire, England). Coated disks were aseptically layered at the center of both pre-inoculated and un-inoculated plates. Controls and tested plates were both incubated at

25°C for 5 days. At the end of incubation period, measurements of inhibition area diameters were recorded. Inhibition zone were calculated using Eq. 1:

퐼푛ℎ𝑖푏𝑖푡𝑖표푛 푎푟푒푎 푑𝑖푎푚푒푡푒푟−푇푒푠푡𝑖푛𝑔 푑𝑖푠푐 푑𝑖푎푚푒푡푒푟 퐼푛ℎ𝑖푏𝑖푡𝑖표푛 푧표푛푒 = (1) 2

64

Testing disk diameter was 12 mm; therefore, inhibition zone varied as inhibition area diameter changed. Theoretical MIC values of natamycin were estimated by analyzing the correlation between natamycin concentration and its inhibition zone. Experiment was performed in triplicates, and executed with all mold isolates.

2.3.6 Testing natamycin-containing shellac on shell eggs

Shellac coating solutions with different concentrations of natamycin were prepared (100 µg/ml, 200 µg/ml, and 400 µg/ml), then eggs were coated with the solutions by spraying. When they were successfully coated, all eggs were inoculated with the mixture of mold spores. Prepared eggs were held separately in different retail cartons and incubated for up to 7 days at 25°C. Inhibition of mold growth was observed based on the visual examination of mold growth after 7 days of incubation. Application MIC was recorded as the lowest concentration that resulted in no visible growth of fungi after 7 days of incubation.

2.3.7 Data analysis

Linear regression of natamycin concentrations vs. inhibition zone was performed using SAS® version 9.4.1 (SAS institute, INC., Cary, NC).

2.4 Results

2.4.1 Identification of mold contaminants

Three predominant species of mold were recovered from contaminated egg sources. Two of the molds were isolated from the surface of contaminated eggs, while the third was isolated from the fecal matters attached to the egg surface. The BLAST® 65

results revealed that the three mold isolates were: Cladosporium ramatenellum (99% identical), Penicillium commune (99% identical), and Mucor hiemalis (99% identical).

2.4.2 Minimum inhibition concentration for natamycin in shellac solution

MIC tests on the three mold species indicated that the inhibition efficacy of natamycin was proportional to the natamycin concentration in the coating material

(Figures 2.3, 2.4, and 2.5). Experimental results revealed that natamycin could generate zones of inhibition on studied mold when applied in solidified shellac coating. In addition, the higher natamycin concentration was used in shellac coating, the larger inhibition zone was observed.

Figure 2.2: Inhibition zone of natamycin-coated disks on Penicillium inoculated on PDA plates. Natamycin concentration were: (from left to right): 400, 200, 100, and 50 µg/ml.

The relationship between natamycin concentration (12.5 to 800 µg/ml) and its inhibitory effect was linear for all three mold species (Figures 2.3, 2.4, and 2.5). The minimum inhibitory concentration for these mold isolates could be estimated by

66

determining the x-axis intercept that corresponds to zero inhibition zone. The estimated

MIC for: Mucor, Cladosporium, and Penicillium were different (Table 2.3).

8

7

6

5

4

3 y = 2.2333x - 14.771 R² = 0.9987

2 Inhibition zone (mm) zone Inhibition 1

0 6 6.5 7 7.5 8 8.5 9 9.5 10 Log Natamycin Concentration (μg/ml) 2

Figure 2.3: Inhibition zones (mm) at different natamycin concentrations (μg/ml) in shellac-coated disks against Mucor hiemalis on PDA plates.

The coefficients of correlation, R2, from Figure 2.3 supported the linear relationship between natamycin concentration and resulting zone of inhibition. Similar linear relationship between inhibition zones of Cladosporium or Penicillium and natamycin concentration was observed (Figures 2.4 and 2.5, respectively).

67

18 16 14 12 10

8 y = 4.65x - 25.511 6 R² = 0.9962

Inhibition zone(mm) Inhibition 4 2 0 5 5.5 6 6.5 7 7.5 8 8.5 9 Log2 Natamycin Concentration (μg/ml)

Figure 2.4: Inhibition zones (mm) at different natamycin concentrations (μg/ml) in shellac-coated dsiks against Cladosporium ramotenellum on PDA plates.

68

9 8 7 6 5

4 y = 2.61x - 14.862 3 R² = 0.9866

Inhibition zone (mm) zone Inhibition 2 1 0 5 5.5 6 6.5 7 7.5 8 8.5 9 Log2 Natamycin Concentration (μg/ml)

Figure 2.5 Inhibition zones (mm) at different natamycin concentrations (μg/ml) in shellac-coated disks against Penicillium commune on PDA plates.

These results are summarized in Table 2.3. When natamycin was used in shellac coating to treat Mucor, Cladosporium, and Penicillium, natamycin the threshold for effectiveness is predicted to be 97.7, 44.9, and 51.6 µg/ml respectively.

Table 2.3 Estimated natamycin MIC in shellac coating for mold inhibition.

Molds X-intercept value Estimated MICa Mucor hiemalis 6.61 97.7 µg/ml Cladosporium ramotenellum 5.49 44.9 µg/ml Penicillium commune 5.69 51.6 µg/ml

69

2.4.3 Minimum inhibitory concentration of natamycin on shell eggs

The natamycin minimum inhibitory concentrations in shellac coating, when applied on shell eggs, were observed after incubation at 25-°C for 7 days. Natamycin at

400 µg/ml was chosen as the practical MIC for egg application experiments since this was the concentration that inhibited all mold contaminants.

Figure 2.6 Examples of mold contaminations on shellac-coated eggs that contained different concentrations of natamycin. Natamycin concentrations (from left to right): 100, 200, and 400 µg/ml).

Figure 2.6 shows mold contaminations can still be observed on eggs that were coated with shellac containing 100 and 200 µg/ml natamycin; however, limited mold contaminations were observed on shell eggs receiving 400 µg/ml natamycin.

2.5 Discussion

Mold contamination can occur throughout the entire egg supply chain (Gulich &

Fitzgarald, 1964). The risk of contamination increases when storage conditions such as

70

temperature and relative humidity are not optimal, airborne spores in production or storage environment are abundant, dirty washing water are used, and presence of debris on egg shell (Romanoff & Romanoff, 1949). During prolonged storage, airborne mold spores and fecal remains are the two major factors that can potentially cause mold contaminations (Australian Egg Corporation Limited, 2009). These observations may be supported by the results of this study. The three mold contaminants isolated from egg surface were confirmed to be Mucor hiemalis, Cladosporium ramotenellum, and

Penicillium commune. Cladosporium and Penicillium are the most commonly airborne mold genera (Rao et al., 2007), and Mucor is often described as “dung fungus” (Santiago,

Cavalcanti, & Trufem, 2008).

Cladosporium ramotenellum, and Penicillium commune are more similar morphologically and genetically when compared to Mucor hiemalis. Comparisons between microscopic structures such as hyphae (septate vs. non-septate), conidiophore

(shape of asexual reproduction structure), and conidia (spores shape), show that both

Cladosporium and Penicillium belong to the division of Ascomycota while Mucor belongs to the division of Zygomycota (Lumbsch & Huhndorf, 2007). Since DNA analysis has been incorporated into taxonomy, phylogenetic studies are used to provide more information about species similarities from the genetic prospective (Inglis &

Tigano, 2006). According to Figure 2.7, the evolutionary history was inferred by using the maximum likelihood method based on the Tamura-Nei model, the tree with the highest log likelihood is shown (Tamura et al., 2013). Each highlighted jointed point represented a potential “common ancestor” shared by the related branch (Tamura et al.,

2013). Evolutionary analyses were conducted in Molecular Evolutionary Genetics 71

Analysis (MEGA)® 6.06 (Tamura et al., 2013). The morphological and genetic difference between mold isolates suggested that eggs could be contaminated by molds from different sources.

Figure 2.7 Molecular phylogenetic tree of Mucor, Cladosporium, and Penicillium generated by Maximum Likelihood method (MEGA® 6.06; Tamura et al., 2013).

Natamycin is famous for protecting the surface of many foods such as cheese against the growth of molds (Pintado et al., 2010). However, direct application of natamycin onto food surface without protective matrix may cause partial inactivation and rapid degradation of the active compound (Fajardo et al., 2010). The use of shellac coating as a carrier for natamycin when applied on egg surfaces can make the antifungal agent more effective, since shellac coating can maintain the concentration of natamycin on food surface for extended period of time without suffering any migration of the active 72

compounds (Ouattara et al., 2000). Such “locking” mechanism could improve antifungal efficacy, and it also could limit the release rate of natamycin onto treatment surface

(Fajardo et al., 2010).

Minimum inhibitory concentration (MIC) is the lowest concentration of an antimicrobial agent that inhibits visible growth of a microorganism after a given period of time (Andrews, 2001). Therefore, MIC value is closely associated with the visible cue of the antimicrobial effects. In the current experiments, inhibitory effects of natamycin- containing shellac coating could be expressed as zone of inhibition (mm) of the tested mold on pre-inoculated PDA plates.

In general, the higher natamycin concentration in shellac coating the stronger the inhibition effects against targeted mold. Lowest natamycin concentration to inhibit mold growth was difficult to determine with naked eye, it can be predicted based on the linear relationship it had with inhibition zone value. When inhibition zone theoretically equals zero, the corresponding concentration of natamycin could be consider its MIC value.

Therefore, the x-intercept (where inhibition zone = 0) in Figure 2.3, 2.4, and 2.5 could be considered the natamycin MIC.

Natamycin MIC in shellac coating is different when used to treat different molds.

Natamycin MIC was the highest for Mucor; therefore, concentration of the antifungal agent sufficient to control this mold will also be sufficient to control Cladosporium and

Penicillium.

Natamycin had a long history of safe use as antifungal agent, and it is regulated at dosage level that cannot exceed 20 ppm in the final product to prevent mold and yeast growth (FDA, 2014). Table 2.4 translated the predicted natamycin MIC in shellac coating 73

suspension to the final concentration level when applied on eggs that were estimated to be 60 grams in weight (average USDA grade A egg weight)

Table 2.4 Predicted natamycin MICs for different mold inhibition in shellac coating and their correlated MICs when applied on eggs

Natamycin Estimated natamycin MICs Molds MICs in shellac coating when applied on shell eggs (µg/ml) (mg/kg) Mucor 97.7 ~0.75 Cladosporium 51.6 ~0.375 Penicillium 44.9 ~0.375

As Table 2.4 indicates, the predicted natamycin MIC sufficient to inhibit all the three molds on shell eggs was 0.75 mg/kg.

Preliminary experiments showed that calculated natamycin concentrations just sufficient to control mold on shell eggs were underestimated. The eggs coated with shellac contained 400 µg/ml natamycin did not show contamination after inoculation with molds when stored at 25 °C for 7 days. Smaller concentrations than 400 μg natamycin/ml coating did not exclude mold growth (Figure 2.6). A study on natamycin effectiveness in chitosan-based edible film suggested that MIC level of natamycin in edible films was

~500 µg/ml in chitosan suspension when applied on cheese surface (Fajardo et al., 2010).

The interaction with food surface could reduce natamycin antifungal activity, and the high water content from agar may impact the release mechanism of natamycin (Fajardo et

74

al., 2010). Hence, effective natamycin concentration in shellac coating should be at 400

μg/ml.

2.6 Conclusions

Results from mold isolation and identification study suggest that eggs can be contaminated with different species of molds during prolonged storage. Cladosporium ramotenellum and Penicillium commune, which were isolated from eggshell area without fecal debris are more closely related to each other. However, Mucor hiemalis that was isolated from eggshell area with fecal matter is more distantly related to the other two molds.

Results from MIC study indicate that natamycin can inhibit mold contaminations when used in shellac coating. Natamycin MIC differs when the compound is used to treat different molds. Natamycin MIC was at 97.7, 51.6 and 44.9 µg/ml in shellac coating for

Mucor, Cladosporium, and Penicillium, repectively. Natamycin MIC in shellac coating for mold growth prevention on PDA plates was determined to be 99.27 µg/ml. When applied on shell eggs, higher natamycin concentration in shellac is required: (i): estimated

MIC was based on natamycin concentration that might not inhibit mold growth, and (ii): experimental data was generated on PDA instead of actual shell eggs. Recommended dose of natamycin concentration in shellac coating of shell eggs is 400 µg/ml.

75

2.7 Reference

Andrews, J. M. (2001). Determination of minimum inhibitory concentrations. The

Journal of Antimicrobial Chemotherapy, 48 (1), 5–16.

http://doi.org/10.1093/jac/48.suppl_1.5

Australian Egg Corporation Limited. (2009). Code of Practice for Shell Egg Production,

Grading, Packing and Distribution.Retrived from

https://www.aecl.org/assets/Uploads/Resources/Code-of-Practice-for-Shell-egg-

production-grading-packing-and-distribution-2009.pdf

Bennett, J. W., & Klich, M. (2003). Mycotoxins. Clinical Microbiology Reviews, 16(3),

497–516. doi:10.1128/CMR.16.3.497-516.2003

Caner, C. (2005). The effect of edible eggshell coatings on egg quality and consumer

perception. Journal of the Science of Food and Agriculture, 85(11), 1897–1902.

http://doi.org/10.1002/jsfa.2185

Fajardo, P., Martins, J. T., Fuciños, C., Pastrana, L., Teixeira, J. A., & Vicente, A. A.

(2010). Evaluation of a chitosan-based edible film as carrier of natamycin to

improve the storability of Saloio cheese. Journal of Food Engineering, 101(4),

349–356. http://doi.org/10.1016/j.jfoodeng.2010.06.029

FDA. (2014). GRAS Notification use of natamycin in yoghurt, (GRN No. 517).

Retrieved from

http://www.accessdata.fda.gov/scripts/fdcc/?set=GRASNotices&id=517

Gulich, A., & Fitzgarald, J. (1964). USDA Egg Grading Manual, No. 75. Washington:

Agric Marketing Service.

Inglis, P. W., & Tigano, M. S. (2006). Identification and taxonomy of some 76

entomopathogenic Paecilomyces spp. (Ascomycota) isolates using rDNA-ITS

sequences. Genetics and Molecular Biology, 29(1), 132–136.

http://doi.org/10.1590/S1415-47572006000100025

King, R. A., Preston, C. D., & Croft, J. M. (2001). Molecular confirmation of

Potamogeton× bottnicus (P. pectinatus× P. vaginatus, Potamogetonaceae) in

Britain. Botanical Journal of the linnean society, 135(1), 67-70.

Lu, H., Schmidt, M. A., & Jensen, K. F. (2005). A microfluidic electroporation device for

cell lysis. Lab on a Chip, 5(1), 23-29.

Lumbsch, H. T., & Huhndorf, S. M. (2007). Outline of Ascomycota. Myconet, 13, 1–58.

Nicholson, C. (1991). Some notes on shellac. Conservation News (United Kingdom

Institute for Conservation of Historic and Artistic Works), (44), 15–17.

Ouattara, B., Simard, R. E., Piett, G., Bégin, A, & Holley, R. A. (2000). Inhibition of

surface spoilage bacteria in processed meats by application of antimicrobial films

prepared with chitosan. International Journal of Food Microbiology, 62(1), 139–

148. http://doi.org/10.1016/S0168-1605(00)00407-4

Pedersen, J. C. (1992). Natamycin as a fungicide in agar media. Applied and

Environmental Microbiology, 58(3), 1064-1066. Retrieved from:

http://aem.asm.org/content/58/3/1064.short.

Pintado, C. M. B. S., Ferreira, M. A. S. S., & Sousa, I. (2010). Control of pathogenic and

spoilage microorganisms from cheese surface by whey protein films containing

malic acid, nisin and natamycin. Food Control, 21(3), 240–246.

http://doi.org/10.1016/j.foodcont.2009.05.017

Rao, C. Y., Riggs, M. A., Chew, G. L., Muilenberg, M. L., Thorne, P. S., Van Sickle, D., 77

Dunn, K.H. Brown, C. (2007). Characterization of airborne molds, endotoxins,

and glucans in homes in New Orleans after Hurricanes Katrina and Rita. Applied

and Environmental Microbiology, 73(5), 1630–1634.

http://doi.org/10.1128/AEM.01973-06

Romanoff, A. L., & Romanoff, A. J. (1949). The avian egg. New York: J. Wiley.

Santiago, A. L. C. M. D. A., Cavalcanti, M. A. Q., & Trufem, S. F. B. (2008). Mucor

guilliermondii (Mucorales): a rare species found in herbivore dung from

Neotropics. Mycotaxon, 106, 103–108.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6:

Molecular evolutionary genetics analysis version 6.0. Molecular Biology and

Evolution, 30(12), 2725–2729. http://doi.org/10.1093/molbev/mst197

Te Welscher, Y. M., Ten Napel, H. H., Balagué, M. M., Souza, C. M., Riezman, H., De

Kruijff, B., & Breukink, E. (2008). Natamycin blocks fungal growth by binding

specifically to ergosterol without permeabilizing the membrane. Journal of

Biological Chemistry, 283(10), 6393–6401.

http://doi.org/10.1074/jbc.M707821200

USDA. (2016). Egg market news report. Retrieved from

https://www.ams.usda.gov/mnreports/pybshellegg.pdf

WHO. (2011). Mycotoxins. Children’s Health and the Environment, 1–42.Retrieved

from http://www.who.int/ceh/capacity/mycotoxins.pdf

Yu, Z., & Morrison, M. (2004). Improved extraction of PCR-quality community DNA

from digesta and fecal samples. Biotechniques, 36(5), 808-813.

78

Chapter 3 : Antifungal effectiveness of natamycin-shellac coating when applied on commercially washed eggs and mild heat/ozone pasteurized eggs

3.1 Abstract

The purpose of this study was to evaluate the antifungal efficacy of the natamycin- shellac coating on commercially washed eggs and pasteurized eggs. Eggs were prepared into three groups: eggs that received no coating (control), eggs that were coated with shellac only (treatment 1), and eggs that were coated with shellac containing

400 µg/ml of natamycin (treatment 2). Concentration of natamycin suitable for application on shell eggs was determined previously. Egg groups were inoculated with mold spores and stored at 25°C for 18 days, and mold growth were monitored by enumeration on potato dextrose agar (PDA). Molds tested in this study belong to three genera: Mucor, Cladosporium and Penicillium. The experiment was repeated three times and results were analyzed statistically. Treatments that permitted mold growth provided data that allowed the construction of growth curves. These growth curves were fitted with logistic model, and growth kinetic parameters (maximum population (A), maximum specific growth rate (µmax), and lag time (λ) were estimated and compared. According to parameters comparison between control and treatment 1, shellac coating did inhibit fungal growth on washed egg, but it exhibited antifungal effectiveness against Mucor and

79

Penicillium on pasteurized eggs. Presence of natamycin in shellac coating significantly inhibited fungal contamination on both commercially washed eggs and pasteurized eggs.

This study illustrated that shellac coating can be used as a carrier for natamycin to create an effective protection against mold contaminations of eggs, hence the antifungal agent can potentially extend the shelf-life of treated eggs and minimize economic lose.

3.2 Introduction

Shell egg production is a large industry. It was estimated that 223 million eggs were laid in the US every day in 2014 (Range & Carolina, 2016). Shell eggs have gained significant popularity over the years as well; the annual per capita consumption of eggs in the US has increased from 248 eggs in 2009 to 266 years in 2015 (Range & Carolina,

2016). Contamination of egg surface with mold has serious economic repercussions, since moldy eggs are considered “loss eggs” by USDA and have to be restricted from human consumption (USDA, 2000). Mold contamination may happen during storage when these conditions are compromised for a period of time (Romanoff and Romanoff

1949). Currently, commercial eggs can be stored between 3 to 5 weeks, which grants enough time for many mold contamination source to propagate on egg surface (Rao et al.,

2007). Processing such as commercial washing, or pasteurizing, improves eggs value, but it may introduce new opportunities for mold contamination. According to USDA eggs exporting data, nearly 1.8% shell eggs were estimated as “loss eggs”, which amounted in nearly 6.35 million cases of eggs in 2015 (Range & Carolina, 2016). With millions of

80

eggs lost due to mold defects each year, it is clear there is a need for treatment that can minimize the losses.

Mold contamination during egg storage prompted researchers to investigate antifungal coating materials. Edible coatings can be applied as carrier of antifungal agents in order to protect food surfaces, which are a popular site of mold contamination

(Fajardo et al., 2010). Compared to mineral oil that is often used to coat washed eggs, edible coatings can retain egg quality better due to their excellent barrier property against oxygen, carbon dioxide, and water vapor exchange across egg shell (Caner, 2005). Egg coatings made of shellac, chitosan and whey protein isolates were compared for ability to retain quality and minimize changes in weight, pH, haugh units, and yolk index

(Caner, 2005). Shellac has been recognized as the best alternative egg coating when considering egg quality retention (Caner, 2005).

Natamycin is Generally Recognized as Safe (GRAS) by Food and Drug

Administration (FDA) (FDA, 2014). With excellent anti-fungal activities against several food borne molds and yeasts, natamycin has a long history of safe use, as antifungal agent, in dairy products such as cheese and yogurt (Resa, Jagus, & Gerschenson, 2014).

Direct application of antifungal agents without any matrix will cause quick loss of anti- fungal activity due to rapid diffusion within food. (Fajardo et al., 2010). Therefore, natamycin is preferably incorporated with a media for coating application (Fajardo et al.,

2010). Currently, natamycin is allowed for surface treatment of cheese in amounts not exceed 20 ppm in the finished product (FDA, 2014).

This study was initiated to evaluate mold control on processed eggs when coated with natamycin-shellac coating. Using a mathematical model to fit experimental data is 81

also a popular approach to analyze microbial population data (McKellar, 1997). The advantage of mathematical modeling lies in the possibility of estimating kinetic parameters of a mold growth, which can be used to describe the mold growth trending

(Zwietering, Jongenburger, Rombouts & Van, 1990).

Commercially washed eggs and pasteurized eggs were covered in this investigation. Commercial eggs available in the US market have to be washed prior to packaging (USDA, 2000). Dirty washing water and insufficient drying were the two main factors responsible for spoilage of washed eggs (Hamm, Searcy & Mercuri, 1974).

Pasteurized eggs are those that have been treated to achieve a minimum of 5-log

Salmonella reduction within the shell (Perry, Rodriguez-Saona & Yousef, 2011).

Currently, there are several methods available to produce pasteurized eggs, yet processes such as gamma irradiation and immersion heating can cause quality changes in treated eggs (Perry & Yousef, 2013).

The purpose of this study was to evaluate the anti-fungal effectiveness of natamycin-shellac coating when applied on commercially washed eggs and mild heat/ozone pasteurized eggs. To the best of author’s knowledge, there has been no work reported on the application of shellac coating as a carrier of natamycin to inhibit mold growth on egg surface.

3.3 Materials and methods

3.3.1 Materials

Grade-A large shell eggs were obtained from Egg-tech Ltd. (Columbus, OH) and held at 4°C until used. Eggs were carefully examined prior to experiment to ensure the 82

consistence of surface area. There were two types of eggs based on how they were processed: commercially washed eggs and pasteurized eggs. Commercially washed eggs were eggs that have been soaked, rinsed, sanitized, and dried without oiling (Bradley &

King, 2006). Pasteurized eggs were washed eggs that received mild heat/ozone combined treatment to achieve a minimum of 5-log Salmonella reduction (Perry et al., 2011).

The materials used to prepare the coating were: none bleached dry shellac

(Mantrose-Haeuser, Westport, CT); 95% ethanol (Fisher Scientific, Fair Lawn, NJ); 95%

Methanol (Fisher Scientific, Fair Lawn, NJ), and natamycin (Sigma-Aldrich, Santa Clara,

CA). According to the manufacturer, purity of natamycin was 95%.

3.3.2 Preparation of fungal inoculum

Mucor hiemalis, Cladosporium ramotenellum, and Penicillium commune were isolated and identified from contaminated surface of moldy eggs. All fungi were recovered and grown on potato dextrose agar (PDA; Oxoid, Hampshire, England). Spores of theses molds were harvested and suspended into aqueous solution containing 0.05%

(w/v) tween 80 (Fisher Scientific, Fair Lawn, NJ). The suspensions were held at 4°C for up to three months (original stock).

For inoculation of shell eggs, mold spores inocula were prepared from the original stocks as follows. Portions of the spore stock were spread onto PDA and plates were incubated for seven days at 25 °C. The resulting mold colonies were rinsed with sterile

0.05% Tween 80 to gently wash off the spores. Spores were collected with sterile pipettes and transferred into separate tubes. This process was repeated until at least 40 ml of spore suspension (inoculum suspension) were obtained. Spore counts were determined using

83

spread-plating on PDA, and counts of Mucor, Cladosporium, and Penicillium in the inoculum suspensions were ~107 spores per ml.

3.3.3 Coating preparation and application

Shellac coating was prepared by dissolving 24 grams of non-bleached shellac in

90 ml of 95% ethanol (25% w/w) with agitation using a magnetic stirring bar. Shellac formulation has been developed and optimized for egg coating by Yousef et al. (2015).

Part of the shellac coating was mixed with natamycin for testing as an antifungal coating.

Natamycin has higher solubility in methanol than in ethanol; therefore, natamycin solution in methanol was prepared before mixing with shellac coating. Thirty grams of natamycin powder was mixed with 30 ml of methanol (1 mg/ml) with vortex for 2 minutes, then the solution was transferred into 45 ml of shellac coating. The final concentration of natamycin in shellac coating was 400 µg/ml.

Shellac and natamycin-shellac coatings were applied on egg surface via spraying using a regular 200-ml hand-held sprayer obtained from local hardware store (Columbus,

OH). The sprayer was connected to an air jet with pressure setting at 200 psi. After loading the sprayer with coating material, the quality of the spraying pattern was tested using scraps of cardboards. To achieve a good spray pattern, the pressure of the air jet was increased slowly from a minimum value. A good spray pattern had no runs, and the spray was smooth and even. Before spraying, all the eggs were aligned on a metal stand.

Sprayer was aimed perpendicular to the exposed egg surface and the content was sprayed from left to right while maintaining a consistent distance between the sprayer and the target surface. Once one side of the eggs was coated, the eggs were held undisturbed for 5

84

minutes, until the coating dried. Then the eggs were rotated and aligned on the metal stand again with the uncoated side of the egg shell facing upward for spraying. This process was repeated until the entire surfaces of eggs were covered with the desired coating. Due to the scale of equipment, only 12 eggs were coated at once, and the applied coating tended to be somewhat thicker compared to industrial-scale coating. Figure 3.1 shows examples of non-coated and shellac-coated eggs.

Figure 3.1 Examples of regular eggs vs. coated eggs. (Eggs from left to right: no coating, shellac coating).

3.3.4 Egg inoculation

Three experimental groups were prepared for both commercially washed and pasteurized eggs: (i) eggs with no coating (control sample), (ii) eggs coated with shellac only (treatment 1), and eggs coated with shellac containing natamycin (treatment 2). All three groups were inoculated with mold spores as follows. Fourty ml mold spores suspension were mixed with 360 ml 0.05% (w/v) Tween 80 peptone water in sterile beaker. Eggs were inoculated with mold spores by dipping into prepared spore 85

suspension (~106 spores per ml) for 5 seconds to simulate contamination on egg surface during storage. Inoculum suspensions were agitated with magnetic stirring bar to ensure that spores were evenly distributed within the suspension. Each inoculated egg was lifted above the inoculation beaker for half a minute to allow dripping off and drying.

Inoculated eggs were stored in retail cartons at 25°C to simulate abused storage condition. The same experimental procedures were executed with Mucor, Cladosporium and Penicillium spores, and each exercise was carried out in triplicates.

3.3.5 Microbiological analysis

Population of Mucor, Cladosporium, and Penicillium on eggs were enumerated on PDA. During 18 days of storage, eggs were selected randomly from each carton and tested on day 1, 2, 3, 4, 5, 6, 7, 8, 11, 14, and 17. Sampled eggs were submerged in 100 ml of sterile 0.1% peptone water in a stomacher bag, and the entire egg surface was gently rubbed for at least 30 seconds until no visible mold residuals (mycelium or spores) were attached. The eggs were removed, and contents in the bag were homogenized for 1 min in a stomacher (Tekmar, Cincinnati, OH). Egg washings were serially diluted in

0.1% (w/v) peptone water and spread-plated on PDA. Aliquots of 0.1 ml from all dilutions were plated on PDA plates to complete the enumeration test. Inoculated plates were incubated at 25°C for 5 days, however, Mucor plates sometimes were examined after three days of incubation since the size of Mucor colony could be too large to be accurately counted after five days of incubation.

3.3.6 Modeling

86

Antifungal effectiveness of natamycin-shellac coating (400 µg/ml natamycin) could be quantified by comparing the mold growth curves on different eggs during storage. Growth data were fitted using logistic function (Zwietering et al., 1990).

푎 푦 = (1) [ 1 + exp(푏 − 푐 • 푥)]

Several phases could be used to describe a growth curve: (1) lag phase, when microorganism shows very little to no growth since they are adjusting to the new environment, (2) log phase, when microorganism population increases at an exponential rate, and (3) stationary phase, when microorganism population reaches its maximum density and remains at that level for a period of time (Sinigaglia et al., 2012). In order to quantify growth behavior, each phase can be defined with a kinetic parameter: lag phase duration (λ), maximum specific growth rate (µmax), and maximum population (A); and each growth curve kinetic parameter can be derived from logistic model based on the mathematical and biological meanings of its first derivative and second derivative. The parameters are calculated using Eq. (2, 3, 4), as described in the literature review section

(Zwietering et al., 1990).

Eq. 2. Growth curve kinetic parameters derived from logistic model constants

A = a (2)

푎•푐 (3) µmax = 4 (4) 2 − 푏 휆 = 푐

Upon acquiring the kinetic parameters from each growth curve, these can be compared statistically. 87

3.3.7 Statistical analysis

Statistical software SAS® version 9.4.1 (SAS institute, INC., Cary, NC) was used to fit data to the logistic function (non-linear regression analysis), to estimate growth kinetic parameters of mold growth curves. Growth kinetic parameters for mold on control and treatment 1 were compared statistically and means were analyzed using Tukey-test (p

< 0.05) with SAS® version 9.4.1 (SAS institute, INC., Cary, NC).

3.4 Results

3.4.1.1 Anti-fungal activities of coatings against Mucor on washed eggs

Mold growth data and estimated growth kinetic parameters were presented in this section. Growth curve could be defined with growth kinetic parameters: maximum population (A), maximum specific growth rate (µmax), and lag time (λ). Kinetic parameters were estimated by fitting logistic model to experimental data.

88

Con Trt 1 Trt 2 Control Model Trt 1 Model 6 5.5 5 4.5 4 3.5

Log10CFU 3 2.5 * 2 1.5 1 1 3 5 7 9 11 13 15 17 19

Days

Figure 3.2 Modeling example of Mucor hiemalis growth using logistic model on commercially-washed eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 2 data). * Detection limit of enumeration method is <100 CFU/egg.

Figure 3.2 is an example of the growth curves obtained when washed eggs were inoculated with Mucor (trial 2). Uncoated and shellac-coated eggs were prone to Mucor growth. Growth kinetic parameters estimated from three experiment trails were listed in

Table 3.1, and compared for statistic differences.

According to Table 3.1, Mucor growth under treatment 1 had no significant

(p>0.05) difference in maximum specific growth rate and lag time when compared to control. Mucor maximum population was significantly (p<0.05) higher on treatment 1 89

eggs than control eggs. The anti-fungal activity of natamycin-containning shellac coating was so significant that, the inoculated Mucor spores could not propagate in the presence of this coating on washed egg surface. At the end of 17 days of storage, there was 2.3 log difference between control and treatment 2 eggs, and 3.2 log difference between treatment 1 and treatment 2 eggs.

Table 3.1 Comparison of Mucor growth kinetic parameters1 on commercially washed eggs.

Average and standard deviation3 2 A (Log10 µmax λ Treatment Trials -1 1 CFU/egg) (Day ) (Days) A (Log10 µmax λ CFU/egg) (Day-1) (Days) Trial 1 1.56 0.12 4.22 3.03 4.33 0.28 Control Trial 2 1.95 0.58 0.99 (±1.77) (±0.03)a (±0.25)a Trial 3 1.90 0.15 3.88 a Trial 1 2.21 0.18 3.97 3.93 5.15 0.18 Trt 1 Trial 2 2.45 0.21 3.71 (±0.21) (±0.21)b (±0.03)a Trial 3 2.32 0.15 4.12 a Trial 1 2.00 Trt 2 Trial 2 * * * * * (±0.00)4 Trial 3

1 Growth parameters are maximum population (A), maximum specific growth rate (µmax), and lag time (λ) 2 Treatments are washed eggs with no coating (control); washed eggs and coated with shellac (Trt 1) and washed eggs coated with natamycin-containing shellac coating (Trt 2) 3 Averages with different superscripted letter are significantly different. 4 Maximum population (A) for treatment 2 eggs was an average of three replicates using Mucor population on day 17 of storage. * No mold growth occurred on Treatment 2; hence growth curve couldn’t be constructed and growth parameters couldn’t be calculated.

90

3.4.1.2 Anti-fungal effectiveness against Cladosporium on washed eggs

Trial 3 of the Cladosporium growth data on commercially washed eggs were shown in Figure 3.3.

Control Trt 1 Trt 2 Control Model Trt 1 Model 7

6

5

4

Log10 CFU Log10 3

* 2

1 1 3 5 7 9 11 13 15 17 19 Days

Figure 3.3 Modeling example of Cladosporium ramotenellum growth using logistic function on commercially-washed eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 3 data). * Detection limit of enumeration method is <100 CFU/egg.

Both control and treatment 1 eggs had considerable amount of mold contamination after storage. there were no significant difference (p>0.05) between kinetic parameters when comparing control and treatment 1 eggs. Due to the limitation of logistic model, estimated logistic function trend-line could not reasonably represent

Cladosporium growth on treatment 2 eggs. Though Cladosporium growth was also

91

observed on treatment 2 eggs, the contamination level appeared to be at a much lower degree compared to the other treatments by visual examination. At the end of 17 days of storage, there was 2.4 log difference between control and treatment 2 eggs, and 2.7 log difference between treatment 1 and treatment 2 eggs.

Table 3.2 Comparison of Cladosporium growth kinetic parameters1 on commercial washed egg samples.

Average and standard deviation3

2 A (Log10 µmax λ Treatment Trials -1 CFU/egg) (Day ) (Days) A (Log10 -1 λ µmax (Day ) CFU/egg) (Days)

Trial 1 3.29 0.490 1.19 5.57 0.92 0.71 Control Trial 2 3.42 1.45 0.290 (±0.24)a (±0.49)a (±0.45)a Trial 3 3.40 0.820 0.640 Trial 1 3.86 0.660 0.29 5.88 0.74 0.48 Trt 1 Trial 2 4.04 1.11 0.05 (±0.15)a (±0.34)a (±0.55)a Trial 3 3.57 0.460 1.10 Trial 1 3.17 Trt 2 * * Trial 2 * * * (±0.43)4 Trial 3

1 Growth parameters are maximum population (A), maximum specific growth rate (µmax), and lag time (λ) 2 Treatments are washed eggs with no coating (control); washed eggs and coated with shellac (Trt 1) and washed eggs coated with natamycin-containing shellac coating (Trt 2) 3 Averages with different superscripted letter are significantly different. 4 Maximum population (A) for treatment 2 eggs was an average of three replicates using Cladosporium population on day 17 of storage. * Reasonable kinetic parameter could not be estimated due to logistic function limitation

92

3.4.1.3 Anti-fungal effectiveness against Penicillium on washed eggs

An example of Penicillium growth data is shown in Figure 3.4. Growth kinetic parameters estimated from all Penicillium inoculum experiment trails were listed in Table

3.2, and compared for statistic differences.

Control Trt 1 Trt 2 Control Model Trt 1 Model

6 5.5 5 4.5 4 3.5

3 Log10 CFU/egg Log10 2.5

* 2 1.5 1 1 3 5 7 9 11 13 15 17 19 Days

Figure 3.4 Modeling example of Penicillium commune growth on commercially-washed eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 3 data). * Detection limit of enumeration method is <100 CFU/egg.

Both control and treatment 1 sample had considerable amount of Penicillium contamination after storage. According to data in Table 3.3, Penicillium growth kinetic parameters for treatment 1 eggs had no significant difference (p>0.05) compared to 93

kinetic parameters of control eggs. Due to the limitation of logistic model, estimated logistic function trend-line could not reasonably represent Penicillium growth on treatment 2 eggs. Though Penicillium growth was also observed on treatment 2 eggs, the contamination level appeared to be much lower compared to the other treatments by both visual examination and plate counting. At the end of 17 days of storage, there was 2.3 log difference between control and treatment 2 eggs, and 2.4 log difference between treatment 1 and treatment 2 eggs.

Table 3.3 Comparison of Penicillium growth kinetic parameters1 on commercial washed egg samples.

Average and standard deviation3 A (Log µ λ Treatment2 Trials 10 max CFU/egg) (Day-1) (Days) A (Log10 µmax λ CFU/egg) (Day-1) (Days) Trial 1 1.88 0.16 4.03 5.20 0.35 2.29 Control Trial 2 2.05 0.43 1.60 (±0.08)a (±0.17)a (±1.51)a Trial 3 2.57 0.46 1.25 Trial 1 2.26 0.28 2.41 5.34 0.40 1.63 Trt 1 Trial 2 2.48 0.40 1.57 (±0.11)a (±0.12)a (±0.75)a Trial 3 2.86 0.51 0.92 Trial 1 2.95 Trt 2 Trial 2 * * * (±0.48)4 Trial 3

1 Growth parameters are maximum population (A), maximum specific growth rate (µmax), and lag time (λ) 2 Treatments are washed eggs with no coating (control); washed eggs and coated with shellac (Trt 1) and washed eggs coated with natamycin-containing shellac coating (Trt 2) 3 Averages with different superscripted letter are significantly different. 4 Maximum population (A) for treatment 2 eggs was an average of three replicates using Penicillium population on day 17 of storage. * Reasonable kinetic parameter could not be estimated due to logistic function limitation

94

3.4.1.4 Anti-fungal effectiveness of coating against Mucor on pasteurized eggs

Con Trt 1 Trt 2 Control Model Trt 1 Model 6 5.5 5 4.5 4 3.5

Log10 CFU Log10 3 2.5 * 2 1.5 1 1 3 5 7 9 11 13 15 17 19 Days

Figure 3.5 Modeling example of Mucor hiemalis growth on pasteurized eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 3 data). * Detection limit of enumeration method is <100 CFU/egg.

Figure 3.5 showed trial 3 Mucor inoculum experimental data as examples to illustrate the modeling of Mucor growth on pasteurized eggs under uncoated and shellac coating treatment. Uncoated and shellac-coated eggs were prone to Mucor growth.

Growth kinetic parameters estimated from three experiment trails were listed in Table

3.4, and compared for statistic differences.

95

According to data in

Table 3.4, Mucor maximum specific growth rate on eggs received treatment 1 was significantly (p<0.05) slower, maximum population was significantly (p<0.05) higher, and lag time was significantly (p<0.05) longer than control. The anti-fungal activity of natamycin-contained shellac coating was so significant that, the inoculated amount of

Mucor spores could not propagate at the presence of this coating on pasteurized eggs.

Hence, no meaningful parameters could be estimated. At the end of 17 days of storage, there was 2.4 log difference between control and treatment 2 eggs, and 3.0 log difference between treatment 1 and treatment 2 eggs.

96

Table 3.4 Comparison of Mucor growth kinetic parameters1 on pasteurized egg samples.

Average and standard deviation3

2 A (Log10 µmax λ Treatment Trials CFU/egg) (Day-1) (Days) A (Log10 µmax λ CFU/egg) (Day-1) (Days) Trial 1 1.61 0.32 1.68 4.38 0.30 1.87 Control Trial 2 1.51 0.31 1.80 (±0.07)a (±0.04)a (±0.24)a Trial 3 1.43 0.25 2.14 Trial 1 2.45 0.25 2.88 5.00 0.25 2.77 Trt 1 Trial 2 1.91 0.28 2.48 (±0.02)b (±0.02)b (±0.25)b Trial 3 2.00 0.23 2.96 Trial 1 2.00 Trt 2 Trial 2 * * * (±0.00)4 Trial 3 1 Growth parameters are maximum population (A), maximum specific growth rate (µmax), and lag time (λ) 2 Treatments are pasteurized eggs with no coating (control); pasteurized eggs coated with shellac (Trt 1) and pasteurized eggs coated with natamycin-containing shellac coating (Trt 2) 3 Averages with different superscripted letter are significantly different. 4 Maximum population (A) for treatment 2 eggs were averaged using Mucor population on day 17 of storage. * No mold growth occurred on Treatment 2; hence growth curve couldn’t be constructed and growth parameters can’t be calculated.

97

3.4.1.5 Anti-fungal effectiveness against Cladosporium on pasteurized eggs

Control Trt 1 Trt 2 Control Model Trt 1 Model 7

6

5

4 Log10 CFU Log10 3

* 2

1 1 3 5 7 9 11 13 15 17 19 Days

Figure 3.6 Modeling example of Cladosporium ramotenellum growth on pasteurized eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin- containing shellac (treatment 2). (Trial 3 data). * Detection limit of enumeration method is <100 CFU/egg.

Figure 3.6 demonstrated the modeling of Cladosporium growth curves of mold propagation on control and treatment 1 eggs with logistic function using trial 3 data.

Growth kinetic parameters estimated from three experiment trails were listed in Table

3.5, and compared for statistic differences.

Both control and treatment 1 sample had considerable amount of mold contamination after storage. According to data in

98

Table 3.5, there were no significant differences (p>0.05) between all estimated kinetic parameters when comparing control and treatment 1 eggs. Due to the limitation of logistic model, estimated logistic function trend-line could not reasonably represent

Cladosporium growth on treatment 2 eggs. Although Cladosporium growth was also observed on treatment 2 eggs, the contamination level appeared to be at much lower degree compare to the other treatments by both visual examination and plate counting. At the end of 17 days of storage, there was 2.7 log difference between control and treatment

2 eggs, and 2.8 log difference between treatment 1 and treatment 2 eggs.

Table 3.5 Comparison of Cladosporium growth kinetic parameters1 on pasteurized egg samples.

Average and standard 3 deviation 2 A (Log10 µmax λ Treatment Trials -1 CFU/egg) (Day ) (Days) A (Log10 µmax λ CFU/egg) (Day-1) (Days) Trial 1 3.00 0.75 0.81 5.56 0.55 1.37 Control Trial 2 2.62 0.56 1.16 (±0.12)a (±0.20)a (±0.69)a Trial 3 2.46 0.35 2.14 Trial 1 3.13 0.69 0.93 5.67 0.63 1.09 Trt 1 Trial 2 2.70 0.68 0.99 (±0.17)a (±0.09)a (±0.23)a Trial 3 2.59 0.52 1.36 Trial 1 2.88 Trt 2 Trial 2 * * * (±0.30)4 Trial 3

1 Growth parameters are maximum population (A), maximum specific growth rate (µmax), and lag time (λ) 2 Treatments are pasteurized eggs with no coating (control); pasteurized eggs coated with shellac (Trt 1) and pasteurized eggs coated with natamycin-containing shellac coating (Trt 2) 3 Averages with different superscripted letter are significantly different. 4 Maximum population (A) for treatment 2 eggs was an average of three replicates using Cladosporium population on day 17 of storage. 99

* Reasonable kinetic parameter could not be estimated due to logistic function limitation

3.4.1.6 Anti-fungal effectiveness against Penicillium on pasteurized eggs

Trial 1 Penicillium growth data on three types of commercially washed eggs were shown in Figure 3.7.

Control Trt 1 Trt 2 Control Model Trt 1 Model 7

6

5

4

Log10 CFU Log10 3

* 2

1 1 3 5 7 9 11 13 15 17 19

Days

Figure 3.7 Growth of Penicillium commune on pasteurized eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2, Trial 1 data). * Detection limit of enumeration method is <100 CFU/egg.

100

Figure 3.7 illustrated the modeling of control and treatment 1 growth curve with logistic function using trial 1 data as examples. Growth kinetic parameters estimated from other Penicillium inoculum experiment trails were listed in Table 3.6, and compared for statistic differences.

Both control and treatment 1 eggs had considerable amount of Penicillium contamination after storage. According to data in Table 3.6, Penicillium maximum specific growth rate on eggs received treatment 1 was significantly (p<0.05) slower, maximum population was significantly (p<0.05) higher, and lag time was significantly

(p<0.05) longer than control. Due to the limitation of logistic model, estimated logistic function trend-line could not reasonably represent Penicillium growth on treatment 2 eggs. Although Penicillium growth was also observed on treatment 2 eggs, the contamination level appeared to be at a much lower degree compare to the other treatments by both visual examination and plate counting. At the end of 17 days of storage, there was 2.3 log difference between control and treatment 2 eggs, and 2.8 log difference between treatment 1 and treatment 2 eggs.

101

Table 3.6 Comparison of Penicillium growth kinetic parameters1 on pasteurized egg samples.

Average and standard deviation3 A (Log µ λ Treatment2 Trials 10 max CFU/egg) (Day-1) (Days) A (Log10 µmax λ CFU/egg) (Day-1) (Days) Trial 1 1.94 0.45 1.44 5.05 0.58 1.17 Control Trial 2 2.13 0.58 1.16 (±0.08)a (±0.13)a (±0.26)a Trial 3 2.42 0.71 0.92 Trial 1 2.63 0.36 1.89 5.59 0.35 1.85 Trt 1 Trial 2 2.28 0.34 1.92 (±0.28)b (±0.01)b (±0.09)b Trial 3 2.63 0.36 1.75 Trial 1 2.76 Trt 2 Trial 2 * * * (±0.14)4 Trial 3

1 Growth parameters are maximum population (A), maximum specific growth rate (µmax), and lag time (λ) 2 Treatments are pasteurized eggs with no coating (control); pasteurized eggs coated with shellac (Trt 1) and pasteurized eggs coated with natamycin-containing shellac coating (Trt 2) 3 Averages with different superscripted letter are significantly different. 4 Maximum population (A) for treatment 2 eggs was an average of three replicates using Penicillium population on day 17 of storage. * Reasonable kinetic parameter could not be estimated due to logistic function limitation

3.5 Discussion

3.5.1 Antifungal effectiveness on commercial washed eggs

Commercially washed eggs which have been coated with shellac containing 400

µg/ml natamycin did not develop visible mold during study. Although data presented in

Figure 3.2, 3.3, and 3.4 were from single experiment trial, data from other trails within the same experiment shared similar result patterns. Mucor, Cladosporium, and

102

Penicillium growth on control and treatment 1 eggs were compared using kinetic parameters estimated from logistic model. Both control and treatment 1 eggs had considerable amount of mold contamination after storage. there were no significant difference (p>0.05) between kinetic parameters when comparing control and treatment 1 eggs. Due to the limitation of logistic model, estimated logistic function trend-line could not reasonably represent Cladosporium growth on treatment 2 eggs. Though

Cladosporium growth was also observed on treatment 2 eggs, the contamination level appeared to be at a much lower degree compared to the other treatments by visual examination. At the end of 17 days of storage, there was 2.4 log difference between control and treatment 2 eggs, and 2.7 log difference between treatment 1 and treatment 2 eggs.

Table 3.2, and 3.3, there were no significant differences among Mucor,

Cladosporium, and Penicillium, considering maximum specific growth rate and lag time, when control and treatment 1 were compared. The application of shellac coating did not inhibit mold growth during storage. Mucor maximum population range was determined to be significant higher on treatment 1 eggs than control eggs; however, it is hard to prove that shellac coating increase the risk of mold contamination during storage. Since mold growth was achieved by mycelia extension, the barrier property of shellac coating might have prevented vertical mycelia extension through the shell, and thus resulted in more mycelia collection during sample preparation.

Due to the limitation of logistic model, estimated logistic function trend-line could not reasonably represent Cladosporium and Penicillium growth on treatment 2 103

eggs. Using Gompertz modeling as an alternative solution for the modeling approach,

Figure 3.8 shows Penicillium growth data fitted to this model.

Con Trt 1 Trt 2 Control Model Trt 1 Model Trt 2 Model 6 5.5 5 4.5 4 3.5

3 Log10 CFU Log10 2.5 2 1.5 1 1 6 11 16 Days

Figure 3.8 Gompertz modeling example of Penicillium commune growth on commercially-washed eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin-containing shellac (treatment 2). (Trial 3 data). * Detection limit of enumeration method is <100 CFU/egg.

It is clear that Gompertz model underestimated the lag phase of Penicillium growth on control and treatment 1 eggs. Similarly, Penicillium growth on treatment 2 eggs was not fitted correctly with the Gompertz model. According to data in Table 3.7,

Growth kinetic parameters generated with Gompertz model confirmed the observations

104

made on Figure 3.8. The lag phase appeared to be negative, and treatment 2 growth could not be well represented. Similar analytical results were observed on Gompertz modeling on Cladosporium data; as a result, demonstration of anti-fungal effectiveness on shell eggs with modeling approach appeared to be difficult.

Table 3.7 Comparison of Penicillium growth kinetic parameters1 on commercial washed egg samples.

Average and standard deviation3 A (Log µ λ Treatment2 Trials 10 max CFU/egg) (Day-1) (Days) A (Log10 µmax λ CFU/egg) (Day-1) (Days) Trial 1 5.27 0.55 -5.97 5.22 1.02 -3.48 Control Trial 2 5.26 1.40 -2.30 (±0.08)a (±0.43)a (±2.15)a Trial 3 5.13 1.11 -2.18 Trial 1 5.32 0.81 -3.63 5.37 1.00 -2.73 Trt 1 Trial 2 5.48 1.08 -2.56 (±0.10)a (±0.17)a (±0.83)a Trial 3 5.29 1.11 -2.00 Trial 1 2.95 Trt 2 Trial 2 * * * * * (±0.48)4 Trial 3

1 Growth parameters are maximum population (A), maximum specific growth rate (µmax), and lag time (λ) 2 Treatments are washed eggs with no coating (control); washed eggs and coated with shellac (Trt 1) and washed eggs coated with natamycin-containing shellac coating (Trt 2) 3 Averages with different superscripted letter are significantly different. 4 Maximum population (A) for treatment 2 eggs was an average of three replicates using Penicillium population on day 17 of storage. * Reasonable kinetic parameter could not be estimated due to logistic function limitation

105

Comparison between treatment 2 and other treatments were not accomplished with the modeling approach, since logistic and Gompertz model fitting could not represent mold growth on washed eggs under treatment 2. Mold inhibition is more effective on natamycin containing shellac coated eggs than non-coated or shellac coated eggs. Comparison of the final mold population after storage is a common way to show anti-fungal effectiveness. Tables 3.1, 3.2, and 3.3 revealed that, at the end of 17 days of room temperature storage, Mucor, Cladosporium, and Penicillium growth on control washed eggs were 2.3 log, 2.4 log, and 2.3 log more than mold growth on treatment 2 eggs respectively. Similarly, the difference in mold population between treatment 1 and 2 were 3.2, 2.7, and 2.4 log, respectively.

Growth curve results suggested that commercial washed eggs that were stored improperly at 25 °C could be easily contaminated by Mucor, Cladosporium, and

Penicillium. By applying shellac coating that contained 400 µg/ml natamycin on washed egg surface, no Mucor contamination could be observed, and Cladosporium and

Penicillium contamination could be effectively controlled.

3.5.2 Antifungal effectiveness on pasteurized eggs

Pasteurized eggs that have been coated with shellac contained 400 µg/ml natamycin did not develop visible mold. Although data presented in Figure 3.5, 3.6, and

3.7 were from single experiment trial, data from other trails within the same experiment shared similar result patterns. Mucor, Cladosporium, and Penicillium growth on control and treatment 1 eggs were compared using kinetic parameters estimated from logistic model.

106

Data in Table 3.5 reveled that there were no significant difference between maximum specific growth rate and lag time of Cladosporium on control and treatment 1 eggs. According to data in

Table 3.4 and 3.6, maximum population (A), maximum specific growth rate

(µmax), and lag time (λ) were significantly different between control and treatment 1 eggs for both Mucor and Penicillium growth. However, conclusions in regards to the influences of shellac could not be draw from these results. As described in the earlier section, prevention of vertical mycelia extension due to shellac barrier properties could cause more mycelia collection during sample homogenization, which produced higher mold counts that could result in apparently higher maximum population on shellac coated eggs. Therefore, significant difference of maximum population between control and treatment 1 eggs might have been calculated based on less than ideal enumeration results.

Despite the conflicting comparison results between treatment 1 and control maximum population, shellac coating can decreased Mucor and Penicillium growth rate, and extend their lag time on pasteurized eggs according to kinetic parameter comparisons.

Logistic function fitted Cladosporium and Penicillium growth on treatment 2 eggs imperfectly. Gompertz modeling, an alternative modeling approach, was tested using the same set of Cladosporium data from the results section (Figure 3.6). 107

Control Trt 1 Trt 2 Control Model Trt 1 Model Trt 2 Model 7

6

5

4

3 Log10 CFU/egg Log10

2

1 1 6 11 16 Days

Figure 3.9 Modeling example of Cladosporium ramotenellum growth on pasteurized eggs that were uncoated (control), shellac-coated (treatment 1), and coated with natamycin- containing shellac (treatment 2). (Trial 3 data). * Detection limit of enumeration method is <100 CFU/egg.

Figure 3.9 showed that Cladosporium lag phase on control and treatment 1 eggs were underestimated when Gompertz function was used to analyze the data.

Cladosporium growth on treatment 2 eggs were fitted imperfectly with Gompertz model neither. Data from Table 3.7, further illustrated the observations made from Figure 3.9.

The lag phase appeared to be negative, and treatment 2 growth could not be well fitted. 108

Similar analytical results were observed for Gompertz modeling on Penicillium data; therefore, it’s difficult to reveal the anti-fungal effectiveness of natmaycin-shellac coating data with modeling approach.

Table 3.8 Comparison of Cladosporium growth kinetic parameters1 on pasteurized egg samples.

Average and standard 3 deviation 2 A (Log10 µmax λ Treatment Trials -1 CFU/egg) (Day ) (Days) A (Log10 µmax λ CFU/egg) (Day-1) (Days) Trial 1 5.62 1.68 -1.51 5.58 1.37 -2.20 Control Trial 2 5.44 1.40 -1.92 (±0.12)a (±0.34)a (±0.86)a Trial 3 5.67 1.01 -3.16 Trial 1 5.89 1.54 -1.73 5.69 1.54 -1.84 Trt 1 Trial 2 5.59 1.72 -1.63 (±0.17)a (±0.18)a (±0.29)a Trial 3 5.59 1.36 -2.17 Trial 1 2.88 Trt 2 Trial 2 * * * (±0.30)4 Trial 3

1 Growth parameters are maximum population (A), maximum specific growth rate (µmax), and lag time (λ) 2 Treatments are pasteurized eggs with no coating (control); pasteurized eggs coated with shellac (Trt 1) and pasteurized eggs coated with natamycin-containing shellac coating (Trt 2) 3 Averages with different superscripted letter are significantly different. 4 Maximum population (A) for treatment 2 eggs was an average of three replicates using Cladosporium population on day 17 of storage. * Reasonable kinetic parameter could not be estimated due to logistic function limitation

109

Comparison between treatment 2 and other treatments were not accomplished with the modeling approach, since Logistic and Gompertz models could not fit mold growth on washed eggs under treatment 2. Shellac coating contained 400 µg/ml natamycin was effective in inhibiting mold growth. Anti-fungal effectiveness can be showed via comparison between mold populations at the end of storage period. Tables

3.1, 3.2, and 3.3 revealed that, at the end of 17 days of room temperature storage, Mucor,

Cladosporium, and Penicillium growth on control eggs were 2.4 log, 2.7 log, and 2.3 log more than growth on treatment 2 eggs respectively; while these molds grew 3.0 log, 2.8 log, and 2.8 log more on treatment 1 eggs than treatment 2 eggs following the same order.

Growth curve results suggested that pasteurized eggs that were stored improperly at 25 °C could be easily contaminated by Mucor, Cladosporium, and Penicillium. By applying shellac coating that contained 400 µg/ml natamycin on pasteurized egg, no

Mucor contamination could be observed, and Cladosporium and Penicillium contamination could be effectively controlled.

3.6 Conclusion

In presence of high spore counts, both commercial washed eggs and pasteurized eggs were prone to mold contamination when stored at 25 °C. Mold growth on uncoated, or shellac coated eggs increased rapidly under abused storage condition. Mold contamination can be controlled using shellac coating contained 400 µg/ml natamycin.

Both commercial washed and pasteurized eggs that were coated with natmaycin-

110

contained shellac coating had no Mucor contamination detected during the storage period.

Based on the inhibitory concentration obtained (400 µg/ml), the antifungal activity of shellac coating contained 400 µg/ml natamycin was significant. For three mold inoculums: Mucor, Cladosporium, and Penicillium, natamycin treatment reduced mold maximum population (A), decreased mold maximum specific growth rate (µmax), and extend its lag time (λ). Effects were equally significant on both commercial washed and pasteurized eggs. Shellac coating without natamycin enhancement did not possess any significant antifungal activities.

Experimental results suggested that egg surface could be contaminated by mold within the current average storage time for sale (5 days) when storage condition was less ideal. Most eggs in the US are refrigerated and unlikely to be stored at room temperature; however, studied storage condition that simulate situations such as power outage, equipment malfunction, and control software failure should be investigated. In general, mold spoilage of eggs is undesirable, this jeopardizes egg qualities during storage. In order to effectively prevent mold contamination, the use of safe and permitted methods, such as the application of natamycin-shellac coating, in combination with cGMP is essential to the overall quality assurance program.

111

3.7 Reference

Bradley, F. A., & King, A. J. (2006). Egg Basics for the Consumer : Packaging , Storage

, and Nutritional Information, 1–6.

Caner, C. (2005). The effect of edible eggshell coatings on egg quality and consumer

perception. Journal of the Science of Food and Agriculture, 85(11), 1897–1902.

doi:10.1002/jsfa.2185

Fajardo, P., Martins, J. T., Fuciños, C., Pastrana, L., Teixeira, J. A., & Vicente, A. A.

(2010). Evaluation of a chitosan-based edible film as carrier of natamycin to

improve the storability of Saloio cheese. Journal of Food Engineering, 101(4), 349-

356. doi:10.1016/j.jfoodeng.2010.06.029

FDA. (2014). GRAS Notification use of natamycin in yoghurt, (GRN No. 517).

Retrieved from

http://www.accessdata.fda.gov/scripts/fdcc/?set=GRASNotices&id=517

Forsythe, R. H. (1970). Egg processing technology-Progress and sanitation programs.

Journal of Milk and Food Technology (JMFT), 33(2), 64-73.

Hamm, D., Searcy, G. K., & Mercuri, A. J. (1974). A study of the waste wash water from

egg washing machines. Poultry Science, 53(1), 191-197. doi: 10.3382/ps.0530191

McKellar, R.C. (1997). A heterogeneous population model for the analysis of bacterial

growth kinetics. International Journal of Food Microbiology, 36(2), 179–186.

doi:10.1016/S0168-1605(97)01266-X

Perry, J. J., Rodriguez‐Saona, L. E., & Yousef, A. E. (2011). Quality of Shell Eggs

Pasteurized with Heat or Heat‐Ozone Combination during Extended Storage.

Journal of food science, 76(7), S437-S444. doi:10.1111/j.1750-3841.2011.02294.x 112

Perry, J. J., & Yousef, A. E. (2013). Factors Affecting Thermal Resistance of Salmonella

enterica Serovar Enteritidis ODA 99-30581-13 in Shell Egg Contents and Use of

Heat-Ozone Combinations for Egg Pasteurization. Journal of Food Protection®,

76(2), 213-219.

Romanoff, A. L., & Romanoff, A. J. (1949). The avian egg. New York: J. Wiley.

Range, P., & Carolina, N. (2016). Egg market news report, 63(10), 2015–2017.

Rao, C. Y., Riggs, M. A., Chew, G. L., Muilenberg, M. L., Thorne, P. S., Van Sickle, D.,

Dunn, K.H., Brown, C. (2007). Characterization of airborne molds, endotoxins, and

glucans in homes in New Orleans after Hurricanes Katrina and Rita. Applied and

Environmental Microbiology, 73(5), 1630–1634. doi:10.1128/AEM.01973-06

Resa, C. P. O., Jagus, R. J., & Gerschenson, L. N. (2014). Natamycin efficiency for

controlling yeast growth in models systems and on cheese surfaces. Food Control,

35(1), 101-108. doi:10.1016/j.foodcont.2013.06.049

Robinson, R. K., Batt, C. A., & Patel, P. D. (2000). Encyclopedia of food microbiology.

San Diego: Academic Press.

Sinigaglia, M., Corbo, M. R., & Bevilacqua, A. (2012). 28 Modeling microbial growth.

Decontamination of Fresh and Minimally Processed Produce.

Swinnen, I. A. M., Bernaerts, K., Dens, E. J. J., Geeraerd, A. H., & Van Impe, J. F.

(2004). Predictive modelling of the microbial lag phase: A review. International

Journal of Food Microbiology, 94(2), 137–159.

doi:10.1016/j.ijfoodmicro.2004.01.006

United States Department of Agriculture (USDA). (2000). Egg-Grading Manual.

Agricultural Handbook, (75), 12. Retrieved from 113

http://aem.asm.org/content/56/6/1875.short

Zwietering, M. H., Jongenburger, I., Rombouts, F. M., & Van't Riet, K. (1990). Modeling

of the bacterial growth curve. Applied and environmental microbiology, 56(6),

1875-1881.

114

Appendix

Calculation of Natamycin Minimum Inhibitory Concentration When Applied on Shell

Eggs

Natamycin minimum inhibitory concentration (MIC) was estimated using coated disk/agar diffusion assay on PDA plates. The estimated MIC is based on the concentration of natamycin in the shellac coating mixture. This mixture is composed of shellac, natamycin, ethanol, and methanol. The calculation is done in eight steps:

1. Weight of natamycin containing shellac mixture was obtained, and its density was

determined by divided coating mixture weight by coating mixture volume.

2. Weight percentage of both natamycin and shellac in the coating mixture was

calculated using Eq 1.

(Wshellac + Wnatamycin) / (Woriginal shellac suspension + Wnatamycin suspension) = Weight % Eq 1

3. Weight of shellac and natamycin applied on shell eggs were measured.

4. Weight of shellac and natamycin applied (from step 3) was divided by weight

percentage of natamycin and shellac (from step 2) to obtain the total weight of

natamycin-shellac coating mixture applied on shell eggs Eq 2.

115

(Wshellac+ Wnatamycin) / Weight% = Wtotal Eq2

5. Volume of natamycin containing shellac mixture can be obtained by using the

total weight (from step 4) divided by its density (from step 1).

6. Since ratio of natamycin suspension used in natamycin containing shellac coating

mixture was known, the natamycin solution volume applied can be determined.

7. From the natamycin solution volume determined, weight of natamycin applied on

shell eggs can be calcualted.

8. Natamycin weight per egg weight (FDA regulation format) can be estimated with

actual natamycin applied weight divided by shell egg weight (mg/kg).

The calculation result indicates how much natamycin is used on shell egg surface treatment; as a result, the estimated value can be used for FDA regulation compliance measures.

116

List of Reference

Andrews, J. M. (2001). Determination of minimum inhibitory concentrations. The

Journal of Antimicrobial Chemotherapy, 48 (1), 5–16.

http://doi.org/10.1093/jac/48.suppl_1.5

Appendini, P., & Hotchkiss, J. H. (20`02). Review of antimicrobial food packaging.

Innovative Food Science and Emerging Technologies, 3(2), 113–126.

doi:10.1016/S1466-8564(02)00012-7

Australian Egg Corporation Limited. (2009). Code of Practice for Shell Egg Production,

Grading, Packing and Distribution.Retrived from

https://www.aecl.org/assets/Uploads/Resources/Code-of-Practice-for-Shell-egg-

production-grading-packing-and-distribution-2009.pdf

Baker, R. A., Baldwin, E. A., & Nisperos-Carriedo, M. O. (1994). Edible coatings and

films for processed foods. In J.M. Krochta, E. A. Baldwin, & M. O. Nisperos-

Carriedo (Eds). Edible coatings and films to improve food quality. Lancaster, PA.

Technomic Publ.

Baldwin, E. A, Nisperos-Carriedo, M. O., & Baker, R. A. (1995). Use of edible coatings

to preserve quality of lightly (and slightly) processed products. Critical Reviews

in Food Science and Nutrition, 35(6), 509–524. doi:10.1080/10408399509527713

Baldwin, E. A., Nisperos, M. O., Chen, X., & Hagenmaier, R. D. (1996). Improving

117

storage life of cut apple and potato with edible coating. Postharvest Biology and

Technology, 9(2), 151–163. doi:10.1016/S0925-5214(96)00044-0

Bell, D. D., Weaver, W. D., & North, M. O. (2002). Commercial chicken meat and egg

production (5th ed). Norwell, MA: Kluwer Academic.

Belyavin, C.G., Boorman, K.N.(1980. The influence of the cuticle on egg-shell strength.

British Poultry Science, 21, 295–298.

Bennett, J. W., & Klich, M. (2003). Mycotoxins. Clinical Microbiology Reviews, 16(3),

497–516. doi:10.1128/CMR.16.3.497-516.2003

Bierhalz, A. C. K., Da Silva, M. A., & Kieckbusch, T. G. (2012). Natamycin release from

alginate/pectin films for food packaging applications. Journal of Food

Engineering, 110(1), 18–25. doi:10.1016/j.jfoodeng.2011.12.016

Binz, P. A., & Kägi, J. H.R. (1999). Metallothionein: molecular evolution and

classification. In C. D. Klaassen (Ed.), Metallothionein IV (pp. 7-13). Basel:

Birkhä user Verlag.

Blunden, G., Roch, O. G., Rogers, D. J., Coker, R. D., Bradburn, N., & John, A. E.

(1991). Mycotoxins in food. Medical laboratory sciences, 48(4), 271–282.

Board, R.G., & Hall, N.A. (1973). The cuticle: a barrier to liquid and particle penetration

of the shell of the hen’s egg. British Poultry Science 14 (1): 69-97.

doi:10.1080/00071667308415999

Bosquez-Molina, E., Guerrero-Legarreta, I., & Vernon-Carter, E. J. (2003). Moisture

118

barrier properties and morphology of mesquite gum-candelilla wax based edible

emulsion coatings. Food Research International, 36(9-10), 885–893.

doi:10.1016/S0963-9969(03)00097-8

Bourtoom, T. (2008). Edible films and coatings : characteristics and properties.

International Food Research Journal, 15(3), 237–248.

Bovee, E. C., & Jahn, T. L. (1966). Mechanisms or Movement in Taxonomy or Sarcodina

. III . Orders , Suborders , Families , ana Subramilies in tne Superorder Lobida.

Systematic Biology, 15(3), 229–240.

Bradley, F. A., & King, A. J. (2006). Egg Basics for the Consumer : Packaging , Storage

, and Nutritional Information, 1–6.

Brik, H. (1976). New high-molecular decomposition products of natamycin (pimaricin)

with intact lactone-ring. The Journal of antibiotics, 29(6), 632-637.

http://doi.org/10/7164/antibiotics.29.632

Brik, H. (1994) Natamycin. Analytical Profiles of Drug Substances, 10, 513-561. doi:

10.1016/S0099-5428(08)60650-4

Burley, R.W., & Vadehra, D.V. (1989) The Avian Egg: Chemistry and Biology. New

York: Wiley.

Cagri, A., Ustunol, Z., & Ryser, E. T. (2001). Antimicrobial, Mechanical, and Moisture

Barrier Properties of Low pH Whey Protein‐based Edible Films Containing p‐

Aminobenzoic or Sorbic Acids. Journal of Food Science, 66(6), 865-870.

119

doi:10.1111/j.1365-2621.2001.tb15188.x

Campos, C. A., Gerschenson, L. N., & Flores, S. K. (2011). Development of Edible Films

and Coatings with Antimicrobial Activity. Food and Bioprocess Technology,

4(6), 849–875. doi:10.1007/s11947-010-0434-1

Caner, C. (2005). The effect of edible eggshell coatings on egg quality and consumer

perception. Journal of the Science of Food and Agriculture, 85(11), 1897–1902.

doi:10.1002/jsfa.2185

Carmichael, J.W. (1955). Lacto-fuchsin: a new medium for mounting fungi. Mycologia

47(4), 611.

Cha, D. S., Cooksey, K., Chinnan, M. S., & Park, H. J. (2003). Release of nisin from

various heat-pressed and cast films. LWT - Food Science and Technology, 36(2),

209–213. doi:10.1016/S0023-6438(02)00209-8

Chang, C. F., & Hamilton, P. B. (1982). Increased severity and new symptoms of

infectious bursal disease during aflatoxicosis in broiler chickens. Poultry Science,

61(6), 1061–1068. doi: 10.3382/ps.0611061

Chen, H. (1995). Functional properties and applications of edible films made of milk

proteins. Journal of Dairy Science, 78(11), 2563–2583. doi:10.3168/jds.S0022-

0302(95)76885-0

Cotterill, O.J., & Geiger, G.S. (1977) Egg product yield trends from shell eggs. Poultry

Sciences 56(3): 1027–1031. doi: 10.3382/ps.0561027

120

Dalgaard, P., & Koutsoumanis, K. (2001). Comparison of maximum specific growth

rates and lag times estimated from absorbance and viable count data by different

mathematical models. Journal of Microbiological Methods, 43(3), 183-196.

doi:10.1016/S0167-7012(00)00219-0

Davey, K. R. (1989). A predictive model for combined temperature and water activity on

microbial growth during the growth phase. Journal of Applied Bacteriology,

67(5),483-488. doi:10.1111/j.1365-2672.1989.tb02519.x

Debeaufort, F., Quezada-Gallo, J.A., & Voilley, A. (1998). Edible Films and Coatings:

Tomorrow’s Packagings: A Review. Critical Reviews in Food Science and

Nutrition, 38(4), 299–313. doi:10.1080/10408699891274219

Dekker A. (2012), Effect of sorbate and Natamycin on US yogurt starter cultures and

yeast inhibition. Unpublished internal DFS study (#00058521).

Devlieghere, F., Vermeiren, L., & Debevere, J. (2004). New preservation technologies:

Possibilities and limitations. International Dairy Journal, 14(4), 273–285.

doi:10.1016/j.idairyj.2003.07.002

Donald, W. W., & Mirocha, C. J. (1977). Chitin as a measure of fungal growth in soured

corn and soybean seed. Cereal Chemistry, 54(3), 466-474.

Easter, M. (2003). Hygiene monitoring in support of food safety–a review of methods

and industry trends. Acedido em Janeiro, 12, 2008.

Edward, D. G., & Freundt, E. A. (1956). The classification and nomenclature of

121

organisms of the pleuropneumonia group. Journal of General Microbiology, 14,

197–207.

European Commission (EC). (2008). Commission Regulation (EC) No 589/2008 of 23

June 2008 laying down detailed rules for implementing Council Regulation (EC)

No 1237/2007 as regards marketing standards for eggs. Official Journal of the

European Union L163/6:6.

Fajardo, P., Martins, J. T., Fuciños, C., Pastrana, L., Teixeira, J. A., & Vicente, A. A.

(2010). Evaluation of a chitosan-based edible film as carrier of natamycin to

improve the storability of Saloio cheese. Journal of Food Engineering, 101(4),

349–356. doi:10.1016/j.jfoodeng.2010.06.029

Falguera, V., Quintero, J. P., Jiménez, A., Muñoz, J. A., & Ibarz, A. (2011). Edible films

and coatings: Structures, active functions and trends in their use. Trends in Food

Science and Technology, 22(6), 292–303. doi:10.1016/j.tifs.2011.02.004

FDA. (2014). GRAS Notification use of natamycin in yoghurt, (GRN No. 517).

Retrieved from

http://www.accessdata.fda.gov/scripts/fdcc/?set=GRASNotices&id=517

Food and Drug Administration (1998) Food additives permitted for direct addition to

food for human consumption: Natamycin (pimaricin), Final rule, Fed. Reg., Vol

63, No 230, 66015

Food and Drug Administration (2014) GRAS Notification for the Use of Natamycin in

122

Yogurt.

Forsythe, R. H. (1970). Egg processing technology-Progress and sanitation programs.

Journal of Milk and Food Technology (JMFT), 33(2), 64-73.

Frisvad, J. C., Frank, J. M., Houbraken, J. A. M. P., Kuijpers, A. F., & Samson, R. A.

(2004). New ochratoxin A producing species of Aspergillus section

Circumdati. Studies in Mycology, 50(1), 23-43.

Fu, C., Liu, T., Li, L., Liu, H., Chen, D., & Tang, F. (2013). The absorption, distribution,

excretion and toxicity of mesoporous silica nanoparticles in mice following

different exposure routes. Biomaterials, 34(10), 2565–2575.

doi:10.1016/j.biomaterials.2012.12.043

Galagan, J. E., Henn, M. R., Ma, L. J., Cuomo, C. A., & Birren, B. (2005). Genomics of

the fungal kingdom: Insights into eukaryotic biology. Genome Research, 15(12),

1620–1631. doi:10.1101/gr.3767105

Galiş, A. M., Marcq, C., Marlier, D., Portetelle, D., Van, I., Beckers, Y., & Théwis, A.

(2013). Control of Salmonella contamination of shell eggs—Preharvest and

postharvest methods: A review. Comprehensive Reviews in Food Science and

Food Safety, 12(2), 155-182.doi:10.1111/1541-4337.12007

Gardner, J. W., & Bartlett, P. N. (1994). A brief history of electronic noses. Sensors and

Actuators B: Chemical, 18(1), 210-211. doi:10.1016/0925-4005(94)87085-3

123

Gerloff, G. C., Fitzgerald, G. P., & Skoog, F. (1950). The isolation, purification, and

culture of blue-green algae. American Journal of Botany, 216-218.

Guarro, J., Gené, J., & Stchigel, A. M. (1999). Developments in fungal taxonomy.

Clinical microbiology reviews, 12(3), 454-500.

Guilbert, S., Gontard, N., & Cuq, B. (1995). Technology and applications of edible

protective films. Packaging Technology and Science, 8(6), 339-346.

DOI: 10.1002/pts.2770080607

Gulich, A., & Fitzgarald, J. (1964). USDA Egg Grading Manual, No. 75. Washington:

Agric Marketing Service.

Hagenmaier, R. D., & Shaw, P. E. (1991). Permeability of Shellac Coatings to Gases and

Water Vapor. Journal of Agricultural and Food Chemistry, 39(5), 825-

829.doi:10.1021/jf00005a001

Hamm, D., Searcy, G. K., & Mercuri, A. J. (1974). A study of the waste wash water from

egg washing machines. Poultry Science, 53(1), 191-197. doi: 10.3382/ps.0530191

Han, C., Lederer, C., McDaniel, M., & Zhao, Y. (2005). Sensory evaluation of fresh

strawberries (Fragaria ananassa) coated with chitosan‐based edible

coatings. Journal of Food Science, 70(3), S172-S178. doi: 10.1111/j.1365-

2621.2005.tb07153.x

Hincke, M. T., Nys, Y., Gautron, J., Mann, K., Rodriguez-Navarro, A. B., & McKee, M.

D. (January 01, 2012). The eggshell: Structure, composition and

124

mineralization. Frontiers in Bioscience, 17(4), 1266-1280.

Hocking, A. D. (1990). Responses of fungi to modified atmospheres. In E. Highley, H. J.

Banks, & B. R. Champ, Eds. Fumigation and Controlled Atmosphere Storage of

Grain: Proceedings of an International Conference, Singapore, 14-18 February

1989. (pp 70–82). Canberra: Australian Centre for International Agricultural

Research.

Holzapfel, W. H. (2002). Appropriate starter culture technologies for small-scale

fermentation in developing countries. International Journal of Food

Microbiology, 75(3), 197–212. doi:10.1016/S0168-1605(01)00707-3

Hosseini, M. H., Razavi, S. H., & Mousavi, M. A. (2009). Antimicrobial, physical and

mechanical properties of chitosan-based films incorporated with thyme, clove and

cinnamon essential oils. Journal of Food Processing and Preservation, 33(6),

727–743. doi:10.1111/j.1745-4549.2008.00307.x

Huang, J.C., Yang, J.W., Lai, W. D., Song, M. D., Feng, D., & Lin, J. Y. (2003).

Impedance method for rapid detection of total counts of bacteria and fungi in

bottled purified water. Journal of AOAC International, 86(4), 719-721.

Inglis, P. W., & Tigano, M. S. (2006). Identification and taxonomy of some

entomopathogenic Paecilomyces spp. (Ascomycota) isolates using rDNA-ITS

sequences. Genetics and Molecular Biology, 29(1), 132–136.

http://doi.org/10.1590/S1415-47572006000100025

125

Janisiewicz, W. J., & Roitman, J. (1988). Biological control of blue mold and gray mold

on apple and pear with Pseudomonas cepacia. Phytopathology, 78(12), 1697-

1700.

Jarvis, B., Seiler, D. A. L., Ould, A. J. L., & Williams, A. P. (1983). Observations on the

enumeration of moulds in food and feedingstuffs. Journal of Applied

Bacteriology, 55(2), 325-336. doi: 10.1111/j.1365-2672.1983.tb01329.x

Jones, E. B. G., & Moss, S. T. (1978). Ascospore appendages of marine ascomycetes: An

evaluation of appendages as taxonomic criteria. Marine Biology, 49(1), 11–26.

doi:10.1007/BF00390726

Kamper, S. L., & Fennema, O. (1984). Water vapor permeability of edible bilayer films.

Journal of Food Science, 49(6), 1478–1481.doi: 10.1111/j.1365-

2621.1984.tb12825.x

Kester, J.J., & Fennema, O.R. (1986). Edible films and coatings: a review. Food

Technology, 40(12), 47-59.

King, R. A., Preston, C. D., & Croft, J. M. (2001). Molecular confirmation of

Potamogeton× bottnicus (P. pectinatus× P. vaginatus, Potamogetonaceae) in

Britain. Botanical Journal of the linnean society, 135(1), 67-70.

Klis, J. B., Witter, L. D., & Ordal, Z. J. (1959). The effect of several antifungal

antibiotics on the growth of common food spoilage fungi. Food

Technology, 13(2), 124-128.

126

Koninklijke Nederlandsche Gist- en Spiritus-Fabriek N.V. (KNG&SF) (1957) Werkwijze

ter bereiding van een antibioticum met behulp van een Streptomyces-soort. NL

Octrooi no 87323

Kurtzman, C. P., & Robnett, C. J. (2003). Phylogenetic relationships among yeasts of the

‘Saccharomyces complex’determined from multigene sequence analyses. FEMS

yeast research, 3(4), 417-432. DOI: http://dx.doi.org/10.1016/S1567-

1356(03)00012-6

Levinskas, G. J., Ribelin, W. E., & Shaffer, C. B. (1966). Acute and chronic toxicity of

pimaricin. Toxicology and applied pharmacology, 8(1), 97-109.

doi:10.1016/0041-008X(66)90105-0

López, S., Prieto, M., Dijkstra, J., Dhanoa, M. S., & France, J. (2004). Statistical

evaluation of mathematical models for microbial growth. International journal of

food microbiology, 96(3), 289-300. doi:10.1016/j.ijfoodmicro.2004.03.026

Lu, H., Schmidt, M. A., & Jensen, K. F. (2005). A microfluidic electroporation device for

cell lysis. Lab on a Chip, 5(1), 23-29.

Lumbsch, H. T., & Huhndorf, S. M. (2007). Outline of Ascomycota. Myconet, 13, 1–58.

Manninen, M. T., Fung, D. Y. C., & Hart, R. A. (1990). Spiral system and laser colony

scanner for enumeration of microorganisms. Journal of food safety, 11(3), 177-

187. DOI: 10.1111/j.1745-4565.1990.tb00049.x

Mathlouthi, M. (2001). Water content, water activity, water structure and the stability of

127

foodstuffs. Food Control, 12(7), 409–417. doi:10.1016/S0956-7135(01)00032-9

McHugh, T. H. (2000). Protein-lipid interactions in edible films and coatings.

Food/Nahrung, 44(3), 148–151. doi:10.1002/1521-

3803(20000501)44:3<148::AID-FOOD148>3.0.CO;2-P

McKee, L. H. (1995). Microbial contamination of spices and herbs: A review. LWT -

Food Science and Technology, 28(1), 1–11. doi:10.1016/S0023-6438(95)80004-2

McKellar, R.C. (1997). A heterogeneous population model for the analysis of bacterial

growth kinetics. International Journal of Food Microbiology, 36(2), 179–186.

doi:10.1016/S0168-1605(97)01266-X

Mislivec, P. B., & Bruce, V. R. (1977). Incidence of toxic and other mold species and

genera in soybeans. Journal of Food Protection®, 40(5), 309-312. Avaiblable

from

http://www.ingentaconnect.com/content/iafp/jfp/1977/00000040/00000005/art000

05

Moss, M. O. (2008). Fungi, quality and safety issues in fresh fruits and vegetables.

Journal of Applied Microbiology, 104(5), 1239–1243. doi:10.1111/j.1365-

2672.2007.03705.x

Newcomer, V. D., Sternberg, T. H., Wright, E. T., Reisner, R. M., McNall, E. G., &

Sorensen, L. J. (1960). The treatment of systemic mycoses with orally

administered pimaricin: preliminary report. Annals of the New York Academy of

128

Sciences, 89(1), 240-246. DOI: 10.1111/j.1749-6632.1960.tb20145.x

Newell, S. Y., Arsuffi, T. L., & Fallon, R. D. (1988). Fundamental procedures for

determining ergosterol content of decaying plant material by liquid

chromatography. Applied and Environmental Microbiology, 54(7), 1876–1879.

Retrieved from http://aem.asm.org/content/54/7/1876.short

Nicholson, C. (1991). Some notes on shellac. Conservation News (United Kingdom

Institute for Conservation of Historic and Artistic Works), (44), 15–17.

Notermans, S., Heuvelman, C. J., Van Egmond, H. P., Paulsch, W. E., & Besling, J. R.

(1986). Detection of mold in food by enzyme-linked immunosorbent

assay. Journal of Food Protection®, 49(10), 786-791. Retrieved from

http://www.ingentaconnect.com/content/iafp/jfp/1986/00000049/00000010/art000

04#expand/collapse

Okubo T, Akachi S, Hatta H (1997) Structure of hen eggs and physiology of egg laying.

In: T.Yamamoto, L.R. Juneja, H, Hatta, M. Kim M (Eds). Hen Eggs: Their Basic

and Applied Science. Boca Raton, FL: CRC Press

Ouattara, B., Simard, R. E., Piett, G., Bégin, A, & Holley, R. A. (2000). Inhibition of

surface spoilage bacteria in processed meats by application of antimicrobial films

prepared with chitosan. International Journal of Food Microbiology, 62(1-2),

139–148. doi:10.1016/S0168-1605(00)00407-4

Patel, P. D., & Williams, A. P. (1985). A note on estimation of food spoilage yeasts by

129

measurement of adenosine triphosphate (ATP) after growth at various

temperatures. Journal of Applied Bacteriology, 59(2), 133-136.

DOI: 10.1111/j.1365-2672.1985.tb03311.x

Pedersen, J. C. (1992). Natamycin as a fungicide in agar media. Applied and

Environmental Microbiology, 58(3), 1064-1066. Retrieved from:

http://aem.asm.org/content/58/3/1064.short.

Perry, J. J., Rodriguez-Saona, L. E., & Yousef, A. E. (2011). Quality of Shell Eggs

Pasteurized with Heat or Heat-Ozone Combination during Extended Storage.

Journal of Food Science, 76(7), 437-444. doi:10.1111/j.1750-3841.2011.02294.x

Perry, J. J., & Yousef, A. E. (2013). Factors affecting thermal resistance of Salmonella

enterica serovar enteritidis ODA 99-30581-13 in shell egg contents and use of

heat-ozone combinations for egg pasteurization. Journal of Food Protection,

76(2), 213–219. doi:10.4315/0362-028X.JFP-12-324

Pintado, C. M., Ferreira, M. A., & Sousa, I. (2009). Properties of whey protein–based

films containing organic acids and nisin to control Listeria

monocytogenes. Journal of Food Protection®, 72(9), 1891-1896. Retrieved from

http://www.ingentaconnect.com/content/iafp/jfp/2009/00000072/00000009/art000

12

Pintado, C. M., Ferreira, M. A., & Sousa, I. (2010). Control of pathogenic and spoilage

microorganisms from cheese surface by whey protein films containing malic acid,

130

nisin and natamycin. Food Control, 21(3), 240-246.

doi:10.1016/j.foodcont.2009.05.017

Pitt, J. I., & Hocking, A. D. (2009). Fungi and food spoilage (Vol. 519). New York:

Springer.

Pitt, J. I., & HOCKING, A. D. (1977). Influence of solute and hydrogen ion

concentration on the water relations of some xerophilic

fungi. Microbiology,101(1), 35-40. doi: 10.1099/00221287-101-1-35

Ponce, A. G., Roura, S. I., del Valle, C. E., & Moreira, M. R. (2008). Antimicrobial and

antioxidant activities of edible coatings enriched with natural plant extracts: In

vitro and in vivo studies. Postharvest Biology and Technology, 49(2), 294–300.

doi:10.1016/j.postharvbio.2008.02.013

Powers, E. M., & Berkowitz, D. (1990). Efficacy of an oxygen scavenger to modify the

atmosphere and prevent mold growth on meal, ready-to-eat pouched

bread. Journal of Food Protection®, 53(9), 767-771. Retrieved from

http://www.ingentaconnect.com/content/iafp/jfp/1990/00000053/00000009/art000

09

Range, P., & Carolina, N. (2016). Egg market news report, 63(10), 2015–2017.

Rao, C. Y., Riggs, M. A., Chew, G. L., Muilenberg, M. L., Thorne, P. S., Van Sickle, D.,

Dunn, K.H. Brown, C. (2007). Characterization of airborne molds, endotoxins,

and glucans in homes in New Orleans after Hurricanes Katrina and Rita. Applied

131

and Environmental Microbiology, 73(5), 1630–1634.

http://doi.org/10.1128/AEM.01973-06

Resa, C. P. O., Jagus, R. J., & Gerschenson, L. N. (2014). Natamycin efficiency for

controlling yeast growth in models systems and on cheese surfaces. Food Control,

35(1), 101-108. doi:10.1016/j.foodcont.2013.06.049

Richard, J. L. (2007). Some major mycotoxins and their mycotoxicoses-An overview.

International Journal of Food Microbiology, 119(1-2), 3–10.

doi:10.1016/j.ijfoodmicro.2007.07.019

Robinson, R. K., Batt, C. A., & Patel, P. D. (2000). Encyclopedia of food microbiology.

San Diego: Academic Press.

Romanoff, A. L., & Romanoff, A. J. (1949). The avian egg. New York: J. Wiley.

Sanjurjo, K., Flores, S., Gerschenson, L., & Jagus, R. (2006). Study of the performance

of nisin supported in edible films. Food Research International, 39(6), 749–754.

doi:10.1016/j.foodres.2006.01.016

Santiago, A. L. C. M. D. A., Cavalcanti, M. A. Q., & Trufem, S. F. B. (2008). Mucor

guilliermondii (Mucorales): a rare species found in herbivore dung from

Neotropics. Mycotaxon, 106, 103–108.

Schmidt, K. A. (2004). Food Processing: Principles and Applications, 1–10.

Scott, W. J. (1957). Water Relations of Food Spoilage Microorganisms. Advances in

Food Research, 7(C), 83–127. doi:10.1016/S0065-2628(08)60247-5

132

Seydim, A. C., & Sarikus, G. (2006). Antimicrobial activity of whey protein based edible

films incorporated with oregano, rosemary and garlic essential oils. Food

Research International, 39(5), 639–644. doi:10.1016/j.foodres.2006.01.013

Shahani K.M., Bullerman L.B., Barahart H.M. and Hortung T.E. (1973), Effect of an

antifungal, pimaricin, upon the retardation of food spoilage and incidence of

toxins. Proc. 1st International Congress for Bacteriology, 2, 41.

Shen, X. L., Wu, J. M., Chen, Y., & Zhao, G. (2010). Antimicrobial and physical

properties of sweet potato starch films incorporated with potassium sorbate or

chitosan. Food Hydrocolloids, 24(4), 285–290.

doi:10.1016/j.foodhyd.2009.10.003

Sinigaglia, M., Corbo, M. R., & Bevilacqua, A. (2012). Modeling microbial growth. In

V. M. Gómez-López (Ed).Decontamination of fresh and minimally processed

produce (pp. 529-539). Oxford, UK: Blackwell.

DOI: 10.1002/9781118229187.ch28

Stadelman, W.J. (1995). Egg production practices. In: Stadelman, W.J., Cotterill, O.J.

(Eds). Egg Science and Technology (4th ed), (pp.9-37). New York: Food

Products Press.

Stark, J. (2003). Natamycin, an effective fungicide for food and beverages in natural

133

antimicrobials for the minimal processing of foods. In S. Roller (Ed.), Natural

antimicrobials for the minimal processing of foods (pp. 82-97). Cambridge, UK:

Woodhead Publishing.

Swinnen, I. A. M., Bernaerts, K., Dens, E. J., Geeraerd, A. H., & Van Impe, J. F. (2004).

Predictive modelling of the microbial lag phase: a review. International journal of

food microbiology, 94(2), 137-159. doi:10.1016/j.ijfoodmicro.2004.01.006

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6:

Molecular evolutionary genetics analysis version 6.0. Molecular Biology and

Evolution, 30(12), 2725–2729. http://doi.org/10.1093/molbev/mst197

Te Welscher, Y. M., Ten Napel, H. H., Balagué, M. M., Souza, C. M., Riezman, H., De

Kruijff, B., & Breukink, E. (2008). Natamycin blocks fungal growth by binding

specifically to ergosterol without permeabilizing the membrane. Journal of

Biological Chemistry, 283(10), 6393–6401.

http://doi.org/10.1074/jbc.M707821200

Theys, T. E., Geeraerd, A. H., Verhulst, A., Poot, K., Van Bree, I., Devlieghere, & Van

Impe, J. F. (2008). Effect of pH, water activity and gel micro-structure, including

oxygen profiles and rheological characterization, on the growth kinetics of

Salmonella Typhimurium. International journal of food microbiology, 128(1), 67-

77. doi:10.1016/j.ijfoodmicro.2008.06.031

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6:

134

Molecular evolutionary genetics analysis version 6.0. Molecular Biology and

Evolution, 30(12), 2725–2729. doi:10.1093/molbev/mst197

Taylor, J. W. (1995). Making the Deuteromycota redundant: a practical integration of

mitosporic and meiosporic fungi. Canadian Journal of Botany, 73(S1), 754–759.

doi:10.1139/b95-319

Te Welscher, Y. M., van Leeuwen, M. R., de Kruijff, B., Dijksterhuis, J., & Breukink, E.

(2012). Polyene antibiotic that inhibits membrane transport proteins. Proceedings

of the National Academy of Sciences, 109(28), 11156-11159. doi:

10.1073/pnas.1203375109

Thomas, C., & Swayne, D. E. (2007). Thermal inactivation of H5N1 high pathogenicity

avian influenza virus in naturally infected chicken meat. Journal of Food

Protection®, 70(3), 674-680.

Tognon, G., Campagnoli, A., Pinotti, L., Dell'Orto, V., & Cheli, F. (2005).

Implementation of the electronic nose for the identification of mycotoxins in

durum wheat (Triticum durum). Veterinary research communications, 29, 391-

393.doi: 10.1007/s11259-005-0089-y

United States Department of Agriculture (USDA). (2000). Egg-Grading Manual.

Agricultural Handbook, (75), 12.

USDA. (2016). Egg market news report. Retrieved from

https://www.ams.usda.gov/mnreports/pybshellegg.pdf

135

Vaclavik, V., & Christian, E. W. (2008). Essentials of food science (3rd ed.). New York,

NY: Springer.

Van der Vossen, J. M. B. M., Rahaoui, H. A. K. I. M., De Nijs, M. W. C. M., & Hartog,

B. J. (2003). PCR methods for tracing and detection of yeasts in the food chain. In

T. Boekhout; & V. Roberts (Eds.). Yeasts in food (pp. 123-138). Hamburg: Behr's

Verlag.

Verhulst, P. F. (1838). Notice sur la loi que la population suit dans son accroissement.

Correspondance Mathématique et Physique Publiée par A. Quetelet, 10, 113-121.

Vieira, M. G. A., Da Silva, M. A., Dos Santos, L. O., & Beppu, M. M. (2011). Natural-

based plasticizers and biopolymer films: A review. European Polymer Journal,

47(3), 254–263. doi:10.1016/j.eurpolymj.2010.12.011

Vilgalys, R., Smith, M., Talbot, J., Branco, S., Smith, D., & Gilbertson, R. L. (2012).

Newsletter of the Mycological Society of America, 63(June), 277–304.

Wang, Q., Larese-Casanova, P., & Webster, T. J. (2015). Inhibition of various gram-

positive and gram- negative bacteria growth on selenium nanoparticle coated

paper towels. International Journal of Nanomedicine, 10, 2885–2894.

http://doi.org/10.2147/IJN.S78466

Wheeler, K. A., Hurdman, B. F., & Pitt, J. I. (1991). Influence of pH on the growth of

some toxigenic species of Aspergillus, Penicillium and Fusarium. International

Journal of Food Microbiology, 12(2), 141–149. doi:10.1016/0168-

136

1605(91)90063-U

WHO. (2011). Mycotoxins. Children’s Health and the Environment, 1–42.Retrieved

from http://www.who.int/ceh/capacity/mycotoxins.pdf

Windhorst, H.W. (2007). Changes in the structure of global egg production. World's

Poultry Science Journal, 23(6), 24–25.Retrieved from

http://www.worldpoultry.net/PageFiles/23639/001_boerderij-download-

WP6839D01.pdf

Wijtzes, T., De Wit, J. C., Van't, R., & Zwietering, M. H. (1995). Modelling bacterial

growth of Lactobacillus curvatus as a function of acidity and temperature. Applied

and environmental microbiology, 61(7), 2533-2539. Retrieved from

http://aem.asm.org/content/61/7/2533.short.

Yamamoto, T., Juneja, L.R., Hatta, H., Kim, M. (eds). (1997). Hen Eggs: Their Basic and

Applied Science. Boca Raton, FL: CRC Press.

Yu, Z., & Morrison, M. (2004). Improved extraction of PCR-quality community DNA

from digesta and fecal samples. Biotechniques, 36(5), 808-813.

Zeidler, G. (2002). Further-processing eggs and egg products. In: D. Bell, W. D. Weaver,

& M. O. North (Eds). Commercial Chicken Meat and Egg Production (5th ed),

(pp.1163-1197). Norwell, Mass: Kluwer Academic Publishers.

Ziani, K., Fernández-Pan, I., Royo, M., & Mate, J. I. (2009). Antifungal activity of films

and solutions based on chitosan against typical seed fungi. Food Hydrocolloids,

137

23(8), 2309–2314. doi:10.1016/j.foodhyd.2009.06.005

Zwietering, M. H., Jongenburger, I., Rombouts, F. M., & Van't Riet, K. (1990).

Modeling of the bacterial growth curve. Applied and environmental

microbiology, 56(6), 1875-1881.

138