US009 163078B2

(12) United States Patent (10) Patent No.: US 9,163,078 B2 Rao et al. (45) Date of Patent: *Oct. 20, 2015

(54) REGULATORS OF NFAT 2009.0143308 A1 6, 2009 Monk et al. 2009,0186422 A1 7/2009 Hogan et al. (75) Inventors: Anjana Rao, Cambridge, MA (US); 2010.0081129 A1 4/2010 Belouchi et al. Stefan Feske, New York, NY (US); Patrick Hogan, Cambridge, MA (US); FOREIGN PATENT DOCUMENTS Yousang Gwack, Los Angeles, CA (US) CN 1329064 1, 2002 EP O976823. A 2, 2000 (73) Assignee: Children's Medical Center EP 1074617 2, 2001 Corporation, Boston, MA (US) EP 1293569 3, 2003 WO 02A30976 A1 4, 2002 (*) Notice: Subject to any disclaimer, the term of this WO O2/O70539 9, 2002 patent is extended or adjusted under 35 WO O3/048.305 6, 2003 U.S.C. 154(b) by 0 days. WO O3/052049 6, 2003 WO WO2005/O16962 A2 * 2, 2005 This patent is Subject to a terminal dis- WO 2005/O19258 3, 2005 claimer. WO 2007/081804 A2 7, 2007 (21) Appl. No.: 13/161,307 OTHER PUBLICATIONS (22) Filed: Jun. 15, 2011 Skolnicket al., 2000, Trends in Biotech, vol. 18, p. 34-39.* Tomasinsig et al., 2005, Current Protein and Peptide Science, vol. 6, (65) Prior Publication Data p. 23-34.* US 2011 FO269174 A1 Nov. 3, 2011 Smallwood et al., 2002, Virology, vol. 304, p. 135-145.* • - s Chattopadhyay et al., 2004. Virus Research, vol. 99, p. 139-145.* Abbas et al., 2005, computer printout pp. 2-6.* Related U.S. Application Data Strausberg et al., 2004, GenEmbl Accession No. BC069270, com AV puter printout, pp. 13-17.* (63) Continuation of application No. 12/160.030, filed as Roos et al., 2007, US 2007003 1814 A1, effective filing date Mar. 4, application No. PCT/US2007/000280 on Jan.5, 2007. 2003.* (60) Provisional application No. 6O7756 934 filed on Jan. Zhang et al., U.S. Appl. No. 1 1/582,861, US 20070099251, effective 5, 2006 s- - is filing date Oct. 17, 2005, see computer printout, pp. 8-10.* s Harkinet al., U.S. Appl. No. 1 1/266,748, US 20060134663, effective (51) Int. Cl. filing date Jul. 18, 2005, computer printout, pp. 6-9.* CI2O I/00 (2006.01) (Continued) A6 IK 4.8/00 (2006.01) CI2N 15/63 (2006.01) C7H 2L/04 (2006.01) Primary Examiner — Shin Lin Chen OW' 3:08: (74) Attorney, Agent, or Firm — Nixon Peabody LLP CI2N 5/16 (2006.01) CI2N 15/90 (2006.01) (57) ABSTRACT (52) U.S. Cl. CPC ...... C07K 16/18 (2013.01); G0IN33/5041 Disclosed are methods of identifying an agent that modulates (2013.01); C07H21/04 (2013.01); C12N 5/16 an NFAT regulator protein. One such method comprises con (2013.01); C12N 15/63 (2013.01); C12N tacting at least one test agent with a recombinant cell com I 5.90. (2013.01); C12O 1/00 (2013.01) prising at least one NFAT regulator protein or fragment or (58) Field of Classification Search derivative thereof, assessing the effect of the test agent on an CPC ...... C12N 5/16: C12N 15/63; C12N 15/907; activity, interaction, expression, or binding to the NFAT regu f C2Q 1f9. SOH 1/04 lator protein or fragment orderivative thereof, and identifying S. licati - - - - - is . 4. i. 424 R 536/23.5 the test agent that has an effect on an activity, interaction, ee application file for complete search history. expression, or binding to the NFAT regulator protein or frag (56) References Cited ment orderivative thereof, whereby the identified testagent is characterized as an agent that modulates an NFAT regulator U.S. PATENT DOCUMENTS protein. Methods of identifying an agent that modulates intra cellular calcium, methods to screen for an agent that modu 6,875,581 B1 4/2005 Voelkel 2001 OO18196 A1 8, 2001 Mendoza et al. lates NFAT regulator function, methods to diagnose unex 2004/0219521 A1 1 1/2004 Tang et al. plained immunodeficiency in a Subject, and methods for 2005/0107588 A1 5/2005 Duggan et al. identifying an agent for treating or preventing a disease or 2005/0255487 A1 11, 2005 Khvorova et al. 2006/0286605 A1 12/2006 Liou et al. disorder associated with a NFAT regulator protein or calcium 2007/0031814 A1 2/2007 Roos et al. signaling are also disclosed. 2008, OO39392 A1 2/2008 Cahalan 2008/0096,227 A1 4/2008 Penner 2008/0293,092 A1 11/2008 Stauderman et al. 27 Claims, 33 Drawing Sheets US 9,163,078 B2 Page 2

(56) References Cited Kim, E. and Sheng, M., “PDZDomain Proteins of Synapses.” Nature Reviews Neuroscience 5:771-781, 2004. OTHER PUBLICATIONS Kotturi, M. F. et al., “Identification and Functional Characterization Strausberg et al., 2004, GenEmbl Accession No. BC075831, direct of Voltage-dependent Calcium Channels in T Lymphocytes.” J Biol submission on Jul. 6, 2004, ORAI1. Strauysberg1.* Chem 278(47):46949-46960, 2003. Krogh, A. et al., “Predicting Transmembrane Protein Topology with Strausberg et al., 2004, GenEmbl Accession No. BC069270, direct a Hidden Markov Model: Application to Complete Genomes.” J Mol submission on Apr. 26, 2004, ORAI2, Strausberg2.* Biol 305:567-580, 2001. Strausberg et al., 2001, GenEmbl Accession No. BC015555, direct Le Deist, F. et al., “A primary T-cell immunodeficiency associated submission on Oct. 1, 2001, ORAI3, Strausberg3.* with defective transmembrane calcium influx.' Blood 85: 1053-1062, Abecasis, G. R. et al., “Merlin-rapid analysis of dense genetic maps 1995. using sparse gene flow trees.” Nature Genetics 30: 97-101, 2002. Lepple-Wienhues, A. and Cahalan. M. D., "Conductance and Perme Altshuler, D. et al., “Ahaplotype map of the human genome.” Nature ation of Monovalent Cations through Depletion-Activated Ca2+ 437(7063): 1299-1320, 2005. Channels (Icrac) in Jurkat T Cells.” Biophysical Journal 71:787-794, Aramburu, J. et al., "Affinity-Driven Peptide Selection of an NFAT 1996. Inhibitor More Selective Than Cyclosporin A,” Science 285:2129 Lewis, R. S., "Calcium Signaling Mechanisms in T Lymphocytes.” 2133, 1999. Annu Rev Immunol 19:497-521, 2001. Badou, A. et al., “Requirement of Voltage-Gated Calcium Channel B4 Leykin, I. et al., “Comparative linkage analysis and visualization of Subunit for T Lymphocyte Functions.” Science 307: 117-121, 2005. high-density oligonucleotide SNP array data.” BMC Genetics 6(7): 1 Beals, C. R. et al., “Nuclear Export of NF-ATc Enhanced by Glyco 16, 2005. gen Synthase Kinase-3.” Science 275:1930-1933, 1997. Liou, J. et al., “STIM Is a Ca2+ Sensor Essential for Ca2+-Store Clipstone, N. A. et al., “Molecular Analysis of the Interaction of Depletion-Triggered Ca2+ Influx.” Current Biology 15:1235-1241, Calcineurin with Drug-Immunophilin Complexes.” J Biol Chem 2005. 269(42): 26431-26437, 1994. Liu, J., “FK506 and cyclosporin, molecular probes for studying Courtois, G. et al., “A hypermorphic 1-kappa-B-beta mutation is intracellular signal transduction.” Immunology Today 14(6):290-295, 1993. associated with autosomal dominant anhidrotic ectodermal dysplasia Macian, F. “NFAT Proteins: Key Regulators of T-Cell Development and T cell immunodeficiency.” JClin Invest 112:1108-1115, 2003. and Function.” Nature 5:472-484, 2005. Crabtree, G. R. and Olson, E.N., "NFATSignaling: Choreographing Macian, F. “Partners in transcription: NFAT and AP-1.” Oncogene the Social Lives of Cells' Cell 9:S67-S79, 2002. 20:2476-2489, 2001. Cui, J. et al., “CaT1 Contributes to the Stores-operated Calcium Mori, Y. et al., “Transient Receptor Potential 1 Regulates Capacita Current in Jurkat T-lymphocytes' J Biol Chem 277 (49)47175 tive Ca2+Entry and Ca2+ Release from Endoplasmic Reticulum in B 47183, 2002. Lymphocytes.” J Exp Med 195(6)673-681, 2002. Döffinger, R. "X-linked anhidrotic ectodermal dysplasia with Myers, E. W. et al., “A Whole-Genome Assembly of Drosophila.” immunodeficiency is caused by impaired NF-kappa-B signaling.” Science 287:2196-2204, 2000. Nature Genetics 27:277-285, 2001. Okamura, H. et al., “Concerted Dephosphorylation of the Transcrip Feske, S. et al., “The Duration of Nuclear Residence of NFAT Deter tion Factor NFAT1 Induces a Conformational Switch that Regulates mines the Pattern of Cytokine Expression in Human SCIDT Cells.” Transcriptional Activity.” Molecular Cell 6:539-550, 2000. J Immunol 165:297-305, 2000. Okamura, H. et al., “A Conserved Docking Motif for CK1 Binding Feske, S. et al., “Gene regulation mediated by calcium signals in T Controls the Nuclear Localization of NFAT1...' Molecular and Cellu lymphocytes.” Nature Immunology 2(4):316-324, 2001. lar Biology 24(10):4184-4195, 2004. Feske, S. et al., “A mutation in Orail causes immune deficiency by Parekh, A. B. and Putney, Jr., J. W. “Store-Operated Calcium Chan abrogating CRAC channel function.” Nature 441: 179-185, 2006. nels” Physiol Rev 85:757-810, 2005. Feske, S. et al., “A severe defect in CRAC Ca2+ channel activation Parekh, A. B. and Penner, R., “Store Depletion and Calcium Influx.” and altered K+ channel gating in T cells from immunodeficient Physiological Reviews 77(4):901-930, 1997. patients.” JEM 202(5):651-662, 2005. Partiseti, M. et al., “The Calcium Current Activated by T Cell Recep Feske, S. et al., "Ca2+/calcineurin signalling in cells of the immune tor and Store Depletion in Human Lymphocytes is Absent in a Pri system.” Biochemical and Biophysical Research Communications mary Immunodeficiency.” JBiol Chem 269(51):32327-32335, 1994. 3 11:1117-1132, 2003. Philipp, S. et al., “TRPC3 Mediates T-cell Receptor-dependent Cal Gabriel, S. B. et al., “The Structure of Haptotype Blocks in the cium Entry in Human T-lymphocytes.” J Biol Chem 278(29):26629 Human Genome.” Science 296:2225-2229, 2002. 26638, 2003. Gudbartsson, D. F. et al., “Allegro, a new computer program for Prakriya, M. and Lewis, R. S., "CRAC channels: activation, perme multipoint linkage analysis.” Nature Genetics 25:12-13, 2000. ation, and the search for a molecular identity.” Cell Calcium 33:311 Gwack, Y. et al., “A genome-wide Drosophila RNAi screen identifies 321, 2003. DYRK-family kinases as regulators of NFAT.” Nature 441:646-650, Feske et al., “A Mutation in Orail Causes Immune Deficiency by 2006. Abrogating CRAC Channel Function.” Nature 441: 179-185 (2006). Hermosura, M. C. et al., “Dissociation of the store-operated calcium Parekh, A.B., "Cell Biology: Cracking the calcium entry code.” current Icrac and the Mg-nucleotide-regulated metal ion current Nature 441 (11):163-165 (2006). MagNuM.” J. Physiol 539(2):445-458, 2002. Robinson, L.C, and Marchant, J.S., "Calcium Influx: Beyond 'Cur Hogan, P. G. et al., “Transcriptional regulation by calcium, rent Biology.” Current Biology 16(14):R548-550 (2006). calcineurin, and NFAT Genes & Dev 17:2205-2232, 2003. Smyth et al., “Emerging perspective in store-operated Ca2+ entry: Horsley, V. And Pavlath, G. K., "NFAT: ubiquitous regulator of cell Roles Orai. Stim and TRP” Biochimica Biophysica Acta (2006) differentiation and adaptation.” J Cell Biol 156 (5):771-774, 2002. doi:10, 1016/j.bbamer 2006.08.050. Im. S. and Rao A., “Activation and Deactivation of Gene Expression Vig et al., “CRACM1 is a plasma membrane protein essential for by Ca2+/Calcineurin-NFAT-mediated Signaling.” Mol Cells 18(1):1- store-operated Ca2+ entry.” Science 312(5777): 1220-1223 (2006). 9, 2004. Zhang et al., “Genome Wide RNAi Screen of Ca2+ influx identifies The International HapMap Consortium, “The International HapMap Genes that Regulate Ca2+ Channel Activity.” PNAS USA Project.” Nature 426:789-796, 2003. 103(4):9357-9362 (2006). Käll, L. et al., “A Combined Transmembrane Topology and Signal Prakriya, M. and Lewis, R. S., “Separation and Characterization of Peptide Prediction Method.” J Mol Bio 1338: 1027-1036, 2004. Currents through Store-operated CRAC Channels and Mg2+-inhib Kanno, T. and Siebenlist, U. “Activation of Nuclear Factor-kappa-B ited Cation (MIC) Channels.” J Gen Physiol 119(5):487-508, 2002. via T Cell Receptor Requires a Raf Kniase and Ca2+ Influx.” J Puel, A. et al., “Inherited disorders of NF-kappa-B-mediated immu Immunol 157:5277-5283, 1996. nity in man.” Current Opinion in Immunology 16:34-41, 2004. US 9,163,078 B2 Page 3

(56) References Cited Coury et al., Methods in Enzymology, 306:169-186 (1999). “10 Use of Yeast secó Mutant for Purification of Vesicles Containing OTHER PUBLICATIONS Recombinant Membrane Proteins.” Derler et al., The Journal of Biological Chemistry, 284(23): 15903 Roderick, H. L. and Bootman, M.D., "Calcium Influx: Is Homer the 15915 (2009). "Increased Hydrophobicity at the N Terminus/Mem Missing Link?” Current Biology 13:R976-R978, 2003. brane Interface Impairs Gating of the Severe Combined Roos, J. at el. “STIM1, an essential and conserved component of Immunodeficiency-related ORAI1 Mutant.” store-operated Ca2+ channel function.” J Cell Biol 169(3):435-445, Eid et al., BMC Developmental Biology, 8:104 (2008). “The 2005. Drosophila STIMI orthologue, dSTIM. has roles in cell fate specifi Salazar, C. and Hôfer, T., "Allosteric Regulation of the Transcription cation and tissue patterning.” Factor NFAT1 by Multiple Phosphorylation Sites: A Mathematical Heyman et al., The Journal of Cell Biology, 127(5):1259-1273 Analysis.” J. Mol. Biol. 327:31-45, 2003. (1994). “Role of the PAS1 Gene of Pichia pastoris in Peroxisome Schmidt-Ulrich, R. et al., “Requirement of NF-kappa-B/Rel for the Biogenesis.” development of hair follicles and other epidermal appendices.” Hogan et al., TRENDS in Biochemical Sciences, 32(5):235-245 Development 128:3843-3653, 2001. (2007). "Dissecting ICRAC, a store-operated calcium current.” Smahi, A. et al., “The NF-kappa-B signalling pathway in human Huang et al., Nature Cell Biology, 8(9): 1003-1010 (2006). “STIM1 diseases: from incontinentia pigmenti to ectodermal dysplasias and carboxyl-terminus activates native SOC, Icrac and TRPC1 channels.” immune-deficiency syndromes.” Human Molecular Genetics Ji et al., PNAS, 105(36): 13668-13673 (2008). “Functional 11(20):2371-2375, 2002. Stoichiometry of the unitary calcium-release-activated calcium chan Venkatachalam, K. et al., “The cellular and molecular basis of store nel. operated calcium entry.” Nature Cell Biology 4:E263-E272, 2002. Kawasaki et al., Biochemical and Biophysical Research Communi Voets, T. et al., “CaT1 and the Calcium Release-activated Calcium cations, 385:49-54 (2009). "A minimal regulatory domain in the C Channel Manifest Distinct Pore Properties.” J Biol Chem terminus of STIM1 binds to and activates ORAI1 CRAC channels.” 276(51):47767-47770, 2001. Koh et al., Developmental Biology, 330:368-376 (2009). “STIM1 Winslow, M. M. et al., "Calcium signalling in lymphocytes.” Current regulates store-operated Ca2+ entry in oocytes.” Opinion in Immunology 16:299-307, 2003. Laize et al., FEBS Letters, 373:269-274 (1995). “Functional expres Yeromin, A. V. et al., “A Store-operated Calcium Channel in sion of the human CHIP28 water channel in a yeast secretory Drosophila S2 Cells,” J Gen Physiol 123:167-182, 2004. mutant. Yue, L. et al., “CaT1 manifests the pore properties of the calcium Lietal. The Journal of Biological Chemistry, 282(40):29448-29456 release-activated calcium channel.” Nature 410:705-709, 2001. (2007). "Mapping the Interacting Domains of STIM1 and Orail in Zhang, S. L. et al., “STIM1 is a Ca2+ sensor that activates CRAC Ca2+ Release-activated Ca2+ Channel Activation.” Liou et al., PNAS, 104(22):9301-9306 (2007). “Live-cell imaging channels and migrates from the Ca2+ store to the plasma membrane.” reveals sequential oligomerization and local plasma membrane tar Nature 437(7080):902-905, 2005. geting of stromal interaction molecule 1 after Ca2+ store depletion.” Zweifach, A. and Lewis, R. S., “Rapid Inactivation of Depletion Locke et al., Molecular and Cell Biology, 20018):6686-6694 (2000). activated Calcium Current (Icrac) Due to Local Calcium Feedback.” "A Homolog of Voltage-Gated Ca2+ Channels Stimulated by Deple J Gen Physiol 105:209-226, 1995. tion of Secretory Ca2+ in Yeast.” Zweifach, A. and Lewis, R. S., "Calcium-dependent Potentiation of Lorin-Nebel et al., J. Physiol, 580(1):67-85 (2007). “CRAC channel Store-operated Calcium Channels in T Lymphocytes.” JGen Physiol activity in C. elegans is mediated by Orail and STIM1 homologues 107:597-610, 1996. and is essential for ovulation and fertility.” Markianos, K. et al., “Efficient Multipoint Linkage Analysis through Luiket al., Nature,454:538-542 (2008). “Oligomerization of STIM1 Reduction of Inheritance Space.” Am J Hum Genet 68:963-977. couples ER calcium depletion to CRAC channel activation.” 2001. Lyfenko et al., J. Physiol, 586(20):4815-4824 (2008). “Differential Salzar, C. et al., “Activation of the Transcription Factor NFAT1: dependence of store-operated and excitation-coupled Ca2+ entry in concerted or modular regulation?” FEBS Lett579:621-626, 2005. skeletal muscle on STIM1 and Orail.” Eck et al., Goodman & Gilman's The Pharmacological Basis of Muiketal. The Journal of Biological Chemistry, 28.3(12):8014-8022 Therapeutics, McGraw-Hill, New York, pp. 77-101. (2008). "Dynamic Coupling of the Putative Coiled-coil Domain of Gorecki. D., 2001, Expert Opin. Emerging Drugs, 6(2): 187-198. ORAI1 with STIM1 Mediates ORAI1 Channel Activation. Kodama et al., 2006, Current Medicinal Chemistry, vol. 13, pp. Muiketal. The Journal of Biological Chemistry, 284(13):8421-8426 2155-2161. (2009). "A Cytosolic Homomerization and a Modulatory Domain Nishikawa et al., 2001, Human Gene Therapy, vol. 12, pp. 861-870. within STIM1 C Terminus Determine Coupling to ORAI 1 Chan Panet al., 1997, Biochemical and Biophysical Research Communi nels. cations, vol. 240, pp. 314-323. Nakamoto et al., The Journal of Biological Chemistry, 266(12):7940 International Search Report dated Jan. 18, 2008 for International 7949 (1991). “Expression of the Yeast PLasma Membrane H+] App. No. PCT/US2007/000280. ATPase in Secretory Vesicles.” Park et al., “STIM1 Clusters and Activates CRAC Channels via Navarro-Borelly et al., J. Physiol, 586(22):5383-5401 (2008). Direct Binding of a Cytosolic Domain to Orail”. Cell, 136:876-890 “STIM1-Orail interactions and Orail conformational changes (2009). revealed by live-cell FRET microscopy.” Gwacket al., JBC. 282(22): 16232-16243 (2007). “Biochemical and Ong et al., The Journal of Biological Chemistry, 282(16): 12176 functional characterization of Orai proteins.” 12185 (2007). “Relocalization of STIM1 for Activation of Store Tang et al., Viewing Sequences: 58, 182 of 412 for Document operated Ca2+ Entry is Determined by the Depletion of Subplasma #20040219521. Publication Site for Issued and Published Sequences Membrane Endoplasmic Reticulum Ca2+ Store.” (PSIPS) online, Nov. 2004, United States Patent and Trademark Penna et al., Nature, 456:116-120 (2008). “The CRAC channel con Office, Alexandria, VA, USA (retrieved on Jun. 6, 2012). Retrieved sists of tetramer formed by Stim-induced Oral dimerization of Orai from the Internets JRL:http://seqdata.uspto.gov/ dimers.” ?pageRequest=viewSequence&DocID=20040219521 Prakriya et al., Nature, 443:230-231 (2006). “Orail is an essential &seqID=58%2C182>, SEQ ID No. 58, 182. pore subunit of the CRAC channel.” Clapham, Cell, 136:814-816 (2009). “A STIMulus Package Puts Orai Putney, Cell Calcium, 42:103-110 (2007). “Recent breakthroughs in Calcium Channels to Work.” the molecular mechanism of capacitative calcium entry (with Coury et al., Am J Physiol, 274:F34-F42 (1998). “Reconstitution of thoughts on how we gothere).” water channel function of aquaporins 1 and 2 by expression in yeast Ruetz et al., Cell, 77: 1071-1081 (1994). “Phosphatidylcholine secretory vesicles.” Translocase: A Physiological Role for the mdr2 Gene.” US 9,163,078 B2 Page 4

(56) References Cited Koonpaew et al., JEM, 203(1): 119-129 (2006). “LAT-mediated sig naling in CD4+CD25+ regulatory T cell development.” OTHER PUBLICATIONS Mauri et al., Immunol. Res., 15(2):126-140 Abstract (1996). “Involvement of CD80 in the generation of CD4+ cytotoxic T cells.” Silverman-Gavrila et al., Journal of Cell Science, 115:5013-5025 (2002). "An IP3-activated Ca2+ channel regulates fungal tip growth.” Ohga et al., International Immunopharmacology, 8:1787-1792 Stathopulos et al., Cell, 135:110-122 (2008). "Structural and Mecha (2008). “Characterization of YM-58483/BTP2, a novel store-oper nistic Insights into STIM1-Mediated Initiation of Store-Operated ated Ca2+ entry blocker, on T cell-mediated immune responses in Calcium Entry.” vivo. Stiber et al., Nature Cell Biology, 10(6):688-697 (2008). “STIM1 Oh-Hora et al., Nature Immunology, 9(4):432-443 (2008). “Dual signalling controls store-operated calcium entry required for devel functions for the endoplasmic reticulum calcium sensors STIM1 and opment and contractile function in skeletal muscle.” STIM2 in T cell activation and tolerance.” Strayle et al., The EMBO Journal, 18(17):4733-4743 (1999). Oh-Hora et al., FASEB Summer Research Conferences, retrieved "Steady-state free Ca2+ in the yeast endoplasmic reticulum reaches from the internet: https://secure.faseb.org/faseb/meetings/Sum only 10 uM and is mainly controlled by the Secretory pathway pump mrconfprograms/11643.pdf, Jun. 23, 2007. Pmr1. Peterson et al., Clin Genet, 77:511-524 (2010). "Conquering the Terbush et al., The EMBO Journal, 15(23):6483-6494 (1996). “The Exocyst is a multiprotein complex required for exocytosis in Sac complex world of human Septins: implications for health and dis charomyces cerevisiae.” ease. Varnai et al., J. Biol. Chem. 282:29678-29690 (2007). “Mechanisms Picard et al., N Engl J Med, 360(19): 1971-1980 Author Manuscript of Signal Transduction: Visualization and Manipulation of Plasma (2009). “STIM1 Mutation Associated with a Syndrome of Membrane-ENdoplasmic Reticulum Contact Sites Indicates the Immunodeficiency and Autoimmunity.” Presence of Additional Molecular Components within the STIM1 Ranger et al., Immunity, 9:627-635 (1998). “Inhibitory Function of Orail Complex.” Two NFAT Family Members in Lymphoid Homeostasis and Th2 Vig et al., Current Biology, 16:2073-2079 (2006). “CRACM1 Development.” Multimers Form the Ion-Selective Pore of the CRAC Channel.” Soboloff et al., Journal of Biological Chemistry, 28.1(30):20661 Wu et al., The Journal of Cell Biology, 174(6):803-813 (2006). 20665 (2006). “Orail and STIM Reconstitute Store-operated Cal “Ca2+ store depletion causes STIM1 to accumulate in ER regions cium Channel Function.” closely associated with the plasma membrane.” Soboloff et al., Current Biology, 16:1465-1470 (2006). “STIM is an Yeromin et al., Nature, 443:226-229 (2006). “Molecular identifica Inhibitor of STIM1-Mediated Store-Operated Ca2+ Entry.” tion of the CRAC channel by altered ion selectivity in a mutant of Orai. Swanson et al., Proc. Natl. Acad. Sci., 89:3741-3745 (1992). Yuan et al., Nature Cell Biology, 11(3):337-343 (2009). “SOAR and “Cyclosporin-mediated inhibition of bovine calcineurin by the polybasic STIM1 domains gate and regulate Orai channels.” cyclophilins A and B.” Zhang et al., The Journal of Biological Chemistry, 28.3(25):17662 Trevillyan et al., The Journal of Biological Chemistry, 17671 (2008). "Store-dependent and -independent Modes Regulat 276(51):48 118-48126 (2001). “Potent Inhibition of NFAT Activation ing Ca2+ Release-activated Ca2+ Channel Activity of Human Orail and T Cell Cytokine Production by Novel Low Molecular Weight and Orai3. Pyrazole Compounds.” Feghalietal. Frontiers in Bioscience, 2:d 12-d26 (1997). "Cytokines Wittmann et al., Journal of Leukocyte Biology, 80:75-86 (2006). in Acute and Chronic Inflammation.” “Critical involvement of IL-12 in IFN-y induction by calcineurin Huang et al., Molecular Biology of the Cell, 19:1717-1726 (2008). antagonists in activated human lymphocytes.” "Mammalian Septins are Required for Phagosome Formation.” Wulff et al., PNAS, 97(14):8151-8156 (2000). “Design of a potent Ishikawa et al., J. Immunol. 170:4441-4449 (2003). “A Pyrazole and selective inhibitor of the intermediate-conductance Ca2+-acti Derivative, YM-58483, Potently Inhibits Store-Operated Sustained vated K+ channel, IKCal: A potential immunosuppressant.” Ca2+ Influx and IL-2 Production in T Lymphocytes.” Eck et al., Goodman & Gilman's The Pharmacological Basis of Kloor et al., Biochimica et Biophysica Acta, 1579:219-224 (2002). Therapeutics, McGraw-Hill, New York, pp. 77-101, 1996. “Identification and characterization of UEV3, a human cDNA with similarities to inactive E2 ubiquitin-conjugating enzymes.” * cited by examiner U.S. Patent Oct. 20, 2015 Sheet 1 of 33 US 9,163,078 B2

Na

U.S. Patent Oct. 20, 2015 Sheet 2 of 33 US 9,163,078 B2

1200 1OOO E 800 E t 60 S 400 2OO O Co CO Fa Vo P 3. 35 INFLUX RATE

as as a.

U.S. Patent Oct. 20, 2015 Sheet 4 of 33 US 9,163,078 B2

RNA MOCK dSTM MOCK dOrai TG - + ------

RNAi FOR GFP RNAi FOR STM

RNAi FOR GFP RNAi FOR Orai

O 50 1OO 150 200 250 TIMES) FIG. 2b

U.S. Patent Oct. 20, 2015 Sheet 6 of 33 US 9,163,078 B2

M1 M2 M3 M4 E. E. 3 3 1. sE O o se -1 - -2 - -3 - -4 - O 40 80 120 16O 200 240 280 WINDOWPOSITION FIG. 3b

EXTRACE LULAR

re E S.

INTRACELLULAR C FIG. 3c U.S. Patent Oct. 20, 2015 Sheet 7 Of 33 US 9,163,078 B2

TIME(s) FIG. 4a

ca-CRAC Na-CRAC V (mW) V (mW)

-100 100 -100 1OO

-80 - -30 (pA) WM (pA)A U.S. Patent Oct. 20, 2015 Sheet 8 of 33 US 9,163,078 B2

2 Ca DVF VF

5 -50– R>W MUTATION

-100 2O 4. TIME (s) FIG, 4G DVF O

O 2 4. 6 TIME (s)

O e-8 SOPE - 26A

5

100 200 300 U.S. Patent Oct. 20, 2015 Sheet 9 Of 33 US 9,163,078 B2

20 pA 50ms

-100 V FIG. 4e

O 50 10 TIME (s) FIG. 4f U.S. Patent Oct. 20, 2015 Sheet 10 of 33 US 9,163,078 B2

50 1OO 150 TIME (s)

5

4.

s 3 se 5 2

1

O CR SC -- GENE SCID -- GFP. GENE (RDW) FIG. 4h U.S. Patent Oct. 20, 2015 Sheet 11 of 33 US 9,163,078 B2

20 Ca O Ca 20 Ca

1OOO 2-APB (75uM)

800

600

400

200

- 2OO 400 600 BOO 100 TIME (s) FIG. 5a

20 Ca O Ca 2O Ca

1OOO 2-APB (3 uM)

O 200 400 600 8OO 1000 TIME (s) FIG. 5 U.S. Patent Oct. 20, 2015 Sheet 12 of 33 US 9,163,078 B2

20 Ca OCa 20 Ca

3+ 500- La

400

30 -

2 - 1OO -N- O --- -T- - O 200 AOO GOO BOO 1000 TIME (s) FIG. 5c

20 Ca O Ca 20 Ca

8OO La3+

OO

4DO

2OO

O 200 40 600 BOO OOO TIME (s) FIG. 5d. U.S. Patent Oct. 20, 2015 Sheet 13 of 33 US 9,163,078 B2

AD REGULATORY

&s ($ Š SRR1 SP2 & SP3 -- CING DOCKING GS 1-415 SRR SP2 SP3 SRR1 : GYRESPASSGSSASFISDTF (SEQ ID NO: 50) SP2: SPRTSPIMSPRTSLAED (SEQ ID NO:51) SP3: SPQRSRSPSPOPSPHVAPQDD (SEQ ID NO : 52)

V FIG. 6a

Unti G kDa 10 (NFAT1-(P) NFAT1-de(P) B. NFAT

ift WES TOTALSCREENED (EXCLUDING 293 INTERNAL CONTROLS) 21,884 UNESTED FORTECHNICAL REASONS 813 SCORE AS NEGATIVE 19,844 SCORED VISUALLY AS DEAD, OR HITS IN VIABILITY/SHAPESCREENS 489 SCORED AS POSITVE 738 MSANNAE 39 OFF-TARGETS > 10 37 TOTAL PUTATIVE POSITIVES 662 (3%) PERCEN POSITIVE UPON RETESTING 272/326 (83%) FIG. 6c U.S. Patent 597?07 $3 US 9,163,078 B2 Eº?i?SHIÚSAT==++i

s e

ge s *gxx ge

E 8 sexs

-- st s e gree xxx

ses SN e xxx 8 xxxx

-- *xiee N os e - O

ense sex R es 8 res

-- es sees e 8 s

- I - tee

: es

sees e U.S. Patent Oct. 20, 2015 Sheet 16 of 33 US 9,163,078 B2

G TG unt in in

CSA (min) - 5 10 15 20 26 30

NFANFAT1(P) E8 Do agreergig up up to an CONTROsiRNA

NFAT1(P) D- as SiRNA NFAT1 de(P) D as a cist as a DYRK1A

DYRK1A RNA EXPRESSION

O

O- ---

SiCONTROL SiRKA siCONTROL SiVRKA DAY 3 DAY A.

FIG. 7c U.S. Patent Oct. 20, 2015 Sheet 17 Of 33 US 9,163,078 B2

IL-2 PROMOTER-LUCIFERASE

DYRK2 (WT) DYRK2 (KD)

FIG. 8a. U.S. Patent Oct. 20, 2015 Sheet 18 of 33 US 9,163,078 B2

i t

s:

NS OO -- s R

--

2 -- (- U.S. Patent Oct. 20, 2015 Sheet 19 Of 33 US 9,163,078 B2

ENDOGENOUSL-2 PRODUCTION

DYRK2 (wi) DYRK2 (KD)

FIG. 8c U.S. Patent Oct. 20, 2015 Sheet 20 of 33 US 9,163,078 B2

SO 40 2O

RNA: NONE SV FIG. 9a

5 l GFPRNA

3. STM RNA

10 O 50 O 150 GO 250 TIME (SEC) FIG. 9o U.S. Patent US 9,163,078 B2

/\ 100I’01),

978180qulli 0501100 U.S. Patent Oct. 20, 2015 Sheet 22 of 33 US 9,163,078 B2

l

ar g

res. t a ale asit " at

s s: gosee e se ise sea e se e seeas te ep as rsr se are f ex Y was a (HOOT STWON) NOISSX-VNA U.S. Patent Oct. 20, 2015 Sheet 23 of 33 US 9,163,078 B2

10II(91H. U.S. Patent Oct. 20, 2015 Sheet 24 of 33 US 9,163,078 B2

QII'9IAI

(z;ON(IIÕES)OLZ69008ZIVIHO< U.S. Patent Oct. 20, 2015 Sheet 25 Of 33 US 9,163,078 B2

OII’9IJI

(§:ON(IIÕIS)I·3822&THINÇIKTIO< U.S. Patent Oct. 20, 2015 Sheet 26 of 33 US 9,163,078 B2

10II(9IAI U.S. Patent Oct. 20, 2015 Sheet 27 Of 33 US 9,163,078 B2

(ºp,4u00)pII(9IAI U.S. Patent Oct. 20, 2015 Sheet 28 of 33 US 9,163,078 B2

aII(9IAI U.S. Patent Oct. 20, 2015 Sheet 29 Of 33 US 9,163,078 B2

/II'?IH

(9;ON(II?ES)$89.900TÄNZYH?G< U.S. Patent Oct. 20, 2015 Sheet 30 Of 33 US 9,163,078 B2

5.II(?IH

(L:ONGIÕES)Z8G200TNNÇHENG< U.S. Patent Oct. 20, 2015 Sheet 31 of 33 US 9,163,078 B2

(8;ON(IIÖES)I-Gº8000TWIN(YRING< U.S. Patent Oct. 20, 2015 Sheet 32 of 33 US 9,163,078 B2

1II(9IAI U.S. Patent Oct. 20, 2015 Sheet 33 Of 33 US 9,163,078 B2

("p,qu00)1II(9IAI US 9,163,078 B2 1. 2 REGULATORS OF NEAT (NM 032790; SEQID NO: 1), ORAI2(BC069270: SEQID NO: 2), and/or ORAI3 (NM 152288: SEQID NO:3). In one CROSS-REFERENCED TO RELATED embodiment, the agent modulates phosphorylation of NFAT, APPLICATIONS e.g., via modulation of a DYRK protein, e.g., proteins encoded by DYRK1A (NM 001396; SEQ ID NO:4), This application is a Continuation application of U.S. Util DYRK1B (NM 004714; SEQ ID NO:5), DYRK2 (NM ity application Ser. No. 12/160,030 filed Oct. 28, 2008, which 003583; SEQ ID NO:6), DYRK3 (NM 003582: SEQ ID is a 35 U.S.C. S371 National Phase Entry Application of NO:7), DYRK4 (NM 003845; SEQ ID NO:8) and/or International Application No. PCT/US2007/000280 filed DYRK6 (NM 005734; SEQ ID NO:9). Jan. 5, 2007, which designates the U.S. and which claims 10 The present invention provides a method of identifying an benefit under 35 U.S.C. S 119(e) to U.S. Provisional Applica agent that modulates an NFAT regulator protein, comprising tion 60/756,934, filed, Jan. 5, 2006, the entire contents of contacting at least one test agent with a recombinant cell which are incorporated by reference herein. comprising at least one NFAT regulator protein or fragment or derivative thereof, assessing the effect of the test agent on an GOVERNMENT SUPPORT 15 activity, interaction, expression, or binding to the NFAT regu lator protein or fragment orderivative thereof, and identifying This invention was Supported, in part, by National Insti the test agent that has an effect on an activity, interaction, tutes of Health (NIH) Grant Nos. RO1 AI40127, HD39685, expression, or binding to the NFAT regulator protein or frag R21 AI054933, and GM 075256. The government of the ment orderivative thereof, whereby the identified testagent is characterized as an agent that modulates an NFAT regulator United States has certain rights to the invention. protein. FIELD OF THE INVENTION In one embodiment, the NFAT regulator protein is encoded by at least one NFAT regulator selected from the group con The invention relates to the field of regulation of a family of sisting of ORAI1 (SEQ ID NO:1), ORAI2 (SEQ ID NO:2), calcium regulated transcription factors known as NFAT pro 25 ORAI3 (SEQ ID NO:3), DYRK1A (SEQ ID NO:4), teins. DYRK1B (SEQIDNO:5), DYRK2 (SEQIDNO:6), DYRK3 (SEQID NO:7), DYRK4 (SEQID NO:8) and DYRK6 (SEQ BACKGROUND OF THE INVENTION ID NO:9). In one embodiment, the NFAT regulator protein is encoded by at least one of the genes listed in Table I. Hyperactivity or inappropriate activity of the immune sys 30 In one embodiment, assessing the effect of the test agent tem is a serious and widespread medical problem. It contrib comprises using an antibody which specifically binds to a utes to acute and chronic immune diseases, e.g., allergic and NFAT regulator protein encoded by ORAI1 (SEQID NO: 1), atopic diseases, e.g., asthma, allergic rhinitis, allergic con ORAI2 (SEQID NO: 2), ORAI3 (SEQID NO:3), DYRK1A junctivitis and atopic dermatitis, and to autoimmune diseases, (SEQ ID NO:4), DYRK1B (SEQ ID NO:5), DYRK2 (SEQ e.g., rheumatoid arthritis, insulin-dependent diabetes, inflam 35 IDNO:6), DYRK3 (SEQID NO:7), DYRK4 (SEQID NO:8), matory bowel disease, autoimmune thyroiditis, hemolytic or DYRK6 (SEQID NO:9). anemia and multiple Sclerosis. Hyperactivity or inappropriate In one embodiment, the method further comprises assess activity of the immune system is also involved in transplant ing the effect of the test agent on electrical current across the graft rejections and graft-versus-host disease. plasma membrane of the cell. In one embodiment, the elec A certain family of transcription factors, the NFAT proteins 40 trical current is due to flux of monovalent cations or divalent (nuclear factor of activated T cells), are expressed in immune cations across the cell. In one embodiment, the method fur cells and play a key role in eliciting immune responses. The ther comprises assessing the effect of the test agent on intra NFAT proteins are activated by an increase in intracellular cellular calcium within the cell. In one embodiment, the calcium levels, e.g., by means of store-operated calcium method further comprises identifying the test agent that has entry. The activated NFAT proteins, in turn, induce transcrip 45 an effect on intracellular calcium within the cell, whereby the tion of cytokine genes which are required for an immune identified test agent is characterized as an agent that modu response. The immunosuppressive drugs cyclosporin A and lates intracellular calcium and an agent that modulates NFAT FK506 are potent inhibitors of cytokine gene transcription in regulator protein. activated immune cells, and have been reported to act by In one embodiment, the cell comprises at least one heter inhibiting calcineurin Such that calcineurin is not able to 50 ologous NFAT regulator proteins or a fragment or derivative activate NFAT. These drugs, however, can display nephro thereof. In one embodiment, the cell comprises heterologous toxic and neurotoxic effects after long term usage. Since nucleic acid encoding at least one NFAT regulator protein or calcineurin is ubiquitously expressed in many tissues, the a fragment or derivative thereof. In one embodiment, the cell drugs inhibition of calcineurin activity toward substrates overexpresses, or underexpresses at least one NFAT regulator other than NFAT may contribute to the observed toxicity. 55 protein or fragment or derivative thereof. There is a need for immunosuppressive agents which selec The present invention further provides a method of identi tively inhibit the store-operated calcium entry activation of fying an agent that modulates intracellular calcium, compris NFAT. ing contacting at least one test agent with a recombinant cell comprising at least one NFAT regulator protein or fragment or SUMMARY OF THE INVENTION 60 derivative thereof, assessing the effect(s) of the test agent on intracellular amounts, or concentrations, of cations or diva The present invention provides a method for identifying an lent cations within the cell, or on ion influx into the cell; and agent that modulates NFAT activity. In one embodiment, the identifying the test agent that has an effect on intracellular agent modulates NFAT activity by means of modulating intra amounts or concentrations of cations or divalent cations cellular calcium levels. In one preferred embodiment, the 65 within the cell, or on ion influx into the cell, whereby the agent modulates at least one component of the CRAC chan identified test agent is characterized as an agent that modu nel, e.g., an ORAI protein, e.g., proteins encoded by ORAI1 lates intracellular calcium. In one embodiment, the intracel US 9,163,078 B2 3 4 lular cation is calcium. In one embodiment, assessing the the biological sample to a wildtype sequence. In one embodi effect of the test agent comprises monitoring calcium levels in ment, the variation comprises a nucleotide mutation from C to the cytoplasm, monitoring calcium levels in an intracellular Tat position 271 of the coding sequence of ORAI 1 (SEQID calcium store, monitoring calcium movement, or monitoring NO: 1). In one embodiment, the unexplained immunodefi a calcium-entry mediated event. In one embodiment, the ciency is associated with defects in regulation of NFAT activ method further comprises assessing the effect of the testagent ity. In one embodiment, the variation comprises a mutation in on an activity, interaction, expression, or binding to the NFAT a splice site. In one embodiment, the variation comprises a regulator protein or fragment or derivative thereof. In one nonsynonymous mutation. embodiment, the NFAT regulator protein is encoded by at The present invention further provides a method for iden least one NFAT regulator selected from the group consisting 10 tifying an agent for treating or preventing a disease or disor of ORAI1 (SEQ ID NO: 1), ORAI2 (SEQ ID NO: 2), or der associated with a NFAT regulator protein, comprising ORAI3 (SEQ ID NO: 3), DYRK1A (SEQ ID NO:4), assessing the effects of a test agent on an organism exhibiting DYRK1B (SEQIDNO:5), DYRK2 (SEQIDNO:6), DYRK3 a disease or disorder associated with NFAT regulator protein; (SEQ ID NO:7), DYRK4 (SEQ ID NO:8) or DYRK6 (SEQ and identifying the test agent as an agent for treating or ID NO:9). In one embodiment, the agent that modulates intra 15 preventing a disease or disorder associated with NFAT regu cellular calcium is further characterized as an agent that lator protein if it has an effect on a phenotype of the organism modulates NFAT regulator protein. In one embodiment, the associated with the disease or disorder, wherein the test agent recombinant cell comprises at least one heterologous NFAT modulates an activity, interaction, expression, or binding of regulator proteins or a fragment or derivative thereof. In one at least one NFAT regulator protein or fragment or derivative embodiment, the recombinant cell comprises a heterologous thereof. In one embodiment, the organism comprises one or nucleic acid encoding at least one NFAT regulator proteins or more cells that exhibit calcium dyshomeostasis. In one fragment or derivative thereof. In one embodiment, the embodiment, the organism exhibits calcium dyshomeostasis. recombinant cell overexpresses at least one NFAT regulator In one embodiment, the phenotype on which the testagent has protein or fragment orderivative thereof. In one embodiment, an effect is associated with the disease or disorder. This the recombinant cell exhibits dyshomeostasis. In one embodi 25 method is particularly useful, for diseases or conditions asso ment, the recombinant cell exhibits calcium dyshomeostasis ciated with altered regulation of intracellular calcium. In one The present invention further provides a method to screen embodiment, the disease or disorder is primarily attributable for an agent that modulates NFAT regulator function, com to deranged calcium signaling. In one embodiment, the dis prising administering at least one test agent to a recombinant ease or disorder associated with NFAT regulator protein is cell comprising at least one vector that comprises heterolo 30 rheumatoid arthritis, inflammatory bowel disease, allogeneic gous nucleic acid encoding at least one NFAT regulatory or Xenogeneic transplantation rejection, graft-Versus-host domain or a fragment or derivative thereof, operably linked to disease, aplastic anemia, psoriasis, lupus erytematosus, a sequence encoding a reporter protein; and monitoring intra inflammatory disease, MS, type I diabetes, asthma, pulmo cellular localization of at least one expression product nary fibrosis, Scleroderma, dermatomyositis, Sjogren's Syn encoded by the vector, whereby a test agent that has an effect 35 drome, postpericardiotomy syndrome, Kawasaki disease, on intracellular localization of the expression product is char Hashimoto's thyroiditis, Graves' disease, myasthenia gravis, acterized as an agent that modulates NFAT regulator function. pemphigus Vulgaris, autoimmune hemolytic anemia, idio In one embodiment, the agent that modulates NFAT regulator pathic thrombopenia, chronic glomerulonephritis, Goodpas function is associated with cytoplasmic or nuclear localiza ture's syndrome, Wegner's granulomatosis, multiple Sclero tion of the expression product. In one embodiment, the cell is 40 sis, cystic fibrosis, chronic relapsing hepatitis, primary biliary under resting conditions. In one embodiment, the cell is cirrhosis, uveitis, allergic rhinitis, allergic conjunctivitis, stimulated with a calcium modulating agent. In one embodi atopic dermatitis, Crohn's disease, ulcerative colitis, colitis/ ment, the cell is stimulated withthapsigargin orionomycin. In inflammatory bowel syndrome, Guillain-Barre syndrome, one embodiment, the cell is further administered a vector that chronic inflammatory demyelinating polyradiculoneuropa comprises a heterologous nucleic acid encoding at least one 45 thy, eczema, and autoimmune thyroiditis. Transplant graft NFAT regulator protein, or a fragment orderivative thereof. In rejections, acquired immunodeficiencies, common variable one embodiment, the vector that comprises the heterologous immunodeficiency, myocardial hypertrophy, severe com nucleic acid encoding at least one NFAT regulator protein, or bined immunodeficiency, dilated cardiomyopathy, excessive fragment or derivative thereof, is the same vector that com or pathological bone resorption, excessive adipocyte differ prises heterologous nucleic acid encoding at least one NFAT 50 entiation, obesity, or reactivation of latent viruses. regulatory domain or a fragment or derivative thereof, oper The present invention further provides an antibody which ably linked to a sequence encoding a reporter protein. specifically binds to a NFAT regulator protein encoded by The present invention further provides a method to diag ORAI1 (SEQID NO: 1), ORAI2 (SEQID NO: 2), or ORAI3 nose unexplained immunodeficiency in a Subject comprising (SEQID NO:3), DYRK1A (SEQID NO:4), DYRK1B (SEQ sequencing at least 25 contiguous nucleotides in a gene from 55 IDNO:5), DYRK2 (SEQID NO:6), DYRK3 (SEQID NO:7), the subject corresponding to ORAI1 (SEQID NO:1), ORAI2 DYRK4 (SEQ ID NO:8) or DYRK6 (SEQ ID NO:9), or a (SEQID NO:2), ORAI3 (SEQID NO:3), DYRK1A (SEQID homolog thereof. NO:4), DYRK1B (SEQID NO:5), DYRK2 (SEQID NO:6), The NFAT regulator protein of the invention can be pro DYRK3 (SEQ ID NO7), DYRK4 (SEQ ID NO:8), DYRK6 duced by a variety of means known in the art, e.g. automated (SEQ ID NO:9), or any of the genes listed in Table I; and 60 peptide synthesis or culturing a host cell comprising a recom comparing the sequence of the Subject’s gene to the wild type binant vector, the recombinant vector comprising a nucleic sequence of the gene, wherein a variation between the gene acid sequence, the nucleic acid sequence comprising/encod from the wild type sequence indicates the Subject's gene is ing the NFAT regulator or a fragment or derivative thereof, responsible for the immunodeficiency. In one embodiment, wherein the host cell is cultured under conditions suitable for the comparison comprises obtaining a biological sample from 65 expression of the NFAT regulator. the Subject, sequencing the DNA in the biological sample, The present invention further provides a system compris and electronically aligning the DNA sequence obtained from ing an isolated cell comprising at least one heterologous US 9,163,078 B2 5 6 NFAT regulator protein or fragment or derivative thereof, with a defect in SOCE and CRAC channel function. Two male and/or at least one heterologous nucleic acid encoding a SCID patients (subject ID numbers 8 and 11; filled black NFAT regulator protein or fragment or derivative thereof; and squares) were born to consanguineous parents (Subject ID a monitoring agent used to monitor, detect, or measure elec numbers 35 and 36). For functional and genetic analysis, trical current across the plasma membrane of the cell. In one DNA and blood samples were obtained from all individuals embodiment, the monitoring agent is an apparatus. In one shown in yellow or black. Halfblack squares or circles indi embodiment, the electrical current is due to flux of cations or cate heterozygous disease carriers as determined by pheno divalent ions across the cell. In one embodiment, the moni typic analysis. Double horizontal bars indicate consanguine toring agent is used to monitor the effect of a test agent on intracellular calcium within the cell. In one embodiment, the ous marriages, blackboxes SCID disease, diagonal bars death monitoring agent is used to monitor, detect, or measure a 10 of individuals. FIG. 1B shows reduced SOCE in T cells of calcium-entry mediated event. both parents of CRAC deficient SCID patients that defines The present invention further provides a system compris them as heterozygous carriers of the disease trait. T cells were ing a recombinant cell overexpressing at least one mamma stimulated with thapsigargin (TG) in the absence of extracel lian NFAT regulator protein or fragment orderivative thereof; lular Ca". The peak (upper panel) and rate (bottom panel) of and a monitoring agent used to monitor, detect, or measure a 15 Ca" influx were measured after readdition of 0.5 mM extra calcium-entry mediated event. In one embodiment, the NFAT cellular Ca". FIG. 1C shows reduced SOCE that phenotypi regulator is encoded by ORAI1 (SEQ ID NO: 1), ORAI2 cally identifies 12/21 family members of the SCID patients as (SEQID NO: 2), or ORAI3 (SEQID NO:3), DYRK1A (SEQ heterozygous disease trait carriers. Ca' influx was measured IDNO:4), DYRK1B (SEQID NO:5), DYRK2 (SEQID NO: as described in B but using 0.2 mM extracellular Ca". Shown 6), DYRK3 (SEQ ID NO: 7), DYRK4 (SEQ ID NO: 8) or are the averages of Ca" influx rates from 4-5 experiments. DYRK6 (SEQ ID NO:9). Individual ID numbers correspond to those shown in FIG.1.A. The present invention further provides a recombinant cell Stars indicate heterozygous carriers as defined by influx rates comprising at least one heterologous NFAT regulator protein below 2 nM/s (dotted redline). Co, healthy control; P. patient. or fragment or derivative thereof, and/or at least one heter FIGS. 2A-2B show that a genome-wide RNAi screen iden ologous nucleic acid encoding a NFAT regulator protein or 25 tifies Drosophila Orai as a protein regulating NFAT translo fragment or derivative thereof. In one embodiment, the cation and store-operated Ca" entry. FIG. 2A shows that recombinant cell overexpresses at least one mammalian RNAi of dSTIM or dOrai inhibits dephosphorylation of NFAT regulator protein or fragment or derivative thereof. NFAT. S2R+ cells stably transfected with NFAT1(1-460)- The present invention further provides a recombinant cell GFP were incubated for 4 days with double-stranded (ds) overexpressing at least on mammalian NFAT regulator pro 30 RNAi against dSTIM, dOrai or an irrelevant DNA sequence tein or fragment or derivative thereof. (mock). Cells were left unstimulated (-TG) or stimulated The present invention further provides a method for iden with thapsigargin (+TG) for 10 min, then lysed after stimu tifying an agent for treating or lation with TG, and cell extracts were separated by SDS preventing a disease or disorder associated with calcium PAGE and immunoblotted with antibodies against NFAT1. signaling. The method comprises assessing the effects of a 35 Dephosphorylation of NFAT is evidenced by more rapid test agent on an organism exhibiting the disease or disorder, migration (lower band) on SDS-PAGE. FIG. 2B shows that and identifying the test agent as an agent for treating or RNAi of either dSTIM or dOrai inhibits Ca" influx in S2R+ preventing the disease or disorder if it modulates an activity, cells. Cells were left unstimulated (-TG) or stimulated with interaction, expression, or binding of at least one NFAT regu thapsigargin (+TG) for 10 min, then loaded with Fluo-4 and lator protein or fragment thereof. In one embodiment, the 40 Fura-Red and analyzed for Ca" influx by flow cytometry. 1 disease or disorder is rheumatoid arthritis, inflammatory uMthapsigargin was added at the indicated time. The top line bowel disease, allogeneic or Xenogeneic transplantation in each panel shows RNAi for Gfp and the bottom line RNAi rejection, graft-Versus-host disease, aplastic anemia, psoria for dSTIM or dOrai. Decreased Ca" influx is indicated by the sis, lupus erytematosus, inflammatory disease, MS, type I much reduced change in emission ratio following addition of diabetes, asthma, pulmonary fibrosis, Scleroderma, dermato 45 thapSigargin. myositis, Sjogren's syndrome, postpericardiotomy syn FIGS. 3A-3C show that Orail is a transmembrane protein. drome, Kawasaki disease, Hashimoto's thyroiditis, Graves FIG. 3A shows that Orail is highly conserved in eukaryotes. disease, myasthenia gravis, pemphigus Vulgaris, autoimmune Shown is the sequence conservation in the first of four puta hemolytic anemia, idiopathic thrombopenia, chronic glom tive transmembrane regions (M1, underlined) of Orai1, which erulonephritis, Goodpasture's syndrome, Wegner's granulo 50 contains the R-W mutation (bold) found in the SCID matosis, multiple Sclerosis, cystic fibrosis, chronic relapsing patients. FIG. 3B shows membrane topology of Orail. Hydr hepatitis, primary biliary cirrhosis, uveitis, allergic rhinitis, opathy plots were calculated from the full-length amino acid allergic conjunctivitis, atopic dermatitis, Crohn's disease, sequence of human Orail (301 a.a. NP 116179) using the ulcerative colitis, colitis/inflammatory bowel syndrome, Kyte-Doolittle algorithm with a window size of 19 amino Guillain-Barre syndrome, chronic inflammatory demyeli 55 acids. Three transmembrane domains (M2-M4) are predicted nating polyradiculoneuropathy, eczema, and autoimmune with a score >1.8; M1 has a score of ~1.3. FIG. 3C shows thyroiditis. Transplant graft rejections, acquired immunode schematic representation of the predicted membrane topol ficiencies, common variable immunodeficiency, myocardial ogy of Orail, based on the hydropathy plot and immunocy hypertrophy, severe combined immunodeficiency, dilated tochemistry data. The site of the R-W mutation in the SCID cardiomyopathy, excessive or pathological bone resorption, 60 patients is indicated by a dark box. FIGS. 4A-4H show that excessive adipocyte differentiation, obesity, or reactivation of expression of Orail restores CRAC channel function in SCID latent viruses. T cells. FIG. 4A shows activation of an inward current in an Orai'-complemented SCID T cell by passive store deple BRIEF DESCRIPTION OF THE DRAWINGS tion with a pipette solution containing 8 mMBAPTA. At the 65 indicated times, the 20 mM Ca", solution was replaced with FIGS. 1A-1C show gene-dosage effect in store-operated a divalent free (DVF) solution. Enhanced current in the Ca" entry (SOCE). FIG. 1A shows a pedigree of patients absence of divalent cations is a characteristic of CRAC chan US 9,163,078 B2 7 8 nels and certain other Ca"-selective channels. FIG.4B shows FIGS. 7A-7C shows screening of candidate kinases iden the current-voltage (I-V) relation of currents in 20 mM Ca" tified in the Drosophila S2R+ cell RNAi screen, for NFAT (left) and in DVF solution (right) measured during voltage phosphorylation and identification of DYRK as a negative ramps from -100 to +100 mV. Data were collected at the regulator of NFAT, FIG. 7A shows the ability of overex times indicated by the arrows in 4A. Note that the Ca" pressed mammalian homologs of the candidate kinases to current I-V relation is inwardly rectifying with a reversal directly phosphorylate the NFAT regulatory domain. FLAG potential D+90 mV. In DVF solution, the current reversed at tagged mammalian homologues of selected Drosophila ~+50 mV. FIG.4C shows that SCIDT cells expressing mutant kinases were expressed in HEK293 cells, and immunopuri Orail', inward Ca" and Na" currents fail to develop dur fied kinases were tested using an in vitro kinase assay for ing passive store depletion by 8 mMBAPTA. FIG. 4D shows 10 noise characteristics of the depotentiating Na' current. Top phosphorylation of GST-NFAT1(1-415). Phosphorylation graph shows the mean current at a constant holding potential levels were assessed by autoradiography with either short of-100 mV. The dotted line indicates the Zero current level (top panel) or long (middle panel) exposures. Expression of (measured in 20 mM Ca"+2 uM La"). Variance was calcu each kinase was verified by immunoblotting (IB) using an lated from 100-ms segments of the Na" current and plotted 15 anti-FLAG antibody. Kinases tested are as follows: lane 1, against mean current in lower panel. The data are fit by a CK1C.; lane 2, CKle; lane 3, Bub1; lane 4, STK38; lane 5, straight line with a slope of 26 fa, giving a lower limit to the STK38L: lane 6, CDC42BPA: lane7, ARAF; lane 8. PRKG1; unitary current. FIG. 4E shows fast inactivation of the Ca" lane 9, SGK: lanes 10 and 11, CSNKA1 and CSNKA2 (CKII current in a SCID T cell expressing Orai'. Fast inactivation isoforms); lane 12, SRPK1; lane 13, DYRK2: lane 14, was measured during 300-ms steps to -100 mV from a hold ALS2CR7; lane 15, IRAK4. Bub1 was later dropped from our ing potential of +30 mV with 20 mM Ca". FIG. 4F shows candidate list because of >10 predicted off-targets (Example blockade of the Ca" current by 2 uM La". After passive 3). FIG. 7B shows overexpression of DYRK2 blocks cal induction of the inward current in a SCID T cell expressing cineurin-mediated dephosphorylation of NFAT1. Each Orai", 2 MLa" was applied. The dotted line indicates the kinase was co-transfected with NFATGFP into HEK293 Zero current level, determined from traces collected at the 25 cells; after 18 hrs cells were stimulated with 1 uM ionomycin beginning of the experiment immediately following whole in the presence of 2 mM CaCl. Lysates were immunoblotted cell break-in. FIG. 4G shows potentiation and blockade of using NFAT1 antibody. Relative expression levels of the I, by application, respectively, of low (5uM) and high (40 kinases were determined by immunoblot using anti-FLAG uM) doses of 2-APB. FIG. 4H shows the summary of peak antibody, and were identical to those represented in FIG. 6A current densities in the indicated cell categories. Peak cur 30 (bottom panel). FIG. 7C shows depletion of endogenous rents were measured during steps to -100 mV. Reconstitution DYRK1A potentiates NFAT activation. HeLa cells stably with wild-type Orail thus reconstitutes a current with the expressing Ha-tagged NFAT1-GFP were transfected with expected characteristics of native CRAC channels. Cells control siRNA or DYRK1A-specific siRNA. After 4 days transduced with Orail' or Orai1** were visually selected cells were stimulated with 1 uM thapsigargin (TG) or 1 uM based on GFP-fluorescence; untransduced cells were GFP 35 thapsigargin (TG) followed by 20 nM CSA for indicated negative. times; lysates were immunoblotted for NFAT-GFP using anti FIGS.5A-5D show that expression of Orail in fibroblasts HA antibody (left). DYRK1A mRNA levels (right) were from SCID patients restores store-operated Ca" influx. FIG. assessed after 3 and 4 days by real-time PCR. siControl, 5A shows inhibition of Ca" influx in Orai1' expressing scrambled control siRNA: silDYRK1A, DYRK1A-specific SCID fibroblasts by 75 uM2-APB. FIG. 5B shows potentia 40 siRNA. Results show the average and standard deviation of tion of Ca' influx in Orai1'-expressing SCID fibroblasts three independent experiments. by 3 uM 2-APB. FIGS. 5C-5D shows inhibition of Cat FIGS. 8A-8C show that DYRK2 inhibits NFAT-dependent influx in Orai1'-expressing SCID fibroblasts by 2 uMLa" reporter activity and endogenous IL-2 expression. FIG. 8A added before (FIG.5C) or after (FIG. 5D) readdition of 20 shows that overexpression of DYRK2 inhibits IL2 promoter mM Ca". For each experiment, ~15-20 GFP-positive fibro 45 driven luciferase activity in stimulated Jurkat T cells. (The blasts were analyzed. Experiments were repeated at least IL2 promoter is an example of a cytokine promoter whose three times for each protocol. activation exhibits a strong requirement for NFAT.) Exponen FIGS. 6A-6C show the NFAT regulatory domain and tially growing Jurkat T cells were co-transfected with pRLTK results of the genome-wide RNAi screen in Drosophila. FIG. (renilla luciferase, internal control), IL-2-pGL3 (IL-2-pro 6A shows a schematic diagram of the N-terminal regulatory 50 moter driven firefly luciferase, experimental promoter) and domain of NFAT1, showing the conserved phosphorylated empty vector or increasing amounts of wild type (WT) or serine motifs which are dephosphorylated upon stimulation kinase dead (KD) DYRK2 expression plasmids (5, 10, 15 and (circles). Peptides corresponding to the SRR1, SP2 and SP3 20 ug). After 24h cells untreated or stimulated with PMA and motifs used for in vitro kinase assays are represented. Serine ionomycin for 6 h were analyzed for IL-2-promoter-driven residues shown underlined have been identified to be phos 55 luciferase activity. Firefly luciferase was normalized to phorylated in NFAT1 in vivo, and these are the residues renilla luciferase and fold induction calculated relative to mutated to alanine in the mutant SP2 and SP3 motifs. FIG. 6B IL-2 promoter activity measured in untreated cells. Results shows that heterologously expressed NFAT is correctly regu show the average and Standard deviation of three independent lated by Ca" and calcineurin in Drosophila S2R+ cells. experiments. FIG. 8B shows that overexpression of DYRK2 Drosophila S2R+ cells were transfected with NFAT1-GFP 60 inhibits endogenous IL-2 expression in stimulated Jurkat T expression vector. 48 hrs later, the cells were left untreated cells. Exponentially-growing Jurkat T cells were co-trans (Untr) or treated with thapsigargin (TG, 1 uM) for 30 min and fected with GFP and empty vector or increasing amounts of lysates from the cells were analysed by immunoblotting (IB) wild type (WT) or kinase dead (KD) DYRK2 expression with anti-NFAT1. P and dePrefer to the migration positions plasmids (10, 20 and 30 Jug). After 24 h cells untreated or of phosphorylated and dephosphorylated NFAT-GFP, respec 65 stimulated with PMA and ionomycin for 6 h were evaluated tively. FIG. 6C shows the tabulation of the results of the for IL-2 expression in GFP+ cells by intracellular cytokine primary Screen. staining and flow cytometry. FIG. 8C shows quantification of US 9,163,078 B2 the results shown in 8B. Results show the average and stan - Continued dard deviation of three independent experiments. DYRK3 sense: FIGS.9A-9C shows that STIM proteins affect NFAT local (SEQ ID NO: 16) TGCAATCCTTCTGAACCACCTCCA, ization by altering store-operated Ca" influx. FIG.9A shows 5 the percent of cells with nuclear NFAT was quantified in three DYRK3 anti-sense: independent experiments after mock treatment or treatment (SEO ID NO : 17) with dsRNAs against dSTIM. Mean and standard deviations GCTGTTCTACCTTCATCTCACCTCCA: are plotted. 50-100 cells were analyzed for each experiment. DYRK4 sense: FIG. 9B shows the effect of RNAi-mediated depletion of 10 (SEQ ID NO: 18) Drosophila STIM (dSTIM) on NFAT phosphorylation status. AGGCTGTCATCACTCGAGCAGAAA, Lysates made from unstirnulated orthapSigargin (TG)-stimu DYRK4 anti-sense: lated S2R-- cells were examined by immunoblotting with (SEQ ID NO: 19) antibody against NFAT1. The cells were mock-treated or AGTCCTGCTGATCACCTGAATGCT; 15 treated for 4 days with dsRNAs targeting dSTIM. FIG.9C DYRK6 sense: shows intracellular Ca" levels, analyzed by flow cytometry, (SEQ ID NO: 2O) in S2R+ cells depleted with dSTIM or novel gene candidates GCCGATGAGCATATGGCAAACACA, from the confirmatory screen. GFP dsRNA was used as a DYRK6 anti-sense: control for non-specific effects caused by dsRNA treatment. (SEQ ID NO: 21) After 30 sec of basal (Ca, measurement, 1 uMthapsigargin TACCCACTGCAGAAGGCTGGTTTA. was added (arrow) and Cal, measurements were continued for a further 5 min. Depletion of dSTIM almost completely FIGS. 11A-11 I show the nucleotide sequences for NFAT abolishes thapsigargin-triggered, that is store-operated, Ca" regulator genes. FIG. 11A shows the nucleotide sequence influx. ORAI1 (NM 032790: SEQID NO:1). FIG. 11B shows the 25 nucleotide sequence for ORAI2 (BC069270: SEQID NO:2). FIGS. 10A-10B shows the phylogenetic relation between FIG. 11C shows the nucleotide sequence for ORAI3 (NM different members of the DYRK family in Drosophila and in 152288: SEQ ID NO:3). FIG. 11D shows the nucleotide humans, and the expression pattern of human DYRKs in sequence for DYRK1A (NM 001396; SEQID NO:4). FIG. Jurkat T cells. FIG. 10A shows the phylogenetic tree of 11E shows the nucleotide sequence for DYRK1B (NM DYRK family kinases using distance-based methods (neigh 30 004714; SEQ ID NO:5). FIG. 11F shows the nucleotide bour joining). The left-hand side figures show the homology sequence for DYRK2 (NM 003583; SEQ ID NO:6). FIG. relationships between Drosophila CG40478 and human 11G shows the nucleotide sequence for DYRK3 (NM DYRK 2, 3: Drosophila CG4551 (smi35A) and human 003582: SEQ ID NO:7). FIG. 11H shows the nucleotide DYRK4; Drosophila CG7826 (mnb) and human DYRK1A, sequence for DYRK4 (NM 003845; SEQ ID NO:8). FIG. B (top); as computed by the program Tcoffee. In the right 35 11 I shows the nucleotide sequence for DYRK6 (NM hand side figures, the orthologue bootstrap value for 0.05734; SEQID NO:9). CG40478-DYRK2 is higher than for CG40478-DYRK3 (top). Therefore, DYRK2 is an orthologue of CG40478 (the DETAILED DESCRIPTION OF THE INVENTION genes diverged by a speciation event), while DYRK3 may be 40 a paralogue (the genes diverged by a duplication event). The Aspects of the present invention relate to the characteriza calculations of the ortholog bootstrap values were performed tion of genes regulating NFAT activity, for example, via with Orthostrapper. FIG. 10B shows expression of DYRK Store-Operated Calcium Entry (SOCE) or via modulation of family members in Jurkat T cells. Expression level of mam NFAT phosphorylation. In particular, to the discovery of an malian DYRK mRNAsin Jurkat T cells was estimated by 45 essential component of the Ca" release-activated Ca" RT-PCR analysis. Primers correspond to: (CRAC) channel. Accordingly, aspects of the invention relate to novel regulators of NFAT activity, particularly with regard DYRK1A sense: to modulation of NFAT activity in T cells. Aspects of the (SEQ ID NO: 10) invention also relate to methods to screen for novel agents that AGTTCTGGGTATTCCACCTGCTCA 50 modulate NFAT activity. Aspects of the invention further DYRK1A anti-sense: relate to methods to screen for agents that modulate the activ (SEQ ID NO: 11) ity of the NFAT regulators of the present invention. The TGAAGTTTACGGGTTCCTGGTGGT; invention further provides methods to Screen for agents that modulate the NFAT regulators of the present invention by DYRK2 sense: 55 means of modulating intracellular calcium. (SEQ ID NO: 12) NFAT Genes and Proteins TCCACCTTCTAGCTCAGCTTCCAA By NFAT protein (nuclear factor of activated T cells) is DYRK2 anti-sense: meant a member of a family of transcription factors compris (SEQ ID NO: 13) ing the members NFAT1, NFAT2, NFAT3 and NFAT4, with TGGCAACACTGTCCTCTGCTGAAT; 60 several isoforms. Any other NFAT protein whose activation is DYRK1B sense: calcineurin dependent is also meant to be included. NFAT (SEQ ID NO: 14) proteins can be, e.g., mammalian proteins, e.g., human or GCCAGCTCCATCTCCAGTTCT, murine. NFAT1, NFAT2 and NFAT4 are expressed in immune DYRK1B anti-sense: cells, e.g., T lymphocytes, and play a role in eliciting immune (SEQ ID NO: 5) 65 responses. NFAT proteins are involved in the transcriptional CACAATATCGGTTGCTGTAGCGGT; regulation of cytokine genes, e.g., IL-2, IL-3, IL-4, TNF alpha and IFN-gamma, during the immune response. US 9,163,078 B2 11 12 The conserved regulatory domain of NFAT is an N-termi Drosophila photoreceptor TRP (Transient Receptor Poten nal region of NFAT which is about 300 amino acids in length. tial) gene. But most TRP proteins form non-specific cation The conserved regulatory domain of murine NFAT1 is a channels and even those that show some preference for diva region extending from amino acid residue 100 through amino lent cations do not exhibit all of the key biophysical hallmarks acid residue 397, of human NFAT1 is a region extending from 5 of the CRAC channel when heterologously expressed amino acid residue 100 through 395, of human NFAT2 is a (Clapham, 2003. Nature 426:517). Until recently, TRPV6 region extending from amino acid residue 106 through 413. was the most promising CRAC channel candidate gene of human NFAT2b is a region extending from amino acid because some of its biophysical features overlapped with that residue 93 through 400, of human NFAT3 is a region extend of CRAC. But while TRPV6, like CRAC, selectively con ing from amino acid residue 102 through 404, and of human 10 ducts Ca", it is not activated by store depletion, a defining NFAT4 is a region extending from amino acid residue 97 characteristic of the CRAC channel. Knockdown studies through 418. The conserved regulatory domain is moderately using RNAi to suppress TRPV6 expression and our studies conserved among the members of the NFAT family, NFAT1, using T cells from TRPV6-/- mice showed no defect in NFAT2, NFAT3 and NFAT4. The conserved regulatory region SOCE or ICRAC in the absence of TRPV6 (Kahr, et al. 2004. binds directly to calcineurin. The conserved regulatory region 15 J Physiol 557: 121; Kepplinger, et al. Neither CaT1 nor is located immediately N-terminal to the DNA-binding TRPC3 proteins contribute to CRAC of T lymphocytes. domain (amino acid residues 398 through 680 in murine Manuscript in preparation). Thus, neither TRPV6 nor any NFAT1, amino acid residues 396 through 678 in human other gene has been confirmed to be involved in SOCE or NFAT1, amino acid residues 414 through 696 in human CRAC channel activity. NFAT2, amino acid residues 401 through 683 in human 20 Mechanisms of SOCE and CRAC Channel Activation. NFAT2b, amino acid residues 405 through 686 in human The mechanism by which CRAC channels are activated is NFAT3, and amino acid residues 419 through 700 in human equally unclear. Depletion of intracellular Ca" stores is nec NFAT4). essary for CRAC activation but how the information about Store Operated Calcium Entry reduced Ca" concentrations in the ER is conveyed to the SOCE is one of the main mechanisms to increase intracel- 25 CRAC pore is not known. Three main models have been lular cytoplasmic free Ca" concentrations (Ca'i) in elec proposed but no consensus has been reached (Parekh and trically non-excitable cells. Ca" elevations are a crucial sig Putney, Jr. 2005, Physiol Rev 85:757). (i) The “conforma nal transduction mechanism in virtually every cell. The tight tional coupling model” postulates a conformational change of control of intracellular Ca", and its utility as a second mes a molecule at the surface of the ER which then binds to the senger, is emphasized by the fact that Cali levels are typi- 30 CRAC channel; (ii) The “secretion coupling model” Suggests cally 70-100 nM while extracellular Ca" levels (Calex) that (constitutively active) CRAC channels reside in intracy are 10-fold higher, -1-2 mM. The immediate source of Ca" toplasmic vesicles that fuse to the plasma membrane upon for cell signaling can be either intracellular or extracellular store depletion; (iii) The "Calcium influx factor (CIF) model (FIG. 1). Intracellular Ca" is released from ER stores by predicts a soluble small molecule, which activates Ca" influx inositol 1,4,5-triphosphate (IP3), or other signals, while 35 through CRAC channels when CIF is released into the cyto extracellular Ca" enters the cell through voltage-gated, plasm of stimulated cells. ligand-gated, store-operated or second messenger-gated Ca" Stromal interaction molecule 1 (STIM1). Recent evidence channels in the plasma membrane. In electrically non-excit Suggests that STIM1 plays an important role in store operated able cells such as lymphocytes, the major mechanism for Ca" entry and CRAC channel function. Three independent Ca" entry is store-operated Ca" entry, a process controlled 40 RNAi screens by Roos et al. (2005, JCell Biol 169:435), Liou by the filling state of intracellular Ca" stores. Depletion of et al. (2005, Curr Biol 15:1235) and by our group (see intracellular Ca" stores triggers activation of membrane Example 2 below) have found that suppression of STIM Ca" channels with specific electrophysiological characteris expression by RNAi impairs Ca" influx in Drosophila mela tics, which are referred to as calcium release-activated Ca" nogaster S2 cells as well as mammalian cells (FIG.5). STIM1 (CRAC) channels (Parekh and Putney, Jr. 2005, Physiol Rev 45 is a type I transmembrane protein which was initially char 85:757). acterized as a stromal protein promoting the expansion of Ca" release activated Ca" (CRAC) channels. The elec pre-B cells and as a putative tumor suppressor (Oritani, et al. trophysiological characteristics of CRAC channels have been 1996. J Cell Biol 134:771; Sabbioni, et al. 1997. Cancer Res studied intensively, but the molecular nature of the channel 57:4493). The human gene for STIM1 is located on chromo itself and the mechanisms of its activation remain unknown. 50 some 11 p 15.5 which is believed to contain genes associated One definition of CRAC channels holds that depletion of with a number of pediatric malignancies, including Wilms intracellular Ca" stores is both necessary and sufficient for tumor (Parker et al. 1996, Genomics 37:253). STIM1 con channel activation without direct need for increases in Ca" tains a Ca" binding EF hand motif and a sterile C-motif i. inositol phosphates IP3 or IP4, c0MP or cAMP (Parekhand (SAM) domain in its ER/extracellular region, a single mem Penner. 1997, Physiol Rev. 77:901). Biophysically, CRAC 55 brane-spanning domain, and two predicted cytoplasmic current is defined, amongst other criteria, by its activation as coiled-coil regions (Manji et al. 2000, Biochim Biophys Acta a result of ER Ca" store depletion, its high selectivity for 1481:147). Domain structure and genomic organization are Ca" over monovalent (Cs", Na") cations, a very low single conserved in a related gene called STIM2, which differs from channel conductance, a characteristic I-V relationship with STIM1 mainly in its C-terminus (Williams et al. 2002, Bio pronounced inward rectification and its susceptibility to phar- 60 chim Biophys Acta 1596:131). STIM1 is able to homodimer macological blockade for instance by La" and 2-APB (100 ize or heterodimerize with STIM2 (Williams et al. 2002 uM), respectively (Parekh and Putney, Jr. 2005, Physiol Rev Supra). Expressed in the ER, its C-terminal region is located 85:757; Lewis, 2001, Annu Rev Immunol 19:497). in the cytoplasm whereas the N-terminus resides in the lumen Candidate genes for SOCE and CRAC. The molecular of the ER, as judged by glycosylation and phosphorylation nature of the CRAC channel remains completely unknown. 65 studies (Maji et al. 2000 supra; Williams et al. 2002 supra). A The most widely investigated candidate genes for the CRAC minor fraction of STIM1 is located in the plasma membrane. channel have been the >25 mammalian homologues of the Although RNAi mediated suppression of STIM1 expression US 9,163,078 B2 13 14 interferes with SOCE and CRAC channel function, STIM1 is The term fragment, as used herein, refers to a fragment of unlikely to be a Ca" channel itself. Rather it is thought that the NFAT regulator protein, or nucleic acid sequence, STIM1 may sense Ca" levels in the ER via its EF hand wherein the (encoded) protein retains at least one biological (Putney, Jr. 2005. J Cell Biol 169:381; Marchant, 2005, Curr activity of the full length NFAT regulator protein. The term Biol 15:R493). Consistent with the conformational coupling fragment and functional fragment are used herein inter model of store-operated Ca" influx, STIM1 could act as a changeably. A fragment of a sequence contains less nucle key adapter protein, which physically bridges the space otides or amino acids than the corresponding full length between ER and plasma membrane, and thus directly con sequences, wherein the sequences present are in the same nects sensing of depleted Ca" stores to store-operated Ca" consecutive order as is present in the full length sequence. As channels in the plasma membrane (Putney, Jr. 2005. Supra; 10 Putney, Jr. 1986, Cell Calcium 7:1). Such, a fragment does not contain internal insertions or dele NFAT Regulators tions of anything (e.g. nucleic acids or amino acids) in to the As used herein, the term "NFAT regulators' is used to refer portion of the full length sequence represented by the frag to the proteins (NFAT regulator proteins), and the encoding ment. This is in contrast to a derivative, which may contain internal insertions or deletions within the nucleic acids or genes (NFAT regulator genes) which regulate NFAT activity. 15 The methods of the present invention are intended to include amino acids that correspond to the full length sequence, or use of homologues, analogues, isoforms (e.g. alternative may have similarity to full length coding sequences. splice variants), derivatives, and functional fragments of the A derivative may comprise the same or different number of NFAT regulators described herein. Preferably, homologues of nucleic acids or amino acids as full length sequences. The NFAT regulator proteins have at least 70%, more preferably, term derivative, as used herein with respect to an NFAT regu 80%, and more preferably 90% amino acid identity to those lator protein, includes NFAT regulator proteins, or fragments specifically identified herein. thereof, which contain one or more modified amino acids. e.g. NFAT Regulator Proteins chemically modified, or modification to the amino acid In one preferred embodiment, the NFAT regulator proteins sequence (Substitution, deletion, or insertion). Such modifi of the present invention are encoded by the ORAI genes. 25 cations should substantially preserve at least one biological Previous to the discoveries upon which the present invention activity of the NFAT regulator protein. Such biological activ is based, the function of the ORAI genes was unknown. ity is readily determined by a number of assays known in the ORAI 1 nucleic acid sequence corresponds to GenBank art, for example, a calcium influx assay described below in accession number NM 032790, ORAI2 nucleic acid Example 1. By way or nonlimiting example, a derivative may sequence corresponds to GenBank accession number 30 BC069270 and ORAI3 nucleic acid sequence corresponds to be prepared by standard modifications of the side groups of GenBank accession number NM 152288. As used herein, one or more amino acid residues of the NFAT regulator pro ORAI refers to any one of the ORAI genes, e.g., ORAI1, tein, its analog, or a functional fragment thereof, or by con ORAI2, ORAI3. jugation of the NFAT regulator protein, its analogs or frag In one embodiment, the NFAT regulator proteins of the 35 ments, to another molecule e.g. an antibody, enzyme, present invention are encoded by the DYRK genes. Previous receptor, etc., as are well known in the art. Accordingly, to the discoveries upon which the present invention is based, "derivatives” as used herein covers derivatives which may be the DYRK genes were not known to regulate NFAT activity or prepared from the functional groups which occur as side function. DYRK1A is encoded by several nucleic acid iso chains on the residues or the N- or C-terminal groups, by forms including GenBank accession numbers NM 001396, 40 means known in the art, and are included in the invention. NM 101395, NM 130436, NM 130437, and Derivatives may have chemical moieties Such as carbohy NM 130438. DYRK1B is encoded by multiple nucleic acid drate or phosphate residues. Such a derivativization process isoforms including GenBank accession numbers should preserve at least one biological activity of the NFAT NM 004714, NM 006483, and NM 006484. DYRK2 is regulator protein. Derivatives can be made for convenience in encoded by GenBank accession numbers including 45 expression, for convenience in a specific assay, to enhance NM 003583 and NM 006482. DYRK3 is encoded by Gen detection, or for other experimental purposes. Derivatives Bank accession numbers including NM 001004023 and include dominant negatives, dominant positives and fusion NM 003582. DYRK4 is encoded by GenBank accession proteins. number NM 003845. DYRK6, also known as HIPK3, is Antibodies encoded by GenBank accession number NM 005734. 50 In one embodiment, the invention provides antibodies to In one embodiment, the NFAT regulator proteins of the the NFAT regulators of the present invention. Antibodies can present invention are encoded by the genes listed in Table I. be prepared that will bind to one or more particular domains The term “fragment’ or "derivative' when referring to a of a peptide of the invention and can be used to modulate NFAT regulator protein means proteins or polypeptides NFAT regulator gene or protein activity. which retain essentially the same biological function or activ 55 Moreover, administration of an antibody against an NFAT ity in at least one assay as the native NFAT regulator proteins. regulator protein or fragment or derivative thereof, preferably For example, the NFAT regulator fragments or derivatives of monoclonal or monospecific, to mammalian cells (including the present invention maintain at least about 50% of the human cells) can reduce or abrogate NFAT induced transcrip activity of the native proteins, preferably at least 75%, more tion of immune system associated genes, thus serving to treat preferably at least about 95% of the activity of the native 60 hyperactivity or inappropriate activity of the immune system. proteins, as determined e.g. by a calcium influx assay Administration of an activating antibody against an NFAT described in Example 1. regulator protein or fragment or derivative thereof, e.g. an Fragments or derivatives as the term is used herein can Orai protein, may serve to treat hypoactivity of the immune include competitors of the native NFAT regulators with system by activating NFAT and thereby inducing transcrip respect to a particular NFAT regulator domain activity. How 65 tion of immune response associated genes. Administration of ever, the fragment or derivative shows an overall similarity to an antibody againstan NFAT regulator protein or fragment or NFAT regulators in other areas as explained herein. derivative thereof, e.g., a DYRK protein, may serve to treat US 9,163,078 B2 15 16 hypoactivity of the immune system by activating NFAT and that are incapable of expressing endogenous immunoglobulin thereby inducing transcription of immune response associ heavy and light chain genes, but which can express human ated genes. heavy and light chain genes. The present invention also relates to antibodies that binda NFAT Associated Diseases protein or peptide encoded by all or a portion of the NFAT The methods of the present invention can also be utilized to regulator nucleic acid molecule, as well as antibodies which treat, or identify agents useful in treatment of conditions and bind the protein or peptide encoded by all or a portion of a diseases associated with NFAT disregulation/disfunction variant nucleic acid molecule. For instance, polyclonal and and/or Calcium signaling. Such diseases include, without monoclonal antibodies which bind to the described polypep limitation, immune system diseases involving hyperactivity 10 or inappropriate activity of the immune system, e.g., acute tide or protein, or fragments or derivatives thereof, are within immune diseases, chronic immune diseases and autoimmune the scope of the invention. diseases Examples of Such diseases include rheumatoid Antibodies of this invention can be produced using known arthritis, inflammatory bowel disease, allogeneic or Xenoge methods. An animal. Such as a mouse, goat, chicken or rabbit, neic transplantation rejection (organ, bone marrow, stem can be immunized with an immunogenic form of the protein 15 cells, other cells and tissues), graft-Versus-host disease, aplas or peptide (an antigenic fragment of the protein or peptide tic anemia, psoriasis, lupus erytematosus, inflammatory dis which is capable of eliciting an antibody response). Tech ease, MS, type I diabetes, asthma, pulmonary fibrosis, scle niques for conferring immunogenicity on a protein or peptide roderma, dermatomyositis, Sjogren's syndrome, include conjugation to carriers or other techniques well postpericardiotomy syndrome, Kawasaki disease, Hashimo known in the art. The protein or peptide can be administered to's thyroiditis, Graves disease, myasthenia gravis, pemphi in the presence of an adjuvant. The progress of immunization guS Vulgaris, autoimmune hemolytic anemia, idiopathic can be monitored by detection of antibody titers in plasma or thrombopenia, chronic glomerulonephritis, Goodpasture's serum. Standard ELISA or other immunoassays can be used syndrome, Wegner's granulomatosis, multiple Sclerosis, cys with immunogen as antigen to assess the levels of antibody. tic fibrosis, chronic relapsing hepatitis, primary biliary cir Following immunization, anti-peptide antisera can be 25 rhosis, uveitis, allergic rhinitis, allergic conjunctivitis, atopic obtained, and if desired, polyclonal antibodies can be isolated dermatitis, Crohn's disease, ulcerative colitis, colitis/inflam from the serum. Monoclonal antibodies can also be produced matory bowel syndrome, Guillain-Barre syndrome, chronic by standard techniques which are well known in the art inflammatory demyelinating polyradiculoneuropathy, (Kohler and Milstein, Nature 256:4595-497 (1975); Kozbar eczema, and autoimmune thyroiditis. Transplant graft rejec 30 tions can result from tissue or organ transplants. Graft-Versus et al., Immunology Today 4:72 (1983); and Cole et al., Mono host disease can result from bone marrow or stem cell trans clonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. plantation. Immune system diseases involving hypoactivity 77-96 (1985)). Such antibodies are useful as diagnostics for of the immune system include, e.g., immunodeficiency dis the intact or disrupted gene, and also as research tools for eases including acquired immunodeficiencies, such as HIV identifying either the intact or disrupted gene. 35 disease, and common variable immunodeficiency (CVID). As an alternative to preparing monoclonal antibody-secret The methods of the present invention can also be utilized to ing hybridomas, a monoclonal antibody to NFAT regulator treat or identify agents useful in treatment of conditions and proteins may be identified and isolated by Screening a recom diseases that are not immune mediated, but which neverthe binant combinatorial immunoglobulin library (e.g., an anti less involve the Ca"-calcineurin-mediated activation of body phage display library) to thereby isolate immunoglobu 40 NFAT, e.g. a protein-protein interaction between calcineurin lin library members that bind to NFAT regulator proteins. Kits and NFAT. Examples include myocardial hypertrophy, for generating and Screening phage display libraries are com dilated cardiomyopathy, excessive or pathological bone mercially available from, e.g., Dyax Corp. (Cambridge, resorption, excessive adipocyte differentiation, obesity, and Mass.) and Maxim Biotech (South San Francisco, Calif.). reactivation of latent human herpesvirus-8 or other viruses. Additionally, examples of methods and reagents particularly 45 Further, the methods of the present invention can be utilized amenable for use in generating and screening antibody dis to treat, or identify agents useful in the treatment of condi play libraries can be found in the literature. tions that involve a dysfunction of cellular Ca" signaling, Polyclonal sera and antibodies may be produced by immu attributable to altered function of an NFAT regulator protein, nizing a suitable subject, such as a rabbit, with NFAT regula wherein, the dysfunction ofCa" signaling causes a disease or torproteins (preferably mammalian; more preferably human) 50 disorder at least in part through its effects on other Ca" or an antigenic fragment thereof. The antibody titer in the dependent pathways in addition to the Ca"-calcineurin immunized Subject may be monitored over time by standard NFAT pathway, or wherein the dysfunction of Ca" signaling techniques, such as with ELISA, using immobilized marker acts largely through Such other pathways and the changes in protein. If desired, the antibody molecules directed against NFAT function are ancillary. NFAT regulator proteins may be isolated from the subject or 55 Severe Combined Immunodeficiency culture media and further purified by well-known techniques, One NFAT associated diseasef disorder is Severe Com Such as protein A chromatography, to obtain an IgG fraction. bined Immunodeficiency (SCID). SCID is a group of con Fragments of antibodies to NFAT regulator proteins may genital immune disorders caused by failed or impaired devel be produced by cleavage of the antibodies in accordance with opment and/or function of both T and B lymphocytes. A rare methods well known in the art. For example, immunologi 60 disease with an estimated prevalence of 1 per 100,000 popu cally active F(ab') and F(ab'), fragments may be generated by lation, SCID can be caused by mutations in more than 20 treating the antibodies with an enzyme Such as pepsin. Addi different genes. Mutations in the common Y chain (cy) of the tionally, chimeric, humanized, and single-chain antibodies to interleukin 2 (IL-2), IL-4, -7, -9 and -15 receptors leading to NFAT regulator proteins, comprising both human and non X-linked SCID account for 50% of all cases. Approximately human portions, may be produced using standard recombi 65 10% of all SCID cases are due to a variety of rare mutations nant DNA techniques. Humanized antibodies to NFAT regu in genes important for T and B cell development or function, lator proteins may also be produced using transgenic mice especially signal transduction (CD3e and Y, ZAP-70, p56lck, US 9,163,078 B2 17 18 CD45, JAK3, IL-7RO. chain). Due to the low incidence of and/or their encoded protein products, modulate the activity these mutations and Small family sizes, classical positional of NFAT either directly or indirectly. cloning is usually not possible for most of these SCID dis As used herein, the term “modulates' refers the effect an eases and mutations were often found in known signal trans agent, including a gene product, has on another agent, includ ducing genes by functional analysis of T cells followed by ing a second gene product. In one embodiment, an agent that sequencing of candidate genes. Scientifically, SCID disease modulates another agent upregulates or increases the activity has been of extraordinary value for the elucidation of T cell of the second agent. In one embodiment, an agent that modu and B cell function, highlighting the consequences of gene lates another agent downregulates or decreases the activity of dysfunction in the immune system. the second agent. In one embodiment, the invention relates to a method to 10 One example of an NFAT regulator detected through the diagnose unexplained immunodeficiency in a Subject com RNAi screening described herein is calcineurin. The role of prising comparison of a nucleotide sequence corresponding calcineurin in NFAT signaling was previously known. Spe to a gene from the subject comprising the NFAT regulators of cifically, calcineurin dephosphorylates and activates NFAT, the present invention to wild type sequence of that gene, and therefore is a positive regulator. wherein alteration of the nucleotide sequence of the gene 15 Calcineurin serves to illustrate the relationship between from the wildtype sequence indicates that the alteration in the altered expression of a regulator and altered NFAT signaling: gene is responsible for the immunodeficiency. In one embodi Overexpression of calcineurin leads to increased activation of ment, the alteration in the gene is a mutation in a splice site. In NFAT in standard assays; conversely, diminished expression one embodiment, the alteration in the gene is a nonsynony of calcineurin, as in the RNAi screen detailed below in mous mutation. In one embodiment, the unexplained immu Example 1, leads to a decrease in NFAT activation. Cal nodeficiency is associated with defects in regulation of NFAT cineurin also illustrates that altered activity of a regulator, by activity. an agent, is reflected in altered NFAT signaling. Thus, In one embodiment, the comparison is accomplished by cyclosporin A and FK506 are calcineurin inhibitors when way of obtaining a biological sample from the Subject, complexed with their cytoplasmic binding proteins (cyclo sequencing the DNA in the biological sample, and electroni 25 philin A and FKBP12, respectively), and the inhibitory action cally aligning the DNA sequence obtained from the biologi of these compounds on calcineurin can be detected, for cal sample to a wild type sequence. example, by examining the effect of cyclosporin A or FK506 In one embodiment, a comparison is accomplished by way on NFAT localization in cells stimulated with thapsigargin, or of obtaining a DNA sample, processing the DNA sample Such in T cells stimulated physiologically through the T cell recep that the DNA is available for hybridization, combining the 30 tOr. DNA with nucleotide sequences complementary to the nucle An assay for an agent that affects an NFAT regulator need otide sequence of a NFAT regulator of the present invention not directly involve NFAT. Thus, a number of agents that alter under conditions appropriate for hybridization of the probes the activity of calcineurin, for example, the PVIVIT peptide with complementary nucleotide sequences in the DNA and its derivatives, the CSA-cyclophilin A complex, and the sample, thereby producing a combination; and detecting 35 FK506-FKBP12 complex, can be assayed by examining their hybridization in the combination, wherein absence of hybrid binding to calcineurin; and the calcineurin autoinhibitory ization in the combination is indicative of alteration in the peptide can be assayed by examining its effect on dephospho nucleotide sequence in the gene. rylation of substrates other than NFAT. Method to Screen for Agents that Modulate NFAT Regulator Positive regulators of NFAT are known to act at other Function 40 stages of the Ca"-calcineurin-NFAT signaling pathway. For In one embodiment, the present invention relates to meth example, Orail and STIM1 contribute to the elevation of ods to screen for agents that alter NFAT regulator expression cytoplasmic Ca", and thereby elicit activation of cal or function. In one embodiment, the present invention relates cineurin and Subsequently of NFAT. Here again, agents that to methods to screen for agents that alter the function of the decrease expression of Orail or STIM1 (e.g., RNAi reagents, NFAT regulator proteins of the present invention. NFAT regu 45 as shown herein for both Orail and STIM1, and as shown for lator function may be altered as to the modulation of CRAC dStim and STIM1 in Roos et al (2005) J Cell Biol 169, channel activation. NFAT regulator function may be altered 435-445; Liou et al (2005) Current Biology 15, 1235-1241) as to the modulation of NFAT phosphorylation. NFAT regu can be recognized either by their effects on NFAT activation lator function may be altered as to modulation of NFAT (e.g., NFAT dephosphorylation or intracellular localization) subcellular localization. NFAT regulator function may be 50 or on other parameters diagnostic of the function of the NFAT altered as to modulation of free intracellular calcium levels. regulators in question (e.g., cytoplasmic Ca" levels). NFAT regulator function may be altered as to modulation of Agents that inhibit function of the Ca"-calcineurin-NFAT calcineurin activity. In one embodiment, alter or modulate signaling pathway by affecting one or more NFAT regulator refers to upregulation or enhancement of activity. In one proteins, for example agents that inhibit Ca" influx through embodiment, alter or modulate refers to downregulation or 55 the CRAC channel (e.g., La", Gd", 2-APB) are likewise inhibition. readily detected. The inhibitory agents that are known at As used herein, the term "NFAT regulator genes' is used to present, however, are not entirely selective, which is the rea refer to the genes identified by the methods of the present son that the assays described herein constitute a valuable tool invention that regulate NFAT activity, including by way of for the discovery of agents that target the NFAT modulator SOCE, by way of direct phosphorylation of NFAT or by other 60 proteins of this pathway more selectively. means as described in example 2. The NFAT regulator genes The present invention is also inclusive of negative regula of the present invention include: ORAI1, ORAI2, ORAI3, the tors of Ca"-calcineurin-NFAT signaling. These include, for DYRK genes including DYRK1A, DYRK1B, DYRK2, example, DYRK-family kinases, casein kinase-1 isoforms, DYRK3 DYRK4 and DYRK6 and the genes disclosed in and glycogen synthase kinase (GSK-3). Inhibition of the Table I in Example 3. In one preferred embodiment, the NFAT 65 expression of these negative regulators, for example by RNAi regulator genes of the present invention are ORAIs, e.g., treatment, or inhibition of their activity, for example by treat ORAI1, ORAI2, and ORAI3. The NFAT regulator genes ment with an agent that inhibits enzyme activity (e.g., the US 9,163,078 B2 19 20 casein kinase inhibitor CKI-7: Li as a GSK-3 inhibitor), in Example 1, including T cells and fibroblasts, may be useful in each case can be detected using an assay that monitors an the methods of the present invention. aspect of NFAT activation. As used herein, the term “recombinant cell' is used to refer The invention relates to screening methods (also referred to to a cell with exogenous and/or heterologous nucleic acid herein as “assays”) for identifying modulators, i.e., candidate incorporated within, either incorporated stably so as to compounds or agents (e.g., proteins, peptides, peptidomimet remain incorporated in clonal expansion of the cells, or intro ics, peptoids, oligonucleotides (such as siRNA or anti-sense duced transiently into a cell (or a population of cells). The RNA), Small non-nucleic acid organic molecules, Small inor nucleic acid may contain, for example, an NFAT regulator ganic molecules, or other drugs) that bind to NFAT regulator gene or its mRNA, or its complementary (antisense) strand, proteins, or to NFAT, have an inhibitory (or stimulatory) 10 oran shRNA or siRNA, or any fragment or derivative of the effect on, for example, NFAT regulator gene expression or foregoing. The nucleic acid may comprise genomic DNA of protein activity, NFAT gene expression or protein activity, or NFAT regulator proteins, fragments, or derivative thereof. have a stimulatory or inhibitory effect on, for example, the The nucleic acid can comprise corresponding coding and expression or activity of an NFAT regulator-interacting pro non-coding mRNA or its complementary (anticoding) strand, tein (e.g. a NFAT regulator substrate) or a NFAT-interacting 15 which can be employed to regulate expression of the corre protein (e.g. a NFAT Substrate). Such interacting proteins can sponding mRNA, e.g. corresponding short nucleotides of include Ca" and other subunits of calcium channels, proteins shRNA or siRNA. The nucleic acid can result in altered that interact with one or more Orai proteins, e.g., additional expression (e.g. over expression or underexpression) of at CRAC channel subunits or CRAC channel modulatory pro least one NFAT regulator protein or its mRNA or antisense. It teins. Compounds thus identified can be used to modulate the may also result in the expression of a NFAT regulator protein activity of target gene products (e.g., NFAT regulator functional fragment or derivative otherwise not expressed in polypeptides, NFAT polypeptides) either directly or indi the recipient cell. rectly in a therapeutic protocol, to elaborate the biological Test Compounds function of the target gene product, or to identify compounds The test compounds of the present invention can be that disrupt the normal interactions of the target gene or gene 25 obtained using any of the numerous approaches in combina product. Identification of a blocking agent or inhibitor of an torial library methods known in the art, including: biological NFAT regulator gene oran encoded product can be carried out libraries; peptoid libraries (libraries of molecules having the using the screening methods of this invention and other meth functionalities of peptides, but with a novel, non-peptide ods known in the art. backbone, which are resistant to enzymatic degradation but Compounds that affect NFAT regulator expression or 30 that nevertheless remain bioactive; see, e.g., Zuckermann, et activity can be identified as described herein or using other al., 1994J. Med. Chem. 37: 2678-85); spatially addressable methods known in the art. The modulator compounds can be parallel solid phase or solution phase libraries; synthetic novel, compounds not previously identified as having any library methods requiring deconvolution; the one-bead one type of activity as a calcium channel modulator, or a com compound library method; and synthetic library methods pound previously known to modulate calcium channels, but 35 using affinity chromatography selection. The biological that is used at a concentration not previously known to be library and peptoid library approaches are limited to peptide effective for modulating calcium influx. The modulator can libraries, while the other four approaches are applicable to also be a modulator compound for NFAT regulators other peptide, non-peptide oligomer or Small molecule libraries of than CRAC channel components. compounds (Lam (1997) Anticancer Drug Des. 12:145). The term "agent' or “compound as used herein and 40 Examples of methods for the synthesis of molecular librar throughout the specification means any organic or inorganic ies can be found in the art, for example in: DeWitt et al., 1993, molecule, including modified and unmodified nucleic acids Proc. Natl. Acad. Sci. USA. 90:6909; Erb et al., 1994, Proc. such as antisense nucleic acids, RNAi, such as siRNA or Natl. Acad. Sci. USA 91:11422, Zuckermann et al., 1994, J. shRNA, peptides, peptidomimetics, receptors, ligands, and Med. Chem. 37:2678; Cho et al., 1993, Science 261: 1303: antibodies. 45 Carrell et al., 1994, Angew. Chem. Int. Ed. Engl. 33:2059: Compounds that inhibit the activity or expression of an Carell et al., 1994, Angew. Chem. Int. Ed. Engl. 33:2061; and NFAT regulator are useful in the treatment of disorders Gallop et al., 1994, J. Med. Chem. 37: 1233. involving cells that express an NFAT regulator. Particularly Libraries of compounds may be presented in Solution (e.g., relevant disorders are those involving hyperactivity or inap Houghten, 1992, Biotechniques 13:412-421), or on beads propriate activity of the immune system or hypoactivity of the 50 (Lam (1991) Nature 354:82-84), chips (Fodor, 1993, Nature immune system, as further described herein. 364:555-556), bacteria (Ladner, U.S. Pat. No. 5,223.409), Cells or tissues affected by these disorders can be used in spores (Ladner, U.S. Pat. No. 5.223.409), plasmids (Cullet screening methods, e.g., to test whether an agent that modu al., 1992, Proc. Natl. Acad. Sci. USA 89:1865-1869) or on lates expression or activity of an NFAT regulator can reduce phage (Scott and Smith, 1990, Science 249:386-390; Devlin, proliferation of affected cells, alleviate abnormal SOCE func 55 1990, Science 249:404–406; Cwirla et al., 1990, Proc. Natl. tion, or alleviate abnormal NFAT activity. Other cells useful Acad. Sci. 87:6378-6382; Felici, 1991, J. Mol. Biol. 222:301 in the screening methods of the present invention are cells that 310; and Ladner supra.). exhibit store-operated calcium entry, which include insect The compounds that can be screened by the methods cells, e.g., Drosophila cells (e.g., Schneider 2 or S2 cells), described herein include, but are not limited to, any small human embryonic kidney (HEK) cells, neuronal or nervous 60 molecule compound libraries derived from natural and/or system cells, e.g., SHSY5Y neuroblastoma cells and PC12 synthetic sources, Small non-nucleic acid organic molecules, cells, rat basophilic leukemia (RBL) cells, and immune sys Small inorganic molecules, peptides, peptoids, peptidomi tem cells, e.g., primary T cells from mammals such as human metics, oligonucleotides (e.g., siRNA, antisense RNA, or mouse, lymphocytes such as T lymphocytes, including aptamers such as those identified using SELEX), and oligo Jurkat cells. Cells derived from the knock out or transgenic 65 nucleotides containing synthetic components. animals described below may be useful. Cells derived from The test compounds can be administered, for example, by immunodeficient patients, e.g., patients described in diluting the compounds into the medium wherein the cell is US 9,163,078 B2 21 22 maintained, mixing the test compounds with the food or expression of a NFAT regulatory protein or fragment or liquid of a test animal (see below), topically administering the derivative thereof, achieved with the tools/methods described compound in a pharmaceutically acceptable carrier on the test herein. animal, using three-dimensional Substrates soaked with the In one embodiment, the test cells are resting cells wherein test compound Such as slow release beads and the like and 5 NFAT is normally localized to the cytoplasm. Nuclear local embedding Such substrates into the test animal, intracranially ization, or partial nuclear localization in excess of that administering the compound, parenterally administering the observed in untreated control cells, of the NFAT-reporter compound. fusion protein in the resting test cell indicates that the test A variety of other reagents may also be included in the agent successfully activated NFAT activity. 10 In one embodiment, the test cells are stimulated cells, mixture. These include reagents such as salts, buffers, neutral wherein intracellular Ca" stores are depleted and store-op proteins, e.g. albumin, detergents, etc. which may be used to erated Ca" entry is activated and NFAT is localized to the facilitate optimal protein-protein and/or protein-nucleic acid nucleus. Ca" store depletion may be accomplished, for binding and/or reduce non-specific or background interac example, by means of contacting the test cells with thapsi tions, etc. Also, reagents that otherwise improve the effi 15 gargin orionomycin. The test cells may be stimulated priorto, ciency of the assay, Such as protease inhibitors, nuclease concurrently with or Subsequent to contacting the test cells inhibitors, antimicrobial agents, etc. may be used. with the test agent. Cytoplasmic localization, or a reduction in The language “pharmaceutically acceptable carrier is nuclear localization compared to that observed in control intended to include Substances capable of being coadminis cells, of the NFAT-reporter fusion protein in the stimulated tered with the compound and which allow the active ingredi test cell indicates that the test agent successfully inhibited ent to perform its intended function of preventing, ameliorat NFAT activation. ing, arresting, or eliminating a disease(s) of the nervous A reporter gene which encodes a reporter protein to be system. Examples of Such carriers include solvents, disper operably linked to nucleotide sequences encoding the NFAT sion media, adjuvants, delay agents and the like. The use of regulatory domain, any reporter gene for general use is satis Such media and agents for pharmaceutically active Substances 25 factory provided that its localization in the cell can be is well known in the art. Any conventional media and agent assessed either directly or indirectly in the context of the compatible with the compound may be used within this fusion protein. For example, the reporter can be any protein invention. whose localization can be detected by staining with a labeled The compounds can be formulated according to the antibody, or a protein epitope Such as a haemagglutinin or 30 myc epitope, or green fluorescent protein (GFP) or one of its selected route of administration. The addition of gelatin, fla variants. In one preferred embodiment, the reporter protein is Voring agents, or coating material can be used for oral appli GFP. The NFAT protein in the fusion protein may be full cations. For Solutions or emulsions in general, carriers may length or may comprise the regulatory domain, particularly include aqueous or alcoholic/aqueous Solutions, emulsions or the calcineurin and CK1 docking sites and the conserved Suspensions, including saline and buffered media. Parenteral 35 serine rich regions (SRR) and serine-proline (SP) repeat vehicles can include Sodium chloride, potassium chloride motifs. among others. In addition intravenous vehicles can include Another aspect of the invention relates to methods for fluid and nutrient replenishers, electrolyte replenishers identifying an agent for treating or preventing a disease or among others. disorder associated with calcium signaling. In one embodi Preservatives and other additives can also be present. For 40 ment, the method comprises assessing the effects of a test example, antimicrobial, antioxidant, chelating agents, and agent on an organism that exhibits the disease or disorder, or inert gases can be added (see, generally, Remington’s Phar exhibits at least one phenotype associated with the disease or maceutical Sciences, 16th Edition, Mack, 1980). disorder. The test agent is identified as an agent for treating or Test Assays for Agents that Modulate NFAT Activity preventing the disease or disorder if it modulates an activity, Another aspect of the invention relates to a method to 45 interaction, expression or binding of at least one NFAT regu screen for regulators of free intracellular Ca" levels, cal lator protein, fragment, or derivative thereof. In one embodi cineurin activation and NFAT localization in cells as ment, the NFAT regulator protein, fragment, or derivative described in Examples 1 through 3. In one embodiment, a thereof is expressed either endogenously or exogenously in recombinant vector encoding a fusion protein comprising the cells of the organism. Appropriate methods of administration entire NFAT regulatory domain or a functional fragment or 50 of the test agent and assessment of effects can be determined derivative thereof, and an operably linked reporter protein by the skilled practitioner. (for determining Subcellular localization of the regulatory Test Assays for Agents that Modulate Calcium Levels domain, e.g. GFP or an antigenic epitope) is transfected into In monitoring the effect of a test agent on intracellular cells, i.e. test cells. Test cells transfected with the vector are calcium in any of the screening/identification methods pro contacted with the test agent. After a period of time, e.g., 55 vided herein, a direct or indirect evaluation or measurement 48-72 hours, the test cells are scored for subcellular localiza of cellular (including cytosolic and intracellular organelle or tion of the NFAT-reporter fusion protein. Scoring may be compartment) calcium and/or movement of ions into, within accomplished by way of automated microscopy, as in the or out of a cell, organelle, or portions thereof (e.g., a mem examples, or by way of manual microscopy, e.g., fluorescent brane) can be conducted. A variety of methods are described microscopy, confocal microscopy. Secondary test assays 60 herein and/or known in the art for evaluating calcium levels include calcium influx detection assays. If the test agent has and ion movements or flux. The particular method used and an effect on intracellular localization of the expression prod the conditions employed can depend on whether a particular uct of the recombinant vector, this is indicative that it modu aspect of intracellular calcium is being monitored. For lates NFAT regulator function. example, as described herein, reagents and conditions are In one embodiment, the cells also express an exogenous 65 known, and can be used, for specifically evaluating store (e.g. heterologous or homologous) NFAT regulator protein, operated calcium entry, resting cytosolic calcium levels and or fragment or derivative thereof, and/or exhibit altered calcium levels and uptake by or release from intracellular US 9,163,078 B2 23 24 organelles. The effect of test agent on intracellular calcium It may also be useful to experimentally reduce the endog can be monitored using, for example, a cell, an intracellular enous expression or functional levels of a particular protein organelle or storage compartment, a membrane (including, (e.g. by inhibition of protein expression or function) to iden e.g., a detached membrane patch or a lipid bilayer) or a tify an agent that modulates intracellular calcium by targeting cell-free assay system. that particular protein. Expression of an NFAT regulator pro Generally, monitoring the effect of a test agent on intrac tein can be reduced in a cell by known experimental methods ellular calcium involves contacting a test agent with or expos Such as by targeting expression at the nucleic acid level, e.g. ing a test agent to (1) a protein (and/or nucleic acid, orportion siRNA or shRNA treatment, to thereby reduce expression of (s) thereof, encoding a protein) involved in modulating functional protein. Systems which comprise Sucha cell which 10 have reduced, or completely inhibited, expression of NFAT intracellular calcium (in particular, a protein provided herein) regulator are included in this invention. Such systems may and/or (2) a cell, or portion(s) thereof (e.g., a membrane or further contain an exogenous (e.g. homologous or heterolo intracellular structure or organelle) that may or may not con gous) nucleic acid molecule encoding one or more mamma tain a protein (and/or nucleic acid, or portion(s) thereof, lian NFAT regulator proteins, or a portion thereof, in express encoding a protein) involved in modulating intracellular cal 15 ible form. cium. A cell can be one that exhibits one or more aspects of The type of control comparison described above, where intracellular Ca" modulation, such as, for example, store endogenous expression/functional levels of a particular pro operated calcium entry. Before, during and/or after the con tein are reduced in a cell, is particularly useful when trying to tacting of test agent, a direct or indirect assessment of intra identify an agent that specifically modulates intracellular cal cellular calcium can be made. An indirect assessment can be, cium via an effect on, or modulation of a particular protein for example, evaluation or measurement of current throughan (and/or nucleic acid, or portion(s) thereof, encoding a par ion transport protein (e.g., a store-operated calcium channel ticular protein). Thus, for example, if there is no detectable or ora Ca"-regulatedion channel), or transcription of a reporter substantial difference in intracellular calcium in the test (non protein operably linked to a calcium-sensitive promoter. A modified) versus control (reduced endogenous expression/ direct assessment can be, for example, evaluation or measure 25 function) cells in the presence of the agent, the agent likely ment of intracellular (including cytosolic and intracellular does not mediate its effect on intracellular calcium via the organelle) calcium. particular protein (or nucleic acid encoding the protein). A The assessment of intracellular calcium is made in Such a detectable or substantial difference in intracellular calcium in way as to be able to determine an effect of an agent on the test versus control cells in the presence of the test agent, intracellular calcium. Typically, this involves comparison of 30 indicates the test agent may be a candidate agent that specifi intracellular calcium in the presence of a test agent with a cally modulates intracellular calcium via an effect on or control for intracellular calcium. For example, one control is modulation of the particular protein. A candidate agent can be a comparison of intracellular calcium in the presence and Subjected to further control assays to compare intracellular absence of the test agent or in the presence of varying calcium in test cells in the presence and absence of test agent amounts of a test agent. Thus, one method for monitoring an 35 or to compare intracellular calcium in control cells in the effect on intracellular calcium involves comparing intracel presence and absence of test agent, which can aid in determi lular calcium before and after contacting a test agent with a nation of whethera candidate agent is an agent that modulates test cell containing a protein that modulates intracellular cal intracellular calcium. cium, or comparing intracellular calcium in a test cell that has An assessment of intracellular calcium conducted to moni been contacted with test agent and in a test cell that has not 40 tor the effect of test compound on intracellular calcium can be been contacted with test agent (i.e., a control cell). Generally, made under a variety of conditions. Conditions can be the control cell is Substantially identical to, if not the same as, selected to evaluate the effect of test compound on a specific the control cell, except it is the cell in the absence oftestagent. aspect of intracellular calcium. For example, as described A difference in intracellular calcium of a test cell in the herein, reagents and conditions are known, and can be used, presence and absence of test agent indicates that the agent is 45 for specifically evaluating store-operated calcium entry, rest one that modulates intracellular calcium. ing cytosolic calcium levels and calcium levels of and cal Another method for monitoring an effect on intracellular cium uptake by or release from intracellular organelles. For calcium involves comparing intracellular calcium of a test example, as described herein, calcium levels and/or calcium cell and a control cell that is substantially similar to the test release from the endoplasmic reticulum can directly be cell (e.g., comparing a cell containing a protein (and/or 50 assessed using mag-fora 2, endoplasmic reticulum-targeted nucleic acid encoding a protein) involved in intracellular aequorin or cameleons. One method for indirect assessment calcium signaling, such as the proteins provided herein), and of calcium levels or release is monitoring intracellular cyto a cell that does not contain, or that contains lower levels of plasmic calcium levels (for example using fluorescence the particular protein involved in modulating intracellular based methods) after exposing a cell to an agent that effects calcium signaling. Thus, for example, if the test cell contain 55 calcium release (actively, e.g., IP, or passively, e.g., thapsi ing the protein involved in intracellular calcium modulation is gargin) from the organelle in the absence of extracellular a recombinant cell generated by transfer of nucleic acid calcium. Assessment of the effect of the test agent/compound encoding the protein into a host cell, then one possible control on concentrations of cations or divalent cations within the cell is a host cell that has not been transfected with nucleic cell, or of ion influx into the cell, can also be used to identify acid encoding the protein or that has been transfected with 60 a test agent as an agent that modulates intracellular calcium. vector alone. Such a cell would be substantially similar to the Resting cytosolic calcium levels, intracellular organelle test cell but would differ from the test cell essentially only by calcium levels and cation movement may be assessed using the absence of the introduced nucleic acid encoding the pro any of the methods described herein or known in the art (see, tein. Thus, a control cell may contain, e.g., endogenously, the e.g., descriptions herein of calcium-sensitive indicator-based particular protein involved in modulating intracellular cal 65 measurements, such as fluo-3, mag-furs 2 and ER-targeted cium, in which case the test cell would contain higher levels aequorin, labeled calcium (such as “Ca")-based measure of (or overexpress) the particular protein. ments, and electrophysiological measurements). Particular US 9,163,078 B2 25 26 aspects of ion flux that may be assessed include, but are not assessing a current across a membrane or into a cell that is limited to, a reduction (including elimination) or increase in characteristic of a store-operated calcium entry current (e.g., the amount of ion flux, altered biophysical properties of the responsiveness to reduction in calcium levels of intracellular ion current, and altered sensitivities of the flux to activators or stores) or assessing transcription of a reporter construct that inhibitors of calcium flux processes, such as, for example, includes a calcium-sensitive promoter element. In particular store-operated calcium entry. Reagents and conditions foruse embodiments, a test agent is identified as one that produces a in specifically evaluating receptor-mediated calcium move statistically significant difference. E.g., at least a 30% differ ment and second messenger-operated calcium movement are ence in any aspect or parameter of store-operated calcium also available. entry relative to control (e.g., absence of compound, i.e., In particular embodiments of the methods for screening for 10 vehicle only). or identifying agents that modulate intracellular calcium, the Generally, a testagentis identified as an agent, or candidate methods are conducted under conditions that permit store agent, that modulates intracellular calcium if there is a detect operated calcium entry to occur. Such conditions are able effect of the agent on intracellular calcium levels and/or described herein and are known in the art. Test agents can be ion movement or flux, such as a detectable difference in levels contacted with a protein and/or nucleic acid encoding a pro 15 or flux in the presence of the test agent. In particular embodi tein (such as the proteins and nucleic acids provided herein) ments, the effect or differences can be substantial or statisti involved in modulating intracellular calcium and/or a cell (or cally significant. portion thereof) containing Such a protein (or nucleic acid) Test Assays for Agents that Modulate NFAT Regulator Activ under these appropriate conditions. For example, in conduct ity ing one method for screening for an agent that modulates In one embodiment, an assay is a cell-based assay in which intracellular calcium under conditions selected for evaluating a cell that expresses an NFAT regulator protein or biologically store-operated calcium entry, intracellular calcium levels of active portion thereof is contacted with a test compound, and test cells are monitored over time using a fluorescent calcium the ability of the test compound to modulate NFAT regulator indicator (e.g., FLUO-4). Store-operated calcium entry into activity is determined. Determining the ability of the test the cells is detected depending on the specific indicator used 25 compound to modulate NFAT regulator activity can be as, e.g. an increase in fluorescence, a decrease in fluores accomplished by monitoring, for example, changes in cal cence, or a change in the ratio of fluorescence intensities cium flux in the cell or by testing downstream effects of elicited by excitation using light of two different wave modulating calcium flux such activation or IL-2 expression. lengths. in response to conditions under which store-operated Methods of testing such downstream effects are known in the calcium entry occurs. The methods for eliciting the fluores 30 art and include modulation of cell proliferation and cell cence signal for a specific calcium indicator and for interpret growth. For example, a compound that decreases the number ing its relation to a change in free calcium concentration are of NFAT regulator molecules in a cell or affects the function well known in the art. The conditions include addition of a of an NFAT regulator channel may decrease cellular prolif store-depletion agent, e.g., thapsigargin (which inhibits the eration. Alternatively, transcription of genes requiring NFAT ER calcium pump and allows discharge of calcium stores 35 transactivation may be monitored. through leakage) to the media of cell that has been incubated U.S. Pat. Application No. 2004.0002117 discloses known in Ca"-free buffer, incubation with thapsigargin for about gene targets of NFAT and teaches methods to identify further 5-15 minutes, addition of test compound (or vehicle control) genes transcribed due to activity of NFAT. Detection of tran to the media and incubation of the cell with test agent for Scription or protein expression of NFAT target genes may be about 5-15 minutes, followed by addition of external calcium 40 useful in the methods of the present invention. Ablation of to the media to a final concentration of about 1.8 mM. By induced expression of NFAT target genes in the presence of a adding thapsigargin to the cell in the absence of external test agent indicates that the test agent is effective in inhibiting calcium, it is possible to delineate the transient increase in NFAT regulator activity, where the NFAT regulator is a posi intracellular calcium levels due to calcium release from cal tive regulator of NFAT. Conversely, expression of NFAT tar cium stores and the more Sustained increase in intracellular 45 get genes above basal levels in the presence of a test agent, in calcium levels due to calcium influx into the cell from the otherwise unstimulated conditions, indicates that the test external medium (i.e., store-operated calcium entry through agents is effective in inhibiting a negative regulator of NFAT. the plasma membrane that is detected when calcium is added In some cases, the cell used in Such assays does not nor to the medium). Because the fluorescence-based assay allows mally express the NFAT regulator of interest (e.g. a channel for essentially continuous monitoring of intracellular calcium 50 protein). By way of non-limiting example, a cell Such as a levels during the entire period from prior to addition of thapsi Xenopus oocyte or immune system cell or derivative thereof gargin until well after addition of calcium to the medium, not can be engineered to expresses a recombinant NFAT regulator only can peak' or maximal calcium levels resulting from protein, biologically active portion or derivative thereof. In store-operated calcium entry be assessed in the presence and general, recombinant expression that results in increased absence of test agent, a number of other parameters of the 55 expression of the NFAT regulator compared to a correspond calcium entry process may also be evaluated, as described ing cell that does not express recombinant NFAT regulator, is herein. For example, the kinetics of store-operated calcium referred to as “overexpression of the NFAT regulator. Alter entry can be assessed by evaluation of the time required to natively, the cell can be of mammalian origin. The cell can reach peak intracellular calcium levels, the up slope and rate also be a cell that expresses the NFAT regulator of interest constant associated with the increase in calcium levels, and 60 (e.g. a calcium channel) but in which such NFAT regulator the decay slope and rate constant associated with the decrease activity can be distinguished from other NFAT regulator (e.g. in calcium levels as store-operated calcium entry discontin calcium channel) activity, for example, by comparison with ues. Any of these parameters can be evaluated and compared controls. The ability of the test compound to modulate NFAT in the presence and absence of testagent to determine whether regulator binding to a compound, e.g., an NFAT regulator the agent has an effect on store-operated calcium entry, and 65 substrate, or to bind to NFAT regulator can also be evaluated. thus on intracellular calcium. In other embodiments, store This can be accomplished, for example, by coupling the com operated calcium entry can be evaluated by, for example, pound, e.g., the Substrate, with a radioisotope or enzymatic US 9,163,078 B2 27 28 label Such that binding of the compound, e.g., the Substrate, to thereof is contacted with a test compound and the ability of NFAT regulator can be determined by detecting the labeled the test compound to bind to the NFAT regulator protein or compound, e.g., Substrate, in a complex. Alternatively, NFAT biologically active portion thereof is evaluated. Preferred bio regulator could be coupled with a radioisotope or enzymatic logically active portions of the NFAT regulator proteins to be label to monitor the ability of a test compound to modulate used in assays of the present invention include fragments or NFAT regulator binding to an NFAT regulator substrate in a derivatives that participate in interactions with other signal complex. For example, compounds (e.g., NFAT regulator ing molecules, or fragments or derivatives that interact substrates) can be labeled with 'I, S, ''C, or H, either directly with NFAT. directly or indirectly, and the radioisotope detected by direct Cell-free assays involve preparing a reaction mixture of the counting of radioemission or by Scintillation counting. Alter 10 target gene protein and the test compound under conditions natively, compounds can be enzymatically labeled with, for and for a time sufficient to allow the two components to example, horseradish peroxidase, alkaline phosphatase, or interact and bind, thus forming a complex that can be luciferase, and the enzymatic label detected by determination removed and/or detected. of conversion of an appropriate Substrate to product. The interaction between two molecules can also be An example of a screening assay for a compound that 15 detected, e.g., using fluorescence resonance energy transfer specifically modulates activity of an NFAT regulator (FRET) (see, for example, Lakowicz et al., U.S. Pat. No. polypeptide is as follows. Incubate a cell that expresses the 5,631,169; Stavrianopoulos et al., U.S. Pat. No. 4,868,103). A NFAT regulator polypeptide of interest (e.g., a Jurkat cell or fluorophore label is selected such that a first donor label's an 14E1 (293 cell) with a test compound for a time sufficient emission spectrum overlaps with the absorption spectrum of for the compound to have an effect on transcription or activity a second, acceptor molecule, which then fluoresces on exci (e.g., for at least 1 minute, 10 minutes, 1 hour, 3 hours, 5 tation of the donor, if the labels are in close proximity, due to hours, or 24 or more hours. Such times can be determined transfer of energy. Alternately, the donor protein molecule experimentally. The concentration of the test compound can may simply utilize the natural fluorescent energy of tryp also be varied (e.g., from 1 nM-100 uM, 10 nM to 10 uMor, tophan residues. Labels are chosen that emit different wave 1 nM to 10 uM). Inhibition of calcium influx in the presence 25 lengths of light, such that the acceptor molecule label may and absence of the test compound is then assayed using meth be differentiated from that of the donor. Since the efficiency ods known in the art. For example, fura-2, Indo-1, Fluo-3, or of energy transfer between the labels is related to the distance Rho-2 can be used to assay calcium flux. Other methods can separating the molecules, the spatial relationship between the be used as assays of inhibition. For example, a test compound molecules can be assessed. In a situation in which binding is considered to have, or Suspected of, having a significant 30 occurs between the molecules, the fluorescent emission of the impact on influx if any one or more of the following criteria acceptor molecule label in the assay is increased over the are met: emission when binding does not occur, or when, e.g., binding a. there is direct inhibition of increased Cati as mea is prevented by the excess of unlabelled competitor protein. A Sured by a calcium indicator. FRET binding event can be conveniently measured, in com b. there is a direct inhibition of I, as measured by patch 35 parison to controls, through standard fluorometric detection clamp: means well known in the art (e.g., using a fluorimeter). c. there is inhibition of downstream signaling functions Assays which monitor assembly of the protein complex in such as calcineurin activity, NFAT subcellular localiza cells or in cell free assays may also be used. tion, NFAT phosphorylation, and/or cytokine, e.g., IL-2, In another embodiment, determining the ability of the production; or 40 NFAT regulator protein to bind to a target molecule can be d. there are modifications in activation-induced cell prolif accomplished using real-time Biomolecular Interaction eration, differentiation and/or apoptotic signaling path Analysis (BIA) (see, e.g., Solander and Urbaniczky, 1991, ways. Anal. Chem. 63:2338-2345 and Szabo et al., 1995. Curr. Direct testing of the effect of a test compound on an activity Opin. Struct. Biol. 5:699-705). "Surface plasmon resonance” of a specific NFAT regulator polypeptide can be accom 45 or “BIA detects biospecific interactions in real time, without plished using, e.g., patch clamping to measure I. This labeling any of the interactants (e.g., BIAcore). Changes in method can be used in screening assays as a second step after the mass at the binding Surface (indicative of a binding event) testing for general effects on calcium influx or as a second result in alterations of the refractive index of light near the step after identifying a test compound as affecting expression Surface (the optical phenomenon of Surface plasmon reso of an NFAT regulator mRNA or polypeptide. Alternatively, 50 nance (SPR)), resulting in a detectable signal that can be used direct testing can be used as a first step in a multiple step assay as an indication of real-time reactions between biological or in single step assays. molecules. The ability of a compound (e.g., an NFAT regulator sub In one embodiment, the target gene product, e.g., NFAT strate) to interact with the NFAT regulator with or without the regulator polypeptide or the test Substance, is anchored onto labeling of any of the interactants can be evaluated. For 55 a solid phase. The target gene product/test compound com example, a microphysiometer can be used to detect the inter plexes anchored on the solid phase can be detected at the end action of a compound with NFAT regulator without the label of the reaction. In general, the target gene product can be ing of either the compound or the NFAT regulator (McCon anchored onto a solid Surface, and the test compound, (which nell et al., 1992, Science 257:1906-1912). As used herein, a is not anchored), can be labeled, either directly or indirectly, “microphysiometer” (e.g., Cytosensor) is an analytical 60 with detectable labels discussed herein. instrument that measures the rate at which a cell acidifies its It may be desirable to immobilize an NFAT regulator, an environment using a light-addressable potentiometric sensor anti-NFAT regulator antibody or its target molecule to facili (LAPS). Changes in this acidification rate can be used as an tate separation of complexed from non-complexed forms of indicator of the interaction between a compound and NFAT one or both of the proteins, as well as to accommodate auto regulator polypeptide. 65 mation of the assay. Binding of a test compound to an NFAT In yet another embodiment, a cell-free assay is provided in regulator protein, or interaction of an NFAT regulator protein which a NFAT regulator protein or biologically active portion with a target molecule in the presence and absence of a US 9,163,078 B2 29 30 candidate compound, can be accomplished in any vessel Suit Protocols in Molecular Biology 1999, J. Wiley: New York). able for containing the reactants. Examples of Such vessels Such resins and chromatographic techniques are known to include microtiter plates, test tubes, and micro-centrifuge one skilled in the art (see, e.g., Heegaard, 1998, J. Mol. tubes. In one embodiment, a fusion protein can be provided Recognit. 11:141-8; Hage and Tweed, 1997, J. Chromatogr. which adds a domain that allows one or both of the proteins to B. Biomed. Sci. Appl. 699:499-525). Further, fluorescence be bound to a matrix. For example, glutathione-S-transferase? resonance energy transfer may also be conveniently utilized, NFAT regulator fusion proteins or glutathione-S-transferase/ as described herein, to detect binding without further purifi target fusion proteins can be adsorbed onto glutathione cation of the complex from Solution. SepharoseTM beads (Sigma Chemical, St. Louis, Mo.) or glu The assay can include contacting the NFAT regulator pro tathione-derivatized microtiter plates, which are then com 10 tein or biologically active portion thereof with a known com bined with the test compound or the test compound and either pound that binds NFAT regulator to form an assay mixture, the non-adsorbed target protein or NFAT regulator protein, contacting the assay mixture with a test compound, and deter and the mixture incubated under conditions conducive for mining the ability of the test compound to interact with an complex formation (e.g., at physiological conditions for salt NFAT regulator polypeptide, wherein determining the ability and pH). Following incubation, the beads or microtiter plate 15 of the test compound to interact with an NFAT regulator wells are washed to remove any unbound components, the protein includes determining the ability of the test compound matrix immobilized in the case of beads, complex determined to preferentially bind to NFAT regulator or biologically active either directly or indirectly, for example, as described above. portion thereof, or to modulate the activity of a target mol Alternatively, the complexes can be dissociated from the ecule, as compared to the known compound. matrix, and the level of NFAT regulator binding or activity To the extent that NFAT regulator can, in vivo, interact with determined using standard techniques. one or more cellular or extracellular macromolecules, such as Other techniques for immobilizing either NFAT regulator proteins, inhibitors of such an interaction are useful. Such protein or a target molecule on matrices include using conju interacting molecules include Ca" and subunits of the cal gation of biotin and streptavidin. Biotinylated NFAT regula cium channel complex as well as signaling molecules that tor protein or target molecules can be prepared from biotin 25 directly interact with the channel. Such as kinases, phos NHS(N-hydroxy-succinimide) using techniques known in phatases and adapter proteins, can be used to identify inhibi the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, tors. For example, a preformed complex of the target gene Ill.), and immobilized in the wells of streptavidin-coated 96 product and the interactive cellular or extracellular binding well plates (Pierce Chemicals). partner product is prepared Such that either the target gene To conduct the assay, the non-immobilized component is 30 products or their binding partners are labeled, but the signal added to the coated Surface containing the anchored compo generated by the label is quenched due to complex formation nent. After the reaction is complete, unreacted components (see, e.g., U.S. Pat. No. 4,109,496 that utilizes this approach are removed (e.g., by washing) under conditions such that any for immunoassays). The addition of a test Substance that complexes formed will remain immobilized on the solid sur competes with and displaces one of the species from the face. The detection of complexes anchored on the solid sur 35 preformed complex will result in the generation of a signal face can be accomplished in a number of ways. Where the above background. In this way, test Substances that disrupt previously non-immobilized component is pre-labeled, the target gene product-binding partner interaction can be iden detection of label immobilized on the surface indicates that tified. Alternatively, an NFAT regulator polypeptide can be complexes were formed. Where the previously non-immobi used as a “bait protein’ in a two-hybrid assay or three-hybrid lized component is not pre-labeled, an indirect label can be 40 assay (see, e.g., U.S. Pat. No. 5.283.317; Zervos et al., 1993, used to detect complexes anchored on the Surface; e.g., using Cell 72:223-232; Madura et al., 1993, J. Biol. Chem. 268: a labeled antibody specific for the immobilized component 12046-12054: Bartel et al., 1993, Biotechniques 14:920-924; (the antibody, in turn, can be directly labeled or indirectly Iwabuchi et al., 1993, Oncogene 8:1693-1696; and Brent labeled with, e.g., a labeled anti-Ig antibody). WO94/10300), to identify other proteins, that bind to or inter This assay is performed utilizing antibodies reactive with 45 act with NFAT regulator (“NFAT regulator-binding proteins' NFAT regulator protein or target molecules but which do not or “NFAT regulator-bp’) and are involved in NFAT regulator interfere with binding of the NFAT regulator protein to its activity. Such NFAT regulator-bps can be activators or inhibi target molecule. Such antibodies can be derivatized to the tors of signals by the NFAT regulator proteins or NFAT regu wells of the plate, and unbound target or NFAT regulator lator targets as, for example, downstream elements of an protein trapped in the wells by antibody conjugation. Meth 50 NFAT regulator-mediated signaling pathway, e.g., NFAT tar ods for detecting such complexes, in addition to those get gene expression or activity. described above for the GST-immobilized complexes, Modulators of NFAT regulator expression can also be iden include immunodetection of complexes using antibodies tified. For example, a cell or cell free mixture is contacted reactive with NFAT regulator protein or target molecule, as with a candidate compound and the expression of an NFAT well as enzyme-linked assays which rely on detecting an 55 regulator mRNA or protein evaluated relative to the level of enzymatic activity associated with the NFAT regulator pro expression of an NFAT regulator mRNA or protein in the tein or target molecule. absence of the candidate compound. Methods to detect Alternatively, cell free assays can be conducted in a liquid expression or evaluate expression level are well known to the phase. In Such an assay, the reaction products are separated skilled artisan. When expression of an NFAT regulator from unreacted components, by any of a number of standard 60 mRNA or protein is greater in the presence of the candidate techniques, including, but not limited to: filtration; differen compound than in its absence, the candidate compound is tial centrifugation (see, for example, Rivas and Minton, 1993, identified as a stimulator of NFAT regulator mRNA or protein Trends Biochem. Sci. 18:284-7); chromatography (gel filtra expression. Alternatively, when expression of NFAT regula tion chromatography, ion-exchange chromatography); elec tor mRNA or protein is less (i.e., statistically significantly trophoresis (see, e.g., Ausubel et al., eds. Current Protocols in 65 less) in the presence of the candidate compound than in its Molecular Biology 1999, J. Wiley: New York.); and immu absence, the candidate compound is identified as an inhibitor noprecipitation (see, for example, Ausubel et al., eds. Current of NFAT regulator mRNA or protein expression. The level of US 9,163,078 B2 31 32 NFAT regulator mRNA or protein expression can be deter The proteins (and/or nucleic acids encoding proteins) or mined by methods described herein for detecting an NFAT cells (or portions thereof) of the system can be contained in a regulator mRNA or protein. medium that contains an agent that provides for passive or A modulating agent can be identified using a cell-based or active intracellular calcium store reduction or depletion (e.g., a cell-free assay, and the ability of the agent to modulate the thapsigargin and other agents described herein or known in activity of a NFAT regulator protein can be confirmed in vivo, the art) and/or that contains a molecule or molecules that e.g., in an animal Such as an animal model for a disease (e.g., facilitate monitoring or measurement of intracellular calcium an animal with leukemia or autoimmune disease oran animal and/or calcium movement. Such molecules include fluores harboring a Xenograft from an animal (e.g., human) or cells cent (or otherwise labeled) calcium indicators, trivalent cat from a cancer resulting from a leukemia or other lymphocytic 10 ions, divalent cations other than calcium and calcium-buffer disorder, or cells from a leukemia or other lymphocytic dis ing agents, e.g., calcium chelators. order cell line. Recombinant Cells This invention further pertains to novel agents identified by Aspects of the invention further relate to recombinant cells the above-described screening assays. Accordingly, it is used in the assays described in the methods discussed herein. within the scope of this invention to further use an agent 15 In one aspect, the invention also encompasses any recombi identified as described herein (e.g., a NFAT regulator-modu nant cells described herein. In one embodiment, the recom lating agent, an antisense NFAT regulator nucleic acid mol binant cell comprises at least one exogenous (heterologous or ecule, a NFAT regulator-specific antibody, or a NFAT regu homologous) NFAT regulator protein or fragment or deriva lator-binding partner) in an appropriate animal model (Such tive thereof. The recombinant cell may also further comprise as those described above) to determine the efficacy, toxicity, at least one exogenous (heterologous or homologous) nucleic side effects, or mechanism of action, of treatment with Such acid encoding a NFAT regulator protein or fragment or an agent. Furthermore, novel agents identified by the above derivative thereof. The NFAT regulator protein may be of described screening assays can be used for treatments as mammalian origin. The recombinant cell may over express described herein. the NFAT regulator protein or fragment or derivative thereof. Animal models that are useful include animal models of 25 This overexpression may result from expression of an exog leukemia and autoimmune disorders. Examples of Such ani enous (heterologous or homologous) NFAT regulator protein mal models are known in the art and can be obtained from (e.g. from an exogenous nucleic acid) or may result from over commercial sources, e.g., the Jackson Laboratory (Bar Har expression of native/endogenous NFAT regulator protein. bor, Me.) or generated as described in the relevant literature. Transgenic Animals Examples of animals useful for Such studies include mice, 30 The invention provides non-human transgenic animals that rats, dogs, cats, sheep, rabbits, and goats. Other useful animal are engineered to overexpress an NFAT regulator, ectopically models include, without limitation, those for other disorders express an NFAT regulator, express reduced levels of an of Ca"-NFAT signaling or of Ca" signaling, e.g., for myo NFAT regulator, express a mutant NFAT regulator, or be cardial hypertrophy, dilated cardiomyopathy, excessive or knocked out for expression of an NFAT regulator. Such ani pathological bone resorption, excessive adipocyte differen 35 mals and cell lines derived from such animals are useful for tiation, obesity, and reactivation of latent human herpesvi studying the function and/or activity of an NFAT regulator rus-8 or other viruses, as discussed elsewhere in this docu protein and for identifying and/or evaluating modulators of ment. NFAT regulator activity. An animal that overexpresses an Systems NFAT regulator polypeptide is useful, e.g., for testing the Also provided herein are systems for use in identifying an 40 effects of candidate compounds for modulating the activity of agent that modulates one or more of the following: a NFAT the NFAT regulator polypeptide and assessing the effect of protein, a NFAT regulator protein, and intracellular or cyto the compound in vivo. plasmic calcium. Such a system includes a cell, or portion(s) As used herein, a “transgenic animal' is a non-human thereof, containing one or more proteins, e.g., NFAT regula animal, in general, a mammal, for example, a rodent such as tor proteins of the present invention, or fragments or deriva 45 a rat or mouse, in which one or more of the cells of the animal tive thereof, e.g., ORAI proteins or fragments or derivatives include a transgene. Other examples of transgenic animals thereof. In one embodiment, the proteins are exogenous (het include non-human primates, sheep, dogs, cows, goats, erologous or homologous) to the cell. In one embodiment, the chickens, amphibians, and the like. A transgene is exogenous cell contains an exogenous (e.g. heterologous or homolo DNA or a rearrangement, e.g., a deletion of endogenous chro gous) nucleic acid encoding a NFAT regulator protein or 50 mosomal DNA, which is in most cases integrated into or fragment or derivative thereof. In one embodiment, the sys occurs in the genome of the cells of a transgenic animal. A tem further contains a monitoring agent used to monitor, transgene can direct the expression of an encoded gene prod detect or measure electrical current across the plasma mem uct in one or more cell types or tissues of the transgenic brane of the cell. Many such monitoring agents are known in animal; other transgenes, e.g., a knockout, reduce expression. the art. The term “monitoring agent' is also meant to include 55 Thus, a transgenic animal can be one in which an endogenous any apparatus used for Such monitoring. NFAT regulator gene has been altered by, e.g., by homolo In particular embodiments of the systems, the protein(s) gous recombination between the endogenous gene and an involved in modulating intracellular calcium are contained in exogenous DNA molecule introduced into a cell of the ani cells. The cells can be isolated cells or cell cultures that mal, e.g., an embryonic cell of the animal, prior to develop endogenously express Such protein(s) or recombinantly 60 ment of the animal. express such proteins as described above with respect to the Intronic sequences and polyadenylation signals can also be methods for identifying agents, e.g. a recombinant cell over included in the transgene to increase the efficiency of expres expressing at least one NFAT regulator protein or fragment or sion of the transgene. A tissue-specific regulatory sequence(s) derivative thereof. Systems in which the cells recombinantly can be operably linked to a transgene of the invention to direct express the proteins can be such that the cells are isolated cells 65 expression of an NFAT regulator protein to particular cells. A or cell cultures or are contained within an animal, in particu transgenic founder animal can be identified based upon the lar, a non-human animal, e.g., a non-human mammal. presence of an NFAT regulator transgene in its genome and/or US 9,163,078 B2 33 34 expression of NFAT regulator mRNA in tissues or cells of the capsules, cachets or tablets each containing a predetermined animals. A transgenic founder animal can then be used to amount of the active ingredient; as a powder or granules; as a breed additional animals carrying the transgene. Moreover, Solution or a Suspension in an aqueous liquid or a non-aque transgenic animals carrying a transgene encoding an NFAT ous liquid; or as an oil-in-water liquid emulsion or a water regulator protein can further be bred to other transgenic ani in-oil liquid emulsion, or packed in liposomes and as a bolus, mals carrying other transgenes. etc. NFAT regulator proteins or polypeptides can be expressed A tablet may be made by compression or molding, option in transgenic animals or plants, e.g., a nucleic acid encoding ally with one or more accessory ingredients. Compressed the protein or polypeptide can be introduced into the genome tablets may be prepared by compressing in a suitable machine of an animal. In preferred embodiments the nucleic acid is 10 the active ingredient in a free-flowing form Such as a powder placed under the control of a tissue specific promoter, e.g., a or granules, optionally mixed with a binder, lubricant, inert milk or egg specific promoter, and recovered from the milk or diluent, preservative, Surface-active or dispersing agent. eggs produced by the animal. Suitable animals are mice, pigs, Molded tablets may be made by molding in a suitable cows, goats, and sheep. machine a mixture of the powdered compound moistened In one non-limiting example, a mouse is engineered to 15 with an inert liquid diluent. The tablets optionally may be express an NFAT regulator polypeptideusing a T cell-specific coated or scored and may be formulated so as to provide slow promoter Such as an LCK promoter using methods known in or controlled release of the active ingredient therein. the art (e.g., Zhang et al., 2002, Nat. Immunol. 3:749-755). In Compositions suitable for topical administration include an alternative example, a mouse is engineered with a tissue lozenges comprising the ingredients in a flavored basis, usu specific knockdown of an NFAT regulator mRNA and pro ally Sucrose and acacia or tragacanth; and pastilles compris tein, e.g., by Cre-lox mediated recombination, where expres ing the active ingredient in an inert basis Such as gelatin and sion of the recombinase is under control of a tissue-specific glycerin, or Sucrose and acacia. promoter. Engineered animals can be identified using known Compositions suitable for parenteral administration methods of identifying the presence of a transgene in cells and include aqueous and nonaqueous sterile injection solutions by assaying a cell sample (e.g., T cells) for the overexpression 25 which may contain anti-oxidants, buffers, bacteriostats and or underexpression of the NFAT regulator (for example, using solutes which render the formulation isotonic with the blood immunocytochemistry) or by assaying calcium flux in a cell of the intended recipient; and aqueous and non-aqueous ster from the sample. Such transgenic animals are useful, e.g., for ille Suspensions which may include Suspending agents and testing compounds for their ability to inhibit NFAT regulator thickening agents. The formulations may be presented in mediated cell proliferation. 30 unit-dose or multi-dose containers, for example, sealed The invention also includes a population of cells from a ampules and vials, and may be stored in a freeze dried (lyo transgenic animal. Methods of developing primary, second philized) condition requiring only the addition of the sterile ary, and immortal cell lines from Such animals are known in liquid carrier, for example water for injections, immediately the art. prior to use. Extemporaneous injection solutions and Suspen Pharmaceutical Compositions 35 sions may be prepared from Sterile powders, granules and For therapeutic applications, peptides and nucleic acids of tablets. the invention, the antibodies to the NFAT regulators or the Application of the subject therapeutics often will be local, agents identified by the screening methods of the present so as to be administered at the site of interest. Various tech invention, e.g., Small molecules, siRNAS, shRNAS, may be niques can be used for providing the Subject compositions at Suitably administered to a subject Such as a mammal, particu 40 the site of interest, such as injection, use of catheters, trocars, larly a human, alone or as part of a pharmaceutical composi projectiles, pluronic gel, stents, Sustained drug release poly tion, comprising the peptide, nucleic acid, antibody or agent mers or other device which provides for internal access. together with one or more acceptable carriers thereof and Where an organ or tissue is accessible because of removal optionally other therapeutic ingredients. The carrier(s) must from the patient, Such organ or tissue may be bathed in a be “acceptable' in the sense of being compatible with the 45 medium containing the Subject compositions, the Subject other ingredients of the formulation and not deleterious to the compositions may be painted onto the organ, or may be recipient thereof. applied in any convenient way. Systemic administration of a The pharmaceutical compositions of the invention include nucleic acid using lipofection, liposomes with tissue targeting those Suitable for oral, rectal, nasal, topical, e.g., including (e.g. antibody) may also be employed. buccal and Sublingual, mucosal or parenteral, e.g., including 50 It will be appreciated that actual preferred amounts of a Subcutaneous, intramuscular, intravenous and intradermal given peptide or nucleic acid of the invention, or of an anti administration. The formulations may conveniently be pre body or agent identified by the screening methods of the sented in unit dosage form, e.g., tablets and Sustained release present invention, used in a given therapy will vary to the capsules, and in liposomes, and may be prepared by any particular active peptide or nucleic acid or agent being uti methods well know in the art of pharmacy. See, for example, 55 lized, the particular compositions formulated, the mode of Remington’s Pharmaceutical Sciences, Mack Publishing application, the particular site of administration, the patients Company, Philadelphia, Pa. (17th ed. 1985). weight, general health, sex, etc., the particular indication Such preparative methods include the step of bringing into being treated, etc. and other Such factors that are recognized association with the molecule to be administered ingredients by those skilled in the art including the attendant physician or Such as the carrier which constitutes one or more accessory 60 Veterinarian. Optimal administration rates for a given proto ingredients. In general, the compositions are prepared by col of administration can be readily determined by those uniformly and intimately bringing into association the active skilled in the art using conventional dosage determination ingredients with liquid carriers, liposomes or finely divided testS. Solid carriers or both, and then if necessary shaping the prod Various embodiments of the invention are further illus uct. 65 trated in the following examples. All references made to other Compositions of the present invention suitable for oral publications or disclosures throughout this document are administration may be presented as discrete units such as incorporated by reference herein. US 9,163,078 B2 35 36 EXAMPLE1 CACGTCCAGCACCTC (SEQ ID NO. 23) (exon 1); Ora1eX2fOr1 5 TCTTGCTTTCTGTAGGGCTTTCTG Identification of Ca" Release Activated Ca" (SEQ ID NO: 24) (exon 2); Orailex2rev1 5' TCTCAAAG (CRAC) Channel Gene, ORAI1, in SCID Patients GAGCTGGAAGTGC (SEQID NO:25) (exon 2). DNA was amplified using AmpliTaq Gold polymerase and separated on Materials and Methods: 1% agarose gels. PCR products were gel-purified and Case Reports sequenced directly using the following primers: Detailed case reports of the two SCID patients investigated Orailex 1 for25' AGCATGCAAAACAGCCCAGG (SEQ ID in this study have been described (Feske 1996, 2000). NO: 26) (exon 1); Orailex 1 rev2 5' ACGGTTTCTC Cell Lines and Reagents 10 T cell lines were established from peripheral blood lym CCAGCTCTTC (SEQID NO: 27) (exon 1); Orai1 ex2for2 5' phocytes of two patients and 21 family members and grown as TGACAGGAGGAGAGCTAGG (SEQID NO: 28) (exon 2): described. Foreskin fibroblasts from the newborn SCID Orai1 ex2rev25' AAGAGATCCTCCTGCCTTGG (SEQ ID patient 2 and a healthy newborn (Hs27 cell line, ATCC, NO: 29). Sequencing was done at the DF/HCC DNA Manassas, Va.) were immortalized by retroviral transduction 15 Resource Core (DFCI) and DNA sequences analyzed using with a telomerase expression plasmid (hTERT, generous gift Xplorer Lite (dnaTools, Ft. Collins, Colo.). of S. Lessnick, DFCI, Boston, Mass.). The macrophage Sequenom Analysis of HapMap DNA hemocyte-like Drosophila cell line S2R was grown in To exclude the possibility that the CDT point mutation at Schneider's medium with 10% fetal calf serum (Invitrogen) position 271 in the coding sequence of Orail (NM 032790) according to standard protocols. Thapsigargin was purchased is a SNP, we examined DNA from a panel of 270 individuals from LC Biochemicals (Woburn, Mass.), Charybdotoxin of diverse geographical origin assembled for the International (CTX) and 2-aminoethoxydiphenylborate (2-APB) from HapMap project''. Genotyping was performed using a Sigma (St. Louis, Mo.). high-throughput primer extension method with detection by Single Nucleotide Polymorphism (SNP) Array Based Link mass spectrometry (MALDI-TOF) on the Sequenom plat age Analysis 25 form as previously described. A detailed description of this Genomic DNA of SCID patients and 21 relatives was pre method can be found at http://www.hapmap.org/downloads/ pared from peripheral blood mononuclear cells using genotyping protocols.html under “Sequenom platform'. genomic DNA Maxi prep kits (Qiagen). Genotyping was 89% of samples were genotyped successfully and all were performed at the SNP Genotyping Center (Broad Institute, identified as CC homozygotes. Cambridge, Mass.) and the Harvard Partners Center for 30 dsRNA Mediated Knockdown in Drosophila Cells Genetics and Genomics (Boston, Mass.), using “GeneChip’ PCR fragments (size up to 600 bp) were used as templates Human Mapping 10K Arrays (Xba 142 2.0, Affymetrix, for invitrotranscription reactions, followed by DNase I treat Santa Clara, Calif.) with an average SNP heterozygosity of ment to remove the template DNA. After purification, dsRNA 0.38 and a mean intermarker density of 258 kb. This platform (5 g) was co-transfected together with the NFATGFP allowed for simultaneous genotyping of more than 10,000 35 expression plasmid into S2R-- cells in 8-chamber slides (10 SNPs in the human genome. For parametric linkage analysis, ug for 12 well plate). After 72 hrs of incubation, cells were data were converted into "Linkage' format using "Compare treated with the Ca" influx inducers, 1 uM ionomycin or 1 Linkage'. Mendelian genotype errors inconsistent with the uMthapsigargin for localization assays and were trypsinized parental genotypes were detected and set to missing geno for the measurement of Cal, levels. types. Multipoint parametric linkage analysis was performed 40 Genome-Wide RNAi Screen to compute LOD scores at each SNP position using Allegro'. The RNAi screen was performed essentially as described To confirm linkage, we reanalyzed the SNP data using Gene (Armknecht S. et al., 2005, Methods Enzymol 392, 55-73: hunter 2.1 r6 and Merlin obtaining very similar results. Btros M. et al. 2004 Science 303,832-835). The macrophage For parametric analysis, a disease allele frequency of 0.001, a hemocyte-like Drosophila cell line S2R+ was stably trans penetrance value of 0.99 and a phenocopy of 0.01 were used 45 fected with the coding sequence for the NFAT1 (1-460)-GFP for all the pedigrees. Parametric linkage analyses were car fusion protein subcloned into the expression plasmid pAc5.1 ried out using recessive and dominant models of inheritance, (Invitrogen). Transfection was achieved using Effectene respectively. For the “recessive' model, haplotypes from both (Qiagen) with a 19:1 ratio of the expression plasmid to pCo patients, their parents, unaffected brother and grandparents Hygro (Invitrogen), which encodes a hygromycin resistance (individuals 8, 11,35,36, 37,38,39, 63, 64 in FIG. 1A) were 50 gene under the control of a constitutively active promoter. The analyzed assuming an autosomal recessive mode of inherit cells were selected for 3-4 weeks with 300 ug/ml hygromy ance for the SCID disease with both SCID patients being cin, and stable clones were selected by visual inspection. 10' homozygous for a common disease-causing mutation. The S2R" cells stably expressing NFAT1(1-460)-GFP were added predicted maximum logo of the odds ratio (LOD) score from onto each well of a 384 well plate containing 0.25 ug of this analysis was ~1.9 (i.e. -logo 0.25x0.25x0.25x0.75). 55 dsRNAs (in 10 ul of serum-free medium) against Drosophila For the “dominant model, 12 family members with reduced mRNAs and incubated for 1 h at 26° C. and incubated for store-operated Ca" entry were defined as “affected”, i.e. 48-72 hrs at 26°C. to achieve RNAi S2R" cells were stimu carriers of a dominantly acting mutation, and their SNP hap lated with 1 uM thapsigargin in Schneider medium contain lotypes compared to those of 8 healthy family members with ing 5 mM CaCl at room temperature for 10 min, fixed and normal store-operated Ca" entry. The predicted maximum 60 stained with DAPI. Coincident GFP and DAPI images were LOD score from this analysis was ~3.8 (i.e. -logo 0.5'). acquired by an automated camera from three different loca Genomic DNA Sequencing tions in each well, and scored by visual inspection. A total of Genomic DNA of two patients, 21 family members and fifty-eight 384-plates were analysed, containing a total of three independent controls was sequenced for mutations in 21,884 wells into which individual dsRNAs had been exons 1 and 2 of Orail using the following oligonucleotide 65 arrayed. For this study, we note that the dsRNA amplicons for primers: Orailex 1 for1 5' ACAACAACGCCCACTTCTTG both dStim and dOrai had no predicted off-targets with exact GTGG (SEQ ID NO: 22) (exon 1); Orailex1 rev1 5' TGCT matches of 19 nucleotides or greater. US 9,163,078 B2 37 38 Plasmids and Retroviral Transduction Fluo4-AM and Fura-Red (2 uM each, Molecular Probes, Full-length cDNA for Orail (BC015369) was purchased Eugene, Oreg.) for 45 min at room temperature and then from OpenBiosystems (Huntsville, Ala.) and subcloned into resuspended in loading medium (Schneider's medium+10% pENTR11 (“Gateway” system, Invitrogen, Carlsbad, Calif.) FCS). Immediately before the flow cytometric Ca" measure in frame with an N- or C-terminal terminal sequence encod ments, cells were resuspended in Ringer solution containing ing the myc epitope. Orail was then moved to the bicistronic 2 mM Ca" and analyzedonia FACSCalibur (BDBiosciences, retroviral expression vectorpMSCV-CITE-eGFP-PGK-Puro San Jose, Calif.). After 30 sec, thapsigargin (3 uM) in Ca" (kind gift of Masatsugu Oh-hora), which allows for simulta free Ringer to deplete intracellular Ca" stores, 4 mM Ca" neous expression of Orail, GFP and a puromycin resistance Ringer solution was added and cellular Ca" levels were gene. gp293 packaging cell lines were co-transfected with 10 plasmids encoding Orail, gag-poland env to produce ampho monitored for 300 sec. The ratio of Fluo-4 and Fura-Red tropic, replication-incompetent retrovirus. Virus containing emission was analyzed using Flo.Jo Software (Tree Star, Inc., supernatant was collected for 24h, filtered (0.45 microm, low Ashland, Oreg.). protein binding) and concentrated by centrifugation at Solutions and Chemicals 6000xg for 16 h. T cells and fibroblasts were transduced by 15 The standard extracellular Ringer's solution contained (in addition of viral supernatant for 4d and 1 d, respectively. mM): 155 NaCl, 4.5 KC1, 20 CaCl, 1 MgCl, 10 D-glucose, Transduction efficiency was evaluated by GFP expression using flow cytometry and myc-Orail expression using immu and 5 Na-Hepes (pH 7.4). The standard divalent-free (DVF) noblotting and immunocytochemistry. In some cases, trans Ringer's solutions contained (in mM): 155 Na, 10 HEDTA, 1 duced T cells were further selected with 1 lug/ml puromycin EDTA and 10 Hepes (pH 7.4). Charybdotoxin (CTX) was for 3 days. included in all external solution to block Kv1.3 channels to Bioinformatic Prediction of Membrane Topoplogy prevent contamination of I recordings in DVF solutions. The hydropathy plot of Orail was generated using the The standard internal solution contained (in mM): 150 Cs Kyte-Doolittle algorithm’. Membrane topology was further aspartate, 8 MgCl, 8 BAPTA, and 10 Cs-Hepes (pH 7.2). evaluated using the Phobius algorithm based on the hidden 25 Thapsigargin (LC Biochemicals, Woburn, Mass.) was Markov model. Sequence alignment was performed using diluted from a 1 mM stock in DMSO, CTX (Sigma, St. Louis, MegAlign (DNAStar, Madison, Wis.). Mo.) was diluted 1:1000 from 50 LM stock solution in water. Confocal Imaging 2-aminoethyoxydiphenylborate (2-APB, Sigma) was diluted Immunocytochemistry for Orail was done as described'. from stock solutions in DMSO. The drugs were diluted to the Briefly, retrovirally transduced T cells and fibroblasts were 30 concentrations indicated in the legends and applied to the fixed with 3% paraformaldehyde, left unpermebealized or cells using a multi-barrel local perfusion pipette with a com permeabilized with wash buffer containing 0.5% NP-40, mon delivery port. The time for 90% solution exchange was incubated with anti-myc antibodies (9E10) and Cy3-labeled measured to be <1 s, based on the rate at which the K current secondary antibodies. Immunofluorescence was analyzed by reversal potential changed when the external K" was confocal imaging usinga Radiance 2000 Laser-scanning con 35 focal system (Bio-Rad Laboratories) on a BX50BWI Olym Switched from 2 mM to 150 mM. pus microscope using a 63x water immersion objective. Patch-Clamp Measurements Single-Cell Ca" Imaging Patch-clamp experiments were conducted in the standard T cells were loaded at 1x10° cells/ml with 1 uM fura-2/AM whole-cell recording configuration at 22-25° C. using an (Molecular Probes) in loading medium (RPMI-10% FBS) 40 Axopatch 200 amplifier (Axon Instruments, Foster City, for 30 min at 22-25°C., resuspended in loading medium and Calif.) interfaced to an ITC-16 input/output board (In attached to poly-L-lysine-coated coverslips for 15 min. strutech, Port Washington, N.Y.) and a Macintosh G3 com Fibroblasts were grown directly on UV-sterilized coverslips puter. Recording electrodes were pulled from 100-ml and loaded with 3 uM fura-2/AM for 45 min at 22-25° C. For pipettes, coated with Sylgard, and fire-polished to a final Ca", measurements, cells were mounted in a RC-20 closed 45 resistance of 2-5 MS2. Stimulation and data acquisition and bath flow chamber (Warner Instrument Corp., Hamden, analysis were performed using in-house routines developed Conn.) and analyzed on an Axiovert S200 epifluorescence on the Igor Pro platform (Wavemetrics, Lake Oswego, Oreg.). microscope (Zeiss) with OpenLab imaging software (Impro The holding potential was +30 mV unless otherwise indi vision). Cells were perfused in Ca"-free Ringer solution and cated. Voltage stimuli usually consisted of a 100-ms step to Ca" stores were passively depleted with 1 uM thapsigargin. 50 -100 mV followed by a 100-ms ramp from -100 to +100 mV. Active depletion of stores was induced by incubation with 10 applied every 1.3 s. Currents were filtered at 2 kHz with a ug/ml anti-CD3 antibody (OKT3, eBioscience, San Diego, 4-pole Bessel filter and sampled at 5 kHz. Data are corrected Calif.) for 10 min at 22-25°C. Fura-2 emission was detected for the liquidjunction potential of the pipette solution relative at 510 nm with excitation at 340 and 380 nm and Fura-2 to Ringers in the bath (-10 mV) and for the bath DVF emission ratios (340/380) were calculated for each 5-s inter 55 Solution relative to Ringers in the bath-ground agar bridge Val after subtraction of background. For each experiment, (+5 mV.). For noise analysis, 200-ms sweeps were acquired at approximately 100 individual cells were analyzed for 340/ the rate of 3 Hz at a holding potential of -100 mV, digitized at 380 ratios using Igor Pro (Wavemetrics, Lake Oswego, Oreg.) 5 kHz, and low-pass filtered using the Axopatch 200 ampli analysis software. Cal, was estimated from the relation fiers internal Bessel filter at 2 kHz. The mean and variance Ca", K*(R-R)/(R-R). K*, R, and R, were 60 were calculated from 100-ms segments of the digitized data. measured in control human T cells in situ as previously described. Ca" influx rates were calculated from the maxi Data Analysis mal rate of rise in Ca" concentrations (dCa"/dt) after Unless noted otherwise, all data were corrected for leak readdition of 0.2 mM extracellular Ca". currents collected either with 2 uM La" or with traces col Ca" influx in S2R+ cells was measured by flow cytometry 65 lected prior to I, induction during passive dialysis with after detaching cells from the dish with trypsin (CellCiro, BAPTA. Permeability ratios (P/PX) was calculated from Herndon, Va.). Cells were loaded with the Ca" indicator dyes the biionic reversal potential using the equation: US 9,163,078 B2 40 the TRP family of ion channels have been proposed to encode the CRAC channel, including TRPC1', TRPC3, and TRPV6'7", as well as voltage-gated Ca" (Cav) channels'’ 20. However, evidence that TRPs are store-dependent follow ing heterologous expression in several cell lines is inconsis where R. T. and F have their usual meanings and E,re: is the tent'', and none of the candidates exhibit all of the reversal potential. biophysical properties of the CRAC channel. Previous Introduction sequence analyses and complementation studies in the SCID Ca" is an essential second messenger in almost all cell patients cells had failed to establish a role for several TRP types. In particular, Sustained Ca" influx across the plasma 10 family members including TRPC3, TRPV5 and TRPV6 in the membrane is crucial for lymphocyte activation and the adap defect in CRAC channel function'. More recently, the type I tive immune response. Antigen recognition by the Surface membrane proteins STIM1 and STIM2 were shown to be antigen receptors of T and B lymphocytes triggers an elabo essential for store-operated Ca" entry and CRAC channel rate signal transduction cascade, involving the activation of function’’. STIM1 has been suggested to “sense” the fill multiple tyrosine kinases and the assembly of large scaf 15 ing state of the ER Ca" stores via its EF hand domain, thus folded complexes containing diverse adapters and signaling coupling Store depletion to the opening of CRAC channels. proteins. An early biochemical consequence is the activation However neither STIM1 nor STIM2 were mutated in the of PLCY, which releases Ca" from the endoplasmic reticu SCID patients, and expression of STIM1 in SCID T cells did lum (ER) by generating IP; the resulting decrease in lumenal not result in complementation of the Ca" entry defect''. ERCa" opensa class of "store-operated” Ca" channels with Here we describe the identification of a novel protein cru very specific electro-physiological characteristics, which cial for store-operated Ca" entry and CRAC channel func have been termed Ca" release-activated Ca" (CRAC) chan tion. The protein, here termed Orai1, was identified using two nels'. CRAC channel opening results in sustained influx of unbiased genetic approaches: a modified linkage analysis to Ca" ions across the plasma membrane, promoting a sus identify the gene mutated in the SCID patients, and agenome tained elevation of intracellular free Ca" (Ca") levels and 25 wide RNAi screen in Drosophila to identify regulators of activating diverse Ca"/calmodulin-dependent enzymes store-operated Ca" entry and NFAT nuclear import. The including the protein phosphatase calcineurin; an ultimate combination of these two approaches pinpointed a single consequence is the activation of Ca"-dependent transcrip candidate gene. We show that RNAi-mediated depletion of tional pathways required for proliferation and effector Drosophila Oraiabrogates store-operated Ca" entry as effec immune function'. One of the major Ca"-regulated tran 30 tively as RNAi against Drosophila Stim. We further show that scription factors is NFAT, a family of heavily-phosphorylated a point mutation in Orail is responsible for the Ca" influx proteins that resides in the cytoplasm of resting cells. Sus defect in the SCID patients, and that complementation of tained Ca" influx results in the dephosphorylation of NFAT SCID T cells and fibroblasts with wild type Orail reconsti by calcineurin and promotes its translocation to the nucleus, tutes store-operated Ca" influx and CRAC channel current where it turns on the expression of a large number of activa 35 (I). The pharmacological and electrophysiological prop tion-associated genes''. erties of the reconstituted currents are indistinguishable from A great deal of pharmacological, electrophysiological, and those of endogenous I in control T cells. The primary genetic evidence Supports the notion that CRAC channels are sequence of Orail predicts four transmembrane domains, and the principal pathway for Ca" influx in both developing and immunocytochemistry of epitope-tagged Orail shows that mature T cells, thus orchestrating essentially all aspects of 40 the protein is localized at or near the plasma membrane. lymphocyte development and function''. Analysis of two Results families of patients with hereditary severe combined immune Phenotypic Identification of Heterozygous Disease Carriers deficiency (SCID), who presented as infants with a marked The two SCID patients were born to consanguineous par propensity to bacterial and viral infections, revealed that the ents, Suggesting an autosomal recessive mode of inheritance primary defect is lack of store-operated Ca" entry in the 45 as neither the parents of the SCID patients nor any other patients' lymphocytes'. Detailed analysis of T cell lines members of the SCID patients’ family showed clinical symp derived from one family of patients revealed severe impair toms of immunodeficiency (FIG. 1A). Furthermore, T cells ment of NFAT dephosphorylation, nuclear translocation and derived from the parents of the SCID patients showed almost activation of NFAT-dependent genes, secondary to a corre normal store-operated Ca" entry in the presence of 2 mM spondingly severe impairment of store-operated Ca" influx 50 extracellular Ca' '. To unmask a potential defect in Ca" in cells activated through the T cell receptor or treated with entry in the parental T cells, we measured the initial rate of thapsigargin, an inhibitor of the SERCA Ca" pump'. Elec Ca" influx (here defined as the initial rate of change of trophysiological analysis of the patients' T cells confirmed an intracellular free Ca" concentration, dCa"I/dt) after almost complete absence of CRAC channel function'. thapsigargin-mediated Store depletion, but decreased the Together these data highlight the crucial importance of 55 driving force for Ca" entry by reducing the extracellular CRAC channels and store-operated Ca" entry for lympho Ca" concentration from 2 mM to 0.2-0.5 mM CaCl. Under cyte activation and immune defense. these conditions, peak Ca" levels and Ca" influx rates in T Although the pharmacological and electrophysiological cells from both parents were ~50% or less of those observed properties of the CRAC channel have been described in some in wild-type control T cells (FIG. 1B). We hypothesized that detail'''', its molecular identity has remained elusive to 60 this finding reflected a potential gene-dosage effect, resulting date. The key biophysical hallmarks of the channel include from the fact that the parents were heterozygous carriers of high selectivity for Ca" over monovalent cations, low single the causal mutation in the SCID patients. channel conductance (<1 pS), an inwardly rectifying I-V We used this assay to identify other potential heterozygous relationship, a lack of significant Voltage-dependent gating, carriers of Such a mutation in the more extended pedigree. rapid inactivation by intracellular Ca", extracellular block 65 Blood samples were obtained from 19 additional family ade by Submicromolar La", and modulation of channel prop members (FIG. 1A), T cell lines were generated, and Ca" erties by 2-APB''''. Several candidate genes belonging to entry phenotype was evaluated by phenotypic analysis in US 9,163,078 B2 41 42 vitro. Thirteen family members consistently showed reduced patients were heterozygous. The -6.5 Mb interval contains peak Ca" influx and decreased initial rate of Ca" influx, ~74 genes, of which 16 were annotated as “hypothetical pro compared to T cells from 8 other family members and unre teins” or potential geneloci (Human genome assembly, NCBI lated controls (FIG. 1C). An arbitrary cutoff of Ca" influx build 35.1). Of these, 2 were predicted to contain transmem rate below 2 nM/s was used to distinguish potential heterozy brane domains (KIAA0152 and FLJ14466) using TMHMM gous disease carriers from unaffected (homozygous wild and Phobius algorithms’’’. type) individuals (FIG. 1C). With this cutoff, the distribution A Genome-Wide RNAi Screen in Drosophila Identifies of putative heterozygous carriers within the family appears olf186F (dorai) as a Novel Regulator of Store-Operated Ca" fully compatible with an autosomal dominant mode of inher Entry itance (FIG. 1A). 10 In parallel with the positional cloning effort, we conducted Linkage Manning by Genome-Wide SNP Array Screen a genome-wide RNAi screen for NFAT regulators in Droso Genomic DNA from the 23 members of the SCID family phila, as an independent method of identifying components was used for genotyping using genome-wide SNP arrays. of the CRAC channel and the signalling pathway leading to SNP data were evaluated using two independent linkage CRAC activation. Drosophila S2R-- cells, stably-expressing analyses. The first analysis assumed an autosomal recessive 15 an NFATGFP fusion protein, were incubated for 3 days with mode of inheritance based on the clinical phenotype, and arrayed dsRNAs against each of -21,000 Drosophila genes to DNA from the two patients, their parents, their unaffected achieve knockdown of gene expression. The cells were then brother and their grandparents was analysed (Pedigree A, stimulated for 10 min with thapsigargin to deplete Ca" indicated by the grey shaded area in FIG. 1A). In contrast, the stores, thus activating store-operated Ca" entry and nuclear second analysis utilized the remainder of the pedigree in a translocation of NFATGFP. The cells were then fixed, wells completely independent analysis. Here, an autosomal domi containing the cells were photographed robotically, and the nant mode of inheritance was assumed, based on our ability to subcellular distribution of NFAT-GFP was assessed by visual identify heterozygous carriers of the disease mutation by inspection. Among the positive candidates whose depletion phenotypic analysis in vitro (Pedigree B, indicated by the interfered with NFAT nuclear translocation were several green box in FIG. 1A). Importantly, the first analysis (stan 25 expected regulators of the Ca"/calcineurin/NFAT signalling dard homozygosity mapping) was performed without consid pathway, including Calcineurin B (CanB), Calcineurin A eration of the heterozygous phenotype status of individuals, (CanA-14F) and Drosophila Stim'7. and the second (dominant inheritance) was performed on the One positive candidate, olf186F, was notable because the large pedigree as two unrelated halves (the relatives of parent gene encoding one of its three human homologues was 35 and 36 being treated independently) such that the results of 30 located within the 6.5 Mb homozygous genomic region these two analyses are fully independent. Thus we can con linked to the SCID mutation at 12q24 (hypothetical protein sider the analyses of these two runs to emerge from three FLJ14466, NM 032790, NP 116179). For reasons dis independent pedigrees (one homozygosity mapping run and cussed below, olf186F and its human homologue at 12q24 two unrelated dominant pedigrees) and can simply add the have been designated Drosophila Orai (dOrai) and human parametric LOD scores from these to acquire a statistically 35 Orail respectively; the other two human homologues, robust combined LOD score (see Materials and Methods). C7Orf19 located on chromosome 7 and MGC 13024 located Parametric linkage analysis for a recessive trait (Pedigree on chromosome 16, have been designated Orai2 and Orai3 A) identified six regions on six chromosomes with LOD (FIG. 3A). In Drosophila S2R+ cells, RNAi-mediated deple scores of 1.5-1.9—while one of these is almost certain to tion of either dStim or dOrai blocked nuclear translocation harbor the gene, it is fully expected that this maximum LOD 40 and dephosphorylation of NFAT-GFP (FIG. 2B). Likewise, score would be achieved several times by chance and thus the knockdown of either dSTIM or dOrai completely inhibited homozygosity mapping is not sufficient alone to map this thapsigargin-induced Ca" influx in S2R-- cells (FIG. 2B). gene. Satisfyingly, the dominant analysis identified a unique These data confirm previous reports that dSTIM and human region on chromosome 12q24, clearly overlapping with one STIM1 are essential for store-operated Ca" entry and CRAC of the 6 regions identified in the homozygosity mapping 45 channel activation in Drosophila and mammalian analysis, with a LOD score of -3.8. The combination of these cells'''', and identify dOraias a second novel regulator of two linkage analyses defines an overlapping ~9.8 Mb candi store-operated Ca" entry in Drosophila cells. date region with a highly significant cumulative LOD score of Orail is Mutated in the SCID Patients 5.7, representing odds of ~500,000:1 in favor of linkage— Since our data implicated dOrai as a second novel regulator overwhelmingly likely to contain the true gene. This region is 50 of store-operated Ca" entry (FIG. 2), and since the gene for located between SNP A-1514003 and SNP A-1510776 human Orail was located in the 12q24 region that is homozy (115.49 Mb-125.27 Mb). In support of this conclusion, no gous in the SCID patients, we asked whether the SCID defect other region in the genome had a cumulative LOD score was associated with a mutation in human Orail (FIG. 3). By exceeding Zero. Because incorrect assignment of heterozy sequencing genomic DNA from the 23 individuals (patients gous disease carrier status based on phenotypic analysis 55 and their relatives) shown in FIG. 1A, we found that both would decrease overall LOD scores rather than yielding false SCID patients were homozygous for a missense mutation in positives of this magnitude, our novel combination of reces exon 1 of Orail. The mutation at position 271 of the coding sive and dominant analyses Successfully identifies a genomic sequence of Orail (position 444 of NM 032790), a C>T region with a very high probability of linkage to the mutant transition, leads to Substitution of tryptophan for a highly gene. 60 conserved arginine residue at position 91 (R91W) of the Genomic sequencing of six known genes in this region protein (NP 116179, FIG. 3B). The mutated residue is with a potential role in Ca" signaling or Ca" binding located at the beginning of the first of four potential trans (PLA2G1B, CABP1, P2RX7, P2RX4, CAMKK2, PIT membrane segments in Orail, predicted by calculating the PNM2) did not reveal any mutations in exons or immediately hydrophobicity of Orail using the Kyte-Doolittle method adjacent genomic regions. It did however allow us to narrow 65 (FIG. 3B, 3C). All 13 phenotypically predicted heterozygous down the candidate homozygous region from ~9.8Mb to ~6.5 disease carriers (FIG. 1) were genotypically heterozygous for Mb, on the basis of several SNPs in PITPNM2 for which the the mutation (C/T), while healthy controls and unaffected US 9,163,078 B2 43 44 family members were homozygous for the wild-type allele tion. SCIDT cells were retrovirally transduced with Orail in (C/C). The mutation at this position is not an annotated SNP a bicistronic IRES-GFP vector, and cells expressing Orail (dbSNP Build 124), rendering it unlikely this is simply a were identified by GFP fluorescence as described above. In common polymorphism. To confirm this hypothesis, we the experiments shown here, store depletion was accom typed this polymorphism in the entire HapMap panel (270 5 plished either by including 8 mMBAPTA in the patch pipette individuals in total from Utah, Ibadan (Nigeria), Tokyo and or by treatment with thapsigargin. Beijing) and did not find a single copy of the putatively causal In SCID cells reconstituted with wild type Orail, inclusion “T” allele in this panel (Materials and Methods, and data not of 8 mMBAPTA in the patch pipette caused the slow devel shown)'''. These data demonstrate unequivocally that the opment of an inward current in 20 mM Ca", following C>T transition is not a common sequence variant in the gen 10 eral population; thus the mutation is likely to have occurred whole-cell break-in, reminiscent of the development of I spontaneously in the ancestors of the SCID patients and is in response to store depletion (FIG.4A). By contrast, SCID strongly associated with disease. T cells expressing the R91W mutant of Orail failed to mani Expression of Orail Restores Store-Operated Ca" Influx in fest any inward Ca" currents following store depletion either the SCIDT Cells 15 with BAPTA (FIG. 4C) or with thapsigargin (data not shown), We asked whether Orail would complement the Ca" as expected from the inability of this mutant protein to recon influx defect in the SCID T cells (and fibroblasts) by express stitute store-operated Ca" entry. The current observed in ing N- and C-terminally epitope-tagged versions of wild type Orail-reconstituted SCID T cells displayed many key hall and mutant Orail in T cells and fibroblasts from the SCID marks of the Ice'''. First, when a divalent-free (DVF) patients. Retroviral expression of Myc-Orail' in SCID T solution lacking Ca" and Mg", in which the only current cells or fibroblasts using a bicistronic IRES-GFP vector carrier is Na', was applied after full development of the restored Ca" influx in response to thapsigargin treatment in current in 20 mM Ca", an inward Na" current was observed GFP-positive but not GFP-negative cells, whereas retroviral that was initially much larger than the Ca" current but that expression of mutant R91 >W Orail (Myc-Orai1') did not declined over tens of seconds (FIG. 4A). This decline of the restore Ca" influx. The inability of Myc-Orai1 'to restore 25 Na' current, known as depotentiation, is characteristic of Ca" influx in the SCID T cells and fibroblasts was not due to CRAC channels in Jurkat T cells, RBL cells and human T cell aberrant expression of Myc-Orail'" compared to Myc lines''. Second, both the Ca" and Na" currents showed Orail', because mutant and wild-type proteins are present an inwardly rectifying current-Voltage (I-V) relationship at equivalent levels and appear to be similarly localized at or (FIG. 4B). The reversal potential of the inward current in 20 near the plasma membrane as judged by immunoblotting 30 mM Ca" was >+90 mV, consistent with the known high (data not shown) and immunocytochemistry. We were unable selectivity of CRAC channels for Ca", whereas the reversal to stain non-permeabilized cells with the anti-myc antibody, potential in divalent-free solution was 49+2 mV (n=4 cells), consistent with a topology in which both the N- and C-termini indicating that the channels are only weakly permeable to the are cytoplasmically oriented and so inaccessible to the anti Cs" ions in the patch pipette (P/P, 0.14) and consistent body (FIG. 3C). 35 with the selectivity of CRAC channels for monovalentions Notably, Ca" influx in SCID T cells (and fibroblasts) 35. Third, the noise characteristics of the Orail complemented reconstituted with Myc-Orail" did not occur in unstimu current were consistent with those of CRAC channels in lated T cells (or fibroblasts) when 2-20 mM extracellular Ca" wild-type T cells (FIG. 4D). During depotentiation of the was present but was only observed after store-depletion with Na' current, variance declined linearly with mean current thapsigargin (FIG. 5A-5D). This is an important finding 40 with an average slope of 29+4 fa (n=4 cells), providing a because it demonstrates that restoration of Ca" influx in lower limit estimate of the unitary current similar to that of Orail-expressing cells is dependent on store depletion, a previous measurements of I. Furthermore, the Ca" cur defining feature of store-operated Ca" entry through CRAC rent resulting from complementation with Orail exhibited channels, and is not due to expression or activation of consti fast inactivation in 20 mM Ca" (FIG. 4E); the extent and tutively-open Ca" channels. Myc-Orail' also restored 45 time course of inactivation was similar to that previously store-operated Ca" entry in SCIDT cells in response to TCR reported for CRAC channels in Jurkat T cells (current inac crosslinking. The pharmacological characteristics of thapsi tivates by 54+5% at -100 mV within 200 ms: t: gargin- and TCR-induced Ca" entry in SCID T cells and 9+2 ms: t: 84t 12 ms). And lastly, the pharmacological fibroblasts complemented with Orail were exactly those hallmarks of the reconstituted current included complete expected for Ca" influx through CRAC channels''. Treat 50 block by 2 uM La" (FIG. 4F), inhibition by high doses of ment with 75uM2-APB or 2 uM La" inhibited Ca" influx 2-APB (FIG. 4G) and potentiation by low doses of 2-APB (FIG. 5A,5C,5D), whereas treatment with a low dose of (FIG. 4G); moreover the block observed with high doses of 2-APB (3 uM) caused a distinct further increase in Ca", 2-APB was accompanied by the loss of fast inactivation. (FIG. 5B), although the increase in the Orail' expressing The discrepancy between full complementation of CRAC SCID T cells was slightly lower than that in control T cells 55 currents by expression of Orail (FIG. 4H) and the partial (~15% vs. -23%). Taken together, these results show clearly complementation of Ca" influx observed by Ca" imaging that Orail is the gene responsible for the Ca" influx defect in may be explained by the fact that for measurements of I, the SCID patients' T cells and fibroblasts. we selected T cells with high GFP/Orail levels, whereas for Expression of Orail Restores I, in the SCIDT Cells the single-cell Ca" imaging, we averaged responses of all The recovery of Ca" influx seen in the previous experi 60 GFP/Orai 1-positive cells (both bright and dim). ments could reflect reconstitution of active CRAC channels in In summary, reconstitution of SCID T cells with Orail the patients cells, or could arise from expression (or activa restores not only store-operated Ca" entry but also a current tion) of store-operated, Ca" permeable ion channels distinct that is identical to I, with regard to store dependence, ion from CRAC. To distinguish between these possibilities, we selectivity and unitary conductance, gating properties, and characterized in detail the current arising from store-deple 65 pharmacological profile. Thus, we conclude that Orail is tion in the SCID cells reconstituted with wild type or mutant essential for CRAC channel function in T cells. The pore (R91W) Orail, using the whole-cell patch-clamp configura properties and pharmacological characteristics of the channel US 9,163,078 B2 45 46 observed in SCIDT cells complemented with Orail are indis nuclear localization of an NFAT-GFP fusion protein in tinguishable from those of bonafide CRAC channels. response to stimulation with thapSigargin. Among the posi Discussion tive candidates was olf186F (here renamed Drosophila Orai), Here we identify Orail as an evolutionarily-conserved which has three human homologues, FLJ14466, C7Orf19 and component of store-operated Ca" entry and an essential con 5 MGC13024. Since these are novel proteins without known tributor to I. We show that a point mutation in Orail is function, we named them Orai1-3, respectively. In Greek responsible for the genetic defect in store-operated Ca" entry mythology, the Orai are the keepers of the gates of heaven: and I function in two patients with a rare form of severe Eunomia (Order or Harmony), Dike (Justice) and Eirene combined immune deficiency (SCID)'''. Identification of (Peace)''': in Japan, Orai is in part derived from the sound Orail as the defective gene was accomplished through the 10 of “all right in English and also refers to comings and goings, synergistic combination of two independent genetic analyses, communication, Streets and traffic in Japanese. In a satisfying both involving unbiased genome-wide screens. validation of our dual strategy, the gene encoding Orail (hy Our first screen employed genome-wide SNP analysis to pothetical protein FLJ14466) is located on chromosome identify the chromosomal region linked to the SCID disease. 12q24, exactly the region identified by our SNP analysis as Because only two diseased individuals exist, the theoreti 15 linked genetically to the SCID syndrome. DNA sequencing cally-attainable LOD score from traditional linkage analysis rapidly revealed the genetic basis for the SCID defect as a is ~ 1.9, significantly below the 3.0 value necessary to estab point mutation (C-T) in exon 1 of Orai1, which resulted in an lish linkage. Indeed, analysis of a small pedigree including arginine to tryptophan Substitution at residue 91. This muta the two SCID patients, their parents and their grandparents tion is not a known polymorphism, as confirmed by sequenc identified 6 regions on 6 Separate chromosomes with maxi ing DNA from 270 individuals of mixed ethnic backgrounds mum LOD scores of 1.9 (Pedigree A). To extend the amount assembled for the international HapMap project'. This num of genetic information available, we devised a method of ber of samples is sufficient to find almost all haplotypes with identifying heterozygous carriers of the mutant allele. This frequencies of 5% or higher. Although there is a small chance was accomplished through a simple modification of our in that the CDT mutation is a SNP confined to a small ethnic vitro method of measuring store-operated Ca" influx, in 25 population not represented in the HapMap panel, this possi which the driving force for Ca" entry was decreased by bility can be ruled out with reasonable certainty based on the reducing the extracellular Ca" concentration. When this fact that complementation with Orail restores store-operated assay was applied to T cell lines derived from 21 additional Ca" entry and I in SCID patient cells. Furthermore, family members of the SCID patients (Pedigree B), 13 mem arginine 91 which is mutated in the SCID patients is located bers showed a significantly reduced initial rate of Ca" influx, 30 in a putative transmembrane region that is highly conserved which we interpret as reflecting a gene-dosage effect consis across species (FIG. 3A), highlighting its potential impor tent with heterozygosity for the mutant allele. A second, tance in the function of Orail. completely independent linkage analysis, in which the hap The characteristics of Ca" influx and Ca" current in lotype of these 13 putatively heterozygous individuals was Orail-complemented SCID T cells were indistinguishable compared to that of the remaining 8 homozygous healthy 35 from those observed in control T cells. In particular, both family members, yielded experimental LOD scores that iden processes were strictly regulated by Store depletion, and the tified a unique region on 12q24 with a LOD score of 3.8. This electrophysiological and pharmacological properties of the region overlapped with one of the regions identified by link restored current were fully consistent with those of I. age analysis of Pedigree A. Because the individuals used for These properties include: an extremely high selectivity for each analysis and the phenotypes used to classify them were 40 Ca" over monovalent cations, inwardly rectifying I-V rela distinct, allele sharing and thus linkage results were com tion, depotentiation under divalent-free conditions, current pletely independent in these analyses; hence we could com noise characteristics, rapid Ca"-dependent inactivation, bine LOD scores from the two analyses to obtain an unbiased blockade by low micromolar La" and positive and negative cumulative and highly significant LOD score of -5.7 for an modulation by 2-APB. We therefore conclude that Orail ~9.8 Md region at 12q24. In principle, this novel and powerful 45 reconstituted I, in the SCID patients' T cells, and thus that combination of linkage mapping approaches may be applied the CDT transition and resulting R91W mutation in the Orail to elucidate the genetic causes of other rare autosomal-reces coding region and protein are responsible for the SCID sive diseases, even if only a very few diseased individuals are defect. While its specific role has not yet been determined, the available and conventional homozygosity mapping fails to available data are consistent with the possibility that Orail establish linkage. Prerequisites are that other family members 50 encodes a channel Subunit or a closely-associated channel are available and that mutation of one allele can be detected as regulator in the plasma membrane. First, the hydropathy pro a quantifiable trait in vitro. file of Orail predicts a membrane protein with three, or poten In the hope of rapidly identifying a gene in the 12q24 tially four, hydrophobic membrane domains (FIG. 3B). Sec region that was involved in store-operated Ca" entry, we ond, immunocytochemistry of myc-tagged Orail is conducted a parallel genome-wide RNAi screen in Droso 55 consistent with localization at the plasma membrane under phila, taking advantage of the fact that Drosophila S2R cells resting conditions; this distribution differs from that of contain a store-operated Ca" channel with characteristics STIM1, which is predominantly located in the ER where it is very similar to CRAC. Rather than focusing solely on Ca" thought to sense Ca" store depletion via its luminal EF hand entry, we designed the screen to identify evolutionarily-con domain (Feske 2005, Liou 2005, Ref). Notably, both N- and served regulators of the Ca"-regulated transcription factor 60 C-terminal epitope tags on Orail are inaccessible to antibody NFAT; although Ca"-regulated NFAT proteins are not them staining in non-permeabilised cells; this finding is consistent selves represented in Drosophila, there is strong evolutionary with the prediction of four transmembrane domains and pre conservation of the pathways which regulate its nuclear-cy dicts a topology compatible with a channel Subunit, in which toplasmic shuttling, through effects on Ca' homeostasis, both N- and C-termini are cytoplasmically oriented (FIG. store-operated Ca" entry, calcineurin activity and kinase 65 3C). Further studies will be necessary to determine whether phosphatase balance’. The screen was used to identify can Orail is part of the CRAC channel itself, or whether it didates whose RNAi-mediated depletion interfered with encodes a regulator of the channel. US 9,163,078 B2 47 48 Orail is widely expressed at the mRNA level, potentially 13. Parekh, A. B. & Penner, R. Store depletion and calcium explaining our previous observations that not only T cells but influx. Physiol Rev. 77,901-930 (1997). also B cells and fibroblasts from the SCID patients show a 14. Prakriya, M. & Lewis, R. S. CRAC channels: activation, substantial defect in store-operated Ca" entry. Surprisingly, permeation, and the search for a molecular identity. Cell however, the clinical phenotype of the SCID patients is pre Calcium 33, 311-21 (2003). dominantly one of immunodeficiency, associated in the single 15. Mori, Y. et al. Transient receptor potential 1 regulates Surviving patient with ectodermal dysplasia and anhydrosis capacitative Ca(2+) entry and Ca(2+) release from endo (EDA) and a mild, congenital, non-progressive myopathy. plasmic reticulum in B lymphocytes. J Exp Med 195, 673 EDA is characterized by defective tooth enamel and hair 81 (2002). follicle function, and complete absence of Sweat glands, and 10 16. Philipp, S. et al. TRPC3 mediates T-cell receptor-depen many previous studies have linked it to hypoactivation of NF-kB'"'. Ca" mobilization is thought to contribute to dent calcium entry in human T-lymphocytes. J Biol Chem NFKB activation in T cells and other cell types under certain 278, 26629-38 (2003). conditions of stimulation, thus the EDA syndrome may 17. Yue, L., Peng, J. B., Hediger, M. A. & Clapham, D. E. well reflect defective NFKB activation, either during devel 15 CaT1 manifests the pore properties of the calcium-release opment or acutely in specific cell types. In contrast the activated calcium channel. Nature 410, 705-9 (2001). myopathy could potentially be a direct consequence of defec 18. Cui, J., Bian, J. S., Kagan, A. & McDonald, T. V. CaT1 tive NFAT activation, given that NFAT has a major role in contributes to the stores-operated calcium current in Jurkat certain aspects of skeletal muscle development and function T-lymphocytes. J Biol Chem 277, 47175-83 (2002). (reviewed in'). 19. Badou, A. et al. Requirement of Voltage-gated calcium In conclusion, our studies establish a critical role for Orail channel beta4 subunit for T lymphocyte functions. Science in T cell function and the in vivo immune response. A single 307, 117-21 (2005). point mutation in Orail, a novel protein conserved from C. 20. Kotturi, M. F., Carlow, D.A., Lee, J. C., Ziltener, H. J. & elegans to humans, disrupts store-operated Ca" entry and Jefferies, W. A. Identification and functional characteriza CRAC channel function in patients with an inherited immune 25 tion of Voltage-dependent calcium channels in T lympho deficiency. Future studies will address the relation between cytes. J Biol Chem 278, 46949-60 (2003). Orai and Stim proteins and the mechanism by which store 21. Voets, T. et al. CaTI and the calcium release-activated depletion couples to CRAC channel opening. calcium channel manifest distinct pore properties. J Biol Chem 276, 47767-70. (2001). REFERENCES 30 22. Venkatachalam, K., Van Rossum, D. B., Patterson, R. L., Ma, H.T. & Gill, D. L. The cellular and molecular basis of 1. Lewis, R. S. Calcium signaling mechanisms in T lympho store-operated calcium entry. Nat Cell Biol 4, E263-72 cytes. Annu Rev Immunol 19, 497-521 (2001). (2002). 2. Hoth, M. & Penner, R. Depletion of intracellular calcium 23. Liou, J. et al. STIM is a Ca2+ sensor essential for Ca2+- stores activates a calcium current in mast cells. Nature 355, 35 store-depletion-triggered Ca2+ influx. Curr Biol 15, 1235 353-6 (1992). 41 (2005). 3. Zweifach, A. & Lewis, R. S. Mitogen-regulated Ca2+ 24. Roos, J. et al. STIM1, an essential and conserved compo current of T lymphocytes is activated by depletion of intra nent of store-operated Ca2+ channel function. J Cell Biol cellular Ca2+ stores. Proc Natl Acad Sci USA 90, 6295-9 169, 435-45 (2005). (1993). 40 25. Krogh, A., Larsson, B. Von Heijne, G. & Sonnhammer, E. 4. Feske, S., Okamura, H., Hogan, P. G. & Rao, A. Ca2+/ L. Predicting transmembrane protein topology with a hid calcineurin signalling in cells of the immune system. Bio den Markov model: application to complete genomes. J chem Biophys Res Commun 311, 1117-32 (2003). Mol Biol 305, 567-80 (2001). 5. Macian, F. NFAT proteins: key regulators of T-cell devel 26. Kall, L., Krogh, A. & Sonnhammer, E. L. A combined opment and function. Nat Rev Immunol 5, 472-84 (2005). 45 transmembrane topology and signal peptide prediction 6. Winslow, M. M., Neilson, J. R. & Crabtree, G. R. Calcium method. J Mol Biol 338, 1027-36 (2004). signalling in lymphocytes. Curr Opin Immunol 15, 299 27. Gwack, Y. S., S. et al. A genome-wide Drosophila RNAi 307 (2003). screen identifies DYRK as a novel regulator of NFAT. 7. Hogan, P. G., Chen, L., Nardone, J. & Rao, A. Transcrip Nature (submitted; see example 2) (2005). tional regulation by calcium, calcineurin, and NFAT. 50 28. Zhang, S. L. et al. STIM1 is a Ca2+ sensor that activates Genes Dev 17, 2205-32 (2003). CRAC channels and migrates from the Ca2+ store to the 8. Partiseti, M. et al. The calcium current activated by T cell plasma membrane. Nature 437,902-5 (2005). receptor and store depletion in human lymphocytes is 29. Kyte, J. & Doolittle, R. F. A simple method for displaying absent in a primary immunodeficiency. J Biol Chem 269, the hydropathic character of a protein. J Mol Biol 157, 32327-35 (1994). 55 105-32 (1982). 9. Le Deist, F. et al. A primary T-cell immunodeficiency 30. Altshuler, D. etal. A haplotype map of the human genome. associated with defective transmembrane calcium influx. Nature 437, 1299-320 (2005). Blood 85, 1053-62 (1995). 31. Consortium, T.I. H. The International HapMap Project. 10. Feske, S., Giltnane, J., Dolmetsch, R., Staudt, L. & Rao, Nature 426,789-96 (2003). A. Gene regulation by calcium influx in T lymphocytes. 60 32. Prakriya, M. & Lewis, R. S. Potentiation and inhibition of Nature Immunology 2, 316-324 (2001). Ca(2+) release-activated Ca(2+) channels by 2-aminoeth 11. Feske, S. Prakriya, M., Rao, A. & Lewis, R. S. A severe yldiphenylborate (2-APB) occurs independently of IP(3) defect in CRAC Ca2+ channel activation and altered K+ receptors. J Physiol 536, 3-19 (2001). channel gating in T cells from immunodeficient patients. J 33. Prakriya, M. & Lewis, R. S. Separation and characteriza Exp Med 202, 651-62 (2005). 65 tion of currents through store-operated CRAC channels 12. Parekh, A. B. & Putney, J. W., Jr. Store-operated calcium and Mg(2+)-inhibited cation (MIC) channels. J Gen channels. Physiol Rev 85, 757-810 (2005). Physiol. 119, 487-507 (2002). US 9,163,078 B2 49 50 34. Hermosura, M. C., Monteilh-Zoller, M. K. Scharenberg, EXAMPLE 2 A. M., Penner, R. & Fleig, A. Dissociation of the store operated calcium current I(CRAC) and the Mg-nucleotide A Genome-Wide Drosophila RNAi Screen Identifies regulated metal ion current MagNuM.JPhysiol 539, 445 DYRK as a Novel Regulator of NFAT 58 (2002). 35. Lepple-Wienhues, A. & Cahalan, M. D. Conductance and Materials and Methods permeation of monovalent cations through depletion-acti The Genome-Wide Primary Screen vated Ca2+ channels (ICRAC) in Jurkat T cells. Biophys J Methods were adapted from refs'''. 10'S2R cells were 71, 787-94 (1996). added into each well containing 0.25ug of dsRNAs in 10ul of 36. Zweifach, A. & Lewis, R. S. Rapid inactivation of deple 10 serum-free medium and incubated for 1 h at 26°C. The cells tion-activated calcium current (ICRAC) due to local cal were then transiently transfected with NFAT1(1-460)-GFP cium feedback. J Gen Physiol 105, 209-26 (1995). expression plasmid''' (10 ng) in Schneider's medium (Invit 37. Yeromin, A. V., Roos, J., Stauderman, K. A. & Cahalan, rogen) (30 ul). After incubation for 48-72 hrs at 26°C., the M. D. A store-operated calcium channel in Drosophila S2 15 cells were fixed and stained with DAPI, and the coincident cells. J Gen Physiol 123, 167-82 (2004). GFP and DAPI images were acquired by an automated cam 38. Stewart, M. “The Hours”, Greek Mythology: From the era from three different locations in each well. A total of Iliad to the Fall of the Last Tyrant. http://messagenet.com/ fifty-eight 384-plates were analysed, containing a total of myths/bios/hours.html (2005). 21,884 wells into which individual dsRNAs had been 39. Homer. Iliad (Book 5) pp. 749-50. arrayed. 40. Homer. Iliad (Book 8), pp. 393-394. Control wells (no dsRNA, dsRNA against GFP, and 41. Doffinger, R. et al. X-linked anhidrotic ectodermal dys dsRNA against a gene (thread-anti-apoptotic) causing cell plasia with immunodeficiency is caused by impaired NF death) were present on each plate and served as an internal kappaB signaling. Nat Genet 27, 277-85 (2001). control for knockdown efficiency of each plate. All three 42. Courtois, G. et al. A hypermorphic IkappaBalpha muta 25 photographs of GFP fluorescence in each assay well were tion is associated with autosomal dominant anhidrotic manually scored using MetaMorph 6.1 Software (Universal ectodermal dysplasia and T cell immunodeficiency. JClin Imaging Corporation). To identify even weak effectors of Invest 112, 1108-15 (2003). NFAT localization non-stringent criteria were used in the 43. Schmidt-Ulrich, R. etal. Requirement of NF-kappaB/Rel primary Screen, Such that wells were scored positive even if for the development of hair follicles and other epidermal 30 only one cell in each of three fields showed complete nuclear appendices. Development 128,3843-53 (2001). localization of NFAT-GFP. Since the RNAi library was con 44. Puel, A., Picard, C., Ku, C. L., Smahi, A. & Casanova, J. structed before the Drosophila genome was completely anno L. Inherited disorders of NF-kappaB-mediated immunity tated, 39 of the 738 positives did not correspond to known in man. Curr Opin Immunol 16, 34-41 (2004). 35 genes and were eliminated. Another 37 candidates were 45. Smahi, A. et al. The NF-kappaB signalling pathway in eliminated because the dsRNAs used to identify them had human diseases: from incontinentia pigmenti to ectoder more than 10 predicted “off-targets” with exact matches of 21 mal dysplasias and immune-deficiency syndromes. Hum nucleotides (nt) (see Bioinformatics and Classification Mol Genet 11, 2371-5 (2002). below). 46. Kanno, T. & Siebenlist, U. Activation of nuclear factor 40 The Confirmatory Screen kappaB via T cell receptor requires a Rafkinase and Ca2+ The confirmatory screening on the 699 potentially positive influx. Functional synergy between Raf and calcineurin. J candidates from the primary Screen was performed essen Immunol 157, 5277-83 (1996). tially as described for the primary screen, except that S2R" 47. Horsley, V. & Pavlath, G. K. NFAT: ubiquitous regulator cells stably transfected with NFAT1(1-460)-GFP were used, of cell differentiation and adaptation. J Cell Biol 156, 45 and candidates were tested for whether their depletion altered 771-4 (2002). NFAT subcellular localization in both resting and stimulated 48. Feske, S., Draeger, R., Peter, H. H. Eichmann, K. and S2R" cells. Wells in which all cells contained cytoplasmic Anjana Rao. The Duration of Nuclear Residence of NFAT NFATGFP got the lowest score (0) while wells with >90% of Determines the Pattern of Cytokine Expression in human the cells showing nuclear NFAT-GFP scored the highest (3). SCIDT Cells. J Immunol 165, 297-305 (2000). 50 The Summed scores from all three experiments are presented 49. Leykin, I. et al. Comparative linkage analysis and visual in Table I. Note that the highest possible score is 9, but ization of high-density oligonucleotide SNP array data. because we scored conservatively in the confirmatory screen, BMC Genet 6, 7 (2005). the highest actual score obtained by any candidate is 6. All 50. Gudbjartsson, D. F. Jonasson, K., Frigge, M. L. & Kong, candidates were also tested for whether they prevented NFAT A. Allegro, a new computer program formultipoint linkage 55 nuclear localization in cells treated with thapSigargin (1 LM, analysis. Nat Genet 25, 12-3 (2000). 30 min); only Drosophila STIM (dSTIM) scored positive in 51. Markianos, K., Daly, M. J. & Kruglyak, L. Efficient this assay. multipoint linkage analysis through reduction of inherit To generate the stably-expressing cell line, the coding ance space. Am J Hum Genet 68,963-77 (2001). sequence for the NFAT1(1-460)-GFP fusion protein was sub 52. Abecasis, G. R., Cherny, S.S., Cookson, W. O. & Cardon, 60 cloned into the expression plasmid pAc5.1 (Invitrogen), and L. R. Merlin rapid analysis of dense genetic maps using the macrophage-hemocyte-like Drosophila cell line S2R" sparse gene flow trees. Nat Genet 30, 97-101 (2002). was transfected in a 6-well format using Effectene (Qiagen) 53. Gabriel, S. B. et al. The structure of haplotype blocks in with a 19:1 ratio of the expression plasmid to pCoHygro the human genome. Science 296, 2225-9 (2002). (Invitrogen), which encodes a hygromycin resistance gene 54. Zweifach, A. & Lewis, R. S. Calcium-dependent poten 65 under the control of a constitutively active promoter. The cells tiation of store-operated calcium channels in T lympho were selected for 3-4 weeks with 300 g/ml hygromycin, and cytes. J Gen Physiol 107,597-610 (1996). stable clones were selected by visual inspection. US 9,163,078 B2 51 52 Bioinformatics and Classification mutants in serines phosphorylated in vivo)". Immunocom Scores were consolidated and formatted for submission to plexes were washed twice with lysis buffer (1.0% NP-40, 50 the DRSC (Drosophila RNAi Screening Center at Harvard mM HEPES pH 7.4, 150 mM NaCl, 5 mM EDTA, 5 mM Medical School), which then provided the identity of the EGTA, 1 mM dithiothreitol DTT, 20 mM f-glycerol-phos genes assayed (FlyBase identifier, Drosophila gene name, phate, 10 mM sodium pyrophosphate, 0.1 mM sodium ortho where known; some Gene Ontology (GO) identifiers; and vanadate, 10 mM NaF. 1 mM phenylmethylsulfonyl fluoride Some human homologues). Gene Ontology (GO) annotation PMSF, 10 ug/ml aprotinin, 10 ug/ml leupeptin) and twice was retrieved in two ways. First, we employed Ensembl’s with kinase buffer (20 mM HEPES, pH 7.4, 20 mMMgCl, 1 EnsMart tool using the FlyBase identifier for each gene to get mMDTT, 0.1 mM sodium orthovanadate, 20 mMB-glycerol the GO description. Second, we used the GO identifiers pro 10 phosphate), and incubated at 30°C. for 20 minutes in a 40 ul vided by the screening center to get descriptions from the final volume of kinase buffer in the presence of 20 uM ATP, 2 “GO terms and IDs' file from the Gene Ontology Consor uCi YP-ATP and 10 ug of wild-type or mutant GST-pep tium. Functional categories of genes were constructed by tide substrate. Peptides were isolated on glutathione keyword searches of the positives followed by manual cura Sepharose and phosphorylation was assessed by SDS gel tion. Positive genes were also examined for involvement in 15 electrophoresis and autoradiography. common pathways using tools such as those at the KEGG The ability of DYRK1A and DYRK2 to phosphorylate Pathway Database. GST-NFAT1 fusion peptides was examined using 20 ng of For each candidate that was positive in the primary screen, recombinant protein kinase (Upstate Biotechnology) in a 40 the number of off-targets was determined using the off-target ul final volume of kinase buffer in the presence of 20LM ATP, sequence search tool on the DRSC website (http://www.fly 2 uCi -P-ATP and 10 ug of GST-peptide substrate. The mai.org/RNAi primer design.html). This bioinformatic tool ability of GSK3 to phosphorylate NFAT1 was examined by is based on an algorithm similar to that in ref except that it first pre-phosphorylating GST fusion proteins pre-bound to does not have a built-in primer design component (Flockhart glutathione Sepharose beads using 1U of recombinant protein et al., Submitted). Amplicon (dsRNA) sequences are searched kinase A (PKA) (New England Biolabs NEBI), 20 ng for predicted off-targets by considering all possible frag 25 DYRK1A or DYRK2 in the presence of 1 mM cold ATP for ments, of length 16-50 bp with a default value of 21 bp, that 16 hat 30°C. After cold priming fusion proteins were washed perfectly match sequences in fly transcripts in release 4.0. repeatedly to remove recombinant kinase and ATP. Phospho Ideally, only 1 match corresponding to the targeted mRNA rylated fusion proteins were then incubated with 1U of GSK3 should be found, but some amplicons have matches with other (NEB) in a 40 ul final volume of kinase buffer in the presence mRNAs which are not the intended target. For the genes in 30 of 20 uM ATP 2 uCi YP-ATP for 45 minutes. Table I, a default length of 21 nt was used to compute the Reporter Assays and IL-2 Expression Assays number of off-targets for each positive candidate, and candi Exponentially growing (10) Jurkat T cells stably express dates with >10 off-targets were eliminated. For the genes in ing HA-tagged full-length NFAT1 in the pCZ vector' were Table II (calcineurin) and III (candidates used for additional transfected by electroporation at 250 V and 960 uF. For experiments), shorter fragments of 19 nt and 20 nt were 35 luciferase experiments, cells were transfected with 0.5 lug considered as well. The identity of off-targets was determined pRLTK reporter (Renilla luciferase for internal control), 5.0 using BLASTN against Drosophila NCBI RefSeq database. ug pGL3 reporter (firefly luciferase, experimental promoter) Mammalian orthologues of Drosophila melanogaster pro and expression plasmids encoding empty vector, wild type or teins in Table I were retrieved from the NCBI Homologene kinase dead DYRK2. At 24 h post transfection cells left database (http://www.ncbi.nlm.nih.gov/entrez/ 40 untreated or stimulated with PMA (20 nM), ionomycin (1 query.fcgi?db-homologene). The human homologues of the uM) and 2 mM CaCl for 6 hours were measured for reporter fly kinases were obtained by reciprocal blast method using gene activity using the Dual-Luciferase Reporter Assay BLASTP; Altschul, et al. 1990, J. Mol. Biol. 215:403-410), as (Promega) as recommended by the manufacturer. For intrac described. Phylogenetic analysis was performed using ellular cytokine staining, cells were co-transfected with GFP TCoffee', and the reliability of the ortholog assignments was 45 encoding plasmid and empty vector plasmids, wild type or assessed with the bootstrap method implemented in Orthos kinase-dead DYRK2. At 24 h post transfection cells left trapper'. untreated or stimulated with PMA (20 nM), ionomycin (1 DsRNA Mediated Knockdown in Drosophila Cells uM) and 2 mM CaCl for 6 hours in the presence of Brefeldin PCR fragments (size up to 600 bp) were used as templates A (2 ug/mL) for the last 4 hours were fixed with 4% paraform for in vitro transcription reactions, followed by DNase I treat 50 aldehyde in PBS for 20 minat 25°C., washed twice with PBS, ment to remove the template DNA. After purification, dsRNA permeabilized in saponin buffer (PBS, 0.5% saponin (5 ug) was co-transfected together with the NFATGFP Sigma, 1% BSA and 0.1% sodium azide) and stained with expression plasmid into S2R cells in 8-chamber slides (10 ug phycoerythrin-conjugated ratanti-human IL-2 (PharMingen) for 12 well plate). After 72 hrs of incubation, cells were left for 30 min at 25° C. Cells were washed twice in PBS and untreated or were treated with the Ca" influx inducers, 1 uM 55 analyzed with a FACSCalibur flow cytometer (Becton Dick ionomycin or 1 uM thapsigargin for localization assays and inson) and FlowJo software. were trypsinized for the measurement of Ca2'i levels. siRNA-Mediated Knockdown of DYRK1A In Vitro Kinase Assays 0.5x10° HeLa cells stably expressing NFAT1(1-460)-GFP FLAG-tagged human kinases were immunoprecipitated were seeded in 6-well plates and transfected the next day with from whole cell lysates of transiently-transfected HEK293 60 siRNAS (Dharmacon, Inc., Lafayette, Colo.) corresponding cells using anti-FLAG antibody-coupled protein G beads to control siRNA or human DYRK siRNA using lipo (Sigma), and immunoprecipitates were analysed for phos fectamine 2000 transfection reagent (Invitrogen, Carlsbad, phorylation of either the entire NFAT1 regulatory domain Calif.) according to the manufacturer's protocol. Cells were (GST-NFAT11-415) expressed in bacterial cells, or GST. reseeded and the transfection procedure was repeated after 24 fused peptides corresponding to the SRR-1 (amino acids 149 65 h to increase the efficiency of knockdown. Cells were har 183), SP-2 (amino acids 206-237) and SP-3 (amino acids Vested for immunoblot analysis or immunocytochemistry 4 264-295) motifs of NFAT1 (both wild-type and Ser->Ala days post transfection. DYRK transcript levels were mea US 9,163,078 B2 53 54 sured by real-time RT-PCR. Threshold cycles (C) for Introduction and Results DYRKIA were normalized to GAPDH housekeeping gene The subcellular localization of NFAT is determined by a expression levels (ACT) and plotted as 0.5^*10 (arbitrary complex process of signal integration that involves inputs units). The siRNA sequences correspond to DYRK1A: from diverse signalling pathways. In resting cells, NFAT AGGUGGAGGUGCAAUAUUA (SEQ ID NO: 31); proteins are heavily phosphorylated and reside in the cyto scrambled control: CUUUAAGCCUCGAGAUAUA (SEQ plasm; in cells exposed to stimuli that raise intracellular free ID NO:32). The RT-PCR primer sequences correspond to Ca" (Cat) levels they are dephosphorylated by the calm DYRKIA Sense: AGTTCTGGGTATTCCACCTGCTCA odulin-dependent phosphatase calcineurin and translocate to (SEQ ID NO: 10), DYRKIA anti-sense: TGAAGTT the nucleus. Dephosphorylation of NFAT by calcineurin is TACGGGTTCCTGGTGGT (SEQID NO:11). 10 countered by distinct NFAT kinases, among them CK1, Intracellular Calcium Measurements by Time-Lapse Video GSK3, and various members of the MAP kinase family''. Imaging The transcriptional activity of NFAT is regulated by addi HEK 293T cells were grown directly on UV-sterilized tional inputs, including phosphorylation of the N-terminal coverslips, loaded with Ca" indicator dye Fura-2 AM (3 uM, transactivation domain, recruitment of co-activators and co Molecular Probes, Eugene, Oreg.) for 45 min at room tem 15 repressors, and choice of partner proteins in the nucleus'''. perature, washed and resuspended in loading medium We used a strategy, based on genome-wide RNAi screen (RPMI+10% FCS). For rationetric Ca" videoimaging, cov ing in Drosophila S2R+ cells'''', to identify regulators of erslips were mounted on a closed bath RC-20 flow chamber intracellular free Ca" (Ca") levels, calcineurin activation (Warner Instrument Corp., Hamden, Conn.) and perfused in 2 and NFAT localization in cells. The strategy relies on the fact mM Calcium Ringer solution (155 mM NaCl, 4.5 mM KC1, that although Ca"-regulated NFAT proteins are not repre 10 mM D-glucose, 5 mM Hepes (pH 7.4), 1 mM MgCl, 2 sented in Drosophila, the pathways of Ca' homeostasis, mM CaCl). After switching to Ca" free Ringer solution (2 Ca" influx, and calcineurinactivity that regulate NFAT local mM Ca" replaced with 2 mM MgCl), intracellular Cat ization are evolutionarily conserved''. To validate this stores were depleted with 1 M thapisgargin, and store-oper point, we used the GFP fusion protein NFAT1(1-460)-GFP ated Ca2+ influx was measured after perfusing cells with 25 (here termed NFAT-GFP)'7. NFATGFP contains the entire Ringer solution containing 2 mM CaCl2. Single cell video regulatory domain of NFAT, including the calcineurin and imaging was performed on a S200 inverted epifluorescence CK1 docking sites, the nuclear localization signal (NLS), and microscope (Zeiss, Thornwood, N.Y.) using OpenLab imag the conserved serine-rich regions (SRR) and serine-proline ing software (Improvision, Lexington, Mass.). Fura-2 emis repeat (SP) motifs which control NFAT1 subcellular localiza sion was detected at 510 nm following excitation at 340 and 30 tion and DNA-binding affinity'''7 (FIG. 6A). NFAT-GFP 380 nm, respectively, with ratios of 340/380 being calculated was correctly regulated in Drosophila S2R+ cells: it was for each 5 sec interval after background subtraction. Calibra phosphorylated and properly localized to the cytoplasm tion values (R. R. S.) were derived from cuvette mea under resting conditions and became dephosphorylated and surements as previously described. For each experiment, translocated to the nucleus in response to Ca" store depletion approximately 50-100 cells were analyzed. For simultaneous 35 with the SERCA inhibitor thapsigargin (FIG. 6B); it was measurements of Cali and DYRK2 expression, Jurkat T imported into the nucleus with similar kinetics in S2R+ cells cells were cotransfected with DYRK2 cDNA and eGFP at a and mammalian HeLa cells and was sensitive to the cal ratio of 10:1. 48 hrs post transfection, cells were used for Ca" cineurin inhibitor CSA in both cell types. S2R+ cells treated imaging as described above. For single cell analysis of Ca2+ with limiting amounts of thapsigargin displayed intermediate i, GFP (that is, DYRK2) and GFP" (that is, DYRK2) cells 40 phosphorylated forms of NFAT-GFP, most likely reflecting were gated and plotted separately. progressive dephosphorylation of serines within the indi Intracellular Calcium Measurements by Flow Cytometry vidual conserved motifs of the regulatory domain'. Finally, S2R-- cells were detached from the dish with trypsin (Cell depletion of the primary NFAT regulator, calcineurin, by Gro, Herndon, Va.) and loaded with the Ca" indicator dye RNAi in S2R+ cells inhibited thapsigargin-dependent Fluo4-AM (2 uM Molecular Probes, Eugene, Oreg.) for 45 45 dephosphorylation and nuclear import of NFAT-GFP (Table min at room temperature and then resuspended in loading II). Together these experiments confirmed that the major medium (RPMI-10% FCS). Immediately before the flow pathways regulating NFAT phosphorylation and subcellular cytometric Ca" measurements, cells were resuspended in localization-store-operated Ca" influx, calcineurin activa Ca" free Ringer solution and analyzed on a FACSCalibur tion, and NFAT phosphorylation—are conserved in Droso (BD Biosciences, San Jose, Calif.). 180 sec after addition of 50 phila and appropriately regulate vertebrate NFAT. thapsigargin (3 uM) in Ca" free Ringer to deplete intracel We performed a genome-wide RNAi screen''' on lular Castores, 4 mM Ca" Ringer solution was added to the unstimulated S2R+ cells, and scored visually for aberrant cells to achieve a final concentration of 2 mM Ca". Cellular nuclear localization of NFAT-GFP (see Methods and Ca" levels were then analyzed using FloJo software (Tree Example 3). Of 21,884 screened wells, 662 were scored as Star, Inc., Ashland, Oreg.). 55 potentially positive using non-stringent criteria; in a confir Subcloning of Human Orthologues of the Candidate Kinases matory screen, 27 1/325 (83%) retested candidates were con Full-length cDNAs encoding human orthologues of the firmed as positive, attesting to the reproducibility of our initial kinase candidates were obtained from Flexgene Kinase assessment of NFAT nuclear localization (FIG. 6C). Positive Repository (Harvard Institute of Proteomics) or the Mam candidates included Na"/Ca" exchangers and SERCA Ca" malian Gene Collection (MGC. Open Biosystems), sub 60 ATP-ases whose knockdown would be expected to increase cloned into pENTRY.11 (Invitrogen) vectors with insertion of basal Ca", and the scaffold protein Homer which has been Flag-tag at the N-terminus, and then recombined into linked to Ca" influx and Ca" homeostasis'' (Table I). The pDEST12.2 (Invitrogen). Kinase-dead DYRK2 was con screen also identified Stim, a recently-identified regulator of structed by introducing a K251 R point mutation in the ATP store-operated Ca" influx'' as causing nuclear localiza binding pocket of the active site using the PCR-based method 65 tion of NFAT-GFP in resting S2R+ cells, possibly because its (QuikChange Site-Directed Mutagenesis, Stratagene) and depletion resulted in minor dysregulation of NFAT kinases or sequenced to ensure polymerase fidelity. small increases in basal Ca"I levels (FIGS. 9A-9C). US 9,163,078 B2 55 56 Finally, the screen identified a large number of protein ticularly impressive, given the higher affinity (~40–50-fold) kinases which could potentially influence basal Ca", levels of the VIVIT (SEQ ID NO:30) docking site for calcineurin or calcineurinactivity, directly phosphorylate the NFAT regu compared to the affinity of the wild type SPRIEIT (SEQ ID latory domain, or indirectly influence the activity of direct NO:33) docking site''. Consistent with direct phosphoryla NFAT kinases (Table I). tion of NFAT, Ca" mobilization in response to thapsigargin We were interested in kinases that directly phosphorylate was unaffected by depletion of the DYRK-family candidate the NFAT regulatory domain. In the family member NFAT1, CG40478 in S2R-- cells, and only slightly diminished by the regulatory domain bears 14 phosphorylated serines, 13 DYRK2 overexpression in Jurkat T cells. of which are dephosphorylated by calcineurin (FIG. 6A). DYRKs constitute an evolutionarily-conserved family of Five of these serines are located in the SRR-1 motif, which 10 proline or arginine-directed protein kinases distantly related controls exposure of the NLS and is a target for phosphory to cyclin-dependent kinases (CDK), mitogen-activated pro lation by CK1'; three are located in the SP-2 motif, which tein kinases (MAPK), glycogen synthetase kinases (GSK), can be phosphorylated by GSK3 after a priming phosphory and CDK-like (CLK) kinases (CMGC kinases. The DYRK lation by protein kinase A (PKA)''': and four are located in family has multiple members (FIG. 11A) which have been the SP-3 motif, for which a relevant kinase had yet to be 15 designated class I (nuclear, DYRK1A and DYRK1B) or class identified at the time this study was initiated. The SP-2 and II (cytoplasmic, DYRK2-6), depending on their subcellular SP-3 motifs do not directly regulate the subcellular localiza localisation. RT-PCR and western blotting suggested that tion of NFAT1, but their dephosphorylation increases both the DYRK1A and DYRK2 were major representatives of nuclear probability of NLS exposure and the affinity of NFAT for and cytoplasmic DYRKs in Jurkat T cells, respectively (FIG. DNA'''. It was not known how distinct SRR-1, SP-2 and 11B). Depletion of endogenous DYRK1A using DYRK1A SP-3 kinases acted together to promote the full phosphoryla specific siRNA in HeLa cells stably expressing NFATGFP tion of NFAT; nevertheless, we expected that depletion of increased the rate and extent of NFAT1 dephosphorylation individual NFAT kinases in S2R-- cells would result in vary and nuclear import while slowing rephosphorylation and ing degrees of nuclear accumulation of NFAT, depending on nuclear export, in response to treatment with thapsigargin for kinase expression level, the particular motif phosphorylated, 25 10 min (to induce dephosphorylation and nuclear import) and whether or not other related kinases were redundantly followed by CSA addition for 5 to 30 min (to inactivate expressed. Wetherefore tested at least one mammalian homo calcineurin and permit rephosphorylation by NFAT kinases logue (where available) of all constitutively-active kinases for nuclear export) (FIG. 10C left panel). Results obtained identified in the screen, regardless of their score in the sec using endogenous DYRK1A depletion, which reflect a ondary screen. Some inducible kinases were included, but 30 knockdown efficiency of approximately 70% of mRNA lev others (e.g. protein kinases C and D) will be investigated as els (FIG. 10C right panel), indicate that DYRK represent part of a separate study. physiological negative regulators of NFAT activation in cells. FLAG-tagged mammalian homologues of selected Droso Further experiments showed that DYRK specifically tar phila kinases were expressed in HEK293 cells, and anti geted the SP-3 motif of NFAT1. FLAG-tagged DYRK2 was FLAG immunoprecipitates were tested in an in vitro kinase 35 expressed in HEK 293 cells, immunoprecipitated with anti assay for their ability to phosphorylate the GST-NFAT1 (1- FLAG antibodies, and phosphorylated peptides correspond 415) fusion protein (FIG. 7A). Three novel candidates— ing to the conserved SP-3 but not the SP-2 motif of the NFAT PRKG 1, DYRK2 and IRAK4—showed strong activity in this regulatory domain in vitro. To rule out the possibility that the assay (FIG. 7A, lanes 8, 13 and 15; CK1 isoforms CK1C. and NFAT kinase was not DYRK itself but rather a DYRK-asso CKle were included as positive controls in lanes 1 and 2). 40 ciated kinase, we tested bacterially-expressed recombinant PRKG 1 was expressed at equivalent or higher levels than DYRK1A and DYRK2 for in vitro phosphorylation of pep DYRK2 (FIG. 7A, bottom panel, lanes 8 and 13), but only tides corresponding to three conserved serine-rich motifs of DYRK2 could counter the dephosphorylation of NFAT-GFP NFAT1 phosphorylated in cells (SRR-1, SP-2 and SP-3 by calcineurin (FIG. 7B, lanes 3, 4:7, 8; 11, 12). IRAK4 was motifs). DYRK2 and DYRK1A both displayed strong and poorly expressed (FIG. 7A, bottom panel, lane 15); however 45 selective kinase activity towards the SP-3 motif of NFAT1, CD4+ Th1 cells isolated from IRAK4-/- mice showed nor but neither kinase phosphorylated an SP-3 peptide with mal NFAT1 dephosphorylation, rephosphorylation and Serd Ala substitutions in the specific serine residues known to nuclear transport compared to control cells. For these rea be phosphorylated in cells. At least 2 serine residues (bold sons, neither PRKG 1 nor IRAK4 were further investigated. and underlined) in the SP-3 motif (SPQRSRSPSPQP We focused on the role of DYRK-family kinases as direct 50 SPHVAPQDD) (SEQ ID NO. 34) fit the known sequence regulators of NFAT. Overexpression of DYRK2 maintained preference of DYRK kinases for serine/threonine residues NFAT-GFP in its phosphorylated form after ionomycin treat with arginine at the -2 or -3 position, and proline (or valine) ment (FIG. 7B, lanes 5-8); similarly, overexpression of wild at the +1 position’’, and both are known to be phosphory type (WT) DYRK2 but not a kinase-dead (KD) mutant of lated in cells (see FIG. 6A). Additional studies will be DYRK2, prevented NFAT nuclear localization in thapsigar 55 needed to establish whether the two other phosphorylated gin-treated cells. DYRK overexpression yielded a slower serine residues (underlined) in the SP-3 motif are targets for migrating form of NFAT (FIG. 7B, lanes 7, 8), leading to the DYRK or other NFAT kinases in vivo. concern that DYRK (a serine/proline-directed kinase) Phosphorylation at the SP-2 and SP-3 motifs are the pri phosphorylated SPRIEIT (SEQID NO: 33), the calcineurin mary determinants for upward mobility shift of phosphory docking sequence on NFAT1, preventing NFAT:cal 60 lated NFAT1, and we have shown here and previously that cineurin interaction. However, DYRK2 inhibited the ionomy they are phosphorylated by GSK3 and DYRK, respectively. cin-induced dephosphorylation of NFAT-GFP containing a Because DYRK kinases have been reported to prime for SPRIEITPS (SEQ ID NO:53)>HPVIVITGP (SEQ ID NO: GSK3-mediated phosphorylation of protein-synthesis initia 54) (VIVIT) (SEQID NO:30) substitution'', which elimi tion factor eIF2Be and the microtubule-associated protein nates the SP and TP sequences that could be targeted by 65 tau, we asked whether DYRK kinases could similarly prime DYRK. The ability of DYRK to inhibit dephosphorylation of for GSK3-mediated phosphorylation of NFAT. The SP2 motif the VIVIT (SEQ ID NO:30)-substituted NFAT-GFP is par of NFAT1 can be phosphorylated by GSK3', and GSK3 US 9,163,078 B2 57 58 recognition of the target sequence requires a priming phos signal transduction pathways, although they are often tran phorylation that can be mediated by PKA. In contrast to the sient and difficult to detect at endogenous levels of expres strong priming by PKA, neither DYRK2 nor DYRK1A could sion. efficiently prime for phosphorylation of the SP-2 motif by Discussion GSK3. We have shown that genome-wide RNAi screening in As DYRK2 phosphorylated only the SP-3 motif of NFAT Drosophila is a valid and powerful strategy for exploring in vitro, and because it was not a priming kinase for GSK3 at novel aspects of signal transduction in mammalian cells, pro the SP-2 motif, we expected that it would cause only half the vided that key members of the signaling pathway are evolu expected mobility shift of NFAT1 when expressed in cells. tionarily conserved and represented in the Drosophila However, overexpression of DYRK2 resulted in complete 10 genome. We have used the method to identify conserved regulators of the purely vertebrate transcription factor, NFAT: phosphorylation of NFAT1 (FIG. 7B). To resolve this para to our knowledge, this is the first example of a genome-wide dox, we asked whether prior phosphorylation of the entire RNAi screen that crosses evolutionary boundaries in this NFAT regulatory domain by DYRK would facilitate further manner. The strategy was successful because Drosophila phosphorylation by GSK3. The GST-NFAT1(1-415) fusion 15 developed an evolutionary niche that was later used by Ca"- protein was prephosphorylated to completion by PKA or regulated NFAT proteins when they emerged in vertebrates. DYRK2 using the recombinant kinases, then washed and Using this approach we have identified DYRK as a novel incubated briefly (45 min) in the absence or presence of physiological regulator of NFAT, and the first SP-3 motif recombinant GSK3 and radiolabelled Y-‘P ATP. As shown directed kinase. It is likely that conserved aspects of the previously, GSK3 does not phosphorylate GST-NFAT1 (1- regulation of other mammalian processes will also be suc 415) without priming, but does phosphorylate after pre-phos cessfully defined by developing assays in Drosophila cells. phorylation with either PKA or DYRK2. Pre-phosphoryla Our data suggest that DYRK regulates NFAT phosphory tion with DYRK2 caused an upward mobility shift of the lation by a mechanism in which DYRK phosphorylates the GST-NFAT1(1-415) substrate as judged by Coomassie blue NFAT regulatory domain within the conserved SP-3 motif, staining, as expected from the fact that DYRK2 phosphory 25 and thereby facilitates further phosphorylation of the NFAT lates the SP-3 motif moreover, pre-phosphorylation with regulatory domain by GSK3. A similar sequential mechanism DYRK2 yielded a radioactive GSK3-phosphorylated band of may regulate progressive dephosphorylation of NFAT, slower mobility compared to the band observed after pre whereby dephosphorylation of the SRR-1 motif promotes phosphorylation with PKA. These results suggest that while dephosphorylation of the SP-2 and SP-3 motifs by increasing PKA primes for GSK3 by phosphorylating the fourth serine 30 their accessibility to calcineurin. It is likely that class II (bold) in the SP-2 motif (SPRTSPIMSPRTSLAED) (SEQID DYRKs (DYRK2, 3 and 4) which are localized to the cyto NO: 35) and permitting processive N-terminal phosphoryla plasm, function primarily as “maintenance” kinases that tion of the underlined serines by GSK3, while DYRK2 poten sustain the phosphorylation status of cytoplasmic NFAT in tiates GSK3-mediated phosphorylation of the regulatory resting cells, whereas class I DYRKs (DYRK1A and 1B). 35 which are localized to the nucleus, re-phosphorylate domain motif by phosphorylating a separate motif, the SP-3 nuclear NFAT and promote its nuclear export. Notably, motif. Indeed, the serine targeted by PKA in the SP-2 motif is DYRK1A and the endogenous calcineurin regulator RCN/ not found phosphorylated in cells", providing further evi DSCR1/calcipressin-1 are both localized to the Down Syn dence for physiological regulation of NFAT by DYRK. drome Critical Region on chromosome 21. Thus overexpres We asked whether DYRK expression regulated the tran 40 sion of these negative regulators of NFAT in Down Syndrome scriptional activity of NFAT utilizing the kinase-dead mutant could contribute, by inhibiting NFAT activation, to the severe of DYRK2 as an inhibitor of DYRK activity in cells''. neurological and immune developmental defects associated Jurkat T cells were co-transfected with an IL-2 promoter with chromosome 21 trisomy. driven luciferase reporter plasmid and increasing amounts of expression plasmids for either wildtype (WT) or kinase-dead 45 REFERENCES (KD) DYRK2: one day later, the cells were stimulated for 6h with PMA and ionomycin and reporter activity was mea 1. Rao, A., Luo, C. & Hogan, P. G. Transcription factors of the sured. WT DYRK2 strongly diminished NFAT-dependent NFAT family: regulation and function. Annu Rev Immunol activity, while the KD mutant behaved as an inhibitor by 15, 707-47 (1997). increasing NFAT-dependent luciferase activity at higher con 50 2. Crabtree, G. R. & Olson, E. N. NFAT signaling: choreo centrations (FIG. 8A). Similar results were obtained using graphing the social lives of cells. Cell 109 Suppl. S67-79 luciferase reporters containing tandem copies of the ARRE2 (2002). NFAT:AP-1 site of the IL-2 promoter as well as the K3 site 3. Hogan, P. G., Chen, L., Nardone, J. & Rao, A. Transcrip of the TNFC. promoter. In related experiments expression tional regulation by calcium, calcineurin, and NFAT. WT DYRK2 also diminished, the production of endogenous 55 Genes Dev 17, 2205-32 (2003). IL-2 by stimulated Jurkat T cells in a dose-dependent manner 4. Salazar, C. & Hofer, T. Allosteric regulation of the tran while KD DYRK2 again had an inhibitory effect, when scription factor NFAT1 by multiple phosphorylation sites: expressed at high concentrations, by increasing IL-2 produc a mathematical analysis. J Mol Biol 327, 31-45 (2003). tion under these conditions (FIGS. 8B, 8C). Furthermore, we 5. Salazar, C. & Hofer, T. Activation of the transcription factor detected endogenous DYRK2 co-immunoprecipitating with 60 NFAT1: concerted or modular regulation? FEBS Lett579, HA-NFAT1 stably expressed at low endogenous levels in a 621-6 (2005). Jurkat cell line; in this respect DYRK may resemble the 6. Feske, S., Okamura, H., Hogan, P. G. & Rao, A. Ca2+/ SRR-1 kinase CK1, which forms a stable complex with NFAT calcineurin signalling in cells of the immune system. Bio under resting conditions but dissociates following activa chem Biophys Res Commun 311, 1117-32 (2003). tion'. A DYRK-NFAT interaction supports the hypothesis 65 7. Beals, C. R., Sheridan, C.M., Turck, C.W., Gardner, P. & that DYRK is a physiological NFAT kinase: kinase-substrate Crabtree, G. R. Nuclear export of NF-ATc enhanced by interactions of this type are known to be critical in many other glycogen synthase kinase-3. Science 275, 1930-4 (1997). US 9,163,078 B2 59 60 8. Zhu, J. et al. Intramolecular masking of nuclear import potential role for DYRK as a glycogen synthase kinase signal on NF-AT4 by casein kinase I and MEKK1. Cell 93, 3-priming kinase. Biochem J 355, 609-15 (2001). 851-61 (1998). 30. Kentrup, H. et al. Dyrk, a dual specificity protein kinase 9. Okamura, H. et al. Concerted dephosphorylation of the with unique structural features whose activity is dependent transcription factor NFAT1 induces a conformational on tyrosine residues between subdomains VII and VIII. J switch that regulates transcriptional activity. Mol Cell 6, Biol Chem 271, 3488-95 (1996). 539-50 (2000). 31. Wiechmann, S. et al. Unusual function of the activation 10. Okamura, H. et al. A conserved docking motif for CK1 loop in the protein kinase DYRK1A. Biochem Biophys binding controls the nuclear localization of NFAT1. Mol Res Commun 302, 403-8 (2003). Cell Biol 24, 4184-95 (2004). 10 11. Macian, F., Lopez-Rodriguez, C. & Rao, A. Partners in 32. Macian, F., Garcia-Rodriguez, C. & Rao, A. Gene expres transcription: NFAT and AP-1. Oncogene 20, 2476-89 sion elicited by NFAT in the presence or absence of coop (2001). erative recruitment of Fos and Jun. Embo J 19, 4783-95 12. Boutros, M. et al. Genome-wide RNAi analysis of growth (2000). and viability in Drosophila cells. Science 303, 832-5 15 33. Esensten, J. H. et al. NFAT5 binds to the TNF promoter (2004). distinctly from NFATp, c. 3 and 4, and activates TNF 13. Kiger, A. A. et al. A functional genomic analysis of cell transcription during hypertonic stress alone. Nucleic Acids morphology using RNA interference. J Biol 2, 27 (2003). Res 33,3845-54 (2005). 14. Echard, A., Hickson, G. R. Foley, E. & O’Farrell, P. H. 34. Johnson, S.A. & Hunter, T. Kinomics: methods for deci Terminal cytokinesis events uncovered after an RNAi phering the kinome. Nat Methods 2, 17-25 (2005). screen. Curr Biol 14, 1685-93 (2004). 35. Bhattacharyya, A. & Svendsen, C. N. Human neural stem 15. Yeromin, A. V., Roos, J., Stauderman, K. A. & Cahalan, cells: a new tool for studying cortical development in M. D. A store-operated calcium channel in Drosophila S2 Down's syndrome. Genes Brain Behav 2, 179-86 (2003). cells. J Gen Physiol 123, 167-82 (2004). 36. Brizuela, L., Richardson, A., Marsischky, G. & Labaer, J. 16. Myers, E. W. et al. A whole-genome assembly of Droso 25 The FLEXGene repository: exploiting the fruits of the phila. Science 287, 2196-204 (2000). genome projects by creating a needed resource to face the 17. Aramburu, J. et al. Affinity-driven peptide selection of an challenges of the post-genomic era. Arch Med Res 33, NFAT inhibitor more selective than cyclosporin A. Science 318-24 (2002). 285,2129-33 (1999). 37. Arziman, Z., Horn, T. & Boutros, M. E-RNAi: a web 18. Roderick, H. L. & Bootman, M. D. Calcium influx: is 30 application to design optimized RNAi constructs. Nucleic Homer the missing link? Curr Biol 13, R976-8 (2003). 19. Kim, E. & Sheng, M. PDZ domain proteins of synapses. Acids Res 33, W582-8 (2005). Nat Rev Neurosci 5, 771-81 (2004). 38. Yu, H. et al. Annotation transfer between genomes: pro 20. Roos, J. et al. STIM1, an essential and conserved compo tein-protein interologs and protein-DNA regulogs. nent of store-operated Ca2+ channel function. J Cell Biol 35 Genome Res 14, 1107-18 (2004). 169, 435-45 (2005). 39. Remm, M. & Sonnhammer, E. Classification of trans 21. Liou, J. et al. STIM is a Ca2+ sensor essential for Ca2+- membrane protein families in the Caenorhabditis elegans store-depletion-triggered Ca2+ influx. Curr Biol 15, 1235 genome and identification of human orthologs. Genome 41 (2005). Res 10, 1679-89 (2000). 22. Zhang, S. L. et al. STIM1 is a Ca(2+) sensor that activates 40 40. Notredame, C., Higgins, D.G. & Heringa, J. T-Coffee: A CRAC channels and migrates from the Ca(2+) store to the novel method for fast and accurate multiple sequence plasma membrane. Nature 437,902-5 (2005). alignment. J Mol Biol 302, 205-17 (2000). 23. Clipstone, N. A., Fiorentino, D. F. & Crabtree, G. R. 41. Storm, C. E. & Sonnhammer, E. L. Automated ortholog Molecular analysis of the interaction of calcineurin with inference from phylogenetic trees and calculation of drug-immunophilin complexes. J Biol Chem 269,26431-7 45 orthology reliability. Bioinformatics 18, 92-9 (2002). (1994). 42. Ogawa, H., Ishiguro, K., GaubatZ, S. Livingston, D.M. & 24. Kannan, N. & Neuwald, A. F. Evolutionary constraints Nakatani, Y. A complex with chromatin modifiers that associated with functional specificity of the CMGC protein occupies E2F- and Myc-responsive genes in G0 cells. Sci kinases MAPK, CDK, GSK, SRPK, DYRK, and ence 296, 1132-6 (2002). CK2alpha. Protein Sci 13, 2059-77 (2004). 50 43. Grynkiewicz, G., Poenie, M. & Tsien, R.Y. A new gen 25. Becker, W. & Joost, H. G. Structural and functional char acteristics of Dyrk, a novel subfamily of protein kinases eration of Ca2+ indicators with greatly improved fluores with dual specificity. Prog Nucleic Acid Res Mol Biol 62, cence properties. J Biol Chem 260, 3440-50 (1985). 1-17 (1999). EXAMPLE 3 26. Lochhead, P. A., Sibbet, G., Morrice, N. & Cleghon, V. 55 Activation-loop autophosphorylation is mediated by a novel transitional intermediate form of DYRKs. Cell 121, Table I 925-36 (2005). 27. Himpel, S. et al. Specificity determinants of substrate List of candidates that were positive in the secondary recognition by the protein kinase DYRK1A. J Biol Chem 60 screen, classified into the categories in Table I. The first 275,2431-8 (2000). column indicates whether or not the candidate was retested in 28. Campbell, L. E. & Proud, C. G. Differing substrate speci the confirmatory screen (NT, not tested); if tested, the ficities of members of the DYRK family of arginine-di Summed localization score from 3 separate experiments is rected protein kinases. FEBS Lett 510, 31-6 (2002). shown (see Methods). Other columns list gene names, Fly 29. Woods, Y. L. et al. The kinase DYRK phosphorylates 65 base numbers, and human orthologues as obtained from protein-synthesis initiation factor eIF2Bepsilon at Ser539 Homologene (for the kinase category, the phylogenetic analy and the microtubule-associated protein tau at Thr212: sis described in Methods was used in addition), and number US 9,163,078 B2 61 62 of predicted off-targets with exact match of 21-nt, 37 candi equivalent inhibition (-70%) of NFAT nuclear localization, dates with >10 off-targets are not listed. even though CanB is barely expressed while CanB2 is expressed at high levels. This is most likely due to the fact that Table II CanB and CanB2 are reciprocal off-targets, with 20 nt overlap 5 in their respective amplicons DRSC 18449 and DRSC07355. Analysis of expression, RNAi phenotype in thapsigargin- Table IV treated cells, and amplicon off-targets for calcineurin Sub- a) units and related proteins. Expression level of the subunits in Amplicon off-targets for selected candidates that were S2R- cells was estimated by RT-PCR analysis, and the effect evaluated in additional experiments. Scores of the candidates of their depletion on NFAT nuclear localization in thapsigar- in the confirmatory Screen, evaluating the effects of their gin (TG)-treated cells was evaluated (+++, strong inhibition; RNAi-mediated depletion on NFAT nuclear accumulation in -, no inhibition). The DRSC amplicons targeting each of the resting cells, are shown (taken from Table I). For each candi subunits were analyzed for predicted off-targets with exact date with positive DRSC amplicons, predicted off-targets matches of 21-, 20-, or 19-int as described in Methods. with exact matches of 21-, 20-, or 19-int are listed. Description Description of the off-targets is provided in Table III. Red of the off-targets is provided below. Red indicates off-targets indicates off-targets belonging to the same family as the pri- belonging to the same family as the primary targets that were mary targets. positive in the initial Screen. Of the three isoforms of calcineurin A, the amplicon for The amplicon corresponding to the GSK3 homologue sgg CanA1 and one amplicon each for Pp2b-14D and CanA-14F (DRSC18832) gave the highest score but also has a high show no predicted off-targets. CanA1 is poorly expressed and ' number of off-targets. None of these off-targets corresponds its depletion does not inhibit NFAT nuclear translocation, to gskt (DRSC 14056), which gave a low score of 1 in the while Pp2B-14D and CanA-14F are both expressed and primary Screen. depletion of either isoform results in strong inhibition of The amplicon corresponding to the highest-scoring CK1 NFAT nuclear translocation. family membergish has no predicted off-targets, indicating Why does depletion of the moderately expressed isoform ' that it represents a bonafide regulator of NFAT. Clear cross CanA-14F give similar inhibition as depletion of the more inactivation exists for amplicons DRSC16929, DRSC20231 highly expressed isoform Pp2B-14D? Different methods and DRSC19863, corresponding to the CK1 isoforms dco, have different sensitivities, and while the eye is able to discern CK1alpha/CG2028 and CG2577, each of which has a posi subtle changes in the nuclear localization of NFAT, such tive localization score of 1. Further work is necessary to visual estimates are not as quantitative as (for instance) esti- ' determine whether the scores associated with the other iso mating extent of dephosphorylation by western blotting. forms reflect expression levels of the isoforms, off-target Of the three isoforms of calcineurin B, two (CanB and effects, or both. CanB2) are strongly related to mammalian calcineurin B We are fortunate that for the two candidates—DYRK and while CG32812 is more distantly related, resembling mam- STIM—that we focused on for this study, there are no pre malian CHP. RNAi against either CanB or CanB2 gave dicted off-targets for exact matches of either 21, 20 or 19 nt. TABLE 1

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) PHOSPHATASES 5 Ptip FBgn0039111 O PTPMT1 protein tyrosine phosphatase, mitochondrial 1 3 CanA1 FBgn0010015 O PPP3CC protein phosphatase 3 (formerly 2B), catalytic Subunit, gamma isoform 3 filw FBgn0000711 1 PPP1CB protein phosphatase 1, catalytic Subunit, beta isoform 3 PpD6 FBgn0005779 1 3 wob FBgn0027492 O PPP2RSE protein phosphatase 2, regulatory Subunit B (B56), epsilon isoform 1 CanB FBgn0010014 O PPP3R1 protein phosphatase 3 (formerly 2B), regulatory subunit B, 19 kDa, alpha isoform 1 Can B2 FBgn0015614 O PPP3R1 protein phosphatase 3 (formerly 2B), regulatory subunit B, 19 kDa, alpha isoform 1 CG32812 FBgn0025642 O LOC63928 hepatocellular carcinoma antigen gene 520, related to mammalian CHP O Pp2B-14D FBgn0011826 1 PPP3CB protein phosphatase 3 (formerly 2B), catalytic Subunit, beta isoform PROTEIN KINASES 6 Sgg FBgn0003371 3 GSK3B glycogen synthase kinase 3beta 5 CG7125 FBgn0038603 O PRKD protein kinase D 4 CG31640 FBgn0051640 O DDR 4 gish FBgn001 1253 O CSNK1G casein kinase 1, gamma 4 inaC FBgn0004784 O PRKCB1 protein kinase C, beta 1 3 CG12147 FBgn0037325 O CSNK1 casein kinase 1 family 3 CkIIalpha FBgn0000258 O CSNK2A12 casein kinase 2, alpha 3 pII FBgn00.10441 O RAK 2 CG2905, FBgn0004661 O TRRAP transformation/transcription domain Nipped-A associated protein 2 aPKC FBgn0022131 O PRKCI protein kinase C, iota US 9,163,078 B2 63 64 TABLE 1-continued

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) 2 CG11489 FBgn0025702 O SRPK1 SFRS protein kinase 1 2 CG32687 FBgn0052687 O LOC116064 hypothetical protein LOC116064 2 CG6498 FBgn0036511 O MAST2 microtubule associated serine/threonine kinase 2 2 CGT097 FBgn0034421 O MAP4K3 mitogen-activated protein kinase kinase kinase kinase 3 2 I(1)GO148 FBgn0028360 O CDC7 CDC7 cell division cycle 7 2 Pkc53E FBgn0003091 O PRKCA protein kinase C, alpha 2 Pkcdelta FBgn0030387 O PRKCD protein kinase C, delta 2 polo FBgn0003124 O PLK1 polo-like kinase 1 2 trc FBgn0003744 O STK38, STK38L serine/threonine kinase 38 like CG4O478 FBgn0069975 O DYRK dual-specificity tyrosine-(Y)-phosphorylation regulated kinase CG2577 FBgn003.0384 3 CSNK casein kinase 1 family CG4168 FBgn0028888 O CGS483 FBgn0038816 O CGAO94 FBgn0032650 O CSNK casein kinase 1 family CkIalpha FBgn0015024 3 CSNK1A1 casein kinase 1, alpha 1 Cks FBgn00.10314 O CKS1B CDC28 protein kinase regulatory subunit 1B dco FBgn0002413 O CSNK1 D, E casein kinase 1, delta epsilon for FBgn0000721 2 PRKG protein kinase, c0MP-dependent, type I gskt FBgn0046332 O GSK3A phl FBgn0003079 2 BRAF v-raf murine sarcoma viral oncogene homolog B1 Pk61C FBgn0020386 O PDPK 3-phosphoinositide dependent protein kinase 1 Pkc.98E FBgn0003093 O PRKCE protein kinase C, epsilon Tie FBgn0014073 4 O CG11533 FBgn0039908 O O CG9962 FBgn0031441 O CSNK casein kinase 1 family O CG10579 FBgn0005640 O ALS2CR7, PFTK1 PFTAIRE protein kinase 1 O png FBgn000O826 O NT CG17698 FBgn004.0056 O CAMKK2 calcium calmodulin-dependent protein kinase kinase 2, beta NT gek FBgn0023081 O CDC428PA, B CDC42 binding protein kinase alpha (DMPK ike) OTHERKINASES KINASE-RELATED 1 Pi3K59F FBgn0015277 O PIK3C3 phosphoinositide-3-kinase, class 3 O CG8298 FBgn0033673 O O Pok FBgn0017558 O PDK3 pyruvate dehydrogenase kinase, isoenzyme 3 NT CG3809 FBgn0037995 O NT CG6218 FBgn0038321 O NAGK N-acetylglucosamine kinase NT CG-6364 FBgn0039179 O UCK2 uridine-cytidine kinase 2 NT dig FBgn0001624 8 DLG1 discs, large homolog 1 MISCELLANEOUS. CALCIUM RELATED

5 CG14387 FBgn0038,089 O 4 TpnC4 FBgn0033027 O 4 TpnC73F FBgn001.0424 O 3 Stim FBgn0045073 O STIM1 Stromal interaction molecule 1 3 Cam FBgn0000253 O CALM2 calmodulin 2 (phosphorylase kinase, delta) 3 CG11165 FBgn0033238 2 3 CG13898 FBgn0035161 O 2 norFA FBgn00.04625 O PLCB4 phospholipase C, beta 4 2 TpnC41C FBgn00.13348 O 2 TpnC47D FBgn001.0423 O 1 CG13526 FBgn0034774 O 1 CG31.345 FBgn0051345 O CAPSL calcyphosine-like 1 CG316SO FBgn0031673 O RCN2 reticulocalbin 2, EF-hand calcium binding domain 1 CG31958 FBgn0051958 2 1 CG31960 FBgn0051960 2 1 TpnC25D FBgn0031692 1 MEMBRANE SIGNALLING 5 CG6919 FBgn0038980 O HTR4 5-hydroxytryptamine (serotonin) receptor 4 4 CG3O340 FBgn0050340 O 4 DopR FBgn0011582 4 DRD1 dopamine receptor D1 4 Grafa FBgn0041242 O 4 Or8S FBgn0037594 O 4 Su(fu) FBgn0005355 O SUFU Suppressor of fused homolog (Drosophila) 3 Ac3 FBgn0023416 O ADCY3 adenylate cyclase 3 US 9,163,078 B2 65 66 TABLE 1-continued

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) 3 Gyc-89Db FBgn0038436 O 3 homer FBgn0025777 O HOMER2 homer homolog 2 3 8W FBgn0039914 O TGFB3 transforming growth factor, beta 3 3 PGRP-LE FBgn0030695 O PGLYRP3 peptidoglycan recognition protein 3 2 cenB1A FBgn0039056 O CENTB2 centaurin, beta 2 2 CG10823 FBgn0038880 O 2 CG11319 FBgn0031835 O DPP10 dipeptidylpeptidase 10 2 CG6989 FBgn0038063 O 2 fz3 FBgn0027343 O 2 N FBgn0004647 O NOTCH1 Notch homolog 1, translocation-associated 2 Plc21C FBgn00.04611 O PLCB1 phospholipase C, beta 1 (phosphoinositide specific) 2 pxb FBgn0053207 1 2 SOg FBgn0003463 O CHRD chordin 2 spz FBgn0003495 O 1 1Bw FBgn00.04364 O 1 CG16752 FBgn0029768 O 1 CG17262 FBgn0031499 O 1 Crag FBgn0025864 O MYCPBP c-myc promoter binding protein 1 Grip FBgn004.0917 O GRIP1 glutamate receptor interacting protein 1 1 nkd FBgn0002945 O 1 s FBgn0003416 O PLCG1 phospholipase C, gamma 1 O bm FBgn0000221 O B3GALT2 UDP-Gal:betaGlcNAc beta1,3- galactosyltransferase, polypeptide 2 O CG10747 FBgn0032845 O PLCXD2 phosphatidylinositol-specific phospholipase C, X domain containing 2 O CG31350 FBgn0051350 2 O fz2 FBgn0016797 O FZD8 frizzled homolog 8 O Rab-RP1 FBgn0015788 O RAB32 RAB32, member RAS oncogene family O skf FBgn0050021 O MPP7 membrane protein, palmitoylated 7 NT Alg10 FBgn0052076 O NT CG3O361 FBgn0050361 4 GRM4 glutamate receptor, metabotropic 4 NT rho-5 FBgn0041723 O NT Sema-1a FBgn001 1259 O SEMA6D sema domain, transmembrane domain (TM), and cytoplasmic domain, (Semaphorin) 6D NT sif FBgn0019652 O NT Syx1A FBgn00.13343 O STX1A Syntaxin 1A NT tinc FBgn0038554 O CATION CHANNELS AND TRANSPORTERS 5 CG13223 FBgn0033599 O SLC24A6 solute carrier family 24 (sodium/potassium calcium exchanger), member 6 5 CG14741 FBgn0037989 O ATP8B2 ATPase, Class I, type 8B, member 2 4 CG1046S FBgn0033017 O KCTD10 potassium channel tetramerisation domain containing 10 4 CG6737 FBgn0032294 O 4 Cng FBgn0014.462 O CNGA3 cyclic nucleotide gated channel alpha 3 4 GluRIA FBgn00.04620 O 4 inx6 FBgn0027107 O 4 Irk3 FBgn0032706 O 3 Ca-beta FBgn0015608 4 3 Ca-P60A FBgn0004551 O ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 3 CG1115S FBgn0039927 O GRIK3 glutamate receptor, ionotropic, kainate 3 3 CG216S FBgn0025704 O ATP2B3 ATpase, Ca++ transporting, plasma membrane 3 3 CG32792 FBgn0052792 O 3 CG3367 FBgn0029871 2 3 CG44SO FBgn0032113 O 3 CG6812 FBgn0036843 O SFXN2 sideroflexin 2 3 KaiRIA FBgn0028422 1 GRIA4 glutamate receptor, ionotrophic, AMPA 4 3 ppk21 FBgn0039675 O 3 trp FBgn0003861 O 2 Ca-alpha1D FBgn0001991 O CACNA1D calcium channel, voltage-dependent, L type, alpha 1D Subunit 2 Catx FBgn0013995 O SLC8A3 solute carrier family 8 (Sodium-calcium exchanger), member 3 2 CG12376 FBgn0033323 O SLC24A6 solute carrier family 24 (sodium/potassium calcium exchanger), member 6 2 CG12904 FBgn0033510 O KCNT2 potassium channel, Subfamily T, member 2 2 CG1698 FBgn0033443 1 2 CG31284 FBgn0051284 O US 9,163,078 B2 67 68 TABLE 1-continued

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) 2 CG31729 FBgn0051729 O ATP9B ATPase, Class II, type 9B 2 CG3822 FBgn0038837 O GRIK1 glutamate receptor, ionotropic, kainate 1 2 CG4536 FBgn0029904 5 2 CG9361 FBgn0037690 O KCNK9 potassium channel, Subfamily K, member 9 2 elk FBgn0011589 O KCNH8 potassium voltage-gated channel, Subfamily H (eag-related), member 8 2 Gluclalpha FBgn0024963 O GLRA3 glycine receptor, alpha 3 2 GluRIII FBgn0031293 O 2 Irk2 FBgn0039081 O KCNJ9 potassium inwardly-rectifying channel, subfamily J, member 9 2 KCNQ FBgn0033494 3 KCNQ5 potassium voltage-gated channel, KQT-like subfamily, member 5 2 nAcRalpha-34E FBgn0028875 O CHRNA7 cholinergic receptor, nicotinic, alpha polypeptide 7 2 nAcRalpha- FBgn0000036 O CHRNA3 cholinergic receptor, nicotinic, alpha 96Aa polypeptide 3 2 Nmdar1 FBgn0010399 1 GRIN1 glutamate receptor, ionotropic, N-methyl D aspartate 1 2 Ork1 FBgn0017561 O KCNK4 potassium channel, Subfamily K, member 4 2 sei FBgn0003353 O KCNH6 potassium voltage-gated channel, Subfamily H (eag-related), member 6 Ca-alpha1T FBgn002.9846 O C8C FBgn0005563 O CACNA1A calcium channel, voltage-dependent, P.O ype, alpha 1A subunit CG10830 FBgn0038839 O KCTD12 potassium channel tetramerisation domain containing 12 CG312O1 FBgn0051201 1 GRIA4 glutamate receptor, ionotrophic, AMPA 4 CG32770 FBgn0052770 O CG33298 FBgn0032120 O ATP1 OA ATPase, Class V, type 10A CG4O146 FBgn0039941 O CGS621 FBgn0038840 O CG8743 FBgn0036904 O MCOLN3 mucolipin 3 CG993S FBgn0039916 1 GRIA1 glutamate receptor, ionotropic, AMPA 1 eag FBgn0000535 O KCNH1 potassium voltage-gated channel, Subfamily H Glu-RIB FBgn0028431 1 GRIA2 glutamate receptor, ionotropic, AMPA 2 GluRIIB FBgn0020429 O Ir FBgn0039061 O KCNJS potassium inwardly-nectifying channel, subfamily J, member 5 I(2)O1810 FBgn00.10497 O nAcRalpha- FBgn0000039 1 CHRNA2 cholinergic receptor, nicotinic, alpha 96 Ab polypeptide 2 nAcRbeta-64B FBgn0000038 O CHRNA4 cholinergic receptor, nicotinic, alpha polypeptide 4 nAcRbeta-96A FBgn000411 B O CHRNB4 cholinergic receptor, nicotinic, beta polypeptide Nmdar2 FBgn0014.432 O GRIN2B glutamate receptor, ionotropic, N-methyl D aspartate 2B nompC FBgn0016920 O pain FBgn0060296 O Pk2 FBgn0041195 O PKD2L1 polycystic kidney disease 2-like 1 Sha FBgn0005564 O KCND3 potassium voltage-gated channel, Shal related subfamily, member 3 Sip1 FBgn0010620 O TFIP11 uflelin interacting protein 11 Sio FBgn0003429 O KCNMA1 potassium large conductance calcium activated channel, Subfamily M, alpha member 1 O Anktm1 (Trp-A1 FBgn0035934 O TRPA1 ransient receptor potential cation channel, subfamily A, member 1 O CG12455 FBgn0028859 O CACNA2D3 calcium channel, voltage-dependent, alpha 2. delta3 subunit O CG13762 FBgn0040333 1 PKD2L1 polycystic kidney disease 2-like 1 O CG14647 FBgn0037244 O KCTD9 potassium channel tetrameristation domain containing 9 O CG17922 FBgn0034656 O CNGB1 cyclic nucleotide gated channel beta 1 O CG32704 FBgn0052704 O O CG32810 FBgn0025394 O KCTDS potassium channel tetramerisation domain containing 5 O CG4301 FBgn0030747 O ATP11B ATPase, Class VI, type 11B O CG9472 FBgn0036874 O PKD1L3 polycystic kidney disease 1-like 3 O clumsy FBgn0026255 O GRIK2 glutamate receptor, ionotropic, kainste 2 O Cng FBgn0029090 3 O Glu-RI FBgn00.04619 O GRIA3 glutamate receptor, ionotrophic, AMPA 3 O Nickx30C FBgn0028704 O SLC24A2 solute carrier family 24 (sodium/potassium calcium exchanger), member 2 O Rya-rá4F FBgn00.11286 O RYR2 ryanodine receptor 2 (cardiac) US 9,163,078 B2 69 70 TABLE 1-continued

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) O Shab FBgn0003383 O KCNB1 potassium voltage-gated channel, Shab related subfamily, member 1 O SK FBgn0029761 O KCNN3 potassium intermediate small conductance calcium-activated channel, Subfamily N, member 3 O trpl FBgn0005614 O NT CG21.96 FBgn0039872 1 NT nAcRalpha-808 FBgn0037212 O OTHER TRANSPORTERS 3 ATPsyn-CI6 FBgn0016119 O 3 CG1599 FBgn0033452 O SYBL1 synaptobrevin-like 1 3 CG31116 FBgn0051116 O CLCN2 chloride channel 2 3 CG31,158 FBgn0051158 O 3 CG31305 FBgn0051305 O SLC25A1 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 3 CG6901 FBgn0038414 O 3 Mst84Db FBgn0004173 O 2 CG3860 FBgn0034.951 O OSBPL1A oxysterol binding protein-like 1A 2 CG3902 FBgn0036824 1 ACADSB acyl-Coenzyme A dehydrogenase, short branched chain 2 CG5127 FBgn0039335 O 2 CGA442 FBgn0037140 O 2 CGT578 FBgn0028538 O ARFGEF1 ADP-ribosylation factor guanine nucleotide exchange factor 1 2 CG927O FBgn0032908 O ABCC2 ATP-binding cassette, sub-family C (CFTR/MRP), member 2 1 CG31731 FBgn0028539 O 1 CG8389 FBgn0034063 O 1 rdgB FBgn0003218 O PITPNM2 phosphatidylinositol transfer protein, membrane-associated 2 1 W FBgn0003996 O O CG33214 FBgn0053214 O GLG1 golgi apparatus protein 1 O CGA458 FBgn0037144 O NT Beach1 FBgn0043362 O WDFY3 WD repeat and FYVE domain containing 3 NT CG12539 FBgn0030586 O NT CG14482 FBgn0034245 O NT CG14691 FBgn0037829 O SV2A synaptic vesicle glycoprotein 2A NT CG17119 FBgn0039045 O CTNS cystinosis, nephropethic NT CG18324 FBgn0033905 O SLC25A34 solute carrier family 25, member 34 NT CG3071 FBgn0023527 O UTP15 UTP15, U3 Small nucleolar ribonucleoprotein NT CG32230 FBgn0052230 O NT CG6142 FBgn0039415 O NT CGA181 FBgn0037097 O NT CGA830 FBgn0032015 O TUSC3 tumor suppressor candidate 3 NT CG9990 FBgn0039594 O NT Cyp49a1 FBgn0033524 O CYP27A1 cytochrome P450, family 27, Subfamily A, polypeptide 1 NT didum FBgn0015933 O MYOSA myosin VA (heavy polypeptide 12, myoxin) NT ERp.60 FBgn0033663 1 PDLA3 protein disulfide isomerase-associated 3 NT Pbprp2 FBgn00.11280 O NT Syx6 FBgn0037084 3 STX10 Syntaxin 10 MISCELLANEOUS. OTHER 6 Prosalpha7 FBgn0023175 O PSMA3 proteasome (prosome, macropain) subunit, alpha type, 3 5 CG3812 FBgn0030421 O AGPAT1 1-acylglycerol-3-phosphate O acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) 4 bif FBgn0014133 3 4 CG11727 FBgn0030299 O 4 CG2781 FBgn0037534 O ELOVL7 ELOVL family member 7, elongation of long chain fatty acids 4 CG4960 FBgn0039371 O C19Crf32 chromosome 19 open reading frame 32 4 CGA304 FBgn0036527 O GALNT11 UDP-N-acetyl-alpha-D- galactosamine:polypeptide N acetylgalactosaminyltransferase 11 (GalNAc T11) 4 CG8258 FBgn0033342 O CCT8 chaperonin containing TCP1, Subunit 8 (theta) 4 CRMP FBgn0023023 O DPYS dihydropyrimidinase 4 Eip63F-1 FBgn0004910 O 3 ActS7B FBgn0000044 5 ACTB actin, beta 3 CG11299 FBgn0034897 O SESN3 sestrin 3 US 9,163,078 B2 71 72 TABLE 1-continued

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) 3 CG6509 FBgn0032363 O DLGS discs, large homolog 5 3 CG9342 FBgn0032904 O MTP microsomal triglyceride transfer protein (large polypeptide, 88 kDa) 3 CG9467 FBgn0037758 O KCTD3 potassium channel tetrameristation domain containing 3 3 eIF-2beta FBgn0004926 O EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38 kDa 3 fao FBgn0011596 O MFN1 millofusin 1 3 prox FBgn0004596 O PROX1 proxpero-related homeobox 1 3 Su(var)3-9 FBgn0003600 O EIF2S3 eukaryotic translation initiation factor 2, Subunit 3 gamma, 52 kDa 2 14-3-3epsilon FBgn0020238 O YWHAE tyrosine 3-monoxygenase? tryptophan 5 monooxygenase activation protein, epsilon polypeptid 2 80 FBgn0000022 3 ASCL2 achaele-acute complex-like 2 2 Arpé6B FBgn0011744 O ACTR3 ARP3 actin-related protein 3 homolog 2 CG10069 FBgn0034611 O SLC37A2 solute carrier family 37 (glycerol-3- phosphate transporter), member 2 2 CG11600 FBgn0038068 1 2 CG11608 FBgn0038069 O LIPL3 lipase-like, ab-hydrolase domain containing 3 2 CG14625 FBgn0040358 4 2 CG2678 FBgn0014931 O 2 CG3074 FBgn0034709 O TINAGL1 tubulointerstitial nephritis antigen-like 1 2 CG3263S FBgn0052635 1 2 CG4448 FBgn0039067 O 2 CG5278 FBgn0038986 3 2 CGS8O2 FBgn0038863 O SLC3SB1 solute carrier family 35, member B1 2 CGA140 FBgn0037147 O 2 RadS1D FBgn0030931 O XRCC2 X-ray repair complementing defective repair in Chinese hamster cells 2 Ce FBgn0034443 O CG-6330 FBgn0039464 O UPP2 uridine phosphorylase 2 CGT568 FBgn0039673 O WDR69 WD repeat domain 69 CG9326 FBgn0032885 O MPP6 membrane protein, pelmitoylated 6 (MAGUK p55 subfamily member 6) CG9784 FBgn0030761 O PIBSPA phosphatidylinositol (4,5) bisphosphate 5 phosphatase, A ClC FBgn0000338 O eIF2B-beta FBgn0024996 O EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39 kDa gammaTub23C FBgn0004176 O TUBG1 tubulin, gamma 1 Hn FBgn0001208 O PAH phenylalanine hydroxylase Pgantiš5A FBgn0001970 O GALNT11 UDP-N-acetyl-alpha-D- galactosamine:polypeptide N acetylgalactosaminyltransferase 11 (GalNAc T11) pgantA FBgn0051956 O skip A FBgn0025637 1 LOC4O1713 organ of Corti protein 2: RNA polymerase II elongation factor-like protein OCP2; cyclin ACDK2-associated p19 O CG15408 FBgn0031523 O O CG4SOO FBgn0028519 O ACSBG1 acyl-CoA synthetase bubblegum family member 1 O CGA348 FBgn0036940 O O CG9647 FBgn0035729 O O D FBgn0000411 1 O nahode FBgn0034797 O O Pode6 FBgn0038237 O PDE11A phosphodiesterase 11A O sdt FBgn0003349 1 MPP5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) O TSG101 FBgn0036666 O TSG101 tumor Susceptibility gene 101 NT Aats-cys FBgn0027091 O CARS cysteinyl-tRNA synthetase NT Aats-met FBgn0027083 O MARS2 methionine-tRNA synthetase 2 NT Acp70A FBgn0003034 O NT Act,9B FBgn0000045 5 ACTG2 actin, gamma 2, Smooth muscle, enteric NT Ahcy13 FBgn0014455 O AHCY S-adenosylhomocysteine hydrolase NT 8Ol FBgn0023179 O PCSK2 proprotein convertase Subtilisinkexin type 2 NT asparagine- FBgn0041607 O synthetase NT ATbp FBgn0039946 5 NT BEAF-32 FBgn0015602 O NT beat-Ic FBgn0028644 8 NT beat-Vb FBgn0038092 O NT Bin1 FBgn0024491 O SAP18. sin3-associated polypeptide, 18 kDa NT BM-40-SPARC FBgn0026562 O SPARCL1 SPARC-like 1 (mast9, hevin) NT btsz FBgn0010940 O US 9,163,078 B2 73 74 TABLE 1-continued

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) NT bwa FBgn0045064 O ASAH3L N-acylsphingosine amidohydrolase 3-like NT CG101.68 FBgn0039087 O NT CG11107 FBgn0033160 O DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 NT CG12162 FBgn0037329 O POLDIP2 polymerase (DNA-directed), delta interacting protein 2 NT CG13643 FBgn0040601 O NT CG13779 FBgn004.0954 O NT CG14869 FBgn0038341 O NT CG15105 FBgn0034412 O NT CG1571 FBgn0029993 O DNAI2 dynein, axonemal, intermediate polypeptide 2 NT CG16710 FBgn0039101 O NT CG16857 FBgn0028482 O NT CG17294 FBgn0032032 O HDHD2 haloacid dehalogenase-like hydrolase domain containing 2 NT CG17826 FBgn0036227 O FBN2 fibrillin 2 (congenital contractural arachnodactyly) NT CG18493 FBgn0038701 O NT CG2051 FBgn0037376 O HAT1 histone acetyltransferase 1 NT CG3066 FBgn0037515 O NT CG31115 FBgn0051115 O MTAP methylthioedenosine phosphorylase NT CG31159 FBgn0051159 O GFM2 G elongation factor, mitochondrial 2 NT CG31224 FBgn0051224 O NT CG31287 FBgn0051287 O NT CG31453 FBgn0051453 O TRIP13 thyroid hormone receptor interactor 13 NT CG31716 FBgn0051716 O NT CG32284 FBgn0052284 O NT CG3231 FBgn0027522 O RBBP6 retinoblastoma binding protein 6 NT CG32557 FBgn0052557 O NT CG32700 FBgn0052700 O NT CG32727 FBgn0052727 O DNAJC15 DnaJ (Hsp40) homolog, subfamily C, member 15 NT CG33100 FBgn0053100 O EIF4E2 eukaryotic translation initiation factor 4E member 2 NT CG.3356 FBgn0034989 O UBE3C ubiquitin protein ligase E3C NT CG36OS FBgn0031493 O SF382 splicing factor 3b, subunit 2, 145 kDa NT CG3554 FBgn0036004 O NT CG-3700 FBgn0034796 1 TMPRSS9 ransmembrane protease, serine 9 NT CG3940 FBgn0037788 O NT CG4O17 FBgn0032143 O CPB1 carboxypeptidase B1 NT CG4030 FBgn0034585 O RABEP1 rabaptin, RAB GTPase binding effector protein 1 NT CG4O90 FBgn0038492 1 NT CG4291 FBgn0031287 O WBP4. WW domain binding protein 4 (formin binding protein 21) NT CG43O2 FBgn0027073 O UGT2B10, UGT2B11, UDPglucuronosyltransferase 2 family, UGT2B28 polypeptide B10, B11, B28 NT CG4653 FBgn0030776 O NT CG4747 FBgn0043456 O N-PAC cytokine-like nuclear factorn-pac NT CG4851 FBgn0032358 O PPT2 palmitoyl-protein thioesterase 2 NT CG4901 FBgn0032.194 O DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 NT CGS103 FBgn0036784 O TKT ransketolase (Wernicke-Korsakoff syndrome) NT CGS122 FBgn0032471 O NT CGS191. FBgn0038803 O NT CG5587 FBgn0036780 O LOC28.3871 hypothetical protein LOC28.3871 NT CG5715 FBgn0039180 O NT CG6041 FBgn0029826 1 TMPRSS9 ransmembrane protease, serine 9 NT CG6656 FBgn0038912 O NT CG6717 FBgn0031924 O SERPIN85 serpin peptidase inhibitor, clade 8 (ovalbumin), member 5 NT CG6763 FBgn0039069 1 NT CGS764 FBgn0037899 O C1 Sorf15 chromosome 15 open reading frame 15 NT CG6841 FBgn0036828 O C20orf14 chromosome 20 open reading frame 14 NT CG6906 FBgn0036261 O NT CG6937 FBgn0038989 O MKI67IP MKI67 (FHA domain) interacting nucleoter phosphoprotein NT CGTO17 FBgn0036951 O NT CGA290 FBgn0036949 O NT CGA928 FBgn0039740 O NT CG8117 FBgn0030683 O TCEA2 transcription elongation factor A (SII), 2 NT CG922O FBgn0030662 O CHSY1 carbohydrate (chondroitin) synthase 1 NT CG8383 FBgn0037697 O NT CG952O FBgn0032078 O C1GALT1 core 1 synthase, glycoprotein-N- acetylgalactosamine 3-beta galactosyltransferase, 1 US 9,163,078 B2 75 76 TABLE 1-continued

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) NT CG9535 FBgn0027501 O UAP1 UDP-N-acteylglucosamine pyrophosphorylase 1 NT CG9550 FBgn0029939 2 NT CG9843 FBgn0037237 O NT CG9947 FBgn0030752 O TMEM3OA transmembrane protein 30A NT comm3 FBgn0053209 O NT CtBP FBgn0020496 1 CTBP1 C-terminal binding protein 1 NT dbo FBgn0040230 O KLHL20 kelch-like 20 (Drosophila) NT Dhfr FBgn0004087 O DHFR dihydrofolate reductase NT dmirt11E FBgn0030477 2 NT drm FBgn0024244 O NT eas1 FBgn0010110 1 NT (C FBgn0025376 1 NT Eflalpha100E FBgn0000557 1 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 NT af FBgn0005632 O USP9X ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila NT op FBgn0032820 O FBP1 fructose-1,6-bisphosphatase 1 NT red FBgn0051774 O NT GSDS FBgn0010041 5 NT GSE2 FBgn0063498 O NT Hand FBgn0032209 O HAND2 heart and neural crest derivatives expressed 2 NT HGTX FBgn004.0318 O NKX6-1 NK6 transcription factor related, locus 1 NT Hsp608 FBgn001 1244 O NT (2)k05713 FBgn0022160 O GPD2 glycerol-3-phosphate dehydrogenase 2 NT (3)LX-14 FBgn0002478 O LMLN leishmanolysin-like (metallopeptidase MB family) NT Ota FBgn00.0583.0 2 LOC441636 similar to Submaxillary apomucin NT Map60 FBgn0010342 O NT Mes-4 FBgn0039559 O WHSC Wolf-Hirschhom syndrome candidate 1 NT Mgaf2 FBgn0039738 O MGAT2 mannosyl (alpha-1,5-)-glycoprotein beta-1,2- N-acetylglucosaminyltransferase NT mol FBgn0028528 O NIP homolog of Drosophila Numb-interacting protein NT mre 11 FBgn0020270 O MRE11A MRE 11 meiotic recombination 11 homolog A NT mRpL15 FBgn0036990 1 MRPL15 mitochondrial ribosomal protein L15 NT mRpL2a FBgn0037833 O MRPL37 mitochondrial ribosomal protein L37 NT nbs FBgn0026198 1 NBN nibrin NT NfI FBgn0042696 O NFLA nuclear factor IA NT OS FBgn0002962 2 NOS1 nitric oxide synthase 1 NT Odc1 FBgn00.13307 O ODC1 ornithine decarboxylase 1 NT Peb FBgn0004181 O PRB1, PRB2 proline-rich protein BstNISubfamily 1, proline rich protein BstNISubfamily 2 NT PH4alphaEFB FBgn0039776 O P4HA1 procollagen-proline, 2-oxoglutarate 4 dioxygenase (proline 4-hydoxylase), alpha polypeptide I NT Phax FBgn0033380 O RNUXA RNAU, Small nuclear RNA export adaptor NT ple FBgn0005626 O TH tyrosine hydroxylase NT Rb97D FBgn0004903 2 LOC144983 heterogeneous nuclear ribonucleoprotein A1 like NT Rbp2 FBgn0010256 O WBSCR1 Williams-Beuren syndrome chromosome region 1 NT RI1 FBgn0019938 O POLR1A polymerase (RNA) I polypeptide A NT RpL10Aa FBgn0038281 O RPL10A ribosomal protein L10a NT RS1 Ob FBgn0031035 O RPS10 ribosomal protein S10 NT Rrp1 FBgn0004584 O APEX1 APEX nuclease (multifunctional DNA repair enzyme)1 NT Salr FBgn0000287 O SALL3 sal-like 3 NT SC8 FBgn0015541 1 ARTS-1 type 1 tumor necrosis factor receptor Shedding aminopeptidase regulator NT SF1 FBgn0025571 O SF1 splicing factor 1 NT shn FBgn0003396 O NT Sirt2 FBgn0038788 O SIRT2 sirtuin (silent mating type information regulation 2 homolog) 2 NT SnRNP69D FBgn0016940 O SNRPD1 Small nuclear ribonucleoprotein D1 polypeptide 16 kDa NT Spn43Ab FBgn0024293 O NT Spt3 FBgn0037981 1 NT Sqd FBgn0003498 O NT ST6Gal FBgn0035.050 O ST6GAL2 ST6 beta-galactosamide alpha-2,6- sialyltranferase 2 NT Stau FBgn0003520 O STAU staufen, RNA binding protein NT stich1 FBgn0016941 1 NT Sw FBgn0004648 O CPD carboxypeptidase D NT T3d FBgn0017482 1 ADHFE1 alcohol dehydrogenase, iron containing, 1 NT Tcp1 FBgn0051953 O TDP1 tyrosyl-DNA phosphodiesterase 1 US 9,163,078 B2 77 78 TABLE 1-continued

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) NT tth FBgn0030502 5 NT Ugt86Dd FBgn0040256 O NOVEL

5 CG17142 FBgn0035112 O 4 CG14O76 FBgn0036829 O 4 CG14870 FBgn0038342 O EPPB9 B9 protein 4 CG31145 FBgn0051145 O FAM2OC family with sequence similarity 20, member C 4 CG312O3 FBgn0051203 O 4 CG31288 FBgn0051288 O 4 CG4585 FBgn0025335 O 4 CGT706 FBgn0038640 O SLC4A1AP solute carrier family 4 (anion exchanger), member 1, adaptor protein 4 Osi10 FBgn0037417 O 3 CG14084 FBgn0036855 O 3 CG14556 FBgn0039413 O 3 CG14744 FBgn0033324 O SLC24A6 solute carrier family 24 (sodium/potassium calcium exchanger), member 6 3 CG14945 FBgn0032402 O 3 CG17005 FBgn0032109 O 3 CG1968 FBgn0033401 O COG6 component of oligomeric golgi complex 6 3 CG1971 FBgn003.9881 O 3 CG3566 FBgn00298.54 O CYB5-M outer mitochondrial membrane cytochrome b5 3 CG4786 FBgn0037012 O 3 CG874O FBgn0027585 O 3 CG9264 FBgn0032911 O 3 CG9525 FBgn0032080 O 2 CG10946 FBgn0029974 O 2 CG1113 FBgn0037304 O 2 CG11381 FBgn0029568 3 2 CG12688 FBgn0029707 O 2 CG12958 FBgn0034018 O 2 CG14314 FBgn0038581 O 2 CG143S4 FBgn0039376 O 2 CG15897 FBgn0029857 O WDR4 WD repeat domain 4 2 CG16786 FBgn0034974 O 2 CG3O389 FBgn0050389 O TMEM57 transmembrane protein 57 2 CG32224 FBgn0036950 O 2 CG3704 FBgn0040346 O XAB1 XPA binding protein 1, GTPase 2 CG4098 FBgn0036648 O NUDT9 nudix (nucleoside diphosphate linked moiety X)-type motif 9 2 CG4643 FBgn0043010 O FBXO45 F-box protein 45 2 CGS3O8 FBgn0037908 3 2 CGS348 FBgn0034156 O SLC24A6 solute carrier family 24 (sodium/potassium calcium exchanger), member 6 2 CG92OS FBgn0035181 O 2 CG9752 FBgn0034614 O C9orf64 chromosome 9 open reading frame 64 2 le:S FBgn0026630 O C3F putative protein similar to nessy CG10514 FBgn0039312 O CG13659 FBgn0039319 O CG1416O FBgn0036068 O SLC2AS solute carrier family 2 (facilitated glucosef fructose transporter), member 5 CG14515 FBgn003964.8 O CG14629 FBgn0040398 1 CG14743 FBgn0033326 O SLC24A6 solute carrier family 24 (sodium/potassium calcium exchanger), member 6 CG18679 FBgn004O663 O CG-2879 FBgn0025834 O LRRC8B leucine rich repeat containing 8 family, member B CG2921 FBgn0034689 1 CG3106 FBgn003.0148 O CG31410 FBgn0051410 O CG321.59 FBgn0052159 O CG32637 FBgn0052637 O LGR8 leucine-rich repeat-containing G protein coupled receptor 8 CG3634 FBgn0037026 O ST7 Suppression of tumorigenicity 7 CG8858 FBgn0033698 O KIAAO368 KIAAO368 8S FBgn0033845 O DLG7 discs, large homolog 7 Osi16 FBgn0051561 O sip2 FBgn0031878 O O CG1009S FBgn0037993 2 O CG101.83 FBgn0039093 2

US 9,163,078 B2 83 84 TABLE 1-continued

Number of Human Score in secondary potential 21 nt orthologs (NCBI Description of the human SCEl Gene FBGN off-targets Homologene) orthologs (NCBI Gene) NT CG6631 FBgn0039206 O NT CGTO53 FBgn0030960 O FLJ11773 hypothetical protein FLJ11773 NT CGA200 FBgn0032671 1 JMJD4 jumonji domain containing 4 NT CGA242 FBgn0040494 O NT CGA381 FBgn0038098 O NT CGT567 FBgn0039670 O NT CG8031 FBgn0038110 O C2orf24 chromosome 2 open reading frame 4 NT CG842O FBgn0037664 O NT CG8538 FBgn0038223 O NT CG8852 FBgn0031548 1 LRRTM4 leucine rich repeat transmembrane neuronal 4 NT CG9328 FBgn0032886 O NT CG9380 FBgn0035094 O NT CG9773 FBgn0037609 O NT CR.322OS FBgn0052205 1 NT Edg78E FBgn0000551 O NT I(1)GO196 FBgn0027279 O KIAAO433 KIAA0433 protein NT I(1)G0222 FBgn0028343 O NT Mkm1 FBgn0029152 1 MKRN1 makorin, ring finger protein, 1 NT msb1I FBgn0027949 O NT MTA1-like FBgn0027951 4 MTA1 metastasis associated 1 NT nito FBgn0027548 O RBM15 RNA binding motif protein 15 NT olf186-M FBgn0015522 O NT Osi13 FBgn0037422 O NT Osi17 FBgn0037427 O NT Osi19 FBgn0037429 O NT Pep FBgn0003046 O NT S8O FBgn00344.08 O NT T48 FBgn00.04359 O NT yellow-d2 FBgn0034.856 O

TABLE II Inhibition of NFAT nuclear localization # of in TG- potential treated off-targets Gene Description CG Amplicon No. Expression cells of 21 nt

CanA1 Calcineurin A1 CG14SS DRSC18600 +f- O Pp2B-14D Protein phosphatase CG9842 DRSC23315 ------O 2B at 14D DRSC2O270 ------1 CanA-14F Calcineurin A at 14F CG9619 DRSC23296 ------O DRSC2O211 ------13 CanB Calcineurin B CG4209 DRSC18449 +f- ---- O Can B2 Calcineurin B2 CG11217 DRSCO7355 ------O CG32812 CG32812 CG32812 DRSC18478 -- O Identity of # of Identity of # of potential off potential potential off potential Identity of targets of off-targets targets of off-targets potential off Gene 21nt of 20nt 20nt of 19nt targets of 19nt Comments

CanA1 O 1 CG7952 Pp2B-14D O O CG12238 2 CG12238, 3 CG12238, CG32223 CG32223, CG32O2S CanA-14F O O not listed 56 not listed 183 not listed CG9642 (Pp2B-14D) has 18 matches with this amplicon. CanB 1 CG11217 2 CG11217 (CanB2), (CanB2) CG15859 Can B2 1 CG4209 2 CG4209 (CanB), (CanB) CGS744 CG32812 O O US 9,163,078 B2 85 86 TABLE III

Potential off-target Description of the potential off-target (NCBI Gene) Molecule in Suppl Table III I. DIRECT NFAT KINASES Shaggy CG13772 neurexin binding: ectoderm development and neurogenesis; (sgg. CG2621) (neuroligin) CG4771 NA CG12199 peroxidase activity, cell adhesion, defense response; reactive oxygen species metabolism; transmission of nerve (kek5) impulse: CG1049 choline-phosphate cytidylyltransferase activity; (cct1) CG5907 calcium sensitive guanylate cyclase activator activity; calmodulin binding; neurotransmitter secretion; synaptic (fra) transmission; CG32538 nicotinic acetylcholine-activated cation-selective channel activity; muscle contraction; nerve-nerve synaptic (nAcRalpha 18C) CG9176 intracellular cyclic nucleotide activated cation channel activity; potassium channel activity; sensory perception; (engl.) signal transduction; CG3427 cAMP-dependent protein kinase regulator activity; Small GTPase mediated signal transduction; (epec.) CG33S13 N-methyl-D-aspartate selective glutamate receptor activity; cation transport; nerve-nerve synaptic transmission; (nmdar2) CG13290 NA CG12708 NA CG4136 nucleobase, nucleoside, nucleotide and nucleic acid metabolism; regulation of transcription from RNA polymerase II promoter; ligand-dependent nuclear receptor activity; Gasket CG12212 transcription factor activity; leading edge cell fate determination; ectoderm development; photoreceptor cell (gsk. CG11338, (peb) morphogenesis; maintenance of tracheal epithelial integrity; negative regulation of JNK cascade; CG31003) CG12147 CG62OS acyltransferase activity; cell adhesion; regulation of Wnt receptor signaling pathway; (por) CG14895 receptor signaling protein serine/threonine kinase activity: MAPKKK cascade; actin filament organization; cell (pak3) proliferation; cytoskeleton organization and biogenesis: CG18214 Rho guanyl-nucleotide exchange factor activity; actin cytoskeleton organization and biogenesis; axon guidance; (trio) central and peripheral nervous system development; transmission of nerve impulse. Disc overgrown CG2028 receptor signaling protein serine/threonine kinase activity; Wnt receptor signaling pathway; negative regulation of (den. CG2048) Smoothened signaling pathway; regulation of proteolysis and peptidolysis; CK1 alpha CG2048 receptor signaling protein serine/threonine kinase activity; Wnt receptor signaling pathway; negative regulation of (CG2028) (ckIalpha) Smoothened signaling pathway; regulation of proteolysis and peptidolysis; CG2577 receptor signaling protein serine/threonine kinase activity; casein kinase I activity; CG9102 transcription factor activity; chromatin assembly or disassembly: eye-antennal disc metamorphosis; sex (bab2) determination; female gonad development; leg morphogenesis; transmission of nerve impulse. CGT838 receptor signaling protein serine/threonine kinase activity; chromosome segregation; mitotic spindle checkpoint (bab1) regulation of exit from mitosis. CGT892 receptor signaling protein serine/threonine kinase activity; anti-apoptosis; cell proliferation; establishment of (nmo) planar polarity; eye morphogenesis; wing morphogenesis; negative regulation of Wnt receptor signaling pathway; negative regulation of frizzled signaling pathway; CG16973 JUN kinase kinase kinase kinase activity; Small GTPase regulator activity; oogenesis; photoreceptor cell (mSn) morphogenesis; regulation of cell shape; CG2577 CG2048 receptor signaling protein serine/threonine kinase activity; casein kinase I activity; cell communication; circadias rhythm; imaginal disc growth; regulation of ecclysteroid secretion; regulation of protein-nucleus import; CG2O28 receptor signaling protein serine/threonine kinase activity; Wnt receptor signaling pathway; negative regulation of Smoothened signaling pathway; regulation of proteolysis and peptidolysis; CGT838 receptor signaling protein serine/threonine kinase activity; chromosome segregation; mitotic spindle checkpoint; (bab1) regulation of exit from mitosis CGF236 receptor signaling protein serine/threonine kinase activity; cytokinesis; regulation of progression through cell cycle; CG3228 ATP-dependent helicase activity; nuclear mRNA splicing, via spliceosome; proteolysis and peptidolysis. (kurz) CGAO94 CG913S guanyl-nucleotide exchange factor activity; proteolysis and peptidolysis. CG9962 CGS621 glutamate-gated ion channel activity; kainate selective glutamate receptor activity; potassium channel activity; nerve-nerve synaptic transmission. II. OTHER KINASES CG31640 CG33531 transmembrane receptor protein tyrosine kinase activity; cell-cell adhesion; ectoderm development; mesoderm (ddr) development; nervous system development; CG2699 phosphoinositide 3-kinase regulator activity; insulin receptor signaling pathway; positive regulation of cell size; (PI3K21B) positive regulation of growth; regulation of cell proliferation; regulation of cell size; Pelle CGS263 mRNA 3’-UTR binding; translation repressor activity: (pil. CG5974) I(1)GO148 CG9463 alpha-mannosidase activity; hydrolase activity, hydrolyzing N-glycosyl compounds. (CG32742) US 9,163,078 B2 87 88 TABLE III-continued

Potential off-target Description of the potential off-target (NCBI Gene) Pole hole CG8522 fatty acid biosynthesis; positive regulation of transcription; transcription from RNA polymerase II promoter; (phl. CG2845) (HLH106) CG11073 NA CG3634 NA CG15105 transcription regulator activity; ubiquitin-protein ligase activity; CG31.98 nuclear mRNA splicing, via spliceosome CG17299 receptor signaling protein serine/threonine kinase activity; defense response; fatty acid metabolism; regulation of phosphate metabolism; response to stress CG846S NA Foraging CGT826 receptor signaling protein serine/threonine kinase activity; nervous system development: ectoderm development; (for. CG10033) (mnb) olfactory learning; cell proliferation; circadian rhythm; induction of apoptosis; learning and/or memory; CG32629 NA CG13472 NA CG18389 transcription factor activity; autophagy; ecclysone-mediated induction of salivary gland cell death; induction of (Elp93F) apoptosis by hormones; Iarval midgut histolysis; CG9310 steroid hormone receptor activity; regulation of transcription from RNA polymerase II promoter; endoderm (hnfA) development; mesoderm development; CG16902 steroid hormone receptor activity; metamorphosis; regulation of transcription from RNA polymerase II promotor (Hr4) CG4O13 corepressor activity; regulation of transcription from RNA polymerase II promoter. (Smr) CG8949 NA CG14447 glutamate receptor binding; determination of muscle attachment site: (grip) CGS683 RNA polymerase II transcription factor activity; cell proliferation; (Aefl) CG3218O specific RNA polymerase II transcription factor activity; autophagy; cell death; salivary gland cell death (elp74EF) mesoderm development; oogenesis; CG32423 mRNA processing: CG3696 ATP-dependent helicase activity; blastoderm segmentation; chromatin assembly or disassembly: (kis) CG3695 RNA polymerase II transcription mediator activity; mediator complex; (MED23) CG14023 NA CG13109 transcription coactivator activity; signal transducer activity; border follicle cell migration; (tal) CG9381 learning and/or memory; olfactory learning: (mura) CGS466 NA CG12254 RNA polymerase II transcription mediator activity: (MED25) CG93S4 nucleic acid binding; structural constituent of ribosome; (RpL34b) CG6575 carbohydrate binding: cell adhesion; heterophilic cell adhesion; nervous system development. (glec) CG14366 NA CG1161 NA CG10732 NA CGT368 NA CG12432 NA transcription factor activity; circadian rhythm; mesoderm development; Octopamine receptor activity; octopamineftyramine signaling pathway; ovulation; cysteine-type endopeptidase activity; ubiquitin thiolesterase activity; ubiquitin-specific protease activity NA III. OTHER

CG6919 CG18208 G-protein coupled receptor protein signaling pathway; transmission of nerve impulse. CG31288 CG1541S NA CG32381 neurotransmitter secretion; synaptic vesicle priming. (une-13-4A) Molecule in Suppl Table II CanA1 CG7952 (giant) negative regulation of transcription from RNA polymerase II promoter; posterior head segmentation; (CG1455) terminal region determination; zygotic determination of anterior posterior axis; ring gland development; salivary gland development; torso signaling pathway. CG12238 chromatin binding; transcription regulator activity; gene silencing; oogenesis. (1(1)GOO84) CG32223 NA CG32O2S NA CanA-14F not listed (CG9819) CanB CG11217 calcium-dependent protein serine/threonine phosphatase activity; cell homeostasis; neurotransmitter (CG4209) (CanB2) Secretion; vesicle-mediated transport. CG15859 NA US 9,163,078 B2 89 90 TABLE III-continued

Potential off-target Description of the potential off-target (NCBI Gene) CG11217 CG4209 (CanB) calcium-dependent protein serine/threonine phosphatase activity; cell homeostasis; neurotransmitter (CanB2) Secretion; vesicle-mediated transport. CGS744 calcium-mediated signaling; sensory perception; signal transduction; visual perception.

US 9,163,078 B2 117 118 - Continued acagttccac ttgtaactica ggc.cccagct gtgcago cac tacagat.ccg accaggagtt 228O

Ctttct caga C9tggtctgg tagaacacag Cagatgctgg to Ctgcct g gcaac aggtg 234 O acacccct gg ctic ctdctac tact acacta acttctgaga gtgtggctgg ttcacacagg 24 OO Cttggagact gggggaagat gattt catgc agcaat catt atalacticagt gatgcc.gcag 246 O cct cittctga ccaatcagat aactittat cit gcc cct cago cagttagtgt gigggattgca 252O Catgttgtct ggccticagoc to Cactacc aagaaaaata aac agtgcca galacagaggt 2580 attittggtaa alactaatgga atgggagcca ggaagagagg aaataaatgc titt cagttgg 264 O agtaattcat tacagaatac caat atcc.ca cattcagcat ttatttctic c aaagataatt 27 OO aatgggaaag atgtcgagga agtaagttgt atagaalacac aggacaatca gaact cagaa 276 O ggagaggcaa gaaattgctg taalacat ct at CagaCagg actictgatt C at Cagtttca 282O gacaaacagc ggcaaac Cat Cattattgcc gactic ccc.ga gtcCtgcagt gagtgtcatC 288O actatcagca gtgacactga tigaggaagag act tcc.caga gacattcact cagagaatgt 294 O aaagg tagt c tagattgttga agcttgc.cag agc actittga at attgatcg gatgtgttca 3 OOO ttaagtag to citgatagtact ctdagtacc agctic ct cag gigcagtic cag cc catcc ccc 3 O 6 O tgcaa.gagac caatagt at gtcagatgaa gagcaagaaa gtagttgttga tacggtggat 312 O ggct ct Coga Catctgactic titc.cgggcat gacagtic cat ttgcagagag cactitttgttg 318O gaggacactic atgaaalacac agaattggta t cct ctgctg acacagaaac caa.gc.ca.gct 324 O gtctgttctg ttgttggtgcc accagtggala Ctagaaaatg gCttaaatgc cgatgagcat 33 OO atggcaaaca Cagattictat atgc.ca.gc.ca ttaataaaag gacgatctgc ccctggalaga 3360 ttaalaccago Cttctgcagt gigg tact.cgt cagcaaaaat toga catcagc atticcagoag 342O Cagcatttga actticagt caggttcagcac tittggatctg ggcatcaaga gtggaatgga 3480 aactittgggc acagaagaca gcaa.gctitat attcc tacta gtgttaccag taatc catt c 354 O actic tittctic atggaagt co caat cacaca gcagtgcatg cccacctggc tiggaaataca 36OO cacct cqgag gacagoctac totact tcca tacccatcat cagccaccct cagtag togct 366 O gcaccagtgg cccacctgtt agcct citccg td tacct caa gacctatgtt acago atcca 372 O actitataata t ct cocatcc cagtggcata gttcaccaag toccagtggg cittaaatcc c 378 O cgtctgttac catc.cccaac catt catcag act cagtaca aaccalat citt cocaccacat 384 O t cittacattg cagcatcacc togcatatact ggattitccac tdagt.ccaac aaaacticago 3900 cagtat coat atatgtgaaa alacagtatat tdgggaagct caatgataca aacatttgat 396 O taaaaataaa alacatggt at ttaat attag ccatggcaca agaaaattat ttittgaatca 4 O2O tgtag acttg ggtgcaattit aaacaactitt gagctittaaa aactic actitt tdatgtgttt 4 O8O tgcacatttg gtataacttg totttggit ca tdttatc.ttic titatgtagta actictagaca 414 O ggtgactitat giggagcagaa gtc.cagttitt gct cotgcta ttttittataa attgc ctitct 42OO aact agtgca agacacgt.ct acatttggga agc cattctg tdt acagact tagagcaa.ca 426 O gatgcacata tdt cagaatt acago ataca agtgaattgt attatcc.gtg tct tagtgta 432O taaatgttgg gtcact tacc taagaaattig agctattgtt ctitta cattt gcatgtgtct 438 O tittgcatggg caaaatgttg cct agactitt gct cittaaat gttgttctaa taatctgagc 4 44 O tgcattgtaa accott cota cacat agtgc cittaaatatt tdaggttgtt aatgttatta 4500 cctatatata aatgttgagg actgcago ac ttaaaattica gacct act at ttagttt cot 456 O US 9,163,078 B2 119 120 - Continued tittgatagcg taatgttcat ttttgtttitt gtgtgg tatg atttcaggta gtagctgttt 462O ttitt cott at taagagggca gcatgtttgc tatagotgaa ttctgctgtc. tdatttitt.ca 468O gaatgatcta gct tcaagaa aagcaa.gcag ttagtag tec ttaagaaaaa ttgatt Cagt 474. O atc. 47.43

SEQ ID NO 10 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

SEQUENCE: 1.O agttctgggt attccacctg. citca 24

SEQ ID NO 11 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

SEQUENCE: 11 tgaagtttac gggttcCtgg toggt 24

SEQ ID NO 12 LENGTH; 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

SEQUENCE: 12 tccaccittct agcticagott coaa 24

SEQ ID NO 13 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

SEQUENCE: 13 tggcaa.cact gtc.ctctgct gaat 24

SEQ ID NO 14 LENGTH: 21 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

SEQUENCE: 14 gccagotcca tot coagttct 21

SEO ID NO 15 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: US 9,163,078 B2 121 122 - Continued <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 15

Cacaat at cq gttgctgtag cqgt 24

<210s, SEQ ID NO 16 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 16 tgcaatcc tt ctdaaccacc ticca 24

<210s, SEQ ID NO 17 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 17 gctgttctac citt catct ca cct coa 26

<210s, SEQ ID NO 18 &211s LENGTH: 24 & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 18 aggctgtcat cacticgagca gaaa 24

<210s, SEQ ID NO 19 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 19 agtic ctdctg at cacctgaa togct 24

<210s, SEQ ID NO 2 O &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 2O gcc.gatgagc atatggcaaa caca 24

<210s, SEQ ID NO 21 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic US 9,163,078 B2 123 124 - Continued primer

<4 OOs, SEQUENCE: 21 tacic cactgc agaaggctgg ttta 24

<210s, SEQ ID NO 22 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 22 acaacaacgc ccacttcttg gtgg 24

<210s, SEQ ID NO 23 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 23 tgct cacgtc. cagcacctic 19

<210s, SEQ ID NO 24 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 24 t cittgctttctgtagggctt totg 24

<210s, SEQ ID NO 25 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 25 tctcaaagga gctggaagtg C 21

<210s, SEQ ID NO 26 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 26 agcatgcaaa acagoccagg

<210s, SEQ ID NO 27 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer US 9,163,078 B2 125 126 - Continued

<4 OOs, SEQUENCE: 27 acggitttctic cca.gct ctitc 2O

<210s, SEQ ID NO 28 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer

<4 OOs, SEQUENCE: 28 tgacaggagg aga.gct agg 19

<210s, SEQ ID NO 29 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer

<4 OOs, SEQUENCE: 29 aagagat.cct cctgccttgg 2O

<210s, SEQ ID NO 3 O &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 30

Wall Ile Wall Ile Thr 1. 5

<210s, SEQ ID NO 31 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 31 aggluggaggll gCaalalulla 19

<210s, SEQ ID NO 32 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 32 cuuulaagccu. Cagaulaua 19

<210s, SEQ ID NO 33 &211s LENGTH: 7 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide