US 20120231 019A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2012/0231019 A1 YONEYAMA et al. (43) Pub. Date: Sep. 13, 2012

(54) FIBROSIS INHIBITOR (30) Foreign Application Priority Data (75) Inventors: HIROYUKIYONEYAMA, Jun. 7, 2007 (JP) ...... 2007-151164 Minato-ku (JP); Yoshiro Kai. Kashihara-shi (JP); Hideki Publication Classification Tagashira, Minato-ku (JP); Jun (51) Int. Cl. Koyama, Minato-ku (JP) A 6LX 39/395 (2006.01) (73) Assignee: Stelic Institute of Regenerative A6IP 29/00 (2006.01) Medicine, Stelic Institute & Co. CI2P 2L/02 (2006.01) C07K 6/8 (2006.01) (21) Appl. No.: 13/474,048 (52) U.S. Cl...... 424/172.1; 530/389.1; 435/70.4 (22) Filed: May 17, 2012 (57) ABSTRACT Related U.S. Application Data An objective of the present invention is to provide methods (63) Continuation of application No. 12/663,420, filed on for treating or preventing fibrotic diseases, which are based on Mar. 5, 2010, filed as application No. PCT/JP2008/ the novel finding that fibrosis is Suppressed by administering 060455 on Jun. 6, 2008. ER-TR7 to a subject. Patent Application Publication Sep. 13, 2012 Sheet 1 of 13 US 2012/0231019 A1

ER-R-REAE RO

R. R. REA R §§

§§ x 100

Patent Application Publication Sep. 13, 2012 Sheet 2 of 13 US 2012/0231019 A1 }|-galvanimš! Narºga

3|

* Patent Application Publication Sep. 13, 2012 Sheet 3 of 13 US 2012/0231019 A1

sesses &E::::

R UNTREATED ER-TR7

FIG. 3 Patent Application Publication Sep. 13, 2012 Sheet 4 of 13 US 2012/0231019 A1

8x38: 8x.333

8: 2s 8x8.83.

…(¿? ·§§§§§§§§§ ********

#####~$$$$$$$$$$$$$$ × ****** Patent Application Publication Sep. 13, 2012 Sheet 5 of 13 US 2012/0231019 A1

DC CES S CERA 0 g/ml

10 g/ml Patent Application Publication Sep. 13, 2012 Sheet 6 of 13 US 2012/0231019 A1

s ESERN 8 SAN BO

75 kD ER-RT SO kD 50 kD a ANGEN

S S S S &x

Patent Application Publication Sep. 13, 2012 Sheet 7 of 13 US 2012/0231019 A1

NORA. OUSE FBROSS-ODE OUSE

Patent Application Publication Sep. 13, 2012 Sheet 8 of 13 US 2012/0231019 A1

NORA. OUSE F BROSS-ODE OUSE

Fig. 8 Patent Application Publication Sep. 13, 2012 Sheet 9 of 13 US 2012/0231019 A1

NORA. OSE F BROSS-ODE. OSE

Fig. 9 Patent Application Publication Sep. 13, 2012 Sheet 10 of 13 US 2012/0231019 A1

?? Q* ****

100) Patent Application Publication Sep. 13, 2012 Sheet 11 of 13 US 2012/0231019 A1

NORA. OUSE F BROSS-ODE OUSE

(x00 Patent Application Publication Sep. 13, 2012 Sheet 12 of 13 US 2012/0231019 A1

FIG. 12 Patent Application Publication Sep. 13, 2012 Sheet 13 of 13 US 2012/0231019 A1

FIG. 13 US 2012/0231 019 A1 Sep. 13, 2012

FIBROSIS INHIBITOR Japan Society for Dialysis Therapy in 2004. The number of dialysis patients was 35,000, up 3.2% from the previous year, TECHNICAL FIELD and increasing each year. 0006. At present, there is no radical therapeutic method for 0001. The present invention relates to agents for treating completely curing fibrotic diseases. The reason is that the or preventing fibrotic diseases, and uses thereof. cause and pathogenesis is not understood. Presently, the pur pose of treatment is to improve patients’ quality of life (QOL) BACKGROUND ART through maintaining relief from Symptoms by controlling the 0002 Fibrosis is an uncontrolled wound healing response. activeness of the disease. The ultimate form of treatment is An injured tissue is repaired by replacing damaged cells with dialysis or organ transplantation. However, these therapeutic cells of the same type, but occasionally, parenchymal tissues methods significantly impair patients QOL, and many cases are replaced by connective tissues. In Such cases, fibroblasts show complications and recurrence of fibrosis in a trans become activated and differentiate into myoblasts, leading to planted organ. Pathologically, fibrotic diseases are character synthesis, deposition, formulation, and remodeling of the ized by overaccumulation of extracellular matrix Such as extracellular matrix. This results in fibrosis. Chronic fibrotic collagen. The overactivation of fibroblasts is recently disease is a general term for the terminal stage of chronic assumed to be the major cause of the overaccumulation. Thus, inflammatory conditions that can develop in various organs, fibroblasts are drawing attention as a therapeutic target. and is accompanied by excessive tissue fibrosis. Chronic 0007 Currently, as candidate therapeutic agents for fibrotic disease includes, for example, cirrhosis of the liver fibrotic diseases, hope is placed on adrenal cortical steroids, and sclerosis of the kidney. Furthermore, these fibrotic dis colchicine, IL-10, and the like, which Suppress chronic eases progress into organ failure or cancer (Non-patent Docu inflammation: TGF-B inhibitors, HGF (suppressing the activ ment 1). ity of TGF-B), endothelin inhibitors, angiotensin inhibitors, 0003. A colonic disease known to involve fibrosis is and such, which activate fibroblasts; matrix metalloprotein Crohn's disease, which has been designated as a specified ase (MMP) which degrades collagen, etc. However, none has disease by the Ministry of Health, Labor, and Welfare of lead to an established therapeutic method. Japan. Crohn's disease has been defined as “a disease of 0008 ER-TR7 is a rat monoclonal antibody against non uncertain etiology mostly seen in young Subjects, which lymphocytic cells of mouse thymus, which was produced by involves granulomatous inflammatory focus with fibrosis and Van Vliet et al. in 1984 (Non-patent Document 2). ER-TR7 ulcers, can affect any part of the gastrointestinal tract from the has been reported as an antibody that recognizes reticular oral cavity to anus, and may also affect areas other than the fibroblasts (Non-patent Document 3), and is commercially gastrointestinal tract (specifically skin). Most lesion areas available from several Suppliers as a connective tissue marker have longitudinal ulcers, cobblestone appearances, or aphtha for various organs. However, the antigen is yet unidentified. in the Small or large intestine, or both. Crohn's disease is Recently, it was reported that, when contacted with lympho categorized into disease types such as longitudinal ulcer type cytes, lymph node fibroblastic reticular cells contribute to the and cobblestone appearance type, or Small intestine type, immunological function by secreting ER-TR7 antigen as an Small/large intestine type, and large intestine type according extracellular matrix to make a reticular meshwork (Non to the location of Stenosis. Common symptoms include patent Document 4). abdominal pain, diarrhea, weight loss, fever, and anal lesions. 0009. Non-patent Document 1 Wynn T. A. J. Clin. Occasionally, the disease may show symptoms similar to Invest., (2007) 117: 524-529 those of appendicitis, ileus, intestinal perforation, or massive 0010 Non-patent Document 2 Van Vliet E. et al., Eur. J. bleeding. Alternatively, the disease may develop with anal Immunol., (1984) 14:524-529 lesions or fever, without abdominal symptoms. Extragas 0011 Non-patent Document 3 Van Vliet E. et al., J. His trointestinal complications include anemia, hypoproteine tochem. Cytochem., (1986) 34: 883-890 mia, ankylosing spondylitis, aphthous stomatitis, erythema 0012 Non-patent Document 4 Katakai T. et al., J. Exp. nodosum, pyoderma gangrenosum, iritis, and growth disor Med., (2004) 200: 783-795 ders. 0004. In Japan, the former Ministry of Health and Welfare DISCLOSURE OF THE INVENTION set up a study group in 1975, defined diagnostic criteria for Crohn's disease, and implemented a nationwide Survey. The Problems to be Solved by the Invention number of patients has been increasing every year since the 0013 An objective of the present invention is to provide start of the survey. The number of Medical Care Certificates agents that can Suppress tissue fibrosis, which are useful in issued was 128 in 1976, but was increased to 24,396 in 2007. treating or preventing fibrotic diseases. The most common age at onset ranges from 20 to 24 in men, and 15 to 19 in women. The male-to-female ratio is about 2:1. Means for Solving the Problems Thus, Crohn's disease is more common in men. 0005. As for other chronic fibrotic diseases, carriers of 0014. The present inventors suspected that ER-TR7, a hepatitis virus, which is a major cause of progression to monoclonal antibody that has been used as a fibrosis marker, cirrhosis, are estimated to be 1,200,000 to 1,400,000 for type may neutralize fibrosis-enhancing Substances and thus have B and 1,000,000 to 2,000,000 for type C, according to blue the effect of Suppressing fibrosis. The present inventors car ribbon panel report on hepatitis countermeasures presented in ried out research based on this assumption and as a result, 2001. Furthermore, the number of patients who undergo discovered that ER-TR7 can suppress fibrosis. Thus, the dialysis due to chronic renal failure caused by kidney fibrosis present invention was completed. ER-TR7 and functionally was approximately 250,000 according to the fundamental equivalent Substances are effective fibrosis-Suppressing Survey on chronically-dialyzed patients conducted by the agents treating or preventing fibrosis. US 2012/0231 019 A1 Sep. 13, 2012

0015 The present invention relates to agents for suppress of intestinal length measurement in a control group, and ing fibrosis and therapeutic agents for fibrotic diseases com ulcerative colitis model groups (untreated and ER-TR7 prising the agents as an active ingredient, more specifically, treated). provides the following: 0032 FIG. 4 shows the suppression of fibrosis marker 001 6 1 a fibrosis-suppressing agent comprising gene expression as a result of ER-TR7 administration in ER-TR7 or a functionally equivalent substance as an active ulcerative colitis model mice. (1) to (3) show alterations in the ingredient; expression levels of C-SMA, TNFC., and type 1 collagen, 0017 2 the agent of 1, wherein the substance has an respectively, determined by qPCR. ER-TR7 antigen-targeting activity; 0033 FIG. 5 shows photographs depicting the expression 0018 (3 the agent of 1, wherein the substance has an of ER-TR7 antigen in normal human lung fibroblasts in the activity of enhancing the degradation of an ER-TR7 antigen; presence or absence of lipopolysaccharide (LPS). The pho tographs show staining images for ER-TR7 in normal human 0019 4 the agent of 1, wherein the substance has an lung fibroblasts. activity of inhibiting the synthesis of an ER-TR7 antigen: 0034 FIG. 6 shows photographs depicting electrophoresis 0020) 5 the agent of 1, wherein the substance has an images of normal human lung fibroblast extracts. The photo activity of neutralizing the activity of an ER-TR7 antigen: graphs show images of Coomassie brilliant blue staining and 0021 6 the agent of 1, wherein the substance has an Western blot. activity of inhibiting the modification of an ER-TR7 antigen; 0035 FIG. 7 shows photographs depicting the accumula 0022 7 the agent of 1, wherein the substance has an tion of ER-TR7-positive cells in lesions of a fibrosis model. activity of enhancing the demodification of an ER-TR7 anti Namely, it shows the result for lung tissue of pulmonary gen, emphysema model mice. Antibody binding was detected by 0023 8 the agent of any one of 1 to 7, wherein the visualizing as a brown signal. production or accumulation of an ER-TR7 antigen in each 0036 FIG. 8 shows photographs depicting the accumula organ is inhibited; tion of ER-TR7-positive cells in lesions of a fibrosis model. 0024 9 the agent of any one of 1 to 8), which is used Namely, it shows the result for pancreatic tissue of type 2 for treating or preventing a fibrotic disease (the fibrotic dis diabetes model mice. Antibody binding was detected by visu eases are not particularly limited, and include, for example, alizing it as a brown signal. various diseases caused by fibrosis of body tissues such as 0037 FIG. 9 shows photographs depicting the accumula organs and skin, which include cirrhosis, renal sclerosis, pull tion of ER-TR7-positive cells in lesions of a fibrosis model. monary fibrosis, Scleroderma, cardiomyopathy, myelofibro Namely, it shows the result for brain tissue of Parkinson's sis, and chronic peritonitis); disease model mice. Antibody binding was detected. 0025 10 a method for producing a fibrosis-suppressing 0038 FIG. 10 shows photographs depicting the accumu agent comprising as an active ingredient an antibody, which lation of ER-TR7-positive cells in lesions of a fibrosis model. comprises the step of preparing the antibody using an ER Namely, it shows the result for cardiac tissue of cardiomy TR7 antigen; opathy model mice. Antibody binding was detected by visu 0026 11 a method for treating or preventing a fibrotic alizing it as a brown signal. disease, which comprises the step of administering the agent 0039 FIG. 11 shows photographs depicting the accumu of any one of 1 to 9 to a subject; and lation of ER-TR7-positive cells in lesions of a fibrosis model. 0027 12 the use of ER-TR7 or a functionally equivalent Namely, it shows the result for colonic tissue of ulcerative Substance in producing a fibrosis-Suppressing agent. colitis model mice. Antibody binding was detected by visu alizing it as a brown signal. Effects of the Invention 0040 FIG. 12 shows photographs depicting the accumu lation of ER-TR7-positive cells in lesions of a fibrosis model. 0028. The present invention revealed that ER-TR7 antigen Namely, it shows the result for the kidney tissue of renal is involved in the onset and promotion offibrosis. The present fibrosis model mice. Antibody binding was detected by visu invention also demonstrated that the onset of fibrosis was alizing it as a brown signal. suppressed by neutralizing ER-TR7 antigen. These findings 0041 FIG. 13 shows photographs depicting the accumu are applicable to provide unprecedented novel-concept fibro lation of ER-TR7-positive cells in lesions of a fibrosis model. sis-suppressing agents. Since fibrosis occurs in various Namely, it shows the result for liver tissue of cirrhosis model organs and can lead to severe diseases, the agents have great mice. Antibody binding was detected by visualizing it as a medical and industrial significances. brown signal.

BRIEF DESCRIPTION OF THE DRAWINGS BEST MODE FOR CARRYING OUT THE INVENTION 0029 FIG. 1 shows photographs depicting the therapeutic 0042 Chronic fibrotic disease is a general term for the effect of ER-TR7 in cirrhosis model mice. (1) immunostain terminal stage of chronic inflammatory conditions that can ing image for type 4 collagen; (2) Masson staining image. develop in various organs, and is accompanied by excessive 0030 FIG. 2 shows the suppression of fibrosis marker tissue fibrosis. The progression of these diseases results in gene expression as a result of ER-TR7 administration into severe pathological conditions such as organ failure or can cirrhosis model mice. (1) to (3) show alterations in the expres ceration. The present inventors focused on ER-TR7 as a fibro sion levels of C-SMA, TNFC., and type 1 collagen, respec sis marker, and established an ulcerative colitis model mice to tively, determined by qPCR. analyze the effect of ER-TR7 administration in detail. The 0031 FIG. 3 shows the therapeutic effect of ER-TR7 in analysis revealed that the administration resulted in improve ulcerative colitis model mice. This diagram shows the result ment of inflammatory symptoms Such as reduction of inflam US 2012/0231 019 A1 Sep. 13, 2012 matory activity and Suppression of atrophy when compared to preferred. Thus, “ER-TR7 of the present invention also wild type colonic mucosa. Specifically, the present inventors includes polyclonal and monoclonal antibodies that recog discovered that ER-TR7 administration improved fibrosis nize a nonhuman protein equivalent to the ER-TR7 antigen through neutralization of ER-TR7 antigen, which is closely (homolog, ortholog, etc.). In addition, recombinant antibod involved in inflammation as well as fibrosis. ies prepared by using genetic engineering techniques are 0043. The present invention relates to fibrosis-suppressing included in the “ER-TR7” of the present invention. “Sub agents comprising ER-TR7, or an antibody or compound stances that are functionally equivalent to the ER-TR7 of the whose target is an ER-TR7 antigen, as an active ingredient. present invention include antibodies whose target is the same 0044) The “fibrosis-suppressing agents’ of the present antigen as ER-TR7. However, the substances are not limited invention can effectively suppress tissue fibrosis. Herein, to the above examples. Compounds having the activity of “Suppressing tissue fibrosis” means reducing or eliminating inhibiting or neutralizing the ER-TR7 antigen by binding, are fibrotic lesions in fibrotic tissues, or retarding or inhibiting also included. further advancement offibrosis (Suppressing the expansion of 0048. In the present invention, the “inhibition or neutral fibrotic lesions). ization of production and accumulation of ER-TR7 antigen 0045. For example, the degree of fibrosis in liver tissues includes, for example, “inhibition of synthesis”, “enhance can be evaluated by various methods known to those skilled in ment of degradation”, “inhibition of modification”, “demodi the art. In the most fundamental method, fibrosis may be fication', and "elimination of ER-TR7 antigen activity, but evaluated by histologically observing fibrotic findings in a is not limited thereto. The “inhibition or neutralization of liver biopsy, for example, images of fibrotic tissues empha production and accumulation' of ER-TR7 antigen means that sized by special staining (aniline blue stain, trichrome stain, the content, function, or activity of ER-TR7 antigen is silver stain, and Such) in liver biopsy samples. Specifically, reduced or eliminated as compared to a control. In the present evaluation of fibrosis can be achieved, for example, by pre invention, the “inhibition or neutralization of production and senting the degree of hepatic fibrosis in each sample mea accumulation of ER-TR7 antigen is not particularly limited; Sured by immunohistochemical staining in terms of a fibrosis however, such preferred substances are “substances with the score according to Dai K, et al., World J. Gactroenterol. 2005, activity of promoting degradation”, “substances with the 31,4822-4826; or Hillebrandt S, et al., Nature Genetics 2005, activity of inhibiting synthesis”, “substances with the activity 37, 835-843. Alternatively, the degree of hepatic fibrosis in of inhibiting modification”, “substances with the activity of liver tissues may be evaluated more simply by using hepatic promoting demodification of ER-TR7 antigen, or “sub fibrosis markers, such as hyaluronic acid, type I, III, and IV stances with the activity of neutralizing ER-TR7 antigen. collagens and other collagens, fibroblasts, and macrophages. 0049) “Expression' includes “transcription' from genes Simple tests that comprise determining the platelet count, and “translation' into polypeptides. Furthermore, “suppres which sensitively reflects the degree of hepatic fibrosis, can sion of degradation of proteins is also included. The “expres also be conveniently used. Alternatively, the degree of hepatic sion of ER-TR7 antigen proteins’ refers to transcription and fibrosis can also be roughly estimated by image diagnosis of translation of the genes encoding ER-TR7 antigen proteins, the liver, Such as abdominal ultrasonographic examinations. or production of ER-TR7 antigen proteins through transcrip Alternatively, the degree of hepatic fibrosis can also be evalu tion and translation. Furthermore, the “function of ER-TR7 ated using a measurement device (FibroScan 502, or such) for antigen proteins includes, for example, their binding with a non-invasive method that examines hepatic fibrosis based other cellular components or such. Those skilled in the art can on the transient elastography technology recently developed appropriately evaluate (measure) the various above-men by EchoSens (France). The degree of suppression of hepatic tioned functions using general methods. Specifically, the fibrosis by fibrosis-suppressing agent of the present invention evaluation can be performed using the methods described in may be determined based on evaluation of the degree of the Examples herein below, or using the same methods with hepatic fibrosis by the methods described above. appropriate modifications. 0046. The fibrosis-suppressing effect offibrosis-suppress 0050. The “promotion of degradation” of ER-TR7 antigen ing agents of the present invention is preferably accompanied may also be an increase in the expression of enzymes that by in particular, Suppression of at least one of type III collagen cleave or degrade ER-TR antigen, or of enzymes involved in elongation, type I collagen deposition, fibroblast accumula the cleavage or degradation of antigens. Furthermore, the tion, and macrophage accumulation in body tissues such as “promotion of degradation” may be caused by administering skin and internal organ, and more preferably suppression of a substance that promotes the expression of ER-TR7 anti all of them. The degree of suppression of fibrosis by the genS. fibrosis-Suppressing agents of the present invention may be 0051 Preferred embodiments of the substance with an determined using one or more of the Suppression effects activity of promoting degradation include, for example, com described above as an indicator. pounds selected from the group consisting of 0047. “ER-TR7” of the present invention is a rat mono 0.052 (a) antibodies that bind to ER-TR7 antigen proteins: clonal antibody against non-lymphocytic cells of mouse thy 0053 (b) ER-TR7 antigen protein variants that are domi mus, which was produced by Van Vliet et al. ER-TR7 is nant-negative for ER-TR7 antigen proteins; and commercially available from several Suppliers as an antibody 0054 (c) low-molecular-weight compounds that bind to that recognizes connective tissues of various mouse and ER-TR7 antigen proteins. human organs. “ER-TR7 of the present invention is not 0055. Furthermore, the substance with an activity of pro limited to commercially available ER-TR7, also includes moting degradation include, for example, compounds antibodies which share the same epitope as that recognized by (nucleic acids) selected from the group consisting of: ER-TR7, and antibodies that recognize as an epitope a differ 0056 (a) antisense nucleic acids against transcripts of the ent portion in ER-TR7 antigen. The species from which ER genes encoding ER-TR7 antigen proteins, or portions TR7 is derived are not particularly limited; however human is thereof; US 2012/0231 019 A1 Sep. 13, 2012

0057 (b) nucleic acids with the ribozyme activity of spe 0078 Preferred embodiments of the “substances with the cifically cleaving transcripts of genes encoding ER-TR7 anti activity of promoting demodification' include, for example, gen proteins; and compounds selected from the group consisting of 0058 (c) substances with the activity of using RNAi effect (0079 (a) antibodies that bind to ER-TR7 antigen protein to inhibit the expression of genes encoding ER-TR7 antigen demodification enzyme-Suppressing proteins; proteins. 0080 (b) ER-TR7 antigen protein demodification 0059) “Inhibition of synthesis” of ER-TR7 antigens enzyme-Suppressing protein variants which are dominant includes, for example, inhibition of the activities of enzymes negative for ER-TR7 antigen protein demodification enzyme involved in the synthesis of ER-TR7 antigens, but is not Suppressing proteins; and limited thereto. The inhibition refers to inhibition of any of I0081 (c) low-molecular-weight compounds that bind to the processes of ER-TR7 antigen synthesis. ER-TR7 antigen protein demodification enzyme-suppressing 0060 Preferred embodiments of substances with an activ proteins. ity of inhibiting synthesis include, for example, compounds I0082. The “substances with the activity of promoting (nucleic acids) selected from the group consisting of: demodification' also include compounds (nucleic acids) 0061 (a) antibodies that bind to ER-TR7 antigen protein selected from the group consisting of: synthetases; I0083 (a) antisense nucleic acids against transcripts of the 0062 (b) ER-TR7 antigen protein synthetase variants that genes encoding ER-TR7 antigen protein demodification are dominant-negative for ER-TR7 antigen protein Syn enzyme-Suppressing proteins, or portions thereof; thetases; and I0084 (b) nucleic acids with the ribozyme activity of spe 0063 (c) low-molecular-weight compounds that bind to cifically cleaving transcripts of genes encoding ER-TR7 anti ER-TR7 antigen protein synthetases. gen protein demodification enzyme-suppressing proteins; 0064. The substances with the activity of inhibiting syn and thesis also include, for example, compounds (nucleic acids) I0085 (c) substances with the activity of using RNAi effect selected from the group consisting of: to inhibit the expression of genes encoding ER-TR7 antigen 0065 (a) antisense nucleic acids against transcripts of protein demodification enzyme-suppressing proteins. genes encoding ER-TR7 antigen protein synthetases, or por I0086. The “neutralization” of ER-TR7 antigen refers to tions thereof; the suppression of ER-TR7 antigen activity through binding 0066 (b) nucleic acids with the ribozyme activity of spe of a compound to the activation site of the ER-TR7 antigen, cifically cleaving transcripts of the genes encoding ER-TR7 and such compounds include, for example, ER-TR7 antigen antigen protein synthetases; and activation-suppressing proteins that bind to the activation site 0067 (c) substances with the activity of using RNAi effect of ER-TR7 antigen. to inhibit the expression of genes encoding ER-TR7 antigen 0087 Preferred embodiments of “substance with the neu protein synthetases. tralizing activity include, for example, compounds selected from the group consisting of 0068 “Modification” of ER-TR7 antigen refers to post I0088 (a) antibodies that bind to ER-TR7 antigens: translational modification of ER-TR7 antigen, and includes, I0089 (b) ER-TR7 antigen activation-suppressing protein for example, addition of Sugar chains or lipids, or functional variants that are dominant-negative for ER-TR7 antigen acti groups such as phosphate or methyl groups. Vation-suppressing proteins; and 0069 Preferred embodiments of substances with an activ 0090 (c) low-molecular-weight compounds that bind to ity of inhibiting modification include, for example, com ER-TR7 antigens. pounds (nucleic acids) selected from the group consisting of 0091. The “substance with the activity of promoting 0070 (a) antibodies that bind to ER-TR7 antigen protein demodification' also include, for example, compounds modification enzymes; (nucleic acids) selected from the group consisting of: 0071 (b) ER-TR7 antigen protein modification enzyme 0092 (a) antisense nucleic acids against transcripts of variants that are dominant negative for ER-TR7 antigen pro genes encoding ER-TR7 antigen activation-Suppressing pro tein modification enzymes; and teins, or portions thereof; 0072 (c) low-molecular-weight compounds that bind to 0093 (b) nucleic acids with the ribozyme activity of spe ER-TR7 antigen protein modification enzymes. cifically cleaving transcripts of the genes encoding ER-TR7 0073. The “substances with the activity of inhibiting antigen activation-suppressing proteins; and modification” also include compounds selected from the 0094 (c) substances with the activity of using RNAi effect group consisting of to inhibit the expression of genes encoding ER-TR7 antigen 0074 (a) antisense nucleic acids against transcript of the activation-suppressing proteins. genes encoding ER-TR7 antigen protein modification 0095 Antibodies that bind to the above-described ER enzymes, or portions thereof; TR7 antigen protein, synthetase, modification enzyme, 0075 (b) nucleic acids with the ribozyme activity of spe demodification enzyme-Suppressing protein, ER-TR7 anti cifically cleaving transcripts of genes encoding ER-TR7 anti gen activation-Suppressing protein can be prepared by meth gen protein modification enzymes; and ods known to those skilled in the art. Polyclonal antibodies 0076 (c) substances with the activity of using RNAi effect can be obtained, for example, by the following procedure: to inhibit the expression of genes encoding ER-TR7 antigen Small animals such as rabbits are immunized with an above protein modification enzymes. described natural protein or a recombinant protein expressed 0077. The “demodification” of ER-TR7 antigen refers to a in microorganisms as a fusion protein with epitope tags Such reaction Such as hydrolysis to eliminate the post-translational as GST, or a partial peptide thereof. Sera are obtained from modification that is required for the activity of ER-TR7 anti these animals and purified by, for example, ammonium Sul gen. fate precipitation, Protein A or G columns, DEAE ion US 2012/0231 019 A1 Sep. 13, 2012 exchange columns, affinity columns coupled with the ER antibodies for human administration (antibody therapy), the TR7 antigen protein, synthetase, modification enzyme, antibodies are preferably human or humanized antibodies in demodification enzyme-Suppressing protein, ER-TR7 anti order to reduce immunogenicity. gen activation-suppressing protein described above, a syn 0101. In addition, included in the present invention are thetic peptide, or such, to prepare antibodies. Monoclonal methods for producing fibrosis-Suppressing agents compris antibodies can be obtained by the following procedure: small ing as an active ingredient an antibody that binds to an ER animals such as mice are immunized with an above-described TR7 antigen protein, which comprise the step of preparing the ER-TR7 antigen protein, synthetase, modification enzyme, antibody by using the antigen protein. demodification enzyme-Suppressing protein, ER-TR7 anti 0102. Furthermore, in the present invention, low-molecu gen activation-Suppressing protein, or a partial peptide lar-weight Substances (low-molecular-weight compounds) thereof. Spleens are removed from the mice and crushed to that bind to the above-described ER-TR7 antigen proteins, isolate cells. The cells are fused with mouse myeloma cells synthetases, modification enzymes, demodification enzyme using a reagent Such as polyethylene glycol. Clones produc Suppressing proteins, ER-TR7 antigen activation-suppress ing antibodies that bind to an above-described ER-TR7 anti ing proteins are also included in the Substances capable of gen protein, synthetase, modification enzyme, demodifica inhibiting the function of the above-described ER-TR7 anti tion enzyme-Suppressing protein, ER-TR7 antigen gen proteins, synthetases, modification enzymes, demodifi activation-suppressing protein are selected from among the cation enzyme-suppressing proteins, ER-TR7 antigen activa resulting fused cells (hybridomas). The obtained hybridomas tion-Suppressing proteins. Such low-molecular-weight are then transplanted in the peritoneal cavities of mice, and Substances may be natural or artificial compounds. In general, ascites collected. The obtained monoclonal antibodies can be the compounds can be produced or obtained by methods purified by, for example, ammonium sulfate precipitation, knownto those skilled in theart. In addition, the substances of Protein A or G columns, DEAE ion exchange columns, affin the present invention capable of inhibiting the expression or ity columns coupled with the ER-TR7 antigen protein, syn function of the above-described ER-TR7 antigen proteins, thetase, modification enzyme, demodification enzyme-Sup synthetases, modification enzymes, demodification enzyme pressing protein, ER-TR7 antigen activation-Suppressing Suppressing proteins, ER-TR7 antigen activation-suppress protein described above, or a synthetic peptide, or such. ing proteins include dominant-negative mutants (dominant 0096. The antibodies of the present invention are not par negative proteins) for the above-described ER-TR7 antigen ticularly limited as long as they bind to an above-described proteins, synthetases, modification enzymes, demodification ER-TR7 antigen protein, synthetase, modification enzyme, enzyme-suppressing proteins, ER-TR7 antigen activation demodification enzyme-Suppressing protein, ER-TR7 anti Suppressing proteins. gen activation-suppressing protein of the present invention. 0103) A protein variant that is dominant negative for an The antibodies of the present invention may be human anti ER-TR7 antigen protein, synthetase, modification enzyme, bodies, humanized antibodies created by gene recombina demodification enzyme-suppressing protein, or ER-TR7 tion, fragments or modified products of Such antibodies, in antigen activation-suppressing protein’ refers to a protein addition to the polyclonal and monoclonal antibodies that, when expressed, has the function of reducing or elimi described above. nating the activity of the endogenous wild type protein. 0097. The proteins of the present invention used as sensi 0104. In the present invention, “nucleic acids’ refer to tizing antigens to prepare antibodies are not limited in terms both RNAs and DNAs. Chemically synthesized nucleic acid of the animal species from which the proteins are derived. analogs, such as so-called “PNAs (peptide nucleic acids) or However, the proteins are preferably derived from mammals, Morpholino antisense oligos, are also included in the nucleic for example, mice and humans. Human-derived proteins are acids of the present invention. PNAS are nucleic acids in particularly preferred. which the fundamental backbone structure of nucleic acids, 0098. In the present invention, the proteins to be used as the pentose-phosphate backbone, is replaced by a polyamide sensitizing antigens may be whole proteins or partial peptides backbone with glycine units, and Morpholino antisense oli thereof. Such partial peptides of the proteins include, for gos are nucleic acids in which the pentose-phosphate back example, amino-terminal fragments and carboxyl-terminal bone is replaced by a morpholino backbone. PNAS and mor fragments of the proteins. Herein, “antibodies' refer to anti pholino antisense oligos have a three-dimensional structure bodies that react with a full-length protein or fragment quite similar to that of nucleic acids. thereof. 0105 Methods for suppressing the expression of specific 0099. In addition to immunizing nonhuman animals with endogenous genes using antisense technology are well antigens to obtain the above hybridomas, human lympho knownto those skilled in theart. There area number of causes cytes, for example, EB virus-infected human lymphocytes, for the action of antisense nucleic acids in Suppressing target can be sensitized in vitro with the proteins or with cells gene expression, including: expressing the proteins, or with lysates thereof, and the sen 0106 inhibition of transcription initiation by triplex for sitized lymphocytes can be fused with human-derived mation; myeloma cells with the ability to divide permanently, for 0107 transcription inhibition by hybrid formation at a site example, U266, to obtain hybridomas that produce desired with a local open loop structure generated by an RNA poly human antibodies with binding activity to the proteins. merase: 0100. It is expected that antibodies against the above-de 0.108 transcription inhibition by hybrid formation with scribed ER-TR7 antigen proteins, synthetases, modification the RNA being synthesized: enzymes, demodification enzyme-Suppressing proteins, ER 0109 splicing inhibition by hybrid formation at an intron TR7 antigen activation-suppressing proteins of the present exonjunction; invention exhibit the effect of inhibiting protein expression or 0110 splicing inhibition by hybrid formation at the site of function by binding to the proteins. When using the prepared spliceosome formation; US 2012/0231 019 A1 Sep. 13, 2012

0111 inhibition of transport from the nucleus to the cyto present invention are not limited to the lengths mentioned plasm by hybrid formation with mRNA: above, and they may be 100 nucleotides or more, or 500 0112 translation initiation inhibition by hybrid formation nucleotides or more. at the capping site or poly(A) addition site; 0118 Expression of the above-mentioned genes encoding 0113 inhibition of translation initiation by hybrid forma ER-TR7 antigen proteins, synthetases, modification tion at the translation initiation factor binding site; enzymes, demodification enzyme-suppressing proteins, ER 0114 inhibition of translation by hybrid formation at the TR7 antigen activation-suppressing proteins can also be ribosome binding site adjacent to the initiation codon; inhibited using ribozymes or ribozyme-encoding DNAs. 0115 inhibition of peptide chain elongation by hybrid Ribozymes refer to RNA molecules with catalytic activity. formation in the translational region of mRNA or at the poly There are various ribozymes with different activities. Among some binding site of mRNA; and others, studies that focused on ribozymes functioning as 0116 inhibition of gene expression by hybrid formation at RNA-cleaving enzymes have enabled the design of the protein-nucleic acid interaction sites (Hirashima and ribozymes that cleave RNAs in a site-specific manner. Some Inoue, Shin Seikagaku Jikken Koza 2 (New Courses in ribozymes have 400 or more nucleotides, such as group I Experimental Biochemistry 2), Kakusan (Nucleic Acids) IV: intron type ribozymes and M1 RNA, which is comprised by “Idenshi no Fukusei to Hatsugen (Gene replication and RNase P, but others, called hammerhead and hairpin expression), Ed. The Japanese Biochemical Society, Tokyo ribozymes, have a catalytic domain of about 40 nucleotides Kagakudojin, 1993, pp. 319-347). There are causes for the (Koizumi, M. and Otsuka, E., Tanpakushitsu Kakusan Koso action of antisense RNA in Suppressing target gene expres (Protein, Nucleic Acid, and Enzyme) 1990, 35, 2191). sion includes inhibition of gene expression by RNAi effect of 0119 For example, the autocatalytic domain of a hammer double strand RNA formation by hybrid formation with head ribozyme cleaves the sequence G13U14C15 at the 3' mRNA, and such. Thus, antisense nucleic acids inhibit the side of C15. Base pairing between U14 and A9 has been expression of target genes by inhibiting various processes, shown to be essential for this activity, and the sequence can be Such as transcription, splicing, and translation. cleaved when C15 is substituted with A15 or U15 (Koizumi, 0117 The antisense nucleic acids used in the present M. et al., FEBS Lett. 1988, 239, 285; Koizumi, M. and invention may inhibit the expression and/or function of genes Otsuka, E., Tanpakushitsu Kakusan Koso (Protein, Nucleic encoding any of the ER-TR7 antigen proteins, synthetases, Acid, and Enzyme) 1990, 35, 2191; and Koizumi, M. et al., modification enzymes, demodification enzyme-Suppressing Nucl. Acids Res. 1989, 17, 7059). proteins, ER-TR7 antigen activation-suppressing proteins 0120 In addition, hairpin ribozymes are also useful for the described above, based on any of the actions described above. purposes of the present invention. Such ribozymes are found In one embodiment, antisense sequences designed to be in, for example, the minus strand of satellite RNAs of tobacco complementary to an untranslated region adjacent to the 5' ringspot viruses (Buzayan, J. M., Nature 1986, 323,349). It end of an mRNA for a gene encoding an above-described has been shown that target-specific RNA-cleaving ribozymes ER-TR7 antigen protein, synthetase, modification enzyme, can also be created from hairpin ribozymes (Kikuchi, Y. and demodification enzyme-Suppressing protein, ER-TR7 anti Sasaki, N., NuclAcids Res. 1991, 19, 6751; and Kikuchi, Y. gen activation-suppressing protein may be effective for inhib Kagaku to Seibutsu (Chemistry and Biology) 1992, 30, 112). iting translation of the gene. Sequences complementary to a Thus, the expression of the above-described genes encoding coding region or 3'-untranslated region can also be used. ER-TR7 antigen proteins, synthetases, modification Thus, the antisense nucleic acids to be used in the present enzymes, demodification enzyme-suppressing proteins, ER invention include not only nucleic acids comprising TR7 antigen activation-suppressing proteins can be inhibited sequences antisense to the coding regions, but also nucleic by using ribozymes to specifically cleave the gene transcripts. acids comprising sequences antisense to untranslated regions 0121 The expression of endogenous genes can also be of genes encoding the above-described ER-TR7 antigen pro suppressed by RNA interference (hereinafter abbreviated as teins, synthetases, modification enzymes, demodification “RNAi’), using double-stranded RNAs comprising a enzyme-Suppressing proteins, ER-TR7 antigen activation sequence the same as or similar to a target gene sequence. Suppressing proteins. Such antisense nucleic acids to be used 0122. A great many disease-related genes have been rap are linked downstream of adequate promoters and are pref idly identified since the entire human genome nucleotide erably linked with transcription termination signals on the 3' sequence was revealed upon the recent completion of the side. Nucleic acids thus prepared can be introduced into genome project, and currently specific gene-targeted thera desired animals (cells) using known methods. The sequences pies and drugs are being actively developed. Of these, the of the antisense nucleic acids are preferably complementary application to gene therapy of Small interfering RNAS (siR to a gene or portion thereof encoding an ER-TR7 antigen NAs), which produce the effect of specific post-transcrip protein, synthetase, modification enzyme, demodification tional Suppression, has been drawing attention. RNAi is a enzyme inhibiting protein, ER-TR7 antigen activation inhib technology currently drawing attention in which double iting protein that is endogenous to the animals (cells) to be stranded RNAs (dsRNAs) incorporated into cells suppress transformed with them. However, the sequences need not be the expression of genes with sequences homologous to the perfectly complementary, as long as the antisense nucleic dsRNAs. In mammalian cells, RNAi can be induced using acids can effectively suppress expression of a gene. The tran dsRNAS and has many advantages: compared to knockout scribed RNAs preferably have 90% or higher, and most pref mice, RNAi has a stable effect, simple experiments, low erably 95% or higher complementarity to target gene. To costs, and so on. effectively inhibit target gene expression using antisense I0123 RNAi is a phenomenon where an mRNA compris nucleic acids, the antisense nucleic acids are preferably at ing a base sequence complementary to a double-stranded least 15 nucleotides long, and less than 25 nucleotides long. RNA is degraded. RNAi is a method based on this phenom However, the lengths of the antisense nucleic acids of the enon, in which the expression of an arbitrary gene is Sup US 2012/0231 019 A1 Sep. 13, 2012

pressed by artificially introducing a 21- to 23-mer double a small number of bases are included, as long as they have the stranded RNA (siRNA). In 1998, Fire et al. discovered using function of Suppressing the expression of Such genes. C. elegans that double-stranded RNA silences genes in a 0128. Some details of the RNAi mechanism still remain sequence-specific manner (Fire, A. et al., Nature 1998, 391, poorly understood, but it is known that an enzyme called 806-811). After elucidating the underlying mechanism of “DICER' (a member of the RNase III nuclease family) binds mRNA cleavage by 21- to 23-mer processed double-stranded to a double-stranded RNA and degrades it in to small frag RNA (Zamore P D. et al., Cell 2000, 101,25-33), identifying ments, called “siRNAs. The double-stranded RNAs of the RNA-induced silencing complex (RISC) (Hammond, S. M. present invention that have RNAi effect include such double et al., Science 2001, 293, 1146-1150), and cloning Dicer stranded RNAs prior to being degraded by DICER. Specifi cally, since even long RNAs that have no RNAi effect when (Bernstein, E. et al., Nature, 409, 363-366), Elbashir et al. intact can be degraded into siRNAs which have RNAi effect demonstrated in 2001 that siRNA could also suppress expres in cells, the length of the double-stranded RNAs of the present sion in a sequence-specific manner in mammalian cells (El invention is not particularly limited. bashir S M. et al., Nature 2001, 411, 494-498). Thus, appli I0129. For example, long double-stranded RNAs covering cation of RNAi to gene therapy is highly expected. the full-length or near full-length mRNA of a gene encoding 0.124 Nucleic acids with inhibitory activity based on an above-described ER-TR7 antigen protein, synthetase, RNAi effect are generally referred to as siRNAs or shRNAs. modification enzyme, demodification enzyme-suppressing RNAi is a phenomenon in which, when cells or such are protein, ER-TR7 antigen activation-suppressing protein can introduced with short double-stranded RNAs (hereinafter be pre-digested, for example, by DICER, and then the degra abbreviated as “dsRNAs) comprising sense RNAs that com dation products can be used as agents of the present invention. prise sequences homologous to the mRNAS of a target gene, These degradation products are expected to contain double and antisense RNAS that comprise sequences homologous a stranded RNA molecules with RNAi effect. With this method, sequence complementary thereto, the dsRNAs bind specifi it is not necessary to specifically select the regions expected to cally and selectively to the target gene mRNAs, induce their have RNAi effect. In other words, it is not necessary to accu disruption, and cleave the gene transcript, thereby effectively rately determine regions with RNAi effect in the mRNAs of inhibiting (Suppressing) target gene expression. For example, the genes described above. when dsRNAs are introduced into cells, the expression of 0.130. The siRNAs of the present invention are not neces genes with sequences homologous to the RNAS is Suppressed sarily single pairs of double-stranded RNAs directed to target (the genes are knocked down). As described above, RNAi can sequences, but may be mixtures of multiple double-stranded Suppress the expression of target genes, and is thus drawing RNAs directed to regions that cover the target sequence. The attention as a method applicable to gene therapy, or as a siRNAs of the present invention include so-called “siRNA simple gene knockout method replacing conventional meth cocktails”. ods of gene disruption, which are based on complicated and I0131 All nucleotides in the siRNAs of the present inven inefficient homologous recombination. The RNAs to be used tion do not necessarily need to be ribonucleotides (RNAs). in RNAi are not necessarily perfectly identical to the genes or Specifically, one or more of the ribonucleotides constituting portions thereof that encode an above-described ER-TR7 the siRNAs of the present invention may be replaced with antigen protein, synthetase, modification enzyme, demodifi corresponding deoxyribonucleotides. The term "correspond cation enzyme-suppressing protein, ER-TR7 antigen activa ing' means that although the Sugar moieties are structurally tion-suppressing protein; however, the RNAs are preferably differently, the nucleotide residues (adenine, thymine perfectly homologous to the genes or portions thereof. (uracil), guanine, or cytosine) are the same. For example, 0.125. The targets of the siRNAs to be designed are not deoxyribonucleotides corresponding to ribonucleotides with particularly limited, as long as they are genes encoding an adenine refer to deoxyribonucleotides with adenine. The term above-described ER-TR7 antigen protein, synthetase, modi “or more described above is not particularly limited, but fication enzyme, demodification enzyme inhibiting protein, preferably refers to a small number of about two to five ER-TR7 antigen activation inhibiting protein. Any region of ribonucleotides. the gene can be a candidate for a target. 0.132. Furthermore, DNAs (vectors) that are capable of 0126 The siRNAs can be introduced into cells by adopt expressing the above-described RNAs of the present inven ing methods that comprise annealing two RNA strands or tion are also included in preferred embodiments of the above such. The double-stranded RNA described above may be described compounds that can Suppress the expression of closed at one end with a hairpinstructure (shRNAs). shRNAs genes encoding ER-TR7 antigen proteins, synthetases, modi refer to short hairpin RNAs, which are RNA molecules with fication enzymes, demodification enzyme-Suppressing pro a stem-loop structure, since a portion of the single strand teins, or ER-TR7 antigen activation-suppressing proteins of constitutes a strand complementary to another portion. Thus, the present invention. The DNAs that are capable of express molecules capable of forming an intramolecular double ing the above-described double-stranded RNAs of the present stranded RNA are also included in the siRNAs of the present invention are, for example, DNAS having a structure in which invention. a promoter(s) is linked to DNA encoding one strand of the 0127. In a preferred embodiment of the present invention, double-stranded RNA and to DNA encoding the other so as to RNAs (siRNAs) that have an RNAi effect and thus can Sup express both of the RNAs. Alternatively, such DNAs may be press the genes encoding the above-described ER-TR7 anti those in which a target sequence has been flanked by appro gen proteins, synthetases, modification enzymes, demodifi priate sequences and inserted as a palindromic structure cation enzyme-suppressing proteins, or ER-TR7 antigen downstream of an appropriate promoter. This yields an activation-suppressing proteins are included in the siRNAs of shRNA described above. the present invention. For example, even double-stranded I0133. Furthermore, the expression-inhibitory substances RNAs with a structure having a deletion or addition of one or of the present invention include compounds that inhibit the US 2012/0231 019 A1 Sep. 13, 2012 expression of genes encoding the above-described ER-TR7 ity pneumonitis, idiopathic pulmonary fibrosis, lymphocytic antigen proteins, synthetases, modification enzymes, interstitial pneumonia, Langerhans-cell granulomatosis, cys demodification enzyme-Suppressing proteins, or ER-TR7 tic fibrosis, pustular fibrosis, pulmonary fibrosis, fibrosing antigen activation-suppressing proteins, by binding to tran pulmonary alveolitis, interstitial fibrosis, diffuse pulmonary Scription factors that bind to the expression regulatory regions fibrosis, chronic interstitial pneumonia, bronchiectasis, bron of genes encoding the above-described ER-TR7 antigen pro chiolar fibrosis, peribronchial fibrosis, pleural fibrosis, and teins, synthetases, modification enzymes, demodification Such in the respiratory system such as lung; enzyme-Suppressing proteins, or ER-TR7 antigen activation 0140 male hypogonadism, myotonic dystrophy, fibrosis Suppressing proteins. Such as associated with Peyronie's disease, chronic tubuloint 0134. The present invention also relates to methods for erstitial nephritis, autosomal recessive cystic kidney, Suppressing fibrosis in body tissues such as skin and organs of myeloma kidney, hydronephrosis, rapidly progressive glom Subjects, in which "fibrosis-suppressing agents of the erulonephritis, nephrotoxic diseases, Xanthogranulomatous present invention are administered to the Subjects. pyelonephritis, sickle cell nephropathy, nephrogenic diabetes 0135 Furthermore, the “fibrosis-suppressing agents' of insipidus, autosomal dominant polycystic kidney disease, the present invention can be advantageously used to treat or chronic glomerular nephritis, IgA nephropathy, renal sclero prevent fibrotic diseases (diseases associated with excessive sis, focal glomerulosclerosis, membranous nephritis, mem tissue fibrosis), because they can efficiently suppress fibrosis branoproliferative glomerulonephritis, chronic pyelonephri of body tissues such as skin and organs. In the present inven tis, renal amyloidosis, polycystic kidney disease, tion, there is no limitation to the type of fibrotic disease. The retroperitoneal fibrosis, pathology in the kidney associated “fibrotic diseases” in the present invention is not particularly with a connective tissue disease such as lupus nephritis, dia limited, and specifically include, for example, elastosis, scle betic nephropathy, chronic prostatitis, and urocystitis associ roderma, chronic peritonitis, and retroperitoneal fibrosis in ated with Schistosomiasisin the urogenital system such as integumentary and epithelial tissues such as skin; kidney; 0.136 polymyositis, dermatomyositis, polyarteritis 0141 fibrotic breast disease, mammary fibroadenoma, nodosa, Soft tissue fibrosis, chronic rheumatoid arthritis, pal and such; mar fibromatosis, tendinitis, tenovaginitis, Achilles tendini 0.142 congenital torticollis, ankylosing spondylitis, spinal tis, mycetoma pedis, and Such in Supportive tissues such as cord disorders such as neurofibroma and neurological dys connective tissues and muscles; function after spinal cord injury, and cranial nerve diseases 0.137 myelofibrosis, hypersplenism, vasculitis, brad Such as Parkinson's disease and Alzheimer's disease in the yarrhythmia, arteriosclerosis, obstructive thrombotic angii nervous system such as spinal cord; tis, nodular fibrosis, angina pectoris, dilated congestive car 0.143 retrolental fibrosis and proliferative retinopathy in diomyopathy, heart failure, restrictive cardiomyopathy, the eyeball; and diffuse nonobstructive cardiomyopathy, obstructive cardi 0144) sarcoidosis that develops systemic involvement, omyopathy, cor pulmonale, mitral Stenosis, aortic valve fibrosis and systemic Scleroderma associated with systemic Stenosis, chronic pericarditis, endocardial fibrosis, endomyo lupus erythematosus, polymyositis, dermatomyositis, and cardial fibrosis, and Such in blood tissues and vascular system such. However, in the present invention, the “fibrotic disease' Such as bone marrow and heart; is not limited thereto, and includes diseases caused by fibrosis 0138 chronic pancreatitis, Crohn's disease, ulcerative in each body tissue such as skin and organs. colitis, alcoholic hepatitis, chronic hepatitis B, chronic hepa 0145 The “fibrosis-suppressing agents’ of the present titis C, Wilson's disease, cirrhosis, viral hepatitis, Gaucher's invention can also be referred to as “therapeutic agents for disease, glycogen storage disease, alpha 1-antitrypsin defi fibrosis”, “fibrosis-improving agents”, “antifibrotic agents', ciency, hemochromatosis, tyrosinemia, levulosemia, galac or the like. Meanwhile, the “suppressing agents’ of the tosemia, Zellweger syndrome, congenital hepatic fibrosis, present invention can also be referred to as “pharmaceutical portal hypertension, hepatic granulomatosis, Budd-Chiari agents”, “pharmaceutical compositions”, “therapeutic medi syndrome, primary Sclerosing cholangitis, fatty liver, nonal cines', or the like. coholic hepatitis, hepatic fibrosis, congenital hepatic fibrosis, 0146 The “treatments of the present invention also com alcoholic cirrhosis, viral cirrhosis, parasitic cirrhosis, toxic prise preventive effects, ameliorating effects, or Such that can cirrhosis, trophopathic cirrhosis, congestive cirrhosis, Suppress the onset of fibrosis in advance. The treatments are hepatic sclerosis, Charcot's cirrhosis, Todd's cirrhosis, sec not necessarily limited to those producing a perfect therapeu ondary biliary cirrhosis, unilobar cirrhosis, cirrhosis resulting tic effect on tissues developing fibrosis, and the effects may be from chronic nonSuppurative destructive cholangitis, partial. obstructive cirrhosis, cholangiolitic cirrhosis, biliary cirrho 0147 According to the present invention, fibrosis of body sis, atrophic cirrhosis, postnecrotic cirrhosis, posthepatitic tissue in a Subject can be effectively suppressed by adminis cirrhosis, nodular cirrhosis of the liver, mixed cirrhosis, tering a “fibrosis-Suppressing agent of the present invention micronodular cirrhosis, compensatory cirrhosis, decompen to the subject. There is no limitation on the administration sated cirrhosis, macronodular cirrhosis, septal cirrhosis, route of the “fibrosis-Suppressing agents'; however, cryptogenic cirrhosis, periportal cirrhosis, portal cirrhosis, parenteral route is preferred. Preferred examples of such primary biliary cirrhosis, and Such in the gastrointestinal sys parenteral routes include intravenous, intraarterial, intraperi tem. Such as liver, toneal, and Subcutaneous routes. The “fibrosis-Suppressing 0139 coccidioidomycosis, blastomycosis, allergic bron agents' of the present invention may be administered sys chopulmonary aspergillosis, Goodpasture's syndrome, pull temically or locally (for example, administered directly to monary fibrosis associated with adult respiratory distress Syn fibrotic liver tissues). The administered dose varies depend drome, chronic obstructive pulmonary disease, pulmonary ing on the patient's weight and age, and the administration atelectasis, pneumonia, chalicosis, asbestosis, hypersensitiv method or such; however, those skilled in the art (medical US 2012/0231 019 A1 Sep. 13, 2012

practitioners, Veterinarians, pharmacists, and the like) can 1304-1311, 2004). ER-TR7 (10 ul in 200 ul of PBS) was appropriately select a suitable dose. administered to the cirrhosis-induced mice twice a week for 0148 Preferred subjects to be administered with the two weeks (four times). These mice were used as an ER-TR7 "fibrosis-Suppressing agents of the present invention are treated group. Furthermore, mice administered with PBS mammals, including humans, domestic animals, pets, and alone in the same way were used as an untreated group, while experimental animals. In particular, mammals (patients) with cirrhosis-uninduced mice, which were not administered with fibrotic diseases, for example, cirrhosis and pulmonary fibro carbon tetrachloride, were used as a control group. Mice of sis, are preferred Subjects of the present invention. each group were sacrificed to collect their livers. 014.9 The pharmaceutical agents of the present invention 0156 Portions of second lobes from the collected livers may be administered orally or parenterally as pharmaceutical were embedded in the OCT compound (Miles), an embed compositions appropriately comprising pharmaceutically ding medium for cryosectioning. Cryoblocks were prepared acceptable (pharmaceutically inactive) carriers, excipients, using liquid nitrogen, and then sliced into 6 um-thick sections and/or diluents. Such carriers, excipients, and/or diluents of using Cryostat (Microm). the present invention include, but are not limited to, for 0157. The resulting sections were fixed with acetone example, water, physiological saline, phosphate buffered (Wako Pure Chemical Industries Ltd.) for ten minutes, and saline, polyvinyl alcohol, polyvinylpyrrolidone, carboxylvii then washed with phosphate buffer. Next, anti-type IV col nyl polymer, Sodium alginate, water-soluble dextran, pectin, lagen antibody (rabbit serum, 2,000 times dilution: LSL) was Xanthan gum, gum Arabic, gelatin, agar, glycerin, propylene added as the primary antibody, and the sections were incu glycol, polyethylene glycol, Vaseline, paraffin, Stearyl alco bated at room temperature for one hour. Then, the secondary hol, Stearic acid, human serum albumin, mannitol, Sorbitol, antibody reaction was conducted using peroxidase-labeled and lactose. The pharmaceutical compositions of the present anti-rabbit antibody (200 times dilution; MP biomedicals), invention may further comprise additives, such as preserva followed by addition of DAB substrate (Nichirei) (FIG. 1(1)). tives. The pharmaceutical compositions of the present inven 0158. Furthermore, the resulting sections were fixed with tion may further comprise other pharmacological ingredients. Bouin solution (Sigma-Aldrich), and then nuclear staining 0150. The pharmaceutical composition of the present was carried out using Weigert’s Iron Hematoxyline Set invention may be provided as oral or parenteral preparations; (Sigma-Aldrich) according to the instruction manual. After however they are more preferably provided as parenteral washing with water, the sections were stained with Trichrome preparations. Preferred parenteral preparations are liquid Masson (Sigma-Aldrich) according to the instruction manual preparations such as liquids and Suspensions. Injections or (FIG. 1(2)). The resulting samples were observed under a drops are especially preferred. light microscope (LEICA Microsystems). 0151. Furthermore, the present invention provides meth 0159. Some examples of the obtained staining images of ods for treating or preventing fibrotic diseases, which com liver tissues are shown in FIG. 1. The respective stains prise the step of administering agents of the present invention showed that the images of the ER-TR7-treated group were to individuals (for example, patients with fibrotic diseases, similar to those of the control group. This suggests that the etc.). fibrotic conditions have been improved as compared to the 0152 The present invention also relates to the use of the untreated group. Specifically, the ER-TR7 treatment was above-described ER-TR7 or functionally equivalent sub demonstrated to relieve the fibrosis symptoms. stances in producing the agents of the present invention (fi brosis-Suppressing agents, agents for treating or preventing Example 2 fibrotic diseases, and Such). 0153 All publications, patents, and patent applications Therapeutic Effect of ER-TR7 in Cirrhosis Model cited herein are incorporated herein by reference in their Mice: Determination of Expression Levels of Fibro entirety. sis Markers

EXAMPLES 0160 A mixture of carbon tetrachloride (10 ul; Sigma Aldrich) with 90 ul of mineral oil (Sigma-Aldrich) was 0154 Hereinbelow, the present invention will be specifi administered into the peritoneal cavities of C57BL/6J mice cally described with reference to Examples, but the technical (female, five to six weeks old; CLEAJapan Inc.) twice a week Scope of the present invention is not to be construed as being for four weeks (seven times) to induce hepatic fibrosis. Then, limited thereto. carbon tetrachloride was additionally administered twice a week for two weeks (11 times in all) to induce cirrhosis. The Example 1 carbon tetrachloride-induced hepatic fibrosis model has Therapeutic Effect of ER-TR7 in Cirrhosis Model excellent reproducibility, and is thus widely used as an experi Mice: Clinical Presentation mental cirrhosis model (Sakaida I., et al., Hepatology, 40: 1304-1311, 2004). ER-TR7 (10 ul in 200 ul of PBS) was 0155. A mixture of carbon tetrachloride (10 ul; Sigma administered to the cirrhosis-induced mice twice a week for Aldrich) with 90 ul of mineral oil (Sigma-Aldrich) was two weeks (four times). These mice were used as an ER-TR7 administered into the peritoneal cavities of C57BL/6J mice treated group. Furthermore, mice administered with PBS (female, five to six weeks old; CLEAJapan Inc.) twice a week alone in the same way were used as an untreated group, while for four weeks (seven times) to induce hepatic fibrosis. Then, cirrhosis-uninduced mice, which were not administered with carbon tetrachloride was additionally administered twice a carbon tetrachloride, were used as a control group. Mice of week for two weeks (11 times in all) to induce cirrhosis. The each group were sacrificed to collect their livers. carbon tetrachloride-induced hepatic fibrosis model has 0.161 Some portions were excised from the collected liv excellent reproducibility, and is thus widely used as an experi ers, transferred into 1.5-ml tubes, and frozen in liquid nitro mental cirrhosis model (Sakaida I., et al., Hepatology, 40: gen. 1 ml of RNA-Bee (TEL-TEST, Inc.) per 50 mg of tissue US 2012/0231019 A1 Sep. 13, 2012 was added. The tissue was homogenized, and 200ul of chlo roform (Sigma-Aldrich) was added to the resulting suspen TABLE 1 - continued sion. The mixture was gently mixed and then cooledonice for about five minutes, and centrifuged in a centrifuge (Centri NM_013693 fuge 5417R: Eppendorf) at 12,000 rpm and 4°C. for 15 Mus musculus tumor necrosis factor (Tnf), mRNA minutes. After centrifugation, 500 ul of the Supernatant was (TNF-C.) transferred to a fresh 1.5-ml tube, and an equal volume of (SEQ ID NO: 7) isopropanol (500 ul; Sigma-Aldrich) was added thereto. The F: CAGGAGGGAGAACAGAAACTCCA solution was mixed, and then 1 Jul of glycogen (Invitrogen) (SEQ ID NO: 8) was added thereto. The mixture was cooled on ice for 15 R. CCTGGTTGGCTGCTTGCTT minutes, and then centrifuged at 12,000 rpm and 4°C. for 15 NM_0077.43 minutes. Next, RNA precipitate obtained after washing three Mus musculus pro collagen, type I, alpha 2 times with 1,000 ul of 75% ethanol (Sigma-Aldrich) was (Co11a2), mRNA (Type 1 collagen) air-dried for 30 minutes to one hour, and then dissolved in (SEQ ID NO: 9) Otsuka distilled water (Otsuka Pharmaceutical Co., Ltd). The F: ACCCGATGGCAACAATGGA solution was 100 times diluted with Otsuka distilled water. (SEQ ID NO : 10) The RNA concentrations of extracted samples in UV plates R: ACCAGCAGGGCCTTGTTCAC (Corning Costar) were determined using a plate reader NM_007392 (POWER Wave XS: BIO-TEK). The concentrations of the Mus musculus actin, alpha 2, Smooth muscle, aorta (Acta2), mRNA (C-SMA) obtained RNA samples were adjusted to 500 ng/20 ul. The (SEQ ID NO: 11) samples were heated at 68°C. for three minutes in a BLOCK F: GAGCATCCGACACTGCTGACA INCUBATOR (ASTEC), and cooled on ice for ten minutes. (SEQ ID NO: 12) After cooling on ice, 80 ul of RT PreMix solution (composi R: AGCACAGCCTGAATAGCCACATAC tion: 18.64 ul of 25 mM MgCl2 (Invitrogen), 20 Jul of 5x Buffer (Invitrogen), 6.6 ul of 0.1 MDTT (Invitrogen), 10ul of 10 mM dNTP mix (Invitrogen), 2 ul of Rnase Inhibitor (Invit (0163 The result showed that the expression levels of all rogen), 1.2 ul of MMLV Reverse Transcriptase (Invitrogen), tested genes were reduced in the ER-TR7-treated group when 2ul of Random primer (Invitrogen), and sterile distilled water compared to the control group. This suggests that ER-TR7 (Otsuka distilled water, Otsuka Pharmaceutical Co., Ltd.)), administration results in suppression of fibrosis (FIG. 2). which had been prepared in advance, was added to the samples. The mixtures were heated in a BLOCKINCUBA Example 3 TOR at 42°C. for one hour and at 99° C. for five minutes, and then cooled on ice. cDNAs (100 ul) were prepared by the Therapeutic Effect of ER-TR7 in Ulcerative Colitis procedure described above. Model Mice: Macroscopic Features (0162. PCR was carried out using the prepared cDNAs in (0164. The ulcerative colitis model mice were prepared by the following composition. 1 ul of cDNA was mixed with allowing C57BL/6J mice (female, seven weeks old; CLEA 12.5 ul of SYBR Premix EX Tag (TAKARA), 11.3 ul of Japan Inc.) to freely drink high-concentration chlorine water sterile distilled water (Otsuka distilled water), and 0.1 ul of containing 3% dextran sulfate sodium (DSS: Wako Pure primers (50 pmol/ul: Table 1). The resulting mixtures were Chemical Industries Ltd.) for seven days. At the same time reacted in Real-time PCR Dice (TAKARA) with 40 cycles of when the mice were fed with 3% DSS water, 10ul of ER-TR7 95°C. for 5 seconds and 60°C. for 30 seconds. After reaction, (0.4 mg/ml: BMA Biomedicals) premixed with 190 ul physi the expression level of each fibrosis marker gene was deter ological saline (Otsuka Pharmaceutical Co., Ltd.), or 200 ul mined relative to the expression levels of 36B4 gene and of physiological saline alone was injected into the peritoneal GAPDH gene as an internal standard. cavities of the mice. The groups of mice treated as described above were named the ER-TR7 group and control group. The TABLE 1. mice were reared for eight days while giving 3% DSS water. Then, the mice in each group were sacrificed, and their large NM_0073.93 Mus musculus actin, beta, cytoplasmic (Actb) , intestines were collected to determine their lengths. mRNA (B-actin) (0165. The result showed that the length of the intestines (SEQ ID NO: 1) was significantly conserved in the ER-TR7-administered F: CATCCGTAAAGACCTCTATGCCAAC group as compared with the control group (p<0.05; t test). (SEQ ID NO: 2) This suggests that ER-TR7 suppresses theatrophy of the large R: ATGGAGCCACCGATCCACA intestine due to fibrous degeneration (FIG. 3). NM 008084 Mus musculus glyceraldehyde-3-phosphate Example 4 dehydrogenase, mRNA (GAPDH) (SEQ ID NO : 3) F: AAATGGTGAAGGTCGGTGTG Therapeutic Effect of ER-TR7 in Ulcerative Colitis (SEQ ID NO : 4) Model Mice: Determination of Expression Levels of R: TGAAGGGGTCGTTGATGG Fibrosis Marker Genes NM_007475 (0166 The ulcerative colitis model mice were prepared by Mus musculus acidic ribosomal phosphoprotein allowing C57BL/6J mice (female, seven weeks old; CLEA PO (Arbp), mRNA (36B4) Japan Inc.) to freely drink high-concentration chlorine water (SEQ ID NO: 5) F: TTCCAGGCTTTGGGCATCA containing 3% dextran sulfate sodium (DSS: Wako Pure (SEQ ID NO : 6) Chemical Industries Ltd.) for seven days. At the same time R: ATGTTCAGCATGTTCAGCAGTGTG when the mice were fed with 3% DSS water, 10ul of ER-TR7 (0.4 mg/ml: BMA Biomedicals) premixed with 190 ul physi US 2012/0231 019 A1 Sep. 13, 2012

ological saline (Otsuka Pharmaceutical Co., Ltd.), or 200 ul Growth Medium (CELL APPLICATION) containing 10% of physiological Saline alone was injected into the peritoneal fetal calf serum (CELL APPLICATION) and 10 g/ml cavities of the mice. The groups of mice treated as described lipopolysaccharide (Escherichia Coli 055:B5: Sigma-Ald above were named the ER-TR7 group and control group. The rich) in 6-well plates (Corning Costar) with a gap cover glass mice were reared for eight days while giving 3% DSS water. (24x25 mm; Matsunami Glass Ind., Ltd.). The cells were Then, the mice in each group were sacrificed, and their large washed three times with PBS, and then ice-cold methanol intestines were collected to determine their lengths. (Wako Pure Chemical Industries Ltd.) was added thereto. The 0167. After length determination of the collected large cells were incubated at 4°C. for 15 minutes. After washing intestines, some portions were excised and transferred into three times with PBS, a BlockAce solution (Snow Brand Milk 1.5-ml tubes and frozen in liquid nitrogen. 1 ml of RNA-Bee Products Co., Ltd.) was added, and then the cells were incu (TEL-TEST, Inc.) per 50 mg of tissue was added. The tissue bated at room temperature for two hours. Then, ER-TR7 (0.4 was homogenized, and 200 ul of chloroform (Sigma-Aldrich) mg/ml) was added to the Block Ace solution at a ratio of was added to the resulting Suspension. The mixture was gen 1:500, and the cells were incubated at room temperature for tly mixed and then cooled on ice for about five minutes, and two hours. After washing three times with PBST (0.05% centrifuged in a centrifuge (Centrifuge 5417R, Eppendorf) at Tween20) for ten minutes, 1/2000 volume of Alexa Fluor (R) 12,000 rpm and 4° C. for 15 minutes. After centrifugation, 488 Goat Anti-rat IgG (Molecular Probes) and 1/5000 vol 500 ul of the supernatant was transferred to a fresh 1.5-ml ume of TO-PRO3 (Molecular Probes) were added to PBST. tube, and an equal Volume of isopropanol (500 ul; Sigma The mixture was added to the cells, and the cells were incu Aldrich) was added thereto. The solution was mixed, and then bated at room temperature for two hours in the dark. After 1 Jul of glycogen (Invitrogen) was added thereto. The mixture washing three times with PBST for ten minutes, the cells were was cooled on ice for 15 minutes, and then centrifuged at mounted with Fluorescent Mounting Medium (DAKO Cyto 12,000 rpm and 4°C. for 15 minutes. Next, RNA precipitate mation), and observed under a fluorescence microscope obtained after washing three times with 1,000 ul of 75% (Leica TCS SPE; Leica Microsystems). ethanol (Sigma-Aldrich) was air-dried for 30 minutes to one 0171 The result showed that normal human pulmonary hour, and then dissolved in Otsuka distilled water (Otsuka fibroblasts expressed ER-TR7 antigens (FIG. 5). Pharmaceutical Co., Ltd.). The solution was 100 times diluted with Otsuka distilled water. The RNA concentrations of Example 6 extracted samples in UV plates (Corning Costar) were deter mined using a plate reader (POWER Wave XS: BIO-TEK). Identification of ER-TR7 Antigen in Normal Human The concentrations of the obtained RNA samples were Pulmonary Fibroblast Extract adjusted to 500 ng/20 ul. The samples were heated at 68°C. for three minutes in a BLOCKINCUBATOR (ASTEC), and 0172 Normal human pulmonary fibroblasts were cultured cooledonice for ten minutes. After cooling on ice, 80 ul of RT until 80% confluent (approximately 5x107 cells) in HLF PreMix solution (composition: 18.64 ul of 25 mM MgCl2 Growth Medium containing 10% fetal calf serum in a T150 (Invitrogen), 20 ul of 5x Buffer (Invitrogen), 6.6 ul of 0.1 M flask (Corning Costar). After washing three times with PBS, DTT (Invitrogen), 10ul of 10 mM dNTP mix (Invitrogen), 2 HLF Growth Medium containing 10% fetal calf serum and 10 ul of Rnase Inhibitor (Invitrogen), 1.2 Lul of MMLV Reverse ug/ml lipopolysaccharide (Escherichia Coli 055:B5) was Transcriptase (Invitrogen), 2 ul of Random primer (Invitro added to the flask. The cells were cultured for three days. gen), and sterile distilled water (Otsuka distilled water; After washing three times with PBS, 500 ul of M-PER Mam Otsuka Pharmaceutical Co., Inc.)), which had been prepared malian Protein Extraction Reagent (PIERCE) was added to in advance, was added to the samples. The mixtures were prepare cell extract.8ll of the obtained cell extract was mixed heated in a BLOCKINCUBATOR at 42°C. for one hour and with 8 ul of 2x Sample Buffer (composition: 62.5 mM Tris at 99°C. for five minutes, and then cooledonice. cDNAs (100 HCl (pH 6.8: Invitrogen), 25% glycerol (Wako Pure Chemi ul) were prepared by the procedure described above. cal Industries Ltd.), 2% SDS (Nacalai Tesque),350 mMDTT 0168 PCR was carried out using the prepared cDNAs in (Sigma Aldrich), 0.01% Bromophenol Blue (Sigma-Ald the following composition. 1 ul of cDNA was mixed with rich)), and this was heated in a BLOCK INCUBATOR 12.5 ul of SYBR Premix EX Tag (TAKARA), 11.3 ul of (ASTEC) at 99 C. for five minutes. After heating, the total sterile distilled water (Otsuka distilled water), and 0.1 ul of volume was subjected to SDS-polyacrylamide gel electro primers (50 pmol/ul: Table 1). The resulting mixtures were phoresis (electrophoresis chamber: AE-6530M RAPIDAS reacted in Real-time PCR Dice (TAKARA) with 40 cycles of minislab gel electrophoresis chamber (ATTO); concentrating 95°C. for 5 seconds and 60°C. for 30 seconds. After reaction, gel: 125 mM Tris-HCl (pH 6.8: Invitrogen), 0.01% SDS the expression level of each fibrosis marker gene was deter (Nacalai Tesque), 3.75% acrylamide solution (29:1-acryla mined relative to the expression level of B-actin gene as an mide (Invitrogen): bisacrylamide (Invitrogen)); resolving internal standard. gel: 375 mM Tris-HCl (pH 8.8), 0.01% SDS, and 7.5% acry 0169. The result showed that the expression levels of all lamide solution; electrophoresis buffer: 25 mM Tris-HCl, 192 tested genes were reduced in the ER-TR7-treated group when mM glycine (Wako Pure Chemical Industries Ltd.), and 0.1% compared to the control group. This suggests that ER-TR7 SDS (pH 8.3)). Electrophoresis was carried out at 100 V for 40 minutes using Power Pac Basic (BIORAD). After electro administration results in suppression of fibrosis (FIG. 4). phoresis, the samples were transferred onto Immobilon-P Example 5 membrane (MILLIPORE) in a MinitransBlot Cell (BIO RAD) at 100 V for 40 minutes. Then, the membrane was ER-TR7 Immunocytochemistry of Normal Human incubated in a Block Ace solution at room temperature for one Pulmonary Fibroblasts hour. ER-TR7 (0.4 mg/ml) was mixed with a Block Ace solu (0170 Normal human pulmonary fibroblasts (1x10" cells; tion at a ratio of 1:500, and the membrane was incubated in CELL APPLICATION) were cultured for one day in HLF this solution at room temperature for two hours. After wash US 2012/0231 019 A1 Sep. 13, 2012

ing three times with TBST (50 mM Tris, 150 mM. NaCl, and body binding was visualized as brown signals. From the 0.01% Tween20) for five minutes, HRPGOAT anti-rat whole result described above, the presence of ER-TR7-positive cells A (GE Healthcare Bioscience) was added to TBST at a ratio in fibrotic pancreatic tissues was confirmed. Specifically, it of 1:2000. The membrane was incubated in the solution at was demonstrated that fibrotic pancreatic tissues could be a room temperature for one hour, and then washed three times therapeutic target for the agents of the present invention. with TBST for five minutes. Donkey Anti-Goat IgG (H+L) (Jackson ImmunoReseach Laboratories) was added to TBST (3) Accumulation of ER-TR7-Positive Cells in the Brain of at a ratio of 1:2000. The membrane was incubated in the Parkinson's Disease Model Mice Solution at room temperature for one hour. After washing three times with TBST for five minutes, the membrane was (0179 Gestational Day 14 of C57BL/6JcL mice (CLEA soaked in SuperSignal West Dura Extended Duration Sub Japan Inc.) were reared and allowed to deliver. MPTP strate (PIRCE). The signal was detected with Fluorchem (Sigma-Aldrich Japan), which selectively destroys only (AlphaInnotech). dopamine neurons, was administered at 30 mg/kg into eight 0173 As a result, a signal was detected at around 70 kDa. week-old female mice for three consecutive days. The mice This suggests that this protein is the antigen of ER-TR7 and is were reared, and one week after the initial administration deeply involved in the progression of fibrosis (FIG. 6). their brain samples were excised. 0180. The collected brain tissue samples were embedded Example 7 in OCT compound (Miles), an embedding medium for cryo sectioning, and sliced into thin sections using a Cryostat(Carl Confirmation of the Presence of ER-TR7-Positive Zeiss). The obtained sections were fixed with phosphate Cells in Various Tissues buffer containing 4% PFA (Nacalai Tesque) for ten minutes, and then washed with deionized water. ER-TR7 (100 times (1) Accumulation of ER-TR7-Positive Cells in Lung Tissues dilution: BMA) was added as the primary antibody, and the of Pulmonary Emphysema Model Mice sections were incubated at 4°C. overnight. Next, Alexa488 0.174 Porcine pancreatic esterase (PPE, four units; Cal labeled goat anti-rat IgG antibody (200 times dilution: Invit biochem-Novabiochem) was intratracheally administered to rogen) was added as the secondary antibody, and the sections C57BL/6J mice (female, five to six weeks old; CLEA Japan were incubated at room temperature for 30 minutes. Then, the Inc.). The mice were fed for three weeks after administration, antibody binding was visualized. and then lung tissues were collected. Mice without PPE 0181. From the result described above, the presence of administration were used as a control group. ER-TR7-positive cells in fibrotic brain tissues was confirmed. 0.175. The collectedlung tissue samples were embedded in Specifically, it was demonstrated that fibrotic brain tissues OCT compound (Miles), an embedding medium for cryosec could be a therapeutic target for the agents of the present tioning, and sliced into thin sections using a Cryostat (Carl invention. Zeiss). The obtained sections were fixed with acetone (Wako Pure Chemical Industries Ltd.) for ten minutes, and then (4) Accumulation of ER-TR7-Positive Cells in Heart Tissues washed with phosphate buffer. ER-TR7 antibody (rat mono of Cardiomyopathy Model Mice clonal antibody, 1 g/ml, BMA) was added as the primary antibody, and the sections were incubated at room tempera 0182 DOX (15 mg/kg: KYOWA HOKKO) was adminis ture for one hour. Next, after the secondary antibody reaction tered into the peritoneal cavities of C57BL/6J mice (male, was carried out using peroxidase-labeled anti-rat IgG (200 eight weeks old; CLEA Japan Inc.). The mice were fed for times dilution), DAB substrate (Nichirei Bioscience) was one week after administration, and then heart tissues were added for color development. Then, nuclear staining was collected. carried out using Lillie-Mayer hematoxylin (Muto Pure 0183 Immunostaining with ER-TR7 was carried out by Chemicals Co.). The samples were observed under a light the same procedure described above. Then, the antibody microscope (Leica MicroSystems). The antibody binding was binding was visualized as brown signals. visualized as brown signals. 0.184 From the result described above, the presence of 0176 From the result described above, the presence of ER-TR7-positive cells in fibrotic cardiac tissues was con ER-TR7-positive cells in fibrotic lung tissues was confirmed. firmed. Specifically, it was demonstrated that fibrotic cardiac Specifically, it was demonstrated that fibrotic lung tissues tissues could be a therapeutic target for the agents of the could be a therapeutic target for the agents of the present present invention. invention. (5) Accumulation of ER-TR7-Positive Cells in the Colonic (2) Accumulation of ER-TR7-Positive Cells in Pancreatic Tissues of Ulcerative Colitis Model Mice Tissues of Type 2 Diabetes Model Mice 0185. The ulcerative colitis model mice were prepared by (0177 Gestational Day 14 C57BL/6JcL mice (CLEA allowing C57BL/6J mice (female, six weeks old; CLEA Japan Inc.) were reared and allowed to deliver. 10 mg/ml Japan Inc.) to freely drink high-concentration chlorine water Streptozotocin (SIGMA) was subcutaneously injected at 20 containing 3% dextran sulfate sodium (DSS: Wako Pure ul/head to day two postnatal female mice. The mice were fed Chemical Industries Ltd.) for eight days. Then, large intes with CE-2 diet (CLEA Japan Inc.) and sterile water until four tines were collected. weeks old. When the mice became 4 weeks old, they were fed 0186 Immunostaining with ER-TR7 antibody was carried with High Fat Diet (CLEA Japan Inc.) and sterile water for out by the same procedure described above. Then, the anti two weeks and pancreatic tissues were collected. body binding was visualized as brown signals. 0.178 Immunostaining with ER-TR7 antibody was carried 0187. From the result described above, the presence of out by the same procedure described above. Then, the anti ER-TR7-positive cells in fibrotic colonic tissues was con US 2012/0231 019 A1 Sep. 13, 2012

firmed. Specifically, it was demonstrated that fibrotic colonic carbon tetrachloride was additionally administered to the tissues could be a therapeutic target for the agents of the mice twice a week for two weeks (11 times in all) to induce present invention. cirrhosis. The mice were fed for two weeks after the above treatment, and then livers were collected. (6) Accumulation of ER-TR7-Positive Cells in Kidney Tis 0.192 Immunostaining with ER-TR7 antibody was carried sues of Renal Fibrosis Model Mice out by the same procedure described above. Then, the anti 0188 The renal fibrosis model mice were prepared by body binding was visualized as brown signals. performing unilateral ureteral obstruction (UUO) to C57BL/ 0193 From the result described above, the presence of 6JcL mice (female, eight weeks old; CLEA Japan Inc.). The ER-TR7-positive cells in fibrotic liver tissues was confirmed. renal fibrosis mouse model has excellent reproducibility, and Specifically, it was demonstrated that fibrotic liver tissues is thus widely used as an experimental mouse model for renal could be a therapeutic target for the agents of the present fibrosis (American journal of pathology (2003) 163:4; 1261 invention. 1273). Mice were anesthetized with Ketalar/xylazine and INDUSTRIAL APPLICABILITY underwent laparotomy. The ureters were exposed and the right ureter was ligated at two sites with 4-0 surgical Suture. 0194 Fibrosis-suppressing agents of the present invention The peritoneum and skin were closed with 1-0 surgical comprising ER-TR7 as an active ingredient have a therapeu tic or preventive effect on diseases with excessive tissue fibro Suture. Eight days after, the kidney tissues were collected. sis, by Suppressing the fibrosis in body tissues. Since the 0189 Immunostaining with ER-TR7 antibody was carried fibrosis-Suppressing agents of the present invention Suppress out by the same procedure described above. Then, the anti the expression of C-SMA, TNFC, and type I collagen, which body binding was visualized as brown signals. are fibrosis marker genes, in fibrotic tissues, they are 0190. From the result described above, the presence of extremely useful in suppressing tissue fibrosis. Methods for ER-TR7-positive cells in fibrotic kidney tissues was con treating or preventing fibrotic diseases by administering the firmed. Specifically, it was demonstrated that fibrotic kidney fibrosis-Suppressing agents of the present invention can effec tissues could be a therapeutic target for the agents of the tively improve fibroticlesions through medical treatment, and present invention. could be excellent therapeutic methods that are useful for improving patients’ QOL. (7) Accumulation of ER-TR7-Positive Cells in the Liver of 0.195. In addition, the present invention is not only medi Cirrhosis Model Mice cally applicable for humans but can also be expected to be 0191 Carbon tetrachloride (10 ul; Sigma-Aldrich) was used in the pet industry and animal husbandry, for example, to mixed with 90 ul of mineral oil (Sigma-Aldrich). The mixture treat or prevent chronic fibrotic diseases of pets, or to prevent was injected into the peritoneal cavities of C57BL/6J mice diseases of farm animals by administration, when antibodies (female, five to six weeks old; CLEAJapan Inc.) twice a week against ER-TR7 antigen homolog of various animals are pre for four weeks (seven times) to induce hepatic fibrosis. Then, pared.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 12

<21 Os SEQ ID NO 1 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs SEQUENCE: 1

catcc.gtaaa gacct citatgccaac 25

<21 Os SEQ ID NO 2 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs SEQUENCE: 2

atggagccac catccaca 19

<21 Os SEQ ID NO 3 &211s LENGTH: 2O &212s. TYPE: DNA US 2012/0231 019 A1 Sep. 13, 2012 14

- Continued

<213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 3 aaatggtgaa ggtcggtgtg

<210s, SEQ ID NO 4 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 4 tgaagggg.tc gttgatgg 18

<210s, SEQ ID NO 5 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 5 titcCaggctt tdgcatca 19

<210s, SEQ ID NO 6 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 6 atgttcagca tttcagcag ttg 24

<210s, SEQ ID NO 7 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OO > SEQUENCE: 7

Caggagggag alacagaaact cca 23

<210s, SEQ ID NO 8 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 8

Cctggttggc tigCttgctt 19

<210s, SEQ ID NO 9 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide US 2012/0231 019 A1 Sep. 13, 2012 15

- Continued <4 OOs, SEQUENCE: 9 accc.gatggc aacaatgga 19

SEQ ID NO 10 LENGTH: 2O TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 10 accagcaggg ccttgttcac

SEQ ID NO 11 LENGTH: 21 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 11 gaggat.ccga cactgctgac a 21

SEQ ID NO 12 LENGTH: 24 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 12 agcacago: ct gaatagocac attac 24

1. A fibrosis-suppressing agent comprising ER-TR7 or a 10. A method for producing a fibrosis-suppressing agent functionally equivalent Substance as an active ingredient. comprising as an active ingredient an antibody, which com 2. The agent of claim 1, wherein the Substance has an prises the step of preparing the antibody using an ER-TR7 ER-TR7 antigen-targeting activity. antigen. 3. The agent of claim 1, wherein the substance has an 11. A method for treating or preventing a fibrotic disease, activity of enhancing the degradation of an ER-TR7 antigen. which comprises the step of administering the agent of any one of claims 1 to 9 to a subject. 4. The agent of claim 1, wherein the Substance has an 12. (canceled) activity of inhibiting the synthesis of an ER-TR7 antigen. 13. A method of Suppressing fibrosis in a body tissue, 5. The agent of claim 1, wherein the substance has an which comprises the step of administering the agent of claim activity of neutralizing the activity of an ER-TR7 antigen. 1 to a subject. 6. The agent of claim 1, wherein the Substance has an 14. A method of modulating fibrosis in a Subject, compris activity of inhibiting the modification of an ER-TR7 antigen. ing the steps of 7. The agent of claim 1, wherein the substance has an diagnosing a Subject with tissue fibrosis; and activity of enhancing the demodification of an ER-TR7 anti administering to the subject a therapeutically effective gen. amount of a formulation comprised of a pharmaceuti 8. The agent of claim 1, wherein the production or accu cally acceptable carrier and an antibody that binds an mulation of an ER-TR7 antigen in each organ is inhibited. ER-TR7 antigen protein. 9. The agent of claim 1, which is used for treating or preventing a fibrotic disease. c c c c c