DOCSLIB.ORG

Small Interfering RNA Library Screen of Human Kinases and Phosphatases Identifies Polo-Like Kinase 1 As a Promising New Target F

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Small Interfering RNA Library Screen of Human Kinases and Phosphatases Identifies Polo-Like Kinase 1 As a Promising New Target F Published OnlineFirst November 3, 2009; DOI: 10.1158/1535-7163.MCT-09-0365 Published Online First on November 3, 2009 as 10.1158/1535-7163.MCT-09-0365 3024 Small interfering RNA library screen of human kinases and phosphatases identifies polo-like kinase 1 as a promising new target for the treatment of pediatric rhabdomyosarcomas Kaiji Hu,1 Cathy Lee,1 Dexin Qiu,2 Abbas Fotovati,1 B1. Increased expression of WEE 1 was also noted. The Alastair Davies,1 Samah Abu-Ali,1 Daniel Wai,3 induction of apoptosis after PLK1 silencing was confirmed Elizabeth R. Lawlor,3 Timothy J. Triche,3 by increased p-H2AX, propidium iodide uptake, and chro- Catherine J. Pallen,2 and Sandra E. Dunn1 matin condensation, as well as caspase-3 and poly(ADP- ribose) polymerase cleavage. Pediatric Ewing's sarcoma 1Laboratory for Oncogenomic Research, Departments of (TC-32), neuroblastoma (IMR32 and KCNR), and glio- Pediatrics, Experimental Medicine, and Medical Genetics, and 2 blastoma (SF188) models were also highly sensitive to Cell Phosphosignaling Laboratory, Departments of Pediatrics, PLK1 inhibition. Finally, based on cDNA microarray anal- Pathology and Laboratory Medicine, and Experimental Medicine, Child and Family Research Institute, University of British yses, PLK1 mRNA was overexpressed (>1.5 fold) in 10 Columbia, Vancouver, British Columbia, Canada; and of 10 rhabdomyosarcoma cell lines and in 47% and 51% 3Department of Pathology, Keck School of Medicine of the of primary aRMS (17 of 36 samples) and eRMS (21 of 41 University of Southern California, Los Angeles, California samples) tumors, respectively, compared with normal muscles. Similarly, pediatric Ewing's sarcoma, neuro- Abstract blastoma, and osteosarcoma tumors expressed high PLK1.WeconcludethatPLK1couldbeapromisingther- Rhabdomyosarcoma, consisting of alveolar (aRMS) and apeutic target for the treatment of a wide range of pedi- embryonal (eRMS) subtypes, is the most common type atric solid tumors including rhabdomyosarcoma. [Mol of sarcoma in children. Currently, there are no targeted Cancer Ther 2009;8(11):3024–35] drug therapies available for rhabdomyosarcoma. In search- ing for new molecular therapeutic targets, we carried out genome-wide small interfering RNA (siRNA) library screens Introduction targeting human phosphatases (n = 206) and kinases (n = Rhabdomyosarcoma is the most common soft-tissue sarco- 691) initially against an aRMS cell line, RH30. Sixteen ma of children and adolescents. The majority (66%) of cases phosphatases and 50 kinases were identified based on of rhabdomyosarcoma are diagnosed in children <6 years of growth inhibition after 72 hours. Inhibiting polo-like kinase age (1). This disease is thought to arise from primitive mes- 1 (PLK1) had the most remarkable impact on growth inhi- enchymal progenitors that have undergone a limited pro- ∼ bition ( 80%) and apoptosis on all three rhabdomyosarco- gram of myogenic differentiation (2). Rhabdomyosarcoma ma cell lines tested, namely, RH30, CW9019 (aRMS), and consists of a highly heterogeneous family of tumors show- RD (eRMS), whereas there was no effect on normal muscle ing varying degrees of skeletal muscle differentiation (3). cells. The loss of PLK1 expression and subsequent growth Embryonal rhabdomyosarcoma (eRMS) and the morpho- inhibition correlated with decreased p-CDC25C and Cyclin logic spindle/botryoid variants are associated with interme- diate and superior patient prognosis, respectively, whereas alveolar rhabdomyosarcoma (aRMS) is more aggressive, Received 4/22/09; revised 8/7/09; accepted 9/4/09; published OnlineFirst with a high frequency of metastasis at the time of initial di- 11/3/09. agnosis (4). Current treatment for rhabdomyosarcoma in- Grant support: British Columbia Children's Hospital Pediatric Oncology cludes chemotherapy, radiation, and surgery. The “gold Collaborative Research Fund provided funding to support this project ” (S.E. Dunn and C.J. Pallen). The Michael Cuccione Foundation Research standard chemotherapeutic agents vincristine, actinomycin Fellowship also provided salary support (C. Lee). S.E. Dunn and C.J. Pallen D, and cyclophosphamide are commonly prescribed to are recipients of Investigator Awards from the Child and Family Research rhabdomyosarcoma patients (1). Chemoresistance is fairly Institute. Drs. Triche and Lawlor were supported by NIH SPECS grant 1U01CA11475-04. common as are treatment-related side effects (1, 5). This is The costs of publication of this article were defrayed in part by the coupled with the fact that the present cure rate for children payment of page charges. This article must therefore be hereby marked with metastatic rhabdomyosarcoma is still only 20% to 30% advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. (6, 7). Unlike advanced treatment strategies for other types Note: Supplementary materials for this article are available at Molecular of malignancies, there are no targeted drug therapies avail- Cancer Therapeutics Online (http://mct.aacrjournals.org/). able for rhabdomyosarcoma that could potentially improve Requests for reprints: Sandra E. Dunn, Departments of Pediatrics, overall cure rates and reduce morbidity. Thus, identifying Experimental Medicine, and Medical Genetics, Child and Family Research new molecular targets of the disease is necessary. Institute, University of British Columbia, 950 West 28th Avenue, Vancouver, BC, V5Z 4H4, Canada. Phone: 604-875-2000 ext. 6015; Loss of heterozygosity on the short arm of chromosome Fax: 604-875-3120. E-mail: [email protected] 11 (11p15.5) characterizes eRMS (8). In contrast, aRMS har- Copyright © 2009 American Association for Cancer Research. bors the reciprocal chromosomal translocations t(2;13)(q35; doi:10.1158/1535-7163.MCT-09-0365 q14) or t(1;13)(p36;q14), generating a chimeric fusion gene Mol Cancer Ther 2009;8(11). November 2009 Downloaded from mct.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. Published OnlineFirst November 3, 2009; DOI: 10.1158/1535-7163.MCT-09-0365 Molecular Cancer Therapeutics 3025 involving the PAX 3 gene (chromosome 2) or PAX 7 (chro- plates. They were diluted to working stocks at 2 μmol/L mosome 1) and FKHR (chromosome 13), a member of the upon arrival following the manufacturer's instructions, fork-head family (9). The resulting gene fusions encode and were stored at −20°C until use. PAX3-FKHR and PAX 7- FK HR proteins that combine tran- siRNA Library Screen and High Content Screening scriptional domains from corresponding wild-type proteins Analysis and are more potent transcription factors (10). These pro- RH30 cells were seeded (5,000/well) into each well of 96- teins induce cell transformation and inhibit myogenic differ- well plates (Becton Dickinson) overnight. The cells were then entiation and apoptosis, thereby enhancing oncogenic transfected with siRNA using Lipofectamine RNAiMAX activity (11). Recently, several gene expression studies of (Invitrogen) following the manufacturer's instruction. The fi- primary rhabdomyosarcoma tumors have provided new nal concentration of siRNA was 5 nmol/L in 120 μL medium information about the pathways involved in rhabdomyosar- per well. The assay plates were incubated at 37°C with 5% – coma (6, 12 19). New evidence indicates that aRMS can be CO2 for 72h. Forty minutes before the end of siRNA treat- experimentally induced by expressing the PAX/FKHR ment, nuclear dyes, Hoechst 33342, and propidium iodide fusion gene in mesenchymal stem cells followed by the intro- (Sigma-Aldrich) were added to each well of the 96-well plates duction of activating RAS mutation (20). Despite new to give a final concentration of 1 μg/mL of each dye, and the knowledge and the belief that rhabdomyosarcoma arises plates were incubated as before. The cells were washed gent- from disrupted proliferation and differentiation of skeletal ly with PBS three times before the cells were fixed in 2% para- muscle progenitor cells, the mechanisms of growth control formaldehyde. The plates were kept at 4°C in the dark before of rhabdomyosarcoma are not fully understood. analysis on the ArrayScan HCS system (Thermo Fisher Scien- Kinases and phosphatases control the reversible processes tific). Twenty focus fields per cell well were scanned and an- of phosphorylation and are deregulated in many diseases, alyzed. The screen was repeated at least once to confirm the such as cancer. A recent study of genome-wide small interfer- activity of siRNAs. Cells treated with Lipofectamine RNAi- ing RNA (siRNA) libraries against the HeLa cervical carcino- MAX alone without siRNA served as controls. Additionally, ma cell line has shown that a variety of phosphatases and scrambled siRNAs and green fluorescent protein siRNAs kinases are critical in cancer cell survival (21). Kinase inhibi- were included in the libraries, and served as internal refer- tors targeting PAX3-FKHR, IGF-IR, CDK4/6, and EGFR have ences in each assay plate. Apoptosis was identified by nucle- also shown potent antitumorigenic activity on rhabdomyo- ar morphology and dye intensity by the ArrayScan HCS sarcoma under in vitro and in vivo conditions (5, 7, 22–24). It system (26). Growth inhibition was calculated as a percent- is reported that the phosphorylation levels of receptors and age of the control. To focus on the phosphatases and kinases nonreceptor tyrosine kinases, as well as protein kinase C, with the most significant effect on cell growth, only those are elevated in rhabdomyosarcoma tumors and therefore siRNAs
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Wo 2010/075007 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 1 July 2010 (01.07.2010) WO 2010/075007 A2 (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12Q 1/68 (2006.01) G06F 19/00 (2006.01) kind of national protection available): AE, AG, AL, AM, C12N 15/12 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (21) International Application Number: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US2009/067757 HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (22) International Filing Date: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 11 December 2009 ( 11.12.2009) ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (25) Filing Language: English SE, SG, SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, (26) Publication Language: English TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 12/3 16,877 16 December 2008 (16.12.2008) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, (71) Applicant (for all designated States except US): DODDS, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, W., Jean [US/US]; 938 Stanford Street, Santa Monica, TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, CA 90403 (US).
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Investigating the Role of Cdk11in Animal Cytokinesis
    Investigating the Role of CDK11 in Animal Cytokinesis by Thomas Clifford Panagiotou A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Molecular Genetics University of Toronto © Copyright by Thomas Clifford Panagiotou (2020) Investigating the Role of CDK11 in Animal Cytokinesis Thomas Clifford Panagiotou Master of Science Department of Molecular Genetics University of Toronto 2020 Abstract Finely tuned spatio-temporal regulation of cell division is required for genome stability. Cytokinesis constitutes the final stages of cell division, from chromosome segregation to the physical separation of cells, abscission. Abscission is tightly regulated to ensure it occurs after earlier cytokinetic events, like the maturation of the stem body, the regulatory platform for abscission. Active Aurora B kinase enforces the abscission checkpoint, which blocks abscission until chromosomes have been cleared from the cytokinetic machinery. Currently, it is unclear how this checkpoint is overcome. Here, I demonstrate that the cyclin-dependent kinase CDK11 is required for cytokinesis. Both inhibition and depletion of CDK11 block abscission. Furthermore, the mitosis-specific CDK11p58 kinase localizes to the stem body, where its kinase activity rescues the defects of CDK11 depletion and inhibition. These results suggest a model whereby CDK11p58 antagonizes Aurora B kinase to overcome the abscission checkpoint to allow for successful completion of cytokinesis. ii Acknowledgments I am very grateful for the support of my family and friends throughout my studies. I would also like to express my deep gratitude to Wilde Lab members, both past and present, for their advice and collaboration. In particular, I am very grateful to Matthew Renshaw, whose work comprises part of this thesis.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Identifying Novel Actionable Targets in Colon Cancer
    biomedicines Review Identifying Novel Actionable Targets in Colon Cancer Maria Grazia Cerrito and Emanuela Grassilli * Department of Medicine and Surgery, University of Milano-Bicocca, Via Cadore 48, 20900 Monza, Italy; [email protected] * Correspondence: [email protected] Abstract: Colorectal cancer is the fourth cause of death from cancer worldwide, mainly due to the high incidence of drug-resistance toward classic chemotherapeutic and newly targeted drugs. In the last decade or so, the development of novel high-throughput approaches, both genome-wide and chemical, allowed the identification of novel actionable targets and the development of the relative specific inhibitors to be used either to re-sensitize drug-resistant tumors (in combination with chemotherapy) or to be synthetic lethal for tumors with specific oncogenic mutations. Finally, high- throughput screening using FDA-approved libraries of “known” drugs uncovered new therapeutic applications of drugs (used alone or in combination) that have been in the clinic for decades for treating non-cancerous diseases (re-positioning or re-purposing approach). Thus, several novel actionable targets have been identified and some of them are already being tested in clinical trials, indicating that high-throughput approaches, especially those involving drug re-positioning, may lead in a near future to significant improvement of the therapy for colon cancer patients, especially in the context of a personalized approach, i.e., in defined subgroups of patients whose tumors carry certain mutations. Keywords: colon cancer; drug resistance; target therapy; high-throughput screen; si/sh-RNA screen; CRISPR/Cas9 knockout screen; drug re-purposing; drug re-positioning Citation: Cerrito, M.G.; Grassilli, E.
    [Show full text]
  • Support Info
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2014 Supporting Information Design and synthesis of pyrrole–5-(2,6-dichlorobenzyl)sulfonylindolin-2-ones with C- 3’ side chains as potent Met kinase inhibitors Chia-Wei Liu,a Chun-Liang Lai,a Yu-Hsiang Lin,a Li-Wei Teng,a Sheng-chuan Yang,a Win-Yin Wei,a Shu Fu Lin,a Ju-Ying Yang,a Hung-Jyun Huang,a Ru-Wen Wang,a Chao-Cheng Chiang,a Mei-Hui Lee,a Yu- Chuan Wang,b Shih-Hsien Chuang,a Jia-Ming Chang,a Ying-Shuan E. Lee,a and Jiann-Jyh Huang*a,b aDevelopment Center for Biotechnology, No. 101, Lane 169, Kangning St., Xizhi District, New Taipei City 22180, Taiwan bDepartment of Applied Chemistry, National Chiayi University, No. 300, Syuefu Rd., Chiayi City 60004, Taiwan *Corresponding Author. Tel.: +886 5 271 7959; Fax: +886 5 271 7901. E-mail address: [email protected] (J.-J. Huang) Table of Contents: Page Supporting Figure. Ligplot diagrams of the ATP binding site of Met S2 complexed with compounds 2 and 20. Supporting Table. Kinase profiling data of compound 20. S3 References S10 - S1 - Supporting Figure. Ligplot diagrams1 of the ATP binding site of Met complexed with compounds 2 and 20: (A) Met with 2, and (B) Met with 20. - S2 - Supporting Table. Kinase profiling data of 20. Ambit KinomeScan Kinase Profiling (1.0 μM test concentration): Percentage of Percentage of Ambit Gene Symbol control (%) Ambit Gene Symbol control (%) 20 20 AAK1 68 ARK5 27 ABL1(E255K)-phosphorylated 85 ASK1 100 ABL1(F317I)-nonphosphorylated 78 ASK2 67
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Application of a MYC Degradation
    SCIENCE SIGNALING | RESEARCH ARTICLE CANCER Copyright © 2019 The Authors, some rights reserved; Application of a MYC degradation screen identifies exclusive licensee American Association sensitivity to CDK9 inhibitors in KRAS-mutant for the Advancement of Science. No claim pancreatic cancer to original U.S. Devon R. Blake1, Angelina V. Vaseva2, Richard G. Hodge2, McKenzie P. Kline3, Thomas S. K. Gilbert1,4, Government Works Vikas Tyagi5, Daowei Huang5, Gabrielle C. Whiten5, Jacob E. Larson5, Xiaodong Wang2,5, Kenneth H. Pearce5, Laura E. Herring1,4, Lee M. Graves1,2,4, Stephen V. Frye2,5, Michael J. Emanuele1,2, Adrienne D. Cox1,2,6, Channing J. Der1,2* Stabilization of the MYC oncoprotein by KRAS signaling critically promotes the growth of pancreatic ductal adeno- carcinoma (PDAC). Thus, understanding how MYC protein stability is regulated may lead to effective therapies. Here, we used a previously developed, flow cytometry–based assay that screened a library of >800 protein kinase inhibitors and identified compounds that promoted either the stability or degradation of MYC in a KRAS-mutant PDAC cell line. We validated compounds that stabilized or destabilized MYC and then focused on one compound, Downloaded from UNC10112785, that induced the substantial loss of MYC protein in both two-dimensional (2D) and 3D cell cultures. We determined that this compound is a potent CDK9 inhibitor with a previously uncharacterized scaffold, caused MYC loss through both transcriptional and posttranslational mechanisms, and suppresses PDAC anchorage- dependent and anchorage-independent growth. We discovered that CDK9 enhanced MYC protein stability 62 through a previously unknown, KRAS-independent mechanism involving direct phosphorylation of MYC at Ser .
    [Show full text]
  • Androgen Receptor Binding Sites Identified by a GREF GATA Model
    doi:10.1016/j.jmb.2005.09.009 J. Mol. Biol. (2005) 353, 763–771 COMMUNICATION Androgen Receptor Binding Sites Identified by a GREF_GATA Model Katsuaki Masuda1, Thomas Werner2, Shilpi Maheshwari1 Matthias Frisch2, Soyon Oh1, Gyorgy Petrovics1, Klaus May2 Vasantha Srikantan1, Shiv Srivastava1 and Albert Dobi1* 1Center for Prostate Disease Changes in transcriptional regulation can be permissive for tumor Research, Department of progression by allowing for selective growth advantage of tumor cells. Surgery, Uniformed Services Tumor suppressors can effectively inhibit this process. The PMEPA1 gene, a University, Rockville, MD potent inhibitor of prostate cancer cell growth is an androgen-regulated 20852, USA gene. We addressed the question of whether or not androgen receptor can directly bind to specific PMEPA1 promoter upstream sequences. To test this 2Genomatix Software GmbH hypothesis we extended in silico prediction of androgen receptor binding D-80339 Munich, Germany sites by a modeling approach and verified the actual binding by in vivo chromatin immunoprecipitation assay. Promoter upstream sequences of highly androgen-inducible genes were examined from microarray data of prostate cancer cells for transcription factor binding sites (TFBSs). Results were analyzed to formulate a model for the description of specific androgen receptor binding site context in these sequences. In silico analysis and subsequent experimental verification of the selected sequences suggested that a model that combined a GREF and a GATA TFBS was sufficient for predicting a class of functional androgen receptor binding sites. The GREF matrix family represents androgen receptor, glucocorticoid receptor and progesterone receptor binding sites and the GATA matrix family represents GATA binding protein 1–6 binding sites.
    [Show full text]
  • Genome-Wide Sirna Screen for Modulators of Cell Death Induced by Proteasome Inhibitor Bortezomib
    Published OnlineFirst May 11, 2010; DOI: 10.1158/0008-5472.CAN-09-4428 Published OnlineFirst on May 11, 2010 as 10.1158/0008-5472.CAN-09-4428 Integrated Systems and Technologies Cancer Research Genome-Wide siRNA Screen for Modulators of Cell Death Induced by Proteasome Inhibitor Bortezomib Siquan Chen1, Jonathan L. Blank2, Theodore Peters1, Xiaozhen J. Liu2, David M. Rappoli1, Michael D. Pickard3, Saurabh Menon1, Jie Yu2, Denise L. Driscoll2, Trupti Lingaraj2, Anne L. Burkhardt2, Wei Chen2, Khristofer Garcia1, Darshan S. Sappal2, Jesse Gray1, Paul Hales1, Patrick J. Leroy2, John Ringeling1, Claudia Rabino2, James J. Spelman2, Jay P. Morgenstern1, and Eric S. Lightcap2 Abstract Multiple pathways have been proposed to explain how proteasome inhibition induces cell death, but me- chanisms remain unclear. To approach this issue, we performed a genome-wide siRNA screen to evaluate the genetic determinants that confer sensitivity to bortezomib (Velcade (R); PS-341). This screen identified 100 genes whose knockdown affected lethality to bortezomib and to a structurally diverse set of other proteasome inhibitors. A comparison of three cell lines revealed that 39 of 100 genes were commonly linked to cell death. We causally linked bortezomib-induced cell death to the accumulation of ASF1B, Myc, ODC1, Noxa, BNIP3, Gadd45α, p-SMC1A, SREBF1, and p53. Our results suggest that proteasome inhibition promotes cell death primarily by dysregulating Myc and polyamines, interfering with protein translation, and disrupting essential DNA damage repair pathways, leading to programmed cell death. Cancer Res; 70(11); OF1–9. ©2010 AACR. Introduction active oxygen species (ROS), stabilization of Myc and Noxa, and induction of endoplasmic reticulum (ER) stress, any of The primary targets of most cancer chemotherapies are which may trigger cell death (1–4).
    [Show full text]