Research
Transcriptome-derived evidence supports recent polyploidization and a major phylogeographic division in Trithuria submersa (Hydatellaceae, Nymphaeales)
Isabel Marques1,2,3*, Sean A. Montgomery1,2*, Michael S. Barker4, Terry D. Macfarlane5, John G. Conran6, Pilar Catal an3,7, Loren H. Rieseberg1, Paula J. Rudall8 and Sean W. Graham1,2 1Department of Botany, University of British Columbia, 6270 University Boulevard, Vancouver, BC V6T 1Z4, Canada; 2UBC Botanical Garden & Centre for Plant Research, University of British Columbia, 6804 Marine Drive SW, Vancouver, BC V6T 1Z4, Canada; 3Department of Agricultural and Environmental Sciences, High Polytechnic School of Huesca, University of Zaragoza, C/Carretera de Cuarte Km 1, Huesca E22071, Spain; 4Department of Ecology and Evolutionary Biology, University of Arizona, Tucson, AZ 85721, USA; 5Western Australian Herbarium, Science and Conservation Division, Department of Parks and Wildlife, Locked Bag 104, Bentley Delivery Centre, Bentley, WA 6983, Australia; 6School of Biological Sciences, Australian Centre for Evolutionary Biology and Biodiversity & Sprigg Geobiology Centre, The University of Adelaide, Benham Bldg DX 650 312, Adelaide, SA 5005, Australia; 7Department of Botany, Institute of Biology, Tomsk State University, Lenin Av. 36, Tomsk 634050, Russia; 8Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3AB, UK
Summary Author for correspondence: Relatively little is known about species-level genetic diversity in flowering plants outside the Isabel Marques eudicots and monocots, and it is often unclear how to interpret genetic patterns in lineages Tel: +1 604 822 4816 with whole-genome duplications. We addressed these issues in a polyploid representative of Email: [email protected] Hydatellaceae, part of the water-lily order Nymphaeales. Received: 28 June 2015 We examined a transcriptome of Trithuria submersa for evidence of recent whole-genome Accepted: 12 October 2015 duplication, and applied transcriptome-derived microsatellite (expressed-sequence tag sim- ple-sequence repeat (EST-SSR)) primers to survey genetic variation in populations across its New Phytologist (2016) 210: 310–323 range in mainland Australia. doi: 10.1111/nph.13755 A transcriptome-based Ks plot revealed at least one recent polyploidization event, consis- tent with fixed heterozygous genotypes representing underlying sets of homeologous loci. A Key words: ANA-grade, Australia, strong genetic division coincides with a trans-Nullarbor biogeographic boundary. microsatellite markers, population genetic Patterns of ‘allelic’ variation (no more than two variants per EST-SSR genotype) and diversity, transcriptome-enabled markers, recently published chromosomal evidence are consistent with the predicted polyploidization trans-Nullarbor plants, Trithuria. event and substantial homozygosity underlying fixed heterozygote SSR genotypes, which in turn reflect a selfing mating system. The Nullarbor Plain is a barrier to gene flow between two deep lineages of T. submersa that may represent cryptic species. The markers developed here should also be useful for further disentangling species relationships, and provide a first step towards future genomic studies in Trithuria.
1999; Soltis & Soltis, 2004; Saarela et al., 2007; Graham & Iles, Introduction 2009). Here we examined patterns of genetic diversity across Despite the important evolutionary role of polyploidization in most of the range of Trithuria submersa, the most widespread plants (e.g. Soltis et al., 2014; Mayrose et al., 2015), our under- member of Hydatellaceae (one of three families of Nymphaeales; standing of polyploids is still limited compared with diploids, in Angiosperm Phylogeny Group II, 2003). We also applied tran- part because of difficulties in applying standard genetic diversity scriptome-based evidence to address whether it has experienced estimators (e.g. De Silva et al., 2005; Obbard et al., 2006; polyploidization in its recent ancestry, as suggested by karyotypic Dufresne et al., 2014). Species-level genetic diversity studies of evidence (Kynast et al., 2014). polyploids are rare outside the eudicots and monocots in Relatively little is known about the evolutionary history of angiosperms, although see Quan et al. (2009) for a recent exam- Hydatellaceae (Nymphaeales), despite considerable recent atten- ple in the water lilies (Nymphaeales). The latter is an ancient tion following the family’s taxonomic realignment away from the aquatic clade that is the sister group of all other angiosperms monocots (Saarela et al., 2007; Graham & Iles, 2009). The fam- except Amborella (e.g. Mathews & Donoghue, 1999; Soltis et al., ily is now recognized as a major component of the ANITA or ANA grade (named after five of the six constituent families, or *These authors contributed equally to this work. the three component orders, Amborellales, Nymphaeales and
310 New Phytologist (2016) 210: 310–323 Ó 2015 The Authors www.newphytologist.com New Phytologist Ó 2015 New Phytologist Trust New Phytologist Research 311
Austrobaileyales), which collectively defines the deepest divisions reported (O. Hidalgo et al., unpublished; and see Iles et al., in flowering-plant phylogeny. The family comprises c. 12 species 2012). of Trithuria (the sole genus) that are restricted to Australia, New Here, we characterized the polyploid ancestry of T. submersa Zealand and India (Saarela et al., 2007; Iles et al., 2012, 2014). by looking for evidence of gene duplication peaks in the tran- Despite the ancient origin of its stem lineage, the crown clade of scriptome that correspond to whole-genome duplication the family diversified relatively recently (around the early (WGD). To provide further insights into the biogeography of Miocene), and much of its biogeographic distribution may be this species, we also characterized population genetic diversity explained by recent long-distance dispersal events (Iles et al., across mainland populations of T. submersa using microsatellite 2014). This may contrast with generally low dispersability in (expressed-sequence tag simple-sequence repeat; EST-SSR) Cabombaceae and Nymphaeaceae (L€ohne et al., 2005), the two markers that we developed from the transcriptome assembly. We water-lily families that comprise its sister group. also made an initial assessment of cross-species transferability of Most species in the family flourish in temporarily inundated the microsatellite markers in all congeners as a tool for future areas as short-lived (ephemeral) aquatics (Sokoloff et al., 2011; studies on the genetic structure in this family. Iles et al., 2014), although the family also includes several sub- merged aquatic species, at least one of which can live for several Materials and Methods years (Pledge, 1974). A remarkable diversity of reproductive sys- tems is also observed in Hydatellaceae, including dioecy, several cDNA library construction and 454 sequencing of Trithuria forms of cosexuality, autogamy and apomixis (Sokoloff et al., submersa 2008, 2011). The genus Trithuria is a candidate model-plant sys- tem for investigating the early evolution of the flowering plants, RNA extractions and preparation of normalized cDNA libraries along with other candidates in Nymphaeales (Vialette-Guiraud followed the protocol of Lai et al. (2012). Briefly, total RNA et al., 2011; Povilus et al., 2015). Species of Trithuria are a poten- from T. submersa material (Kew living accession no. 3830) grown tially attractive candidate model system because of their small in the Conservation Biotechnology Unit at the Royal Botanic habit (mature plants are a few cm tall), rapid, mostly annual life Gardens, Kew (from seeds collected by Renee Tuckett at Mersea cycle, suitability for cultivation (demonstrated at least vegeta- Road swamp, Western Australia, in 2006) was isolated using Tri- tively), and the capacity for self-fertilization in most species (Tay- zol reagent (Invitrogen) and purified with a Qiagen RNeasy mini lor et al., 2010; Sokoloff et al., 2011). They also have small column. Library construction involved selection for polyadeny- genome sizes (e.g. T. submersa,1C= c. 1.36 pg; Pellicer et al., lated (polyA+) transcripts to enrich for protein-coding mRNAs 2013), which may facilitate future genomic initiatives, and one and normalization with the Trimmer-Direct cDNA Normaliza- or more species in the family is thought to be diploid (e.g. tion Kit (Evrogen, Moscow, Russia) to improve the representa- T. australis,2n = 14; see Iles et al., 2012). We have no informa- tion of low-copy transcripts and thereby maximize gene tion on wild genotypes or the genetic structure of natural popula- discovery. Normalized cDNA was prepared for sequencing fol- tions of Trithuria, which would be useful for clarifying species lowing the genomic DNA shotgun protocol provided by 454 Life limits, particularly in a group of three closely related species of Sciences (Branford, CT, USA). Sequencing was performed using Trithuria: T. bibracteata, T. occidentalis and T. submersa a 454 GS-FLX sequencer and Titanium reagents. The 454 (Sokoloff et al., 2008; Iles et al., 2012, 2014). These three species sequences were cleaned using the program SNOWHITE (Barker appear to be intermingled or nested in gene trees based on plastid et al., 2010; Dlugosch et al., 2013), and the transcriptome was and nuclear ribosomal internal transcribed spacer region (ITS) assembled using MIRA v.3.0.5 (Chevreux et al., 2004) with default data (Iles et al., 2012, 2014), but the phylogenetic data are sug- parameters for 454 data followed by CAP3 (Huang & Madan, gestive of two major lineages of T. submersa, which reflect its split 1999) with P = 94% to further assemble redundant contigs. biogeography. Trithuria submersa is the most broadly distributed species in Identification of WGD the family, as it occurs in southwestern (SW) and southeastern (SE) Australia (including Tasmania), two temperate sclerophyll We characterized the pattern of accumulation of gene duplicates biomes divided on the mainland by the Nullarbor Plain, a c. during the evolution of T. submersa by examining its transcrip- 750 km gap of arid limestone plateau (Fig. 1). Populations in the tome using the DupPipe pipeline (integrated in the online server, two regions have been hypothesized to represent more than one http://evopipes.net/; Barker et al., 2010), which identifies dupli- species based on their disjunct biogeography (Iles et al., 2012, cate gene pairs and their divergence based on substitutions per 2014). Selfing is thought to be the predominant mating system synonymous site (Ks). Duplicate gene pairs were identified as (Rudall et al., 2008, 2009b; Taylor et al., 2010; Taylor & Wil- sequences that demonstrated 40% or higher sequence similarity liams, 2012). A recent chromosome study based on a SW popula- over at least 300 bp from a discontinuous MegaBLAST search tion of the species (2n = 56) suggested an allopolyploid origin for (Morgulis et al., 2008). Reading frames for duplicate pairs were T. submersa, as its karyotype appears to include two discrete sets identified by BLAST queries (Altschul et al., 1990) to the RefSeqs of chromosomes (Kynast et al., 2014). It is possible that this pop- protein data base at NCBI. Each duplicated gene was then ulation is octoploid with a base chromosome number of x = 7, BLASTed against all proteins in a transcriptome using blastx, given that diploid Trithuria species with 2n = 14 have been with a minimum cutoff of 30% sequence similarity over at least
Ó 2015 The Authors New Phytologist (2016) 210: 310–323 New Phytologist Ó 2015 New Phytologist Trust www.newphytologist.com New 312 Research Phytologist
(a)
ARID ZONE ARID ZONE
Nullarbor Nullarbor
SWSW
SESE
05001000 kilometers Fig. 1 (a) Map of Trithuria submersa sampling populations in Australia and the 750 km arid zone separating them. The square inset represents the area where (b) T. submersa was collected (additional populations are known from Tasmania, but High: 1.57 are not included here). The southwestern (SW) and southeastern (SE) Australian biomes are currently separated by the central arid zone and the Nullarbor Plain. (b) Map of DRU overall allelic richness of T. submersa across ELE
BRI the geographic range (Nullarbor and arid
BAN zone masked off after projection, leaving BRO EYR areas close to the sampled populations). KUL BAN, Bandicoot Brook; BAN, Bangham;
BOR BOR, Bordertown; BRI, Brixton; BRO, GEE BAN Brockman; DRU, Drummond; ELE, TAR 0250500 NAM Low: 1.32 Ellenbrook; EYR, Eyre; GEE, Geergala; KUL, kilometers Kulunilup; NAM, Nangwarry; TAR, Talipa.
150 sites. Gene families were constructed by single-linkage clus- nonSSR flanking regions suitable for primers on both sides (tak- tering, and Ks values were calculated and plotted with reference ing into account whether the microsatellite was too close to the to each duplicated pair using codeml in the PAML package using end of a contig). the F3 9 4 model (Yang, 2007). Primer testing and microsatellite amplification Selection criteria for the detection of SSRs We used four geographically representative samples of We used MSTATCOMMANDER v.0.8.2 (Faircloth, 2008) to identify T. submersa (from populations Drummond (DRU), Kulunilup all perfect repeat motifs on the assembled contigs with at least (KUL), Eyre (EYR), Bordertown (BOR); Fig. 1) to test 10 9 coverage. Initially, we searched for all types of motifs microsatellite amplification and to troubleshoot amplification (mono-, di-, tri-, tetra-, penta- and hexanucleotide loci) with dif- conditions. To minimize the cost of primer synthesis during the ferent repeat lengths for a preliminary survey of the most fre- testing phase, we followed a protocol developed by Culley et al. quent types of repeated motifs. From these motifs, we used (2013) in which the DNA was amplified using a triplet of PRIMER 3 (Rozen & Skaletsky, 2000) to design candidate primers primers: a forward primer of each pair modified with a tail for all di- to hexanucleotides. A total of 47 primer pairs were sequence attached to the 50-end; a labeled tail primer with the designed: 28 di- (38.29%), 26 tri- (55.31%) and three tetranu- same tail sequence and with the fluorescent label attached to the cleotide repeats (6.38%). These were based on suitable primer 50-end; and a reverse primer. We used the M13 ( 21) tail annealing sites in the genes (Table 1), that is, the presence of sequence (TGTAAAACGACGGCCAGT) tagged with the
New Phytologist (2016) 210: 310–323 Ó 2015 The Authors www.newphytologist.com New Phytologist Ó 2015 New Phytologist Trust New Phytologist Research 313
Table 1 Characteristics and genetic diversity statistics of the polymorphic microsatellite markers developed for Trithuria submersa
GenBank accession Repeat Locus Primer sequence 50–30 no. motif GO annotation NA
Tri006 F: CTGATGCCTCTGGTCTCCG KT920158 (AG)^12 Biological process 24 R: TTTGCATCGTCAGGCAGGG Tri009 F: CAGCCCATCCCGGGTTATC KT920159 (ATC)^4 tRNA wobble adenosine to inosine editing 22 R: TGATGCTTCGCAAGCTGAC Tri014 F: GGAGAGCAAAGCGAGGATTTC KT920160 (TC)^10 UDP-galactose transport; UDP-glucose transport; lateral root 14 R: GCACGAGCTCCAACTCCG development; root hair cell development Tri017 F: GTGCAGGGCTTGTCTATGC KT920161 (ATTT)^4 Petal differentiation and expansion stage 21 R: CCTACTTCATGATCTGGAACTGC Tri018 F: TGATCAGATATTGCCTCCAGC KT920162 (CGT)^4 Biological process 24 R: TGCGAATTCCCGGCTTCC Tri035 F: ACCTCTGCCTTCTGACGAG KT920163 (GAT)^4 Nucleotide biosynthetic process; phenylalanyl-tRNA 13 R: TGAGGTAGCGAGGCAATCC aminoacylation Tri042 F: ATACAGGTGCCGGTTGGAG KT920164 (CTT)^4 Proteolysis 24 R: TCTGGGCCTGAAGAGCAC Tri043 F: ACTGCCGCCAAATTTCCAC KT920165 (CTT)^5 Regulation of Rab GTPase activity 12 R: GAATTCCGCGTTGGCTCTG Tri053 F: CCGCTTCTCGGATCGTTTC KT920166 (AAC)^4 Biological process 12 R: TTCCAGCCAGTTTCCGAGC Tri056 F: GGCAAATGTCGGAGAAGGC KT920167 (GCT)^5 Flower development, flower morphogenesis; negative regulation 20 R: CAGCTGCTCGAATACTGACG of biological process; organ morphogenesis; regulation of flower development; regulation of transcription; DNA-dependent; response to auxin stimulus; Tri058 F: GAGAGCTGTCTCCAGCCAC KT920168 (AG)^7 Serine-type endopeptidase inhibitor activity 21 R: GAGATGGACGGCGTTGAAG Tri077 F: GCCAGAGTTGGCATCAACG KT920169 (TA)^8 Structural constituent of ribosome 20 R: AGGACCCTTTGCAAGAGTAGG Tri080 F: TGACAGAGCCTTCACCAGC KT920170 (AG)^8 Regulation of transcription, DNA-dependent 22 R: AGCCTTGCGATCGGAGTTC Tri081 F: TAGGGCGACGTTACCGC KT920171 (AAG)^5 DNA repair; actin nucleation; floral organ formation, gravitropism; 20 R: TGGACTCCTCATGCCCAAC negative regulation of transcription; DNA-dependent; reproductive structure development; response to red or far red light Tri084 F: GGTAGCTTCCCTACGGCTG KT920172 (AAG)^4 Galactolipid biosynthetic process; response to hypoxia 18 R: GACGCCGTTTATCTCCACG Tri087 F: CCTTCTGACAGTTCTGCCG KT920173 (AAG)^5 Biological process 18 R: CAACTGCGTCCTTCCCAAC Tri095 F: TGATGTCCGCCCGCATTC KT920174 (TA)^9 Growth and developmental stages 19 R: GCGCTAATCCCTCGATCCG Tri107 F: CTAATAGCTTCGTTATCAACGGG KT920175 (ATGC)^4 Histone methylation; negative regulation of flower development; 21 R: TTCCAATCAAGCACGCTTAC regulation of gene expression by genetic imprinting; vernalization response Tri111 F: ATCGGGAGTTTGGTTCGGG KT920176 (GTT)^5 Anther development; anthocyanin accumulation in tissues 13 R: CCCAAGTTACATGCGGTACG in response to UV light Tri115 F: TTCAGCTTTGTCCTTGCCC KT920177 (CTT)^4 Calcium ion transport, intra-Golgi vesicle-mediated transport; 20 R: AGACAAGCTCCTAATTTGTCATC lipid transport; photoperiodism, flowering Tri119 F: GTGGCCATTTCCGCAGAC KT920178 (AG)^15 Biological process 15 R: GCGCATAGCTCTTTCAGCC Tri121 F: GAATGGGAGGTTGCCGAAG KT920179 (GCT)^6 Regulation of transcription; DNA-dependent 18 R: ACTTGAGAAAGTCTACTCATGAAC
GO, gene ontology annotations based on the TAIR database (http://www.arabidopsis.org); NA, total number of alleles.
6-FAM/blue fluorescent label, after ensuring that it did not containing 10 ng DNA, 0.5 lM of the forward tailed primer, amplify any fragment. Separate amplification reactions were also 2 lM of the reverse primer, 2 lM of the labeled tail, 0.2 ll performed to check that unlabeled forward and reverse primers deoxynucleoside triphosphate (10 pmol), 1 9 reaction buffer, were amplifying the desired microsatellites. Likewise, amplifica- and 0.2 ll Taq DNA polymerase (2U; BioStar Lifetech, tion reactions with only the forward-tailed primer and the reverse Bangalore, Karnataka, India). Amplifications were run under the primer were used to ensure that they also amplified appropriate following conditions: an initial denaturation at 94°C for 5 min, fragments. Amplifications were performed in 10 ll reactions followed by 30 cycles of denaturation (94°C, 30 s), annealing
Ó 2015 The Authors New Phytologist (2016) 210: 310–323 New Phytologist Ó 2015 New Phytologist Trust www.newphytologist.com New 314 Research Phytologist
(56°C, 45 s) and extension (72°C, 45 s), followed by another extensive homozygosity at each homeologous locus (i.e. two eight cycles of denaturation (94°C, 30 s), annealing (53°C, 45 s), underlying loci per SSR locus in a tetraploid) as a consequence of and extension (72°C, 45 s), and a final extension at 72°C for a highly selfing mating system (Taylor et al.,2010).Otherexpla- 10 min. The PCR fragments were analyzed on an ABI 3730 nations may be possible for the observed patterns in a polyploid sequencer (Applied Biosystems, Foster City, CA, USA). Allele (e.g. a high frequency of null alleles). However, the consistent sizes were determined using Peak Scanner v.1.0 (Life Tech- observation of one or two alleles across all 22 SSR loci requires an nologies, Burlington, ON, Canada) and examined manually. explanation that affects the whole genome, and our hypothesis is Amplifications were successful for 44 of the 47 primer pairs consistent with one (perhaps two) recent polyploidization event (94%) in the samples of T. submersa tested. Twelve of these identified in the Ks plot (see the first section of Results). Interpret- showed no variation between samples and 10 failed to produce ing these patterns as alleles at a single diploid locus would lead to readable electropherograms, despite several attempts at PCR substantial departures from equilibrium expectations and incorrect optimization. inference of standard population genetics statistics, such as esti- mates of expected heterozygosity and Hardy–Weinberg equilib- rium (HWE) (Obbard et al., 2006). We typically observed Population study of T. submersa and transferability to other departures from HWE for individual loci, in each nonmonomor- species phic population when analyzed in this way (Table S3). We used the remaining 22 optimized primer pairs (Table 1) for We therefore assessed genetic variation by quantifying the total surveying the patterns of genetic variation and characterizing the number of alleles (An), the number of private alleles for each population structure of T. submersa. After cleaning, preanthetic location, and genotypic diversity, using POLYSAT (Clark & Jasie- reproductive units were cut into small pieces, and immediately niuk, 2011). This is an R package for polyploid microsatellite frozen and stored at 80°C until further processing. DNA was analysis that calculates pairwise distances between individuals extracted using a standard CTAB protocol (Doyle & Doyle, using a stepwise mutation model or infinite alleles model, with- 1987). In total, 240 samples of T. submersa from 12 geographi- out taking ploidy levels or allelic frequencies into account. We cally representative populations (Fig. 1) were used to survey also calculated the frequency of genetically similar genotypes for genetic diversity and population genetic structure. The only each population as the number of unique genotypes observed in major geographic area not included in our sampling is Tasmania, relation to the total number of individuals sampled (Brundu close to the sampled SE populations. We also tested the transfer- et al., 2008). To understand the geographical patterns of genetic ability of SSR markers among related species, by extracting DNA variation, we modeled allelic richness as a function of latitude or from the reproductive units of the 11 remaining species delimited longitude using linear regression. The spatial patterns of allelic in Trithuria: T. bibracteata and T. occidentalis (section Trithuria); richness were visualized by mapping variation for the populations T. austinensis, T. australis, T. filamentosa and T. inconspicua (sec- across space with the interpolation kriging function in ARCINFO tion Hydatella); T. lanterna, T. konkanensis and T. polybracteata (ESRI, Redlands, CA, USA), using a spherical semivariogram (section Hamannia); T. cookeana and T. cowieana (section model. Altofinia) (Sokoloff et al., 2008); single individuals from two populations were genotyped per species, with the exception of Population genetic structure T. cookeana and T. polybracteata, where only one population was available in each case (Supporting Information Table S1). We used the Bayesian program STRUCTURE v.2.3.4 (Pritchard et al., 2000) to model the population structure and to assign indi- vidual plants to subpopulations. Bayesian clustering methods Interpretation of SSR banding patterns, and estimates of such as STRUCTURE assign individuals to one or more genetic genetic variation clusters and are thought to be relatively insensitive to deviations We expected microsatellites in T. submersa to have a multiallelic from HWE (Brundu et al., 2008). Here we considered models phenotype at each locus, reflecting its possible allopolyploid con- with putative numbers of populations (K) from one to 10, with stitution (Kynast et al., 2014). It can be difficult to assign alleles to admixture and correlated allele frequencies. We conducted 10 particular duplicated loci in polyploids (e.g. Mable, 2004; De Silva independent runs with 50 000 burn-in steps, followed by run et al., 2005; Catalan et al., 2006), as is the case here. However, the lengths of 300 000 interactions for each K. The number of true relatively simple SSR patterns that we observed support it being a clusters in the data was estimated using STRUCTURE HARVESTER highly selfing polyploid, as we found only one or two alleles (vari- (Earl & vonHoldt, 2012), which identifies the optimal K based ants) per SSR ‘locus’ (defined by the amplification genotype, both on the posterior probability of the data for a given K and regardless of how many underlying homeologous loci may con- the ΔK (Evanno et al., 2005). To assess the membership propor- tribute). The segregation of alleles in outcrossing allopolyploids tions (q-values) for clusters identified in STRUCTURE correctly, the should follow disomic inheritance patterns with (at least occasion- results of the replicates at the best-fitting K were postprocessed ally) more than two alleles obtained across the homeologous loci using CLUMPP v.1.1.2 (Jakobsson & Rosenberg, 2007). In amplified for a given SSR marker. The consistent observation of addition, BAPS v.5.2 (Corander et al., 2006) was used to explore only one or two amplified variants per SSR marker here population structure further. BAPS determines optimal partitions (Table S2) may be consistent with allopolyploidy, assuming for each candidate K-value and merges the results according to
New Phytologist (2016) 210: 310–323 Ó 2015 The Authors www.newphytologist.com New Phytologist Ó 2015 New Phytologist Trust New Phytologist Research 315 the log-likelihood values, to determine the best K-value. Analyses using a Mantel test (Mantel, 1967) implemented in GENEPOP in BAPS were done at the level group of individuals using two v.3.3 (Raymond & Rousset, 1995). Tests were performed using models (with and without spatial information) independently, the ‘Isolde’ option with 10 000 permutations. IBD patterns were and by selecting one to 13 as possible K-values. Ten repetitions studied for the whole area, and within and between clusters and were performed for each K-value. Although these Bayesian pro- subclusters identified in the Bayesian analyses. grams have been widely used to infer population structure in polyploids (e.g. Lo et al., 2009; Vanderpoorten et al., 2011), Results there may be additional issues with their use. For example, poly- ploids frequently show a shift to selfing or asexual reproduction, 454 sequencing and distribution of gene duplication events violating the assumption of random mating within clusters (Dufresne et al., 2014). Because it is currently unknown how Sequencing of a T. submersa cDNA library of an individual from these violations affect population clustering in STRUCTURE,we SW Australia on a full 454 plate produced a total of 637 824 calculated the frequency of the most common allele for each reads with an average read length of 241.2 bp. The total length of locus and the squared difference in its frequency between eastern the reads was 153.8 megabases. After processing to remove cus- and western regions (the most strongly identified spatial divi- tom library adapters, the total read number was reduced to sion), which we then averaged across loci. We then randomized 531 371, with an average length of 427.4 bp and a total yield of sites (geographical locations) within SSR loci, keeping individuals 30.6 Mb. The average read depth was 6.94 9. A peak of gene = sampled from a site together, and recalculated the average SE vs duplications near Ks 0.1 suggests an ancestral polyploidy event SW difference across loci for 10 000 randomized datasets to in this species (Fig. 2), although, given the complexity of the obtain an expected distribution for the observed mean difference peak, it may include additional successive WGDs (leading to if there were no SE vs SW genetic structure. octaploidy, for example); note that recent background gene duplication events (part of the exponential decay in Ks plots) are swamped here by the recent polyploidy event, and that the scale Genetic differentiation is narrower than is typical for these plots. We estimated genetic differentiation among populations using an analysis of molecular variance (AMOVA) with ARLEQUIN 3.11 Frequency and distribution of different types of SSR (Excoffier et al., 2005). Further, to study differentiation among markers clusters, two independent AMOVAs were also carried out based on the results of the Bayesian analyses retrieved by STRUCTURE and MSTATCOMMANDER detected 9032 repeats from 71 592 nonredun- BAPS. In each analysis, genetic variance was quantified among dant unigenes; 2.5% of the unigene sequences contained more groups, among populations within groups and within sampling than one SSR type. Repeats varied in the following order: 7938 populations, using the genetic distance of Nei (1972, 1978). Each mono- (87.88%), 650 di- (7.19%), 427 tri- (4.72%), 12 tetra- AMOVA was run with 10 000 permutations at 0.95 significance levels. We also constructed a neighbor-joining (NJ) tree (with 1000 bootstrap replicates to estimate branch support) to summa- 400 rize distances among populations that were based on Bruvo dis- tances determined in POLYSAT (Clark & Jasieniuk, 2011). Because allele copy number is frequently unknown in polyploid microsatel- 300 lite data, Bruvo et al. (2004) developed a measure of genetic dis- tance that takes into account mutational distances between alleles. A matrix is created containing all differences in repeat counts between the alleles of two individuals at one locus, which are then 200 geometrically transformed to show probabilities of mutation from one allele to another. The resulting matrix is used to find the mini- No. of duplications No. of duplications mum sum of distances if each allele from one individual is paired 100 to one allele from the other individual, which is then divided by the number of alleles per individual. Finally, we used this matrix to perform a principal coordinate analysis (PCoA) to visualize Bruvo genetic distances between populations. The PCoA method is par- 0 0.1 0.2 0.3 0.4 0.5 0.6 ticularly suitable for analyzing polyploid data, as it also does not K assume HWE (Jombart et al.,2009). s Fig. 2 Age distribution of paralogs estimated from a Trithuria submersa
transcriptome. The peak of gene duplication close to Ks = 0.1 is inferred to Isolation by distance represent one (possibly more) round of polyploidy (x-axis = Ks of nodes in gene trees; y-axis = frequency of nodes). Recent background gene Relationships between Bruvo genetic distance and linear geo- duplications (part of an exponential decay) are dwarfed by the polyploidy graphic distances (isolation-by-distance (IBD)) were examined peak on this scale.
Ó 2015 The Authors New Phytologist (2016) 210: 310–323 New Phytologist Ó 2015 New Phytologist Trust www.newphytologist.com New 316 Research Phytologist
< 2 = < (0.13%), three penta- (0.03%) and two hexanucleotides P 0.0001; FIS, r 0.28, P 0.0001). Only 24% of alleles (28 (0.02%). Mononucleotide repeats were excluded from further out of 118) were shared between SW and SE regions, and 76% analyses, as they can be the result of sequencing error (Zheng of them (90 alleles) were private to each major region. Of these et al., 2013). The number of repeats ranged from four to 36, and private alleles, 69 were exclusively found in SW and 21 in the SE those with eight tandem repeats were the most abundant, fol- regions. Nevertheless, only 35 unique multilocus (across SSR lowed by those with 10 tandem repeats. Motifs that showed > 12 loci) genotypes (25 in SW vs 10 in SE regions, considering all 22 tandem repeats were very rare (< 0.5%). Among the dinucleotide SSR simultaneously) were found within 240 individuals sampled, repeats, the motif AG/CT (73%) was the most frequent one, substantially fewer than might be expected under random mating while among the trinucleotide repeats, the unit AGG/CCT was with 412 allelic variants. Low allelic variation at each SSR locus the predominant type (47%). was particularly evident in SE populations, where only one or two genotypes were found in each population, while up to six dif- ferent genotypes were detected within populations in the SW Patterns of fixed heterozygosity in Trithuria submersa region (see pie charts in Fig. 3a; Table S2). Consistent with these The 22 polymorphic loci were typed in 240 individuals of results, genotypic diversity (H) was very low, especially in SE T. submersa, revealing a total of 412 different allelic variants populations (Table 2), reflecting the presence of few genotypes (Table 1). Most loci showed fixed heterozygosity or homozygos- within each one. There were substantially more cases in which ity in one or more populations, with some variation within popu- individuals and populations from the SE region showed a ‘ho- lations (Table S2). Fixed heterozygosity patterns are expected in mozygous’ multilocus genotype, compared with those in the SW polyploids that are clonal or highly selfing (they should also be region. observed immediately after allopolyploidization, but additional variation should also accumulate across populations over time). Population structure Vegetative clonality may be unlikely in this ephemeral taxon, and pollinator observations and pollination experiments are consis- The Bayesian clustering program STRUCTURE indicated the exis- tent with a high degree of selfing rather than apomixis (e.g. Fig. 7 tence of two geographically distinct clusters in T. submersa, sup- in Taylor et al., 2010). A fixed heterozygosity pattern for SSR ported by the ΔK criterion (Figs 3b, S1). The two clusters, which markers would be expected if the variants at underlying (presum- respectively comprised the SW vs SE sets of populations of ably inbred, homozygous) sets of homeologous loci are different. T. submersa, were each homogeneous, and individuals always had This pattern is what we frequently observed. For example, at SSR a high membership coefficient (q > 0.9). Further genetic sub- locus Tri006 in the DRU population of SW Australia (Fig. 1), all structure was detected within either cluster when STRUCTURE was 20 individuals bore two ‘alleles’ with 120 and 124 repeats (see run considering only SW or SE populations. Within the SW Table S2). In addition, most SSR loci showed significant devia- cluster, two genetically distinct groups were found that divide tions from HWE in populations with variation (Table S3), and north and south populations, whereas in the SE cluster, the most fixed heterozygosity was observed even when there were more isolated population (EYR) formed a distinct genetic group. A than two alleles present within a population (Table S3). This is similar boundary was found in the results obtained by BAPS consistent with homozygosity at underlying duplicated loci, as (Fig. 3d). would be expected in a selfing polyploid (most likely a Because some of the assumptions of STRUCTURE were probably tetraploid). For example, at locus Tri107 in the DRU popula- violated (e.g. random mating; diploid loci), we performed a ran- tion, 15 individuals bore alleles 294 and 308 and five individuals domization test, permuting data at a locus among locations bore alleles 298 and 308 (Table S2); no individuals bore alleles (keeping individuals within a location together). This analysis 294 and 298, as would be expected under random mating at a also supported the existence of a significant spatial genetic struc- single locus. We therefore expect that these correspond to ture between SW and SE locations, as the observed difference homozygous genotypes at separate homeologous loci underlying was well in the tail of the randomized distribution (P 0.01; each amplification genotype. A ‘homozygosity’ pattern for indi- Fig. 4). The NJ tree depicts a picture of population relationships vidual SSR amplifications was also observed in multiple cases that are similar to the previous methods, as SW locations are sep- (such as in the Eyre population for locus Tri009; Table S2), arated from the SE ones in two different clusters, with 99% boot- which is possible if different homeologous loci have the same size strap support (BS). These correspond to the main clusters variant ‘allele’. detected in STRUCTURE and BAPS (Fig. 5a). The remaining highly supported subdivisions found in the NJ tree correspond mainly to the clusters retrieved in BAPS. In addition, the two northern Allelic and genotypic diversity in T. submersa populations populations (Brixton and Ellenbrook) were closely related but Allelic diversity (NA) declined between SW and SE regions well separated from the remaining SW populations (Fig. 5a). We (r2 = 0.61, P < 0.0001) and across populations from north to also performed a PCoA to visualize the variation in genetic dis- south (r2 = 0.77, P < 0.0001; Fig. 1b). A similar trend was tances among populations. This analysis grouped SE populations observed for the remaining genetic parameters (SW to SE: Ho, together in the lower right quadrant of the first PCoA axis (ex- 2 = < 2 = < 2 = r 0.02, P 0.0001; He, r 0.41, P 0.0001; FIS, r 0.19, plaining 71% of the variation), while SW populations clustered < 2 = < 2 = P 0.0001; N to S: Ho, r 0.08, P 0.0001; He, r 0.76, in the upper left quadrant of the second PCoA axis (15% of the
New Phytologist (2016) 210: 310–323 Ó 2015 The Authors www.newphytologist.com New Phytologist Ó 2015 New Phytologist Trust New Phytologist Research 317
(a)
DRU ELE BRI BAN BRO EYR KUL GEE BOR BAN TAR 0 250 500 NAM kilometers
(b) 1.00
0.80
0.60
0.40
0.20 Allele frequencies
0.00 (c) 1.00
0.80
0.60
0.40
STRUCTURE 0.20
0.00 1.00 (d) 0.80
0.60
BAPS 0.40
0.20
0.00 DRU ELE BRI BAN BRO KUL EYR GEE BAN BOR TAR NAM
Fig. 3 Population structure of 240 individuals of Trithuria submersa based on 22 simple sequence repeat (SSR) loci. (a) Detail of the 22 sampled populations based on the map showed in Fig. 1 and proportion of distinct multilocus genotypes (white area in pie charts) within each population sampled. (b) Mean proportion of alleles found only in western (blue) or eastern (yellow) populations, and shared between both (gray). (c) Summary of population structure using the best assignment analysis of STRUCTURE (K = 2); two significant genetic clusters were inferred that divide southwestern (SW) and southeastern (SE) populations. (d) Summary of population structure using BAPS analysis (K = 4) showing a subdivision of the most northern and southern populations within SW and SE clusters; the same results were obtained when STRUCTURE was run only with SW or SE populations. In all diagrams, each individual is represented by a thin vertical line, which is partitioned into K colored segments that represent the individual’s estimated membership fractions. BAN, Bandicoot Brook; BAN, Bangham; BOR, Bordertown; BRI, Brixton; BRO, Brockman; DRU, Drummond; ELE, Ellenbrook; EYR, Eyre; GEE, Geergala; KUL, Kulunilup; NAM, Nangwarry; TAR, Talipa. variation; Fig. 5b). The EYR population was well differentiated clusters, and among individuals within populations, respectively from the remaining SE populations. (Table 3). Similarly, there was significant genetic differentiation between the K = 4 clusters identified using BAPS (Table 3). Genetic differentiation Isolation by distance Genetic differentiation was high across populations (AMOVA = < FST 0.535, P 0.000 01). The analysis performed on the 12 A significant IBD relationship was evident across the whole populations indicated that 64 and 35% of the genetic variation range. The Mantel’s test showed that genetic and geographical was attributed to variation among and within populations, distances of populations are positively correlated (r2 = 0.67, respectively (P < 0.000 01; Table 3). AMOVA attributes 35, 34 y = 0.0081x 0.0241, P < 0.0001). However, this was largely and 30% of the total variation to variation between the two clus- driven by the SW/SE split. The relationship between compar- 2 ters revealed by STRUCTURE, among populations within the isons within the SE cluster was not significant (r = 0.23,
Ó 2015 The Authors New Phytologist (2016) 210: 310–323 New Phytologist Ó 2015 New Phytologist Trust www.newphytologist.com New 318 Research Phytologist
Table 2 Sampled populations of Trithuria submersa by region
Location Code Latitude (N) Longitude (W) n NA AR H
Western Australia Drummond DRU 31.326 12 116.403 27 20 41 1.739 0.345 Brixton BRI 32.030 94 115.970 43 20 38 1.535 0.277 Ellenbrook ELE 31.424 83 116.271 42 20 31 1.486 0.201 Bandicoot Brook BAN 32.818 17 115.905 42 20 41 1.617 0.154 Brockman BRO 34.160 99 115.466 60 20 34 1.414 0.010 Kulunilup KUL 34.321 72 116.779 24 20 34 1.414 0.051 Eastern Australia Eyre EYR 34.420 78 135.704 72 20 34 1.359 0.011 Geergala GEE 36.597 47 140.906 13 20 31 1.359 0.007 Bangham BAN 36.614 93 140.879 53 20 32 1.327 0.005 Bordertown BOR 36.613 41 140.878 02 20 30 1.323 0.002 Talipa TAR 37.161 99 140.621 53 20 32 1.286 0.001 Nangwarry NAM 36.999 59 140.587 57 20 34 1.285 0.001
n, number of plants genotyped; NA, total number of alleles; AR, allelic richness; H, genotypic diversity.
appears to be universal in Trithuria, as it amplified well in all species (Tri0058; Fig. 6; Table 1). 0.08 Discussion 0.06 Polyploidy and genetic diversity in T. submersa 0.04
Probability Our gene duplication analysis supports recent WGD in the evo- lutionary history of T. submersa (Fig. 2). A chromosome count in 0.02 T. submersa points to at least one population having 2n = 56 chromosomes, consistent with an octoploid chromosome com- = 0.00 0.01 0.02 0.03 0.04 0.05 0.06 0.07 plement if the base haploid number is around x 7 (O. Hidalgo Mean squared difference et al., unpublished indicates that there are several diploid species in the family with 2n = 14). No individual exhibited an SSR pat- Fig. 4 Expected distribution of squared differences in the frequency of the tern with more than two variants per ‘locus’ here (Table S2) con- most common allele across southeastern (SE) vs southwestern (SW) regions (average across simple sequence repeat loci), based on a sidering the locus to be the amplification genotype produced by a randomization analysis. The observed difference is marked with an arrow. single SSR primer pair, which probably represents at least two underlying homeologous loci. This pattern might instead point to T. submersa being a highly diploidized tetraploid (Ramsey & y = 0.0023x 0.0451, P = 0.563), and within the SW cluster, Schemske, 2002; De Smeta et al., 2013). However, the lack of the slope of the relationship was low (r2 = 0.14, HWE that we observed (if we interpret each SSR locus as a single y = 0.0256x 0.8742, P < 0.0001). diploid locus) would then only be possible if T. submersa were also apomictic. Two long-lived submerged species of Trithuria (T. filamentosa and T. inconspicua; Remizowa et al., 2008; Rudall Potential transferability to other Trithuria species et al., 2008) are indeed apomictic. However, T. submersa is a We assayed 44 primer pairs in other species of Trithuria,of short-lived annual that reproduces primarily through self- which a maximum of 21 produced amplification products. The fertilization (Rudall et al., 2008, 2009a,b; Taylor et al., 2010; 12 primer pairs that showed no variation in T. submersa and the Taylor & Williams, 2012). 10 that produced unreliable electropherograms did not amplify Different lines of evidence therefore point to the SSR patterns in the other species. One marker (Tri006) was specific for being explained by polyploidization, most likely by a single event. T. submersa, as it showed no amplification in the other species. The morphological bimodality observed in the karyotype of The degree of amplification varied between species and sections T. submersa (Kynast et al., 2014) suggests a round of allopoly- (Fig. 6). However, the SSRs generally amplified quite well, in ploidy (although autopolyploidy might also be consistent with some taxa across nearly all loci (for T. occidentalis and our microsatellite data, assuming sufficient time for accumulation T. bibracteata, two species closely related to T. submersa; Fig. 6). of the observed variation). Three or more variants in an outcross- The primers also showed a relatively high degree of amplification ing tetraploid or a higher-level polyploid would occasionally be in T. australis, despite the fact that this species is not particularly expected from an SSR amplification if there were at least one closely related to T. submersa (Fig. 6). One microsatellite motif round of polyploidization (i.e. assuming at least two
New Phytologist (2016) 210: 310–323 Ó 2015 The Authors www.newphytologist.com New Phytologist Ó 2015 New Phytologist Trust New Phytologist Research 319
(a) (b) GEE 1.50 BAN DRU BOR 1.00 66 TAR ELE BRI NAM cluster Eastern BAN 0.50 EYR BRO DRU 99 KUL 99 0.00 GEE 99 BRI Coord. 2 BAN 64 ELE TAR BOR BAN –0.50 NAM
BRO cluster Western EYR KUL –1.00
0.2 –3.00 –2.00 –1.00 0.00 1.00 2.00 3.00 Coord. 1
Fig. 5 Genetic relationships among the 22 populations of Trithuria submersa populations based on Bruvo genetic distance. (a) Neighbor-joining tree of T. submersa based on pairwise genetic distance estimates between populations (bootstrap value > 50% are shown beside branches). Main STRUCTURE and BAPS identified clusters are overlaid on the tree. (b) Principal Coordinate Analysis (PCoA). BAN, Bandicoot Brook; BAN, Bangham; BOR, Bordertown; BRI, Brixton; BRO, Brockman; DRU, Drummond; ELE, Ellenbrook; EYR, Eyre; GEE, Geergala; KUL, Kulunilup; NAM, Nangwarry.; TAR, Talipa.
Table 3 Analysis of molecular variance (AMOVA) of Trithuria submersa et al. (2014). The published chromosomal evidence for this pop- populations based on 12 sampling populations, two genetic clusters ulation (one not examined here) and the transcriptome presented defined by STRUCTURE, and four genetic clusters defined by BAPS here come from different populations in the SW part of the programs species range, and so it will be important to investigate additional Populations d.f. SS Variance % P-values Ks plots and chromosome counts from both parts of the range of T. submersa. It is also possible that independent polyploidization 12 sampling populations events occurred in different parts of the species range, involving Among all 11 2098.669 4.703 64.23 < 0.000 01 populations different sets of parental species, as has been observed in other Within each 468 1233.3 2.635 35.91 < 0.000 01 polyploid species (e.g. Soltis et al., 2004). Independent polyploid population speciation events in SW and SE parts of the range of T. submersa Total 479 3331.969 7.339 may be consistent with the substantial genetic disjunction we Two genetic clusters defined by STRUCTURE observed between the SW and SE parts of its range. Among two clusters 1 855.031 3.044 34.9 < 0.000 01 Among populations 10 1243.637 3.043 34.89 < 0.000 01 As already noted, the low population variation at the homeolo- within two clusters gous loci that probably underlie the fixed heterozygosity patterns Within all 468 1233.303 2.635 30.21 < 0.000 01 in T. submersa, and the presence of a high number of identical populations SSR genotypes within each population may be explained by its Total 479 3331.969 8.722 highly selfing mating system (Taylor et al., 2010). Populations of Four genetic clusters defined by BAPS programs Among four clusters 3 1337.844 3.157 38.96 < 0.000 01 T. submersa also have low amounts of genetic variation in terms Among populations 8 760.825 2.311 28.52 < 0.000 01 of allelic and genotypic diversity. Other species from the ANA within four clusters grade seem to show higher values of genetic diversity, although Within all 468 1233.301 2.635 32.52 < 0.000 01 these estimates are based on loci assumed to be under HWE. For populations instance, Ho and He in Amborella, which is cross-pollinated by Total 479 3331.969 8.104 wind and insects, ranged from 0.321 to 0.523 and 0.336 to d.f., degrees of freedom; SS, sum of squares; %, percentage of total 0.567, respectively (Poncet et al., 2012). Species in the water lilies variance contributed by populations, clusters and individuals. (Nymphaeaceae), the sister group of Hydatellaceae, show moder- ate to low degrees of genetic diversity, despite being insect- – homeologous loci, each segregating independently). We instead pollinated: Ho and He values were in the ranges 0.10 0.19 and observed a maximum of two ‘allelic’ variants per SSR amplifica- 0.14–0.16 in the diploid Nuphar submersa (Yokogawa et al., tion (Table S2) and variant genotypes across the range for each 2012), and 0–0.16 and 0–0.41 in the tetraploid Euryale ferox locus. These observations are most easily reconciled if the species (Imanishi et al., 2011; see also Quan et al., 2009). Although is a highly selfing tetraploid (i.e. with one round of WGD). Our T. submersa can produce seeds through outcrossing or self- observations of at most two alleles per microsatellite ‘locus’ would fertilization, so far no insects have been observed interacting with be harder to reconcile with widespread octoploidy in the species, it, although wind pollination may occur occasionally (Taylor although recent autopolyploidy could have occurred in some et al., 2010). A predominantly selfing mating system may be parts of the range, such as the population examined by Kynast required for its ephemeral aquatic life cycle, ensuring
Ó 2015 The Authors New Phytologist (2016) 210: 310–323 New Phytologist Ó 2015 New Phytologist Trust www.newphytologist.com New 320 Research Phytologist
(a) (b) Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri Tri 006 009 017014 018 035 042 043 053 056 058 077 080 081 084 087 095 107 111 115 119 121
T. cookeana nA ––––––––––+–––––––– ––– sect. Altofinia 99 T. cowieana nA –––––+*+–––+++–––––– –––
T. polybracteata ––––––––––+–––––––– ––– sect. Hamannia nA
T. konkanensis IN –––––+*+–––+–+––+––– –––
97 T. lanterna nA ––––––––––+–––––––– –––
T. austinensis sect. Hydatella swA –––––+++*––+–––––––– –––
T. australis swA –––++++–––++––––––+ –++
92 T. filamentosa TA ––––––––––+–––––––– –––
T. inconspicua NZ ––––––+*–––+–+–––––– ––– 92 T. occidentalis sect. Trithuria swA –++ ++++++++++++++++ +++
T. bibracteata swA –++ ++++++++++++–+++ +++
T. submersa swA 57 +++++++++++++++++++ +++ 0.003 – seA T. submersa & TA Fig. 6 (a) Phylogenetic relationships within Trithuria are illustrated on the left with a species tree estimated from multispecies coalescence analysis in Iles et al. (2012); western and eastern populations of Trithuria submersa were treated as two different species there. (b) Transferability of the simple sequence repeat markers developed from T. submersa to the remaining species of this genus. Geographic range: IN, India; nA, northern Australia; NZ, New Zealand; seA, southeast Australia; swA, southwest Australia; TA, Tasmania; Sect., section. *Indicates amplification in only one population.
reproduction when opportunities of crossing are low or unpre- period, at c. 34, 14 and 3 million yr ago (Ma) (‘Chills II–IV’), dictable (B alint et al., 2011). However, a highly selfing system each of which probably triggered an arid barrier between SW and might also represent a threat to the future conservation of a SE Australian biomes (Crisp & Cook, 2007). Climate-driven species, as selfing limits the efficacy of genetic recombination, events may therefore have led to a vicariant distribution in reducing the genotypic variation needed to respond to environ- T. submersa. However, the predicted date of a possible speciation mental change (e.g. Unmack, 2001). event between eastern and western T. submersa (if this is the explanation for our observations rather than independent poly- ploidization events in different parts of the range) may instead be A genetic discontinuity in T. submersa is consistent with a consistent with a more recent long-distance dispersal event (Iles major biogeographic barrier et al., 2014). Between the cooling events, an elevation in the sea Our finding of significant clustering of separate SW and SE Aus- level (usually accompanied by a warmer and wetter climate) led tralian populations, together with the high degrees of genetic dif- to marine incursions into the Nullarbor Plain, with the deposi- ferentiation between regions observed in the AMOVA analysis, tion of limestone around 42–34, 27–31 and 16–14 Ma (Crisp & provides further corroboration of the longstanding hypothesis Cook, 2007). Climate amelioration (the Miocene climatic opti- that Australian SW and SE biomes were isolated long ago by the mum; Li et al., 2004) together with these extensive lithic deposi- mid-Miocene aridification and by the uplift of the Nullarbor tions could also have favored the presence of refugial areas and a Plain as an edaphic barrier (Mast & Givnish, 2002; Crisp & subsequent spread of populations across central Australia. The Cook, 2007). This raises the question of whether T. submersa in presence of locally elevated areas in SE Australia where climatic the two regions should be treated as different species, consistent conditions have been largely stable across time has been used to with SE and SW lineages of this species present in both plastid explain the distribution of other trans-Nullarbor plants (Conran and ITS gene trees (Iles et al., 2012, 2014). This question needs & Lowrie, 2007). The lower degrees of genetic diversity and further study, although our data are potentially consistent with allelic richness in SE than in SW populations is expected under a this hypothesis. At least three rapid drying events were associated scenario of colonization of SE locations by more recent long- with a rapid expansion of the Antarctic ice sheet in the Cenozoic distance dispersal, especially if few plants were involved, as
New Phytologist (2016) 210: 310–323 Ó 2015 The Authors www.newphytologist.com New Phytologist Ó 2015 New Phytologist Trust New Phytologist Research 321 reported for other regions (Robichaux et al., 1997; Coates, 2000; also needed to provide insights into the nature and role of poly- Friar et al., 2000), although this could also be explained by other ploidy in this group. For example, we hypothesize that there is scenarios, such as bottlenecks unrelated to colonization (Brookes allopolyploidy in the recent ancestry of T. submersa, which it et al., 1997; Keller et al., 2001) or separate polyploid origins may be possible to test explicitly by considering additional tran- (Doyle et al., 2008). scriptome and chromosome data from closely related species of The north-south clustering pattern observed in SW Australia is Trithuria. also of note. Several studies have described high amounts of genetic structuring in species occurring in this region, even in narrow endemic species (e.g. Coates, 2000; Byrne & Hopper, Acknowledgements 2008; Millar & Byrne, 2013). This pattern is perhaps the hardest We thank Moira Scascitelli for extracting RNA and preparing to explain, as SW Australia is distinguished by high species diver- normalized cDNA for sequencing, and Sally Otto for suggest- sity and endemism (Hopper, 1979; Myers et al., 2000), which ing the randomization analysis and generating this figure, are thought to result primarily from a diverse mosaic of soils Jeannette Whitton for additional advice on interpreting SSR (Anand & Paine, 2002), localized extinctions driven by climatic results, and two anonymous reviewers for their helpful com- fluctuations, and an overall increase of aridity and fire over long ments. Oriane Hidalgo, Jaume Pellicer, Ralf Kynast and Ilia time frames (Hopper, 1979). Habitat fragmentation as a result of Leitch kindly shared unpublished chromosome numbers for recent human activities is also a major conservation issue in the species of Trithuria, and Ilia Leitch provided additional com- state of Western Australia and might offer an explanation for the ments on the manuscript. We also are grateful to the Western patterns observed in our study, as populations often occur in Australian Department of Parks and Wildlife for granting sci- fragmented islands in small protected areas (Mansergh et al., entific purpose licenses to collect the plants. This work was 2008). This is certainly the case for northern populations of supported by the People Programme (Marie Curie Actions) of Trithuria that we collected in natural reserves. Thus, both geo- the European Union’s Seventh Framework Programme (FP7/ graphical barriers and limited gene flow might have caused diver- 2007-2013) under REA grant agreement no. 301257, Aragon gence of these populations. Government – European Social Fund Bioflora – 281113/2 grant to P.C., NSF-IOS-1339156 to M.S.B. and NSERC Dis- Future directions covery grants to L.R. and S.W.G. Our study provides the first insights into patterns of genetic diversity in a species of Trithuria and may be useful for mating Author contributions system studies, species identification and other downstream I.M., S.A.M., M.S.B., L.H.R. and S.W.G. designed and con- studies in Hydatellaceae, an ancient ANA-grade lineage. The ducted research; I.M., T.D.M., J.G.C. and P.J.R. collected and SSR markers developed here show a moderate transferability to contributed plant material; I.M. and M.S.B. analyzed data; I.M., other species, which is highest for T. occidentalis and M.S.B., L.H.R., P.C. and S.W.G. interpreted the data; and I.M., T. bibracteata, two species that are evolutionarily most closely M.S.B. and S.W.G. led the writing of the manuscript. All authors related to T. submersa (Sokoloff et al., 2008; Iles et al., 2012, read and approved the paper. 2014). EST-based microsatellite markers tend to have high transferability among species, as sequences containing these markers are more conserved than sequences containing genomic References SSRs (Thiel et al., 2003; Liu et al., 2014). The transferability of Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local these markers to at least some other species of Trithuria pro- alignment search tool. Journal of Molecular Biology 215: 403–410. vides an opportunity for using these markers to investigate Anand R, Paine M. 2002. Regolith geology of the Yilgarn Craton, Western genetic diversity in the other species, and could also assist in Australia: implications for exploration. Australian Journal of Earth Sciences 49: – their conservation. Such is the case with T. occidentalis, which is 3 162. Angiosperm Phylogeny Group II. 2003. An update of the Angiosperm considered a ‘critically endangered’ species in Australia, with Phylogeny Group classification for the orders and families of flowering plants: only a single population known (Luu et al., 2012; Jones, 2014). APG II. Botanical Journal of the Linnean Society 141: 399–436. Further, although T. submersa may be abundant locally in some B alint M, Domisch S, Engelhardt CH, Haase P, Lehrian S, Sauer J, Theissinger sites, several populations appear to be threatened, as they occur K, Pauls S, Nowak C. 2011. Cryptic biodiversity loss linked to global climate – on roadsides or adjacent to agriculture, making them vulnerable change. Nature Climate Change 1: 313 318. Barker MS, Dlugosch KM, Dinh L, Challa RS, Kane NC, King MG, Rieseberg to human activity, nutrient runoff effects and weed invasion. LH. 2010. EvoPipes.net: bioinformatic tools for ecological and evolutionary The high rates of SSR amplification in species closely related to genomics. Evolutionary Bioinformatics Online 6: 143–149. T. submersa (T. bibracteata and T. occidentalis) should facilitate Brookes MI, Graneau YA, King P, Rose OC, Thomas CD, Mallet JLB. 1997. further studies to address species boundaries and possible inter- Genetic analysis of founder bottlenecks in the rare British butterfly Plebejus – species gene flow within this complex. It would also be valuable argus. Conservation Biology 11: 648 661. Brundu G, Lupi R, Zapelli I, Fossati T, Patrignani G, Camarda I, Sala F, to analyze genetic diversity in the Tasmanian populations of Castiglione S. 2008. The origin of clonal diversity and structure of Populus T. submersa. Thorough analysis of genome size and chromosome alba in Sardinia: evidence from nuclear and plastid microsatellite markers. evolution in T. submersa and other species of Hydatellaceae is Annals of Botany 102: 997–1006.
Ó 2015 The Authors New Phytologist (2016) 210: 310–323 New Phytologist Ó 2015 New Phytologist Trust www.newphytologist.com New 322 Research Phytologist
Bruvo R, Michiels NK, D’Sousa TG, Schulenberg H. 2004. A simple method Graham SW, Iles WJD. 2009. Different gymnosperm outgroups have (mostly) for calculation of microsatellite genotypes irrespective of ploidy level. Molecular congruent signal regarding the root of flowering plant phylogeny. American Ecology 13: 2101–2106. Journal of Botany 96: 216–227. Byrne M, Hopper SD. 2008. Granite outcrops as ancient islands in old Hopper SD. 1979. Biogeographical aspects of speciation in the southwest landscapes: evidence from the phylogeography and population genetics of Australian flora. Annual Review of Ecology and Systematics 10: 399–422. Eucalyptus caesia (Myrtaceae) in Western Australia. Biological Journal of the Huang X, Madan A. 1999. CAP3: a DNA sequence assembly program. Genome Linnean Society 93: 177–188. Research 9: 868–877. Catalan P, Segarra-Moragues JG, Palop-Esteban M, Moreno C, Gonzalez- Iles WDJ, Lee C, Sokoloff DD, Remizowa MV, Yadav SR, Barrett MD, Candelas F. 2006. A Bayesian approach for discriminating among alternative Macfarlane TD, Yadav SR, Barrett MD, Barrett RL et al. 2014. inheritance hypotheses in plant polyploids: the allotetraploid origin of genus Reconstructing the age and historical biogeography of the ancient flowering- Borderea (Dioscoreaceae). Genetics 172: 1939–1953. plant family Hydatellaceae (Nymphaeales). BMC Evolutionary Biology 14: 102. Chevreux B, Pfisterer T, Drescher B, Driesel AJ, Muller WE, Wetter T, Suhai Iles WDJ, Rudall PJ, Sokoloff DD, Remizowa MV, Macfarlane TD, Graham S. 2004. Using the miraEST assembler for reliable and automated mRNA SW. 2012. Molecular phylogenetics of Hydatellaceae (Nympheales) indicates transcript assembly and SNP detection in sequenced ESTs. Genome Research homoplasy in sexual systems and new sectional classification. American Journal 14: 1147–1159. of Botany 99: 663–676. Clark LV, Jasieniuk M. 2011. Polysat: an R package for polyploid microsatellite Imanishi A, Kaneko S, Isagi Y, Imanishi J, Natuhara Y, Morimoto Y. 2011. analysis. Molecular Ecology Resources 11: 562–566. Development of microsatellite markers for Euryale ferox (Nymphaeaceae), an Coates DJ. 2000. Defining conservation units in a rich and fragmented flora: endangered aquatic plant species in Japan. American Journal of Botany 2011: implications for the management of genetic resources and evolutionary e233–e235. processes in south-west Australian plants. Australian Journal of Botany 48: 329– Jakobsson M, Rosenberg NA. 2007. CLUMPP: a cluster matching and 339. permutation program for dealing with label switching and multimodality in Conran JG, Lowrie A. 2007. The biogeography of Drosera stricticaulis analysis of population structure. Bioinformatics 23: 1801–1806. (Droseraceae) in Australia: a disjunct ‘island’ refugee? Transactions of the Royal Jombart T, Pontier D, Dufour A. 2009. Genetic markers in the playground of Society of South Australia 132: 142–151. multivariate analysis. Heredity 102: 330–341. Corander J, Marttinen P, Mantyniemi S. 2006. Bayesian identification of stock Jones A. 2014. Threatened and priority flora list for Western Australia. Kensington, mixtures from molecular marker data. Fishery Bulletin 104: 550–558. WA, Australia: Department of Parks and Wildlife. Crisp MD, Cook LG. 2007. A congruent molecular signature of vicariance Keller LF, Jeffery KJ, Arcese P, Beaumont MA, Hochachka WM, Smith JNM, across multiple plant lineages. Molecular Phylogenetics and Evolution 43: Brufordet MW. 2001. Immigration and the ephemerality of a natural 1106–1117. population bottleneck: evidence from molecular markers. Proceedings of the Culley TM, Stamper TI, Stokes RL, Brzyski JR, Hardiman NA, Klooster MR, Royal Society of London B: Biological Sciences 268: 1387–1394. Merritt BJ. 2013. An efficient technique for primer development and Kynast RG, Jeffrey AJ, Pellicer J, Ramsay MM, Rudall PJ. 2014. Chromosome application that integrates fluorescent labeling and multiplex PCR. Applications behavior at the base of the angiosperm radiation: karyology of Trithuria in Plant Sciences 1: 1300027. submersa (Hydatellaceae, Nymphaeales). American Journal of Botany 101: De Silva HN, Hall AJ, Rikkerink E, McNeilage MA, Fraser LG. 2005. 1447–1455. Estimation of allele frequencies in polyploids under certain patterns of Lai Z, Zou Y, Kane NC, Choi JH, Wang X, Rieseberg LH. 2012. Preparation of inheritance. Heredity 95: 327–334. normalized cDNA libraries for 454 Titanium transcriptome sequencing. De Smeta R, Adams KL, Vandepoele K, Van Montagu MCE, Maere S, Van de Methods in Molecular Biology 888: 119–133. Peer Y. 2013. Convergent gene loss following gene and genome duplications Li Q, Simo JA, McGowran B, Holbourn A. 2004. The eustatic and tectonic creates single-copy families in flowering plants. Proceedings of the National origin of Neogene unconformities from the Great Australian Bight. Marine Academy of Sciences, USA 110: 2898–2903. Geology 203:57–81. Dlugosch KM, Lai Z, Bonin A, Hierro J, Rieseberg LH. 2013. Allele Liu Z, Liu P, Luo D, Liu W, Wang Y. 2014. Exploiting Illumina sequencing for identification for transcriptome-based population genomics in the invasive the development of 95 novel polymorphic EST-SSR markers in common vetch plant Centaurea solstitialis. G3 (Bethesda) 3: 359–367. (Vicia sativa subsp. sativa). Molecules 19: 5777–5789. Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small quantities Lo EYY, Stefanovi c S, Dickinson TA. 2009. Population genetic structure of of fresh leaf tissue. Phytochemistry Bulletin 19:11–15. diploid sexual and polyploid apomictic hawthorns (Crataegus; Rosaceae) in the Doyle JJ, Flagel LE, Paterson AH, Rapp RA, Soltis D, Soltis P, Wendel JF. Pacific Northwest. Molecular Ecology 18: 1145–1160. 2008. Evolutionary genetics of genome merger and doubling in plants. Annual L€ohne C, Yoo M-J, Borsch T, Wiersema J, Wilde V, Bell CD, Barthlott W, Review of Genetics 42: 443–461. Soltis DE, Soltis PS. 2005. Biogeography of Nymphaeales: extant patterns and Dufresne F, Stift M, Vergilino R, Mable BK. 2014. Recent progress and historical events. Taxon 57: 1123–1146. challenges in population genetics of polyploid organisms: an overview of Luu R, Macfarlane T, Brown A. 2012. Western Trithuria, Trithuria occidentalis current state-of-the-art molecular and statistical tools. Molecular Ecology 23: interim recovery plan 2011–2016. Interim Recovery Plan No. 327. Kensington, 40–69. WA, Australia: Department of Environment and Conservation. Earl DA, vonHoldt BM. 2012. STRUCTURE HARVESTER: a website and Mable BK. 2004. ‘Why polyploidy is rarer in animals than in plants’: myths and program for visualizing STRUCTURE output and implementing the Evanno mechanisms. Biological Journal of the Linnean Society 82: 453–466. method. Conservation Genetics Resources 4: 359–361. Mansergh I, Cheal D, Fitzsimons JA. 2008. Future landscapes in south-eastern Evanno G, Regnaut S, Goudet J. 2005. Detecting the number of clusters of Australia: the role of protected areas and biolinks in adaptation to climate individuals using the software STRUCTURE: a simulation study. Molecular change. Biodiversity 9:59–70. Ecology 14: 2611–2620. Mantel N. 1967. The detection of disease clustering and a generalized regression Excoffier L, Laval G, Schneider S. 2005. Arlequin (version 3.0): an integrated approach. Cancer Research 27: 209–220. software package for population genetics data analysis. Evolutionary Mast AR, Givnish TJ. 2002. Historical biogeography and the origin of stomatal Bioinformatics Online 1:47–50. distributions in Banksia and Dryandra (Proteaceae) based on their cpDNA Faircloth B. 2008. Msatcommander: detection of microsatellite repeat arrays and phylogeny. American Journal of Botany 89: 1311–1323. automated, locus-specific primer design. Molecular Ecology 8:92–94. Mathews S, Donoghue MJ. 1999. The root of angiosperm phylogeny inferred Friar EA, Ladoux T, Roalson EH, Robichaux RH. 2000. Microsatellite analysis from duplicate phytochrome genes. Science 286: 947–950. of a population crash and bottleneck in the Mauna Kea silversword, Mayrose I, Zhan SH, Rothfels CJ, Arrigo N, Barker MS, Rieseberg LH, Otto Argyroxiphium sandwicense ssp. sandwicense (Asteraceae), and its implications SP. 2015. Methods for studying polyploid diversification and the dead end for reintroduction. Molecular Ecology 9: 2027–2034. hypothesis: a reply to Soltis et al. (2014). New Phytologist 206:27–35.
New Phytologist (2016) 210: 310–323 Ó 2015 The Authors www.newphytologist.com New Phytologist Ó 2015 New Phytologist Trust New Phytologist Research 323
Millar MA, Byrne M. 2013. Cryptic divergent lineages of Pultenaea pauciflora Sokoloff DD, Remizowa MV, Macfarlane TD, Yadav SR, Rudall PJ. 2011. M.B. Scott (Fabaceae: Mirbelieae) exhibit different evolutionary history. Hydatellaceae: a historical review of systematics and ecology. Rheedea 21: 115–138. Biological Journal of the Linnean Society 108: 871–881. Soltis DE, Segovia-Salcedo MC, Jordon-Thaden I, Majure L, Miles NM, Morgulis A, Coulouris G, Raytselis Y, Madden TL, Agarwala R, Sch€affer AA. Mavrodiev EV, Mei W, Cortez MB, Soltis PS, Gitzendanner MA. 2014. Are 2008. Database indexing for production MegaBLAST searches. Bioinformatics polyploids really evolutionary dead-ends (again)? A critical reappraisal of 24: 1757–1764. Mayrose et al. (2011). New Phytologist 202: 1105–1117. Myers N, Mittermeier R, Mittermeier C, da Fonseca G, Kent J. 2000. Soltis DE, Soltis PS. 2004. Amborella not a “basal angiosperm”? Not so fast. Biodiversity hotspots for conservation priorities. Nature 403: 853–858. American Journal of Botany 91: 997–1001. Nei M. 1972. Genetic distance between populations. American Naturalist 106: Soltis DE, Soltis PS, Pires JC, Kovar ık A, Tate JA, Mavrodiev EV. 2004. Recent 283–292. and recurrent polyploidy in Tragopogon (Asteraceae): cytogenetic, genomic, and Nei M. 1978. Estimation of average heterozygosity and genetic distance from a genetic comparisons. Biological Journal of the Linnean Society 82: 485–501. small number of individuals. Genetics 89: 583–590. Soltis PS, Soltis DE, Chase MW. 1999. Angiosperm phylogeny inferred from Obbard DJ, Harris SA, Pannell JR. 2006. Simple allelic-phenotype diversity and multiple genes as a tool for comparative biology. Nature 402: 402–404. differentiation statistics for allopolyploids. Heredity 97: 296–303. Taylor ML, Macfarlane TD, Williams JH. 2010. Reproductive ecology of the Pellicer J, Kelly L, Magdalena C, Leitch I. 2013. Insights into the dynamics of basal angiosperm Trithuria submersa (Hydatellaceae). Annals of Botany 106: genome size and chromosome evolution in the early diverging angiosperm 909–920. lineage Nymphaeales (water lilies). Genome 56: 437–449. Taylor ML, Williams JH. 2012. Pollen tube development in two species of Pledge DH. 1974. Some observations on Hydatella inconspicua (Cheesem.) Trithuria (Hydatellaceae) with contrasting breeding systems. Sexual Plant Cheesem. (Centrolepidaceae). New Zealand Journal of Botany 12: 559–561. Reproduction 25:83–96. Poncet V, Couderc M, Tranchant-Dubreuil C, Gomez C, Hamon P, Hamon S, Thiel T, Michalek W, Varshney RK, Graner A. 2003. Exploiting EST databases Pillon Y, Munzinger J, de Kochko A. 2012. Microsatellite markers for for the development and characterization of gene-derived SSR-markers in Amborella (Amborellaceae), a monotypic genus endemic to New Caledonia. barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. American Journal of Botany 2012: e411–e414. Unmack PJ. 2001. Biogeography of Australian freshwater fishes. Journal of Povilus RA, Losada JM, Friedman WE. 2015. Floral biology and ovule and seed Biogeography 28: 1053–1089. ontogeny of Nymphaea thermarum, a water lily at the brink of extinction with Vanderpoorten A, Hardy OJ, Lambinon J, Rasp e O. 2011. Two reproductively potential as a model system for basal angiosperms. Annals of Botany 115: 211– isolated cytotypes and a swarm of highly inbred, disconnected populations: a 226. glimpse into Salicornia’s evolutionary history and challenging taxonomy. Pritchard JK, Stephens M, Donnelly P. 2000. Inference of population structure Journal of Evolutionary Biology 24: 630–644. using multilocus genotype data. Genetics 155: 945–959. Vialette-Guiraud ACM, Alaux M, Legeai F, Finet C, Chambrier P, Brown SC, Quan Z, Pan L, Ke W, Ding Y. 2009. Polymorphic microsatellite markers in Chauvet A, Magdalena C, Rudall PJ, Scutt CP. 2011. Cabomba as a model for Euryale ferox Salisb. (Nymphaeaceae). Molecular Ecology Resources 9: 330–332. studies of early angiosperm evolution. Annals of Botany 108: 589–598. Ramsey J, Schemske DW. 2002. Neopolyploidy in flowering plants. Annual Yang Z. 2007. PAML 4: phylogenetic analysis by maximum likelihood. Molecular Review of Ecology and Systematics 33: 589–639. Biology and Evolution 24: 1586–1591. Raymond M, Rousset F. 1995. GENEPOP Version 1.2: population genetics Yokogawa M, Shiga T, Kaneko S, Isagi Y. 2012. Development of nuclear software for exact tests and ecumenicism. Journal of Heredity 86: 248–249. microsatellite markers for the critically endangered freshwater macrophyte, Remizowa MV, Sokoloff DD, Macfarlane TD, Yadav SR, Prychid CJ, Rudall Nuphar submersa (Nymphaeaceae), and cross-species amplification in six PJ. 2008. Comparative pollen morphology in the early-divergent angiosperm additional Nuphar taxa. Conservation Genetics Resources 4: 295–298. family Hydatellaceae reveals variation at the infraspecific level. Grana 47:81– Zheng X, Pan C, Diao Y, You Y, Chaozhu Yang C, Hu Z. 2013. Development 100. of microsatellite markers by transcriptome sequencing in two species of Robichaux RH, Friar EA, Mount DW. 1997. Molecular genetic consequences of Amorphophallus (Araceae). BMC Genomics 14: 490. a population bottleneck associated with reintroduction of the Mauna Kea silversword Argyroxiphium sandwicense ssp. sandwicense (Asteraceae). Conservation Biology 11: 1140–1146. Supporting Information Rozen S, Skaletsky HJ. 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, eds. Bioinformatics methods Additional supporting information may be found in the online and protocols: methods in molecular biology. Totowa, NJ, USA: USA; Humana version of this article. Press, 365–385. Rudall PJ, Eldridge T, Tratt J, Ramsay MM, Tuckett RE, Smith SY, Collinson Fig. S1 STRUCTURE analysis of Trithuria submersa in Aus- ME, Remizowa MV, Sokoloff DD. 2009b. Seed fertilization, development, and germination in Hydatellaceae (Nymphaeales): implications for endosperm tralia. evolution in early angiosperms. American Journal of Botany 96: 1581–1593. Rudall PJ, Remizowa MV, Beer A, Bradshaw E, Stevenson DW, Macfarlane Table S1 Specimen vouchers for testing the transferability of TD, Tuckett RE, Yadav SR, Sokoloff DD. 2008. Comparative ovule and microsatellite (SSR) markers megagametophyte development in Hydatellaceae and water lilies reveal a mosaic of features among the earliest angiosperms. Annals of Botany 101: 941– 956. Table S2 Alleles found in individuals sampled for each Rudall PJ, Remizowa MV, Prenner G, Prychid CJ, Tuckett RE, Sokoloff DD. microsatellite (SSR) ‘locus’ 2009a. Nonflowers near the base of extant angiosperms? Spatiotemporal arrangement of organs in reproductive units of Hydatellaceae and its bearing on Table S3 Results of Hardy–Weinberg Equilibrium (HWE) tests – the origin of the flower. American Journal of Botany 96:67 82. for each microsatellite (SSR) ‘locus’ and population Saarela JM, Rai HS, Doyle JA, Endress PK, Mathews S, Marchant AD, Briggs BG, Graham SW. 2007. Hydatellaceae identified as a new branch near the base of the angiosperm phylogenetic tree. Nature 446: 312–315. Please note: Wiley Blackwell are not responsible for the content Sokoloff DD, Remizowa MV, Macfarlane TD, Rudall PJ. 2008. Classification of or functionality of any supporting information supplied by the the early-divergent angiosperm family Hydatellaceae: one genus instead of two, authors. Any queries (other than missing material) should be – four new species and sexual dimorphism in dioecious taxa. Taxon 57: 179 200. directed to the New Phytologist Central Office.
Ó 2015 The Authors New Phytologist (2016) 210: 310–323 New Phytologist Ó 2015 New Phytologist Trust www.newphytologist.com