DOCSLIB.ORG

Somatic Hypermutation of the YAP Oncogene in a Human Cutaneous Melanoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Somatic Hypermutation of the YAP Oncogene in a Human Cutaneous Melanoma Author Manuscript Published OnlineFirst on March 4, 2019; DOI: 10.1158/1541-7786.MCR-18-0407 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Somatic hypermutation of the YAP oncogene in a human cutaneous melanoma Xiaomeng Zhang1,*, Jian Zhong Tang1,2,*, Ismael A. Vergara1,*, Youfang Zhang1,3,4, Pacman Szeto1,3,4, Lie Yang1, Christopher Mintoff1, Andrew Colebatch1, Lachlan McIntosh1,5,11, Katrina A. Mitchell1, Evangeline Shaw1, Helen Rizos6,7, Georgina V. Long7, Nicholas Hayward7,8, Grant A. McArthur1,9, Anthony T. Papenfuss1,5,9,11, Kieran F. Harvey1,9,10,† and Mark Shackleton1,3,4,7,8,† 1Peter MacCallum Cancer Centre, Melbourne, Victoria, Australia 2Olivia Newton-John Cancer Research Institute, Melbourne, Victoria, Australia 3Central Clinical School, Monash University, Melbourne, Victoria, Australia 4Alfred Health, Melbourne, Victoria, Australia 5The Walter and Eliza Hall Institute, Melbourne, Victoria, Australia 6Faculty of Medicine and Health Sciences, Macquarie University, Sydney, NSW, Australia 7Melanoma Institute of Australia, Sydney, NSW, Australia 8QIMR Berghofer Medical Research Institute, Brisbane, QLD, Australia 9Sir Peter MacCallum Department of Oncology, 10Department of Pathology and 11Department of Mathematics and Statistics, University of Melbourne, Melbourne, Victoria, Australia *†These authors contributed equally Correspondence: Mark Shackleton, Alfred Health and Monash University, 55 Commercial Road, Melbourne, Vic 3004, Australia; e: [email protected], tel: +61 3 9076 2000 Running Title: YAP and melanoma Financial Support: The Cancer Council of Victoria, Australia; Grant #1080255 Conflict of Interest: None 1 Downloaded from mcr.aacrjournals.org on September 26, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on March 4, 2019; DOI: 10.1158/1541-7786.MCR-18-0407 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. ABSTRACT Melanoma is usually driven by mutations in BRAF or NRAS that trigger hyperactivation of mitogen-activated protein kinase (MAPK) signalling. However, MAPK-targeted therapies are not sustainably effective in most patients. Accordingly, characterizing mechanisms that co-operatively drive melanoma progression is key to improving patient outcomes. One possible mechanism is the Hippo signalling pathway, which regulates cancer progression via its central oncoproteins YAP and TAZ, although is thought to be only rarely affected by direct mutation. As YAP hyperactivation occurs in uveal melanoma, we investigated this oncogene in cutaneous melanoma. YAP protein expression was elevated in most benign nevi and primary cutaneous melanomas but present at only very low levels in normal melanocytes. In patient-derived xenografts and melanoma cell lines, we observed variable reliance of cell viability on Hippo pathway signalling that was independent of TAZ activity and also of classical melanoma driver mutations such as BRAF and NRAS. Finally, in genotyping studies of melanoma, we observed the first ever hyperactivating YAP mutations in a human cancer, manifest as seven distinct missense point mutations that caused serine to alanine transpositions. Strikingly, these mutate four serine residues known to be targeted by the Hippo pathway and we show that they lead to hyperactivation of YAP. Implications: Our studies highlight the YAP oncoprotein as a potential therapeutic target in select sub-groups of melanoma patients, although successful treatment with anti-YAP therapies will depend on identification of biomarkers additional to YAP protein expression. KEYWORDS Melanoma, Hippo pathway, YAP 2 Downloaded from mcr.aacrjournals.org on September 26, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on March 4, 2019; DOI: 10.1158/1541-7786.MCR-18-0407 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. INTRODUCTION Recent spectacular advances in treatment of melanoma, a common and deadly form of skin cancer, have leveraged discoveries of mechanisms of disease initiation and progression. A paradigm- changing example was the observation that most oncogenic melanoma-initiating mutations, classically in BRAF or NRAS, increase mitogen-activated protein kinase (MAPK) signalling (1). This led to BRAF- and MAPK kinase (MEK)-targeted therapies that dramatically changed treatment (2, 3). Unfortunately, although most BRAF-mutant melanomas respond to combination BRAF/MEK inhibition, resistance usually develops (4). For patients with non-BRAF-mutant disease, BRAF targeting is usually ineffective, although some respond to MEK targeting (5). Even T-cell checkpoint targeting with immunotherapy, increasingly and successfully applied to a wide variety of cancers including melanoma (6, 7), is not efficacious or sustained in many patients, highlighting the importance of identifying novel drivers of disease progression and therapy resistance. For instance, the Hippo signalling pathway was found to mediate resistance to MAPK pathway targeting in cancers such as melanoma (8-10), spurring efforts to develop Hippo-targeted therapies (11) that might overcome such resistance. The Hippo pathway, which is a critical regulator of organ size, was discovered in Drosophila screens for regulators of tissue growth (12). Subsequently shown to regulate growth in mice (13, 14), Hippo pathway proteins regulate organ size by modulating nuclear access of the transcription co-activators YAP and TAZ (also known as WWTR1). Hippo signalling is regulated by properties such as cell polarity and adhesion and has been linked to G-protein coupled receptor signalling. These signals are typically conveyed by a core kinase cassette, which is comprised of Sterile 20-like kinases (e.g. MST1 and MST2), NDR kinases (e.g. LATS1 and LATS2) and two sets of adaptor proteins (Salvador and Mob family proteins). LATS1/2 repress YAP and TAZ by phosphorylation of serine residues (at least 5 in YAP), which promotes binding to 14-3-3 proteins and cytoplasmic sequestration. YAP and TAZ regulate gene expression with transcription factors, particularly TEAD family proteins (15). Hippo proteins regulate many hallmarks of cancer and pathway activity is deregulated in many cancers (16). Despite this, mutations directly linked to alterations in Hippo pathway activity appear surprisingly uncommon in human cancer. Exceptions are the upstream pathway gene neurofibromin 2 (NF2), which is frequently mutated in mesothelioma (17) and meningioma (18), and the G protein genes GNAQ and GNA11, which collectively are mutated in 85% of uveal melanomas and hyperactivate YAP (19-21). Putative gain-of-function mutations of YAP are apparently very rare, with only one reported, a YAP1-TFE3 fusion in epithelioid hemangioendothelioma (22). In 3 Downloaded from mcr.aacrjournals.org on September 26, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on March 4, 2019; DOI: 10.1158/1541-7786.MCR-18-0407 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. melanoma, Menzel and colleagues found copy number gains directly affecting YAP in 4 – 10 % of patients and, overall, 62% of melanomas had copy number alterations affecting known Hippo pathway genes (23). Unlike uveal melanoma, the role of Hippo signalling in the far more prevalent cutaneous melanoma is poorly defined, particularly in therapy-naïve contexts. Expression of YAP in cutaneous melanoma was described, with one study (23) but not another (24) reporting elevated expression with increasing disease stage. Nallet-Staub and colleagues noted that TAZ expression followed YAP expression, and that benign nevi displayed YAP/TAZ levels similar to melanomas (24) (although this was not reproduced (23)). In functional studies and consistent with other data (16), YAP, TAZ or TEAD were found to promote malignant behaviours in melanoma cell lines (23, 24) . Interestingly, whereas YAP and TAZ inhibited invasion in 1205Lu and SKMEL28 cells (24), heterogeneity in clonogenic growth amongst lines was noted upon TAZ knockdown. This raises the possibility that these oncoproteins might regulate malignant behaviors in only some cancers. Further, it is unknown whether YAP and TAZ, which are paralogous proteins, can compensate for each other’s inhibition. Both these possibilities have implications for development of inhibitors of YAP- or TAZ-mediated transcription. To address these issues, we used melanoma patient samples, patient-derived xenografts (PDX) and cell lines to investigate systematically the Hippo pathway in melanoma. We found Hippo pathway deregulation across a broad spectrum of melanocytic neoplasia, from benign nevi to melanomas. In molecular studies, we identified a patient melanoma with multiple YAP mutations that led to its hyperactivation. In PDX and cell lines, we found that melanoma cells rely on YAP for survival only variably, that this is independent of mutations in BRAF and NRAS, and that TAZ does not consistently compensate for YAP depletion in maintaining melanoma cell viability. We thus report the first obvious gain of function missense mutations in the YAP oncogene in human cancer and implicate the Hippo pathway as a potential therapeutic target in a subset of melanomas. MATERIALS AND METHODS Human tissues and cell lines. Human tissues were obtained from the Melbourne Melanoma Project, the Victorian Cancer
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Legionella Kinase Legk7 Exploits the Hippo Pathway Scaffold Protein MOB1A for Allostery and Substrate Phosphorylation
    The Legionella kinase LegK7 exploits the Hippo pathway scaffold protein MOB1A for allostery and substrate phosphorylation Pei-Chung Leea,b,1, Ksenia Beyrakhovac,1, Caishuang Xuc, Michal T. Bonieckic, Mitchell H. Leea, Chisom J. Onub, Andrey M. Grishinc, Matthias P. Machnera,2, and Miroslaw Cyglerc,2 aDivision of Molecular and Cellular Biology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, NIH, Bethesda, MD 20892; bDepartment of Biological Sciences, College of Liberal Arts and Sciences, Wayne State University, Detroit, MI 48202; and cDepartment of Biochemistry, University of Saskatchewan, Saskatoon, SK S7N5E5, Canada Edited by Ralph R. Isberg, Tufts University School of Medicine, Boston, MA, and approved May 1, 2020 (received for review January 12, 2020) During infection, the bacterial pathogen Legionella pneumophila Active LATS1/2 phosphorylate the cotranscriptional regulator manipulates a variety of host cell signaling pathways, including YAP1 (yes-associated protein 1) and its homolog TAZ (tran- the Hippo pathway which controls cell proliferation and differen- scriptional coactivator with PDZ-binding motif). Phosphorylated tiation in eukaryotes. Our previous studies revealed that L. pneu- YAP1 and TAZ are prevented from entering the nucleus by being mophila encodes the effector kinase LegK7 which phosphorylates either sequestered in the cytosol through binding to 14-3-3 pro- MOB1A, a highly conserved scaffold protein of the Hippo path- teins or targeted for proteolytic degradation (6, 8). Consequently, way. Here, we show that MOB1A, in addition to being a substrate the main outcome of signal transduction along the Hippo pathway of LegK7, also functions as an allosteric activator of its kinase is changes in gene expression (6).
    [Show full text]
  • Title: Therapeutic Potential of HSP90 Inhibition for Neurofibromatosis Type 2
    Author Manuscript Published OnlineFirst on May 28, 2013; DOI: 10.1158/1078-0432.CCR-12-3167 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Title: Therapeutic Potential of HSP90 Inhibition for Neurofibromatosis type 2 Karo Tanaka1, Ascia Eskin3, Fabrice Chareyre1, Walter J. Jessen4, Jan Manent5, Michiko Niwa-Kawakita6, Ruihong Chen7, Cory H. White2, Jeremie Vitte1, Zahara M. Jaffer1, Stanley F. Nelson3, Allan E. Rubenstein8, Marco Giovannini1,9§. Authors’ affiliations: House Research Institute, 1Center for Neural Tumor Research and 2Section on Genetics of Hereditary Ear Disorders, Los Angeles, CA; 3Department of Human Genetics, University of California, Los Angeles, CA; 4Informatics, Covance Inc., Princeton, NJ; 5Peter MacCallum Cancer Institute, Melbourne, Australia; 6Inserm U944, CNRS U7212, Université Paris, Institut Universitaire d'Hématologie, Paris, France; 7NexGenix Pharmaceuticals, Burlingame, CA; and 8New York University Langone Medical Center, New York, NY; and Department of Cell and Neurobiology, University of Southern California, Keck School of Medicine, Los Angeles, CA Running title: HSP90 Inhibition for NF2 Keywords: NF2, HSP90 inhibitors, Transcriptome Financial support: This work was supported by a Drug Discovery Initiative Award, Children’s Tumor Foundation, to M.G., and by the House Research Institute. Corresponding author: Marco Giovannini, House Research Institute, Center for Neural Tumor Research, 2100 West 3rd street, Los Angeles, CA90057. Phone: +1-213-989-6708; Fax: +1-213-989-6778; E-mail: [email protected] 1 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2013 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 28, 2013; DOI: 10.1158/1078-0432.CCR-12-3167 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Structural Basis for Autoinhibition and Its Relief of MOB1 in the Hippo
    www.nature.com/scientificreports OPEN Structural basis for autoinhibition and its relief of MOB1 in the Hippo pathway Received: 10 February 2016 Sun-Yong Kim, Yuka Tachioka, Tomoyuki Mori & Toshio Hakoshima Accepted: 03 June 2016 MOB1 protein is a key regulator of large tumor suppressor 1/2 (LATS1/2) kinases in the Hippo pathway. Published: 23 June 2016 MOB1 is present in an autoinhibited form and is activated by MST1/2-mediated phosphorylation, although the precise mechanisms responsible for autoinhibition and activation are unknown due to lack of an autoinhibited MOB1 structure. Here, we report on the crystal structure of full-length MOB1B in the autoinhibited form and a complex between the MOB1B core domain and the N-terminal regulation (NTR) domain of LATS1. The structure of full-length MOB1B shows that the N-terminal extension forms a short β-strand, the SN strand, followed by a long conformationally flexible positively-charged linker and α-helix, the Switch helix, which blocks the LATS1 binding surface of MOB1B. The Switch helix is stabilized by β-sheet formation of the SN strand with the S2 strand of the MOB1 core domain. Phosphorylation of Thr12 and Thr35 residues structurally accelerates dissociation of the Switch helix from the LATS1-binding surface by the “pull-the-string” mechanism, thereby enabling LATS1 binding. The Hippo pathway is a key signaling cascade that ensures organ size and normal tissue growth by coordinating cell proliferation and differentiation, and has now been recognized as an essential tumor suppressor cascade1–6. In mammals, the core pathway components comprise two Ser/Thr protein kinases, mammalian Ste20-like 1 and 2 (MST1/2) kinases, members of the Ste20 group in the germinal center kinase II (GCK-II) subgroup, and large tumor suppressor 1 and 2 (LATS1/2) kinases, members of the AGC protein kinase family, in addition to transcriptional co-activator Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ).
    [Show full text]
  • Type I and II Interferon Are Associated with High Expression of the Hippo Pathway Family Members
    Cel al & lul ic ar in I l m C m f o u n l a o l n o Journal of Clinical & Cellular r g u y o J ISSN: 2155-9899 Immunology Research Article Type I and II Interferon are Associated with High Expression of the Hippo Pathway Family Members Bianca Sciescia1*, Raquel Tognon2, Natalia de Souza Nunes1, Tathiane Maistro Malta1, Fabiani Gai Frantz1, Fabiola Attie de Castro1, Maira da Costa Cacemiro1 1Department of Clinical, Toxicological and Bromatological Analysis, University of Sao Paulo - USP, Ribeirao Preto - SP, Brazil; 2Department of Pharmacy, Federal University of Juiz de Fora, Campus Governador Valadares, Governador Valadares - MG, Brazil ABSTRACT The Hippo pathway plays a regulatory role on inflammation and cell death and proliferation. Here we described a relationship between Hippo pathway components and inflammation in healthy subjects. The plasma levels of cytokines and chemokines were used to define their inflammatory profile and classify them as normal, high and low producers of cytokines. Leukocytes from healthy subjects with inflammatory profile expressed the highest levels of MSTS1/MST2, SAV1, LATS1/LATS2, MOB1A/MOB1B and YAP genes. The group that overexpressed Hippo pathway-related genes secreted more IFN-ϒ and IFN-α2. Keywords: Hippo pathway; Inflammatory process; Healthy subjects; Cytokines; Chemokines ABBREVATIONS: LATS1/LATS2 kinases (large tumor suppressor kinase 1/2) and MOB kinase activator IL: Interleukin; IFN: Interferon; LATS1/LATS2: Large tumor their adapter proteins MOB1A/MOB1B ( 1A/1B yes-associated suppressor kinase 1/2; MCP-1: Monocyte chemoattractant ), and the transcription coactivators YAP ( protein tafazzin protein protein-1; MIP: Macrophage inflammatory protein; MOB1A/ ) and TAZ ( ).
    [Show full text]
  • 1 Genome-Wide Comparisons of Variation in Linkage Disequilibrium
    Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Genome-wide comparisons of variation in linkage disequilibrium Yik Y. Teo1,*, Andrew E. Fry1, Kanishka Bhattacharya1, Kerrin S. Small1, Dominic P. Kwiatkowski1,2, Taane G. Clark1,2 1 Wellcome Trust Centre for Human Genetics, University of Oxford, United Kingdom 2 Wellcome Trust Sanger Institute, Hinxton, United Kingdom Running title: Genome-wide comparisons of LD Keywords: linkage disequilibrium, imputation, positive selection, meta-analysis, genome-wide association study * Corresponding author: Wellcome Trust Centre for Human Genetics, Roosevelt Drive, Oxford OX3 7BN, United Kingdom. Email: [email protected], phone: +44 1865 287712, fax: +44 1865 287 501. ABSTRACT Current genome-wide surveys of common diseases and complex traits fundamentally aim to detect indirect associations where the SNPs carrying the association signals are not biologically active but are in linkage disequilibrium (LD) with some unknown functional polymorphisms. Reproducing any novel discoveries from these genome-wide scans in independent studies is now a prerequisite for the putative findings to be accepted. Significant differences in patterns of LD between populations can affect the portability of phenotypic associations when the replication effort or meta-analyses are attempted in populations that are distinct from the original population which the genome-wide study is performed in. Here we introduce a novel method for genome-wide analyses of LD variations between populations that allow the identification of candidate regions with different patterns of LD. The evidence of LD variation provided by the introduced method correlated with the degree of differences in the frequencies of the most common haplotype across the populations.
    [Show full text]
  • Multidimensional Informatic Deconvolution Defines Gender
    Mechanisms of Ageing and Development 184 (2019) 111150 Contents lists available at ScienceDirect Mechanisms of Ageing and Development journal homepage: www.elsevier.com/locate/mechagedev Multidimensional informatic deconvolution defines gender-specific roles of hypothalamic GIT2 in aging trajectories T Jaana van Gastela, Huan Caib, Wei-Na Congb, Wayne Chadwickc, Caitlin Daimonb, Hanne Leysena, Jhana O. Hendrickxa, Robin De Scheppera, Laura Vangenechtena, Jens Van Turnhouta, Jasper Verswyvela, Kevin G. Beckerd, Yongqing Zhangd, Elin Lehrmannd, William H. Wood IIId, Bronwen Martinb,e,**,1, Stuart Maudsleya,c,*,1 a Receptor Biology Lab, Department of Biomedical Sciences, University of Antwerp, 2610, Wilrijk, Belgium b Metabolism Unit, Laboratory of Clinical Investigation, National Institute on Aging, National Institutes of Health, Biomedical Research Center, 251 Bayview Boulevard, Baltimore, MD, 21224, United States c Receptor Pharmacology Unit, Laboratory of Neuroscience, National Institute on Aging, National Institutes of Health, Biomedical Research Center, 251 Bayview Boulevard, Baltimore, MD, 21224, United States d Gene Expression and Genomics Unit, Laboratory of Genetics and Genomics, National Institute on Aging, National Institutes of Health, Biomedical Research Center, 251 Bayview Boulevard, Baltimore, MD, 21224, United States e Faculty of Pharmacy, Biomedical and Veterinary Sciences, University of Antwerp, 2610, Wilrijk, Belgium ARTICLE INFO ABSTRACT Keywords: In most species, females live longer than males. An understanding of this female longevity advantage will likely GIT2 uncover novel anti-aging therapeutic targets. Here we investigated the transcriptomic responses in the hy- Longevity pothalamus – a key organ for somatic aging control – to the introduction of a simple aging-related molecular Aging perturbation, i.e. GIT2 heterozygosity. Our previous work has demonstrated that GIT2 acts as a network con- Female troller of aging.
    [Show full text]
  • NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer
    Florida International University FIU Digital Commons FIU Electronic Theses and Dissertations University Graduate School 11-7-2018 Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer Jairo Ramos [email protected] Follow this and additional works at: https://digitalcommons.fiu.edu/etd Part of the Clinical Epidemiology Commons Recommended Citation Ramos, Jairo, "Decipher Mechanisms by which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer" (2018). FIU Electronic Theses and Dissertations. 3872. https://digitalcommons.fiu.edu/etd/3872 This work is brought to you for free and open access by the University Graduate School at FIU Digital Commons. It has been accepted for inclusion in FIU Electronic Theses and Dissertations by an authorized administrator of FIU Digital Commons. For more information, please contact [email protected]. FLORIDA INTERNATIONAL UNIVERSITY Miami, Florida DECIPHER MECHANISMS BY WHICH NUCLEAR RESPIRATORY FACTOR ONE (NRF1) COORDINATES CHANGES IN THE TRANSCRIPTIONAL AND CHROMATIN LANDSCAPE AFFECTING DEVELOPMENT AND PROGRESSION OF INVASIVE BREAST CANCER A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in PUBLIC HEALTH by Jairo Ramos 2018 To: Dean Tomás R. Guilarte Robert Stempel College of Public Health and Social Work This dissertation, Written by Jairo Ramos, and entitled Decipher Mechanisms by Which Nuclear Respiratory Factor One (NRF1) Coordinates Changes in the Transcriptional and Chromatin Landscape Affecting Development and Progression of Invasive Breast Cancer, having been approved in respect to style and intellectual content, is referred to you for judgment.
    [Show full text]
  • The Hippo Signaling Pathway in Drug Resistance in Cancer
    cancers Review The Hippo Signaling Pathway in Drug Resistance in Cancer Renya Zeng and Jixin Dong * Eppley Institute for Research in Cancer and Allied Diseases, Fred & Pamela Buffett Cancer Center, University of Nebraska Medical Center, Omaha, NE 68198, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-402-559-5596; Fax: +1-402-559-4651 Simple Summary: Although great breakthroughs have been made in cancer treatment following the development of targeted therapy and immune therapy, resistance against anti-cancer drugs remains one of the most challenging conundrums. Considerable effort has been made to discover the underlying mechanisms through which malignant tumor cells acquire or develop resistance to anti-cancer treatment. The Hippo signaling pathway appears to play an important role in this process. This review focuses on how components in the human Hippo signaling pathway contribute to drug resistance in a variety of cancer types. This article also summarizes current pharmacological interventions that are able to target the Hippo signaling pathway and serve as potential anti-cancer therapeutics. Abstract: Chemotherapy represents one of the most efficacious strategies to treat cancer patients, bringing advantageous changes at least temporarily even to those patients with incurable malignan- cies. However, most patients respond poorly after a certain number of cycles of treatment due to the development of drug resistance. Resistance to drugs administrated to cancer patients greatly limits the benefits that patients can achieve and continues to be a severe clinical difficulty. Among the mechanisms which have been uncovered to mediate anti-cancer drug resistance, the Hippo signaling pathway is gaining increasing attention due to the remarkable oncogenic activities of its components (for example, YAP and TAZ) and their druggable properties.
    [Show full text]
  • A Study of Alterations in DNA Epigenetic Modifications (5Mc and 5Hmc) and Gene Expression Influenced by Simulated Microgravity I
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Digital Repository @ Iowa State University Genome Informatics Facility Publications Genome Informatics Facility 1-28-2016 A Study of Alterations in DNA Epigenetic Modifications (5mC and 5hmC) and Gene Expression Influenced by Simulated Microgravity in Human Lymphoblastoid Cells Basudev Chowdhury Purdue University Arun S. Seetharam Iowa State University, [email protected] Zhiping Wang Indiana University School of Medicine Yunlong Liu Indiana University School of Medicine Amy C. Lossie Purdue University See next page for additional authors Follow this and additional works at: https://lib.dr.iastate.edu/genomeinformatics_pubs Part of the Bioinformatics Commons, Genetics Commons, and the Genomics Commons Recommended Citation Chowdhury, Basudev; Seetharam, Arun S.; Wang, Zhiping; Liu, Yunlong; Lossie, Amy C.; Thimmapuram, Jyothi; and Irudayaraj, Joseph, "A Study of Alterations in DNA Epigenetic Modifications (5mC and 5hmC) and Gene Expression Influenced by Simulated Microgravity in Human Lymphoblastoid Cells" (2016). Genome Informatics Facility Publications. 4. https://lib.dr.iastate.edu/genomeinformatics_pubs/4 This Article is brought to you for free and open access by the Genome Informatics Facility at Iowa State University Digital Repository. It has been accepted for inclusion in Genome Informatics Facility Publications by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. A Study of Alterations in DNA Epigenetic Modifications (5mC and 5hmC) and Gene Expression Influenced by Simulated Microgravity in Human Lymphoblastoid Cells Abstract Cells alter their gene expression in response to exposure to various environmental changes. Epigenetic mechanisms such as DNA methylation are believed to regulate the alterations in gene expression patterns.
    [Show full text]
  • And Calcium PIX Proteins Β the Concerted Action of GIT1/ Derived Mast Cells Is Regulated by − Marrow Microtubule Nucleation I
    Published March 27, 2015, doi:10.4049/jimmunol.1402459 The Journal of Immunology Microtubule Nucleation in Mouse Bone Marrow–Derived Mast Cells Is Regulated by the Concerted Action of GIT1/ bPIX Proteins and Calcium Vadym Sulimenko,* Zuzana Ha´jkova´,*,† Marke´ta Cernohorska ´,*,† Tetyana Sulimenko,* Vladimı´ra Sla´dkova´,* Lubica Dra´berova´,‡ Stanislav Vinopal,* Eduarda Dra´berova´,* and Pavel Dra´ber* Ag-mediated activation of mast cells initiates signaling events leading to Ca2+ response, release of allergic mediators from cytoplasmic granules, and synthesis of cytokines and chemokines. Although microtubule rearrangement during activation has been described, the molecular mechanisms that control their remodeling are largely unknown. Microtubule nucleation is mediated by complexes that are formed by g-tubulin and g-tubulin complex proteins. In this study, we report that, in bone marrow–derived mast cells (BMMCs), g-tubulin interacts with p21-activated kinase interacting exchange factor b (bPIX) and G protein–coupled receptor kinase-interacting protein (GIT)1. Microtubule regrowth experiments showed that the depletion of bPIX in BMMCs stimulated microtubule nucleation, whereas depletion of GIT1 led to the inhibition of nucleation compared with control cells. Phenotypic rescue experiments confirmed that bPIX and GIT1 represent negative and positive regulators of microtubule nucle- ation in BMMCs, respectively. Live-cell imaging disclosed that both proteins are associated with centrosomes. Immunoprecipi- tation and pull-down experiments revealed that an enhanced level of free cytosolic Ca2+ affects g-tubulin properties and stimulates the association of GIT1 and g-tubulin complex proteins with g-tubulin. Microtubule nucleation also was affected by Ca2+ level. Moreover, in activated BMMCs, g-tubulin formed complexes with tyrosine-phosphorylated GIT1.
    [Show full text]
  • GIT2 (NM 139201) Human Tagged ORF Clone – RC200045 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC200045 GIT2 (NM_139201) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GIT2 (NM_139201) Human Tagged ORF Clone Tag: Myc-DDK Symbol: GIT2 Synonyms: CAT-2; CAT2; PKL Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 GIT2 (NM_139201) Human Tagged ORF Clone – RC200045 ORF Nucleotide >RC200045 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGAAACGGCTCCGGAGCAGCGAGGTGTGCGCTGACTGCAGCGGGCCGGATCCTTCCTGGGCATCAG TAAATAGGGGAACGTTTTTATGTGATGAGTGCTGCAGTGTCCATCGGAGTCTAGGGCGCCATATCTCCCA AGTGAGGCATCTGAAACACACACCGTGGCCTCCAACACTGCTTCAGATGGTTGAGACCTTGTATAATAAC GGTGCTAACTCTATATGGGAGCATTCTTTGCTGGACCCTGCGTCTATTATGAGTGGAAGACGTAAAGCTA ATCCACAGGATAAAGTACATCCCAATAAAGCGGAATTCATCAGAGCCAAGTATCAGATGTTAGCGTTCGT CCATCGCTTGCCCTGCCGGGATGACGATAGTGTGACTGCCAAAGATCTTAGCAAGCAACTCCATTCGAGC GTGAGAACAGGGAATCTTGAAACCTGTTTGAGACTGTTATCTTTAGGAGCACAAGCCAACTTCTTTCATC CTGAAAAAGGAAACACCCCACTCCATGTTGCCTCCAAAGCAGGGCAGATTTTACAGGCTGAATTATTGGC AGTATATGGAGCAGACCCAGGCACACAGGATTCTAGTGGGAAAACTCCCGTTGATTATGCAAGGCAAGGA
    [Show full text]