17

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

INDOOR COMMUNITIES AND DISTRIBUTIONS IN U.S. HOMES

1MATTHEW A. BERTONE, 2MISHA LEONG, 1KEITH M. BAYLESS, 3,4ROBERT R. DUNN, AND 2MICHELLE D. TRAUTWEIN 1Department of Entomology and Plant Pathology, North Carolina State University, Raleigh, NC, USA 2California Academy of Sciences, San Francisco, CA, USA 3Department of Applied Ecology, North Carolina State University, Raleigh, NC, USA 4Center for Macroecology, Evolution and Climate, Natural History Museum of Denmark, University of Copenhagen, Copenhagen, Denmark

Abstract By furthering our understanding of biodiversity in urban landscapes, we can advance our understanding of urban pests. We investigated the complete arthropod community of the indoor biome in 50 houses (located in and around Raleigh, North Carolina, USA). We discovered high diversity, with a conservative estimate range of 32 to 211 morphospecies, and 24 to 128 distinct arthropod families per house. However, the majority of these are not considered urban pests. We found arthropods within homes are both diverse and prevalent, and are a mix of closely synanthropic species and a great diversity of species that enter homes accidentally. Despite being found in the majority of homes, several arthropod groups such as gall (Cecidomyiidae) and book lice () remain unfamiliar to the general public. The diversity of arthropods was non-random with respect to location within the house; for instance, certain families, such as camel crickets (Rhaphidophoridae) and isopods (Armadillidiidae) were particularly abundant in basements. On a landscape scale, the indoor arthropod community conformed to the “luxury effect,” with houses located in higher income neighborhoods having higher arthropod richness, even when accounting for house size and local vegetation. These findings present a new understanding of the diversity, prevalence, and distribution of the arthropods in our daily lives.

Key words Landscape ecology, biodiversity, urban ecology.

INTRODUCTION Humans have lived with associates (both invited and uninvited) for thousands of years. The most diverse group of organisms on Earth is made up of arthropods (, , myriapods, , etc.), and while many species are known to live closely with humans (Robinson, 2005), very few studies have assessed the entire community of arthropods that dwell with people, except for a few noteworthy pest species. To better understand the diversity of arthropods found in homes we comprehensively sampled specimens from houses located in and around Raleigh, NC, USA. We identified the types of arthropods and where they were found in homes, using these data to describe what arthropod diversity in houses look like and other aspects of the indoor arthropod community.

MATERIALS AND METHODS Full methods (including a map of the study area) for this study can be found in Bertone et al. (2016) and Leong et al. (2016). Briefly, 50 free-standing, volunteer homes were randomly selected in and around Raleigh, NC, USA. Trained entomologists visited these homes and hand-collected all arthropods, living and dead, from all visible surfaces of all rooms. Only attics and crawl spaces were sampled less thoroughly, for safety reasons. All specimens were collected into vials of ethanol each labeled according to house, room type and other characteristics (floor type; windows and doors to the outside). Specimens 18 M. A. Bertone, M. Leong, K. M. Bayless, R. R. Dunn, and M. D. Trautwein Indoor Arthropod Communities and Distributions in U.S. Homes were identified by MAB and KMB as specifically as possible, with arthropod family as themajor taxonomic unit. In each group, the number of morphospecies (i.e. those that appeared to be different species) was also documented per room. Some difficult to identify groups (based on current knowledge) and/or specimens (due to physical damage precluding identification) were identified to the most specific taxon possible. We classified rooms into six categories based on their similarities: attics, basements (including finished and unfinished basements, and crawl spaces), bathrooms (including bathrooms and laundry rooms), bedrooms (including bedrooms, offices, and libraries), common rooms (including living rooms, dining rooms, and attached hallways), and kitchens (including kitchens and pantries); rooms not conforming to one of the categories were classified as “other” and were excluded from analysis. We estimated diversity of families based on the complete list of families acquired over each sampled house using the Chao2 Estimator with 1,000 randomization runs in EstimateS (Colwell, 2013). For analyses related to neighborhood income and arthropod diversity, see Leong et al. 2016.

RESULTS AND DISCUSSION Overall Metrics Houses in the study ranged from 840 to 4,833 square feet in area (mean = 2,072; median = 1,720) and were from seven to 94 years old (mean = 41.35; median = 30.5). During the course of sampling 554 rooms in the 50 homes, over 10,000 specimens were collected and identified. These specimens represented all four subphyla (, , Crustacea, and ), as well as six classes, 34 orders and 304 families of arthropods (for a complete list of taxa see Tables 1 and S1 in Bertone et al. 2016). While we could not determine the exact number of morphospecies, there were at least 579 morphospecies based on our most conservative estimates (calculated by summing the maximum number of morphospecies for each family ever found in a single room). We collected 24–128 families from each house, resulting in an average of 61.84 (s.d. = 23.24) distinct arthropod families per house and a total gamma diversity (across houses) of 304 families (Figure 1A). One hundred and forty-nine (149) families were rare, collected from fewer than 10% of homes, 66 of which were found in just a single home. The number of families collected in a home was correlated with house size (r2 = 0.3, p = < 0.001). Conservative species estimates by home ranged from 32 to 211, with an average of 93.14 (s.d. = 42.34) morphospecies per house (Figure 1B). Our conservative species estimate assumes that rooms with the greatest number of morphospecies by family included all species from other rooms (which is almost certainly untrue), thus this number is likely much lower than the true number of species per house.

Taxon Specific Observations While overall diversity was high, 12 frequently found families were identified in at least 80% of homes (Figure 4 in Bertone et al. 2016). Four families were identified from 100% of houses sampled: cobweb spiders (Theridiidae), carpet (Dermestidae), gall (Cecidomyiidae) and (Formicidae). Book lice (Liposcelididae) and dark-winged fungus gnats (Sciaridae) were found in 98% and 96% of homes, respectively. Nearly half of all families (five of 12) found in over 80% of homes were true flies (Diptera): fungus gnats (Sciaridae); mosquitoes (Culicidae); scuttle flies (Phoridae); non-biting midges (); and gall midges (Cecidomyiidae). Typical household pests were found in a minority of the homes, such as German (Blattella germanica: 6% of houses), subterranean (Rhinotermitidae: 28% of houses), and (Pulicidae: 10% of houses); bed bugs ( lectularius) were not found during the study. Larger cockroaches (Blattidae), such as smoky brown (Periplaneta fuliginosa) and American cockroaches (Periplaneta americana) were found in the majority of houses (74%). However, the American (which is the species considered a true pest) was only recovered from three homes; smoky brown cockroaches made up the vast majority of large cockroaches collected. All pest species were less common than other more inconspicuous arthropods such as pillbugs (Armadillidiidae, 78%) and springtails (Entomobryidae, 78%). In addition to those listed above, many of the same pests we recovered were also found in archaeological sites (see discussion in Bertone et al. (2016). Indoor Arthropod Communities and Distributions in U.S. Homes 19

Figure 1A (top): Number of morphospecies collected from homes ranked by house size. The bottom limit is the minimum or conservative estimate of morphospecies by house which was calculated by taking the maximum number of morphospecies from the room containing the highest number of morphospecies, for each family, and summing the total The upper limit is the maximum possible of morphospecies within a house, with the assumption that each set of morphospecies within each room were unique from other rooms. Figure 1B (bottom): Estimated diversity of families. The Figure 1 A. Number of morphospecies collected from homes ranked by house size. The bottom mean, along with 95% limit is the minimum or conservative estimate of morphospecies by house which was calculated by lower and upper confidence taking the maximum number of morphospecies from the room containing the highest number of intervals, was calculated morphospecies, for each family, and summing the total The upper limit is the maximum possible based on the complete list of of morphospecies within a house, with the assumption that each set of morphospecies within each families acquired over each room were unique from other rooms. sampled house using the Chao2 Estimator with 1,000 Arthropod Distribution within the Home randomization runs in EstimateS (from Bertone et Arthropods were found on every level of the home and in all room types. Only 5 rooms (non-attics) had no arthropod specimens collected (four bathrooms, one bedroom). Six arthropod orders dominatedal. 2016) houses, comprising 81% of the diversity in an average room: Diptera (true flies, 23%), Coleoptera (beetles, 19%), Araneae (spiders, 16%), (predominantly ants, 15%), Psocodea (book lice, 4%), and (true bugs, 4%) (Figure 2). Eight additional orders made up another 15% of the diversity (, Collembola, , , Zygentoma, Polydesmida, Orthoptera, and ), while all remaining orders comprised a total of 4% of the overall diversity (Figure 2). The percentage of rooms in which an arthropod was collected varied among taxa, as did their presence in rooms of different types (Table 1 in Bertone et al., 2016). We found that although many groups were common throughout a home, some were more restricted to certain room types than others. After ranking the prevalence of different families by room type, many common groups change rank drastically between rooms. Isopods (Armadillidiidae) and camel crickets (Rhaphidophoridae) ranked as commonly found in basements, but did not make it into the top ten (or even top 20 in most cases) for any other room type. This is expected, as these arthropods are typically limited to dark, damp environments not usually found homes except in basements. Figure 1A (top): Number of morphospecies collected from homes ranked by house size. The bottom limit is the minimum or conservative estimate of morphospecies by house which was calculated by taking the maximum number of morphospecies from the room containing the highest number of morphospecies, for each family, and summing the total The upper limit is the maximum possible of morphospecies within a house, with the assumption that each set of morphospecies within each room were unique from 20 M. A. Bertone, M. Leong, K. M. Bayless, R. R. Dunn, and M. D. Trautwein Indoor Arthropod Communities and Distributions in U.S. Homes other rooms. Figure 1B (bottom): Estimated diversity of families. The mean, along with 95% lower and upper confidence intervals, was calculated based on the complete list of families acquired over each sampled house using the Chao2 Estimator with 1,000 randomization runs in EstimateS (from Bertone et al. 2016)

Figure 1B. Estimated diversity of families. The mean, along with 95% lower and upper confidence intervals, was calculated based on the complete list of families acquired over each sampled house using the Chao2 Estimator with 1,000 randomization runs in EstimateS (from Bertone et al., 2016).

FigureFigure 2. Proportional2: Proportional diversi- diversity of arthropod ty of arthropod orders across all orders across all rooms. rooms.Ave Averagerage morphospecies morphospecies compositioncomposition calculated calculated across all roomacross types. all room Photos types. Allmodified fromphotos Bertone by MAB. et al., 2016. (modified from Bertone et al. 2016)

Figure 3: Rank abundance of families by room type. These are lists of the 20 most commonly collected families for each room type.

Indoor Arthropod Communities and Distributions in U.S. Homes 21

Arthropods and the Luxury Effect The “luxury effect,” in which wealthier neighborhoods are more biologically diverse, has been observed for both plants and including birds (Luck et al., 2013), lizards (Ackley et al., 2015), and bats (Li and Wilkins, 2014). However, where indoor environments are concerned, there is a general perception that homes in poorer neighborhoods harbor more indoor arthropods (Cohn et al., 2016; Wang et al., 2007). After model testing, we found that indoor arthropod diversity was best predicted by models that take into consideration not only house square footage, local ground vegetation cover and diversity, but also mean neighborhood income. To better understand the impact of vegetation on indoor arthropod diversity, we further explored the interactions between income and our house-level vegetation variables. The interaction term revealed that for houses whose yards have limited ground vegetation cover, being located in a higher income neighborhood had a strong positive effect on indoor arthropod diversity (Figure 3). Yet for houses that have yards with high ground vegetation cover, neighborhood income did not influence indoor arthropod diversity. We suspect that in higher income neighborhoods, enhancements at the neighborhood scale (including higher vegetation overall, as found in Hope et al., 2003; Kinzig et al., 2005; Grove et al., 2006; Clarke et al., 2013) can compensate for limited vegetation in the yard of an individual house. Thus, simply being located in a higher income neighborhood may provide ecological benefits to outdoor and indoor biodiversity. This suggests that vegetation at the scale of neighborhoods can be predictive of indoor arthropod diversity at the scale of individual houses. It matters, in short, not only how much vegetation you have in your yard, but how much is present in the yards and other habitats nearby (Goddard, 2010).

Figure 4: Interaction plot. For houses with low and medium levels of vegetative ground cover, neighbourhood income had a strong influence on number of arthropod families. (modified from Leong et al. 2016)

Figure 3. Interaction plot. For houses with low and medium levels of vegetative ground cover, neighbourhood income had a strong influence on number of arthropod families. (modified from Leong et al. 2016) 22 M. A. Bertone, M. Leong, K. M. Bayless, R. R. Dunn, and M. D. Trautwein Indoor Arthropod Communities and Distributions in U.S. Homes

CONCLUSIONS Our results show indoor communities of arthropods in the Southeastern U.S. are a mixture of both synanthropic species (i.e. those that rely on human dwellings for shelter and breeding sites) and accidental visitors from the outdoors that become trapped inside. We also found the majority of arthropods in homes are not typical pest species, though pests were collected. Although almost all parts of a home can be occupied by arthropods, some arthropods are associated with certain room types more than others. Lastly, houses in neighborhoods with higher income appear to have more diversity of arthropods entering homes.

REFERENCES CITED Ackley, J.W., J. Wu, M.J. Angilletta Jr., S.W. Myint, and B. Sullivan. 2015. Rich lizards: How affluence and land cover influence the diversity and abundance of desert reptiles persisting in an urban landscape. Biol. Conserv. 182, 87–92. doi:10.1016/j.biocon.2014.11.009 Bertone, M.A., M. Leong, K.M. Bayless, T.L.F. Malow, R.R. Dunn, and M.D. Trautwein. 2016. Arthropods of the great indoors: characterizing diversity inside urban and suburban homes. PeerJ 4:e1582 https://doi.org/10.7717/peerj.1582 Clarke, L.W., G.D. Jenerette, and A. Davila. 2013. The luxury of vegetation and the legacy of tree biodiversity in Los Angeles, CA. Landsc. Urban Plan. 116, 48–59. doi:10.1016/j. landurbplan.2013.04.006 Cohn, R.D., S.J. Arbes, R. Jaramillo, L.H. Reid, and D.C. Zeldin. 2006. National prevalence and exposure risk for cockroach allergen in U.S. households. Environ. Health Perspect. 114, 522–526. Colwell, R.K. 2013. EstimateS: statistical estimation of species richness and shares species from samples. Version 9. User’s Guide and application. Available at http://purl.oclc.org/estimates Goddard, M. A., A.J. Dougill, and T.G. Benton. 2010. Scaling up from gardens: biodiversity conservation in urban environments. Trends Ecol. Evol. 25, 90–98. doi:10.1016/j. tree.2009.07.016 Grove, J.M., A.R. Troy, J.P.M. O’Neil-Dunne Jr., W.R. Burch, M.L. Cadenasso, and S.T.A. Pickett. 2006. Characterization of Households and its Implications for the Vegetation of Urban Ecosystems. Ecosystems 9, 578–597. doi:10.1007/s10021-006-0116-z Hope, D., C. Gries, W.X. Zhu, W.F. Fagan, C.L. Redman, N.B. Grimm, A.L. Nelson, C. Martin, and A. Kinzig. 2003. Socioeconomics drive urban plant diversity. Proc. Natl. Acad. Sci. U. S. A. 100, 8788–8792. doi:10.1073/pnas.1537557100 Kinzig, A.P., P. Warren, C. Martin, D. Hope, and M. Katti. 2005. The effects of human socioeconomic status and cultural characteristics on urban patterns of biodiversity. Ecol. Soc. 10, 23. Leong, M., M.A. Bertone, K.M. Bayless, R.R. Dunn, and M.D. Trautwein. 2016. Exoskeletons and economics: indoor arthropod diversity increases in affluent neighbourhoods. Biol. Lett. 2016 12 20160322; DOI: 10.1098/rsbl.2016.0322. Published 2 August 2016. Li, H. and K.T. Wilkins. 2014. Patch or mosaic: bat activity responds to fine-scale urban heterogeneity in a medium-sized city in the United States. Urban Ecosyst. 17, 1013–1031. (doi:10.1007/s11252-014-0369-9) Luck, G.W., L.T. Smallbone, and K.J. Sheffield. 2013. Environmental and socio-economic factors related to urban bird communities. Austral Ecol. 38, 111–120. doi:10.1111/j.1442- 9993.2012.02383.x Robinson, W.H. 2005. Urban insects and arachnids: A handbook of urban entomology. Cambridge: Cambridge University Press. Indoor Arthropod Communities and Distributions in U.S. Homes 23

Wang, C., M.M.A. El-Nour, and G.W. Bennett. 2007. Survey of Pest , Asthma, and Allergy in Low-income Housing. J. Community Health 33, 31–39. doi:10.1007/s10900-007- 9064-6 25

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

REVIEW OF CLIMATE CHANGE IMPACTS ON URBAN PESTS

PARTHO DHANG Independent Consultant, 2410 Belarmino Street, Bangkal, Makati City 1233, Philippines

Abstract Urban centres amplify both abiotic and biotic parameters favouring pest life history. In absence of natural enemies in urban areas, these parameters often are directly proportional to growth and population of these pests. Under the influence of climate change and global warming, these centres will act as favourable spots for pests in multiple ways, thus posing far reaching consequences, affecting human lives. Insects are cold-blooded organisms and are unable to regulate their body temperature and it is believed that the effect of temperature on insects largely overwhelms the effects of other environmental factors. Evidence of climate change and its impact are now apparent in many parts of the world, such as reports of vectors and vector borne diseases in previously unrecorded elevations, pest damages in uncited latitudes and pest activity in unexpected seasons. Its influence on aspects such as building materials, quality of urban structures, non-vectors, nuisance pests and prevention are now under examination. Increased urbanization and people’s choice of urban life has made this a very relevant subject and this article reviews impact of climate change on various aspects of pest dynamics as well as its influence on a number of tools and methodologies which are used to control and manage them.

Key words Climate change, global warming, urban pests, urban heat island.

INTRODUCTION Consequences of climate change on humans is mostly unknown, but its impact is slowly being realised. Among many, some could be challenges caused purely by urban and public pests (Dhang, 2016). The impact of climate change on vectors for disease pathogens (mosquitoes, , blackflies, fleas, etc.) and other medically important arthropods (stinging insects, spiders, and bed bugs) is a topic of great concern (Sims and Appel, 2016). Climate change can modify pest life history, resulting in increased diversity and density of pests, consequently posing significant risk to humans. It is also notable that climate change impacts could be amplified in urban centres much different from natural areas due to the creation of urban heat island, making most urban areas warmer than surrounding areas (Douglas and James, 2015). This phenomenon in certain latitudes could influence pests, by increasing their activity and also by making non pest species to move into these warmer centres and become pests as evident by examples described by Douglas and James, (2015). A number of comprehensive reports are available discussing the effects of climate change on public pests in both indoor and outdoor conditions (Dhang, 2016; USEPA, 2010; CIEH 2008; Epstein, 2005; Patz et al., 2003).

MATERIALS AND METHODS Journal articles were retrieved from library, online sources and personal collection using the key words mentioned elsewhere in this article. A relatively small number of studies exist on the topic, so reference list provided in relevant articles were reviewed in detail to find additional articles. The final information was reviewed to check for completeness towards the theme before being written. 26 Partho Dhang Review Of Climate Change Impacts On Urban Pests

RESULTS AND DISCUSSION

Climate Change In Urban Areas The urban environment is a complex of wholly or partially anthropogenically-influenced habitats created from natural areas, sometimes via the intermediate state of agricultural land (Robinson, 2005). In the context of the urban environment, ‘urban’ comprises not just the city centre, but also the surrounding suburbs, urban green space, industrial areas, and the rural-urban fringe (Robinson, 2005). Urban areas present unique composition unlike natural. The main driver of an urban ecosystem is human, his activates and behaviour. Urbanity presents concentrated human population, accumulated resources such as food and water, variety of niches such as micro-habitats, diversity of flora and fauna, climate control options, varied ideology etc. to be called unique. However one of the most significant features which is experienced in urban areas is heat island. An urban heat island (UHI) is an area/city warmer than its surrounding natural areas due to human activities. The main cause of the urban heat island effect is from the modification of land surfaces (Solecki, 2004; USEPA, 2015) and waste heat generated by energy usage is a secondary contributor (LI and Zhao, 2012). Thus urbanization causes regional increases in temperature that exceed those measured on a global scale, which are as much as 12°C warmer than their surroundings (Angilletta et al., 2007). It is obvious, animals and plants living in urban area will deferentially respond to altered conditions in comparison to natural world. This makes urban areas to amplify both abiotic and biotic parameters often favouring pest life history, and in absence of natural enemies, these parameters often are directly proportional to population of these pests (Dhang, 2016). Urban heat island also bring permanent changes in the physiology of the species when compared to their natural populations, favouring a step towards evolution of a group which can be now be called “truly urban”. It is observed that leaf-cutter ants, Atta sexdens colonies in urban heat islands have an increased heat tolerance at no cost (Angilletta et al., 2007). It is expected that species that are good at colonizing can invade to utilize favourable conditions provided by urban heat islands to thrive in regions outside of their normal range. Examples of this include Pteropus poliocephalus, a flying fox, and the house gecko Hemidactylus frenatus, (Warren, 2005). Urban areas around the world are known to harbour common pests due to their close dependence on humans. Roy et al. (2009) predicted the effect of climate change on nuisance insect species in the United Kingdom. The report highlights the nuisance insect species that are unlikely to be affected by environmental warming are Blattella germanica (), Cimex lectularius (), Monomorium pharaonis (Pharaoh ), Anobium punctatum (wood-worm), Ctenocephalides felis (cat fleas), (powderpost ), Hylotrupes bajulus (house longhorn), (common clothes ), Dolichovespula media (media wasp) and Vespa crabro (European hornet). The ten species most likely to increase with climate warming are Tinea riaalternata (moth ), Lasius neglectus (invasive garden ant), Thaumetopoea processionea (oak processionary moth), humile (Argentine ant), Reticulitermes grassei (Mediterranean ), pipiens molestus (urban ), Culex pipiens pipiens (mosquito), Aedes vexans (mosquito – wetland), Ochlerotatus cantans (mosquito – woodland) and Musca domestica (house fly). The study further predicted that the ten species most likely to increase with changes in precipitation patters are the same as for increasing temperature with the exception of Musca domestica, but included Phlebotomus mascittii (sand fly).

Evidence of Climate Change Impacts on Urban Pests Evidence of climate change and its impact are now visible in many parts of the world. Examples of this can be had from changes in distribution, density or behavioural patterns of pests. Reports of new pest occurrence, such as reports of insect vectors and vector borne diseases in previously unrecorded elevations in eastern and central Africa, Latin America, and Asia are now attributed to climate change Review Of Climate Change Impacts On Urban Pests 27

(Dhang, 2016). In addition to mosquitoes, other pest species such as flies, lice, ticks, fleas, bats, rodents, snails and termites could significantly increase their distribution range and contribute to spread of diseases and damages to humans, influenced by changes in climate. This is evident in one of the WHO reports which highlights the linking of climatic factors such as temperature, precipitation, and sea level rise, to the lifecycles of infectious diseases, including both direct and indirect associations via ecological processes (Patz et al., 2003). Mosquito and its link to climate change has recently under close scrutiny with the increased incidence of malaria in highland urban cities, such as Nairobi, and rural highland areas of Papua New Guinea (Reiter, 2008). Similarly vector of Dengue, Chikungunia and other zoonotic disease Aedes aegypti, once limited by temperature to approximately 1000 m in elevation, has recently been found at 1700 m in Mexico and 2200 m in the Colombian Andes (Epstein, 2004). A study conducted by Culler (2015) on artic mosquitoes Aedes nigripes conclusively show that warmer spring temperatures caused the to emerge two weeks earlier and shortened their development time through the larval and pupal stages by about 10 percent for every 1°C increase in temperature. Warming increased the number of mosquitoes being eaten by diving beetles, but the mosquitoes accelerated growth in their vulnerable juvenile stages lessened their time with aquatic predators, which ultimately increased their chance of surviving to adulthood. With a 2°C warming scenario, the model predicted the mosquito’s probability of survival will increase by 53 percent. A number of studies such as by Easterling et al., 2000; Greenough et al., 2001; Pall et al., 2011, also link climate change to mosquito outbreaks. The studies point out that mosquitoes belonging to the species, Culex tritaeniorhynchus and Culex tarsalis, vectors for the Japanese and Western Equine Encephalitis viruses respectively, are floodwater species and may increase in abundance in the urban environment during and after flooding events, which are predicted to increase with climate change. Increase in geographic range of mosquitoes following warm temperature gradients into previously unknown territories in USA (Rochlin et al, 2013), serves as another good example how temperature can influence urban pest dynamics. Evidence of other species showing influence of climate are being increasingly reported. Sims and Appel (2013) reported weather-influenced effects on pests from St. Louis area of USA. They reported termite swarming unusually early in the year, following the extremely mild winter of 2011- 12. The mild winter was followed by a very warm and dry summer and this was also associated with a significant increase in houses invaded by brown recluse spiders that normally reside outdoors. Quarles (2007) suggested temperature increases in the USA to favour warm weather pests such as ants, termite pests, clothes , flies, mosquitoes, fleas, stored product moths, wood boring beetles, and bed bugs. It is observed that termite distribution and abundance is closely linked to distribution and abundance of rainfall gradient (Wood and Johnson, 1986), temperature and relative humidity (Cabrerra, 1994). Termite foraging patterns are linked to key abiotic parameters (Haagsma and Rust 1995; Mesenger and Su 2005; Moura et al., 2006). Evidence of termites in previously unrecorded latitudes are also coming to light now. Reports of tropical species, such as Coptotermes gestroi, becoming established in the subtropics (Grace, 2006); and subtropical species Coptotermes formosanus expanding their range northwards into more temperate areas (Jenkins et al., 2002) substantiate the role climate could play in pest distribution. In colder areas of North America such as Wisconsin and southern Canada, populations of Reticulitermes flavipes appear to be gradually expanding their range and even swarming under natural outdoor conditions (Arango et al., 2014, Scaduto et al., 2012). However, colony growth and slow dispersal without the need for swarming has been associated with these northern colonies on the fringe of their range (Arango et al., 2014). Swarming events can occur in all months of the year. With increasing temperatures, both the total yearly number of swarms and frequency of swarms in cooler months can be expected to increase. 28 Partho Dhang Review Of Climate Change Impacts On Urban Pests

Range expansion in house fly in response to rising global temperatures and anthropogenic changes has received considerable attention in the last two decades (Parmesan and Yohe, 2003; Crozier 2004; Karban and Strauss, 2004; Hickling et al., 2005). Climate change is predicted to have major effects on flies of public health significance in domestic premises and climate change models predict that populations of the house fly, Musca domestica, and blow flies, Calliphora spp., could increase up to 244% by 2080 (Goulson et al., 2005). Climate is one of the most important factors influencing the distribution of ants (Jenkins et al., 2011) and climatic suitability may be the most important factor responsible for the current global distribution of the invasive Argentine ant, Linepithema humile (Roura-Pascual, 2011). The Rasberry crazy ant, now positively identified asNylanderia fulva (Gotzek et al., 2012), was introduced into the Southeastern United States and its distribution continues to rapidly expand. It should eventually occupy the entire Gulf Coast but the northern limits of its range are unclear and will be influenced by weather conditions associated with climate change. Long-term observations on fauna in Europe suggested that medically and veterinary important species changed their areas of occurrence. Many authors correlated this phenomenon with climatic changes such as increasing temperatures in winter months, mild and long spring and autumn, changes in snow cover (Gliniewicz et al., 2016). Changes in climate parameters generate changes in environment, particularly the flora and the fauna components. Ticks can be transported also by small and large mammals and birds as their hosts, when they invade new territories. Expansion of ticks to the new areas because of climatic changes is one cause of observed increase in tick-borne disease cases in European countries. Insects are cold-blooded organisms and cannot regulate their body temperature. The temperature of their body is approximately the same as that of its immediate environment. Therefore, temperature is probably the single most important environmental factor influencing pest behavior, distribution, development, survival, and reproduction (Petzoldt and Seaman, 2010). It has been recognised for many years that climate affects biochemical, physiological and behavioural processes in insects (Thomas and Blanford, 2003). Thus it is inevitable that modest changes to the climate are expected to have a rapid impact on the distribution and abundance of pest insects because of temperature would trigger their physiology, make lifecycles shorte , increase mobility and reproductive potential (Ayres and Lombardero, 2000; Roy et al., 2009). The effect of climate change is however complex and will be determined by the extent of pest’s actual exposure to it. Indoor pests living under continuous air conditioning or in very close proximity to humans may not experience changes as will be faced by outdoor pests. Synanthropic species such as bed bugs, and human-parasitic species such as head lice or pubic lice Pthirus pubis are unlikely to experience major, if any, changes in population size or an impact from climate change unless it drives a major change in human behaviour (Comont, 2016). This is very much predicted by Roy et al. (2009). In addition, a number socioeconomic conditions and human activity will influence pest distribution and density. This complex interlinking further complicates distribution. For example in case of urban mosquitoes, water storage practices, and various intervention methods used to prevent intrusion of mosquitoes into homes affect their distribution and population. Such factors can mix up basic associations between climate parameters and mosquito abundance (Saul Lozano-Fuentes, 2012) and affect prediction models. Close association of Aedes mosquitoes to humans is an example where human action can be a determinant factor in deterring pest distribution and density, irrespective of climate. The impact of climate change on urban pest is a complicated subject knowing that urbanity is a heterogeneous mixture of variables. The review however conclusively shows climate change will affect various aspect of urban pest, most notably their distribution and density. It can be safely concluded that climate change and resulting temperature regimens in particular will have profound influence on urban pests and humans. Review Of Climate Change Impacts On Urban Pests 29

REFERENCES CITED Angilletta, M. J., S. W. Robbie, C. N. Amanda, M. Sears, A.N. Carlos, and P.L. Ribeiro. 2007. Urban Physiology: City Ants Possess High Heat Tolerance PLoS ONE. 2: e258. doi:10.1371/ journal.pone.0000258. Arango, R.A., F. Green, G. R. Esenther, D. A. Marschalek, M. E. Berres, and K. F. Raffa. 2014. Mechanisms of Termite Spread in Wisconsin and Potential Consequences as a Result of Changing Climate Trends. Proceedings of the 109th American Wood Protection Association, April 28 – May 1, 2013, Honolulu, Hawaii: 109: 111-114. Ayres, M.P. and M. J. Lombardero. 2000. Assessing the consequences of global change for forest disturbance from herbivores and pathogens. Science of the Total Environment 262: 263–286. Cabrera, B. J. and M. K. Rust. 1994. The effect of temperature and relative humidity on the survival and wood consumption of the Western drywood termite, (Isoptera: ). Sociobiology 24(2): 95-113. Chartered Institute of Environmental Health. 2008. A CIEH Summary based on Urban Pests and their Public Health Significance. WHO Regional Office for Europe, Denmark. Comont, R. 2016. Climate change effects on urban pest insects. In Dhang P., ed, Climate change impacts on urban pests, CAB International, Wallingford, U.K. 1-14 pp Crozier, L. 2004. Warmer winters drive range expansions by increasing survivorship. Ecology 85: 231–241. Culler, L.E., M. P. Ayres, and R. A. Virginia. 2015. In a warmer Arctic, mosquitoes avoid increased mortality from predators by growing faster. Proceedings of the Royal Society B 282: 1815. Dhang, P. 2016. Climate change and urban pest management. In: Dhang P., ed, Climate change impacts on urban pests, CAB International, Wallingford, U.K.15-30 pp Douglas, I. and P. James. 2015. Adapting to Change. In Douglas, I and Roulledge, J. P ed Urban Ecology – an Introduction Oxon, UK; New York, U.S.A. 373 pp Easterling, D.R., G. A. Meehl, C. Parmesan, s. A. Changnon, T. R. Karl, and L. O. Mearns. 2000. Climate extremes: observations, modelling, and impacts. Science 289: 2068–2074. Epstein, P. R. 2004. Climate Change and Public Health: Emerging Infectious Diseases, Encyclopaedia of Energy, Volume 1, pp 381-392. Available at http://www.bvsde.paho.org/bvsacd/cd35/8else. pdf (accessed, September, 2016). Epstein, P. R. and E. Mills. 2005. Climate change futures: health, ecological and economic dimensions. Center for Health and the Global Environment, Harvard Medical School, Boston, Massachusetts, USA. Available at http://www. climatechangefutures.org/pdf/CCF_Report_ Final_10. 27. pdf (September 2016). Gliniewicz A, G. Karbowiak, E. Mikulak, M. Supergan-Marwicz, A. Królasik, and J. Myślewicz. 2016. Impact of climate change on medically important ticks in europe and their control. In Dhang P., ed, Climate change impacts on urban pests, CAB International, Wallingford, UK pp 111-126. Gotzek, D., S. G. Brady, R. J. Kallal, and J. S. LaPolla. 2012. The importance of using multiple approaches for identifying emerging invasive species: The case of the Rasberry crazy ant in the United States. PLoS ONE : 7, e45314.doi:10.1371/journal.pone.0045314. Goulson, D., L. C. Derwent, M. E. Hanley, D. W. Dunn, and S. R. Abolins, 2005. Predicting calyptrate fly populations from the weather, and probable consequences of climate change. Journal of Applied Ecology 42: 795–804. 30 Partho Dhang Review Of Climate Change Impacts On Urban Pests

Grace, J.K. 2006. When invasive meet: Coptotermes formosanus and Coptotermes vastator in the Pacific. In: Proceedings of the 2006 National Conference on Urban Entomology. Raleigh- Durham, North Carolina, 92-94. Greenough, G., M. McGeehin, S. M. Bernard, J. Trtanj, J. Riad, and D. Engelberg. 2001. The potential impacts of climate variability and change on health impacts of extreme weather events in the United States. Environ. Health Perspective 109: 191–198. Haagsma, K. A. and M. K. Rust. 1995. Colony size estimates, foraging trends, and physiological characteristics of western termite (Isoptera: Rhino.). Environmental Entomology 24: 1520– 1528. Hickling, R., D. B. Roy, J. K. Hill, and C. D. Thomas. 2005. A northward shift of range margins in British Odonata. Global Change Biology 11: 502–506. Jenkins, T.M., R. E. Dean, and B. T. Forschler, 2002. DNA technology, interstate commerce, and the likely origin of Formosan subterranean termite (Isoptera: Rhinotermitidae) in Atlanta, . Journal of Economic Entomology 95: 381-389. Karban, R. and S. Y. Strauss. 2004. Physiological tolerance, climate change, and a northward range shift in the spittlebug, Philaenus spumarius. Ecological Entomology 29: 251–254. Li, Y. and X. Zhao. 2012. An empirical study of the impact of human activity on long-term temperature change in China: A perspective from energy consumption. Journal of Geophysical Research. 117. doi:10.1029/2012JD018132. Mesenger, M.T. and N. Y. Su. 2005. Colony characteristics and seasonal activity of Formosan subterranean termite (Isoptera: Rhinotermidae) in Louis Armstrong Park, New Orleans, Louisiana. Journal of Entomological Science 40: 268–279. Moura, F.M., S. A. Vasconcellos, V.F.P. Araujo, and A. G. Bandiera. 2006. Seasonality in foraging behavior of Constrictotermes cyphergaster (, Nasutitermitinae) in the Caatinga of Northeastern Brazil. Sociobiology 53: 453–479. Pall, P., T. Aina, D. A. Stone, P. A. Stott, T. Nozawa, A. G. Hilberts, D. Lohmann, and M. R. Allen. 2011. Anthropogenic greenhouse gas contribution to flood risk in England and Wales in autumn 2000. Nature 470: 382–385. Parmesan, C. and G. Yohe. 2003. A globally coherent fingerprint of climate change impacts across natural systems. Nature 421: 37–42. Patz, J. A., A. K. Githeko, J. P. McCarty, S. Hussein, U. Confalonieri, and N. de Wet. 2003 Climate change and infectious diseases. Available at http://www.who.int/globalchange/ publications/climatechangechap6.pdf (accessed, September 2016). Petzoldt, C. and A. Seaman. 2010. Climate Change Effects on Insects and Pathogens. Available at http://umaine.edu/oxford/files/2012/01/III.2Insects.Pathogens1.pdf (Accessed, 15th September, 2015). Quarles, W. 2007. Global Warming Means More Pests. The IPM Practitioner Volume XXIX, Number 9/10, September/October. Available at http://www.birc.org/SepOct2007.pdf. (Accessed September 2016). Reiter, P. 2008. Global warming and malaria: knowing the horse before hitching the cart. Available at http://www.malariajournal.com/content/7/S1/S3 (accessed, September 2016). Robinson, W.H. 2005. Urban insects and arachnids: A handbook of urban entomology. Cambridge University Press. Cambridge, UK. Review Of Climate Change Impacts On Urban Pests 31

Rochlin, I., D. V. Ninivaggi, M. L. Hutchinson, and A. Farajolla. 2013. Climate Change and Range Expansion of the Asian Tiger Mosquito () in Northeastern USA: Implications for Public Health Practitioners. Available at http://journals.plos.org/plosone/ article?id=10.1371/journal.pone.0060874. Accessed September 2015). Roura-Pascual, N., C. Hui, T. Ikeda, G. Leday, D. M. Richardson, S. Carpintero, X. Espadaler, C. Gómez, B. Guénard, S. Hartley, P. Krushelnycky, P. J. Lester, M. A. McGeoch, S.B. Menke, J.S. Pedersen, J. P. W. Pitt, J. Reyer, N.J. Sanders, A.V. Suarez, Y. Touyama, D. Ward, P. S. Ward, S. P. and Worner. 2011. Relative roles of climatic suitability and anthropogenic influence in determining the pattern of spread in a global invader. Proceedings of the National Academy of Sciences 108: 220-225. Roy, H., B. Beckmann, R. Comont, R. Hails, R. Harrington, J. Medlock, B. Purse, and C. Shortall C. 2009. Nuisance insects and climate change. Available at http://nora.nerc. ac.uk/8332/ (Accessed 15th September 2015). Saul Lozano-Fuentes, S., M. H. Hayden, C. Welsh-Rodriguez, C. Ochoa-Martinez, B. Tapia- Santos, K. C. Kobylinski, C. K. Uejio, E. Zielinski-Gutierrez, L. D. Monache, A. J. Monaghan, D. F. Steinhoff, and L. Eisen. 2012. The Dengue Virus Mosquito Vector Aedes aegypti at High Elevation in México. Available at http://www.ncbi.nlm.nih.gov/pmc/articles/ PMC3516267/ (Accessed Oct 15, 2016). Scaduto, D.A., S. R. Garner, E. L. Leach, and G. J. Thompson. 2012. Genetic evidence for multiple invasions of the eastern subterranean termite into Canada. Environmental Entomology 41:1680-1686. Sims, S. R. and A. G. Appel. 2016. Climate change and the new dynamics of urban pest management in North America. In Dhang P., ed, Climate change impacts on urban pests, CAB International, Wallingford, U.K. 31 – 49 pp Sims, S.R. and A. G. Appel. 2013. What Does Climate Change Mean for Pests and PMPs. http:// www.pctonline.com/article/pct0413-mosquitoes-increase-climate-change. (Accessed 15th September 2016). Solecki, W. D., C. Rosenzweig, L. Parshall, G. Pope, M. Clark, J. Cox, and M. Wiencke. 2005. Mitigation of the heat island effect in urban New Jersey. Global Environmental Change Part B. Environmental Hazards 6: 39–49. Thomas, M.B. and S. Blanford. 2003. Thermal biology in insect-parasite interactions. Trends in Ecology and Evolution 18: 344–350. US EPA. 2010. Public Health Consequences and Cost of Climate Change Impacts on Indoor Environments, http://sustainablecities.org.nz/wp-content/uploads/US-EPA-Public-Health- Report. pdf (accessed September 2016). USEPA. 2015. Reducing Urban Heat Islands: Compendium of Strategies - Urban Heat Island Basics. https://www.epa.gov/heat-islands/heat-island-compendium (accessed Nov 2016). Wood, T. G. and R. A. Johnson. 1986. The biology, physiology and ecology of termites. In ed. Vinson, S. B., Economic Impact and Control of Social Insects. Praeger, New York, 1–68 pp 33

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

SURVEILLANCE AND DETECTION OF INVASIVE MOSQUITO SPECIES IN THE UNITED KINGDOM

1ALEXANDER G.C. VAUX, 2THOM DALLIMORE, 2CLARE STRODE, 1BENJAMIN CULL, AND 1,3JOLYON M. MEDLOCK 1Medical Entomology group, ERD Science and Technology, Emergency Response Department, Public Health England, Porton Down, Salisbury, SP4 0JG, United Kingdom 2Department of Biology, Edge Hill University, St. Helens Road, Ormskirk, Lancashire, L39 4QP, UK 3NIHR Health Protection Research Unit in Emerging and Zoonotic Infections, UK

Abstract The UK employs a multi-faceted approach to surveillance for invasive Aedes species, including active methods, designed to target particular, potentially higher locations, and passive methods, providing a means for the general public and relevant professional groups to submit mosquito samples for identification. Mosquito surveillance is led by Public Health England’s (PHE) Medical Entomology and Zoonoses Ecology (MEZE) group, whose role is to provide advice to PHE and the Department of Health and other government advisory groups, on the risk to public health from vector borne disease. MEZE, and colleagues at Edge Hill University, work with environmental health and port health officers across the country to run mosquito traps to target the detection of potential introduction of invasive species. Surveillance is also conducted at motorway service stations; key locations that target other potential routes by which invasive mosquitoes might enter the UK. Two species native to the UK, Culex pipiens and Anopheles maculipennis s.l., were found at seaports and airports, and two native species, Cx. pipiens s.l. and annulata, were found at used tyre importers. Eggs of the invasive mosquito Aedes albopictus were found at a service station in the South-East of England and a control program was implemented. To enhance our ability to detect the introduction/presence of unusual species PHE works with the Chartered Institute for Environmental Health to promote passive surveillance; the Mosquito Watch and the Mosquito Recording Schemes. These are useful tools to develop better understanding of the presence oand distribution of the potentially changing distribution of different mosquito species in the UK and an important component of surveillance strategies for the early detection of invasive mosquito species.

Key words Aedes albopictus, Aedes aegypti, Culicidae INTRODUCTION Invasive Aedes mosquitoes have in recent decades spread throughout many regions of the world, where they have been responsible for outbreaks of mosquito borne disease. Globalisation, particularly increase in trade and travel, has enabled the importation of vectors and pathogens into Europe. Particular goods, such as used tyres and wet-footed plants, have facilitated movement of invasive mosquitoes, and together with climate and land-use change, importation of vectors and pathogens increase the potential for the establishment of invasive mosquitoes and vector borne disease (Reiter 1998; Scholte et al., 2007; Scholte and Schaffner, 2007). In Europe Aedes albopictus has now been reported from 28 European countries (Medlock et al, 2015), and there have been associated cases of chikungunya (CHIKV) in and , and dengue (DENV) in Croatia and France (Medlock et al, 2012; Schaffner et al, 2013). Aedes aegypti is established in Madeira (), and around the Black Sea (Akiner et al, 2016), and there have been over 2000 cases of DENV in Madeira as a result (Sousa et al, 2012). The rapid emergence of Zika virus in recent months captivated media around the world, and brought home the importance of a strong surveillance network for invasive mosquitoes. 34 A.G.C. Vaux, T. Dallimore, C. Strode, B. Cull, and J. M. Medlock Surveillance And Detection Of Invasive Mosquito Species In The United Kingdom

Active surveillance for invasive mosquitoes in the UK focusses on high risk goods and points of entry as detailed in Vaux and Medlock (2015). PHE and Edge Hill University work with seaports and airports as part of the Port Invasive Mosquito Surveillance project in order to conduct surveillance at these ports of entry. Surveillance is conducted at used tyre importers to address the importation of used tyres, as the movement and trade of this commodity has inadvertently provided transport for Aedes eggs into new regions across the globe. Service stations providing rest areas to vehicular traffic arriving from continental Europe are also targeted, motorways having been identified as one of the main routes aiding the spread of invasive mosquitoes through Europe (Becker et al, 2012; Werner et al, 2012; Flacio et al, 2016). In 2016 this has been expanded to further locations, and the results of these surveillance efforts are described in this paper.

MATERIALS AND METHODS Surveillance at Ports and Airports Port health officers (PHOs) at ports and airports across the UK were contacted and subsequently engaged between March and October 2016 in order to increase the number of sites participating in the survey for potentially imported invasive mosquitoes. The Gravid Aedes trap (GAT; Biogents, Regensburg, Germany, http://www.biogents.com) was chosen as the preferred trap type, due to its effective targeting of invasive Aedes species, ease of use, low cost, and after an appraisal of other trap types in previous work at UK ports and airports (Johnson et al., 2016; Murphy et al., 2012; Vaux et al., 2011). Many PHOs had difficulty regularly accessing traps that were placed airside within the secure area, and the simple unpowered trap design aided their ability to access these areas regularly. Five GATs were used at each seaport/airport, were filled with water and sited close to key areas within the port: cargo inspection warehouses, aircraft gates, and dockside. Heathrow, Gatwick, and Stansted airports each employed ten GATs each. Three GATs were also used at Eurostar St Pancras as fewer locations were available here for traps. GATs were placed within small dog cages, to ensure the traps were not tampered with or disturbed by aircraft engines. Wherever possible, a powered electrical trap (BG Mosquitaire, Biogents, Regensburg, Germany) was used together with Sweetscent® lures (Biogents, Germany). Four ports were able to run this trap (Heathrow airport, Stansted airport, Felixstowe seaport, and Gatwick airport). Traps were checked once per fortnight from March to October 2016 for adult insects and larvae, and all samples sent to PHE or Edge Hill University for identification, and the results reported here. PHOs continue to check traps at monthly intervals for the winter season (Nov-Mar), and will begin fortnightly checks thereafter.

Surveillance At Service Stations And Used Tyre Importers PHE’s Medical Entomology team identified the main service stations of potential relevance to be along the M20, M2, M25, M3, and M27 motorways; servicing traffic leaving ports at Dover, Folkestone, Southampton and Portsmouth. Seven service stations on these routes were visited in early 2016, and locations for traps identified. Ten ovitraps were set up within the vegetation around the carparks at each site – each trap was filled with water and fixed to the ground with a tent peg to prevent disturbance. A polystyrene block was placed in each ovitrap. Two GATs were also set up, as described above for ports and airports. Where access, security and power constraints could be overcome, one BG Mosquitaire adult trap (Biogents, Regensburg, Germany) baited with Sweetscent® lures (Biogents, Germany), was set up at a service station. The team also undertook three visits to the two largest importers of used tyres during August and September. Two visits were made to a company in Devon, and one visit to a company in Lincolnshire; during each, searches for larvae in the tyres were made dippers, torches, and nets. In these used tyre locations it was not possible to place adult traps, GATs or ovitraps due to a lack of electrical power, and the very high number of alternative ovipositing sites provided by the tyres. Surveillance And Detection Of Invasive Mosquito Species In The United Kingdom 35

RESULTS AND DISCUSSION Surveillance At Ports and Airports Thirty-six seaports, airports, and Eurostar St Pancras conducted surveillance for invasive mosquitoes (Table 1). Each location submitted the catch from each trap every fortnight and these were examined for adult mosquitoes. Mosquitoes were found at eight locations, all were identified as Culex pipiens s.l. or Anopheles maculipennis s.l. (Cardiff Airport 2 Cx. pipiens s.l.; Glasgow Prestwick airport 5 Cx. pipiens s.l. at GAT, 25 Cx. pipiens s.l. from warehouse walls; Heathrow airport 20 Cx. pipiens s.l.; Heysham and Glasson Docks 4 Cx. pipiens s.l.; Felixstowe seaport 15 Cx. pipiens s.l. and 1 An. maculipennis s.l.; Liverpool seaport 8 Cx. pipiens s.l.; Stansted airport 2 Cx. pipiens s.l.; Teesport 9 Cx. pipiens s.l.). The An. maculipennis s.l. was found in the BG Mosquitaire trap, and all the Cx. pipiens were found in the GATs. Both of these species are common British mosquitoes. Anopheles maculipennis s.l. is a species complex which in the UK includes An. atroparvus, An. messae, and An. daciae. These species bite a range of hosts including humans, and occupy a range of permanent aquatic habitats including brackish saltmarshes, coastal ditches, and freshwater ditches and lake margins. The species cannot be separated morphologically hence the result reported here as the species complex An. maculipennis. Culex pipiens s.l. is found in a wide range of aquatic habitats in urban and rural landscapes, and is known for utilising container habitats. In the UK, the typical form, found in above ground habitats, and likely to be the form collected at the ports, bites birds exclusively.

Table 1. Ports and airports taking part in mosquito surveillance.

Belfast City Airport Heathrow Airport Newport Port Belfast International Airport Heysham Port and Glasson Dock Port Talbot Port Belfast Port Hull Port Portsmouth Port Bristol Airport Ipswich Port RAF Akrotiri Airport Cardiff Airport John Lennon Airport River Tees Port Cardiff Port JSPU Limmasol Port RN Davenport Dover Port Liverpool Port RN Portsmouth Falmouth Port Luton Airport Robin Hood Airport Felixstowe Port Manchester Airport Eurostar St Pancras Gatwick Airport Manchester Port Stansted Airport

The lack of mosquito species collected during this extensive surveillance program is not unexpected. The Gravid Aedes traps are designed to target Aedes mosquito species, specifically those which utilise container habitats, and therefore it is unsurprising that only native container breeding Cx. pipiens was found at this trap. The record of An. maculipennis s.l. found at the powered adult trap at Felixstowe is also unsurprising, given the proximity of suitable aquatic habitats near the port, and the propensity of this species to bite humans, hence its attraction to the mammal lure baited adult trap.

Surveillance At Service Stations And Used Tyre Importers Service stations in the south and south-east of England were targeted for surveillance for invasive mosquitoes (Table 2). Four service stations (Winchester, Folkestone, Southampton, and Maidstone), were able to run BG Mosquitaire adult traps. One mosquito species (Culex pipiens s.l.) was recorded present at all of the BG Mosquitaires (Winchester, Folkestone, Southampton, and Maidstone). Two Culiseta annulata females were found at a GAT at Southampton service station. Culex pipiens s.l. larvae were found at two ovitraps in Southampton, and at one ovitrap at Maidstone. No other larvae were recorded. Thirty-seven Aedes eggs were detected in an ovitrap at Folkestone services in late September, and these were identified by MALDI-TOF mass spectrometry and morphological identification of reared 36 A.G.C. Vaux, T. Dallimore, C. Strode, B. Cull, and J. M. Medlock Surveillance And Detection Of Invasive Mosquito Species In The United Kingdom larvae and adults as Aedes albopictus (Medlock et al., 2017). This is the first recorded incursion ofAedes albopictus into the UK, and is likely to have resulted from the vehicular importation of a single female. Additional surveillance was undertaken, and the local authority conducted control of aquatic habitats within a 300-meter radius of the finding (Medlock et al., 2017). No further specimens of this species were found, and surveillance in this area will be conducted in April 2017. Two species were recorded during the used tyre surveys: Cx. pipiens s.l. and Culiseta annulata. Both species are native species typical of container habitats in the UK. The larvae were found in tyres closest to the margins of the yards, in close proximity to vegetation. Discussions with the yard managers revealed that tyres were processed within 3-4 weeks of arrival, and thereafter kept in an indoor warehouse unsuitable for mosquitoes. It may be this relatively fast turnaround time that has meant that to date invasive mosquitoes have not been found at tyre yards in the UK.

Table 2. Location and motorway of service stations taking part in mosquito surveillance.

Location Motorway Medway, Kent M2 Sevenoaks, Kent M25 Maidstone, Kent M20 Folkestone, Kent M20 Ashford, Kent M20 Winchester, Hampshire M3 Southampton, Hampshire M27

Incursions of invasive mosquitoes are likely to increase in number over the coming years, as Ae. albopictus increases its northward march through Europe. Another species of concern is Ae. japonicus, an invasive mosquito that has recently established in central European countries, including France, Belgium, the Netherlands, Germany and Switzerland, following introduction and spread through similar routes to Ae. albopictus (Kampen and Werner, 2014). As densities of these mosquitoes increase in areas within a few hours driving distance of the English Channel, it can be expected that adult mosquitoes will be more frequently transported into the country. Surveillance at key points of entry is therefore vital, as is a defined and actionable control strategy to ensure populations are eradicated swiftly upon detection. An important factor here is the ability for environmental health officers, pest controllers, and the public to be able to submit mosquitoes they find to a central point for identification. Passive schemes have been used to great effect in Europe (Kampen et al 2015), and the Mosquito Recording Scheme, run by PHE and the Biological Records Centre, undertakes this important work (Vaux and Medlock, 2015). Further development of this citizen science element of surveillance is necessary to strengthen our ability to detect new mosquito species. Nevertheless, an active surveillance network, including working with professionals at major ports of entry across the country, remains a vital component of the UK’s preparedness for incursions of key mosquito vectors.

REFERENCES CITED Akiner, M.M., B. Demirci, G. Babuadze, V. Robert, F. Schaffner. 2016. Spread of the Invasive Mosquitoes Aedes aegypti and Aedes albopictus in the Black Sea Region increases risk of Chikungunya, Dengue, and Zika outbreaks in Europe. PLoS Negl Trop 10(5): e0004764. Becker, N., M. Geier, C. Balczun, U. Bradersen, K. Huber, and E. Kiel, E. 2013. Repeated introduction of Aedes albopictus into Germany, July to October. Parasitol Res 112(4):1787-90. Surveillance And Detection Of Invasive Mosquito Species In The United Kingdom 37

Flacio, E., L. Engeler, M. Tonolla, and P. Muller. 2016. Spread and establishment of Aedes albopictus in southern Switzerland between 2003 and 2014: an analysis of oviposition data and weather conditions. Parasites and Vectors 9:404. Johnson, B.J., T. Hurst, H. Luu Quoc, I. Unlu, C. Freebairn, Ary Faraji, and S.A. Ritchie. 2016. Field comparisons of the Gravid Aedes trap (GAT) and BG-Sentinel trap for monitoring Aedes albopictus (Diptera: Culicidae) populations and notes on indoor GAT collections in Vietnam. J Med Entomology 2016: 1 – 9. Kampen, H. and D. Werner. 2014. Out of the bush: the Asian bush mosquito Aedes japonicus japonicus (Theobald, 1901) (Diptera, Culicidae) becomes invasive. Parasit Vectors 2014; 7: 59. Kampen, H., J.M. Medlock, A.G.C. Vaux, C. Koenraadt, A. van Vliet, and F. Bartumeus. 2015. Approaches to passive mosquito surveillance in the EU. Parasit Vectors 8: 9 Medlock, J., K. Hansford, F. Schaffner, V. Versteirt, G. Hendrickx, H. Zeller, and W. Van Bortel. 2012. A review of the invasive mosquitoes in Europe: ecology, public health risks, and control options. Vector Borne Zoonotic Dis 12: 435–447. Medlock, J.M., K.M. Hansford, V. Versteirt, B. Cull, H. Kampen, and D. Fontenille. 2015. An entomological review of invasive mosquitoes in Europe. Bulletin of Entomological Research 6: 637-663. Medlock, J.M., K.M. Hansford, V. Versteirt, B. Cull, H. Kampen, and D. Fontenille. 2015. An entomological review of invasive mosquitoes in Europe. Bulletin of Entomological Research 6: 637-663. Medlock, J.M., A.G.C. Vaux, B. Cull, F. Schaffner, E. Gillingham, V. Pfluger, and S. Leach. 2017. Detection of the invasive mosquito species Aedes albopictus in southern England. Lancet Infect. Dis. 17: 140. Murphy, G., A.G.C. Vaux, and J.M. Medlock. 2012. Challenges in undertaking mosquito surveillance at UK seaports and airports to prevent the entry and establishment of invasive vector species. Int J Environ Health Res 23: 1–10. Reiter, P. 1998. Aedes albopictus and the world trade in used tires, 1998-1995: the shape of things to come. J Am Mosq Control Assoc 14: 83-94. Schaffner, F., J.M. Medlock, and W. Van Bortel. 2013. Public health significance of invasive mosquitoes in Europe. Clin Microbiol Infect 19: 685–692. Scholte, E.J., F. Jacobs, Y.M. Linton, E. Dijkstra, J. Fransen, and W. Takken. 2007. First record of Aedes (Stegomyia) albopictus in Netherlands. Eu Mosq Bull 22: 5-9 Scholte, E.J., and F. Schaffner. 2007. Waiting for the tiger: establishment and spread of the Aedes albopictus mosquito in Europe. In: Takken W, Knols BGJ, eds, Emerging pests and vector- borne diseases in Europe. Wageningen: Wageningen Academic Publishers; 2007: 241-260 Sousa, C.A., M. Clairouin, G. Seixas, B. Viverios, M.T. Novo, A.C. Silva, M.T. Escoval, and A. Economopoulou. 2012. Ongoing outbreak of Dengue type 1 in the autonomous region of Maderia, Portugal: Preliminary Report. Eurosurveillance 17(49): pii=20333 Vaux, A.G.C. and J.M. Medlock. 2015. Current status of invasive msoquito surveillance in the UK. Parasites and Vectors 8: 351 Vaux, A., G. Murphy, N. Baskerville, G. Burden, N. Convery, L. Crossley, L. Dettman, P. Haden, L. Jarrold, C. Massey, K. Napier, I. Pocknell, S. Seddon, A. Smith, S. Tsoi, and J.M. Medlock. 2011. Monitoring for invasive and endemic mosquitoes at UK ports. Eur Mosq Bull 29: 133 – 140. Werner, D., M. Kronefield, F. Schaffner, and H. Kampen. 2012. Two invasive mosquito species Aedes albopictus and Aedes japonicus japonicus, trapped in south-west Germany, July to August 2011. Euro Surveill. 17(4): pii=20067 39

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

POPULATION EXPANSION AND HIGH GENE FLOW IN AEDES FLUVIATILIS (DIPTERA: CULICIDAE) IN URBAN AREAS

1LAURA CRISTINA MULTINI, 1ANDRÉ B. B. WILKE, 2LINCOLN SUESDEK, AND 1MAURO T. MARRELLI 1Faculdade de Saúde Pública da Universidade de São Paulo – FSP/USP / Av. Dr. Arnaldo, 715 São Paulo, Brasil. 2Instituto Butantan / Av. Vital Brasil, 1500 São Paulo, Brasil.

Abstract Aedes fluviatilis is an anthropophilic mosquito abundantly found in urban environments, however, its biology, epidemiological role and genetic characteristics are poorly known. Urbanization processes that resulted in environmental modifications together with climate change benefit certain anthropophilic mosquitoes’ species such as Ae. fluviatilis, increasing its abundance in urban areas. Aiming for better understand whether urbanization processes may modulate the genetic structure of this species in the city of São Paulo, Brazil, there were utilized eight microsatellite loci to genetically characterize Ae. fluviatilis populations collected in nine urban parks located in the city of São Paulo. The results indicated that this species has high gene flow among their populations, low genetic structure, high genetic variation within populations, as a result of a population demographic expansion. Also, our findings suggest that Ae. fluviatilis populations are segregated in two main groups, the first composed by population collected in more conserved areas and the second composed by two populations collected in highly urbanized areas. This result led us to hypothesize that the population dynamics found in this study is probably correlated with the urbanization of the city of São Paulo, which consists mainly in the transformation of rural areas into urbanized areas, to accommodate the increasingly concentration of people living within the city.

Key words Populations genetics, Culicidae, Urbanization, Microsatellites.

INTRODUCTION Aedes fluviatilis (Lutz, 1904) is a neotropical mosquito species abundantly found in urban areas (Forattini, 2002; WRBU, 2015). This species can thrive in urban environments and it is found throughout the city of São Paulo, where it represented around 10% of all mosquito specimens collected in previous studies (Ceretti-Júnior et al., 2015; Medeiros-Sousa et al., 2013). Ae. fluviatilis is highly anthropophilic and it is a potential vector of yellow fever virus (Davis and Shannon, 1931; de Carvalho et al., 2014), Plasmodium gallinaceum and Dirofilaria immitis (Camargo et al., 1983; Kasai, 1979; Vezzani et al., 2006). The success of some species of mosquitoes in inhabiting urban environments depends on three main factors: the availability of breeding sites, blood-meal sources and climate variations. These factors can modulate the abundance of mosquito populations in urban areas (Brown et al., 2011; Chaves and Koenraadt, 2010; Descloux et al., 2012; Edman, 1988). Therefore, a better knowledge of the genetic structure of urban mosquitoes can lead to a better understanding of how Ae. fluviatilis populations are modulated by selective pressures in the urban environment. Microsatellites have been used in genetic population studies since they are not subjected to selective pressures, indeed it can be a very useful tool for population genetic studies of mosquitoes on a macrogeographic (Brown et al., 2011; Fonseca et al., 2006; Wilke et al., 2014) and microgeographic (Olanratmanee et al., 2013; Piccinali and Gürtler, 2015) scale. 40 L. C. Multini, A. B. B. Wilke, L. Suesdek, and M. T. Marrelli Population Expansion And High Gene Flow In Aedes fluviatilis In Urban Areas

Considering the above facts, this study used microsatellite markers to investigate how Ae. fluviatilis populations are genetically structured in the city of São Paulo, Brazil and whether urbanization processes can modulate the genetic structure of this culicid.

MATERIAL AND METHODS Ae. fluviatilis mosquitoes were collected from nine urban parks (Burle Marx, Ibirapuera, Piqueri, Previdência, Santo Dias, Shangrilá, Alfredo Volpi, Chico Mendes and Carmo) in the city of São Paulo, Brazil from 2011 to 2013. Mosquitoes were collected with portable, battery-powered aspirators and

CDC CO2-baited light traps. DNAs were extracted using the DNEasy Blood and Tissue Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. PCR reactions, visualization of fragments, dilution of PCR products, sequencing and fragment analysis were carried out as in Multini et al. (2015). The modified dendrogram displaying the Cavalli-Sforza and Edwards chord distance was constructed using Statistica 7.0 (StatSoft, 2004) by Multini et al. (2016). AMOVA was calculated using the software Arlequin (v3.5) (Excoffier et al., 2005). The amplified alleles were subjected to Bayesian model-based clustering analysis using Structure (v2.3.3) (Pritchard et al., 2007).

RESULTS AND DISCUSSION The dendrogram displaying the Cavalli-Sforza and Edwards genetic distance in Figure 1, clearly showed the studied populations separated in 2 main clusters, one comprising the populations Burle Marx, Chico Mendes, Previdência, Shangrilá, Carmo, Santo Dias and Alfredo Volpi (Group 1) and the other comprising the populations Ibirapuera and Piqueri (Group 2), indicating some degree of differentiation between groups.

Figure 1. Genetic-distance dendrogram for Aedes fluviatilis, modified from Multini et al. (2016).

The AMOVA results showed that differences within population account for 98% of the genetic variation, meaning that variations within population were higher than between population. The Bayesian analysis displayed in Figure 2 showed that although the populations were partially segregated, the differences between them are subtle, indicating the presence of high levels of gene flow, which is probably responsible for the low genetic structure found in Ae. fluviatilis populations. The urbanization processes present in Brazil are characterized by rapid and unplanned growth of the cities, resulting in the lack of basic sanitation, unsanitary houses, polluted rivers and untreated sewage. These factors have been resulting in the increasing in abundance of mosquitoes’ species that are well adapted to man-made alteration. These features are acting as an obstacle in vector control strategies (Taipe-Lagos and Natal, 2003; Li et al., 2014). The main findings of this study suggest that Ae. fluviatilis populations are segregated in two main groups. Since Group 2 is composed by the two populations collected in the most pressed by urbanization areas, it may indicate how man-made alteration in the environments might be modulating Population Expansion And High Gene Flow In Aedes fluviatilis In Urban Areas 41

Ae. fluviatilispopulations.

Figure 2. Bayesian analysis of structure for the two groups of Aedes fluviatilis populations showing the subdivision of individuals k = 2. Each of the 270 individuals is represented by a vertical line divided into different colored segments. The length of each segment represents the probability of the individual belonging to the genetic cluster represented by that color.

It was previously found by Multini et al. (2016) that this culicid undergone a population expansion, a common trend among mosquito species that can thrive in urbanized environments (Michel, 2006; Mirabello and Conn, 2006). The population expansion hypothesis can be also corroborated by the low genetic structure and high gene flow found in the Bayesian analysis. Moreover, the AMOVA results indicate that the low genetic variation between population can be a result of a genetic homogenization of these populations (LaDeau et al., 2015).

CONCLUSION The structure patterns found for Ae. fluviatilis populations are probably correlated with the urbanization of the city of São Paulo, fitting the hypothesis that the transformation of rural areas into urbanized areas might be modulating Ae. fluviatilispopulation dynamics.

REFERENCES CITED Brown, J.E., C.S. McBride, P. Johnson, S. Ritchie, C. Paupy, H. Bossin, J. Lutomiah, I. Fernandez-Salas, A. Ponlawat, A.J. Cornel, W.C. Black, N. Gorrochotegui-Escalante, L. Urdaneta-Marquez, M. Sylla, M. Slotman, K.O. Murray, C. Walker, and J.R. Powell. 2011. Worldwide patterns of genetic differentiation imply multiple “domestications” of Aedes aegypti, a major vector of human diseases. Proc. Biol. Sci. 278: 2446–2454. Camargo, M.V.T., R.A.G.B. Cônsoli, P. Williams, and A.U. Krettli. 1983. Factors influencing the development of Plasmodium gallinaceum in Aedes fluviatilis. Mem. Inst. Oswaldo Cruz. 78. Carvalho, G.C., R.D.S. Malafronte, C. Miti Izumisawa, R. Souza Teixeira, L. Natal, and M.T. Marrelli. 2014. Blood meal sources of mosquitoes captured in municipal parks in São Paulo, Brazil. J. Vector Ecol. 39: 146–52. Ceretti-Júnior, W., A.R. Medeiros-Sousa, A.B.B. Wilke, R.C. Strobel, L.D. Orico, R.S. Teixeira, S. Marques, and M.T. Marrelli. 2015. Mosquito Faunal Survey In a Central Park of the City of São Paulo, Brazil. J. Am. Mosq. Control Assoc. 31: 172–176. Chaves, L.F. and C.J.M. Koenraadt. 2010. Climate change and highland malaria: fresh air for a hot debate. Q. Rev. Biol. 85: 27–55. Davis, C. and R. Shannon. 1931. Studies on yellow fever in South America: attempts to transmit the virus with certain Aedine and Sabethine mosquitoes and with Triatomas (Hemiptera). Am J Trop Med Hyg 11, 21–29. 42 L. C. Multini, A. B. B. Wilke, L. Suesdek, and M. T. Marrelli Population Expansion And High Gene Flow In Aedes fluviatilis In Urban Areas

Descloux, E., M. Mangeas, C.E. Menkes, M. Lengaigne, A. Leroy, T. Tehei, L. Guillaumot, M. Teurlai, A.C. Gourinat, J. Benzler, A. Pfannstiel, J.P. Grangeon, N. Degallier, and X. De Lamballerie. 2012. Climate-Based Models for Understanding and Forecasting Dengue Epidemics. PLoS Negl. Trop. Dis. 6: e1470. Edman J. 1988. Disease control through manipulation of vector-host interaction: some historical and evolutionary perspectives. In: Proceedings of a Symposium: The Role of vector-host interactions in disease transmission. 43-55. Excoffier, L., G. Laval, and S. Schneider. 2005. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. Online 1, 47–50. Fonseca, D.M., J.L. Smith, R.C. Wilkerson, and R.C. Fleischer. 2006. Pathways of expansion and multiple introductions illustrated by large genetic differentiation among worldwide populations of the southern house mosquito. Am. J. Trop. Med. Hyg. 74: 284–289. Forattini, O.P. 2002. Culicidologia Médica, Vol. 2: Identificação, Biologia, Epidemiologia. São Paulo: EDUSP Kasai, N. 1979. Susceptibilidade do mosquito Aedes fluviatilis (Lutz, 1904) à infecção por Dirofilaria immitis (Leidy, 1856). Belo Horizonte: Universidade Federal de Minas Gerais. LaDeau, S.L., B.F. Allan, P.T. Leisnham, and M.Z. Levy. 2015. The ecological foundations of transmission potential and vector-borne disease in urban landscapes. Funct. Ecol. 29: 889– 901. Li, Y., F. Kamara, G. Zhou, S. Puthiyakunnon, C. Li, Y. Liu, Y. Zhou, L. Yao, G. Yan, and X.G. Chen. 2014. Urbanization Increases Aedes albopictus Larval Habitats and Accelerates Mosquito Development and Survivorship. PLoS Negl. Trop. Dis. 8: e3301. Medeiros-Sousa, A.R., W. Ceretti, P.R. Urbinatti, G.C. de Carvalho, M.B. de Paula, A. Fernandes, M.O. Matos, L.D. Orico, A.B. Araujo, M.S. Nardi, and M.T. Marrelli. 2013. Mosquito fauna in municipal parks of São Paulo City, Brazil: a preliminary survey. J. Am. Mosq. Control Assoc. 29: 275–9. Michel, A.P. 2006. Divergence With Gene Flow in Anopheles funestus From the Savanna of Burkina Faso, West Africa. Genetics 173: 1389–1395. Mirabello, L. and J.E. Conn. 2006. Molecular population genetics of the malaria vector Anopheles darlingi in central and South America. Heredity. 97: 438–438. Multini, L.C., M.T. Marrelli, and A.B.B. Wilke. 2015. Microsatellite loci cross-species transferability in Aedes fluviatilis (Diptera:Culicidae): a cost-effective approach for population genetics studies. Parasit. Vectors 8: 635. Multini, L.C., A.B.B. Wilke, L. Suesdek, and M.T. Marrelli. 2016. Population Genetic Structure of Aedes fluviatilis (Diptera: Culicidae). PLoS One. 11: e0162328. Olanratmanee, P., P. Kittayapong, C. Chansang, A. Hoffmann, A.R. Weeks, and N.M. Endersby. 2013. Population Genetic Structure of Aedes (Stegomyia) aegypti (L.) at a Micro- Spatial Scale in Thailand: Implications for a Dengue Suppression Strategy. PLoS Negl. Trop. Dis. 7(1): e1913. Piccinali, R.V. and R.E. Gürtler. 2015. Fine-scale genetic structure of Triatoma infestans in the Argentine Chaco. Infect. Genet. Evol. 34: 143–152. Pritchard, J.K., M. Stephens, and P. Donnelly. 2007. Inference of population structure using multilocus genotype data: dominant markers and null alleles. Mol. Ecol. Notes 7: 574–578. StatSoft, I. 2004. STATISTICA (data analysis software system), version 7. Population Expansion And High Gene Flow In Aedes fluviatilis In Urban Areas 43

Taipe-Lagos, C.B. and D. Natal. 2003. Culicidae mosquito abundance in a preserved metropolitan area and its epidemiological implications. Rev. Saude Publica 37: 275–279. Vezzani, D., D.F. Eiras, and C. Wisnivesky. 2006. Dirofilariasis in Argentina: Historical review and first report of Dirofilaria immitis in a natural mosquito population. Vet. Parasitol. 136: 259– 273. Wilke, A., P. Vidal, L. Suesdek, and M.T. Marrelli. 2014. Population genetics of neotropical Culex quinquefasciatus (Diptera: Culicidae). Parasit. Vectors 7: 468. WRBU, 2015. Systematic Catalog of Culicidae, Washington. http://www.mosquitocatalog.org/taxon_descr.aspx?ID=16082 (Oct. 11, 2015). 45

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

INCREASE IN ENVIRONMENTAL LIGHT CONDITIONS BOOSTS MASSIVE FLIGHTS OF AQUATIC INSECTS

1KIMIO HIRABAYASHI, AND 2HIKARU ZUKERAN 1Applied Ecology, Institute of Textile Science and Technology, Academic Assembly, Shinshu University, Ueda, Nagano Prefecture, 386-8567, Japan 2Applied Biology, Graduate School of Science and Technology, Shinshu University, Ueda, Nagano Prefecture, 386-8567, Japan

Abstract In the middle of June, 2010, we received the following requests from the manager of a bookstore along an irrigation canal which drew water from the Chikuma River. “During the night, massive flights of aquatic insects are attracted to the lights of my shop.” The abundance of aquatic insects was monitored by a daily catch using two light traps equipped with a black light of 6W (BL lamp) and a fluorescent lamp of 6W (FL lamp) set up near the entrance of the shop, from the end of June to the beginning of July 2010 and 2011. As a result, more than 12,000 individual aquatic insects were collected by the two light traps during the investigation periods in 2010. The most abundant taxa were Trichoptera (about 50% of the overall number) followed by Chironomidae, Tipulidae, and Ephemeroptera. The same number of Trichoptera were captured by the BL and FL lamps. However, more Chironomidae and Tipulidae were captured by the BL lamp. In addition, 3 times as many Ephemeroptera were captured by FL lamp compared to BL lamp. In April, 2011, a large shopping center opened on the other side of the bookstore. After its opening, the environmental light condition greatly changed around the investigation place. As a result, the number of aquatic insects attracted to the bookstore observed a very large change in 2011. The number of aquatic insects / 9 day increased compared with 2010, especially, due to the BL lamp. In 2011, the most captured insect was Chironomidae in the bookstore, and the individual number was 12.8 times that of 2010 by BL lamp, against 1.1 times by FL lamp. The captured number of Ephemeroptera also increased to 18 times that of 2010 by BL lamp, against decreased to 0.6 times by FL lamp. As mentioned above, if the number of aquatic insects emerging from the canal was the same in 2010 and 2011, 74.6% of the aquatic insects attracted to the bookstore in 2010 moved to the new shopping center.

Key words Chironomid midges, light attraction, light quantity, , nuisance insect, Trichoptera

INTRODUCTION Aquatic insects include a number of species whose larvae live in almost all types of water bodies (reviewed by Ward, 1992). They are often dominant in mesotrophic / eutrophic urban river/ stream/canal ecosystems, and massive emergence of adults sometimes is a serious nuisance, as well as creating economic problems for people living near water bodies (Tabaru et al., 1987; Ali, 1995; Kondo et al., 2001; Sekine et al., 2013). Furthermore, in recent years many researchers have found that aquatic insect-related particles / hair (e.g., microtrichia) are among the important allergens, especially chironomidae and Trichoptera and so on, taking the form of an inhalant antigen which causes asthma and other respiratory problems (Cranston, 1995). According to Hienton (1974), many nocturnal insects, including almost all adult aquatic insects, showed peak responses to radiant energy in both the near ultraviolet and visible regions of the electromagnetic spectrum, but these responses varied with the energy levels of the sources. Ali et al. (1984, 1986) reported that some chironomid species were generally most attracted by highest-intensity lamps and least by low-intensity lamps. 46 K. Hirabayashi, and H. Zukeran

These chironomid species responded more to the power or intensity than to the color or wavelength of the visible area of the electromagnetic spectrum. In mid-June of 2010, we received the following requests from the manager of a bookstore along an irrigation canal which drew water from the Chikuma River. “During the night, massive flights of aquatic insects are attracted to the lights of my shop. Many books are polluted by them. Please take measures immediately.” In April, 2011, a large shopping center opened on the other side of the bookstore. After its opening, the environmental light condition greatly changed around the investigation place. Light quantity increased. In the present study, we examined the effects of the increase in light conditions on the number of flight insects and taxa composition of the adult aquatic insect population in this area. The aquatic insects were monitored by a daily catch using two light traps equipped with a black light of 6W (BL lamp; control) and a fluorescent lamp of 6W (FL lamp) set up near the entrance of the shop, from the end of June to the beginning of July 2010 (before opening shopping center) and 2011 (after opening). It was expected that the number of aquatic insects attracted by FL lamp was effected by the light intensity of the shopping center.

MATERIALS AND METHODS Study Site The investigation was performed in the bookstore 20-car parking lot along Masuami-yohsuiro canal (about 15 m between the bookstore and canal) in Ueda City, Nagano Prefecture, Central Japan (Figure 1 A). The water of Masuami-yohsuiro canal (same water quality as the Chikuma River COD = 3.5- 4.1 mg/l; Ueda City, 1999) branch and was used as the agricultural water for the paddy region of the south-west part of Ueda City (Figure 1 B). The bookstore located at 600 m west of the Japan Railway Ueda Station (JR Ueda Station) was open 24 hours. On the other side of the bookstore, a railway and Shinkansen tracks run parallel to the canal (ca. 20-30 m). The canal water flow by culvert runs partly between JR Ueda Station and this bookstore parking lot, and an open canal downstream of the parking lot. The canal width was about 3 m and the depth about 5 m. During the investigation the water level was 20-30 cm. Hirabayashi et al. (2016) reported that almost all aquatic insects attracted to the bookstore emerged from the canal in 2010.

Figure 1. Map of the studied area of Ueda City, Japan (A), summary and surroundings of sampling station (B). K. Hirabayashi, and H. Zukeran Increase In Environmental Light Conditions Boosts Massive Flights Of Aquatic Insects 47

Figure 2. Light trap setting locations at bookstore area (A) and layout of Masuami-yohsuiro canal (B).

During the investigation period, in April, 2011, a large shopping center (ca. 20,000m2 area including an extremely well-lit thousand-car parking lot) opened on the other side of the bookstore, making a great change in environmental light conditions around the investigation site.

Collection of Aquatic Insects in 2010 and 2011 The abundance of aquatic insects was monitored by daily catches using two light traps with a suction mechanism (Nozawa NH-5 type, Tokyo As Corporation, Tokyo, Japan) equipped with a 6-W black- fluorescent lamp (BL lamp, peaks at ca. 345-355 nm; control) and 6-W white-fluorescent lamp (FL lamp, peaks at ca. 450 and 550 nm) set up in the parking lot along the Masuami-yohsuiro canal of the bookstore in Ueda City, Nagano Prefecture, Central Japan, from 29 June to 7 July (9 days) in 2010, and from 24 June to 2 July (9 days) in 2011. Each trap was hung from a pole 1.5 m above ground level. At positions 1 and 2 traps with two different lamps were set and rotated by changing location. Traps 1 to 2 were located about 5 m apart, and the distance from the canal to each trap was about 15 m, respectively (Figure 2 A). The width of the canal was ca. 3 m, depth was ca. 5 m, and water depth was ca. 10 to 20 cm (Figure 2 B). To attract adult aquatic insects emerging from the canal, the traps were activated about 4 p.m. (half an hour before sunset) and the insects trapped in the field were left until the next morning. Insects that had entered the cage were killed with insecticide spray every morning at about 8 a.m. After being stored away from the terrestrial insects, the aquatic insects (the numbers of chironomid midges (Chironomidae: Diptera), crane flies (Tipuridae: Diptera), caddis flies (Trichoptera), and (Ephemeroptera)) were counted separately in each taxa in the laboratory. Environmental data, i.e., daily mean air temperature and daily precipitation and daily mean water temperature from the Ministry of Land, Infrastructure and Transport, Hokuriku Regional Development Bureau, the Ueda Meteorological Observatory Station, and Nagano Prefecture were used during the investigation periods.

RESULTS AND DISCUSSION Temporal changes in physical environmental conditions in 2010 and 2011 Figure 3 shows the records of daily mean water temperatures and the daily mean air temperature and daily precipitations during the study in 2010 and 2011.The daily mean water temperature and daily mean air temperatures showed almost the same pattern during the two years. The daily mean water temperatures were 18.2° C (July 5) and 24.6° C (July 2) in 2010 and 19.9° C (June 26) and 22.8° C (June 29) in 2011, averaging 20.7±2.1°C in 2010, and 21.3±1.1°C in 2011. There was significant difference both years (U=16, Z=2.17, P=0.030<0.05 in Mann-Whitney U test). The daily mean air temperatures were 22° C (July 2) and 24.1°C (June 30 and July 5) in 2010, and 22.2° C (June 25) and 27.2° C (June 28) in 2011, averaging 23.4±0.7°C in 2010, and 25.1±1.6° C in 2011. There was no significant difference both years (U=33, Z=0.66, P=0.508>0.05 in Mann-Whitney U test). However, the daily precipitations showed a different pattern, i.e., 29.5 mm (max. July 2) in 2010 and 4.5 mm (max. July 2) in 2011, averaging 9.0±9.4 mm in 2010, and 1.1±1.7 mm in 2011. There was a significant difference both years U( =18, Z=2.03, P=0.043<0.05 in Mann-Whitney U test). 48 K. Hirabayashi, and H. Zukeran

Figure 3. Environmental factors, daily mean air temperature, daily mean water temperature, and precipitation during the investigation periods in 2010 and 2011.

Figure 4. Attraction of each taxa of the total number of adult aquatic insects by two different light source traps, BL lamp (upper) and FL lamp (lower) during the investigation periods.

Abundance of adult aquatic insects collected with two light traps Most of the studies on attraction of light have been conducted on nocturnal insects (reciewed by Glick and Hollingsworth, 1954; Hienton, 1974). Moreover, there have been several studies on phototaxis of harmful insects of agricultural and economical importance. Hirabayashi et al. (1993) and Ali et al. (1984, 1986) reported that light intensity was an important factor in attracting chironomid midges than the wavelength of visible light. Waringer (1989) reported that the adult caddisflies (Trichoptera) were strongly attracted to light. Hirabayashi et al. (2011) and Kimura et al. (2008) also reported that many adult caddisflies were attracted to the vending machine equipped with fluorescent lamps on the river bank. Figure 4 shows the attraction of each taxa of the total number of adult aquatic insects by two different light source traps, BL lamp; control (upper) and FL lamp (lower) during the investigation periods. The number and fauna of aquatic insects attracted to the bookstore evidenced a very great change in 2011. The mean number of aquatic insects/day increased 2 – 15 times compared with 2010, especially, due to the BL lamp. Focused on BL lamp, the total number of aquatic insects collected was 28,480/9 days in 2011 and 6,345/9 days in 2010 (Table 1). In 2011, the most captured insect was Chironomidae (63.3%) at the bookstore, and the individual number was ca 12.8 times that of 2010. The captured number of Trichoptera also increased to 1.8 times that of 2010. As mentioned above, K. Hirabayashi, and H. Zukeran Increase In Environmental Light Conditions Boosts Massive Flights Of Aquatic Insects 49

if the number of aquatic insects emerging from the canal was the same in 2010 and 2011, around 4.5 (28,480/6,453 total number per 9 days) times the number of aquatic insects attracted to the bookstore in 2010 moved from the other habitats (except for the canal, and probably from the Chikuma River) by the large shopping center.

Figure 5 shows the attraction of the total number of adult aquatic insects in two different light conditions in 2010 (before opening shopping center; upper) and in 2011 (after opening; lower). Focused on FL lamp, we collected 6,343 aquatic insects in 2010. Trichoptera was the dominant taxa (58.1% of the total aquatic insects), followed by Chironomidae (17.2%) and Ephemeroptera (2.9%) in 2010. We also collected 7,226 aquatic insects by FL lamp in 2011. During the investigation period, Chironomidae was the dominant taxa (81.6% of the total aquatic insects), followed by Trichoptera (9.7%) and Tipulidae (5.3%) in 2011. Figure 5. Attraction of adult aquatic insects in two different light conditions in 2010 (before opening shopping center; upper) and in 2011 (after opening, lower).

Before the shopping center opened (in 2010), both lamps collected the same number of adult aquatic insects. However, after opening, the BL lamp collected 4 times as many adult aquatic insects as the FL lamp one. In all the taxa, the BL lamp collected more than the FL lamp. 9.7 times the Trichoptera followed by 8.8 times the Ephemeroptera, 3.8 times the Tipulidae and 3 times the Chironomidae, respectively. Before the shopping center opening, since the BL lamp collected as many adult aquatic insects as the FL lamp, probably the difference between the FL lamp and BL lamp might have been attracted by the strong light intensity of the shopping center opened thereafter in 2011. We estimated that value as follows (see Table 1), multiply the ratio (5) (number of aquatic insects attracted by FL (1)/number of aquatic insects attracted by BL (2)) in 2010 by BL in 2011 (4); this values means that estimation of the number of aquatic insects attracted by FL lamp in 2011 (if the shopping center was not open in 2011) (6), and (6) – number of aquatic insects attracted by FL in 2011 (3) = adult aquatic insects which attracted to the shopping center in 2011 (7). For example, we estimate the total number of adult aquatic insects attracted by the shopping center. The number of aquatic insects attracted by BL lamp in 2010 was 6,345, against 6,343 by FL lamp in 2010; in 2011, the BL lamp attracted 28,480, while the FL lamp attracted 7,226. The equation is as follows, (6,343/6,345) x 28,480 – 7,226 = 21,254 individual number/9 days. As mentioned above, if the number of aquatic insects emerging from the canal was the same in 2010 and 2011, 74.6% (21,245/28,471 total number per 9 days) of the aquatic insects attracted to the bookstore in 2010 moved to the new shopping center. 50 K. Hirabayashi, and H. Zukeran

Table 1. Summary of aquatic insect collection by two different light sources (FL lamp and BL lamp) in 2010 and 2011.

Moreover, the taxa most attracted to the shopping center might be Chironomidae (8,044 individual number/9 days; possibly 42.1% of the total number attracted), followed by Trichoptera (6,189, 32.4%), and Ephemeroptera (3,041, 15.9%), respectively. In conclusion, it was revealed that the reaction to strong light intensity varied with each taxa of adult aquatic insects. It was suggested that Chironomidae and Trichoptera were attracted by strong light intensity. The present findings are in agreement with those of Heinton (1974) and Hirabayashi et al. (1983). These findings were very important to prevent the massive flight of aquatic insects, especially adult chironomid midges and adult caddisflies, around the river area.

ACKNOWLEDGEMENTS We wish to express our thanks to the members of the Department of Applied Ecology, Shinshu University (Messrs. T. Mushya, A. Nishimura and M. Takeda) and colleagues for their assistance and generous support during the field survey. Part of the present study was supported by the research grant of river foundation in Japan (Kasen-Zaidan).

REFERENCES CITED Ali, A. 1995. Nuisance, economic impact and possibilities for control. In: Armitage, P.D., Cranston, P.S., Pinder, L.C.V. (eds.) The Chironomidae: biology and ecology of non-biting midges. London: Chapman & Hall. 339-364. Ali, A., S.R Stafford, R.C. Fowler, and B.H. Stanley. 1984. Attraction of adult Chironomidae (Diptera) to incandescent light under laboratory conditions. Environ. Entomol. 13: 1004-1009. Ali, A., B.H. Stanley, and P.K. Chaudhuri. 1986. Attraction of some adult midges (Diptera Chironomidae) of Florida to artificial light in the field. Florida Entomol. 69: 644-650. Cranston, P.S. 1995. Medical significance.In : Armitage, P.D., Cranston, P.S., Pinder, L.C.V. (eds.) The Chironomidae: biology and ecology of non-biting midges. London: Chapman & Hall. 365-384. K. Hirabayashi, and H. Zukeran Increase In Environmental Light Conditions Boosts Massive Flights Of Aquatic Insects 51

Glick, P.A. and J.P. Hollingsworth. 1954. Response of the pink bollworm moth to certain ultraviolet and visible radiation. J. Econ. Entomol. 47:81-86. Hienton, T.E. 1974. Summary of investigation of electric insect traps. In: Hienton, T.E. (ed.) Agric. Res. Serv. Tech. Bull. Washington, D.C: U.S. Dept. of Agriculture. 136 pp Hirabayashi, K., M. Higashino, Y. Taniguchi, and M. Yamamoto. 2016. Field research on phototaxis of aquatic insects from a small canal by light emitting diode and fluorescent lamps. –focus on response of adult chironomid midges. Jpn. J. Environ. Entomol. Zool. 27:43-52. Hirabayashi, K., G. Kimura, and E. Inoue. 2011. Adult caddisflies (Trichoptera) attracted to artificial lights in the middle reaches of the Shinano River from 2005 to 2007. Zoosymposia 5: 143-146. Hirabayashi, K., R. Nakazato, A. Ohara, and T. Okino. 1993. A study on phototaxis for adult Chironomidae (Diptera) by artificial light in Lake Suwa: Response of adult chironomid midges to near ultraviolet and visible light. Jpn. J. Sanit. Zool. 44: 33-39. Kimura, G., E. Inoue, and K. Hirabayashi. 2008. Seasonal abundance of adult caddisfly (Tricoptera) in the middle reaches of the Shinano River in Central Japan. In: William, H. Robinson and Vajomi, D. (eds.) Proceedings of the Sixth International Conference on Urban Pests. OOK- Press Kft, 259-266. Kondo, S., K. Hirabayashi, T. Iwakuma, and R. Ueno, R. (eds). 2001. World of Chironomidae. Baifukan, Tokyo, Japan, 306 pp Sekine, K., M. Sueyoshi, and K. Tojo. 2013. Current distribution of the polymitarcyid mayfly Ephoron shigae in the Chikuma-gawa River. Jpn. J. Limnol. 74: 73-84. Tabaru, Y., K. Moriya, and A. Ali. 1987. Nuisance midges (Diptera: Chironomidae) and their control in Japan. J. Am. Mosq. Cont. Assoc. 3: 45–48. Ueda City. 1999. Climate, rivers and lakes in Ueda City. In: History of Ueda, Ueda City, Japan. 250 pp Waringer, J.A. 1989. The abundance and temporal distribution of caddisflies (Insecta:Trichoptera) caught by light traps on the Austrian Danube from 1986 to 1987. Freshw. Biol. 21:387-399. Ward, J.V. 1992. Aquatic insect ecology. 1. Biology and habitat. John Wiley & Sons, Inc., New York, NY, USA. 438 pp 53

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

HOUSEFLIES: REGULATIONS AND UNINTENDED CONSEQUENCES

CLIVE BOASE The Pest Management Consultancy, Haverhill, Suffolk, CB9 9AF, UK

Abstract In the United Kingdom (UK), legislation is sometimes used to prevent pest problems or to facilitate pest management. However in recent years, the two pieces of legislation that have had the most significant impact on common housefly, Musca domestica, infestations across the UK, were not intended to address fly problems at all. Formerly, most household waste in the UK was tipped in landfill sites. However in order to reduce the loss of potentially useful recyclable materials, a Landfill Tax was introduced in 1996, which placed a charge on all waste going to landfill. Alternative processes and products such as In-Vessel Composting, Mechanical and Biological Treatment, and Refuse Derived Fuel were developed, and were very successful in reducing the volume of waste going to landfill. However several of these new process have been found to be vulnerable to housefly infestations. There have been numbers of cases of fly nuisance to neighbouring properties, and the pest management and waste industries have been working hard to identify solutions. Separately, most poultry eggs were formerly produced by hens kept in small battery cages in deep pit units. These units were vulnerable to infestation, and often generated housefly populations that caused problems for neighbours. The European Welfare of Laying Hens Directive came into force in January 2012, and was intended to improve caged birds’ welfare by requiring hens to be kept in larger cages. The design of the manure removal system associated with these new cages resulted in common housefly populations almost disappearing from caged layer units, a cessation of fly nuisance cases, and a dramatic drop in insecticide usage. The unintended impacts of these two regulations have had a dramatic impact on UK fly populations, both positive and negative. These two examples emphasise the importance of proper scrutiny of new legislation by pest management professionals, in order to avoid unintended consequences. They also illustrate the possibility of creating pest management legislation that works in conjunction with industry on a national scale, to remove conditions conducive to urban pests.

Key words Poultry, waste, refuse, compost, recycling, Musca, Fannia.

INTRODUCTION The housefly (Musca domestica, L.) occurs in temperate and tropical regions throughout the world. Larvae develop preferentially in animal manures or putrescible wastes, so they are usually closely associated with human activity. The adult flies’ powers of dispersion, their preference for the indoor environment, their ability to cause a nuisance to residents, and their role as mechanical vectors of human pathogens, make them one of the most important urban insects (Hogsette and Amendt, 2008). Control of houseflies on a local level often relies on use of insecticides (Chapman and Morgan, 1992) or biological controls (Geden and Axtell, 1988). The flies’ dependence on well-defined and often localised larval habitat also makes them sensitive to changes in habitat availability or suitability. Habitat manipulation is a commonly-used approach to the control of these insects in both the waste management (Toyama, 1988) and poultry husbandry (Armitage, 1985) sectors, and has the advantage of sidestepping the important issue of insecticide resistance (Pospischil et al. 1996, Zhu Fang et al. 2016). Legislation has also been created in the UK to deal with problems with insects such as houseflies. For example, 54 Clive Boase the Clean Neighbourhoods and Environment Act 2005 (UK Government, 2005) gave powers to local authorities to take action against ‘insects emanating from…business premises’. Useful though all these interventions have been, their impact on housefly problems as a whole has essentially been local and incremental. Nonetheless, in recent years, there has been a widespread change in the nature of fly problems in the UK, arising not from any planned intervention, but from the unintended impacts of other legislation that was not intended to address fly problems at all. This paper reviews these unintended impacts, and discusses what the pest management industry can learn from them.

HOUSEFLIES, WASTE AND REGULATIONS Landfill sites are designated areas for tipping and disposal of waste, and are often located in former mineral extraction works. Prior to 1996, around 50 million tonnes/year of mixed household waste was disposed of in landfill sites in the UK. Once tipped, the waste is usually compacted in order to reduce its volume, and then covered with a layer of inert material. This process stabilises the surface, reduces fly emergence, and makes the waste less attractive to other pests. Nonetheless landfill sites are still prone to problems with houseflies, especially if the cover is not well applied (Boase, 1999), so insecticides are often applied in warmer weather. However, because landfill sites are often sited away from urban areas, the impact of infestation at most sites is usually (but not always) relatively low. There were numbers of concerns about this reliance on landfill sites; for example the loss of potentially useful recyclable materials such as metals, plastics or timber, the subsequent generation of ozone-depleting methane within landfill sites, and the lack of space for the numbers of landfill sites required to take the nation’s waste. In 1996 the UK Landfill Tax (UK Government, 2017) was introduced, in order to ensure compliance with the forthcoming European Landfill Directive 1999/31/EC. It placed a charge on every tonne of waste deposited at landfill sites. As intended, the tax reduced the volume of waste going to landfill (Figure 1), and stimulated the development of a wide range of alternative waste processing, recycling and energy generation systems (Figure 2). However, several of these processes have been found to be vulnerable to housefly infestation, and a selection is briefly discussed below.

Figure 1. UK biodegradable landfill inputs 1998 – 2015.

At the core of the waste processing industry are now Mechanical and Biological Treatment facilities (MBT). At these sites recyclables are extracted from mixed household waste, and the residual Clive Boase Houseflies: Regulations and Unintended Consequences 55

waste is then composted within a building for 2 – 6 weeks. During the composting process, the waste spontaneously heats up to a temperature of c. 50oC, which results in its moisture content being reduced from c. 50% to 20%, which increases its value as fuel. However, the warm waste is highly attractive to flies, and very serious fly infestations can develop during composting (Suss et al., 1999). Significant quantities of space-spray, bait and larvicide are used in controlling the flies in MBT sites. There are resistance management concerns about this level of insecticide usage (Zhu Fang et al, 2016), and alternative more sustainable techniques are being sought. After composting, the dried waste is known as Refuse Derived Fuel (RDF). It is typically compressed into bales weighing around one tonne each, and then tightly wrapped in polythene film. Most of this waste is exported from the UK for use in power generation facilities overseas, e.g. in Scandinavia. The bales are stockpiled on dockside areas for up to several months, until a full shipload (several thousand bales) is ready for export. If the wrapping remains intact then the atmosphere within the waste is rapidly depleted of oxygen by the decomposition process (Ozbay and Durmusoglu, 2012) and fly larvae appear unable to develop within it. However, if the wrapping is damaged, then there is ingress of oxygen, and fly larvae can then develop within the exposed waste. There have been numbers of cases in the UK where severe housefly problems have been caused by storage of RDF bales. The recyclables extracted from the household waste have a value, and so are also stockpiled to await sale, transport and reprocessing. For example, aluminium drinks cans and plastic food packaging are baled and may be stored for several months until a load has been stockpiled, or until the market price changes to make the shipment viable. However, the food residue within the containers is able to support fly development, and at some sites large infestations of houseflies, fruit flies (Drosophilidae) and scuttle flies (Phoridae), have developed in such bales. There are also issues with the location of new waste processing and storage sites. Modern waste sites are often located in urban industrial zones, with other businesses or even residential areas nearby. Fly problems developing in these modern waste management sites often have a much greater impact on neighbours, than the more remote landfill sites. 56 Clive Boase

Figure 2. Impact of UK Landfill Tax on waste processing pathways.

Finally, by placing a charge on the disposal of waste, the Regulations also created an incentive to dispose of waste illegally, and so escape the charge. In the UK, there are frequent reports of cases where waste has been dumped illegally, and caused major housefly problems.

In summary, the UK Landfill Tax was successful in reducing the volume of waste going to landfill, and in stimulating a waste recycling industry. However it unexpectedly created a range of new fly problems on which the waste and pest management industries, and regulators, are still working. The diversion of waste from isolated out-of-town landfill sites to urban industrial zones, has accentuated the impact of these new fly problems. Clive Boase Houseflies: Regulations and Unintended Consequences 57

HOUSEFLIES, POULTRY AND REGULATIONS

Figure 3. Impact of Welfare of Laying Hens Directive on housefly problems.

The second sector where recent legislation has had a very significant impact on housefly problems, is in poultry laying farms. In the late 20th century, the majority of laying poultry were housed in intensive caged units, otherwise known as battery cages. In this regime rows of small cages were stacked several tiers high, with individual poultry houses housing up to 100,000 hens or more. The houses were known as deep-pit units, with the manure accumulating in the base of house for the duration of the flock, typically about 13 months, before being removed. The temperature within the house usually remained above 18oC throughout the year so flies, especially the common housefly, colonised the manure in large numbers and at times dispersed to cause problems for neighbours. The fly problems associated with this method of production have been widely reported in the scientific literature, eg. Winpisinger (2005). Although poultry farms are essentially a rural business, the fly problems arising were urban in nature. However there were also concerns about the welfare of birds kept in small cages. In 1999, EU 1999/74/ EC, the Welfare of Laying Hens Directive (European Union, 1999), was passed. This required that by 1 January 2012, laying birds could no longer be kept in small intensive cages. Instead, farmers that wanted to continue with caged laying poultry, had to convert to larger ‘enriched colony cages’. In this system, the birds’ manure typically fell onto a belt on which it was dried, and was then removed from the poultry house and deposited in a purpose-built manure store. Faced with implementing this new Regulation, farmers had two main options:

One option was to strip out all the old cages and install the larger colony cages. Those farmers who converted to the new colony cages found that an unintended outcome of complying with the Regulation, was an immediate and substantial improvement in the fly situation. The rapid drying and removal of the manure from the house prevented fly breeding, and removed the need for insecticide treatments. The usage of baits, sprays and larvicides fell dramatically, and fly nuisance cases involving such farms more or less ceased. The impact of this sudden change was felt not only by the farmers and their neighbours, but also by insecticide suppliers and manufacturers. Alternatively, other farmers chose instead to convert their poultry houses to less intensive free- range laying units. This system allows the birds to forage outdoors in a paddock, with their feed, water and laying boxes remaining indoors. Being less intensive, the temperature within free-range laying houses is lower than within the former intensive caged layers. This cooler environment is less suitable for the common housefly, but much more suitable for the lesser 58 Clive Boase

housefly (Fannia canicularis, L.). In units where the manure remains within the free-range poultry house, farmers are now having to deal with sometimes serious infestations of lesser housefly, and the associated dispersion and nuisance issues (Tabaru, 1993). Lesser houseflies do not respond so well to insecticide fly baits, or even to larvicides (Tabaru and Kobayashi, 1991), so farmers are finding that control of this species is more challenging.

In summary, the introduction of the Welfare of Laying Hens Directive was intended to improve birds’ welfare. In doing so it also had a very significant impact on the nature of fly problems associated with poultry in the UK (Figure 3). For those farmers that converted to the new approved colony cages, problems with common housefly virtually disappeared. However for farmers who instead converted to free range laying units, the common housefly has been replaced by the lesser housefly, which is proving very challenging to control. These changes have had a major effect not only on farmers, but also on the farms’ neighbours, and insecticide suppliers and manufacturers.

CONCLUSIONS In different ways, these two examples highlight the dramatic yet unintended impacts that changes to legislation can have on urban pests. The pest management industry, together with the poultry and waste industries themselves, are still working to develop the means to mitigate the impact of these unintended changes. Looking ahead, there are several different ways that the pest management industry can respond to this understanding of the interrelationship between legislation and urban pests:

The industry can passively observe and record, as this paper does, the impact of legislative changes on urban pests. However, although this may be a passive role initially, hopefully the identification, analysis and reporting of these impacts may guide and inform any subsequent changes in regulations. Alternatively, the pest management industry can take a more pro-active stance in the vetting of draft regulations. Our industry should be more involved in consultation around policy-making, in order to identify and avoid unintended and negative consequences of new legislation. Finally, pests that are largely restricted to and dependent on the urban environment, are potentially sensitive to changes that may affect their habitat, as has been shown in these two examples. This sensitivity opens up the potential for identifying and exploiting opportunities for manipulating the urban environment, in order to reduce pest numbers. In the interest of improving public health, we should consider ways in which legislation can be developed, not simply to facilitate action against individual infestations, but to drive changes across the urban environment that remove the conditions conducive to infestation.

The examples discussed here are specific to the UK. However, the concept of understanding the relationship between legislation and urban pests, and seeking ways to manipulate that relationship positively, are believed to be applicable internationally.

REFERENCES CITED Armitage, D.M. 1985. Environment of deep pit poultry houses: changes in manure moisture with air movement. Brit. Poultry Sci. 26: 281-285. Boase, C. 1999. Trends In Urban Refuse Disposal: A Pest’s Perspective. In. Robinson, W.H., Rettich, F., Rambo, G.W. (eds.). Proc. 3rd Int. Conf. on Urban Pests. Prague, July 1999. 83-98. European Union. 1999. Welfare of Laying Hens Directive 1999/74/EC. http://eur-lex.europa.eu/legal- content/EN/TXT/?qid=1435151498494&uri=CELEX:31999L0074 (31 Jan. 2017). Chapman, P.A. and C.P. Morgan. 1992. Insecticide resistance in Musca domestica L. from Eastern England. Pesticide Sci. 36: 35-45. Clive Boase Houseflies: Regulations and Unintended Consequences 59

Geden, C.J. and R.C. Axtell. 1988. by pumilio (Coleoptera: ) and Macrocheles muscaedomesticae (Acarina: Macrochelidae) on the housefly (Diptera: Muscidae): functional response, effects of temperature, and availability of alternative prey. Environ. Entomol. 17(4): 739-744. Hogsette, J.R. and J. Amendt. 2008. Flies. In: Bonnefoy, X., Kampen, H., and Sweeney, K. eds., Public health significance of urban pests, World Health Organisation. Nurita, A. T., A. Abu Hassan. 2013. Filth flies associated with municipal solid waste and impact of delay in cover soil application on adult filth fly emergence in a sanitary landfill in Pulau Pinang, Malaysia. Bull. Ent. Res. 103(3): 296-302. Ozbay, I. and E. Durmusoglu. 2012. Temporal variation of decomposition gases from baled municipal solid wastes. Biores. Tech. 112: 105-110. Pospischil, R. K. Szomm, M. Londershausen, I. Schröder, A. Turberg, and R. Fuchs. 1996. Multiple resistance in the larger house fly Musca domestica in Germany. Pesticide Sci. 48(4): 333-341. Sûss, L., S. Cassani, B. Serra, and M. Caimi. 1999. Integrated Pest Management for Control of the House Fly Musca domestica (L.) (Diptera: Muscidae) in an Urban Solid Waste Treatment Plant. In. Robinson, W.H., Rettich, F., Rambo, G.W. (eds.) Proc. 3rd Int. Conf. on Urban Pests. Prague, July 1999. 261-267. Tabaru Y. and S. Kobayashi. 1991: Seikarsu to Kankyo, 36(8): 106-113. Tabaru, Y. 1993. Integrated Fly Management in Poultry Houses in Japan. Proc. 1st Int. Conf. on Insect Pests in the Urban Environment. Ed: Wildey & Robinson. 257-259. Toyama, G.M. 1988. A preliminary survey of fly breeding at sanitary landfills in Hawaii with an evaluation of landfill practices and their effect on fly breeding. Proc. Hawaiian Ent. Soc. 28: 49-56. United Kingdom Government. 2005. Clean Neighbourhoods and Environment Act. www.legislation. gov.uk/ukpga/2005/16/pdfs/ukpga_20050016_en.pdf (31 Jan 2017). United Kingdom Government. 2017. The Landfill Tax. https://www.gov.uk/green-taxes-and-reliefs/ landfill-tax (31 Jan. 2017) Winpisinger, K.A., A.K. Ferketich, R.L. Berry, and M.L. Moeschberger. 2005. Spread of Musca domestica (Diptera: Muscidae), from Two Caged Layer Facilities to Neighboring Residences in Rural Ohio. J. Med. Ent. 42(5):732-738. Zhu Fang, Lavine, L., S. O’Neal, M. Lavine, C. Foss, C. and D. Walsh. 2016. Insecticide resistance and management strategies in urban ecosystems. Insects 7(1): 2. 61

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

EFFICACY OF THERMAL REMEDIATION FOR BED BUG (HEMIPTERA: CIMICIDAE) CONTROL IN APARTMENTS OF DIFFERENT CLUTTER LEVELS

KATLYN A. CATRON, MOLLY S. WILSON, AND DINI M. MILLER Department of Entomology, Virginia Tech University, Blacksburg, Virginia, USA 24060 Abstract Whole-home thermal remediation for bed bug control was conducted in fourteen apartment units in Lynchburg, Virginia. Apartment units were divided into categories of low, medium, or high levels of clutter to determine if the time to bed bug lethal temperature (55oC), and treatment efficacy were influenced by household clutter level. For each apartment unit, clutter was quantified, and a clutter ratio was determined by dividing the volume of clutter by the volume of apartment space. The Temp-Air Thermal Remediation System was used for all treatments. In preparation for treatment, four heating units and 10 fans were placed in each apartment, and all furniture drawers and closet doors were opened. Remote temperature sensors were placed in hard-to-heat locations. Sentinel adult bed bugs, nymphs, and eggs were hidden next to sensors. Heaters and fans were turned on, and sensor temperatures were monitored from outside the unit every 15-30 minutes. The average times for sensors to reach the bed bug thermal death point was 2 hours 51 minutes (low clutter); 3 h 4 min (medium clutter); and 3 h 32 min (high clutter ). These times were not significantly different (P > 0.05). It was discovered that even with manipulation of the heaters, fans and belongings, certain locations (“cold spots”) never made it up to lethal temperature. In some of these locations, sentinel bed bugs were able to survive treatment. Overall, we concluded that clutter was not a major contributor to the time or efficacy of whole home thermal remediation. Instead the presence of “cold spots” was the greatest challenge to treatment success.

Key words Heat treatment, Cimex lectularius, cold spots

INTRODUCTION In the United States, the use of whole-home thermal remediation for bed bug (Cimex lectularius L.) control is on the rise. In 2015, the University of Kentucky bed bug survey reported that 40% of PMPs use thermal remediation in some form, and that number of PMPs using heat is increasing (Potter et al., 2015). Bed bugs and their eggs cannot survive temperatures above 48.3°C (118.94°F) and 54.8 °C (130.64°F), respectively (Kells and Goblirsch 2011). Thus, pest management professionals (PMP) can use large heat chambers, steam applications, or whole-home thermal remediation systems for bed bug control. According to Kells and Goblirsch (2011), whole-unit heat treatments are effective if ≥50 °C (instant thermal death point) is reached in all locations where bed bugs may be harboring, or if all locations reach 48°C as long as the heat is held at that temperature for 71.5 min (Kells and Goblirsch 2011). One of the pre-existing conditions that is known to hinder bed bug control in housing units is clutter. Household clutter (personal items, books, shoes, appliances furniture etc.) provides numerous location for bed bugs to hide, and increases the time it takes for the pest control technician to treat infested locations. Clutter makes bed bug treatment using chemical applications particularly time consuming. It is for this reason that many pest management companies require residents to prepare their apartments units prior to treatment. These pretreatment preparations often include moving furniture away from the walls, clearing out all closets and drawers, bagging up clothing and other personal belongings. 62 K. A. Catron, M. S. Wilson, and D. M. Miller Efficacy Of Thermal Remediation For Bed Bug Control

The purpose of this preparation is to get household items that cannot be treated with insecticide out of the way, allowing the technician to treat the unit faster. However, many residents are physically or mentally incapable of preparing their units for treatment. One of the distinct advantages of whole-home thermal remediation is that it requires little preparation, and allows items that cannot be treated with insecticides to be exposed to heat, killing the bed bugs on those items. Yet, many heat treatment technicians still require residents to do some preparation of their units. This is because most believe that clutter takes longer to heat, and allows bed bugs to find more hiding locations where they may be insulated from the heat treatment. While this argument sounds logical, the effect of clutter on whole-home thermal remediation has never been determined. Using one of the most widely marketed and efficacious thermal remediation systems (Temp-Air Inc., Burnsville, Minnesota; Kells and Goblirsch 2011), together with trained heat treatment technicians from Virginia Tech University, we attempted to quantify the specific effects that household clutter have on whole-home thermal remediation. Specifically, we quantified the time it took to reach the bed bug thermal death point in apartment units containing different levels of clutter, and used sentinel bed bugs to determine treatment efficacy.

MATERIALS AND METHODS This study was conducted in 14 separate apartment units (ranging from 37-61 m3 located in a four-story apartment building (Lynchburg, Virginia; June 2016). Units were selected for treatment because their residents had either complained of bed bug presence or had seen bed bugs in the previous 12 months. Some of the selected units had been previously treated (some multiple times) with conventional liquid insecticides by a commercial pest management company. Each apartment unit was unique in its size, layout, and contents. The area and volume of each unit was calculated after measuring the room sizes, ceiling heights, window casing and sill depths, and void spaces throughout the unit. The dimensions of all of the contents of each apartment (furniture, appliances, clothing, knick-knacks, housewares, books, DVDs, electronics, etc.) were also measured and the “clutter volume” was quantified (m3). The amount of clutter in the apartment units ranged from very light, to what would be considered hoarding levels. Whole-unit heat treatments were conducted in each apartment using the Temp-Air Heat Remediation System (Temp-Air Inc., Burnsville, Minnesota). This system included the use of four (7 KW) generator-powered heaters, 10 high-velocity fans, and a remote monitoring system with 22 wireless sensors. Prior to each unit’s heat treatment, heat sensitive belongings (living plants, candles, medications, etc.) were removed from the unit and inspected for bed bug evidence. All air vents, windows, and doors were lined with 5 mm plastic sheeting and sealed with heat-resistant tape. Smoke detectors and overhead sprinkler nozzles on the ceiling were covered with a polystyrene insulating box and secured with heat- resistant tape. Heaters and fans were placed so as to optimize the circulation of hot air throughout the unit. The wireless temperature sensors were placed in hard-to-heat locations within the furniture and clutter, and floor/wall junctions. Sensors were also placed at each heater to monitor temperature output. Nine replicates of sentinel bed bugs (3 replications each of ten adult male bed bugs; ten mixed instar nymphs; and at least ten 3-5 day-old bed bug eggs; contained in a nylon knee-high stocking) were placed alongside nine of the temperature sensors. The heat treatment protocol used in this study was that provided by the Temp-Air manufacturers. The heat treatments were performed using equipment placed and monitored by the trained Virginia Tech Housing technicians who use this system regularly. During the treatment, the technicians adjusted apartment contents and redirected heaters and the fans until all temperature sensors reached 48.9°C (per manufacturer’s instructions). When a treatment concluded, the treatment duration and sentinel bed bug (adult and nymph) mortality was recorded. Bed bug eggs were observed for hatch for five days after the heat treatment was concluded. Efficacy Of Thermal Remediation For Bed Bug Control 63

Data Analysis. The size (volume in m3) and the clutter volume (m3) of each apartment unit were used to calculate a clutter ratio. This ratio allowed us to compare treatment duration across units of different size and clutter levels. Using the clutter ratio, the 14 units were categorized by clutter level: 5 units were low; 4 units were medium; 5 units were high. The average time to for all sensors to reach bed bug lethal temperature in units of different clutter levels was analyzed using ANOVA. Values of P < 0.05 were used to indicate significance.

RESULTS AND DISCUSSION The calculated clutter ratios ranged from 0.07 (less than 10% of apartment volume) to 0.31 (over 30% of apartment volume). The five units had low (0.072 – 0.14) levels of clutter and 4 units (data from the 5th unit was lost) had medium (0.15 – 0.18) clutter ratios. None of these low to medium level clutter units looked exceptionally cluttered when inspected prior to treatment. The apartment units that had high clutter levels were easy to identify prior to taking the clutter measurements. In these units the clutter ratios were also much higher (0.20 - 0.31) than those in units ranked as low or medium.

After all heat treatments were completed, there was a trend indicating that the apartment units with the highest levels of clutter took longer to reach lethal temperature than those with lower levels of clutter. What was surprising was that the differences in average time to lethal temperature in units from all three clutter categories were not significantly different (df = 2;F= 1.9; P = 0.2; Figure 1). The average time it took for the majority of sensors to reach lethal temperature in a low clutter apartment unit was 2 hours 51 minutes. In units of medium clutter, the average time to reach lethal temperature was 3 hours 4 minutes. In apartments with high levels of clutter, the time to reach lethal temperature was 3 hours 32 minutes.

Figure 1. Time for most sensors to reach bed bug lethal temperature (mean ± SE) during whole-unit heat treatments in apartments of varying clutter levels.

The average time to reach bed bug lethal temperature was determined using the Temp-Air protocol coupled with the placement of 22 remote sensors per unit. While the majority of sensors placed in similar locations (in different units) reached temperature at relatively consistent times, sensors placed in certain locations took much longer to get to lethal temperature. We called these locations “cold spots”. In other words, sensors placed in near the heater output consistently took approximately one hour to reach ~55oC. Sensors placed between couch cushions took approximately one hour and 45 minutes (on average) to get to lethal temperature. As expected, sensors placed deep in a dresser drawer full of clothes took an average of 3 hours to reach lethal temperature. 64 K. A. Catron, M. S. Wilson, and D. M. Miller Efficacy Of Thermal Remediation For Bed Bug Control

However, some sensors placed in the open (exposed to ambient temperatures), at the floor wall junction on a slab floor, still took 3 hours and 11 minutes to reach bed bug lethal temperature. Sensors placed on the floor of the utility closet took 3 hours and 30 minutes to reach lethal temperature. The sensor locations that took the longest to reach lethal temperature were under piles of clothes. These locations included, under bagged clothes (left from a previous chemical treatment), or clothes piled on the floor, or clothes left in a laundry basket. Sensors under piles of clothes took approximately 4 hours to get to bed bug lethal temperature. Interestingly, the “cold spots” that were identified in this study were the same (with the exception of the utility closet), as those identified by Kells and Goblirsch (2011). As expected, mortality of the sentinel bed bugs was 100% in those locations that reached lethal temperature. However, some of the sentinels that had been placed in “cold spots” did have survivors. This was true even in some locations where the sensors had reached lethal temperatures. For example, when treating apartment unit 103 (bottom floor; high clutter category) the heat sensor output indicated that all sensors had reached bed bug lethal temperature. Thus, treatment was terminated. However, when the sentinel bed bugs were being collected, researchers observed the adult bed bugs placed in a corner of the kitchen floor (floor wall junction; slab-on-ground construction), near a freezer and under personal belongings, were still moving. The adjacent sensor read 49oC. When the live bed bugs were discovered, a fan and heater were moved and focused on this corner of the kitchen for 15 min (until all sentinels were dead). In addition to the live adults, we did have one bed bug egg hatch from unit 103. This group of eggs had been placed high on a living room closet shelf under many belongings. The sensor in this location reached only 48°C. In apartment unit 108 (0.18 clutter ratio; medium), a replication of eggs that had been placed on the floor of the hot water closet had 6 eggs hatch. At the time of treatment termination the sensor adjacent to this replication of eggs had read 49°C. Also in apartment 310 (0.13 clutter ratio; low), twelve eggs hatched in a replication that had been placed at the kitchen floor-wall junction, but in the corner behind a trash can, in between the cabinet and stove. At the time the treatment had been terminated the adjacent sensor had read 52°C for the previous 15 minutes.

CONCLUSIONS In this study we had the advantage of being able to use trained technicians (with no time constraints) to run one of the highest quality thermal remediation systems, and use 22 remote sensors to constantly monitor heat treatment temperatures throughout the apartment unit. These were optimal treatment conditions that are not the luxury of every technician in the field. We did not ask apartment residents to prepare their units in any way and therefore, we were able to isolate the effects of clutter on heat treatment duration and efficacy. Our results indicated that clutter was not the major contributing factor to heat treatment time and efficacy. Instead, “cold spots” were the single greatest challenge to thermal remediation. We concluded that even under the most optimal heat treatment conditions, these cold spots must be identified and monitored carefully or you run the risk of having bed bugs survivors, particularly those in the egg stage.

Efficacy Of Thermal Remediation For Bed Bug Control 65

REFERENCES CITED Kells, S.A. and M. J. Goblirsch. 2011. Temperature and time requirements for controlling bed bugs (Cimex lectularius (L.) under commercial heat treatment conditions. Insects. 2: 412-422. Potter, M.F., J. Fredericks, and M. Henriksen. 2016. 2015 Bugs without borders executive summary. National Pest Management Association, Fairfax, Virginia. http://www.pestworld.org/news-hub/pest-articles/2015-bugs-without-borders-executive- summary/ (Jan. 12th, 2016). 67

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

BED BUGS, HOTELS, AND TRAVELERS: ATTITUDES AND IMPLICATIONS

1MICHAEL F. POTTER, 2JERROD M. PENN, AND 2WUYANG HU

1Department of Entomology, S-225 Agricultural Science Center N. University of Kentucky, Lexington, KY 40546-0091, USA 2Department of Agricultural Economics, 400 Charles E. Barnhart Bldg., University of Kentucky, Lexington, KY 40546-0276

Abstract Bed bugs, Cimex lectularius, occur wherever there is human activity. While infestations are most common in homes and apartments, they are also prevalent in hotels, raising questions about their impact on travel and tourism. To investigate how much the public knows and cares about bed bugs while traveling, we implemented the first nationwide survey of hotel patrons traveling in the U.S. for leisure and business.While the majority of respondents had limited understanding or experience with bed bugs (two-thirds could not identify the bed bug in a lineup of other household insects), the pests evoke fervent responses in most travelers. Compared to other hotel room issues such as odor or lack of cleanliness, evidence of bed bugs is far more likely to cause guests to switch hotels and seek compensation. When booking accommodations online, the majority of respondents stated that a single report of bed bugs would cause them to choose another hotel. Widespread reliance on social media and online reviews when booking accommodations makes the hotel and lodging industry acutely vulnerable to reports of bed bug infestation, irrespective of whether they are accurate. Most respondents wanted to know if their assigned room had a previous bed bug issue, even if it occurred long ago. Travelers also favored hotels with a protective service plan for bed bugs in place (preventive inspections, bed encasements, etc.). Demographic characteristics of respondents generally provided little indication of which segments of the population are most concerned about bed bugs. Rather, attitudes and apprehensions appeared to be universal.

Key words Survey, social media, online reviews, misidentification

INTRODUCTION The resurgence of the bed bug, Cimex lectularius L, has been well documented in the United States and throughout the world (Boase, 2001; Doggett et al., 2004; Potter et al., 2010). While infestations are most common in homes and apartments, three-fourths (75%) of pest management professionals in the United States also report finding bed bugs in hotels and motels (Potter et al., 2015), which raises questions about the impact of this pest on travel and tourism. In the U.S., nearly five million people stay in hotels and motels nightly, 60% traveling for leisure, 40% for business (AHLA, 2015). Industry statistics indicate there are about 53,000 properties and almost 5 million guestrooms, producing $176 billion in annual revenue. As part of the broader, $1.4 trillion U.S. travel and tourism industry, hotels and motels also influence many interrelated businesses, including airlines, cruise ships, restaurants, car rental firms and travel agencies. To investigate how much the public knows and cares about bed bugs while traveling, we implemented a national survey of hotel patrons. 68 M. F. Potter, J. M. Penn, and W. Hu Bed Bugs, Hotels, And Travelers: Attitudes And Implications

MATERIALS AND METHODS The survey was conducted in May 2015 utilizing the online survey and market research firm Qualtrics (Provo, Utah, U.S.A.). Six rounds of refinement with focus groups occurred before survey deployment. We used an 64-item questionnaire, of which 15 questions pertained directly to traveler awareness, experience and attitudes toward bed bugs. Additional questions surveyed respondent habits when booking and staying in hotels (e.g., frequency, price, desired amenities) and demographics (gender, age, education, etc.). To encourage broad participation and minimize bias, participants initially were told only that they would be asked about attitudes and preferences involving hotels. Questions pertaining to bed bugs were presented later in the survey. Respondents included 2088 people representing all 50 states and the District of Columbia ― 1,298 who travel mainly for leisure and 790 traveling for business. Business travelers were defined as those who stayed in hotels for work-related reasons at least seven nights in the past year. Demographics of travelers participating in the study are presented in Figure 1.

RESULTS AND DISCUSSION Familiarity with Bed Bugs One series of questions evaluated traveler familiarity with bed bugs. When respondents were shown a lineup of enlarged, black silhouettes of an ant, termite, , bed bug and tick, only 35% of business travelers, and 28% of leisure travelers correctly identified the bed bug (Figure 1). Additionally, a substantial proportion of business (29%) and leisure (42%) travelers admitted not knowing (i.e. did not even guess). This has important ramifications for hotels because a person’s stated encounter with bed bugs might be erroneous, as has been the case in recent news stories where allegations of bed bugs have been made on social media (N.A., 2016). Ramifications of a false report can be costly to the proprietor, who often must respond with a professional pest control service and compensating the complainant. Moreover, the hotel’s reputation can be harmed if the guest decides to post an online review even if it is later determined that what they found was not a bed bug.

1-Ant 2-Termite 3-Louse 4-Bed Bug 5-Tick 6- I don't know

Business (n=790)

Leisure (n=1298)

Figure 1. Percentage of respondents (by business and leisure travelers) who identified various arthropod Figureoutlines 1. asPercentage those of of bed respondents bugs. (by business and leisure travelers) who identified various arthropod outlines as those of bed bugs. Bed Bugs, Hotels, And Travelers: Attitudes And Implications 69

Travelers were also asked about their level of prior experience with bed bugs. In general, most respondents said they knew about bed bugs via news outlets, but had no personal experience (44% for business, 56%, for leisure). However, business travelers were more likely than leisure travelers (P = 0.04) to have had personal experience or know someone having personal experience with bed bugs (35% and 21% respectively). Roughly one in five respondents (both business and leisure) mentioned they “haven’t really seen or heard much” about bed bugs, suggesting a further need for public education. We further asked respondents to rate whether they worry about bed bugs while staying in hotels. The majority said they thought about bed bugs while staying in hotels, but were not worried (35%), or only briefly worried about them (29%). About one in five respondents (21%) never thought about bed bugs or considered them a concern while traveling, while 14% worried about them often. Not surprisingly, those who reported finding bed bugs in a publicly-posted hotel review or on social media (12% and 2% of business and leisure respondents, respectively), were significantly more likely to have a greater level of worry, as were those who reported more prior personal experience with bed bugs (P < 0.01). In general, leisure travelers appeared more worried about bed bugs than business travelers despite business travelers spending more nights and money in a hotel. Females were 5% more likely to often worry about bed bugs than males. Additionally, married females with children have an 11.8% higher chance of reporting greater levels of bed bug worry while traveling than single and childless females. While females are 48.4% of the sample, 65.1% say they are primarily responsible for choosing and booking hotels for leisure purposes; therefore, hotels should be mindful of their potential vulnerability to females who generally worry more about bed bugs and who often make the booking decisions.

Reaction to Bed Bugs in Online Reviews The majority of travelers today consider online reviews when booking hotel accommodations. In one survey of global respondents, TripAdvisor found that 80% of travelers read at least 6-12 online reviews before selecting a hotel on their site (PhoCusWright, 2013). Other studies concluded that customer reviews are the most important factor in hotel booking decisions and that online reviews and reputation management are the most important issues of the industry (Ady and Quadri-Felitti, 2014; Deloitte, 2015; PhoCusWright, 2013). Given the importance of online reviews for hotels, we wanted to know how booking decisions would be influenced by reports of bed bugs. Respondents were presented with the following scenario: “You’re about to make a reservation for a certain hotel, but you read an online review posted in the last month that says they found bed bugs in their hotel room.” Travelers then ranked four responses in terms of most to least likely to pursue each: 1) choose the hotel, but be careful to inspect the room, 2) avoid that particular hotel, 3) avoid that entire brand of hotel or 4) reduce the number of hotel nights and overnight trips taken (Figure 2). Tellingly, more than half of all respondents (60% traveling for leisure, 51% for business) said they would be very unlikely to choose a hotel with a single online report of bed bugs. The most frequently chosen second course of action (33% of respondents) was to not select that brand of hotel, suggesting loyalty to an entire brand can be harmed by reviews posted about a single property. 70 M. F. Potter, J. M. Penn, and W. Hu Bed Bugs, Hotels, And Travelers: Attitudes And Implications

1st-Most Likely 2nd 3rd 4th-Least Likely

56.0%

37.9% 33.1% 33.7% 30.0% 26.4% 28.3% 23.8% 24.8% 21.8% 23.4% 21.4%

12.3% 12.3% 8.0% 7.0%

Not that hotel Choose but be careful Not that brand Fewer hotel nights

Figure 2. Respondents’ overall reaction to an online report of bed bugs, and how it would influence their choice of accommodations. Figure 2. Respondents’ overall reaction to an online report of bed bugs, and how it would Reaction to Finding Bed Bugs in Hotel Rooms Weinfluence also wanted their to assesschoice how of accommodations. travelers would respond to finding bed bugs compared to other problematic issues in hotel rooms. Respondents were first asked if they normally check for abnormalities such as an unclean bathroom, odor, linen stains, or signs of bed bugs before settling into their room. A majority of respondents indicated they check for cleanliness of the bathroom (80%), the absence of room odor (72%), and clean sheets and towels (62%). Conversely, only 34% reported searching for signs of bed bugs. Travelers were then asked how they would respond to finding such problems during their stay. For each room issue, they were asked to choose their most likely response from the following options: 1) do nothing, 2) report it to the front desk, 3) request a new room, or 4) switch hotels entirely with a full refund (Figure 3). In most scenarios, traveler responses mainly involved contacting the front desk and/or requesting a new room. Finding signs of bed bugs, however, elicited a more extreme response, with 60% of travelers stating they would leave the hotel and demand a refund. Business travelers showed slightly more leniency toward finding bed bugs than leisure travelers, with 55% indicating they would change hotels versus 63% of leisure travelers. Leisure and business travelers’ reactions to other hotel room issues tended to be more similar. Clearly, consumers are more intolerant of bed bugs than other room deficiencies. Hotels should be cognizant of this fact when responding to complaints, real or perceived.

Do Nothing Report New Room Switch Hotels

Signs of Smoking 17.4% 22.7% 56.8%

Spots on MaSress/Linens 16.8% 43.2% 33.8% 6.2%

Foreign Material (e.g. Blood) 22.3% 52.8% 22.8%

Signs of Bed Bugs 9.9% 29.5% 59.8%

Dirty Sink or Bathtub 37.0% 46.0% 14.0%

Dirty Towels or Sheets 54.3% 29.1% 15.9%

Figure 3. How respondents would deal with hotel room issues, including signs of bed bugs. Figure 3. How respondents said they would deal with hotel room issues, including signs of bed

bugs.

Bed Bugs, Hotels, And Travelers: Attitudes And Implications 71

In a related question, travelers were asked specifically how they would respond to finding a live bed bug in the room during their stay. Respondents were given the option to select the three most and least likely outcomes they would pursue. Most respondents chose “switching rooms with compensation” (74%) or “leaving the hotel” (73%) as their top two picks. Fewer travelers (38%) said that they would leave and avoid future bookings with that hotel brand entirely. Relative to online reviews, 47% of respondents said that if they found a bed bug in their hotel room they would “report it and post about the experience on social media.” Taking legal action against the hotel was the least likely option chosen (9%), suggesting that if hotels offered some form of modest compensation many guests would be content.

Duty to Disclose Infestations Travelers were also interviewed on whether they thought hotels had a duty to warn guests of previous bed bug problems. When asked, “Do you think hotels should be required to tell guests if their assigned hotel room has ever had a prior problem with bed bugs?” the majority of respondents (80%) agreed. Among those who wanted mandatory disclosure of previous bed bug issues, we also asked them how far back in time (i.e. length of time) they would want to know of such occurrences (Figure 4). About two-thirds of leisure travelers wanted to know if there had been bed bugs in the room at some point in the past year, and the remaining third wanted to know if there had been an occurrence ever. Leisure respondents were more likely to want longer lengths of disclosure, with 32% wanting “any occurrence ever” disclosed, compared to 21% of business travelers. Business travelers tended to be more lenient (P = 0.02), with 48% wanting to know of any occurrences in the past 3 months or less, versus 38% of leisure travelers.

Past Week Past Month Past 3 Months Past 6 Months Past Year Any occurrence ever

Business (n=646)

Leisure (n=1015)

Figure 4. How far back in time respondents wanted to know if there were bed bugs in their hotel room. Figure 4. How far back in time respondents wanted to know if there were bed bugs in their Mandated disclosure of a property’s bed bug history is becoming an important and contentious issue in the rentalhotel of room. apartments, with some cities requiring disclosure to prospective tenants (California Assembly, 2016; New York City Administrative Code, 2010). If similar legislation was passed requiring bed bug disclosure in hotels, the consequences could be far-reaching. Such a ruling could potentially take rooms out of service for prolonged periods, possibly long after the threat to guests has diminished. It could also necessitate maintaining and sharing infestation records with some customers, a troubling prospect for the hotel industry. While informing guests about past infestations may seem unnecessary to hoteliers, there is presently no way to be certain that a formerly infested room is now bed bug-free.

72 M. F. Potter, J. M. Penn, and W. Hu Bed Bugs, Hotels, And Travelers: Attitudes And Implications

CONCLUSIONS This is the first U.S. study to survey attitudes of travelers toward bed bugs. The findings have important implications for the public, hoteliers, and pest managers who service these accounts. While the majority of consumers have limited understanding or first-hand experience, the pests evoke fervent responses by both business and leisure travelers. Compared to other hotel room issues such as odor or lack of cleanliness, evidence of bed bugs is more likely to cause guests to switch hotels and seek compensation. When booking accommodations online, the majority of business and leisure travelers stated that a single report of bed bugs would cause them to choose another hotel. More than half of all respondents wanted to know if their assigned room had a previous bed bug issue, even if it occurred long ago. Widespread reliance on social media and online reviews when booking accommodations makes hotels especially vulnerable to reports of infestation. Our findings indicate that a single online report of bed bugs adversely impacts future bookings, irrespective of whether the review is accurate. Hotels and others in the hospitality sector should develop a reputation management plan to prudently respond to such comments. Similarly important is training front desk/customer service employees to respond promptly and empathetically when incidents arise. Hotels should also train their housekeeping and engineering staffs to recognize and report bed bugs in the earliest possible stages when infestations are more manageable.

REFERENCES CITED Ady, M., and D. Quadri-Felitti. 2014. The effect of reviews on hotel conversion rates and pricing. http://marketing.trustyou.com/acton/attachment/4951/f-02bb/1/-/-/-/-/ The%20Effect%20of%20Reviews%20on%20%20Hotel%20Conversion%20Rate s%20and%20Pricing.pdf American Hotel and Lodging Association. 2015. Lodging industry trends 2015. https://www.ahla.com/uploadedFiles/_Common/pdf/Lodging_Industry_Trends_2 015. pdf Boase, C. 2001. Bedbugs-back from the brink. Pesticide Outlook. 4: 159-162. California Assembly. 2016. AB-551 Rental property: bed bugs. Deloitte. 2015. Engaging the empowered holidaymaker. Travel Consumer 2015. https://www2.deloitte.com/content/dam/Deloitte/uk/Documents/consumer- business/ deloitte-uk-travel-consumer-2015.pdf Doggett, S.L., M.J. Geary, and R.C. Russell. 2004. The resurgence of bed bugs in Australia: with notes on their ecology and control. Environmental Health. 2: 30. Greene, L. 2016. Bedbugs reported in some of NYC’s swankiest hotels. NY Daily News http://www.nydailynews.com/new-york/bedbugs-reported-nyc-swankiest-hotels- article- 1.2524895 N.A. 2016. Great Wolf Lodge battles social media claims of bed bugs. http://www.fox5ny.com/news/166816828-story New York City Administrative Code. 2010. §27-2018.1. PhoCusWright. 2013. Customer survey research engagement, prepared for TripAdvisor. http://t4binsightscache.tripadvisor.com/TripAdvisorInsights/sites/default/files/pdf _links/26309_pcw_infographic_en_uk.pdf Bed Bugs, Hotels, And Travelers: Attitudes And Implications 73

Potter, M.F., B. Rosenberg, and M. Henriksen. 2010. Bugs without borders: defining the global bed bug resurgence. PestWorld. 8-20. Potter, M.F., K.F. Haynes, and J. Fredrickson. 2015. Bed bugs in America: the 2015 national bed bug survey. PestWorld. Nov./Dec.:4-14. 75

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

AN OVERVIEW OF BED BUG (HEMIPTERA: CIMICIDAE) TREATMENT IN THE UNITED STATES: USING SCIENCE TO CREATE PROGRESSIVE PROTOCOLS

JEFFREY WHITE Director of Innovation and Technical Content, BedBug Central, 351 Lawrence Station Rd., Lawrenceville, NJ 08648

Abstract For the past 15 years bed bugs, Cimex lectularius, have been aggressively spreading across the United States and pushed professionals to create bed bug treatment protocols with voids in basic research on many control options. The first response to this problem was to use pesticides as the backbone to a bed bug treatment protocol but research quickly detected high levels of resistance within field populations, which forced professionals to evaluate non-chemical options to assist in the control of this pest. Due to the speed at which bed bugs have spread, as well as the resistance issues they present, both academia and the pest control industry has been forced to find alternatives on how to slow their spread and control them properly. This session will look at the past 15 years of bed bug control in the United States and review the history of treatment protocols during that time. Using research conducted over the past decade, different options to control bed bugs will be evaluated. Some treatment tools that will be covered include pesticides, bed encasements, monitors, steamers, amongst others and the value each provide to efficiently and effectively control bed bugs will be discussed.

Key words Bed bugs, preparation, clutter, pesticides, resistance, monitors.

INTRODUCTION Bed bugs have been a pest of human beings since they transitioned from hunter gatherers living in caves to more stable living environments such as farming communities and more traditional residential settings. They have been noted in North America since European settlers and explorers first landed there in the 1600’s but have been documented living with humans in as early as 400 BC (Usinger, 1966; Potter, 2011; Koganemaru and Miller, 2013). Bed bugs continued to spread and infest homes throughout the world until shortly after World War II when residual pesticides such as DDT were introduced to the commercial marketplace. These pesticides were both easy to apply and had strong residual properties, where they would remain active within households for months or years after application. This provided simple and affordable bed bug control for many developed communities across the world and drove bed bugs from a significant pest within homes to a mythic monster that was the subject of fairy-tales and nursery rhymes often told to children as the fell asleep within their beds (Usinger, 1966; Cooper, 2011). Within the past 20 years, an increase in the presence of bed bugs has been noted worldwide. In addition to infesting traditional residential settings, bed bugs have been noted in commercial environments such as offices, schools, hospitals, public transportation, movie theaters, amongst others (Potter, 2006; Potter et al., 2015). Along with an increase in the presence of bed bugs, a high-level of synthetic pyrethroid resistance has been noted in bed bug infestations, which has presented significant challenges to pest control professionals as they have developed protocols to eliminate this pest (Davies et al., 2012; Dang et al., 2013). Resistance to pyrethroids have forced pest management 76 J. White An Overview Of Bed Bug Treatment In The United States professionals to search for other methods to assist in the control of bed bugs. Such methods that have been evaluated and adopted by professionals include but are not limited to: bed encasements, vacuums, steam/non-chemical tools for contact kill and monitors (Pinto et al., 2007; NPMA, 2011; Doggett, 2013). The following will review the past 15-20 years of bed bug management in the United States and discuss currently accepted control practices for bed bugs as well as effective and efficient service protocols for the elimination of infestations.

RESISTANCE TO PESTICIDES: USING LIQUID RESIDUALS AS A LAST RESORT As mentioned above, pesticide resistance has been noted at high-levels within bed bug infestations collected from the field. One study found that 88% of bed bug populations collected from across the United States tested positive for target-site mutations, which suggests probable pyrethroid resistance (Zhu et al, 2010). Another study found that bed bugs collected from an infestation in Virginia were more than 300-times less susceptible to certain synthetic pyrethroids compared to a laboratory strain collected more than 30 years ago (Moore and Miller, 2009). These two studies, amongst many others, illustrate significant and widespread resistance to pyrethroids in the United States. Although widespread resistance had been found in field infestations across the United State, liquid residual pesticides remain one of the most popular choices for bed bug control amongst pest management professionals, being used by 99% of pest management professionals (Potter et al, 2015). Some studies have demonstrated positive effects from certain synthetic pyrethroid products, especially those that have unique formulations that have proven to be effective against bed bugs (Romero et al, 2009). In addition, studies have found that products containing neonicotinoids may demonstrate a high-rate of contact kill along with some residual effect when applied on certain substrates (Potter et al., 2012). These studies suggest that using a liquid residual may provide some value as part of a bed bug control protocol but due to the resistance noted in field infestations they should not alone be relied upon to control infestations and the residual effect on bed bugs should be questioned.

DUST PESTICIDE: CRACKS AND CREVICES Bed bugs have long been noted to hide in cracks and crevices to avoid detection and provide safe harborage (Usinger, 1966). Due to this behavior, dust pesticides to treat cracks and crevices and occasionally applied in more accessible areas (according to label directions) may be one of the most effective options for bed bug control. Through the last 15 years pest management professionals in the United States have had moderate to high level of success using a wide variety of dusts to treat crack and crevices for bed bugs. The biggest issue associated with dust pesticides have not been the effectiveness but instead have been complications with application equipment and that equipment not creating a misapplication “cloud” at the point of treatment. Dusts that are considered low-impact to the environment that use silica or diatomaceous earth as the active ingredient have been demonstrated to be effective for treating cracks and crevices. Also, dusts that contain active ingredients such as deltamethrin or cyfluthrin (amongst others) have been shown to have a positive effect on bedbugs (Wang et al, 2013; Potter et al., 2014). Dust pesticides should be used to treat all cracks and crevices where bed bugs are thought to be hiding. Once most dusts have been applied to a crack or crevice they will remain active for several weeks or months after application. This extended efficacy of treatment seals and prevents many cracks and crevices from being infested in the future as well as placing bed bugs still infesting the home under additional stress. Treating cracks and crevices with dust also shortens the length of future follow-up services since most cracks do not need to be treated more than once. An Overview Of Bed Bug Treatment In The United States 77

MATTRESSES AND BOX SPRINGS: TREATING BEDS Mattresses, and particularly box springs, have proven to be one of the most significant areas to be treated in a bed bug infestation, as well as one of the most challenging (Cooper, 2011). Before the introduction of bed encasements around 2006, most pest management professionals were using pesticides to treat both the mattress and box spring. Due to the limitless amounts of hiding places often found inside box springs, encasements have been widely accepted by the pest control industry as an appropriate method to treat both mattresses and box springs. Surveys have found that up to 84% of pest management professionals use encasements to assist in the treatment of infested bedding (Potter et al., 2015). In addition to assisting with the treatment of hiding places associated with mattress and box springs, encasements also provide value to pest management professionals by shortening follow-up services, easing the detection of bed bugs, protecting new bedding, salvaging old bedding, as well as many other benefits. Other methods to treat bedding include laundering items in a hot dry cycle, vacuums, and non-chemical contact kill tools such as steamers, as well as pesticide impregnated bedding covers. The frequency with which these tools are used often differs by pest control companies as well as the extent of the infestation. Dryers, vacuums and non-chemical contact kill tools are often used to kill and remove bed bugs from infested bedding as well as those hiding on and within the bed itself (Pinto et al., 2007; NPMA, 2011; Doggett, 2013). The value pesticide impregnated bedding covers provide to a bed bug management protocol have been debated over the past 15 years but research in the last 5 years conducted at several universities have suggested that the covers may have more value than first thought (Jones et al., 2015; Kells and Hymel, 2016). While research has suggested that the liners may have more impact than first thought, pesticide impregnated covers are still only being used by about 9% of the pest control industry compared with 84% which use bed encasements (Potter et al., 2015).

KILLING BED BUGS ON CONTACT: VACUUMS, STEAMERS, AND OTHERS Due to the high-levels of pesticide resistance noted in field infestations, professionals have adopted several different tools to kill bed bugs on contact. Vacuums are one method that pest management professionals are using to remove bed bugs that are visible on the surfaces of furniture. Vacuums are being used by approximately 62% of pest management professionals when treating for bed bugs. Another tool often used to kill bed bugs on contact is steamers. Steamers often generate temperatures in excess of 180oF (82oC), which will kill bed bugs and their eggs on contact. Steam also penetrates pleats and folds within upholstered furniture where bed bugs are often hiding. These pleats and folds are often difficult to remove bed bugs from as they are often small and tight, and vacuums and other control tools fail to access the bugs hiding within them. Steamers will penetrate through several millimeters of fabric killing any bed bugs or eggs contained within them (Pinto et al., 2007; NPMA, 2011; Doggett, 2013). Other tools that are being used to kill bed bugs on contact include flash-freeze technology such as Cryonite, all-natural sprays and hot dry cycles. While the value and consistency of flash-freeze technology has been debated in several forums, one study did claim to successfully treat a homeless shelter for bed bugs within two treatments (Brown and Laughlin, 2012). The efficacy of all-natural sprays have been heavily debated for the past 10 years with many being found to be completely ineffective for bed bug control. A study at Rutgers University did find that while several were ineffective for bed bug control there are a few all-natural sprays available that did kill close to 100% of bed bugs treated within 10 days of application (Singh et al., 2013). Lastly, bed bugs and their eggs will be sufficiently killed by a hot dry cycle and has proven to be a great option for the treatment of items that can be laundered (Naylor and Boase, 2010).

78 J. White An Overview Of Bed Bug Treatment In The United States

BED BUG MONITORS: CAN THEY ASSIST IN TREATMENT? While monitors have long been thought of as devices used to detect the presence of bed bugs, since 2007 several have been evaluated as part of a bed bug treatment protocol. The value monitors may provide within a treatment protocol include: reducing the number of bed bugs infesting the home by capturing bugs between services, providing additional information on where bed bugs may be infesting by using where bugs were captured to suggest the direction they may be originating from and reducing the stress placed on residents sleeping within the bed as well as the number of bites received by capturing bed bugs as they search for hosts. This additional information providing by monitors installed during service can reduce both the time and expense associated with eliminating the infestation (Pinto et al., 2007; Koganemaru and Miller, 2013). Several monitors have been evaluated over the past 10 years with the majority of published research focusing on interception devices. Interception devices are pitfall traps that capture bed bugs as they move around an environment. Research has indicated that interception devices can be effective at reducing populations of bed bugs as well as detecting movement of bed bugs from one location to another (Cooper et al, 2015b; Cooper et al., 2015c; Wang et al., 2011). The conclusion of these studies is that interception devices can provide great value as part of a bed bug treatment protocol in addition to their ability to detect infestations. Beyond interception devices, glueboards and other bed bug monitors have been evaluated for both their ability to detect bed bug infestations as well as their ability to capture bugs (Boase et al., 2012; Vaidyanathan and Feldlaufer, 2013). The effectiveness of these products can vary greatly and published research, cost and operational time should be considered when an individual product is considered for use within a bed bug treatment protocol.

CLUTTER AND BED BUG PREPARATION FOR SERVICE From emptying closets of clothes to stripping beds of bedding, what is often required of residents to prepare their home for bed bug treatment has been a heated topic within the pest control industry for the past 15 years. When the bed bug resurgence began most pest management professionals were recommending clients strip their beds of bedding, move furniture away from walls, empty closets and dressers of furniture and launder those items, amongst many others. Getting residents to cooperate with bed bug prep lists is often an uphill battle that many pest control professionals blame for difficult-to- eliminate infestations. These preparations are often provided to every client being treated for bed bugs and one of the more frustrating topics for pest management professionals is “how do we handle clients that don’t prepare the home for bed bug treatment?” In addition to bed bug prep work being a volatile topic amongst pest management professionals, it has also been the source of many arguments between residents, property management and pest control technicians (Pinto et al., 2007). Recent research though has shed light on the topic and suggested that many of these recommendations may not be necessary to solve 95% or more bed bug infestations (Wang et al, 2014; Cooper et al, 2015a). In addition to extensive bed bug preparation lists being unnecessary to control many infestations, there is also concern raised that residents conducting extensive preps may be moving bed bugs around the home and thus complicating treatment moving forward. Many recommendations on bed bug preparation being made now revolve around asking residents to prepare areas where bed bug evidence is noted instead of emptying and moving furniture as a requirement on all services regardless of evidence.

An Overview Of Bed Bug Treatment In The United States 79

THE FUTURE OF BED BUG MANAGEMENT Recommendations on bed bug treatment protocols currently revolve around using a multi-faceted approach to address pesticide resistance amongst bed bugs. Both structural heat and fumigation have been identified as methods to eliminate bed bugs in a single treatment but neither has proven to be cost-effective to the majority of the United States and the rest of the World. That being said, research has demonstrated that an integrated approach to bed bug control can be efficient and effective, especially if infestations are detected early-on. Pest management professionals should not be relying on pesticides alone to control infestations and instead should be taking a multi-faceted approach to bed bug management. Over the next decade protocols should continue to become streamlined and thus reduce the cost associated with bed bug management. In addition, research should demonstrate the impact residents and societal structure can have on the spread of bed bugs and how approaches and protocols should differ based upon the clients being treated for bed bugs.

REFERENCES CITED Boase, C., R. Naylor, and C. Phillips. 2012. Laboratory and field evaluation of Suterra’s new bed bug monitor. International Pest Management. 54 (4), 208-210. Brown, J. and D. Loughlin. 2012. Field study testing the efficacy of Cryonite against bed bugs, Cimex lectularius. International Pest Control. 54: 196-198. Cooper, R. 2011. Bed bugs and kissing bugs. pp. 587–632. In: Hedges S. (ed.), Mallis’ handbook of pest control, 10th edn. GIE Media Publications, Cleveland, OH. Cooper, R., C. Wang and N. Singh. 2015(a). Evaluation of model community-wide bed bug management program in affordable housing. Pest Management Science 72(1): 45-56. Cooper, R., C. Wang and N. Singh. 2015(b). Effects of various interventions, including masstrapping with passive pitfall traps, on low-level bed bug populations in apartments. Journal of Economic Entomology 109(2): 762-769. Cooper, R., C. Wang and N. Singh. 2015(c). Mark-release-recapture reveals extensive movement of bed bugs (Cimex lectularius L.) within and between apartments. PLoS ONE 10(9): e013642. doi: 10.1371/journal.pone.0136462. Dang, K., D.G. Lilly and S.L. Doggett. 2013. Bed bugs and insecticide resistance: Implications for pest managers. Pest Magazine (Jul/Aug): 25-27. Davies, T.G.E., L.M. Field, and M.S. Williamson. 2012. The re-emergence of the bed bug as a nuisance pest: implications of resistance to the pyrethroid insecticides. J. Med. Vet. Entomol. 26: 241–254. Doggett, S.L. 2013. A Code of Practice for the Control of Bed Bug Infestations in Australia, 4th edition, http://medent.usyd.edu.au/bedbug/cop_ed4.pdf. Jones, S.C., J.L. Bryant, and F.S. Sivakoff. 2015. Sublethal Effects of ActiveGuard Exposure on Feeding Behavior and Fecundity of the Bed Bug (Hemiptera: Cimicidae). J. of Med. Entomol. DOI: 10.1093/jme/tjv008. Kells, S.A. and S.N. Hymel. 2016. The influence of time and distance traveled by bed bugs, Cimex lectularius, on permethrin uptake from treated mattress liners. Pest Mngmnt. Sci. DOI: 10.1002/ps.4294. Koganemaru, R. and D.M. Miller. 2013. The bed bug problem: Past, present, and future control methods. Pesticide Biochem. Physiol. 106: 177–189. Moore, D.J. and D.M. Miller. 2006. Laboratory evaluations of insecticide product efficacy for control of Cimex lectularius. J. Econ. Entomol. 99: 2080-2086. 80 J. White

National Pest Management Association. 2011. Best management practices for bed bugs. Available at: http://npmapestworld.org/publicpolicy/documents/NPMABedBugBMP-10-22-11.pdf. Naylor, R.A. and C.J. Boase. 2010. Practical solutions for treating laundry infested with Cimex lectularius (Hemiptera: Cimicidae). J. Econ. Entomol. 103: 136–139. Pinto, L. J., R. Cooper, and S.K. Kraft. 2007. Bed bug handbook-the complete guide to bed bugs and their control. Pinto & Associates, Inc., Mechanicsville, MD. Potter, M.F. 2006. The perfect storm: An extension view on bed bugs. Am. Entomol. 52: 102-104. Potter, M.F. 2011. The history of bed bug management with lessons from the past. Am. Entomol. 57: 14–25. Potter, M.F., K.F. Haynes, J.R. Gordon, E. Hardebeck, and W. Wickemeyer. 2012. Dual-action bed bug killers. Pest Control Technol. 40(3): 62, 63, 65–8, 75, 76. Potter, M.F., K.F. Haynes, J.R. Gordon, L. Washburn, M. Washburn, and T. Hardin. 2014. Silica gel: A better bed bug desiccant? Pest Control Technol. 42(8): 76–81, 84. Potter, M.F., K.F. Haynes, and J. Fredericks. 2015. Bed bugs across America: the 2015 bugs without borders survey. Pestworld (Nov/Dec): 4–14. Romero, A., M.F. Potter, and K.F. Haynes. 2009. Evaluation of piperonyl butoxide as a deltamethrin synergist for pyrethroid-resistant bed bugs. J. Econ. Entomol. 102: 2310-2315. Usinger, R.L. 1966. Monograph of Cimicidae. Volume 7, Thomas Say Foundation Series, Entomological Society of America, College Park, MD. Singh, N., C. Wang and R. Cooper. 2013. Natural pesticides for bed bug control: Do they work? Pest Control Technol. 41(3): 28, 30, 32. Vaidyanathan, R. and M.F. Feldlaufer. 2013. Bed bug detection: Current technologies and future directions. Am. J. of Trop. Med. and Hyg. 88 (4), 619-625. Wang, C, W.T. Tsai, R. Cooper and J. White. 2011. Effectiveness of bed bug monitors for detecting and trapping bed bugs in apartments. J. Econ. Entomol. 104(1). 274-278. Wang, C., N. Singh, R. Cooper, C. Liu and G. Buczkowski. 2013. Evaluation of an insecticide dust band treatment method for controlling bed bugs. J. Econ. Entomol. 106: 347-352. Wang, C., N. Singh and R. Cooper. 2014. What causes bed bug control failure? The resident factor. Pest Control Technol. 42 (3), 86-95. Zhu, F., J. Wigginton, A. Romero, A. Moore, K. Ferguson, R. Palli, M.F. Potter, K.F. Haynes and S.R. Palli. 2010. Widespread distribution of knockdown resistance mutations in the bed bug, Cimex lectularius (Hemipter: Cimicidae), populations in the United States. Archives of Insect Biochem. and Physiol. 73: 245-257. 81

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

GENDER SPECIFIC VISION IN BED BUGS (HEMIPTERA: CIMICIDAE)

1CORRAINE A MCNEILL AND 2SETH A MCNEILL 13800 S. 48th Street, Division of Science and Math, Union College, Lincoln NE, USA 23800 S. 48th Street, Divisions of Science and Math and of Business and Computer Science, Union College, Lincoln NE, USA

Abstract Eye morphology, spectral sensitivity, and harborage color preferences all have significant differences between male and female bed bugs. Bed bug eye automontage images revealed that females had wider eyes than males. Electroretinogram studies gave evidence that bed bugs have at least one photoreceptor with a spectral sensitivity curve peak in the green (λmax = 520 nm) region of the spectrum. This broad peak potentially indicates another photoreceptor in the yellow-green (λmax = 550 nm) portion of the spectrum, or the presence of additional screening pigments. Electroretinogram studies also showed that males were significantly more sensitive to 520 nm wavelengths compared to females, whereas females were more sensitive to 580nm wavelengths compared to males. Bed bug bioassays indicated that, overall, bed bugs preferred red and black harborages, whereas green harborages were least attractive. Additionally, female bed bugs preferred colored harborages with shorter wavelengths whereas males preferred colored harborages with longer wavelengths. Collectively, these advancements in understanding bed bug vision are vital for improving bed bug monitoring tools.

Key words Spectral sensitivity, Cimex lectularius, eye morphology, colored harborages.

INTRODUCTION The common bed bug, Cimex lectularius, is a nest parasite, which implies that, when it is not feeding, it is searching for shelter in a crack or crevice, and spends the majority of time within that harborage or looking for a new harborage (Pinto et al., 2007). Insects use visual cues, which are often based on color perception, to recognize hosts, find mates, oviposit, and also seek shelter. Color is one of the important visual cues that hematophagous insects use to seek shelter (Steverding and Troscianko, 2004). Spectral sensitivity is how sensitive an organism is to various wavelengths within the light spectrum, and can be influenced by 1) a single visual pigment present within the photoreceptor cells of the eye, 2) numerous types of photoreceptors, or 3) by the presence of other factors such as screening pigments (Kelber et al., 2003). The size and development of compound eyes are also important for understanding how insects respond to visual stimuli (Weiss, 1943). Early studies by Aboul-Nasr and Erakey (1969) documented that the common bed bug is able to distinguish between different wavelengths of light. Short-wavelengths such as violet (haematoxylin 0.005% solution) and bluish-green (fast green 0.001%) were preferred compared with other colors tested. Red (eosin 5%) had attractive qualities, while yellow (Bouin’s solution) appeared to be the least attractive. More recent studies by Singh et al., (2015) have also shown that aggregations of adult male bed bugs combined with 3rd-5th instars prefer black and red harborages compared with other tested colors. To gain a better understanding of bed bug vision, this study focuses on the differences found between male and female bed bugs in harborage eye morphology, spectral sensitivity and harborage color preference. 82 C. A McNeill and S. A McNeill Gender Specific Vision In Bed Bugs

MATERIALS AND METHODS Equipment and techniques used to capture images of the bed bug eye were modified from Obenauer et al., (2009). A JVC KY-F70B 3-CCD digital camera (Cypress, CA), integrated with a dissecting Leica MZ12.5 stereomicroscope (Leica Microsystems GmbH, Munich, Germany) was used to capture images of the compound eyes of bed bugs. Bed bugs were killed using ethyl acetate and then mounted on a rotating microscope stage. Five bed bugs from each life stage were then used to determine the number of ommatidia as well as the length and width of the compound eye. Electroretinograms (ERG) were used to determine bed bug spectral sensitivity. All tests were conducted on insects that had been dark-adapted for 30 minutes. A pulse of light (200 milliseconds) was provided by a manual shutter, and eyes were allowed to recover for one minute before presentation of another light pulse. Light intensity through all interference and neutral density filters was measured with a concave grating spectroradiometer (Black comet CXR-SR, StellarNet Inc, Tampa, FL). Bed bugs were exposed to a maximum intensity of 5.2 x 1015 photons/cm2/sec (520 nm). All experiments were comprised of 10 replicates (i.e. five males, five females). Following adaptation, each bed bug was exposed to light passed through each of the 15 filters representing wavelengths between 340 and 700 nm to produce electroretinogram responses of the designated criterion response. Spectral sensitivity curves were calculated from the mean of all ten replicates. To remove differences in absolute sensitivity between individual insects, mean spectral curves were full-scale normalized and then averaged (Allan et al., 1991). The bed bugs used in these experiments were the Harlan strain of the common bed bug (Harold Harlan, Armed Forces Pest Management Board, U.S. Department of Defense, Washington, D.C.) reared at the Urban Entomology Laboratory at the University of Florida (Gainesville, FL) using methods similar to Pfiester et al., (2009). Visual bioassays were conducted in a Lab Tek, extra deep, Petri dish (150 by 20 mm; ThermoFisher Scientific, Pittsburgh, PA). To prevent positional biases within each experiment, a clean Petri dish arena was randomly selected and placed within a large Pyrex dish (25 by 33 cm; Anchor Hocking, Co. Lancaster, OH), to further prevent bed bugs from escaping. Each Petri- dish arena contained seven color choices that were arranged as small tent-like harborages. The colored tent-harborages (2 cm long by 1 cm wide) were made from various colored cardstock paper (Michaels Stores Inc., Irving, TX). All bed bugs were placed in the experimental room for acclimatization 24 hours prior to bioassays. Gloves were used in all situations to keep human odor from arenas and harborages. Colored harborages were arranged in a semicircular manner in the arena with each end harborage ~2.5 cm from the edge of the Petri dish to control for edge effects. Bed bugs were tested individually and one replicate consisted of all seven color choices randomly arranged (based on an Excel randomization algorithm) with a bed bug in the center of the arena. Bed bugs were given 10 minutes to make a choice for a particular colored harborage. At the end of the 10 minute period, the number of bed bugs under each harborage was counted and recorded. DATA ANALYSIS Nominal logistic regression was used to determine whether gender influenced harborage color choice and un-paired t-tests were used to analyze differences between genders. Seven-choice preference data were analyzed using the χ2 analysis (JMP 9.0.2 SAS Institute Inc. 2010), and adult bed bug data were pooled to determine overall bed bug color preference. Mean separation was determined by comparing upper and lower 95% confidence interval (CI) limits for overlap. Means with confidence interval limits that did not overlap were considered significantly different. Data on the number of ommatidia and the size (length and width) of the eye for each bed bug life stage were analyzed by a one-way analysis of variance (ANOVA) to determine if differences existed between life stages. Tukey’s Honest Significant Difference was used as the post-hoc test for comparison of means for eye morphology. Differences between males and females under dark adaptation were compared using unpaired t-tests (JMP software, version 9.0.2 SAS Institute Inc. 2010). Gender Specific Vision In Bed Bugs 83

RESULTS AND DISCUSSION Automontage imaging of the common bed bug eye, for nymphs and adults, revealed the presence of a red-pigmented area surrounding dark-pigmented ommatidia, whose number (F =114.61; df.= 6; P < 0.0001) and size (length: F =72.89; df.= 6; P < 0.0001; width: F =110.54; df.= 6; P < 0.0001) varied with life stage. (Table 1). No ocelli were present for any life stage. The number of ommatidia found in adult male and female eyes were not significantly different. However, females had significantly wider eyes compared with males (F =72.89; df = 6; P < 0.0001). This is in contrast to a general trend of eyes of male insects being larger than females (Land, 1989) and may reflect the lower role of vision in the mating behavior of bed bugs. These eye morphology data can also be used to help differentiate the common bed bug from the tropical bed bug (McNeill et al., 2016a).

Table 1. Anatomical characteristics of the compound eye of Cimex lectularius across various life stages.

Number of Life Stage Length of Eye (µm) Width of Eye (µm) Ommatidia 1st Instar 5.2 ± 0.2c 74 ± 5.1d 62 ± 3.7d 2nd Instar 7.8 ± 0.4c 84 ± 2.4d 64 ±2.5d 3rd Instar 9.0 ± 0.0c 90 ± 3.2d 72 ± 2.0d 4th Instar 21.2 ± 1.6b 154 ± 5.1c 112 ± 3.7c 5th Instar 27.0 ± 1.8a 182 ± 3.7bc 130 ± 3.2b Adult Male 30.0 ± 0.9a 192 ± 14.7ab 146 ± 7.5b Adult Female 30.4 ± 0.7a 214 ± 4.0a 164 ± 2.5a

The common bed bug has a primary photopigment in the green region (λmax 520 nm) with a characteristic large α-peak in the long wavelength region and a smaller β-peak in the UV region (Figure 1) (McNeill et al., 2016a). This was determined by using a rhodopsin adsorption template from Stavenga (2010). While the theoretical pigment absorption curve for λmax at 520 nm provided a close fit to the spectral sensitivity curve in the 430 to 500 nm range, there was poor fit in the UV region and the spectral sensitivity curve was broader from 500-600 nm than the single photopigment curve (McNeill et al., 2016a). A possible explanation for the broader curve could be the presence of another longer wavelength photopigment. The eye color of bed bug eyes, which was dark red, is presumably due to the presence of screening pigments, which often have the effect of broadening the spectral sensitivity curves (Stavenga, 2002; Carlson and Chi, 1979). Males were significantly more sensitive at 520 nm in the green region (t = 2.33, df = 8, P = 0.024) whereas females were significantly more sensitive at 580 nm in the yellow region (t = 1.97, df = 8, P = 0.004). These data may provide some understanding on how bed bugs perceive different colors and use colors for colonization, survival and reproduction. 84 C. A McNeill and S. A McNeill Gender Specific Vision In Bed Bugs

Figure 1. Spectral sensitivity curves with means ± SE of dark adapted male and female bed bugs. N = 5 bed bugs per gender.

Bed bugs are able to preferentially select harborages based on color-specific visual cues. In behavioral studies with bed bugs, green harborages were the most avoided by adult bed bugs and red harborages were preferred to all other harborages except black (F = 10.23, df = 6, P < 0.0001) (McNeill et al., 2016b). Singh et al. (2015) speculated that red and black colors may only appear as general dark colors to bed bugs based on their photonegative reactions, and it is not known whether bed bugs can differentiate between red or black colors. Bed bugs could however be attracted to red harborages because it is similar to the red color reflected by their own integument and may represent the chance for aggregation with other bed bugs (McNeill et al., 2016b). Although there is no evidence based on the spectral sensitivity data that bed bugs possess red visual pigments, they may be using their green photoreceptors to detect red wavelengths similar to the potato aphid (Döring and Chittka 2007). While the common bed bug is nocturnal and considered endophilic, the presence of the green photosensitive pigment may be derived from an ancestral state and provides visual background contrast. For most insects, enhanced sensitivity to green as the predominate color of foliage, provides heightened contrast for detection of objects and movement (Briscoe and Chittka, 2010). Although there is a general harborage color preference for adult bed bugs, gender significantly influenced harborage color choice (χ2= 48.7, df = 6, P < 0.0001). Female bed bugs preferred shorter wavelength (lilac, violet and blue) harborages to hide under compared with males, while males preferred longer wavelength (red and black) harborages (Figure 3). These color preferences can be used to understand how bed bugs seek out and colonize new harborages (McNeill et al., 2016b). Females bed bugs prefer female-female aggregations rather than female-male aggregations (due to excessive mating) (Pfiester et al., 2009) and so females may use color cues to find safer harborages away from males (McNeill et al., 2016b).

Figure 2. Harborage color preference for adult bed bugs. Different letters are significantly different means (P < 0.031; 96.9% confidence intervals based on Bonferroni corrections).

Gender Specific Vision In Bed Bugs 85

Figure 3. Harborage color preference for male and female bed bugs. Asterisks (*) indicate significantly different means P( < 0.031; 95% confidence intervals).

CONCLUSIONS Bed bug eye morphology, spectral sensitivity, and harborage color preferences show significant differences with respect to gender. This information on bed bug visual biology is important for developing future monitoring and control strategies within bed bug IPM.

ACKNOWLEDGEMENTS The authors wish to acknowledge the help and support of the Urban Entomology Lab at the University of Florida, with special thanks to Dr. Roberto Pereira and Dr. Phil Koehler.

REFERENCES CITED Aboul-Nasr, A.E., and M.A. Erakey. 1969. The effect of light reactions upon the bed bug Cimex lectularius L. Bull. Soc. Ent. Egypte. 52: 337–351. Allan, S.A., J.G. Stoffolano, and R.R. Bennett. 1991. Spectral sensitivity of the horse flyTabanus nigrovittatus (Diptera: Tabanidae). Can. J. Zool. 69: 369–374. Briscoe, A.D., and L. Chittka. 2001. The evolution of color vision in insects. Annu.Rev.Entomol. 46:471–510. Carlson, S.D., and C. Chi. 1979. The functional morphology of the insect photoreceptor. Annu. Rev. Entomol. 24: 379–416. Döring, T.F., and L. Chittka. 2007. Visual ecology of aphids-a critical review on the role of colours in host finding. Arthropod-Plant Inte. 1: 3–16. Kelber, A., M. Vorobyev, and D. Osorio. 2003. Animal colour vision - behavioral tests and physiological concepts. Biol. Rev. 78: 81–118. Land, M.F. 1989. Variations in the structure and design of compound eyes. In D.G Stavenga, D.G. and Hardie, R.C., eds., Facets of vision. Berlin: Springer-Verlag McNeill, C.A., S.A. Allan, R. Pereira, P.G. Koehler, and E.N.I. Weeks. 2016a. Vision in the common bed bug Cimex lectularius L. (Hemiptera: Cimicidae): eye morphology and spectral sensitivity. Med Vet. Entomol. 30:426-434. McNeill, C.A., R. Pereira, P.G. Koehler, S.A. McNeill, and R. Baldwin. 2016b. Behavioral responses of nymph and adult Cimex lectularius (Hemiptera: Cimicidae) to colored harborages. J. Med Entomol 53:760-769.

86 C. A McNeill and S. A McNeill

Obenauer, P.J., L.J. Buss,, and P.E. Kaufman. 2009. Utilizing Auto-MontageTM technology for identifying field-collected container-inhabiting mosquito eggs. J. Am. Mosq. Control Ass. 25: 517–520. Pfiester, M., P.G. Koehler, and R.M. Pereira. 2009.Effect of population structure and size on aggregation behavior of Cimex lectularius (Hemiptera: Cimicidae). J. Med. Entomol. 46: 1015– 1020. Pinto, L.J., R. Cooper, and S.K. Kraft. 2007. Bed bug handbook: the complete guide to bed bugs and their control. Mechanicsville, MD: Pinto & Associates, Inc. Singh, N., C. Wang, and R. Cooper. 2015. Role of vision and mechanoreception in bed bug Cimex lectularius L. behavior. PLoS ONE. 10: 1-14. Stavenga, D.G. 2002. Colour in the eyes of insects. J. Comp. Physiol. A Neuroethol. Sens. Neural., Behav. Physiol. 188: 337–348. Stavenga, D.G. 2010. On visual pigment templates and the spectral shape of invertebrate rhodopsins and metarhodopsins. J. Comp. Physiol. A Neuroethol. Sens. Neural., Behav. Physiol. 196:869- 878. Steverding, D., and T. Troscianko. 2004. On the role of blue shadows in the visual behavior of tsetse flies. P. Roy. Soc. B-Biol. Sci. 271: S16–S17. Weiss, H. B. 1943. Color perception by insects. J. Econ. Entomol. 36: 1–17. 87

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

CHEMICAL ECOLOGY OF BED BUGS (: CIMICIDAE) IN THEIR MICROHABITATS

DONG-HWAN CHOE, HOEUN PARK, AND CLAUDIA VO Department of Entomology, University of California, Riverside, CA 92521, USA

Abstract Extracts of the exuviae of nymphal bed bugs (Cimex lectularius) were analysed for volatile compounds that might contribute to arrestment of adult bed bugs. Four volatile aldehydes, (E)-2-hexenal, 4-oxo-(E)-2- hexenal, (E)-2-octenal, and 4-oxo-(E)-2-octenal were consistently detected in the headspace of freshly shed exuviae. Quantification of the aldehydes in the solvent extracts of homogenized exuviae with varying aging periods indicated that the aldehydes are originally present in the exuviae and dissipate over time, possibly through evaporation. Microscopic observation of the exuviae indicated that the dorsal abdominal glands on the exuviae maintained their reservoirs, within which the aldehydes might be retained. Two-choice olfactometer studies with the volatiles from exuviae or a synthetic blend mimicking the volatiles indicated that adult bed bugs tend to settle close to sources of the aldehydes. Our results imply that the presence and accumulation of bed bug exuviae and the aldehydes volatilizing from the exuviae might mediate bed bugs’ interaction with their microhabitats. Some recent studies on the potential functions of the volatile aldehydes within microhabitats of bed bugs are discussed.

Key words Cimex lectularius, aldehyde, ketoaldehyde, pheromone, antimicrobial compound

INTRODUCTION Several recent studies have examined if (E)-2-hexenal and (E)-2-octenal function as part of the aggregation pheromone blend of bed bugs. In these studies, researchers often detected relatively low concentrations of (E)-2-hexenal and (E)-2-octenal from the headspace of a bed bug colony or a paper substrate that was used by bed bugs (Siljander et al., 2008; Mendki et al., 2014; Gries et al., 2015; Olson et al., 2017). Even though the behavioral effects of these chemicals have been investigated in several empirical studies, the potential mechanisms to explain the presence of these aldehydes in the headspace and substrates of the colony have seldom been investigated. The current study examined whether the dorsal abdominal glands on bed bug exuviae function as “dispensers” of the volatile pheromones, allowing the aldehydes to be slowly released from the exuviae. We investigated if the volatile aldehydes could be detected in the headspace of exuviae, and quantities of the aldehydes in the exuviae decreased over time. The morphological characteristics of dorsal abdominal glands on the exuviae are also described. To understand the behavioral significance of the aldehydes, we tested bed bugs’ arrestment in a two-choice olfactometer. The potential significances of the volatile aldehydes on bed bug’s biology are discussed.

88 Dong-Hwan Choe, Hoeun Park, and Claudia Vo Chemical Ecology Of Bed Bugs In Their Microhabitats

MATERIALS AND METHODS

Insect Bed bugs used in these experiments were “Earl” strain individuals obtained from Sierra Research Laboratories (Modesto, CA). Six small colonies (nymph only) established from eggs were used to collect 1st, 2nd, 3rd, 4th, and 5th instar exuviae. Exuviae that had fallen to the bottom of the vials were collected using a fine paintbrush.

Chemical Analyses Headspace volatiles of a group of 25 exuviae (from one instar) were collected with a solid-phase microextraction (SPME) sampler [75 µm carboxen / polydimethylsiloxane (PDMS); Supelco, Inc.] in 2-ml vials (18-hour collection, 25-26˚C). Volatiles absorbed on the SPME fiber were analyzed by gas chromatography– mass spectrometry (Agilent 7890A GC / Agilent 5975C MSD). To determine if quantities of the chemicals decrease as the exuviae age in the open air, freshly collected fifth instar exuviae were aged for 7, 45, and 99 d before extraction. A group of three exuviae were homogenized and extracted in 0.5 ml methylene chloride. One-microliter aliquots of the extracts were analyzed in an Agilent 7890A GC equipped with a flame ionization detector. Calibration curves based on external standards were used for quantification. Simple linear regression equations were calculated to relate amounts of the aldehydes per exuvia (μg) to the aging period (number of days). Quantity values (y) were log-transformed before the regression analyses due to heteroscedasticity. The significance of the regression was tested using analyses of variance (ANOVA) (Zar, 1999).

Gland Morphology Intact and cut exuviae (from 5th instar) were cleaned in solvents and sputter-coated with a gold- palladium mixture, and observed with a Philips XL30-FEG scanning electron microscope (SEM). To determine if the dorsal abdominal gland reservoirs open externally, we examined whether a colored solvent could be taken up into the gland reservoir by submerging the exuviae in a colored solvent [D-limonene with Sudan Black B (Fisher Scientific)] and gently pressing and releasing the gland reservoirs with a fine probe. The surfaces of the treated exuviae were briefly washed with clean acetone, and observed under a stereomicroscope with bright-field illumination.

Olfactometer Study The behavioral responses of adult bed bugs to the volatiles were examined in an olfactometer. A 15-cm piece of flexible polyvinyl chloride (PVC) tubing was used as the body of the olfactometer. Glass vials (2 ml) were attached to each end of the tubing, with a fine fabric screen on the vial openings, serving as treatment and control vials. The piece of fabric screen prevented bed bugs in the olfactometer body from contacting the vial contents. To test exuviae as a source of volatiles, 70-76 exuviae from 3rd, 4th, and 5th instar nymphs were used. Clean empty vials served as controls. To test synthetic aldehydes, blends of test compounds dissolved in paraffin oil (40 μl) were applied to a piece of cotton (≈50 mg) in the treatment vial. Compound ratios were adjusted to match the ratio found in a 7-day old exuviae. Vials containing a piece of cotton treated with clean paraffin oil served as controls. Individual bed bugs were introduced into the olfactometer through a small slit cut at the center of the tubing about 3 hours before the end of photophase, and final location of the bed bug was recorded 18 hours later during photophase. The null hypothesis that adult bed bugs showed no preference for either olfactometer arm (i.e., random choice) was tested using Chi-square goodness of fit tests with the Yates correction for continuity (Zar, 1999). Chemical Ecology Of Bed Bugs In Their Microhabitats 89

RESULTS AND DISCUSSION

Chemical Analyses SPME analyses consistently detected (E)-2-hexenal, 4-oxo-(E)-2-hexenal, (E)-2-octenal, and 4-oxo-(E)-2-octenal in the headspace of exuviae. Because the exuviae were collected from the bottom of small colonies that were comprised of nymphs only, the compounds detected in the headspace of exuviae likely originated from the exuviae themselves, rather than from contamination associated with alarm / defensive responses of live bed bugs. Based on the linear regression analyses, the quantities of the aldehydes per exuvia measured in micrograms (y) fit a log-linear model with the aging period measured in days (x) (Figure 1). The regression equations with population linearity indicated that average amounts of (E)-2-hexenal, (E)-2-octenal, and 4-oxo-(E)-2-octenal decrease by approximately 1.37, 1.83, and 2.28 % per day, respectively. A similar interpretation was not made for 4-oxo-(E)-2-hexenal due to its non-linear population regression (P = 0.003). This information, together with the presence of the same aldehydes in the headspace, indicates that these aldehydes volatilize from the exuviae.

Figure 1. Regression lines of four aldehydes detected from exuviae of 5th instar nymphs. (A) (E)-2- hexenal, (B) 4-oxo-(E)-2-hexenal, (C) (E)-2-octenal, (D) 4-oxo-(E)-2-octenal. Units for the chemical quantity per exuvia is mg. Dotted lines indicate 95% confidence intervals. 90 Dong-Hwan Choe, Hoeun Park, and Claudia Vo Chemical Ecology Of Bed Bugs In Their Microhabitats

Figure 2. Dorsal abdominal gland morphology study with 5th instar exuviae. (A) Dorsal abdominal glands on an exuvia. (B) Scanning electron microscope image showing the longitudinal cut section of dorsal abdominal glands. The arrow indicates the anterior direction of the exuvia. DAGs 1-3 indicate dorsal abdominal glands on the 3rd, 4th, and 5th abdominal tergites, respectively. Gland Morphology Three bell-shaped dorsal abdominal glands were located at the 3rd, 4th, and 5th tergites of the exuviae (Figure 2A). SEM observations of the cut exuviae revealed that the dorsal area of the exuviae contained three reservoirs associated with dorsal abdominal glands (Figure 2B, three hollow spaces). The black colored solvent penetrated the dorsal abdominal gland reservoirs of intact exuviae, suggesting that there were openings and channels connecting the internal space of the gland reservoirs to the cuticular surface. Overall, these evidences support the notion that the compounds retained inside the dorsal abdominal glands of the exuvia slowly evaporate through the small orifices. Olfactometer Assay When left as individuals in the olfactometer over 18 h, adult bed bugs showed significant arrestment at the source of the volatile compounds. When the exuviae were used as a source of volatiles, 26 of 32 (81.3%) male bed bugs were found on the treatment vial of the olfactometer (c2 = 11.28, P < 0.001). In the same experiment, 17 of 20 (85%) female bed bugs were found on the treatment vial (c2 = 8.45, P = 0.004). When the cotton ball with the synthetic blend of aldehydes was used as the source of volatiles, ≈83 % (19 of 23 for male, c2 = 8.52, P = 0.004; 20 of 24 for female, c2 = 9.38, P = 0.002) of individuals were found on the treatment vial.

CONCLUSIONS Bed bugs’ tendency of settling near conspecific exuviae might have important implications for their biology in their “natural” habitats. Bed bug harborages in residential settings can accumulate numerous exuviae from developing bed bugs. In general, bed bugs are believed to typically return to these harborages after feeding forays, forming dense aggregations, where eggs and fecal materials also accumulate (Usinger 1966; Reinhardt and Siva-Jothy 2007). Attraction / arrestment to the source of aldehyde pheromones would allow the bed bugs to direct their movement towards existing harborages where other conspecific individuals are developing. However, there are substantial amount of inconsistency and discrepancy in the research literature regarding the behavioral effect of these aldehyde pheromones (Levinson and Bar Ilan, 1971; Gries et al., 2015; Olson et al., 2017). (E)-2-Hexenal and (E)-2-octenal are known to influence bed bugs’ behavior in a concentration-dependent manner (Siljander et al., 2008; Ulrich et al., 2016). Slow and controlled release of the compounds also might be critical to cause attraction / arrestment of bed bugs to the odor source. In addition to providing information associated with the established harborages, the aldehydes might play a role in modifying biological environments in bed bugs’ microhabitats. For example, Ulrich Chemical Ecology Of Bed Bugs In Their Microhabitats 91 et al. (2015) reported that (E)-2-hexenal and (E)-2-octenal inhibit growth of an entomopathogenic fungus targeting bed bugs by direct contact and via indirect exposure (‘‘fumigation’’), indicating these compounds may play a role in disinfecting the microenvironment of bed bug harborages. Based on research on several species of alydid, coreid, and pentatomid bugs, Noge et al. (2012) and Noge (2015) reported that 4-oxo-(E)-2-hexenal, (E)-2-hexenal, and (E)-2-octenal showed dose-dependent antibacterial activities against four bacterial species. The potential function of volatile aldehyde pheromones in shaping microbial environments associated with bed bug harborages is currently under investigation.

REFERENCES CITED Gries, R., R. Britton, M. Holmes, H. Zhai, J. Draper, and G. Gries. 2015. Bed bug aggregation pheromone finally identified. Angew. Chem. Int. Ed. 54: 1135-1138. Levinson, H.Z. and A.R. Bar Ilan. 1971. Assembling and alerting scents produced by bedbug Cimex lectularius L. Experientia. 27: 102-103. Mendki, M.J., K. Ganesan, B.D. Parashar, D. Sukumaran, and S. Prakash. 2014. Aggregation responses of Cimex hemipterus F. to semiochemicals identified from their excreta. J. Vector Borne Dis. 51: 224-229. Noge, K. 2015. Studies on chemical ecology of the heteropteran scent gland components. J. Pestic. Sci. 40: 143-145. Noge, K., H. Kimura, M. Abe, J.X. Becerra, and S. Tamogami. 2012. Antibacterial activity of 4-oxo- (E)-2-hexenal from adults and nymphs of the heteropteran, (Heteroptera: ). Biosci. Biotechnol. Biochem. 76: 1975-1978. Olson, J. F., L.M.V. Vers, R.D. Moon, and S.A. Kells. 2017. Two compounds in bed bug feces are sufficient to elicit off-host aggregation by bed bugs,Cimex lectularius. Pest Manag. Sci. 73: 198– 205. Reinhardt, K. and M.T. Siva-Jothy. 2007. Biology of the bed bugs (Cimicidae). Annu. Rev. Entomol. 52: 351-374. Siljander, E., R. Gries, G. Khaskin, and G. Gries. 2008. Identification of the airborne aggregation pheromone of the common bed bug, Cimex lectularius. J. Chem. Ecol. 34: 708-718. Ulrich, K.R., M.F. Feldlaufer, M. Kramer, and R.J. St. Leger. 2015. Inhibition of the entomopathogenic fungus Metarhizium anisopliae sensu lato in vitro by the bed bug defensive secretions (E)-2-hexenal and (E)-2-octenal. BioControl. 60: 517-526. Ulrich, K.R., M. Kramer, and M.F. Feldlaufer. 2016. Ability of bed bug (Hemiptera: Cimicidae) defensive secretions (E)-2-hexenal and (E)-2-octenal to attract adults of the common bed bug Cimex lectularius. Physiol. Entomol. 41: 103-110. Usinger, R.L. 1966. Monograph of Cimicidae (Hemiptera-Heteroptera). College Park: Entomological Society of America. Zar, J. 1999. Biostatistical analysis. 4th ed. Upper Saddle River: Prentice Hall. 93

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

PRESERVATION TECHNIQUES AFFECTING DNA EXTRACTION FROM CIMEX LECTULARIUS (HEMIPTERA: CIMICIDAE)

SANJAY BASNET, RALPH B. NARAIN, AND SHRIPAT T. KAMBLE Department of Entomology, University of Nebraska, Lincoln NE 68583, USA

Abstract The quality and quantity of deoxyribonucleic acid (DNA) extracted from insects are extremely important in genomic research. We tested the hypothesis that DNA can be extracted from bed bugs when stored in different preservatives at various temperatures. The bed bugs were stored in five preservatives including ethanol 90 and 70%, isopropanol 90 and 70%, and the no preservative. Bed bugs in all preservatives were stored at -80oC, -20oC and room temperature. DNA from bed bugs was extracted using Puregene Core Kit A. The DNA quantity was measured by Nanodrop-1000 and the DNA quality was determined by running 0.3 µg DNA in 1.7 agarose gel. We observed the significant reduction in the DNA yield over time. The DNA quantity ranged from 87.67 to 143.56 ng/µl, and DNA purity ranged from 1.82 to 2.1 (best purity = 1.80-2.00). Our data demonstrated that DNA can be extracted from bed bugs regardless of preservatives and temperatures. These data are exceedingly valuable to support genomic and forensic research.

Key words Bed bugs, genomics, molecular, isopropanol, ethanol.

INTRODUCTION Insect genomic research on systematics, resistance management, forensic science, population biology and invasive pests has advanced in the recent years. Since the field collected insects are commonly used for the molecular study, appropriate handling and preservation of insect specimens are very important. Freshly killed insects yield the most DNA but it is impractical to maintain live insects in all situations. Insect DNA can remain intact when placed in appropriate preservatives and/or at certain temperatures. DNA of an organism stops replicating after death and degrades over time by factors such as light, oxygen and/or preservatives. In DNA studies, researchers have evaluated ethanol (Post et al., 1993; Dillion et. al., 1996; King and Porter, 2004; Frampton et al.; 2008, Shokralla et al., 2010; Moreau et al., 2013), DMSO solutions (Frampton et al., 2008), isopropanol (King and Porter, 2004), and -80°C (Dillion et. al., 1996; Frampton et al., 2008). Dillion et al. (1996) reported that two hymenopteran insects preserved in 100 % ethanol at -80°C yielded excellent DNA quantity and quality and can be amplified by Polymerase Chain Reaction (PCR) until 16 months. Freshly killed insects preserved in liquid nitrogen at -80°C can be very effective in maintaining DNA intact (Reiss et al., 1995) but this may not be always feasible. Post et al. (1993) got highest yield and less sheared DNA from blackflies when stored in liquid nitrogen or ethanol at room temperature. The best preservation media and the temperatures may vary from insect species to species. With recent resurgence of bed bug in the United States of America, few researchers are involved in genomic research to define population variations. Our research objectives were to determine if high quality of DNA from bed bugs can be extracted using different preservatives at different temperatures up to 24 months. 94 Sanjay Basnet, Ralph B. Narain, and Shripat T. Kamble Preservation Techniques Affecting DNA Extraction From Cimex lectulariuss

MATERIALS AND METHODS The bed bug (Cimex lectularius) used in this experiment were reared in the laboratory, University of Nebraska Lincoln, NE, USA. The bed bugs were fed weekly on reconstituted human blood collected from the Nebraska blood bank (Lincoln, NE) and colonies were maintained in growth chambers at 23 ± 2°C, 55 ± 5% relative humidity, and a photoperiod of 14:10 (Light: Dark) (Montes et al., 2002).

We stored bed bugs using five preservative techniques at different temperatures (Table 1).

Table 1. Bed bugs specimens preserved in different preservatives and temperatures for DNA extraction.

Preservatives Ethanol Isopropanol No Preservative Temperature 90% 70% 90% 70% Not Applicable -80°C 60* 60 60 60 60 -20°C 60 60 60 60 60 **RT(˷24°C) 60 60 60 60 60 *Number of bed bugs preserved per treatment **RT = Room Temperature

Approximately 1,000 adult female bed bugs were placed in a glass container (6 cm x 15 cm) and set in a freezer at -20°C for 20 minutes for quick kill before assigning to each treatment. Sixty bed bugs were randomly transferred to individual glass vials (2 cm x 6 cm) containing respective preservatives thus totaling to 900 bed bugs. The experimental design was a complete randomized design. Three bed bugs were withdrawn from the each glass vial representing the replicate for DNA extraction at intervals of week1, month(s) 1, 6, 12 and 24. For day 1, DNA was extracted from four bed bugs that were crushed immediately after killing. DNA Extraction, Quantification, and Quality Check: The DNA was extracted from whole body of insects using Puregene Core Kit A (Qiagen, Valencia, CA, and Cat. No. 1042601). The DNA was eluted in 30 µl of the elution buffer provided with the kit. The quantity and purity of DNA was measured by NanoDrop-l,000 (Thermo Fisher Scientific, Pittsburgh, PA), and the quality was measured by running 0.3 µg of DNA per sample in 1.7 % agarose gel, stained with ethidium bromide, gel image visualized using UV irradiation and documented using Bio-Rad Gel Doc 2000 gel documentation system (Bio-Rad Laboratories, Hercules, CA). In NanoDrop-l,000, the purity of DNA was measured as the ratio of the absorbance at 260 nm by the absorbance at 280. PCR Amplification: DNA from all 15 treatments were individually diluted to 15 µg/µl and 1 µl of DNA-dilution was used for PCR amplification using the Taq PCR Core Kit (Qiagen, Valencia, CA, and Cat. No. 201273) as per manufacture recommendations. Forward and reverse primers were designed using Primer3plus (http://www.bioinformatics.nl/cgi-bin/primer3plus) to amplify the gene Actin (Accession No.: LOC106674067), which is a highly expressed in the insects; its proteins are highly conserved proteins and are involved in cell motility, structure, and integrity. The primer used were Forward 5’CAGGGAAAAGATGACCCAG-3’ and Reverse 5’TACCGATGGTGATGACCTGA-3’. The 7 µl of PCR product per sample were run in 1% agarose gel, stained with ethidium bromide, gel image visualized using UV irradiation and documented using Bio-Rad Gel Doc 2,000 gel documentation system (Bio-Rad Laboratories, Hercules, CA). Data Analysis: We analyzed DNA data as repeated measures AVOVA (P <0.05) using PROC GLIMMIX (SAS 9.4. SAS institute, NC, USA.). Means were separated by time for significant differences between extraction intervals and compared with Tukey Kramer’s Method. Preservation Techniques Affecting DNA Extraction From Cimex lectulariuss 95

RESULTS DNA Purity and Yield: Purity and the quantification of the DNA were done based on optical density measurement through spectrophotometer. The measurement of the optical density of 260/280 gives the purity; value ranging from 1.8-2.0 indicates the pure DNA. The value below 1.8 indicates tcontamination of DNA with phenol or other contaminants that absorb strongly at or near 280 nm. Purity of DNA from our extraction ranged from 1.82-2.10 indicating an excellent purity. The gel image of the DNA showed clear and distinct bands until 6 months, but we observed sheared DNA in latter intervals (Figure 1). Figure 1. Genomic DNA of bed bug (0.3 µg/well) extracted from different treatments and ran on 1% agarose gel. Lane 1: DNA mass ladder, 2: Ethanol 90 (-80°C), Ln 3: Ethanol 70 (-80°C), 4: Ethanol 90 (-20°C), Ln 5: Ethanol 70 (-20°C), Ln 6: Ethanol 90 (room temp.), Ln 7: Ethanol 70 (room temp.), Ln 8: Isoproponal 90 (-80°C), Ln 9: Isoproponal 70 (-80°C), Ln 10: Isoproponal 90 (-20°C), Ln 11: 1soproponal 70 (-20°C), Ln 12: Isoproponal 90 (Room Temp.), Ln 13: Isopropona 70 (room temp.), Ln 14 : No Preservative (-80°C), Ln 15: No Preservative (-20°C), Ln 16: No Preservative (room temperature).

The data analysis of DNA yield revealed significant effect of time (F= 23.08, df= 5, 140.9, P < 0.0001) (Figure 1). Average DNA yields at 18 and 24 month intervals were significantly lower when compared to DNA extracted at earlier intervals. Increase in the time lowered the DNA yield for all the preservatives and temperatures. In addition, we also observed the significant interaction between the treatments and time (F= 2.08, df =70, 130.6, P <0.0002). However, there was no significant effect of treatments (F=1.11, df= 14, 47.66, P > 0.05). The Average DNA yield for day 1 is 134.1µg/nl and the remaining DNA yields at different intervals are presented in Figure 2.

DISCUSSION This is the first study to show the long term storage (up to 2 years) of bed bugs and successful isolation of DNA for PCR amplification. Ethanol and isopropanol are the most commonly used insect preservatives (Dillon et al., 1996; King and Porter, 2004). The alcohol concentrations of 95-100% are the most effective insect preservation for DNA isolation (Moreau et al., 2013) because ethanol enter the cell membrane barriers, deactivate the DNase activities, and also kills the microorganisms present (King and Porter, 2004). Ultra-cold storage temperatures are also commonly used for insect preservation (Frampton et al., 2008) because enzymes and antibodies lose much of their functional activity (Mandrioli et al., 2006). The factors critical to insect preservation are moisture, light and oxygen. High moisture content favors the microorganism growth and decay. Protein and nucleic acid degradation over time can be minimized by lowering temperature and avoiding light that triggers oxidation process (Prendini, et al., 2002). Bed bugs stored in glass vials at room temperature were not significantly different from those stored in ethanol or isopropanol and maintained at ultralow cold temperatures. 96 Sanjay Basnet, Ralph B. Narain, and Shripat T. Kamble Preservation Techniques Affecting DNA Extraction From Cimex lectulariuss

Figure. 2. Average DNA yield as measured by Nanodrop from different treatments. Each treatment (total samples =270) was replicated three times and average mean and the standard error were calculated.

Figure 3. PCR product (487 bp) for Actin gene amplified from bed bug DNA Lane 1: DNA mass ladder, 2: Ethanol 90 (-80 °C), Ln 3: Ethanol 70 (-80°C), 4: Ethanol 90 (-20°C), Ln 5: Ethanol 70 (-20°C), Ln 6: Ethanol 90 room temp.), Ln 7: Ethanol 70 (room temp.), Ln 8: Isoproponal 90 (-80°C), Ln 9: Isopro- ponal 70 (-80°C), Ln 10: Isoproponal 90 (-20°C), Ln 11: 1soproponal 70 (-20°C), Ln 12: 1soproponal 90 (room temp.), Ln 13: Isopropona 70 (Room Temp.), Ln 14 : No Preservative (-80°C), Ln 15: No Preservative (-20°C), Ln 16: No Preser- vative (room temp.), Ln 17: Negative control.

Preservation Techniques Affecting DNA Extraction From Cimex lectulariuss 97

The bed bugs have at room temperature (˷24°C) in complete dark remains intact for up to 24 months. Lindahl (1993) reported that the degraded-DNA were extracted from the preserved termites under sterile laboratory conditions. Unlike these results, we found good quality DNA in bed bugs until 12 months. Our result showed DNA is well preserved until 6 months irrespective of preservation methods. However, we observed increase in smear due to the degradation of DNA in agarose gel after 6 months (Figure 1). In conclusion, our findings suggest that bed bugs can be stored at room temperature in glass vials until two years without any preservatives for DNA isolation and PCR amplification. These findings help to minimize the confusion of using preservatives and low temperatures for bed bug specimens intended for DNA based molecular research.

REFERENCES CITED Dillon, N., A.D. Austin, and E. Bartowsky. 1996. Comparison of preservation techniques for DNA extraction from hymenopterous insects. Ins. Mol. Bio. 5: 21–24. Frampton, M., S. Droege, T. Conrad, S. Prager, and M.H. Richards. 2008. Evaluation of specimen preservatives for DNA analyses of bees. J. Hymenoptera Research. 17: 195–200. Golenberg, E.M., A. Bickel, and P. Weihs. 1996. Effect of highly fragmented DNA on PCR. Nucleic Acids Res. 24(24): 5026-5033. King, J.R. and S.D. Porter. 2004. Recommendations on the use of alcohols for preservation of ant specimens (Hymenoptera, Formicidae). Insectes Sociaux. 51(2):197-202. Lindahl, T. 1993. Instability and decay of the primary structure of DNA. Nature. 362 (6422): 709- 715. Mandrioli, M., F. Borsatti, and L. Mola. 2006. Factors affecting DNA preservation from museum collected lepidopteran specimens. Entomol. Exp. Appl. 120 (3): 239-244. Montes, C., C. Cuadrillero, and D. Vilella. 2002. Maintenance of a laboratory colony of Cimex lectularius (Hemiptera: Cimicidae) using an artificial feeding technique. J. Med. Entomol. 39: 675-679. Moreau, C.S., B.D. Wray, J.E. Czekanski-Moir, and B.E. Rubin. 2013. DNA preservation: a test of commonly used preservatives for insects. Invertebr. Syst. 27 (1): 81-86. Post, R.J., P.K. Flook, and A.L. Millest. 1993. Methods for the preservation of insects for DNA studies. Biochem. Syst. and Ecol. 21: 85–92. Prendini, L., R. Hanner, and R. DeSalle. 2002. Obtaining, storing and archiving specimens and tissue samples for use in molecular studies. In: DeSalle, R., Giribet, G. and Wheeler, W. eds. Techniques in Molecular Systematics and Evolution. Springer Science & Business Media. Reiss, R.A., D.P. Schwert, and A.C. Ashworth. 1995. Field preservation of Coleoptera for molecular genetic analyses. Environ. Entomol. 24: 716–719. Shokralla, S., G.A. Singer, and M. Hajibabaei. 2010. Competing interests. BioTechniques. 48(3). March 2010. 99

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

EVALUATION AND IMPLEMENTATION OF A MINIMAL MONITORING SYSTEM FOR CIMEX LECTULARIUS (HEMIPTERA: CIMICIDAE) DETECTION IN LOW-INCOME HIGH-RISE HOUSING

KAREN VAIL AND JENNIFER CHANDLER Entomology and Plant Pathology, University of Tennessee, Knoxville, TN USA

Abstract The objective of this study was to implement and evaluate bed bug detection systems in low-income, high-rise housing for the elderly and disabled. In a previous study, one, two or four ClimbUp Insect Interceptors BG or the BlackOut BedBug Detectors placed per apartment resulted in 80% to 90% bed bug detection rates over an 8-week monitoring period. For this study, two BlackOuts were placed in most apartments of the buildings used in the previous study. Floor meetings were held for all residents to explain bed bug biology, prevention and detection, and residents were given two monitors to place against their bed and a chair. Residents were to inspect the monitors weekly and wipe them as needed; pest management professionals (PMPs) to inspect quarterly; and housing managers and other personnel to inspect as opportunities arose. Our lab personnel conducted inspections in one building (designated D) at 7 – 9 months and in other buildings (designated A and B) 22 months after monitor placement. Evidence was lacking to indicate residents were inspecting and reporting infestations. In building D, 11% of inspected apartments had living bed bugs in the monitors, and another 9% had dead bed bugs but had not been treated by PMPs. The apartments in buildings A and B were quickly inspected, i.e., mattresses and the upper surfaces and crevices of upholstered furniture were examined, as were the two monitors. Living bed bugs were found in 8% of apartments and another 2% had dead bed bugs in apartments that had not been treated. Management was unaware of 79% of the living bed bug infestations. Relying on residents to report bed bugs is ineffective and there is a need for a building-wide visual inspection accompanied by monitor inspection.

Key words Bed bug, elderly and disabled housing, BlackOut BedBug Detector, inspection

INTRODUCTION Bed bug management in low-income, high rises for seniors and the disabled is especially troublesome (Wang et al. 2016). Because introduction of one female bed bug can result in building-wide infestations (Saenz et al. 2012), early detection is essential to slow the spread (Wang et al. 2011). In this study we evaluated two building-wide bed bug detection systems.

MATERIALS AND METHODS In a previous study, one, two or four ClimbUp Insect Interceptors BG or the BlackOut BedBug Detectors placed per low-income, high-rise apartment for the elderly and disabled resulted in 80% to 90% bed bug detection rates over an 8-week monitoring period (Vail and Chandler 2017). Of these two monitors, we chose to further evaluate the BlackOut in a building-wide detection program because it seemed more durable and did not require re-applying talc. Floor meetings were held from March through August 2014 for nearly all residents (733) in these four buildings to explain bed bug biology, prevention and detection, and to inform them of the new detection program. Residents were given two BlackOut monitors to place against their bed and a chair. Monitors were placed against furniture rather than under legs to prevent resident injury. Our lab personnel placed monitors if residents needed assistance. Residents were requested to inspect the monitors weekly, wipe them with a soft cloth if debris accumulated and to report any suspected bed bugs to their housing manager. In addition, PMPs were to inspect the monitors 100 K. Vail and J. Chandler Evaluation And Implementation Of A Minimal Monitoring System For Cimex lectularius quarterly during scheduled apartment inspections. Housing managers and other personnel were to inspect monitors during the annual housekeeping inspection and as other opportunities arose. For the first detection system evaluation seven to nine months after monitor placement, the monitors in the building designated as “D” were inspected and furniture was not. Twenty-two months after monitor placement, buildings designated as “A” and “B” were used for the second detection system evaluation which incorporated the quick inspection technique introduced by Wang et al. (2016). In our evaluation, we inspected the two BlackOut monitors and conducted a quick inspection of the bed and upholstered furniture in each apartment. Sheets were pulled back to expose the mattress and the outer surfaces of the mattress, box spring and frame were inspected. Pillows and the upper surfaces of upholstered furniture were also inspected. Beds and furniture were not flipped. Time spent in each apartment was recorded. Pest management records were reviewed after each inspection to determine which apartments managers knew were infested with bed bugs.

RESULTS AND DISCUSSION In building D where only the monitors were inspected, we had access to 256 of 277 apartments. At least one monitor was still present in 83% and 78% of the apartments where UT personnel and residents had placed them, respectively. Living bed bugs were found in 27 apartments, dead bed bugs were found in 25 apartments that had not been treated according to pesticide application records, and dead bed bugs were found in another 22 rooms that had been treated in the past. Vacuuming was not part of the bed bug pest management plan in this building. The infestation rate ranged from 11% (apartments with living bugs only) to 29% (apartments with dead or living bed bugs in monitors), not much different from the results of an earlier inspection in 2013/2014 in which 31% of the apartments were infested. Because the contracted pest management company changed shortly after our inspection, we could not determine which apartments had bed bugs according to managers. In buildings A & B where we quickly inspected the bed and upholstered furniture as well as the BlackOut monitors that had been placed 22 months prior, we had access to 245 of 249 apartments. We spent 3±1.2 (mean ± SD) minutes per apartment, not including time spent opening doors and moving between apartments. Eighty-three percent of the apartments still had at least one monitor present. Only 10% of the monitors were free of debris, which could indicate the resident or others were inspecting regularly. We replaced 104 monitors because they were missing and 39 because they were too “dirty” to be effective. Living bed bugs were found in 19 apartments, dead bed bugs were in six apartments that had never been treated and in 17 apartments that had been treated in the past. In this case, bed bug infestation rates ranged from 8 to 17% compared to 27% in 2013/2014. The manager of this building diligently checked his pest management records, responded to housekeeping needs reported by the PMP and was seen as an authority figure by the residents. The PMP with the most currently contracted company was a seasoned professional. Incentives encouraged residents to attend an annual bed bug presentation by the contracted pest management company. The manager’s and residents’ active involvement and the PMPs experience were some of the reasons the infestation rates were declining in these two buildings. Even under these conditions, management was only aware of four active infestations in the building which indicates 79% of infestations went undetected. This assumes the apartments with dead bed bugs did not have an active infestation. If the apartments with dead bed bugs lacking treatment were included, management would have missed 84%. This combination of a quick visual inspection along with inspection of two monitors already in place is a slightly different technique compared to Wang et al. (2016). In their study, a quick visual inspection of the bed and upholstered furniture was conducted in each accessible apartment. An average of nine monitors under the legs of beds and furniture were only placed in an apartment when bed bugs were suspected but not found. Evaluation And Implementation Of A Minimal Monitoring System For Cimex lectularius 101

CONCLUSIONS The results of this study illustrate the ineffectiveness of relying on residents to report bed bugs to management. Building-wide inspections used in conjunction with bed bug monitors could detect all, or nearly all, bed bug infested apartments at once to prevent infestations from spreading. We present the effective use of two monitors placed per apartment followed up with building-wide quick visual inspections up to 22 months later.

ACKNOWLEDGEMENTS We thank the building managers, their residents and staff as well as Pat Barnwell, Kadie Britt, John Glafenhein, and John Rowan from the University of Tennessee for assistance. This material is based upon work that was supported by the National Institute of Food and Agriculture, U.S. Department of Agriculture, under award numbers 2013-34103-21213 and 2013-41530-21214.

REFERENCES CITED Saenz, V., W. Booth, C. Schal, and E.L. Vargo. 2012. Genetic analysis of bed bug (Cimex lectularius L.) populations reveals small propagule size within individual infestations but high genetic diversity across infestations from the eastern U.S. J. Med. Entomol.49: 865-875. Vail, K. and J. Chandler. 2017. Bed Bug Detection in Low-Income, High-Rise Apartments Using Four or Fewer Passive Monitors. J. Econ. Entomol. Doi Wang, C. and R. Cooper. 2011. Detection tools and techniques. Pest Control Tech. August: 72, 74, 76, 78-79, and 112. Wang, C., N. Singh, C. Zha, and R. Cooper. 2016. Bed bugs: prevalence in low-income communities, resident’s reactions, and implementation of a low-cost inspection protocol. J. Med. Entomol. Doi: 10.1093/jme/tjw018. 103

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

USING MONITORS TO DETECT AND ASSIST IN TREATMENT OF THE COMMON BED BUG (HEMIPTERA: CIMICIDAE)

JEFFREY WHITE Director of Innovation and Technical Content, BedBug Central, 351 Lawrence Station Rd., Lawrenceville, NJ 08648

Abstract Cimex lectularius, continues to spread across the world, and developing effective and efficient control and monitoring techniques is the focus of researchers and pest control professionals. In the research presented here, interception devices were implemented as part of a bed bug treatment protocol and the impact the devices had on the bed bug population were evaluated. Results show that interception devices can impact bed bug control by capturing bed bugs between services, many of which were hiding in difficult-to-treat environments and traveling towards the host for food. Interception devices were also evaluated as a tool to assist in the detection of bed bug infestations by installing the monitors in all apartments within a building. Installing devices combined with visual inspections was effective in detecting infestations. Stand-alone interception devices detected low-level bed bug infestations: 68% within 4 weeks of installation compared to 57% by visual inspection, and they were 20-64% more efficient to use in whole-building monitoring programs. Results of these studies provide insight on how to control bed bugs more efficiently and effectively.

Key words Inspection, trap, BlackOut®, ActivVolcano™, Climbup®, detection

INTRODUCTION Bed bugs, Cimex lectularis L., were a common pest in the United States prior to World War II. Due to the introduction of DDT and other residual pesticides to the commercial marketplace, bed bugs were pushed to the brink of elimination in many developed countries. In the past 20-30 years many of the residual pesticides that pushed bed bugs towards elimination have been banned for use inside homes thus opening the door for the resurgence of this insidious pest. Bed bug infestations are now on the rise in all 50 states within the U.S. as well as increasing in many countries across the world (Usinger, 1966; Potter, 2006; Potter, 2011; Potter et al., 2015). Due the widespread resistance to synthetic pyrethroids being reported within bed bug infestations, many pest management professionals and researchers are searching for alternatives to assist in detecting and controlling bed bugs (Davies et al., 2012; Dang et al., 2013). Interception devices, which can be used both to detect infestations and assist in treatment, are one tool that has drawn the attention of both researchers and PMP’s. These devices are pitfall traps that can be placed either under the legs of furniture or as stand-alone devices that can trap bed bugs as they move around an infested home (Potter et al., 2013; Cooper et al., 2015c). Several studies have also demonstrated the positive impact the installation of interception devices across entire communities can have on the management of community-wide bed bug infestations. Installing these devices in every apartment overcomes the complication of residents not reporting infestations and assists in reducing the number of bed bug infested units to an acceptable level (Cooper et al., 2015a; Wang et al., 2016). To date though, data has been needed to further evaluate the time required to install interception devices in all apartments across a community so that protocols can 104 J. White Using Monitors To Detect And Assist In Treatment Of The Common Bed Bug be streamlined and allow these programs to be more affordable to implement. In addition to be used to detect infestations, interception devices can also be used as part of a bed bug treatment protocol to assist in reducing the number of bed bugs present in an infested home (Koganemaru and Miller, 2013; Cooper et al., 2015b). That being said, although the positive effects these devices have on bed bugs have been demonstrated through several studies, nearly half of pest control companies surveyed as part of a study published in 2015 incorporate these devices into their detection and management protocols (Potter et al., 2015). In one study interception devices were installed under the legs of bed and couches after treatment was rendered to further evaluate the number of bed bugs that could be captured by these devices between services to demonstrate how many bed bugs were not addressed by an initial bed bug treatment. Also, a high-rise building in Canton, OH that was struggling to address community-wide bed bug infestations had monitors installed under the beds in all apartments. In addition, visual inspections were conducted in all units to compare the detection rate of monitors and visual inspections in low- level bed bug infestations. Lastly, operational efficiencies were compared when using under-the-leg interception devices versus free-standing devices to provide data to suggest the feasibility of building- wide installation of these devices for community-wide bed bug management.

MATERIALS AND METHODS Interception Devices as Part of a Treatment Protocol. Bed bug services rendered by Cooper Pest Solutions (Lawrenceville, NJ) were used to complete this study. On the initial service, all bed bugs within the infested home were counted prior to service. Service would then be rendered according to Cooper Pest Solutions bed bug protocol which included the use of pesticides, bed encasements, steam and vacuums. No preparation of the apartment by the tenants was completed prior to service. After the initial service was rendered, Climbup Insect Interceptors® were installed under the legs of the beds and couches. Approximately 10 days after treatment the bugs collected by the interception devices were counted. Bed bugs collected in the inner well versus the outer well of the devices was noted.

Stand-alone Interception Devices for Proactive Detection. The study was conducted in a 199-apartment complex located in Canton, Ohio. The apartment complex had a history of sporadic bed bug issues and management had been unable to reduce the incidences of bed bugs to an acceptable level. At the start of the study 7 bed bug infested units were known to exist by property management and installation of the monitors was conducted by Gold Seal Pest Control (Indianapolis, IN) which was assisted by the management team of the apartment complex. The apartments were divided into three groups and three treatments were installed into the apartments: 1) 2 ActivVolcano’s™ under each bed placed on the floor near the head legs of the bed; 2) 4 ActivVolcano’s™ installed next to each bed leg (or the corner four bed legs); 3) 4 Volcano’s® installed next to each bed leg (or the corner four bed legs). Devices were then left for 2 weeks and inspected for the presence of bed bugs. If no bed bugs were detected the devices were left in place for an additional two weeks and inspected again. If bed bugs were found in the devices after two weeks, the apartment would be scheduled for treatment. At the 4-week conclusion of the study the monitors were inspected and a 5-10 minute visual inspection was conducted in each unit (visual inspection would involve turning the bed and couch over and inspecting all hiding places within those pieces of furniture). If bed bugs were collected by the monitors or noted during visual inspection, all bed bugs were counted to determine the extent of the infestation.

Comparison of Operational Time of Two Interception Devices. A low-income, governmentally subsidized apartment complex was selected from North Bergen, NJ. The apartments selected for the study consisted of 103 high-rise apartments contained within 3 buildings and 52 garden-style apartments. Approximately half of the apartments in the study would receive 2 SenSci ActivVolcano’s™ under every Using Monitors To Detect And Assist In Treatment Of The Common Bed Bug 105 bed and couch. One device was installed on each side of the head of the bed (two devices total) and one device to each side of the back of the couch (2 devices total). The other half of the apartments would receive a BlackOut Bed Bug Detector® under each leg of the bed and couch. On the first day of the study each apartment was visually inspected for 1-2 minutes. Any easily visible area of the mattress and box spring was briefly inspected as well as the ceiling-corners and walls. If bed bugs were noted on the visual inspection the apartment would still receive monitors to determine if the monitors would detect the infestation until the apartment could be treated by pest management professionals. After inspection each apartment received the aforementioned devices. The time to install the devices by floor in the high-rise buildings or by building within garden-style apartments was recorded. The total time for each floor or building was divided by the number of apartments to acquire an average time per apartment. Two weeks after installation, all monitors were inspected. The time to inspect the devices by floor in the high-rise buildings or by building within garden-style apartments was recorded. The total time for each floor or building was divided by the number of apartments to acquire an average time per apartment. Monitors were then placed back under the beds. If bed bugs were detected by the monitors, the apartment was visually inspected and the bed bugs observed were counted to determine the extent of the infestation. The apartment was then scheduled for treatment. If monitors were missing upon inspection the missing monitors were recorded and replaced. Four weeks after monitor installation, all monitors were inspected. All BlackOut® monitors were cleaned using a microfiber cloth and placed back under the legs of the bed or couch. ActivVolcano™ monitors do not require cleaning due to their design and after inspection were placed back under the bed or couch. The time to inspect the devices by floor in the high-rise buildings or by building within garden- style apartments was recorded. The total time for each floor or building was divided by the number of apartments to acquire an average time per apartment. If bed bugs were detected by the monitors, the apartment would be visually inspected and the bed bugs observed were counted to determine the extent of the infestation. The apartment was then scheduled for treatm1ent. If monitors were missing upon inspection the missing monitors were recorded and replaced. Week 4 concluded the study.

RESULTS Interception Devices as Part of a Treatment Protocol. At the start of the study there were 746 bed bugs of all developmental stages noted in 116 apartments (an average of 6.43 bed bugs per apartment). Two weeks after installation the interception devices collect 1619 bed bugs of all developmental stages (an average of 13.96 bed bugs per apartment). Within the interception devices, 1328 bed bugs were collected in the outer trap well and 291 bed bugs were collected in the inner trap well (Table 1).

Table 1. Number of bed bugs observed prior to treatment and collected by Climbup® Insect Interceptors two weeks after treatment.

Prior to Treatment Number of apartments 116 Total number of bed bugs Observed 746 Average number of bed bugs observed 6.43 Two Weeks After Monitors Installed Total number of bed bugs captured 1619 Average number of bed bugs captured 13.96 Bed bugs in outer wall 1328 Beg bugs in inner wall 291 106 J. White Using Monitors To Detect And Assist In Treatment Of The Common Bed Bug

Stand-alone Interception Devices for Proactive Detection. While property management knew of 7 infestations at the start of the study, 29 apartments were confirmed to have active bed bug infestations through the use of monitors and visual inspection (Figure 1). In 8 of the 29 apartments the infestations were found by visual inspection in the couch where monitors were not placed (monitors were only placed under the bed). In addition, the monitors were tampered with in 2 infestations. The 8 infestations found in the couch and 2 infestations where the monitors were tampered with were taken out of the sample size and further analysis was conducted on the 19 infestations where bed bugs were confirmed in the beds. Due to a small sample size of only 19 infestations detected within bedrooms, all treatment groups were combined and the data was analyzed as infestations detected by monitors under bed versus “infestations detected by visual inspection”.

Of the 19 infestations found associated with the beds, all but 2 were found to be low level infestations (less than 20 bed bugs found upon inspection). Within 2 weeks of installation 6 of 19 infestations were detected by the monitors under the bed. Four weeks after installation the detection count increased to 13 of 19 infestations being detected by the monitors (68.4% detection rate of primarily low level infestations). At the conclusion of the 4 week monitor evaluation, visual inspection detected 11 of 19 infestations (57.9% detection rate of primarily low level infestations). In 8 of the 13 infestations where monitors detected infestations, the visual inspection was unable to detect bed bugs. In 6 of the 11 infestations where visual inspection detected bed bugs, the monitors did not collect bed bugs (Figure 2).

Comparison of Operational Time of Two Interception Devices. Installation of SenSci ActivVolcano™ in 51 high-rise apartments required 3.24 minutes per apartment on Day 1, while follow-up inspections in 53 apartments of ActivVolcano™ on Day 14 and 28 required 2.62 min/apt and 2.63 minutes per

Figure 1. Number of infestations known by management prior to whole-building inspection and number of infestations found by both monitors and visual inspections.

Figure 2. Number of infestations detected by monitors 2 and 4 weeks after installation compared to the number of infestations detected by visual inspection and total number of infestations detected. Using Monitors To Detect And Assist In Treatment Of The Common Bed Bug 107 apartment, respectively. Installation of BlackOut Bed Bug Detector® in 48 high-rise apartments required 4.53 minutex per apartment on Day 1, while follow-up inspections of 48 apartments with BlackOut® on Day 14 and 28 required 3.76 minute per apartment and 4.07 minutes per apartment, respectively (Table 2). Installation of SenSci ActivVolcano™ in 34 garden-style apartments required 4.18 minutes per apartment on Day 1, while follow-up inspections in 32 apartments of ActivVolcano™ on Day 14 and 28 required 3.51 minutes per apartment and 4.14 minutes per apartment, respectively. Installation of BlackOut Bed Bug Detector® in 25 garden-style apartments required 6.84 minutes per apartment on Day 1, while follow-up inspections of 26 apartments with BlackOut® on Day 14 and 28 required 4.29 minutes per apartment and 5.65 minutes per apartment, respectively (Table 2).

Table 2. Overview of the average time to install and inspect SenSci ActivVolcano™ bed bug monitors and BlackOut Bed Bug Detectors® per apartment and the increase in time to install and inspect BlackOut® during the study.

High-Rise Apartments SenSci BlackOut Bed Bug Operational Time Activity / Day ® ActivVolcano™ Detector Increase (BlackOut®) Average time to install - 3.24 min/apt 4.53 min/apt 39.8% Day 0 Average time to inspect - 2.62 min/apt 3.76 min/apt 43.5% Day 14 Average time to inspect - 2.63 min/apt 4.07 min/apt 58.6% Day 28 Garden-Style Apartments SenSci BlackOut Bed Bug Operational Time Activity / Day ActivVolcano™ Detector® Increase (BlackOut®) Average time to 4.18 min/apt 6.84 min/apt 63.6% install - Day 0 Average time to inspect - 3.51 min/apt 4.29 min/apt 22.2% Day 14 Average time To inspect - 4.14 min/apt 5.65 min/apt 36.5% Day 28

108 J. White Using Monitors To Detect And Assist In Treatment Of The Common Bed Bug

Table 3. Percentage of missing monitors on day 14 and day 28 inspections.

High-Rise Apartments SenSci ActivVolcano™ BlackOut Bed Bug Detector® Day 14 4.3% 3.3% Day 28 4.9% 2.8% Garden-Style Apartments SenSci ActivVolcano™ BlackOut Bed Bug Detector® Day 14 5.3% 3.9% Day 28 4.1% 4.6%

In the high-rise apartments a total of 4.3% and 4.9% of ActivVolcano’s™ were missing from apartments during the day 14 inspection and day 28 inspections and BlackOut® were missing from 3.3% and 2.8%, respectively. In the garden-style apartments a total of 5.3% and 4.1% of ActivVolcano’s™ were missing from apartments during the day 14 inspection and day 28 inspections and BlackOut® were missing from 3.9% and 4.6%, respectively (Table 3). No infestations were detected across the entire community by the 1-2 minute visual inspection conducted in every unit at the start of the study as well as the 14 day inspection of the monitors. Two bed bug infestations were detected in the high-rise portion of the property on the day 28 inspection in apartments that received BlackOut Bed Bug Detectors®. Both units were treated shortly after they were detected. The two infestations detected on day 28 were the only two infestations found on the property during the study.

DISCUSSION The most important topic being researched today may be evaluating methods to address pesticide resistance through integrated pest management approaches to bed bug control. Interception devices are proving to be a great option for pest management professionals to consider which can provide value as both a treatment and detection tool. When evaluating Climbup Insect Interceptors® as part of a treatment program, over 1600 bed bugs were collected after the first treatment was rendered which demonstrates how many bed bugs are often missed during a first service. Over 80% of the bed bugs collected were trapped in the outer well of the interception device which suggests those bed bugs were hiding in areas away from the beds and couches and traveling to the bed to feed on the human sleeping within it. This study illustrates the value interception devices can provide in a bed bug treatment protocol by capturing host seeking bed bugs as they travel throughout an infested home thus reducing the stress and bites received by the resident. In addition, interception devices can reduce the time required by PMP’s treating the home by not having to search through personal belongings and areas away from the bed in search of every last bed bug. In addition to assisting in the treatment of bed bug infestations, previous research has indicated that under-the-leg interception devices can provide assistance in proactively detecting infestations. These community-wide monitoring programs thus lead to the proactive treatment of unknown infestations that were not being reported by the tenant and reducing community-wide infestations. The study conducted in Canton, OH, illustrated that stand-alone interception devices provide similar value as part of a proactive monitoring program in a high-rise apartment community. Past research conducted at Rutgers University Using Monitors To Detect And Assist In Treatment Of The Common Bed Bug 109 has demonstrated that under-the-leg interception devices (such as Climbup® or BlackOut®) can detect 90% of low-level infestations with two weeks of installation (Cooper et al., 2015a). This study in Canton, OH is the first study to evaluate stand-alone interception devices as part of a building-wide monitoring program. Although the study did demonstrate that stand-alone devices may only detect approximately 70% of low-level infestations within 4 weeks of installation, the design of the device does not require lifting the bed or couch to place the devices under the legs and does not need to be cleaned periodically. In addition, the devices detected approximately 70% of low-level bed bug infestations compared to a 57% detection rate by visual inspections. The study demonstrated that combining the use of stand-alone devices with a visual inspection is an effective approach to proactively inspection and treat building- wide bed bug infestations. While research has indicated that community-wide monitoring programs can dramatically reduce bed bug infestations across entire communities, the feasibility of implementing and cost- effectiveness of these programs has been questioned. The cost of the interception devices and time required to install, inspect and treat any infestations found is often high and many communities that need these programs struggle to find available time and funds to implement these programs. While under- the-leg interception devices may be the most effective monitor to detect bed bug infestations, the time required to install the devices under furniture legs and clean them monthlymay make implementing the programs difficult for management companies to afford. Stand-alone interception devices provide an alternative to under-the-leg devices. Although the detection rate was slightly lower than under-the-leg interception devices, when combined with a 5-10 minute visual inspection all infestations were detected by stand-alone devices and the time and money saved by using these devices may provide another option for management companies to consider. Not having to install stand-alone devices under the legs nor clean them on future follow-ups reduces the amount of time required to use the devices by 20-64% depending upon the type of apartment being inspected. In addition, although the rate of missing devices was slightly higher for the SenSci ActivVolcano™ (average of 4.7% for ActivVolcano™ and 3.7% for BlackOut®), neither missing device rate was considered significant by the management company that implemented the programs. These studies demonstrate that interception devices can provide value both as part of a treatment protocol and to proactively detect bed bugs. Under-the-leg interceptors (BlackOut®) increase the chance that you detect an infestation if one is present but the devices must be installed under the legs to optimize the detection rate and should be cleaned once-per-month to prevent bugs from escaping. Stand-alone interception devices (ActivVolcano™) may detect a few less infestations compared to under-the-leg interceptors but still detect a high-rate of infestations and reduce the time investment required to use the device by not requiring to move the bed to install or clean them periodically. Both devices should be seen as effective methods to detect bed bug infestations and offer management companies multiple options to detect infestations proactively.

ACKNOWLEDGEMENTS I thank Dr. Richard Cooper of Cooper Pest Solutions for assisting in the collection and analysis of data included in this manuscript.

REFERENCES CITED Cooper, R., C. Wang and N. Singh. 2015(a). Evaluation of a model community-wide bed bug management program in affordable housing. Pest Mgt. Science. 72 (1(: 45-56. Cooper, R., C. Wang, and N. Singh. 2015(b). Effects of various interventions, including mass trapping with passive pitfall traps, on low-level bed bug populations in apartments. Journal of Economic Entomology 109(2): 762-769. 110 J. White

Cooper, R., C. Wang and N. Singh. 2015(c). Mark-release-recapture reveals extensive movement of bed bugs (Cimex lectularius L.) within and between apartments. PLoS ONE 10(9): e013642. doi: 10.1371/journal.pone.0136462. Dang, K., D.G. Lilly, and S.L. Doggett. 2013. Bed bugs and insecticide resistance: Implications for pest managers. Pest Magazine (Jul/Aug): 25-27. Davies, T.G.E., L.M. Field, and M.S. Williamson. 2012. The re-emergence of the bed bug as a nuisance pest: implications of resistance to the pyrethroid insecticides. Journal of Medical and Veterinary Entomology 26: 241–254. Koganemaru, R. and D.M. Miller. 2013. The bed bug problem: Past, present, and future control methods. Pesticide Biochemistry and Physiology 106: 177–189. Potter, M.F. 2006. The perfect storm: An extension view on bed bugs. American Entomologist 52: 102-104. Potter, M.F. 2011. The history of bed bug management with lessons from the past. American Entomologist 57: 14–25. Potter, M.F., J.R. Gordon, M.H. Goodman and T. Hardin. 2013. Mapping bed bug mobility. Pest Control Technology 41(6): 72-74, 76, 78, 80. Potter, M.F., K.F. Haynes, and J. Fredericks. 2015. Bed bugs across America: the 2015 bugs without borders survey. Pestworld (Nov/Dec): 4–14. Singh, N., C. Wang and R. Cooper. 2012. Interactions among carbon dioxide, heat, and chemical lures in attracting the bed bug, Cimex lectularius L. (Hemiptera: Cimicidae). Psyche, 1-9pp. Usinger, R.L. 1966. Monograph of Cimicidae. Volume 7, Thomas Say Foundation Series, Entomological Society of America, College Park, MD, 585pp. Wang, C., N. Singh, C. Zha and R. Cooper. 2016. Bed bugs: Prevalence in low-income communities, resident’s reactions, and implementation of a low-cost inspection protocol Journal of Medical Entomology, doi 10.1093/jme/tjw018. 111

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

FIRST OCCURRENCE OF LASIUS NEGLECTUS (HYMENOPTERA: FORMICIDAE) IN ZURICH, SWITZERLAND: DISTRIBUTION AND CONTROL MEASURES

ISABELLE LANDAU, GABI MUELLER, AND MARCUS SCHMIDT Dept. of Environment and Health, Urban Pest Advisory Service, Walchestrasse 31, CH-8006 Zurich

Abstract In July 2015 the Invasive Garden Ant, Lasius neglectus, was identified during control measures in an apartment house in the city of Zurich. This was the second finding of this species in Switzerland and the first finding in an inhabited area. In order to find out the distribution of the population, the surroundings were sampled for ants in October 2015. The population of L. neglectus was not considered to have strong invasive character yet. Knowing of the invasive potential of this species, the Urban Pest Advisory Service (UPAS) and the section Neobiota of the Environment Department Kanton Zurich nevertheless decided to carry out a survey to investigate the extent of the L. neglectus populations. The survey included a zone of 42 ha around the actual infestation and another 40 risk locations in the greater Zurich area. These included horticultural areas, demolition waste dumps, compost works, parks, cemeteries etc. In 2016, L. neglectus was only found in the infestation area of 4.2 ha, including parks with old trees, a school, apartment houses, small gardens, backyards and business buildings, but not in any of the other monitoring sites. In summer 2016 control measures were mainly taken outside, because by then ants were not a problem inside buildings. UPAS and the section Neobiota of the Kanton Zurich decided that eradication is a long-term objective and thus, the monitoring and control measures will continue in 2017.

Key words Invasive garden ant, tramp ants, eradication, control measures, ant survey

INTRODUCTION Lasius neglectus (Van Loon, Boomsma and Andrásfalvy, 1990), known as the invasive garden ant, has its natural range in the area of , and Uzbekistan. It was originally described from a population in the city of Budapest (Van Loon et al., 1990; Boomsma et al. 1990). It is a polygynous, unicolonial species without colony barriers and has no nuptial flight (Espadaler and Rey, 2001). Through movement of potted plants, turf peat, soil material etc. L. neglectus has unintentionally spread westwards to many European countries (ISSG, 2011; CABI datasheet Lasius neglectus). The most northern supercolony is in the city of Rostock (Germany), where two separate populations are actually expanding (Kai Gloyna, personal communication). L. neglectus has many of the typical tramp ant characteristics. It is often found in disturbed or highly degraded habitats, has many queens, disperses by budding, and has relatively small workers (Van Loon et al., 1990; Seifert, 2000; Espalader et al. 2004). Unlike the argentine ant Lintpithema humile (Mayr 1866), L. neglectus can tolerate cold winters with average temperatures of -5° C and therefore colonize more northern regions in Europe (Seifert, 2000). L. neglectus can be found in anthropogenic urban areas, from city streets to semi-urban lots with some natural vegetation or gardens. Honeydew producing aphids on trees and shrubs are a key food resource for the ants. However, L. neglectus may also invade homes and other buildings and can become a nuisance to residents, a pest in food preparation areas and it can occupy insulations, electrical conduits and installations, causing short- circuits or damage to electronic devices (Scholl, 2012; Boase, 2014). 112 I. Landau, G. Mueller, and M. Schmidt First Occurrence Of Lasius neglectus In Zurich, Switzerland

In Switzerland, L. neglectus was found in industrial wasteland near Geneva in 2008 (Neumeyer, 2008). The workers had been detected by chance and were apparently not bothering anybody. Other ant-species were present on the sight. During a second inspection, no L. neglectus could be found (R. Neumeyer, I. Landau, G. Mueller, and M. Schmidt personal communication). Whether this population is still existing is unknown. The finding in Zurich is the second case of this invasive garden ant in Switzerland. In summer 2015, a local pest control technician took control measures against ants in an apartment building in the city of Zurich. Quick-witted he realised that these ants were smaller than the usually found Lasius-species and not bicoloured. The company sent some ants to the ant specialist Bernhard Seifert (Germany, Görlitz), who identified them asLasius neglectus. Subsequently, the Urban Pest Advisory Service of the city of Zurich (UPAS) and the section Neobiota of the Environment Department Kanton Zurich (SNEKZ) were informed. These two involved departments decided to work together and coordinate all the necessary actions. In order to acquire more knowledge of the dimension of the infestation in the city of Zurich as fast as possible, first inspections were already made in fall 2015 inside buildings and in the surroundings of the infested house that had no more ants in the apartments by that time. If extensive control measures were going to be taken, it had to be confirmed that the colony had a manageable dimension. The first focus was therefore not only to monitor the surroundings of the known infestation, but also other likely places where L. neglectus could have been introduced. Only if there was a single introduction of a population, the aim of eradication would be an option. SNEKS wrote a letter to all pest control companies, explaining that a population of the invasive garden ant L. neglectus had been found in Zurich and asking them to be vigilant when facing ant problems. The companies were invited to send ant samples, because identification is difficult without good equipment and a lot of experience.

MATERIALS AND METHODS Localities Around the initial location three zones were defined: A core zone with the size of 4.2 ha, where L. neglectus was actually found, a transition zone, with the size of 18 ha, and a safety zone, with the size of 42 ha (Figure 1). The core zone included parks with old trees, a school and kindergarten, apartment houses, small gardens, backyards and business buildings. In addition to the three zones, 40 risk locations were defined in the greater Zurich area. These risk locations included: Waste incineration plants, compost works, demolition waste dumps, horticultural plant producers, public parks, recycling centres, cemeteries etc. The locations were very heterogeneous in size and structure.

Ant Surveys All people involved in the survey were trained in how to search, correctly identify ants to the - level in the field and collect and label ant samples. SinceL. neglectus cannot be reliably distinguished from other unicoloured Lasius-species in the field, samples of every population found had to be collected and placed into labelled tubes for identification. In order to define the infestation size of the L. neglectus colony, the UPAS conducted inquiries in 17 houses around the initial infestation site by going from door to door, asking the residents if they had seen any ants and checking the rooms for ant activity. The core zone was systematically surveyed by technicians of a pest control company in August and September 2016. In the transition zone all buildings (outside) were systematically surveyed in two occasions in August 2016. In the safety zone only ant- friendly sites were surveyed. In the 40 risk locations, searching points were defined for each location. The focus was to find L. neglectus-suitable places, and sometimes points were chosen randomly. An instructed pest control technician searched and collected unicoloured ants within about 100m2 for two hours. Some locations were very big (e.g. the zoo) and consequently searching time was extended to up to eight hours. First Occurrence Of Lasius neglectus In Zurich, Switzerland 113

Control Measures For the insecticidal control measures mainly bait gels were used: Advion Ant gel (0.05g/100g Indoxacarb) and Maxforce Quantum Gel (0.03g/100g Imidacloprid). A granulated formulation (Killgerm Spezial Ameisenmittel PM, 5g/kg Permethrin) was used for direct application. Additionally, the emulsifiable concentrate Mioplant Ameisengiessmittel (10 mg/g Permethrin) was diluted with water to a 1% solution either direct pouring into the nests with a watering can or with a compression sprayer. Treatments were applied outdoors on eight occasions from July to September 2016 in all the places where L. neglectus workers were active. In total, the following amount of insecticidal products were used in 2016: 145g gel baits, 60g granulate, 15l of Permethrin emulsion, ready to use.

RESULTS AND DISCUSSION Ant Surveys Inquiries with the inhabitants of 15 buildings around the initial infestation site were made in December 2015 and April/May 2016. In December 2015 no ants were found. Inhabitants of seven buildings reported that they have had problems with ants in the previous summer. In April/May 2016 inhabitants of six buildings reported ant problems and at five of these buildingsL. neglectus workers were found on the inside. During the summer no more ants were found in these buildings, and there were no complaints by inhabitants for the rest of the year. Ant trails and nest entrances were only found outside the buildings, along house walls and along tree-trunks, but also in a pile of bricks behind a garage and along small garden walls. A single nest was found in the bark of a tree, which was covered with small plant debris, making it difficult to discover. The survey showed that L. neglectus only colonized the core zone of 4.2 ha in 2016 (Figure 1). Although we did not deliberately search for other ant species, we found L. brunneus, L. emarginatus and L. niger in almost all the locations. The nests of L. neglectus were not very big and the magnitude of ant trails were by no means as huge as described in places with big supercolonies, like for example in East Sussex, UK (Davies, 2016) or in Hidcote Manor Garden, UK (Boase, 2014). In the Northeast of , a density of 800 workers per m2 was found in the soil (Espalader et al., 2004). The colony in Zürich may have been introduced recently and may not have strong invasive character yet. Cremer et al. (2008) describe that it is typical for invasive species to reveal their destructive potential following a long, inconspicuous lag phase. In 2016 the sampling of the transition and safety zones by a private pest control company showed that they were free of L. neglectus colonies. The survey in the 40 risk locations in the greater Zurich area did not reveal any invasive ants.

Figure 1. Lasius neglectus in city of Zurich 2015-2016; three zones around the infested area.

Figure 1. Findings of Lasius neglectus in the city of Zurich 2015-2016. Three zones around the infested area

114 I. Landau, G. Mueller, and M. Schmidt First Occurrence Of Lasius neglectus In Zurich, Switzerland

Control Measures From July to September 2016, outdoor control measures took place on eight occasions, mostly along the buildings and along trees. Ant samples were always taken to ensure that only L. neglectus would be controlled. Gel baits were directly applied in nest entrances or along ant trails. We observed that ant trails were no longer there after a treatment, but the ant traffic at most nest entrances was still busy. After several treatments with gel, we decided to use a Permethrin emulsion in order to treat nest entrances directly. End of September two pour applications were directly performed with a watering can on the visible nests on the bottom of trees and along the buildings. We also performed two spray applications on the tree trunks with ant trails and on a small hibiscus shrub with aphids that were frequently visited by L. neglectus. The following week the aphids and the ants had disappeared. With these spray applications we tried to interrupt the access to their food sources on the trees as described in Rey and Espalader, (2004). Due to the negative ecological impact, we did not consider applying insecticides on 10-20 m high trees. In a pile of bricks behind a garage a nest site became visible when removing some bricks. On July 21, 2016 we found some alate: 3.5 – 4 mm long L. neglectus ants in this nest, probably males. At four occasions ant gel was applied directly in between eggs, larvae and pupae. After over a month of treatments it became obvious that gel was hardly consumed and the treatments did not lead to the decline of the colony. Permethrin granulate directly placed between the bricks was very effective: one week later little activity was observed. The ants were gone after a repeated application in the few active places between the bricks.

Effects of Lasius neglectus on Other Arthropod Species After control measures with gel baits at the L. neglectus nest entrances on the outer east wall of a school building we found several dead sowbugs, Porcellio scaber (Latreille, 1804), some dead fire bugs, (Linnaeus, 1758), and one dead wood cockroach, vittiventris (Costa, 1847) next to a lot of dead workers of L. neglectus. Nagy et al. (2009) found a negative effect of L. neglectus on different arthropod species. The reasons for the death of these specimens remain unknown. Either they fed directly on the bait or on the contaminated insects (P. apterus feeds on dead insects, too), or they were killed by L. neglectus and left behind, because L. neglectus workers were killed by the baits.

CONCLUSIONS FOR FUTURE ANT SURVEYS AND CONTROL MEASURES Ant surveys as performed at the 40 sites in the greater Zurich are quite costly. Pest control technicians are not used to detect a particular ant species. Lack of qualified people resulted in lower chance to find L. neglectus within the given time. A small L. neglectus-population like the one found in Zurich can easily be overseen and therefore it is uncertain whether there are more undetected L. neglectus colonies in Switzerland. Around Lyon (France), 63 occurrences of L. neglectus were found when searching for native and invasive ant species (of the genera Lasius and Tetramorium) by students and ant specialists for a spatial distribution study (Gippet et al., 2016). In this location the distribution of the ants was favoured by roads. Two different expansion rates are possible: slow expansion by budding and (fast) long distance displacement, when small colony fragments are unintentionally moved by humans. Colony budding has been shown to be two to five orders of magnitude smaller (Espadaler et al., 2007) and even the budding expansion rate can differ a lot. Subsequently, small colonies can grow for years, before they are detected. In Rostock, where no authority could decide to start a costly eradication program, the infested area expanded from 6 ha in 2008 to 10.4 ha in 2013, which is an increase of 68 %. Outside of the infested area, in the botanical garden, two single nests of L. neglectus were found in 2008. Five years later, a population covering 2.7 ha was found (Schultz and Busch, 2009; Spiegelberg, 2014). Control measures are only taken in buildings where they are a nuisance to people. First Occurrence Of Lasius neglectus In Zurich, Switzerland 115

There is one problematic fenced back yard (400 m2) within the core zone in Zurich, where a house owner is storing old electronic and construction equipment. There was one L. neglectus nest at the outside of the fence in October 2015. However, no L. neglectus colonies were found in 2016. This back yard could not be accessed in 2016, so there is no knowledge on ant colonies present in this area. The house owner will have to be informed that access to survey that back yard is needed and that he is only allowed to move the stored equipment if the place is free of L. neglectus. The transition zone will have to be surveyed again in 2017. Additionally, information and education of pest control professionals and of the locally involved inhabitants will be important in the future. For organisational reasons ant treatments could not start before July 2016 and at the end of the season we had only used a small amounts of insecticide. We plan to continue control measures with direct baiting, reducing the impact to the environment as much as possible. Other control strategies like controlling the ant’s food sources (mainly aphids in trees and bushes), as applied in northeast Spain (Rey and Espadaler, 2004), are not planned. We strongly believe though that control measures have to be continued. The aim for the next season is to reduce the area where L. neglectus is found and an eradication of all colonies is planned for the near future. Waiting for the L. neglectus population to collapse, as reported for supercolonies in four European countries (Tartally et al., 2016; Lester and Gruber, 2016), is not an option for Zurich, because the mechanisms explaining the collapse of colonies are not yet understood.

ACKNOWLEDGEMENTS Rainer Neumeyer kindly trained all the involved people in identification and checked all collected ants to make sure that their identification was correct. We thank Severin Schwendener, Diego Bünter, Pascal Frei and their team for valuable discussions about control strategy and ant surveys. Rainer Bobst helped tremendously for the figure. Tim Haye kindly read the manuscript and gave useful comments.

REFERENCES CITED Boase, C. 2014. Lasius neglectus (Hymenoptera: Formicidae) in the UK: status, impact and management. In: Proceedings of 8th International Conference on Urban Pests, July 2014, Zurich, Switzerland. G. Müller, R. Pospischil, W.H. Robinson (eds). 223-228. CABI datasheet Lasius neglectus. http://www.cabi.org/isc/datasheet/29888. Last accessed 2. Feb. 2017. Boomsma, J.J., A.H. Brouwer, and A.J. Van Loon. 1990. A new polygynous Lasius species (Hymenoptera; Formicidae) from Central Europe. II. Allozymatic confirmation of species status and social structure. Insectes Sociaux 37: 363-375. Cremer, S., L.V. Ugelvig, F.P. Drijfhout, B.C. Schlick-Steiner, F.M. Steiner, B. Seifert, D.P. Hughes, A. Schulz, K.S. Petersen, H. Konrad, C. Stauffer, K. Kiran, X. Espadaler, P. d’Ettorre, N. Aktaç, J. Eilenberg, G.R. Jones, D.R. Nash, J.S. Pedersen, and J.J. Boomsma. 2008. The Evolution of Invasiveness in Garden Ants. PLoS ONE 3(12). http://dx.doi.org/10.1371/journal.pone.0003838 (Jan. 30, 2017). Davies, M.P. 2016. Invasive Garden Ant Lasius neglectus confirmed in East Sussex, UK. PCN107: 15. Espadaler, X. and S. Rey. 2001. Biological constraints and colony founding in the polygynous invasive ant Lasius neglectus (Hymenoptera, Formicidae). Insectes sociaux 48: 159-164. Espadaler, X., S. Rey, and V. Bernal. 2004. Queen number in a supercolony of the invasive garden ant, Lasius neglectus. Insectes sociaux 51: 232-238. Espadaler, X., A. Tartally, R. Schultz, B. Seifert, and C. Nagy. 2007. Regional trends and preliminary results on the local expansion rate in the invasive garden ant, Lasius neglectus (Hymenoptera, Formicidae). Insectes Sociaux 54: 293-301. 116 I. Landau, G. Mueller, and M. Schmidt

Gippet, J.M.W., N. Mondy, J. Diallo-Dudek, A. Bellec, A. Dumet, L. Mistler, and B. Kaufmann. 2016. I’m not like everybody else: urbanization factors shaping spatial distribution of native and invasive ants are species-specific. Urban Ecosyst. Published online on 07 July 2016. doi: 10.1007/s11252-016-0576-7 (Jan. 23, 2017). ISSG, 2011. Global Invasive Species Database (GISD). Invasive Species Specialist Group of the IUCN Species Survival Commission. http://www.issg.org/database. Last accessed 2. Feb. 2017. Lester, P.J. and M.A.M. Gruber. 2016. Booms, busts and populations collapses in invasive ants. Biol Invasions. doi: 10.1007/s10530-016-1214-2 Nagy, C., A. Tartally, F. Vilisics, O. Merkl, E. Szita, G. Szél, A. Podlussány, D. Rédei, S. Csösz, G. Pozsgai, A. Orosz, G. Szövényi, and V. Markó. 2009. Effects of the invasive garden ant, Lasius neglectus Van Loon, Boomsma and András-Falvy, 1990 (Hymenoptera: Formicidae), on arthropod assemblages: pattern analyses in the type supercolony. Myrmecological News 12: 171-181. Neumeyer, R. 2008. Ergänzungen zur Artenliste der frei lebenden Ameisen (Hymenoptera: Formicidae) in der Schweiz. Entomo Helvetica 1: 43-48. Rey, S. and X. Espadaler. 2004. Area-Wide Management of the Invasive Garden Ant Lasius neglectus (Hymenoptera: Formicidae) in Northeast Spain. J. Agric. Urban. Entomol. Vol. 21, (2): 99–112. Scholl, E. 2012. Die Vernachlässigte Ameise, Lasius neglectus, in einem fränkischen Mehrfamilienhaus. German PCN issue 50: 20-23. Schultz, R. and T. Busch. 2009. The northernmost record of the invasive garden ant, Lasius neglectus (Hymenoptera: Formicidae). Myrmecological News 12: 183-186. Seifert, B. 2000. Rapid range expansion in Lasius neglectus (Hymenoptera: Formicidae) An Asian invader swamps Europe. Mit. Mus. Naturkunde Berlin, Dtsch. Entomol. Z. 47, 2: 173-179. Spiegelberg, J. 2014. Ökologische Ansprüche und Dominanz der invasiven Ameisenart Lasius neglectus in Rostock. Master Thesis, Universität Greifswald, Zoologisches Institut und Museum Tartally, A., V. Antonova, X. Espadaler, D. Csösz, and W. Czechowski. 2016. Collapse of the invasive garden ant, Lasius neglectus, populations in four European countries. Biol. Invasions. Published online 13 July 2016. doi: 10.1007/s10530-016-1227-x (Jan. 23, 2017). Van Loon, A.J., J.J. Boomsma, and A. Andrásfalvy. 1990. A new polygynous Lasius species (Hymenoptera, Formicidae) from Central Europe. I. Description and general biology. Insectes sociaux 37:348-362. 117

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

SEASONAL OCCURRENCE AND EXPERIENCES WITH THE INVASIVE INSECTS: HALYOMORPHA HALYS (HEMIPTERA: PENTATOMIDAE), LEPTOGLOSSUS OCCIDENTALIS (HEMIPTERA: COREIDAE), HARMONIA AXYRIDIS (COLEOPTERA: COCCINELLIDAE), AND CYDALIMA PERSPECTALIS (LEPIDOPTERA: CRAMBIDAE) IN SWITZERLAND

MARCUS E. SCHMIDT, GABI MUELLER, AND ISABELLE LANDAU Dept. of Health and Environment, Urban Pest Advisory Service, Walchestrasse 31, CH-8006 Zurich

Abstract The invasive species brown marmorated stink bug, western conifer seed bug, harlequin ladybird and box tree moth all appeared in Switzerland within the last 10 years. While the first three species use buildings to over-winter and are a nuisance to home owners in autumn and spring when they enter or leave the buildings, the latter species is a pest of box elder trees and appears mainly from May to September with massive damage to the shrubs. The Urban Pest Advisory Service (UPAS) collects data through people’s complaints, mainly from the city of Zurich, but partly also from a larger area of the country. In this paper we present the collected data of UPAS and other institutions over the years since the appearance of these species, show the different influences on occurrence and discuss the declining inquiries. We also show what measures people have taken and which preventive or control measures are successful.

Key words Alien species, Brown marmorated stink bug, Western conifer seed bug, Multicolored Asian lady beetle, Harlequin ladybird, Box tree moth

INTRODUCTION Foreign plants and animals are invading new areas all over the world. Increasing mobility by plane, ship and train and especially increasing worldwide trade with faster transport ways are mainly contributing to the import and establishment of many foreign plants and animals (Ludwig, 2010). Not all species establish at their introduction. The ones that do and that reproduce strongly and show negative impacts on their environment are defined as invasive species (Nentwig, 2011). The Urban Pest Advisory Service (UPAS) of Zurich has already encountered quite a few invasive species, mainly tropical ants and lately mosquitoes like Aedes japonicus (Theobald, 1901) and Aedes albopictus (Skuse, 1894), but more and more also other species that can become an annoyance to people. The brown marmorated stink bug, Halyomorpha halys (Stål, 1855), the western conifer seed bug, Leptoglossus occidentalis (Heidemann, 1910), the harlequin ladybird, Harmonia axyridis (Pallas, 1771) are considered a nuisance to people because they aggregate in buildings when seeking hibernation sites in autumn. The fourth invasive species, the box tree moth, Cydalima perspectalis (Walker, 1859), is a horticultural pest. H. halys is indigenous to Asia (eastern China, Japan, Korea and Taiwan) and was recorded in 2001 for the first time outside its native range in Allentown, Pennsylvania, USA (Bernon, 2004). This bug is highly polyphagous with more than 100 host plants recorded (Wermelinger et al. 2008; Haye et al. 2014a; CABI datasheet) and is now recognized as serious pest of pome and stone fruit (Bernon, 2004). 118 M. E. Schmidt, G. Mueller, and I. Landau Seasonal Occurrence And Experiences With The Invasive Insects

The origin of L. occidentalis is the west coast of the USA. It was first found in the north Italian province Vicenza in 1999 (Bernardinelli and Zandigiacomo, 2001). Most probably it was displaced to Europe in containers or in wood shipments (Werner, 2011). According to Rabitsch (2005; 2010) multiple introductions and secondary translocations within Europe are thought to be the cause for the spread of this bug in whole Europe. This possibly occurred with trucks transporting goods as well as with the ornamental plant trade. The western conifer seed bug causes direct damage by sucking on the young cones and seeds of conifer trees (mostly of the genus Pinus), therefore reducing the fertility. In Italy, L. occidentalis has also been found on Picea, Cedrus, Abies and Juniperus (Villa et al., 2001). A complete list of about 40 hosts is available in Werner (2011). This polyphagous nutrition helps L. occidentalis to establish and to spread. In North American conifer seed orchards seed losses of up to 50% have been recorded (Bates et al., 2000). Harmonia axyridis, the harlequin ladybird is a well-known aphid predator in its native Asian range. Its origin is central and eastern Asia, with a range extending from the Altai Mountains to the Pacific Coast and Japan and from central Siberia to southern China (Koch, 2003). It was released as biological control agent in North America, dating back to 1916. The first established population was documented in 1988 in North America. Harmonia axyridis has been intentionally released as a biological control agent in many European countries since 1982 (Brown et al., 2008). The first feral populations in Europe were found in Germany in 1999 and in Belgium in 2001. Since then H. axyridis has spread throughout Europe (Roy and Migeon, 2010). C. perspectalis, the box tree moth was found in masses in Riehen near Basel and across the border in Germany in spring 2007 and established and expanded its population from 25 km2 in 2007 to around 640 km2 in 2009 (Leuthard et al., 2010; lepiforum), where they fed on box elder trees until total defoliation and bark damage, which results in the death of the trees (Kenis et al., 2013). As box elder trees are densely leafed and the caterpillars develop on the inside, the damage is not detected until the outer leaves are affected as well. Surveys of plant traders showed that box elder trees in many plant shops were infested with the box tree moth larvae (Leuthardt et al., 2010). It is very probable that the box tree moth was imported from Asia, its origin, with the plant trade. A detailed description of the spread and the distribution of the box tree moth is available on the CABI datasheet. The developmental investigations show that larvae overwinter mainly in their third instar and that a diapause is induced by a day length of about 13.5 h (Nacambo et al., 2014). One and a half to 2 months in the cold are necessary to terminate diapause. MATERIALS AND METHODS The UPAS advises people concerning insects and pests in and around houses. All inquiries are taken up in an online Microsoft Dynamics CRM database with the name of the client, the exact date, the address (location) and the species of concern. Around 2000 inquiries are recorded each year. Selected data from this database and from other sources are taken for the four species and used to show the distributions over time in Zurich greater area and in Switzerland (ESRI arcgis) and also to show the developmental trends (excel bar charts). Other sources, who supplied data for this study are the Centre Suisse de Cartographie de la faune (CSCF), Tim Haye from the Centre for Agriculture and Biosciences International (CABI), Ulrich Schneppat from the Bündner Naturmuseum (BNM), the Swiss Federal Institute for Forest, Snow and Landscape Research (WSL) and the Zurich city gardening department (GSZ). The CSCF in Neuchatel is a foundation that collects faunistic data in Switzerland. Table 1. shows an overview of the used data© and their source.

RESULTS AND DISCUSSION Our data and the literature show that the brown marmorated stink bug and the western conifer seed bug have been introduced to Switzerland at the turn of the century. The harlequin ladybird found its way to Switzerland from France or Germany a couple of years later. After the years of discovery in Seasonal Occurrence And Experiences With The Invasive Insects 119

Zurich, complaints rose in the following years to a peak and then declined to a low level of complaints in 2015 and 2016. Following their discovery in Zurich, the UPAS wrote fact sheets of these invasive pests available on the internet. At the same time the UPAS informed the news channels so articles in newspapers made people aware of these invasive species. This generated a lot more inquiries in the beginning. These three invasive species are still present but our data and our observations show that they do not appear as dominantly as in the previous years. The people have got used to seeing them around and know how to deal with them, so they do not bother to notify UPAS anymore. These seem to be the main reasons why inquiries about these three species have declined in the last years.

Table 1. Origin and number of data cases used for this study.

CABI NMB

Invasive species UPAS GSZ T. Haye U. Schnep- CSCF WSL pat Halyomorpha halys 330 - 230 - 11 40 Leptoglossus occidentalis 96 - - 271 103 47 Harmonia axyridis 141 - - - 608 - Cydalima perspectalis 58 353 - - 150 423

Brown Marmorated Stink Bug The brown marmorated stink bug was first identified from Zurich and its surroundings in2007 (Wermelinger et al., 2008). H. halys is very similar to the indigenous pentatomid bug Raphigaster nebulosa and can easily be confounded with it (Wyniger and Kment, 2010; Haye and Wyniger, 2012). The UPAS already has had inquiries about R. nebulosa since 1995. From 2004 the inquiries for this bug started to rise exponentially (Figure 2). Looking back we realized that 2003 or 2004 R. nebulosa must have been displaced by H. halys in our inquiries, but through their similarity we did not realize the change until the findings of Wermelinger et al. (2008) were published. In our collection we found two specimens from 2006 marked as R. nebulosa that were in fact H. halys. With the correct identification the UPAS received many inquiries about this bug in 2008. The amount of inquiries peaked in 2010, then dropped in 2011, just to reach a high level again in 2013 (Figure 1). Working through light traps catches, Arnold (2009) found H. halys in the catch of Balzers, Lichtenstein from 2004. This does not question Zurich as the first introduction, as we have already had complaints at that time and there is photographic proof of H. halys in Zürich in 2004 (Haye et al., 2014a). It shows that H. halys had been in Switzerland longer than assumed. While inquiries at the UPAS have dropped continuously until 2016, inquiries in other parts of Switzerland, mainly in the canton Ticino, have risen due to Italian H. halys populations moving northwards into Switzerland (pers. communication T. Haye) (Figure 1). The distribution map of H. halys in Zurich (Figure 3.) shows the first findings and the spread in detail. The Swiss map (Figure 4) demonstrates the dispersion to Basel in 2012, then to Bern, Geneva, Winterthur and the canton Ticino in 2013 with inquiries the following years. Haye et al. (2014b) report complaints of people with damage to their fruits (apricots, nectarines, cherries) and berries (raspberries and blackberries) in their gardens. Only one incidence of economic damage in pepper culture under plastic has been reported by a vegetable producer in the Canton Zurich (Sauer, 2012; Haye et al., 2014b). The UPAS had one single case where privately grown apricots along the house wall showed damage. The first author found them occasionally in his garden on raspberry and blackberry fruits and few were marked with a buggy smell. Otherwise we have not had any reports of damage on fruit. In northern Switzerland H. halys is mainly a nuisance pest. The bugs shelter in roller shutter casings, behind facings with air space and under the roof. They are not only a nuisance when 120 M. E. Schmidt, G. Mueller, and I. Landau Seasonal Occurrence And Experiences With The Invasive Insects searching for their overwintering place in September and October. In their shelters they become active on warm winter days and in March when the temperatures rise. Wermelinger (2008) suspects that H. halys was imported with ornamentals. Tim Haye (personal communication) has an explanation. Zurich is the partner city of Kunming, China, and in 1994 a Chinese garden was donated to Zurich by Kunming. In 1998, the roof tiles had to be replaced because they had cracked in the cold winter. The new tiles were imported to Zurich in large boxes directly from the imperial brickworks near Beijing. These boxes may have contained overwintering adults. During the last two years, the population of H. halys in Zurich has not been perceived as a big nuisance and people seem to have got used to them. In the canton of Ticino, in Vienna, Austria and Italy there have been many complaints about mass invasions in 2016 (personal communication T. Haye). They seem to be at the point where Zurich stood in 2008. In southern Europe, where the Mediterranean climate is more suitable for H. halys and two generations can be expected (Haye et al., 2014a). The complaints might therefore not decline after some years like in Zurich and damage to fruit crops like in the USA (CABI Datasheet Halyomorpha halys) is already observed on pear cultures in northern Italy (Bariselli et al., 2016). Halyomorpha halys

100 90 Halyomorpha halys 80 100 70 90 60 80 50 70 40 60 30 50 20 40 10 30 0 20 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 10 0 UPAS CABI WSL CSCF 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016

Figure 1. Frequency of HalyomorphaUPAS CABI halysWSL inquiriesCSCF

Figure 1. Frequency of Halyomorpha halys inquiries

Raphigaster nebulosa

35 Raphigaster nebulosa 30 35 25 30 20 25 15 20 10 15 5 10 0 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 5 Figure0 2. Frequency of “Raphigaster nebulosa” inquiries in Zurich 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007

Figure 2. Frequency of “Raphigaster nebulosa” inquiries in Zurich

Seasonal Occurrence And Experiences With The Invasive Insects 121

Figure 3. Distribution map of Halyomorpha halys in Zurich

Figure 3. Distribution map of Halyomorpha halys in Zurich

Figure 4. Distribution map of Halyomorpha halys in Switzerland

Figure 4. Distribution map of Halyomorpha halys in Switzerland The Western Conifer Seed Bug Even though first records of L. occidentalis are from northern Italy in 1999 (Bernardinelli and

Zandigiacomo, 2001) there are pictures of L. occidentalis by the Swiss photographer Ernst Lienhard from the canton of Ticino in 1994 (archive of AGEO-Aargau, personal communication U. Schneppat). It seems to have been in southern Switzerland and northern Italy for quite a few years longer. The first specimens in the canton of Ticino were however found in 2002 (Colombi and Brunetti, 2002). In 2006 and 2007 the first sightings came from canton Valais and from central Switzerland near the main north-south traffic route (Figure 6). 2006 this species had spread northwards along the main trade 122 M. E. Schmidt, G. Mueller, and I. Landau Seasonal Occurrence And Experiences With The Invasive Insects route in central Switzerland (Altdorf) and near Basel (Wyniger, 2007), close to the German border. In 2007 L. occidentalis spread eastwards to the canton of Valais and to the city of Geneva. In 2008 L. occidentalis was reported to the UPAS from the greater Zurich area. We received inquiries of single specimen in houses frequently in the late autumn of each year. In 2009 a total of around 60 incidences of L. occidentalis were compiled from all available sources. These stayed on a similar level until 2012 (Figure 5). 2013 is the peak year of the reports, after that the sightings declined to a lower level in 2015 and 2016. Already by 2010 the western conifer seed bug had spread through the Swiss midlands (Figure 6). As far as we know, there are no reports of damage to conifer trees in Switzerland. Seeking hibernation sites in buildings L. occidentalis worries people by their appearance. When they are found indoors sitting on walls and people try to pick them off, they move away slowly emitting a smell of fresh green apple. Many people worried that this bug might be a cockroach or a wood pest capable of damaging their house. In one case a pest professional even offered expensive control measures for Hylotrupes bajulus in the roof, because a series of L. occidentalis were found in the nursery in the house. Once the people know that this bug is harmless, they do not worry about it anymore. We advise the people to collect the bugs and deposit them outdoors. The supplier of most data, U. Schneppat, confirms that although L. occidentalis is spreading in Europe, it is present in most of Switzerland but on a low level with no signs of damage.

Leptoglossus occidentalis

120

100

80

60

40

20

0 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016

UPAS BNM CSCF WSL

Figure 5. Frequency of Leptoglossus occidentalis inquiries / findings

Figure 6. Distribution map of Leptoglossus occidentalis in Switzerland

Leptoglossus occidentalis

120

100

80

60

40

20

0 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016

UPAS BNM CSCF WSL

Figure 5. Frequency of Leptoglossus occidentalis inquiries / findings

Seasonal Occurrence And Experiences With The Invasive Insects 123

Figure 6. Distribution map of Leptoglossus occidentalis in Switzerland

Harlequin Ladybird Harmonia axyridis was found in 2006 in high density in the canton Basel and in nine other cantons in northern Switzerland (Brown et al., 2008; Eschen et al., 2007). The UPAS in Zurich and the CSCF had first reports in autumn of 2007. In October 2008 the UPAS had almost 50 complaints about mass aggregations of the harlequin ladybird on outer walls and inside houses (Figure 7). This mainly occurred on sunny and rather warm days. It was not the ladybird itself but the large aggregations on and in their houses that worried people. In addition to this kind of nuisance the ladybirds produce a foul smelling yellow secretion, which is part of the hemolymph (Pospischil, 2008). Inside buildings this discolours wall covering and furnishings (Strand, 2009). Our recommendations for complaints are to seal all obvious openings of the building, install insect nets on the windows used for aeration and then to vacuum-clean the ladybirds that enter the building as Kenis et al. (2007) recommend as well. We neither recommend inside nor outside insecticide applications. The first for toxic reasons, the latter because the pyrethroid insecticides available degrade in a couple of weeks and treatments would have to be repeated to be effective. While complaints to the UPAS have declined strongly, the CSCF, whose members collect data in the field, have found H. axyridis spread all over Switzerland at an increasing rate except for 2016 where findings dropped (Figure 7 and 8). One explanation is that the collectors didn’t look for H. axyridis in 2016 as much as in the years before. The other is that in 2016 we had a very wet and cool June, which was bad for the aphid development and subsequently might have influenced the development ofH. axyridis.

Harmonia axyridis 124 M. E. Schmidt, G. Mueller, and I. Landau Seasonal Occurrence And Experiences With The Invasive Insects 140

120

100 80 Harmonia axyridis

140 60

120 40

100 20

80 0 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 60 UPAS CSCF 40 Figure20 7. Frequency of Harmonia axyridis inquiries / findings 0 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016

UPAS CSCF

Figure 7. Frequency of Harmonia axyridis inquiries / findings

Figure 8. Distribution map of Harmonia axyridis in Switzerland

Box Tree Moth Cydalima perspectalis reached the canton of Zurich in 2009 and in 2010 the UPAS had its first inquiries (Figure 9). UPAS and GSZ had no enquiries in Zurich in 2011, but 2012 was a strong year of infestation withFigure a peak 8. Distribution of complaints map of (Figure Harmonia 9). axyridis With optimal in Switzerland conditions the moth can develop up to 3 generations in a season (Leuthard et al., 2010; CABI Datasheet), which seemed to be the case in 2012. The inquiries dropped in the next years and stayed at a very low level during the following years (Figure 9). The data of WSL and CSCF show that C. perspectalis is continuously spreading over the Swiss midlands and the canton Ticino (Figure 10.) and can locally lead to strong infestations. The plant protection specialist Wolfgang Billen from southern Germany confirms that in the German area north of Basel and also around the city itself the box tree moth is only present on a low level (personal communication), because there are hardly any box elder trees left over. The same applies to Vorarlberg Seasonal Occurrence And Experiences With The Invasive Insects 125 in Austria (Klaus Zimmermann, personal communication). Many of the box elder trees have been removed, because they often had a shabby appearance and people did not want to apply insecticides all the time. The gardening stores and horticultural plant nurseries warn people about the box tree moth so they hardly plant these shrubs anymore. The box elder trees left over are often infested with the fungal pathogens Cylindrocladium buxicola (Henricot, 2002) and Volutella buxi (Corda, 1838) which hardly leave any edible leaves for the caterpillars and with strong infestations kills the box elder plants (personal communication W. Billen; Kenis et al., 2013). Still C. perspectalis is spreading northwards in the black forest and along the Rhine river valley. Once the box elder trees are defoliated, they take a long time to recover and the following generation of box tree caterpillars is left without any food resources. In Zurich the UPAS and the gardening department advise the people to check plants early and hand-pick or shake the caterpillars from small, single trees (Stecher and Buckelmüller, 2012). With big trees or whole hedges we recommend the use of the environmentally compatible Bacillus thuringiensis var. israelensis product Delfin in the susceptible first and second larval stages for a successful treatment (Oelhafen et al., 2012; Stecher and Buckelmüller, 2012; Kenis et al., 2013). The gardening department in Zurich has treated their box elder trees in the public parks mainly with Delfin and most have survived the attacks and look healthy again. The box tree moth has not become a bigger problem since 2012. Natural enemies can also contribute to the decline of the box tree moth. Elph (2013) reports about house sparrows, Passer domesticus (Linnaeus, 1758) and wasps (Vespidae) eating the caterpillars. Further citations have appeared the following years (Vorarlberger Nachrichten, 2013 and 2014 and Elph, 2013) that confirm the sightings of birds feeding on the caterpillars. This adapted behaviour of passerine birds might contribute to contain the development of the box tree moth population.

Cydalima perspectalis

500

450

400

350

300

250

200

150

100

50

0 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016

UPAS GSZ WSL CSCF

Figure 9. Frequency of Cydalima perspectalis inquiries / findings

Figure 10. Distribution of Cydalima perspectalis in Switzerland

Cydalima perspectalis

500

450

400

350

300

250

200

150

100

50

0 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016

UPAS GSZ WSL CSCF

126 Figure 9. FrequencyM. of E.Cydalima Schmidt, perspectalis G. Mueller, andinquiries I. Landau / findings Seasonal Occurrence And Experiences With The Invasive Insects

Figure 10. Distribution of Cydalima perspectalis in Switzerland

CONCLUSIONS The declining inquiries to UPAS in the last years and the overall data show that all four invasive species are present in Switzerland, but mostly not causing much nuisance like at the early stage of their discovery. While the harlequin ladybird and the western conifer seed bug have spread over most parts of Switzerland and are present in low levels, the brown marmorated stink bug is spreading slower and seems to establish selectively in cities and in warmer regions. The box tree moth is expanding its range as well. After a few years of infestation the moth is present at a low level as there are no more box elder trees or as the remaining are monitored and treated consequently. Through expanding into new areas, new food sources are found for mass development and new damage is done. Box elder trees will become rare in private gardens of Europe and will mainly be cultivated in places where a professional pest control can be managed.

ACKNOWLEDGEMENTS We thank Ulrich Schneppat (BNM), Tim Haye (CABI), Franz Meier (WSL), Simon Capt (CSCF) and Max Ruckstuhl (GSZ) for supplying additional data on the different invasive species. Rainer Bobst kindly helped with all the distribution figures. We also thank Tim Haye and Beat Wermelinger for proofreading and additional comments to the manuscript.

REFERENCES CITED Arnold, K. 2009. Halyomorpha halys (Stål, 1855), eine für die europäische Fauna neu nachgewiesene Wanzenart (Insecta: Heteroptera: Pentatomidae: Cappaeini). Mitteilungen des Thüringer Entomologenverbandes e.V. 16: 19. Bariselli, M., R. Bugiani, and L. Maistrello. 2016. Distribution and damage by Halyomorpha halys in Italy. EPPO Bulletin 46: 332-334. DOI:10.1111/epp.12289 Bates, S.L., J.H. Borden, A. Savoie, S.E. Blatt, C.G. Lait, A.R. Kermode, and R.G. Bennett. 2000. Impact of feeding by Leptoglossus occidentalis (Hemiptera: Coreidae) on the major storage reserves of mature Douglas-fir (Pinaceae) seeds. Canadian Entomologist 132: 91–102. Seasonal Occurrence And Experiences With The Invasive Insects 127

Bernardinelli, I. and P. Zandigiacomo. 2001. Leptoglossus occidentalis Heidemann (Heteroptera: Coreidae): A conifer seed bug recently found in northern Italy. In: Knizek, M., B. Forster, and W. Grodzki (eds): Methodology of forest insect and diseases survey in Central Europe. Proceedings of the 4th international Workshop of the IUFRO WP 7.03.10, Praha (Czech Republic), September 17–20, 2001. Journal of Forest Science, 47, Special Issue 2: 56 – 58. Bernon, G. 2004. Biology of Halyomorpha halys, the brown marmorated stink bug (BMSB). Final report. United States Department of Agriculture APHIS CPHST, 17 pp. Brown, P.M.J., T. Adriaens, and H. Bathon. 2008. Harmonia axyridis in Europe: spread and distribution of a non-native coccinellid. Biocontrol 53: 5–21. CABI Datasheet Halyomorpha halys (brown marmorated stink bug). http://www.cabi.org/isc/ datasheet/27377, last accessed 24. Jan. 2017. CABI Datasheet Harmonia axyridis (harlequin ladybird). http://www.cabi.org/isc/datasheet/26515, last accessed 28. Jan. 2017. CABI Datasheet Cydalima perspectalis (box tree moth). http://www.cabi.org/isc/datasheet/118433, last accessed 31. Jan. 2017. Colombi, L. and R. Brunetti. 2002. Rapporto del Servizio fitosanitario del cantone Ticino. Servizio fitosanitario, Bellinzona, 36 pp. Elph, P. 2013. “Spatzen fressen den Buchsbaumzünsler”. https://philipp1112.wordpress. com/2013/07/09/spatzen-fressen-den-buchsbaumzunsler/. Last accessed 1. Feb. 2017. Eschen, R., D. Babendreier, S. Nauer, F. Bigler, and M. Kenis. 2007. Surveys for ladybirds (Coleoptera: Coccinellidae) in Switzerland and confirmation of the presence of the invasive alien ladybird species, Harmonia axyridis (Pallas). Mitteilungen der Schweizerischen Entomologischen Gesellschaft 80 (1-2): 7-16. Haye T., S. Abdallah, T. Gariepy, and D. Wyniger. 2014a. Phenology, life table analysis, and temperature requirements of the invasive brown marmorated stink bug, Halyomorpha halys, in Europe. Journal of Pest Science, published online, DOI: 10.1007/s10340-014-0560-z. Haye, T., D. Wyniger, and T. Gariepy, 2014b. Recent range expansion of brown marmorated stink bug in Europe. In: Proceedings of the Eighth International Conference on Urban Pests, 20–23 July 2014, Zurich, Switzerland. G. Müller, R. Pospischil, and W.H. Robinson (editors). 309–314. Haye, T. and D. Wyniger. 2012. Brown marmorated stink bug, Halyomorpha halys. Private homepage with all relevant information to the species and registration program for Switzerland. www.halyomorphahalys.com , last accessed 26. Jan. 2017. Kenis, M., S. Nacambo, F.L.G. Leuthardt, F. di Domenico, and T. Haye. 2013. The box tree moth, Cydalima perspectalis, in Europe: horticultural pest or environmental disaster? Alien 33: 38–41. Kenis, M., H. E. Roy, R. Zindel, and M.E.N. Majerus. 2007. Current and potential management strategies against Harmonia axyridis. Biocontrol(53): 235 - 252. DOI: 10.1007/s10526-007- 9136-7. Koch, R.L. 2003. The multicolored Asian lady beetle, Harmonia axyridis: A review of its biology, uses in biological control, and non-target impacts. Journal of Insect Science. 3:32. 1-16. http:// www.insectscience.org/. Leuthardt, F., W. Billen, and B. Baur. 2010. Ausbreitung des Buchsbaumzünslers Diaphania perspectalis (Lepidoptera, Pyralidae) in der Region Basel – eine für die Schweiz neue Schädlingsart. Entomo Helvetica 3: 51-57.

128 M. E. Schmidt, G. Mueller, and I. Landau

Lepiforum. http://www.lepiforum.de/lepiwiki.pl?Cydalima_Perspectalis. Last accessed 29. Jan. 2017. Ludwig, M. 2010. Invasion – Wie fremde Tiere und Pflanzen unsere Welt erbobern. Ulmer Verlag. Nacambo, S., F.L.G. Leuthardt, H. Wan, H. Li, T. Haye, B. Baur, R.M. Weiss, and M. Kenis. 2014. Developmental characteristics of the box-tree moth Cydalima perspectalis and its potential distribution in Europe. Journal of Applied Entomology 138: 14–26. DOI: 10.1111/ jen.12078 Nentwig, W. (2011). Unheimliche Eroberer - Invasive Pflanzen und Tiere in Europa. Haupt Verlag. Oelhafen, A., E. Fischer, and B. Gentizon. 2012. Hervorragende Wirkung von Delfin gegen den Buchsbaumzünsler. AG Journal: 13. Pospischil, R. 2008. Der asiatische Marienkäfer, Harmonia axyridis. Der praktische Schädlingsbekämpfer 4: 10-11. Rabitsch, W. and E. Heiss 2005. Leptoglossus occidentalis HEIDEMANN, 1910, eine amerikanische Adventivart auch in Österreich aufgefunden (Heteroptera: Coreidae). Ber. nat.-med. Verein Innsbruck, Band 92: 131–135. Rabitsch, W. 2010. True Bugs (Hemiptera, Heteroptera). Chapter 9.1. In: Roques, A. et al. (Eds). Alien terrestrial arthropods of Europe. BioRisk 4 (1): 407–403. DOI: 10.3897/biorisk.4.44. Roy, H. and A. Migeon. 2010. Ladybeetles (Coccinellidae). Chapter 8.4. In: Roques, A. et al. (Eds). Alien terrestrial arthropods of Europe. BioRisk 4(1): 293–313. DOI: 10.3897/biorisk.4.4. Sauer, C. 2012. The marmorated tree bug occurs new in the Swiss horticulture. (Die Marmorierte Baumwanze tritt neu im Deutschschweizer Gemüsebau auf.) Extension Gemüsebau, Forschungsanstalt Agroscope Changins-Wädenswil, Gemüsebau Info, 28(12): 4-5. Stecher, R. and J. Buckelmüller. 2012. Auch 2012 verursacht der Buchsbaumzünsler wieder grosse Schäden-Was tun gegen den Buchsbaumzünsler? UMWELTPRAXIS Nr. 69 / Juli 2012. www. umweltschutz.zh.ch. Strand, R. 2009. Harlequin ladybirds - Harmonia axyridis - with attitude. pest: Issue 6: 8-9. Villa, M., G. Tescari, and S.J. Taylor. 2001. Nuovi dati sulla presenza in Italia di Leptoglossus occidentalis (Heteroptera: Coreidae). Boll. Soc. ent. ital. 133(2): 101 – 112. Vorarlberger Nachrichten (Zud). 2013. Tierische Rettung der Buchsbäume. Samstag/Sonntag, 10. /11. August. Vorarlberger Nachrichten (Hk). 2014. Buchsbaumzünsler hat Schrecken verloren. Mittwoch, 30. Juli. Wermelinger, B., D. Wyniger, and B. Forster. 2008. First records of an invasive bug in Europe: Halyomorpha halys Stål (Heteroptera: Pentatomidae), a new pest on woody ornamentals and fruit trees? Mitteilungen der Schweizerischen Entomologischen Gesellschaft (81): 1–8. Werner, D.J. 2011. Die amerikanische Koniferen-Samen-Wanze Leptoglossus occidentalis (Heteroptera: Coreidae) als Neozoon in Europa und in Deutschland: Ausbreitung und Biologie. Entomologie heute (23): 31-68. Wyniger, D. 2007. Erstnachweise von Leptoglossus occidentalis (Heteroptera, Coreidae) auf der Schweizer Alpennordseite und weitere Funde aus dem Tessin. Mitteilungen der Schweizerischen Entomologischen Gesellschaft 80 (3-4): 161-166. Wyniger, D. and P. Kment. 2010. Key for the separation of Halyomorpha halys (Stal) from similar- appearing pentatomids (Insecta: Heteroptera: Pentatomidae) occuring in Central Europe, with new Swiss records. Mitteilungen der Schweizerischen Entomologischen Gesellschaft (83): 261-270. 129

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

GLOBAL INVASION HISTORY OF THE TERMITE RETICULITERMES FLAVIPES (ISOPTERA: RHINOTERMITIDAE) AS REVEALED BY THREE CLASSES OF MOLECULAR MARKERS

1EDWARD L. VARGO, 2ELFIE PERDEREAU, 2FRANCK DEDEINE, AND 2ANNE-GENEVIÈVE BAGNÈRES 1Department of Entomology, Texas A&M University, College Station, TX, U.S.A. 2Institut de Recherche sur la Biologie de l’Insecte, UMR CNRS 7261, Parc Grandmont, UFR Sciences & Techniques, Université F. Rabelais, 37200 Tours, France

Abstract The subterranean termite, Reticulitermes flavipes, is native to North America. In its native range, it is widely distributed in the central and eastern U.S.A. where it plays a significant ecological role as a decomposer of cellulose and is a major pest of human built structures. It has been introduced to many locations in the world where it attacks buildings, including France, Chile, Uruguay, Canada and the Bahamas. To understand the invasion history of this species, we sampled termites from throughout its native and introduced range and applied three sets of molecular genetic markers: mitochondrial DNA sequence data (cytochrome oxidase II gene), microsatellite genotypes (15 loci) and single-nucleotide polymorphisms (SNPs; >13,000 loci). All three sets of markers are consistent in pointing toward the source of the French populations being New Orleans, Louisiana, a result also supported by the similarity of the breeding structure of colonies in New Orleans and in France. In addition, the SNP markers suggested that New Orleans was the likely source of several other introduced populations including the Bahamas, Germany, one population in Canada, and possibly the Chilean population. Thus, New Orleans seems to have served as a source of introduced populations around the world on multiple occasions.

Key words Invasive species, mitochondrial DNA, microsatellite markers, single-nucleotide polymorphism

INTRODUCTION Termites are prominent species in many tropical and temperate ecosystems where they play an important role in carbon cycling by consuming and digesting cellulose. They can also be important pests of human-built structures where they can cause significant damage. Several termite species are invasive and cause damage in their introduced ranges (Evans et al. 2013). The eastern subterranean termite, Reticulitermes flavipes (Kollar), is native to much of central and eastern United States where it is an important decomposer of woody material as well as a major wood-destroying insect pest. It has been introduced to many places around the world, including France, Germany, Chile, Uruguay, Canada, and the Bahamas (Evans et al. 2013). It has become a significant pest in many of these areas, especially France, Chile and Canada (Dronnet et al. 2004, Smith et al. 2006, Scaduto et al. 2012). We have conducted recent studies to try and pinpoint the sources of invasive populations, especially those in France (Perdereau et al. 2013, Perdereau et al. 2015). In this paper, we combine results from newly published work based on microsatellite genotyping and mitochondrial DNA sequencing with unpublished results using single nucleotide polymorphisms to identify potential source populations. Our results suggest that most introduced populations originated from the area around New Orleans, Louisiana. 130 E. L. Vargo, E. Perdereau, F. Dedeine, and A. Bagnères Global Invasion History Of The Termite Reticulitermes flavipes

MATERIALS AND METHODS Microsatellite genotyping was performed on 170 samples collected from along the East Coast and Gulf Coast of the United States and throughout the invasive range in France. A portion of the cytochrome oxidaseII gene was sequenced from 209 individuals collected from throughout the United States and introduced populations in France, Germany, Chile, Uruguay, and the Bahamas. Details of the locations of these samples are described in Perdereau et al (2013). Single nucleotide polymorphism (SNP) genotyping was carried out on 288 samples, 155 from native throughout the native range and 114 from introduced populations. Nineteen samples of R. virginicus Banks were included as an outgroup. Samples were subjected to double-digest restriction-associated DNA sequencing (dd RADseq) on an Illumina HiSeq 4000 using paired end chemistry. We obtained a total of 2.4 trillion reads for an average of 8.5M reads per individual, which provided about 9 X coverage. From these reads, we identified ~13,500 SNPs.

DATA ANALYSIS Microsatellite genotype data were analyzed using the program Structure (Pritchard et al. 2000). Phylogenetic analysis of the mitochondrial DNA sequence data was performed using four different methods as described by Perdereau et al. (2013). SNPs were identified using the SOAP denovo 2 package (Luo et al. 2012). We then generated a maximum likelihood tree based on pair-wise genetic distance using R studio.

RESULTS AND DISCUSSION Microsatellite genotypes clustered into three main groups: eastern U.S., Gulf Coast and southern Louisiana. Samples from France clustered with the southern Louisiana group, which consisted primarily of samples from New Orleans. A Bayesian phylogenetic tree and minimum spanning network both showed that samples from introduced populations shared close affinity with samples from the New Orleans area. These results are given in detail by Perdereau et al. (2013). The maximum parsimony tree generated from the SNP data show several distinct branches; most of the introduced samples were placed on branches with samples from Louisiana. One branch contains all the French samples, one from Uruguay, eight of 12 samples from Canada and a sample from the Bahamas. The only U.S. samples in this branch came from the New Orleans area. The Chilean samples were in a branch that included a sample from Uruguay and one from the Bahamas. There was also a sample from New Orleans included in this branch. There was a branch that consisted exclusively of Louisiana samples except for one sample that was from Germany. The exceptions to the association with Louisiana samples was an individual sample from Easter Island, one from the Bahamas and four from Canada that were included in a branch with samples primarily from the North Central part of the U.S. Results from three classes of genetic markers point to Louisiana, particularly New Orleans, as the source of introduced populations of R. flavipes in several countries. A study of colony breeding structures in native and introduced populations also supports a Louisiana origin for populations in France and Chile. Perdereau et al. (2015) showed that populations in France and Chile consisted of a mixture of colonies headed by multiple inbreeding neotenic (replacement) reproductives (called extended families) and colonies with multiple unrelated reproductives (called mixed families). Whereas populations in the U.S. consist mainly of colonies with simple families (single king and queen) and extended families, the population around New Orleans had colony breeding structures very similar to those in France and Chile. The fact that many of the introduced populations are associated with different lineages from Louisiana is consistent with multiple separate introductions from Louisiana over a period spanning over 200 years into such places as Canada, France, Chile, Germany, Uruguay and the Bahamas, rather than a single introduction into some area that then served as a bridgehead for introductions into other areas. Global Invasion History Of The Termite Reticulitermes flavipes 131

CONCLUSIONS The eastern subterranean termite R. flavipes has been introduced to at least eight locations from Europe to South America. Genetic data from three classes of genetic markers point to Louisiana, most likely New Orleans, as the source of nearly all of these infestations. These introductions began in France in 1790 with the most recent being the Bahamas in 1998, and appear to have occurred through separate introduction events. Thus, Louisiana has been the source of serial introductions into other countries. Given the number of port cities within the native range of R. flavipes, it suggests something unique about shipments from Louisiana that promotes the spread of this termite.

ACKNOWLEDGEMENTS We thank Laura Johnson for technical assistance and Sichen Wang for help with statistical analyses. Financial support was provided by the Endowed Chair in Urban Entomology fund at Texas A&M University.

REFERENCES CITED Dronnet, S., A.-G. Bagnères, T. R. Juba, and E. L. Vargo. 2004. Polymorphic microsatellite loci in the European subterranean termite, Reticulitermes santonensis Feytaud. Molecular Ecology Notes 4: 127-129. Evans, T. A., B. T. Forschler, and J. K. Grace. 2013. Biology of invasive termites: A worldwide review. Annual Review of Entomology 58: 455-474. Luo, R., B. Liu, Y. Xie, Z. Li, W. Huang, J. Yuan, G. He, Y. Chen, Q. Pan, Y. Liu, J. Tang, G. Wu, H. Zhang, Y. Shi, Y. Liu, C. Yu, B. Wang, Y. Lu, C. Han, D. W. Cheung, S.-M. Yiu, S. Peng, Z. Xiaoqian, G. Liu, X. Liao, Y. Li, H. Yang, J. Wang, and T.-W. Lam. 2012. SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler. GigaScience 1: 18. Perdereau, E., A.-G. Bagnères, S. Bankhead-Dronnet, S. Dupont, M. Zimmermann, E. L. Vargo, and F. Dedeine. 2013. Global genetic analysis reveals the putative native source of the invasive termite, Reticulitermes flavipes, in France. Molecular Ecology 22: 1105-1119. Perdereau, E., A. G. Bagnères, E. L. Vargo, G. Baudouin, Y. Xu, P. Labadie, S. Dupont, and F. Dedeine. 2015. Relationship between invasion success and colony breeding structure in a subterranean termite. Molecular Ecology 24: 2125-2142. Pritchard, J. K., M. Stephens, and P. Donnelly. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945-959. Scaduto, D. A., S. R. Garner, E. L. Leach, and G. J. Thompson. 2012. Genetic evidence for multiple invasions of the eastern subterranean termite into Canada. Environ. Entomol. 41: 1680-1686. Smith, J., N.-Y. Su, W. Ye, R. Ripa, R. H. Scheffrahn, and R. M. Gilbin-Davis. 2006. An areawide population management project for the invasive eastern subterranean termite (Isoptera: Rhinotermitidae) in a low-income community in Santiago, Chile. American Entomologist 52: 253-260. 133

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

CONTROLLING HOUSE MICE IN THE FOOD INDUSTRY

JOHN SIMMONS AND CHRIS SWINDELLS Acheta Consulting Ltd, Front Street, Churchill, Winscombe, North Somerset, UK, BS25 5N

Abstract In recent years we have lost many rodenticide products, and seen increased regulatory restrictions on the way in which remaining products may be used. In the food industry, client-imposed restrictions further limit usage options. House mice (Mus domesticus) remain a major challenge to control, even without such developments, and our experience suggests that around 10-20% of all food manufacturing plants in the UK experience resident mouse infestation. Using an electronic monitoring system, we have demonstrated that some of the rodent baits and traps used in ‘conventional’ monitoring programmes may be an extremely unreliable indicator of activity, with a high degree of behavioural resistance sometimes evident. This has long been known about, or at least suspected, but has rarely been quantified. The implications of this from the viewpoint of controlling mice are profound. Electronic monitoring systems are a useful tool for studying rodent behaviour in the field.

Key words Behavioural resistance, Baits, traps, electronic monitoring,

INTRODUCTION Humphries et al. (1992), working in central Birmingham, the second largest city in the UK, demonstrated that house mice in this urban area avoided conventional cereal-based rodent baits, a phenomenon they termed ‘behavioural resistance’. Further work (Humphries et al., 2000) indicated both a genetic component to the aversion, and recognition that these urban mice exhibited both a degree of neophobia to new foods, and to the receptacles that food is presented in. Driven largely by food safety concerns relating to the potential contamination issues presented both by rodenticides, and the poisoned rodent, the use of rodenticides to monitor and control mice has declined dramatically in the global food industry in recent years. Most food safety related standards include some degree of prohibition on rodenticide use. Trapping based systems, for both monitoring and control, have seen a resurgence, and numerous electronic monitoring systems are now appearing, which claim to detect rodents through either the presence of the animal alone, through consumption of food within a feeding station, or through activation of a trapping device. We are not aware of any statistics concerning the proportion of food manufacturing and storage facilities that experience house mouse infestation. A review of rodent activity within our customer base of 180 food manufacturing facilities, over a 12-month period, (Figure 1), indicated that about three- quarters had experienced either no, or very sporadic, mouse activity. A further 5% had experienced recurring activity, but for reasons we believed to be associated with regular re-importation, for example within incoming goods or packaging, or in empty returned food containment trays and baskets. However, we considered that just over one-fifth of the 180 sites had experienced mouse infestation for an extended period, often the full 12-months, indicative of infestation that was resident within the fabric of the 134 J. Simmons and C. Swindells Controlling House Mice In The Food Industry building. Communication with two UK-based pest control companies produced comparable figures of 8 and 20%, so we consider that it is reasonable to speculate that between 10 and 20% of food manufacturing facilities in the UK have a resident population of house mice. Our extensive experience of working in mainland Europe leads us to further speculate that the situation there is no different. Such levels of infestation obviously have extremely significant food safety implications.

Figure 1. Proportion of UK food manufacturing facilities with house mouse infestation (data generated from Acheta’s client database)

The aim of this study was to investigate whether an electronic rodent monitoring system could offer an alternative to the conventional monitoring approaches based on baits and traps. In-so-doing, could such systems better help detect rodent behavior that might indicate some degree of behavioural resistance?

MATERIALS AND METHODS GreenTrapOnline (GTO) is a wireless electronic system designed specifically for monitoring rodents. A typical GTO set-up (Figure 2) consists of a central control box, routers to boost the signal around the building, and individual detectors, which detect rodent presence using a passive infrared (PIR) sensor. An email alert is triggered by the combination of body heat and movement as the rodent passes beneath the sensor. The system can be combined with conventional bait and trapping stations but, and most importantly for our purposes, the detectors can also be used as standalone monitors, triggered by rodent presence alone.

Figure 2. The main components of the GTO system; con- trol box, router and sensor. Controlling House Mice In The Food Industry 135

The site chosen for the trial was a large (c. 1,000,000 ft2) supermarket distribution centre, which had experienced an extensive and very long-standing (believed to be 10 years or more) infestation of house mice. 25 monitoring locations were selected. Evidence for rodent activity at these locations ranged from none, through to widespread evidence for long-established infestation; the latter being typified by numerous droppings and/or heavy smearing. At each location, we placed four separate monitoring devices, detailed below, and shown in Figure 3:

1. A GTO detector, secured to a length of upturned plastic guttering. Under the guttering was placed a non-toxic bait (Rentokil’s Non-Tox Indicator Paste), and a band of fluorescent tracking dust (Killgerm Yellow Fluorescent Tracking Dust).

2. A plastic bait station (Killgerm AF Advance Mouse Box), containing the non-toxic paste bait.

3. A cardboard bait station (Killgerm No. 4 Cardboard Bait Box), containing the non-toxic paste bait.

4. A plastic trapping station (Killgerm AF Snappa), containing a break-back trap (Snap-E Mouse Trap), and baited with a commercial rodent attractant (Provoke Mouse Attractant, Bell Laboratories).

Figure 3. The four monitoring Figure 4. Footprints in UV tracking dust devices used within the trial. where mice have emerged from the plastic guttering.

The paste bait chosen was one that we knew to be highly palatable to house mice in situations where widespread alternative food was available. Provoke was chosen because it is an attractant that is widely used by pest control operatives. The plastic bait and trapping stations are similarly widely used, and a cardboard bait station was included because it is often stated that mice will enter cardboard bait stations in preference to plastic ones, though the use of cardboard bait stations is problematic in the food industry because of the lack of tamper-resistance. The detectors were left in place for two weeks, with all detections during that period recorded on the GTO central server, accessed via a dedicated portal. All 100 monitors (4 monitors at each of 25 locations) were re-visited at regular intervals (every 3-4 days) through the trial to check on their condition, and to check for evidence of mouse activity. 136 J. Simmons and C. Swindells Controlling House Mice In The Food Industry

RESULTS AND DISCUSSION

Efficacy And Reliability of GTO As A Monitor of Mouse Activity Activations were recorded by 9 of the 25 GTO sensors. The number of activations during the trial, at these 9 locations, varied from 1 to 105. At every one of the 9 locations where mouse activity was recorded there was actual physical evidence for mouse presence found, manifested by footprints through the tracking dust (Figure 4). At none of the 16 GTO locations where there was no activity detected was evidence for mouse activity found. It can therefore be concluded that GTO is a reliable means for detecting the presence of rodents, recording neither false positives nor false negatives.

Efficacy and Reliability Of Baits and Traps As A Monitor Of Mouse Activity One full-take and one part-take was noted on the non-toxic paste baits placed under the guttering housing the GTO sensors. It can therefore reasonably be assumed that mice had encountered this bait at 9 locations, but had chosen to ignore it at 7 of these. Similarly, there were no takes of bait in any of the plastic bait stations, and evidence (UV dust footprints) that mice had entered only one of these stations (Figure 5). The situation was only marginally better with cardboard bait stations, mice having entered one of these, partially consuming the bait in the process. The trapping boxes caught nothing, and the only box where there was any evidence for mice having entered was in one station where the trap had been accidentally activated (Figure 6). Supporting the evidence for mice avoiding baits and traps, and the boxes holding them, was evidence which showed clearly that mice were deliberately avoiding the boxes (Figure 7).

Figure 5. Footprints passing through one Figure 6. Mouse movement over the of the plastic bait stations. treadle of accidentally activated trap.

Implications From A Mouse Control Viewpoint Rodenticide baits and trapping devices (typically break-back traps or glue-boards) are the principal means for monitoring for mouse presence on a global basis. Evidence that they are deliberately avoiding such devices has significant implications in terms of under-estimating populations, particularly if inspection for other supporting evidence is insufficiently rigorous. Similarly, such devices are the mainstay of control programmes in those premises where mice are present, so the public health and food safety implications are profound if mice can no longer be controlled using such products.

Electronic Monitoring As A Tool For Rodent Behavioural Studies Studying the behaviour of rodents in the field is challenging. Tracking dusts and plates will detect presence, and give some indication of the degree of activity. Cameras activated by heat and motion will also highlight presence, but placing sufficient numbers to build a picture of movement and activity throughout a building is probably impractical with current technology. The development of rodent-specific electronic monitoring systems offers an important tool for studying rodent movement in the field. Controlling House Mice In The Food Industry 137

Sensors relying simply on rodent movement and body heat to trigger an alert offer a reliable means for monitoring both presence and activity patterns. The ability to install these at many locations within a building allows an accurate picture of spatial distribution and movement to be constructed. Furthermore, activity patterns can be determined, with clear peaks of activity being evident when the detector activations in this trial are broken down by time of day (Figure 8).

Figure 7. Mouse footprints showing clear avoidance of bait and trap stations.

SCOPE FOR FURTHER STUDY Electronic monitoring provides a useful tool for both monitoring rodents on a commercial basis, and for academic studies into rodent behavior. However, the results from those electronic monitoring systems which rely on, for example, food consumption or trap activation, should be considered with caution, due to potential behavioural resistance concerns such as were clearly evident in this trial. It is hypothesized that control practices over many years at the site concerned may have selected for mice that are naturally reluctant to enter bait and trapping stations. Whether there is a genetic component to such behaviour is not known, but this can certainly be suspected. It is believed that this is a wider problem than is currently recognized amongst the pest management industry. The apparent behavioural resistance observed in this study merits further investigation.

Figure 8. Detector activations by time of day; data generated during week 2 of the trial.

REFERENCES CITED Humphries, R.E., AP. Meehan, and R.M. Sibly. 1992. Characteristics and history of behavioural resistance in inner-city house mice in the UK. Proc. Vertebrate Pest Conf., University of California, USA, March 1992, 161-164. Humphries, R.E., R.M. Sibly, and A.P. Meehan. 2000. Cereal aversion in behaviourally- resistant house mice in Birmingham, UK. Appl. Anim. Behav. Sci., 66, 323-333. (erratum vol 69, 175-176) 139

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Caroline Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Essex TN22 1PH UK

DOUBLE STANDARDS IN SPRING TRAP WELFARE: ENDING INEQUALITY FOR RATS (RODENTIA: MURIDAE), MICE (RODENTIA: MURIDAE) AND MOLES (INSECTIVORA: TALPIDAE) IN THE UNITED KINGDOM

SANDRA E. BAKER, DAVID W. MACDONALD, AND STEPHEN A. ELLWOOD Department of Zoology, University of Oxford, OX3 1PS, UK

Abstract Spring traps require welfare approval in the UK, but break-back traps, for rats and mice, and mole traps are exempt. Mechanical tests on a wide range of these unregulated traps showed that impact momentum varied 6-8-fold, and clamping force varied 4-5.5-fold, among traps for use with each of rats, mice and moles. There was considerable overlap between the strongest mouse traps and weakest rat traps for each force. A post-mortem and x-ray study of 50 spring-trapped moles revealed that none sustained damaged skulls or cervical vertebrae; they were, therefore, unlikely to have become unconscious immediately. Some moles appeared superficially to have broken spines, but in fact they had incurred only soft tissue damage and no broken vertebrae. The primary identifiable cause of death in trapped moles was acute haemorrhage. A minority of moles may have asphyxiated, but evidence for this was weak. Given the scale of rat, mouse and mole trapping in the UK, the wide range of unregulated traps available, and doubts raised regarding their humaneness, this research suggests an urgent imperative to abandon a puzzling double standard, and thereby to reduce the welfare impact of unregulated spring traps for rats, mice and moles. There is a strong case that all traps should be subjected to comparable approval standards. In the meantime, we propose a Voluntary Trap Approval (VTA) scheme under which manufacturers would submit traps for approval testing in the same way as for regulated traps. All approved traps could be given a certification mark and trap suppliers might choose to sell only approved traps, thus edging non-approved traps out of the market.

Key words Apodemus sylvaticus, Mus musculus, Rattus norvegicus, Talpa europaea, voluntary trap approval scheme

INTRODUCTION Spring traps are widely used for killing small mammals in the United Kingdom. While most spring traps are, as might be expected, legally required to meet welfare approval standards, break-back traps (for killing rats [Rattus norvegicus (B.)] and mice [e.g. Mus musculus (L.), Apodemus sylvaticus (L.)]), and mole (Talpa europaea (L.)) traps, have been exempt since the 1950s, when welfare approval for spring traps was first introduced. In 1951, the UK Committee on Cruelty to Wild Animals produced a report which concluded that, “It should be made illegal for any spring trap to be used, the design of which has not been approved by the Minister of Agriculture and Fisheries and the Secretary of State for Scotland, and those Ministers should approve only spring traps which will catch and kill wild animals without causing them unnecessary suffering” (Scott Henderson, 1951). However, the Committee remarked that the rat was “regarded as one of the greatest animal pests…a menace to public health” and that “its control and destruction are essential”; they then concluded, without evidence, that break-back traps caused no unnecessary suffering. The Committee also said that they had no evidence that mole trapping caused unnecessary suffering, although one (unnamed) organisation had raised the possibility that “the ordinary 140 Sandra E. Baker, David W. Macdonald, and Stephen A. Ellwood Double Standards In Spring Trap Welfare: Ending Inequality for Rats type of mole-trap was too weak to kill instantaneously”; they consequently concluded that there was no need to make special recommendations regarding mole trapping. In 1954, The Pests Act implemented the Committee’s recommendations, making it illegal to use a spring trap for killing or taking animals in England, Scotland or Wales, other than a trap approved by an order of the Secretary of State, but with the exception of “traps of any description specified by order of the Minister of Agriculture and Fisheries as being adapted solely for the destruction of rats, mice or other small ground vermin” (http://www.legislation.gov.uk/ukpga/Eliz2/2-3/68/section/8). Four years later, The Small Ground Vermin Traps Order 1958 defined these exempt traps as: “(1) Spring traps known as break-back traps and commonly used for the destruction of rats, mice or other small ground vermin; (2) Spring traps of the kind commonly used for catching moles in their runs”. Sixty years on, these exemptions seem difficult to justify, when welfare approval is required both for: (a) other (non-break-back) spring traps used for rats and mice; and (b) spring traps used for other species with similar capacities for suffering (Mellor et al., 2009). A utilitarian view - one seemingly taken by the 1951 Committee - might be that lower welfare standards are acceptable when an animal is deemed a particularly numerous or serious pest. However, one clearly consistent view is that an absolute welfare standard should be applied (Dubois et al., 2017) and even if pragmatism favours a cost-benefit approach, it does not call for abdication of standards.

WELFARE IMPACT OF UNREGULATED TRAPS Together, rats, mice and moles probably constitute the majority of animals killed in spring traps in the UK, arguably many thousands each year. And spring-trapping is the most frequently reported method of attempting to control moles on British farms and amenities, now that strychnine is banned for this purpose (Baker et al., 2016). Under the exemption from regulation, a plethora of break-back trap designs has become available and mole traps of three main types (scissors, Duffus, talpa) are made by several different manufacturers (Baker et al., 2012). These unregulated traps vary widely in price and apparent quality, and their humaneness has been questioned (Rudge, 1963; Atkinson et al., 1994; Baker et al., 2012, 2015). Mechanical trap performance is widely accepted as an indicator of trap welfare performance (International Organization for Standardization, 1999; Talling and Inglis 2009). We measured impact momentum and clamping force to examine the scope for improving the welfare standards of unregulated traps (Baker et al., 2012). We sourced 41 types of break-back trap (18 for rats, 23 for mice) and 14 combinations of mole trap types and brands. Mole traps were manufactured from metal, while break- back traps consisted of wooden, plastic or metal bodies and either plastic or metal striking bars. Break- back traps also varied in terms of spring type and trap-opening angle (as measured in the set position). We found that impact momentum varied 6-8-fold, and clamping force 4-5.5-fold, among traps intended for killing each species, and there was considerable overlap between the strongest mouse and weakest rat traps for each force (Figures 1 and 2). Both impact momentum and clamping force differed significantly between mole trap types (scissors, Duffus and alpa), and among brands within each of the three types (Figure 2). Of course, it is possible that the strongest traps were greatly over-engineered and that even the weakest traps for each species were sufficiently powerful to cause irreversible unconsciousness within an acceptable time. However, given that, on average, brown rats are 20 times heavier than mice (Macdonald and Barrett, 1993), it is of particular concern that the weakest rat traps were less powerful than some mouse traps. We found no relationship between trap price and the mechanical performance of rat, mouse or mole traps, except in the case of one type of mole trap - the talpa trap - where more expensive brands of talpa trap produced greater clamping forces. This research indicates significant scope for reducing the welfare impact of unregulated spring traps for rats, mice and moles and suggests that exemption from regulation has encouraged the proliferation of ineffective and inhumane traps (Baker et al., 2012). Double Standards In Spring Trap Welfare: Ending Inequality for Rats 141

Different types of break-back trap, in our study, contained one of four different types of spring, while their opening angles, when set, ranged between 45 and 180 degrees. We found that both spring type and opening angle were important predictors of impact momentum and clamping force (Baker et al., 2012). In general, larger opening angles were associated with greater impact momentums, and smaller opening angles with greater clamping forces, while both impact momentum and clamping force were greater in traps with ‘double-peg’ springs. Spring traps that crush the skull are considered the most efficient and humane (Proulx and Barrett, 1991; Mason and Littin, 2003), and damage to the skull or upper cervical vertebrae may cause immediate unconsciousness (Parrott et al., 2009). While both clamping force and impact momentum may contribute to the death of a trapped animal, traps with larger impact momentums are likely to cause more immediate damage (see Warburton and Hall, 1995), so our study indicates that, in our sample, traps with large opening angles and ‘double-peg’ springs were likely to have better welfare impacts. The recent proliferation of weaker, plastic break-back traps - often with ‘jaw’ type springs and smaller opening angles (designed so that users avoid touching working parts and dead animals), is of particular welfare concern. In an effort to examine the welfare impact of mole traps in the field, we conducted a separate post-mortem study of 50 moles, spring-trapped by pest controllers using either scissors or Duffus traps in the course of their normal business (Baker et al., 2015). X-rays revealed that none of the trapped moles had sustained damaged skulls or upper cervical vertebrae, and so moles were unlikely to have become unconscious immediately (see Parrott et al., 2009). Indeed, while no moles had broken vertebrae, some had sufficient soft tissue damage around the capture point that, upon external inspection, their spine appeared broken. However, any possible spinal cord damage would have been unlikely to cause unconsciousness in a short time-frame. Mole trappers finding moles in this condition might believe they are killing moles quickly (Baker et al., 2015). The primary identifiable cause of death among moles in our study was acute haemorrhage, and moles were likely to have experienced something between the two extremes of: (a) a major blood vessel being severed, with the animal losing consciousness and dying very quickly through exsanguination and shock; and (b) a minor blood vessel being severed, with the animal taking longer to die but becoming unconscious before dying (Baker et al., 2015). Moles were unlikely to have bled to death over several hours because, if bleeding was that slow, clotting mechanisms would have come into play and there would have been evidence that moles died of other causes, such as dehydration and starvation. Most moles (94%) were captured at the thorax, abdomen or both, and the rest at the shoulders or hip. One mole, captured at the thorax/abdomen, had broken ribs. A minority of moles (those captured at the shoulder, thorax or thorax-abdomen) may have died of asphyxiation, but we would have expected to find more evidence of this, such as damage to the trachea or larynx, haemorrhage in the respiratory tract or more animals with fractured ribs. If some moles did asphyxiate, they were likely to experience something between the two extremes of: (a) complete obstruction of the airways; and (b) slight compression of the ribcage reducing the amount of oxygen entering the bloodstream (Baker et al., 2015). In their mole trapping studies, Rudge (1963) and Atkinson et al. (1994) reported moles trapped by the skin and forelimbs. While none of the moles presented to us for our study were caught by extremities, it is possible that pest-controllers withheld any animals that they felt were not trapped humanely (Baker et al., 2015).

NO LEGISLATION CHANGE The exemption of traps from regulation has facilitated neglect of welfare standards (Baker et al., 2012). Given the scale of rat, mouse and mole trapping in the UK, the wide range of unregulated traps available for this, and the doubts raised about their humaneness, it is evident that all traps should be subjected to equal approval standards. Besides, higher welfare traps are probably more effective than lower welfare alternatives, and there is no reason to believe they should cost more (Baker et al., 2012). 142 Sandra E. Baker, David W. Macdonald, and Stephen A. Ellwood Double Standards In Spring Trap Welfare: Ending Inequality for Rats

Clearly, on grounds of logic, efficacy and ethics, the law should be changed such that all traps need to be tested. In 1998, the European Community signed the Agreement on International Humane Trapping Standards (AIHTS) with Canada and the Russian Federation. The IAHTS prohibits the use of leghold traps for killing certain species and the importation of pelts of those species from countries that use leghold traps. While the AIHTS is not directly relevant to rats, mice and moles, it did lead the European Commission, in 2004, to propose a European Union trapping Directive, the goal being to set new standards for the approval and use of traps more widely in Europe, and potentially to reconsider which species were covered. A report commissioned by the EU to examine options for such a Directive, and released in 2011, recommended inter alia that traps for all species should be regulated (Talling and Inglis, 2009). In 2012 the European Commission withdrew the proposed Directive. Recently, UK wildlife law has been under review by the Law Commission (http://www.lawcom.gov.uk/project/ wildlife-law/). The related consultation exercise included (among many other issues) consideration of The Pests Act and more general inconsistencies in law (The Law Commission, 2012), but no changes have been proposed in the final report regarding spring trap regulation. In 2006, The Animal Welfare Act made it an offence in the UK to cause ‘unnecessary suffering’ to any animal ‘under the control of man’ which includes a wild animal held in a trap (Natural England, 2010). Surely, in the light of this Act, there is an obligation for all lethal traps in the UK to meet equivalent welfare standards?

Figure 1. Impact momentum versus clamping force for mouse and rat traps. Mouse trap types (n = 23) are represented by circles and rat trap types (n = 17) by triangles or squares. Each point represents a different trap type and is the mean of five measurements on one trap. From Baker et al. (2012). Double Standards In Spring Trap Welfare: Ending Inequality for Rats 143

Figure 2. Impact momentum versus clamping force for mole traps. Each point represents a different trap type/brand combination and is the mean of measurements on 10 individual traps for impact momentum and 20 traps for clamping force. Points for traps of the same type but different brands are enclosed within a polygon. From Baker et al. (2012).

THE SOLUTION Insofar as the legislature has, so far, failed to reform the trap legislation, while awaiting reform we propose a Voluntary Trap Approval (VTA) scheme, in which trap manufacturers submit unregulated lethal traps (not necessarily only spring traps) for approval in the same way as regulated (non-exempt) spring traps. The approval of traps is a devolved issue in the UK, and in England and Wales, for example, traps are submitted to the Animal and Plant Health Agency (APHA) for testing. To meet approval standards, traps must cause irreversible unconsciousness within 5 minutes, in ≥80% of 12 tests (Baker et al., 2012). The costs of testing unregulated traps would need to be met by the manufacturer, as they are for regulated (non-exempt) traps, but once approved the trap could be marketed as ‘welfare approved’ and display a formal certification mark. For consistency, non-exempt traps that already require approval could also be given the certification mark. Such a scheme would not only deliver more effective traps to the market, but would also highlight to the public the issue of unregulated traps, as well as providing them with a choice and the opportunity to express demand for more welfare-friendly traps. Suppliers eager to demonstrate attention to both efficiency and ethics would stock only approved traps, which might lead to a cascade effect, with more manufacturers submitting their unregulated (exempt) traps for testing and more suppliers deciding to sell only approved traps, until non-approved traps are edged out of the market. (UK retail industry concern to avoid selling poor-welfare rodent control products was demonstrated recently when the Humane Society International UK persuaded more than 200 UK suppliers of pest control products not to stock lethal rodent glue traps on welfare grounds [Claire Bass, HSI-UK, personal communication 2016]. Notably, manufacturer concern to avoid producing poor-welfare rodent control products has been demonstrated by STV International Ltd, who, after seeing our 2012 mechanical trap performance study, have altered their approach by: (a) focussing marketing on higher impact momentum traps with ‘double-peg’ springs; (b) redesigning one of their plastic traps which previously had a small opening angle and a ‘jaw’ type spring; (c) implementing minimum standards for the materials and 144 Sandra E. Baker, David W. Macdonald, and Stephen A. Ellwood Double Standards In Spring Trap Welfare: Ending Inequality for Rats manufacture of wooden traps; and (d) introducing quality assurance testing for the resilience of spring strength with repeated use [Edwin Allingham, STV International Ltd, personal communication 2016]). Ultimately, successful implementation of a VTA scheme might lead to legislative change to formalise trap welfare equality in the UK.

ACKNOWLEDGEMENTS The research described in this study was funded by the RSPCA. SB was supported by the Humane Society International/UK and the Baker Trust during preparation of this paper.

REFERENCES CITED Atkinson, R.P.D., D.W. Macdonald, and P.J. Johnson. 1994. The status of the European mole Talpa europaea L. as an agricultural pest and its management. Mamm. Rev. 24: 73-90. Baker, S.E., S.A. Ellwood, P.J. Johnson, and D.W. Macdonald. 2016. Moles and mole control on British farms, amenities and gardens after strychnine withdrawal. Anims. 6: 39. Special edition on: Ethical and Welfare Dimensions of the Management of Unwanted Wildlife. Baker, S.E., S.A. Ellwood, V.L. Tagarielli, and D.W. Macdonald. 2012. Mechanical Performance of Rat, Mouse and Mole Spring Traps, and Possible Implications for Welfare Performance. PLoS ONE. 7: e39334. Baker, S.E., R.F. Shaw, R.P.D. Atkinson, P. West, and D.W. Macdonald. 2015. Potential welfare impacts of kill-trapping European moles (Talpa europaea) using scissor traps and Duffus traps: a post-mortem examination study. Anim. Welf. 24: 1-14. Dubois, S., N. Fenwick, L. Baker, S.E. Baker, N.J. Beausoleil, S. Carter, B. Cartwright, F. Costa, C. Draper, J. Griffin, A. Grogan, G. Howald, B. Jones, K.E. Littin, A.T Lombard, D.J. Mellor, D. Ramp, E.A. Ryan, C.A. Schuppli, T.M. Sharp, and D. Fraser. 2017. International consensus principles for ethical wildlife control. Conserv. Biol. 10.1111/ cobi.12896. International Organization for Standardization [ISO]. 1999. TC191. Animal (mammal) traps. Part 4: methods for testing killing trap systems used on land or underwater. International Standard ISO/DIS 10990-4. Geneva: ISO. Macdonald, D.W. and P. Barrett. 1993. Mammals of Britain and Europe. London: Harper Collins. Mason, G. and K. Littin. 2003. The humaneness of rodent pest control. Anim. Welf. 12: 1-37. Mellor, D.J., E. Patterson-Kane, and K.J. Stafford. 2009. The Sciences of Animal Welfare. Oxford: Wiley-Blackwell. Natural England. 2010. The Animal Welfare Act 2006: what it means for wildlife; Technical Information Note TIN072. Sheffield: Natural England. Parrott, D., R. Quy, K. Van Driel, P. Lurz, S. Rushton, J. Gurnell, N. Aebischer, and J. Reynolds. 2009. Review of red squirrel conservation activity in northern England. A Report by Fera to Natural England (NECR019). Sheffield: Natural England. Proulx, G. and M. Barrett. 1991. Evaluation of the Bionic trap to quickly kill mink (Mustela vison) in simulated natural environments. J. Wild. Dis. 27: 276-280. Rudge, A.J.B. 1963. A study of mole-trapping. Proc. Zool. Soc. Lond. 149: 330-334. Scott Henderson, J. 1951. Report of the Committee on Cruelty to Wild Animals. Home Office/ Scottish Home Department, Cmd 8266, June 1951. London: HMSO. Double Standards In Spring Trap Welfare: Ending Inequality for Rats 145

Talling, J.C. and I.R. Inglis. 2009. Improvements to trapping standards. DG ENV, http://citeseerx.ist. psu.edu/viewdoc/download?doi=10.1.1.306.7379&rep=rep1&type=pdf. The Law Commission. 2012. Wildlife Law: A Consultation Paper. London: Her Majesty’s Stationery Office. Warburton, B. and J. Hall. 1995. Impact momentum and clamping force thresholds for developing standards for possum kill traps. N.Z. J. Zool. 22: 39-44. 147

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

MONITORING OF BROWN RATS ON THE TERRITORY OF MEGALOPOLIS

1VALENTIN A. RYLNIKOV AND 2ANGELINA V. BOGACHEVA 1Russia, Moscow,117342, P. O. B. 36 / Nonstate Private Scientific and Educational Institution Institute of Pest Management 2Russia, Kostromskaya obl. Kostroma, ul. Dzerzhinskogo, d. 17, Kostroma State University

Abstract In 2013-2016 annually questionings of the Moscow and Kostroma (Russian Federation) populations was carried out in July and October for detecting brown rats’ habitats. The suitability of this method for reconnaissance evaluation of their spatial distribution, taking into account the nature of favorable conditions, and for quality evaluation of the works on the management of brown rats’ number is shown. The dependence of rats’ detection frequency on respondents’ number is found. Selective data of urban residents’ interviews is confirmed by the results of observations conducted by professionals.

Key words Brown rat, the incidence of rat, rodent control in the city, questioning the city’s population

INTRODUCTION The presence of Brown rats in metropolitan areas and in small regional centers is an indicator of municipal sanitary troubles. Detection of rats in the streets of the city is the result of the poor work of public services, the rate of inefficiency control measures against rats in urban buildings and in open areas, which finally reduces the life of the townspeople. Assessment of the relative density of the Brown rat (Rattus norvegicus Berk., etc., rats) and evaluation of rodent in the metropolis Moscow, is not an easy task. But even in the cities of regional subordination, this task is impossible in the absence of informative, at the same time, inexpensive methods. One of such methods is the questionings of population to detect the rat in the city, which is the aim of the present study. For this study, the following tasks were set: 1) confirmation via surveys residents priori hypothesis about the presence of rats in the areas of the city; 2) the dependence of the detection rats (rats/km2) on the share of respondents (people / km2); 3) types of frequency distribution of the detection rats index. Places of Brown rats detection on the map, in the hands of an experienced and competent pest controller, is a powerful tool that allows choosing the right tactics and strategy of the pest control and preventive work, to check the results of their activities by assessment of independent

MATERIALS AND METHODS Our studies have begun in 2013 and are still going on. The places of rats’ detection in the cities we get with the help of questioning of the townspeople during the 2013-2016. Randomly selected respondents were asked to answer the following questions: 1. Have you ever seen rats in your home and / or in the surrounding area: since the spring (in the survey in June); since the autumn this year (in the survey in October) till the present time? (If no, pass to question 3, if so, to question 2). Question 2. Please let us know the street and house number, where you have seen rats. Question 3. Can you name the other 148 V. A. Rylnikov and A. V. Bogacheva Monitoring Of Brown Rats On The Territory Of Megalopolis addresses, where you have seen rats? Each survey involved residents of several urban areas. Obtained based on sociological survey addresses of rats’ detection we mark on a special map. Microsoft software package was used for statistical processing and illustration of a sociological survey data, IBM SPSS Statistics 22. To confirm a priori hypothesis about the presence of rats in the districts of the city we used Bayes’ theorem, based on surveys of residents. Virtual maps with marks of rats meetings in Moscow and Kostroma, data analysis, as well as information about the resistance of rats to anticoagulants are published freely accessible on the Internet at www.ratcompany.ru site. For translation from Russian, you can use the program Imtranslator - application to Firefox or other available means.

RESULTS AND DISCUSSION In total for 4 years 4604 people, living in the cities of Moscow and Kostroma, took part in the study. Interviews conducted twice a year in the period of the greatest rat activity. To conduct interviews often economically did not seem appropriate. Regardless of the time of year, the municipal district and the year of survey in Kostroma 13-16% respondents met the rats in the study period. For the megacity, this rate was 26-32%. Placement the addresses of detected rats at inspection of the buildings and the territory of Kostroma, according to cumulative data for 2014-2016, in general corresponds to each other, although the point of rats’ meeting are located disorderly.

A comparison of the spatial and temporal dynamics of Brown rats in open areas and buildings in Kostroma in 2014-2016 was carried out. Figure 1 shows that revealed seasonal patterns correspond to the generally accepted idea of the seasonal dynamics.

0.40 Figure 1. Rats’ detection density in Kostroma 0.35 based on average data for 0.30 2014-2015 monitoring 4 0.25 in buildings. Ordinate 0.20 3 axis- density of the rats 0.15 2 ‘detection places, abscissa 0.10 1 axis- the number of survey 0.05 month. 1 – Central district, 0.00 2 - Fabrichny district, 1 2 3 4 5 6 7 8 9 10 11 12 3- Zavolzhsky district, 3- summary municipal data

Figure 2 shows that the index distribution of the places of rats’ detection in the monitored cities tends to lognormal distribution. The asymmetry of investigated variational series <3, that is not essential. Its presence is due to the influence of various accidental circumstances. Deviations from the normal distribution of excesses as not significant. According to the Student t-test with a probability of 0.954 can be argued that the average value of the sample at a larger volume will not go beyond the found interval.

In accordance with the studies conducted in Kostroma compliance of the index of dynamics of the density of places of the rats’ detection according to surveys in open areas, with the dynamics of the density of places of the rats’ detection in the buildings of the city, to the greatest extent, observed in if the survey was conducted with the stated density distribution of respondents from 1,84 people/km2. Under respondent density of 0.63 people/km2 these regularities do not appear. Stated above gives us the Monitoring Of Brown Rats On The Territory Of Megalopolis 149 grounds to make an adjustment to the method of using the population’ questionings as an indicator of Brown rats location in the city, setting the limit of the number of respondents to be not lower than 1.84 persons/km2 (Bogacheva, 2016).

Figure 2. Logarithmic distribution the places of rats’ locations in Moscow (left) (rats/km2) and Kostroma (right) according to generalized interviews data 2013-2016 (Moscow) and 2014-2016 (Kostroma). Ordinate axis - the relative frequency of rats’ location index, abscissa axis – logarithm of values of rats’ location index (rats/km2).

In Moscow, the density of respondents is conventionally divided into 6 groups, density of places the rats’ detection were also divided into 6 groups. Figure 3 shows that the limit of 1.84 persons/km2 is included in the group 3. The third group of respondents was selected for further studies to test the hypothesis of a necessary minimum of respondent number for conducting questionings.

Figure 3. The density of rats’ detection Moscow.On the abscissa axis - the group of respondents by density. Group 1: 0,1-2,74 people/km2, Group 2: 2,75-5,48 people/km2, Group 3: 5,49-8,22 people/km2, 4 group: 8,23-10,96 people/km2, group 5: 10,97-13,70 people/km2, 6 group: more than 13.70 people/ km2.. On the ordinate axis - the share of rats’ groups of with different densities. Group 1 (0-0,84 rats/ km2) - Column A, group 2 (0,85- 1,68 rats/km2) - Column B, Group 3 (1,69 - 2.52 rats/km2) - the C column, group 4 (2.52 - 3.36 rats/km2) - the D column, group 5 (3,36-4,2 rats/km2) - the E column, group 6 (more than 4.3 rats/km2) - column G. 150 V. A. Rylnikov and A. V. Bogacheva Monitoring Of Brown Rats On The Territory Of Megalopolis

The observed pattern of detection rats in Moscow and Kostroma is, in many respects, a reflection of the conditions that created for rats by people. Favorable conditions stimulate the active reproduction of the resident population of rats and attracts immigrants from neighboring areas (Rylnikov and Tuchkova, 2013). Results of the survey of city residents are used to verify a priori hypotheses about the degree of influence of indicators of favorable conditions for the rats in the different municipal districts. on their numbers. The probability of meeting the rats by citizens in open areas of the city - P (B) = 0.3 - survey data. Let a priori probability characterizing the presence of rats, P (A) = Υ, where Y will take the values depending on the conditions favorable to the presence of rats. It should be noted that we have developed the method of evaluation of favorable conditions for rats, for a single object (Rylnikov, 2013). Obviously, it will require its rework according to the conditions of the municipal districts. The probability of rats meeting by citizens in the places with known food sources (e.g., areas for waste collection and food waste), P (B/A) = β. When β = 0,1, Υ = 0,7, then, according to Bayes’ theorem, the posterior probability, proof of actual data is: P(А/В)=(Р(А)×Р(В/А))/Р(В)=(0.7×0,1)/0,3=0,23. When β=0,01, Υ=0,7, P(А/В)=0,023. The probability of confirmation of the rats’ presence will decrease with a reduction the probability of rats’ detection around garbage dumps. When β = 0,01, Υ = 0,95, P (A/B) = 0.032. That is, the probability of confirmed rats presence will grow with complex conditions favorable to the life of rats. When β = 0,2, Υ = 0,95, P (A/B) = 0.63. This means that the probability of confirmed rats presence will increase with the probability of their meeting in the places of garbage dumps. Let’s estimate maximum number of rats in Moscow, based on the amount of food waste - the main source of the rats’ feeding, which, undoubtedly, is a limiting factor. 186 grams of organic waste accounted per person per day of which some part, assumed 50%, is food (Sapozhnikova, 2017). Tainted food rats do not eat, but its share may not be large, assumed 10%, that is 84 grams of benign (in terms of the rat) waste. One adult rat can eat 15 grams of dry food and 30 grams - wet, i.e. 45 grams per day. Food waste from one person can feed about 2 rats per day. At the same time, the number of Moscow’s population in 2014 was 12,111,000 people (Goroda Rossii, 2017). The maximum of rat numbers in Moscow, taking into account only the amount of food waste is 12111 00 x 2 = 24222 000 animals. The rats usually feed in the available sources of food raw materials, food, fodder, especially in places of domestic, agricultural and service animals. Compassionate old women feed up stray cats and pigeons around the apartment houses, a lot of food waste is around the street food stalls, markets, etc. One cannot ignore the possibility of feeding the rats by small animal food: invertebrates, amphibians, reptiles, clutches birds, small mammals, as well as the vegetative parts of cultivated and wild plants, their fruits and seeds. The actual number of rats would fall to spring and would increase to autumn due to breeding. In addition, the number of rats is under pressure of natural mortality factor in the autumn-winter period and forced mortality as a result of rodent pest control (Rylnikov, 2010). Presumably, all additional food sources, taken together, can provide increasing the number of rats in 1.5-2.0 times, that is 3-4 rats per person. The calculated maximum number does not reflect the real number of rats in the city, which, in fact, can be several times below the maximum possible number. The sanitary and epidemiological welfare of the population - is a state of public health and the human environment in which there is no harmful impact of environmental factors on human and there are favorable conditions for its functioning. Favorable conditions of human life - is a state of the environment in which there is no harmful effect of its factors on human (harmless conditions) and there is potential for the recovery of disturbed functions of the human organism. The absence of rodents and their metabolic products is an integral part of measures aimed at achieving these goals. General and selective evaluation of detection of rodents by such application methods, as traсking devices, traps Gero, arc traps are highly expensive in terms of both financial and manpower, even in a small town, not to mention such metropolis like Moscow. The evaluations of the presence / absence of rodents by town’s people should be recognized not less important than the estimates made by experts, because the rats is Monitoring Of Brown Rats On The Territory Of Megalopolis 151 sanitary conditions indicator. According V.V.Kucheruk the use of the visual (score) assessment of the number of rodents can be recommended for a questionnaire (Kucheruk, 2006). Experts can use the survey materials for the primary determination of rats activity areas in the city, and following monitoring by objective control methods: traсking devices, Gero traps and arc traps. Efficiency of measures against rodents consists of stages, each of which contributes to the resulting value. The factors that determine the number of rodents on controlled objects include: the natural course of the rodent population dynamics depending on reproduction, mortality, immigration and emigration; the capacitance of rodent habitats, which depends on the purpose of the object (objects of increased risk: food objects, houses, children, medical - prophylactic objects, etc.), the sanitary condition, skill of pest control operator (disinfectant), which depends on the theoretical knowledge and practical skills for the qualitative conduct pest control on objects. The tasks and solutions:

1. Correction of a priori hypotheses about the probability of the presence of rats in the municipal districts with favorable conditions for their dwelling can be carried out using a model based on Bayes’ formula, in which, to confirm the data of the survey population can be used;

2. The index of rats’ detection (rats/km2) is proportional to the number of respondents (people/ km2);

3. Hypothesis of logistical dependence of the rats’ detection index on the number of respondents (people/km2) can find evidence under higher respondents density; however, we will face the problem assess the economic feasibility of such increasing;

4. The frequency of the detection rats generally corresponds to a logo-normal distribution;

5. The data of interviewing may be used as a reconnaissance estimation of rats’ abundance in the city, including quality evaluation of conducted disinfestation.

6. If there is information on the number and distribution of brown rats in the city is possible to predict the risk of rats’ appearance anywhere in the city and rural settlements.

REFERENCES CITED Bogacheva A.V. 2016. Brown rat monitoring in Kostroma //Pest species management: Proceedings of the IInd Euroasian Pest Management Conference, Moscow, Russia, September 09-11, 2016. M.: «Institute of Pest Management: 218-224 (RUS). Goroda Rossii. Gorod Moskva. 2017. http://города-россия.рф/sity_id.php?id=1#population (Jan, 2017) (RUS). Kucheruk V.V. 2006. Избранные труды. М.: Товарищество научных изданий КМК: 523. (RUS). Rylnikov V.A. 2013. Pest risk assessment (Brown rat as examples). Pest management: Proceedings of the 1st Euruasian Pest Management Conference, Moscow, Russia, September 09–11, 2013. М.:Institute of Pest Management: 182–185 (RUS). Rylnikov V.A. 2010. Brown rat (Rattus norvegicus Berk.). Ecological bases and approaches to management of number / V.A. Rylnikov. — M.: Nonstate private scientific and educational institution “Institute of Pest Management”, 367. Ill (RUS). 152 V. A. Rylnikov and A. V. Bogacheva

Rylnikov V.A. and N.P. Tuchkova. 2013. Probabilistic Model of the Brown Rat Control. Journal of Agricultural Science and Technology A. 2.V 3: 745-756. Sapozhnikova G.P. 2017. Конец «мусорной цивилизации»: пути решения проблемы отходов, cтр.9. http://clicr.ru/uploads/images/file_public_497.pdf (Jan, 2017) (RUS). 153

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

RODENT CONTROL: BACK TO BASICS TO UNDERSTAND THE FUTURE

R. M. SHAND AND A. J. BRIGHAM Rentokil Initial, Napier Way, Crawley, RH10 9RA, UK

Abstract The current urban rodent control servicing model which relies very heavily on baiting with rodenticides is being increasingly challenged, and two studies are reported here that attempt to ‘go back to the basics’ of rodent behavior in order to investigate new avenues for innovation. The ability of several candidate food-based attractants was assessed in a pen containing a colony of mice maintained in ‘semi-natural’ conditions. None of the materials tested had any effect on increasing bait take in any of the bait boxes treated – in fact the control bait boxes sprayed with water had the highest mean daily bait take. The same colony was used on another occasion to test various candidate mouse-proofing products, through which the mice had to pass to access a central enclosure. Some professional products, as well as industry-recommended materials such as steel wool, did not last the 90 days of the test period. However professional products Mouse Stop and Rodent Barrier, as well as one DIY product (Polyfilla) lasted the length of the trial and would appear suitable for use as part of a rodent control IPM program.

Key words Prevention, rats, mice, bait, neophobia, traps, exclusion, proofing, monitoring.

INTRODUCTION The current urban rodent control servicing model (lay bait, return every 6 weeks to check bait) is under increasing threat as restrictions on product choice and product usage begin to emerge from the European and US regulatory processes. It also exposes some of the deficiencies in that model which have been traditionally overlooked – the main one being an overreliance on bait take from bait boxes for detecting and estimating the size of a rodent population. Rats will show neophobic behaviour (Barnett, 1963) and avoid going into newly-placed bait boxes, often for weeks at a time. Evidence from the field (Charlton, 2012) backed up by research in our own laboratory has shown that a proportion of mice in a population also avoid going into bait boxes – many approaches to bait boxes result in mice passing through without feeding, climbing on top, or walking around in some cases. This limitation means that treatments may take longer to achieve control, but perhaps more importantly it means low-level infestations (especially of mice) could go completely undetected, despite the presence of a pest control service contract. Is there any way bait boxes could become more attractive to rodents in order to overcome this issue? The first part of this paper looks at a selection of studies of different potential ‘attractant’ compounds, in order to ascertain if they have the potential to attract mice into bait boxes to consume a greater amount of bait. These materials have been suggested based on field observations, or the materials are known to be used in some commercial products where attractant potential is claimed. As part of a fully Integrated Pest Management (IPM) programme, non-lethal measures should also be considered that restrict the ability of rodents to gain entry or move around a building – although these are often neglected in order to concentrate on checking bait boxes. An example of an IPM technique is proofing, and examples of these techniques are given by Baker et al. (1994, and more 154 R. M. Shand and A. J. Brigham Rodent Control: Back To Basics To Understand The Future recently abridged by Vantassel et al., 2009). While extremely good guides, they do contain an important error – they confuse the statement that mice can squeeze under a ¼ inch (approximately 6 mm) gap with a later figure that shows a round hole of ¼ inch diameter, clearly too small for even a newly-weaned mouse to get through. Howeve,r facts such as this can become accepted wisdom in the pest control industry, especially in the absence of recent basic behavioural research on proofing techniques.

As part of a programme of proofing, the second part of this paper therefore looks at the relative effectiveness of different hole-proofing materials, in order to assess how more traditional techniques perform compared to some of the modern proofing pastes and other products.

MATERIALS AND METHODS Both sets of trials used the same colony of House Mice, Mus musculus domesticus, although at different times. These mice were maintained in a pen 1.8 metres by 3.6 metres in semi natural conditions, with plenty of harbourage locations and pelleted RM1 lab diet and water available ad libitum. These mice originated from wild-caught mice from a farm in Berkshire, UK that have been maintained as a colony in a variety of semi-natural conditions for approximately 20 years. The number of animals in the colony fluctuates between 60 and 100 animals approximately, and includes all life stages.

Attractants Standard Rentokil Tamper-Resistant Bait Boxes for mice were used in this trial (dimensions 12.5 cm long x 7 cm deep x 4 cm high). These were baited with a proprietary non-toxic Rentokil paste bait and were treated with various attractants as detailed below, or used as controls. Bait boxes were placed along the wall-floor junction of one wall of the pen that was clear of any harbourages or other obstructions. Bait take was measured daily, and sufficient bait was placed in each bait box to ensure it was not emptied overnight. Boxes were placed 30 cm apart along the wall, and each replicate ran for 3 days, after which there was a lag period of 4 days until the next trial. The trial was repeated twice more, each time with the order of placement of bait boxes changed in order to control for possible position preferences. Trial 1 tested a vanilla extract powder ex Berkem. This was tested in an aqueous solution (50% water, 50% monopropylene glycol) at 10% and 40% in a trigger spray which was used to apply approximately 1g of liquid onto the inside of the lid of the bait box before closure. Performance was benchmarked against a control where an equivalent amount of water had been sprayed inside a control bait box. Trial 2 tested a Cocoa extra powder ex Berkem in the same manner as Trial 1. Trial 3 investigated three common household food-flavouring ingredients simultaneously: almond, vanilla and peppermint flavourings all bought from a major supermarket chain.

Hole Proofing For this trial, a rectangular (90 cm x 60 cm) Perspex enclosure was introduced into the pen. This enclosure was 60cm high. Three perspex tubes were inserted into one side of this enclosure, 5cm apart. The tubes were 3.5 cm in diameter. Each tube was filled to a depth of 2.5 cm with a variety of proofing materials on the end of the tube facing into the pen – so the mice had to penetrate the proofing material in order to enter the tube and thus the inside of the enclosure. Approximately 50 g of pelleted RM1 diet was also placed in the centre of the enclosure. Three potential proofing materials could be tested simultaneously. Daily checks were made for signs of damage, and when it appeared that a material had been penetrated this was confirmed with CCTV footage of the pen. The failed material was then replaced with a fresh tube containing the next proofing material and this process continued until all materials had been tested. If a material resisted for 90 days this was considered sufficient to prove efficacy.

Rodent Control: Back To Basics To Understand The Future 155

The materials tested were:

• Polycell Multi-Purpose Quick Drying Polyfilla – a ready to use cement sealing product.

• Sakarat Rodent Barrier – commercial rodent proofing product from Killgerm.

• Sakarat Rodent Stop – commercial rodent proofing product from Killgerm.

• Mouse Stop – mouse proofing product from iPest Control B.V.Coarse Steel Wool.

3M Coarse Synthetic Steel Wool – synthetic material alternative to steel wool Expanding Polyurethane Foam. Unibond Super All-Purpose Silicone Sealant –silicone sealant in a caulking tube. Coarse Builders Sand – filled to depth of 5 cm while still wet.

RESULTS AND DISCUSSION Attractants Table 1 gives the mean daily bait take from all replicates for trials 1 and 2 (vanilla and cocoa extract powders). No statistics have been applied as it is obvious, based on this data that there is no evidence that either extract has increased bait take and therefore no evidence for a useful attractant effect. Table 2 shows the mean daily bait take from all replicates of trial 3. It is clear that no claim for an attractant effect on the basis of increased bait take can be made for any of these food-flavourings.

Table 1. Mean daily bait take (g) over three days from bait boxes sprayed with different concentrations of vanilla and cocoa extract vs. a control sprayed with water.

Concentration of extract in Vanilla Extract Cocoa Extract aqueous solution 40% 10.7 11.3 10% 11.7 12.1 Control (water) 12.0 14.5

Table 2. Mean daily bait take (g) over three days from bait boxes sprayed with different food- flavourings vs. a control sprayed with water.

Almond Vanilla Peppermint Control (water) 11.7 16.1 5.6 19.7

Other results in our laboratory (not published) have found similar results with a range of commercially available attractants, the conclusion being that whilst a novel food scent might divert the attention of a mouse to investigate, this does not necessarily equate to an increase in bait take – or detecting mice on the basis of spotting bait take. Indeed, a surprising result is that peppermint may have potential as a particle repellent, which is worth investigating further. 156 R. M. Shand and A. J. Brigham

Table 3. Number of days proofing materials prevented mice access to the centre of a test chamber.

Proofing Material Tested Number of Days Polyfilla Lasted entire 90 days Rodent Barrier Lasted entire 90 days Mouse Stop Lasted entire 90 days Silicone Sealant 70 Synthetic Wire Wool 60 Expanding Foam 30 Steel Wool 26 Rodent Stop 1* Coarse Sand 1

* This time was so short it was repeated twice – with the same result

Hole Proofing Table 3 shows the number of days that different proofing materials lasted before mice were able to penetrate through them and access the centre of the chamber. Three materials lasted the full 90 days of the trial - although all three did show a small degree of gnawing damage, this was the benchmark set for success. The performance of steel wool and Rodent Stop was surprisingly poor. Steel wool may sometimes be used to fill a gap before applying a cement filler, and this may still be effective. Mice were seen pulling this material out strand by strand until the remaining plug of material was pulled out in one piece. It is clear that not all materials are good for proofing against mice, but two commercial products (Rodent Barrier and Mouse Stop) did last the full 90 days of the test; however, so did a commercially available cement gap filler. This is a very simple test to run, which produces clear and unequivocal results, in order to evaluate any future proofing products. There is no need to entrap mice or remove food sources as a drive to explore appears sufficient motivation – and this experimental design was chosen as it is more relevant to a situation likely to be encountered in the field.

CONCLUSION Recent research in rodent control has focused on producing more palatable / effective bait products, and more latterly alternative control options such as lethal traps. But this emphasis on innovating lethal control measures has meant a lack of studies of the effectiveness of other IPM measures such as proofing, housekeeping, and monitoring techniques, in order to protect premises. It is the author’s opinion that a future rodent control service will involve the use of all these techniques to provide a service that moves the industry from pest control to pest prevention.

REFERENCES CITED Baker, R. O., G.R. Bodman, and R.M. Timm. 1994. Rodent-Proof Construction and Exclusion Methods From: The Handbok: Prevention and Control of Wildlife Damage. Paper 27. http://digitalcommons.unl.edu/icwdmhandbook/27 (15/02/2017) Barnett, S. A. 1963. A Study in Behaviour. London: Methuen & Co Ltd 288pp Charlton, J. 2012. Is Resistance Now a Threat to Mouse Control? Pest 23: 12-13 Vantassel, S. M., S.E. Hygnstrom, D.M. Ferraro, and R.R. Stowell. 2009. Rodent-Proof Construction – Structural. http://extensionpublications.unl.edu/assets/pdf/g1530.pdf (15/02/2017) 157

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

FIELD EVALUATION OF TWO SINGLE FEEDING ANTICOAGULANT RODENTICIDES AGAINST MUS MUSCULUS IN A CONFINED SWINE FACILITY

1ELRAY M. ROPER AND 2GRZEGORZ BUCZKOWSKI 1Syngenta Lawn and Garden, 410 Swing Road, Greensboro, NC 27409; 2Purdue University Department of Entomology, 901 W. State Street, West Lafayette, IN 47907

Abstract Three commercial rodenticide bait blocks were tested at a confined swine facility in Lafayette, Indiana to compare efficacy for control of the house mouse (Mus Musculus). The three products were Talon® Ultrablok rodenticide (brodifacoum 0.005%), Final® All-Weather Blox™ (brodifacoum 0.005%), and Contrac® All-Weather Blox (bromadialone 0.005%). Pretreatment monitoring with non-toxic bait blocks and tracking pads determined that mouse populations were equivalent in the three buildings used as treatment sites. Each building was treated with toxic bait for 15 days. Bait consumption and tracking pad activity were monitored. After a three- day rest period the sites were monitored again with non-toxic bait and tracking pads for eight days. Following the monitoring, multi-catch mouse traps were placed in each building to trap mice remaining in the building. Consumption of Contrac bait (7136 grams) was significantly greater than for Talon (2454 grams) and Final (1094 grams). Consumption of Talon brodifacoum was significantly greater than Final. Following the 15 day toxic baiting period, bait consumption and tracking pad activity were significantly lower for the Talon treatment, (1% bait consumption and tracking pad activity), than for the Final (38 % bait consumption, 27% tracking pad activity) and Contrac (91% bait consumption and 78% tracking pad activity). Trap catches following baiting were 6 mice for Talon, 44 mice for Final, and 57 mice for Contrac. Results indicate that there was probably bait aversion to the Final bait and rodenticide resistance to bromadialon, the active ingredient in Contrac. DNA analysis showed that 67% of the trapped mice were homozygous for Y139C mutation for anti-coagulant resistance, and 33% were heterozygous for the same mutation. In addition 33% of the mice were homozygous for L128S mutation for anti- coagulant resistance. The test confirms the presence of single feeding anticoagulant resistance in a house mouse population in the United States.

Key words Brodifacoum, bromadialone, resistance, DNA, Y139C, L128S.

INTRODUCTION The house mouse, a commensal rodent pest, is common in animal production facilities. Control of these pests is difficult in these situations because of the abundance of harborage and food, and a controlled temperature environment. Growers typically rely on the use of chemical rodenticides, principally the single feeding anticoagulant rodenticides, for control of these rodent pests. Two factors can influence the success of mouse baiting programs, the acceptability of the bait and physiological resistance to the active ingredient. Physiological resistance to single feeding anticoagulant rodenticides has been identified in several locations around the world (Buckle, 2012). This study was initiated to compare three rodent bait formulations for acceptance and control of a house mouse infestation in a confined swine facility. 158 E. M. Roper, G. Buczkowski Field Evaluation Of Two Single Feeding Anticoagulant Rodenticides

MATERIALS AND METHODS Three rodenticide bait blocks were compared for consumption, speed of control, and effectiveness of reduction of a house mouse infestation in a confined swine facility. The test was conducted at the Swine Unit of the Animal Sciences Research and Education Center (ASREC), a commercial swine farm operated by the Department of Animal Sciences at Purdue University in West Lafayette, Indiana. Three separate buildings were used. Each building received one of three treatments. The three treatments were Talon® Ultrablok (0.005% brodifacoum), Contrac® All Weather Blox™ (0.005% bromadialone), and Final® All Weather Blox™ (0.005% brodifacoum). Baits were placed in the buildings in the areas of highest mouse activity as determined by visual inspection. Baits were placed in tamper resistant mouse bait stations (Bell Protecta® Mouse Station). Tracking pads were placed at both entrances of the bait stations. Tracking pads were 6 inch by 6 inch PVC tiles coated with blue construction chalk. The study consisted of 3 phases. Phase I was pre-baiting with non-toxic bait blocks (Detex® Block, Bell Labs) and monitoring with tracking pads. Each building was continuously baited for 8 days and bait was replaced every 48 hours as needed. Bait consumption and tracking activity were measured in each building. During phase II each building was baited with one of the three treatments and tracking was monitored with tracking pads. Phase II began 3 days after the completion of phase I. Each building was baited continuously for 15 days and bait was replenished every 48 hours as needed. Bait consumption and tracking activity were measured. Phase III began 3 days after the end of phase II. Phase III was baiting with non-toxic bait blocks and monitoring with tracking pads. Each building was continuously baited for 8 days and bait was replaced every 48 hours as needed. Bait consumption and tracking activity were measured in each building. At the end of the 8 days of baiting live catch traps (JT Eaton 420CL Repeater™ Multiple Catch Mouse Trap) were placed throughout each building to determine if any mice remained active in the buildings. To check for the presence of anti-coagulant rodenticide resistance a one inch section of the tail of mice that were captured at the end of the study was collected from 12 mice and submitted to the Rodent Research Lab at Reading University (Reading, UK) and a genetic analysis was conducted to look for the presence of the two anti-coagulant resistant mutations, Y139C and L128S. Data Analysis. Differences between tracking activity, bait consumption, and mouse trapping were analyzed by one way Analysis of Variance using SPSS Software. Differences were significant at the p < 0.001 level.

RESULTS AND DISCUSSION Consumption of non-toxic bait for all three buildings during phase I averaged 96.3% of bait applied +/- 1.5%. Mean percent tracking during phase I for all three buildings was 87% +/- 1.7% (Figure 1). There was no significant difference in mouse activity between the three buildings.

Figure 1. Phase I, Percent Consumption of non-toxic bait and Percent Tracking by Treatment. Field Evaluation Of Two Single Feeding Anticoagulant Rodenticides 159

Bait consumption during phase II was; Talon 2454 grams, Final 1094 grams, and Contrac 7136 grams (Figure 2). Consumption of Contrac bait was significantly greater than consumption of Talon and Final baits. Consumption of Talon was significantly greater than consumption of Final. No Final was consumed after the 2nd day of baiting. Tracking during phase II was significantly lower for Talon than for Contrac and Final Figure (3).

Figure 2. Phase II, Total grams of bait consumed for each treatment during 15 days of continuous baiting. No Final All Weather Blox were consumed after the second day of baiting.

Figure 3. Phase II Percent tracking during the 15 days of baiting

Figure 4. Phase III, Percent Consumption of non-toxic (blank) bait and Percent Tracking by Treatment.

160 E. M. Roper, G. Buczkowski

Consumption of non-toxic bait during phase III was 34 grams for the Talon treatment, 1808 grams for the Final treatment, and 2697 grams for the Contrac treatment. Average tracking activity during phase III was 1% for the Talon treatment, 27% for the Final treatment, and 78% for the Contrac treatment (Figure 4). Consumption and tracking for the Talon treatment were significantly less than for the Final and Contrac treatments. Consumption and tracking for Final was significantly less than for Contrac. At the conclusion of the test 6 mice were trapped in the Talon treatment, 44 mice were trapped in the Final treatment, and 57 mice were trapped in the Contrac treatment. The number of mice trapped in the Talon treatment was significantly lower than trapped in the Final and Cotrac treatments. DNA analysis showed that 67% of the mice analyzed were homozygous and 33% were heterozygous for the Y139C mutation for anti-coagulant resistance. In addition another 33% of the mice were homozygous for the L128S mutation for anti-coagulant resistance.

CONCLUSIONS The high rate of consumption of Contrac bait with a low level of control is indicative of physiological resistance to the anti-coagulant active ingredient bromadialone. The results of the DNA analysis confirm the presence of the mutation for anti-coagulant resistance in this mouse population. As this mouse population is fairly isolated is it not indicative that bromadialone resistance is wide spread in the region where the test was conducted. The low consumption of Final bait with moderate control and no feeding after the second day of baiting indicates bait aversion in the mouse population. As a formulation of bait very similar to Final has been used for years at the facility the selection for aversion is highly probable. The moderate consumption of Talon bait with a very high level of control indicates that there is as yet no physiological resistance to brodifacoum in this mouse population. The attractiveness of a novel bait formulation resulted in good consumption and a high level of control.

REFERENCES CITED Buckle, A. 2012. Anticoagulant resistance in the United Kingdom and a new guideline for the management of resistant infestations of rats (Rattus norvegicus Berk.). Pest. Manag. Sci. 69:334–341. 161

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

ALTERNATIVES TO ANTICOAGULANTS: CHLORALOSE

ANDREW J. BRIGHAM Rentokil Initial, Napier Way, Crawley, RH10 9RA, UK

Abstract This paper presents data from the development of a new paste-based formulation containing the acute rodenticide chloralose (RapidPro) in order to assess its suitability as an alternative to anticoagulant rodenticides. Albino mice were single caged and offered a chloralose formulation in a standard ‘Choice’ test against a non-toxic alternative diet. The ‘Paste’ based formulation achieved 100% mortality in less than 24 hours with palatability of 23.0%, at ambient temperatures of 19°C - 20°C. By comparison with an earlier developmental ‘Block’ for- mulation, which only achieved 30% mortality, it is suggested that apparent poor palatability is actually due to a combination of the rapid action of chloralose and a degree of ‘bait shyness’ among animals surviving sedation following a sub-lethal dose. Clearly palatability is still important in order to achieve a lethal dose before the effects of chloralose (sedation) start to take effect, and the ‘Paste’ formulation demonstrated that chloralose can be a very effective and practical alternative to anticoagulants for house mice, with the key advantage of rapid action and faster elimination of an infestation

Key words House mice, Mus musculus domesticus, rodenticide, rodent control, palatability, mortality.

INTRODUCTION Anticoagulants are the toxin of choice for rodent control. However, with the rise of resistance there is an increasing reliance on the most toxic compounds in the class, which pose a significant threat to wildlife. There are also moves to lower the concentrations of active ingredients in order to protect human health (Riby, 2016). This has brought with it a need to impose severe restrictions on use and is a stimulus to search for alternatives. Chloralose (which is a mixture of the active alpha- isomer and the inactive beta- isomer) has been used for mouse control since the late 1960s (Cornwell, 1969). It is a fast-acting sedative, and rising doses cause unconsciousness and then death through depression of the Central Nervous System and inhibition of the respiratory reflex (McLeod and Saunders, 2013). Traditionally only for use against mice, it has always been considered to be of limited use due to poor palatability and lower efficacy at higher ambient temperatures (Meehan, 1984). This paper presents data from the development of a new formulation (RapidPro) in order to reassess this accepted wisdom. MATERIALS AND METHODS Two treatment groups of 10 albino TO mice (5 females, 5 males) were individually caged and acclimatized for 72 hours with RM1 pelleted diet and water available ad libitum. After acclimatisation, the mice were offered the choice of a formulation containing 4% chloralose (nominally 85% of the active isomer alphachloralose and 15% betachloralose) and a non-toxic RM1 powdered diet. One treatment group was offered an earlier developmental ‘Block’ formulation, the other a new ‘Paste’ formulation (RapidPro). 162 A. J. Brigham Alternatives To Anticoagulants: Chloralose

Test baits were offered for 4 days and then replaced with the pelleted diet for a further 3 days. Any distress / mortality observed was noted for these 7 days. As chloralose is a sedative, the normal humane endpoints for test animals were not used (severely sedated animals often recover completely) in order to ensure the accuracy of test results. The test room was maintained between 19° C and 20° C throughout the trial. RESULTS AND DISCUSSION Table 1 shows the summary data, in terms of palatability (bait consumption) and mortality. The Paste formulation achieved 100% mortality within 24 hours, whereas the Block formulation performed much worse. Palatability is much more difficult to examine, because a lethal dose is between 0.1g and 0.2g of formulated bait and this is difficult to measure accurately. Whilst both treatment groups ate an identical amount of chloralose bait on Day 1, the mice offered the Paste formulation clearly became comatose before they could consume significant amounts of the alternative lab diet – which suggests that they sampled the chloralose bait in greater quantity and did so sooner on Day 1 than the other group. The survivors of the Block formulation thereafter showed a marked preference for the alternative non-toxic diet, although they did not necessarily completely avoid the toxic bait.

Table 1. Test Bait consumption and Mortality resulting from presentation to individually-caged treatment groups of 10 albino TO mice of two different chloralose formulations (‘Block’ or ‘Paste’) vs. a non-toxic RM1 powdered diet.

Test Bait Consumption (g) Treatment Mortality Day 1 Day 2 Day 3 Day 4 Total 3.8 ‘Block’ 2.1 0.4 0.3 1.0 3/10 (2.1%) 178.9 Lab Diet 34.6 40.0 50.6 53.6 (97.9%) ‘Paste’ 2.1 0.0 0.0 0.0 2.1 (23%) 10/10 Lab Diet 7.0 0.0 0.0 0.0 7.0 (77%)

The degree of ‘shyness’ towards the Block formulation after Day 1 inevitably results in increased consumption of lab diet, and shows how palatability data can become skewed over a 4 day test. Indeed, it is very difficult to conclude from this data and the author’s experience that chloralose baits are unpalatable as the active ingredient is so fast to act after such small amounts of bait take. It is worth noting that attempts to encapsulate chloralose have resulted in greater palatability, but poorer mortality (Meehan, 1984) – the slower release of chloralose from such capsules ensures mice have more time to consume the bait, but unfortunately that slow release also means that a lethal dose is never reached inside the rodent’s bloodstream. Although the mice offered the Block formulation did continue to feed from this bait in small amounts after the first day, it is at lower levels and could still be considered ‘bait shyness’. This is perhaps not as well understood in mice as most classic Conditioned Taste Aversion / Bait Shyness studies used rats as their model (e.g. Garcia et al., 1955; Rzoska, 1954) and whereas rats have been shown to display marked bait shyness that can persist for months, Shorten (1954) conducted experiments on acute rodenticides that failed to show significant shyness in mice for more than a few days, although Rao and Prakash (1980) recorded bait shyness of Mus musculus bactrianus to Zinc Phosphide that lasted for 30 days. Perhaps the symptoms of chloralose poisoning are not sufficient to cause a complete rejection of the Block formulation, which the mice continue to sample as part of their natural foraging behaviour.

Alternatives To Anticoagulants: Chloralose 163

Subsequent field trials have confirmed the efficacy of the new formulation (data unpublished) –a crucial difference in these trials is the shorter treatment times (maximum 14 days) compared to that expected of anticoagulant rodenticides, due to the rapid nature of the active ingredient. In one trial in a heavily infested animal feed merchant 96.3% control was achieved in the main areas of the site. In the Boiler Room, with ambient temperatures between 25° C to 32° C during the trial, a more modest 70.8% control was achieved. Perhaps better control could have been achieved with time, but this shows that alphachloralose can still be very effective at even these higher temperatures. In summary, this study showed that a rodenticide formulation of chloralose was capable of palatability levels sufficient to deem a rodenticide palatable (ECHA, 2009), and at temperatures which suit its application across all seasons in any temperate environment. This makes it therefore an effective and practical alternative to anticoagulants for house mice, with a key advantage of rapid action and faster elimination of an infestation.

REFERENCES CITED Cornwell, P.B. 1969. Alphakil – a new rodenticide for mouse control. The Pharmaceutical Journal 202: 74-75. ECHA. 2009. Technical Notes for Guidance on Product Evaluation. Appendices to Chapter 7 Product Type 14 Efficacy Evaluation of Rodenticidal Biocidal Products. https://echa.europa. eu/documents/10162/16960215/bpd_guid_revised_appendix_chapter_7_pt14_2009_en.pdf (Feb. 15 2017) Garcia, J., D.J. Kimeldorf, and R.A. Koelling. 1955. Conditioned aversion to saccharin resulting from exposure to gamma radiation. Science 122: 157-158. McLeod L. and G. Saunders. 2013. Pesticides used in the management of vertebrate pests in Australia: a review. Published by the New South Wales Department of Primary Industries. pests/publications/pesticides-used-in-the-management-of-vertebrate-pests (Feb.15 2017). Meehan, A. P. 1984. Rats and Mice: Their Biology and Control. East Grinstead: Rentokil Library Rao, A. M. K. M., and I. Prakash, I. 1980. Bait shyness among the house mouse Mus musculus bactrianus to zinc phosphide and RH-787. Indian Journal of Experimental Biology. 18 (12): 1490–1491 Riby, H. 2016. Toxic to Reproduction: What Does it Mean for Pest Professionals? Pest 48:10-11  http://www.pestmagazine.co.uk/media/437466/10-11-toxic-to-reproduction.pdf (Feb.15 2017) Rzoska, J. 1954. The behaviour of white rats towards poison baits, pp. 374-394. In: Chitty, D., ed., Control of Rats and Mice, Volume II. Oxford: Clarendon Press Shorten, H.N. 1954. The behaviour of the house mouse to poison bait, pp. 129-149. In: Shorten, H.N., ed., Control of Rats and Mice, Volume III. Oxford: Clarendon Press 165

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

THE UK RODENTICIDE STEWARDSHIP REGIME: A MODEL FOR ANTICOAGULANT RISK MITIGATION?

1ALAN BUCKLE, 1COLIN PRESCOTT, 2MATTHEW P. DAVIES, AND 2RUPERT BROOME 1Vertebrate Pests Unit, The University of Reading, School of Biological Sciences, Harborne Building, Whiteknights, Reading, RG6 6AS, UK 2Killgerm Chemicals Ltd., Wakefield Rd, Ossett, WF5 9AJ, UK

Abstract The UK Rodenticide Stewardship Regime has been implemented to promote the nation-wide adoption of best practice in rodent pest management, in particular the use of the second-generation anticoagulants (SGARs) by professionals. The main objective of the regime is to minimize exposure of non-target wildlife to these substances and to reduce the frequency and concentration of residues in the environment. The regime involves voluntary work by individuals and stakeholder organisations operating in six main work areas: best practice, regulatory, training and certification, point of sale compliance, monitoring and communication. This paper describes the development and implementation of the regime, outlines anticipated outcomes and offers the regime as a possible model to offset current common regulatory action, which is increasingly to impose restrictions on who can use rodenticides and where they can be applied, based on hypothetical risk assessments, with unknown potential detrimental effects on human and animal health and hygiene.

Key words Best practice, monitoring, wildlife, anticoagulant residues, risk hierarchy, IPM

INTRODUCTION Anticoagulant rodenticides are the principal chemical intervention used for rodent pest management worldwide (Buckle and Eason, 2015). Therefore, these substances have an essential part to play globally in the maintenance of human health, well-being and prosperity and are equally important in animal health and hygiene. However, regulators in many jurisdictions, particularly in the European Union and the United States, have expressed concerns about anticoagulant rodenticides (USEPA, 2008; HSE, 2013; UBA, 2015), although the precise nature of these concerns differs depending on the authority involved. Also varied is the regulatory action now being implemented to mitigate these concerns. In the USA, risks to humans, particularly children, companion animals and non-target wildlife concern the Environmental Protection Agency (EPA) and restrictions in the availability of second-generation anticoagulants rodenticides (SGARs) to home-owners (amateurs) appears to be the main action implemented (USEPA, 2017). In Europe, concerns about risks to wildlife appear to predominate (HSE, 2013; Berny et al., 2014). Restrictions on amateur use of SGARs also feature prominently in EU Member State actions, although other measures such as the prevention of the use of long-term applications of rodenticides, sometimes called permanent baiting, and the restriction of some compounds to use only indoors are also applied. Whatever the exact nature of the regulatory action taken against anticoagulants in the US and the EU, a common outcome is the implementation of restrictions on who may use these essential products and where they can be applied. However, after the recent extensive reviews of these substances, regulators have universally decided that their continued use is required (Berny et al., 2014). 166 A. Buckle, C. Prescott, M. P. Davies, and R. Broome The UK Rodenticide Stewardship Regime: A Model For Anticoagulant Risk Mitigation?

In the United Kingdom, the Competent Authority for biocides, the Health and Safety Executive (HSE), is principally concerned about the exposure of wildlife to SGARs (HSE, 2012). Researchers in the UK have provided a series of studies which demonstrates that current use patterns result in the exposure of a range of wildlife species, including some of high conservation value (Shore et al., 2015). The biology of the species affected show that exposure follows several different ecological pathways. Perhaps unique to the UK, however, is the wide distribution and severity of anticoagulant resistance (Buckle, 2013). This has resulted in the recent reversal of the regulatory position that for the past 30 years has restricted the uses of the most potent anticoagulants to indoors, to allow their more widespread use. To permit this new strategy to be implemented in the face of regulatory concern about SGARs, HSE has required the development and introduction of a rigorous regime of rodenticide stewardship (HSE 2017). The regime, designed and co-ordinated by the Campaign for Responsible Rodenticide Use (CRRU) UK across all professional user sectors, is based on: 1) increasing awareness among users of the risks presented by the use of anticoagulants in some circumstances, 2) enhanced application of best practice among all professional user groups, 3) requirement for proof of competence at the point of sale to allow professionals to purchase anticoagulant rodenticide products, 4) application of an extensive framework of industry-funded monitoring measures and 5) a system of oversight from all relevant governmental bodies, permitting rapid adjustment of the regulatory strategy if necessary.

STRUCTURE AND IMPLEMENTATION OF THE UK RODENTICIDE STEWARDSHIP REGIME Best Practice The rigorous implementation of best practice is fundamental to the stewardship regime but this begs the question, ‘what is best practice?’ Several principles are applied in this respect. The long-standing maxim of an integrated approach to rodent pest management is always applicable. In other words no single intervention on its own is ever is likely to provide a long-term solution to rodent problems. More innovative, however, is the consideration of a ‘risk hierarchy’ among rodent control interventions. All rodent control practices bring risks, with SGARs probably bringing the most severe. However, the concept of risk hierarchy promotes the use of those interventions likely to be fully effective but which incur the least risk. An appreciation of relative risks by rodenticide users is required. This does not mean that less risky methods must all be tried and those more risky only used when the former are found to fail. Rather, a plan is implemented which first considers all possible techniques and then uses those expected to be fully effective but considered to carry the least risk. Is permanent baiting best practice? It is certainly a widely applied use of anticoagulant rodenticides. Our knowledge of the feeding patterns of some of the most contaminated UK wildlife species (Love et al., 2000), in terms of the proportion of individuals carrying residues, shows that this contamination is likely not caused by the consumption of poisoned target rodents but by exposure to contaminated non-target wild small mammals. There can be little doubt that large-scale application of rodenticides in the absence of extant pest infestations (i.e. permanent baiting) produces environmental risk, especially where permanent tamper-resistant bait boxes containing SGARs are employed outdoors with non-target small mammals present. Some EU regulators now apply a ban on permanent baiting, although some with permissible derogations (UBA, 2015). The paramount requirements of food hygiene, and the very high financial and reputational cost to manufacturers and pest control service providers of rodent detritus found in human food products, indicates that permanent baiting may sometimes be justified. A guideline is provided by CRRU UK explaining when permanent baiting may be used and how to conduct it with the least risk to the environment (CRRU UK, 2016a). The UK Rodenticide Stewardship Regime: A Model For Anticoagulant Risk Mitigation? 167

The fundamentals of best practice for implementation in the UK are now set out in a guideline (CRRU UK, 2015) which forms the basis for course content in all CRRU-approved training and certification schemes (see below). Since its publication it has been downloaded from the CRRU UK website over 8,000 times and 11,000 copies have been printed and distributed to users. A requirement to reduce exposure to wildlife during rodenticide application is emphasised in another document recently published by CRRU UK which provides guidance on environmental risk assessments (CRRU UK, 2016b). This carries a recommendation that an assessment of risk to non-target animals should be conducted whenever anticoagulants are used outdoors.

Regulatory Considerations The review of rodenticides (Product Type 14), under the requirements of the EU Biocidal Products Regulation (EU, 2012), requires the assessment of all technical data to support product authorisations. This process includes the use of environmental risk assessment models in which PEC/PNEC ratios are calculated. This ratio, the relationship between the predicted environmental concentration (PEC) and the predicted no-effect concentration (PNEC), must be less than one if there is to be no environmental concern. Anticoagulant PEC/PNEC ratios fail this test, some by very wide margins (Smith and Shore, 2015), hence the high degree of regulatory concern about these substances. The transition in UK from products regulated under the Control of Pesticides Regulation (1989) to those authorised under stewardship conditions and the EU BPR took place on April 1 2016. The stewardship regime was in place from that date, when the first rodenticide products with ‘stewardship conditions’ labels came on to the market requiring proof of professional competence to permit purchase. A smooth a transition was facilitated by CRRU UK and HSE to co-ordinate the timing of the stewardship- linked authorisations, and ensuring consistency and clarity of labels.

Training and Certification Use of certification as proof of professional competence (PPC) to permit purchase of rodenticide products necessitates definition of what such certification comprises. A training framework was produced to lay out necessary course syllabus content, examination procedures and identify suitable independent certification awarding organisations (CRRU UK, 2016c). The framework identified 13 required topic areas to be included in all approved training for certification. It was subsequently necessary to audit all existing relevant certifications to see if they covered the required topic areas to permit approval. ‘Once only’ training is inadequate when knowledge and best practice evolves quickly and regulatory requirements change. Therefore a scheme for updating certificated personnel will be needed and this is often called Continuing Professional Development (CPD). The timeline for introducing PPC was very challenging for one of the main rodenticide user groups – farmers. It was estimated that up to 100,000 farmers, previously permitted to purchase professional rodenticides, would have been disqualified from doing so because provision of training and certification could not be carried out in time. A means of temporary certification was therefore permitted through membership of a farm assurance scheme whose procedures included a published standard combining rigorous implementation of integrated rodent pest management, archived documentation of all interventions used on-farm and regular independent auditing of compliance with the standard (see Red Tractor Assurance for example, RTA, 2014).

Point of Sale Compliance The responsibility for ensuring compliance with PPC at point of sale resides with product authorisation holders, although this obligation is relayed down the distribution chain to all retail outlets via formal signed declarations of intent. Failure to apply rigorous PPC at point of sale risks manufacturers loosing authorisations and retailers the ability to sell the products in question. Auditing of compliance with 168 A. Buckle, C. Prescott, M. P. Davies, and R. Broome The UK Rodenticide Stewardship Regime: A Model For Anticoagulant Risk Mitigation? point of sale checks is to be carried out by an organisation that is independent of all interested parties. Implementation of point of sale checks at all outlets from which anticoagulants are sold to professionals was one of the challenges overcome by the stewardship regime.

Monitoring The principle purpose of the regime is to reduce wildlife exposure and, therefore, the main monitoring tool will be an annual assessment of the degree of contamination of a sentinel species, the barn owl (Tyto alba) (Table 1; CRRU, 2017). This species was chosen because of the long-term data set made available by the work of the Centre for Ecology & Hydrology, (Shore et al., 2015) and because the predatory behaviour of barn owls is typical of several other species which use the same prey resources. Residues in barn owl livers tell us much about the degree of contamination but nothing about the status of the species and any possible effects of exposure on its distribution and abundance. Therefore, a project is also in place, conducted in conjunction with the Barn Owl Conservation Network, to monitor the annual breeding success of selected UK barn owl populations. Although about 90% of UK barn owls are thought to carry residues of one or more SGAR (Shore et al. 2015), the UK barn owl population has nevertheless been increasing, both in terms of the numbers of breeding pairs and their geographical spread (Balmer et al., 2015). The same holds true for several other UK species of predatory bird, including buzzard (Buteo buteo) and red kite (Milvus milvus), that are commonly contaminated with SGARs.

Table 1. Numbers of UK barn owls found with and without residues of second-generation anticoagulant rodenticides (SGARs). Among the total of 100 birds collected and analysed in 2015, 94% carried residues of one or more SGAR. From Walker et.al. (2016).

broma- difenacoum brodifacoum flocoumafen difethialone diolone Non-detected 23 28 47 98 90 Detected 77 72 53 2 10 % detected 77% 72% 53% 3% 10%

Reducing wildlife exposure is to be achieved through improved use practices (see above). A Knowledge, Attitudes and Practice (KAP) survey was therefore conducted in 2015 to gather information on levels of training, knowledge and adoption of best practice prior to stewardship implementation. KAP surveys will be repeated periodically to monitor progress among the three main user communities in the UK, pest control professionals in the public and private sectors, farmers and gamekeepers.

Communication A fundamental focus of the regime has been on effective communication with all professional rodenticide users to improve their understanding of the causes of wildlife contamination and how it might be prevented. The necessities of best practice, reasons for the implementation of the stewardship regime, the various critical time points within its adoption, such as the introduction of point-of-sale competence checks for purchase of professional rodenticides, and progress towards key monitoring goals have all been the subject of nation-wide communications in all user communities.

The UK Rodenticide Stewardship Regime: A Model For Anticoagulant Risk Mitigation? 169

CONCLUSIONS Regulatory concern about, and therefore regulatory pressure on, anticoagulant rodenticides is unlikely to reduce in the near future. Indeed, a recent decision by the Risk Assessment Committee of the European Chemicals Agency looks set to reduce the active ingredient concentration in many widely-used products from 50 ppm to less than 30 ppm, with unknown effects on efficacy and resistance development, due in this case to hypothetical human health risks (ECHA, 2014). Until demonstrably safer, and equally effective active substances come to the market, and this is unlikely to happen in the foreseeable future (Buckle and Smith, 2015), we must find ways to use these essential biocides whilst minimizing risk, both to human health and the environment. The approach adopted in the UK rodenticide stewardship regime may be capable of wider application. It applies requirements upon all professional users for training and certification to promote more comprehensive use of best practice. Proof of competence is required when products are purchased. Clear objectives are set for success, within a realistic time- frame. Comprehensive monitoring, within projects covering all intended objectives, permits progress to be studied against expectation and, consequently, regulation to be modified if necessary in timely fashion. The regime has permitted, for the time being at least, an expansion of the use of SGARs in the UK, mainly to combat resistance development and spread, at a time when regulators in many other jurisdictions are moving in the opposite direction, based on hypothetical and desk-based risk assessments, with unpredictable outcomes for human and animal health and hygiene.

REFERENCES CITED Balmer, D., S. Gillings, B. Caffrey, B. Swann, I. Downie and R. Fuller. 2013. Bird Atlas 2007-2011. The breeding and wintering birds of Britain and Ireland, BTO Books, Thetford, UK. 720 pp. Berny, P., A. Esther, J. Jacob and C. Prescott. 2014. Risk mitigation measures for anticoagulant rodenticides as biocidal products. Final Report. October 2014. Luxembourg: Publications Office of the European Union. 104 pp. https://circabc.europa.eu/sd/a/352bffd8-babc-4af8- 9d0c-a1c87a3c3afc/Final%20Report%20RMM.pdf. Feb. 17, 2017. Buckle A.P. (2013). Anticoagulant resistance in the UK and a new guideline for the management of resistant infestations of Norway rats (Rattus norvegicus Berk.). Pest Management Science 69(3), 334-341. Buckle, A.P. and C.T. Eason. 2015. Control methods: chemical, pp. 123-154. In: Rodent pests and their control (Buckle, A.P. and Smith R.H. eds.). CABI, Wallingford, UK. 422 pp. Buckle, A.P. and R.H. Smith. 2015. Rodent control: back to the future (the sequel), pp. 397-402. In: Rodent pests and their control. Buckle, A.P. and Smith R.H. eds.. CABI, Wallingford, UK. 422 pp. CRRU UK. 2015. CRRU UK Code of best practice – Best practice and guidance for Rodent Control and the safe use of rodenticides. Campaign for Responsible Rodenticide Use, UK. March 2015. 24 pp. http://www.thinkwildlife.org/crru-code/. Feb. 17, 2017. CRRU UK. 2016a. CRRU Guidance Permanent Baiting. Campaign for Responsible Rodenticide Use, UK. April 2016. 8 pp. http://www.thinkwildlife.org/downloads_resources/. Feb. 17, 2017. CRRU UK. 2016b. CRRU Environmental Risk Assessment. Campaign for Responsible Rodenticide Use, UK. Oct. 2016. 6 pp. http://www.thinkwildlife.org/downloads_resources/. Feb. 17, 2017. CRRU UK. 2016c. Proposals for Development of Courses in Rodent Pest Management and Associated Approved Certifications. Campaign for Responsible Rodenticide Use, UK. December 2016. 6 pp. http://www.thinkwildlife.org/downloads_resources/. Feb. 17, 2017. 170 A. Buckle, C. Prescott, M. P. Davies, and R. Broome

CRRU UK. 2017. UK Rodenticide stewardship Regime: Annual report 2016. Campaign for Responsible Rodenticide Use, UK. February 2017. 6 pp. http://www.thinkwildlife.org/about- crru/. Feb. 17, 2017. ECHA. 2014. Committee for Risk Assessment RAC Opinion proposing harmonised classification and labelling at EU level of Warfarin (ISO); 4-hydroxy-3-(3-oxo-1-phenylbutyl)-2H-chromen- 2-one EC number: 201-377-6 CAS number: 81-81-2 [racemic mixture] Document CLH-O- 0000003175-78-11/F, ECHA, Annankatu 18, P.O. Box 400, FI-00121 Helsinki, Finland. 14 March 2014. pp 19. Available at: http://echa.europa.eu/documents/10162/c303b608-39b8- 422b-8bb5-35a774821333. Feb. 17, 2017. EU. (2012). Regulation (EU) No 528/2012 of the European Parliament and of the Council of 22 May 2012 concerning the making available on the market and use of biocidal products. Official Journal of the European Union L167 vol. 55, 122pp. HSE. 2012. Environmental risk mitigation measures for second generation anticoagulant rodenticides proposed by the UK. Chemicals Regulation Directorate, Health and Safety Executive, UK. August 2012. 30 pp. http://www.hse.gov.uk/biocides/eu-bpr/rodenticides.htm. Feb. 17, 2017. HSE. 2017. High-level principles for Rodenticide Regime(s). Health and Safety Executive, UK. http:// www.hse.gov.uk/biocides/eu-bpr/rodenticides.htm. Feb. 17, 2017. Love, A.R., C.E. Webbon, D. Glue, and S. Harris. 2000. Changes in the food of British Barn Owls (Tyto alba) between 1974 and 1997, Mammal Review 30: 107-129. RTA. 2014. Beef and lamb standards. 1st October 2014. Version 3.0. Red Tractor Assurance. http:// assurance.redtractor.org.uk/contentfiles/Farmers-5613.pdf. Feb. 17, 2017. Shore, R.F. Pereira, M.G. Potter, E.D. and Walker, L.A. 2015. Monitoring rodenticide residues in wildlife, pp. 346-365. In: Rodent pests and their control (Buckle, A.P. and Smith R.H. eds.). CABI, Wallingford, UK. 422 pp. Smith, R.H. and R.F. Shore. 2015. Environmental impacts of rodenticides, pp. 330-345. In: Rodent pests and their control (Buckle, A.P. and Smith R.H. eds.). CABI, Wallingford, UK. 422 pp. Shore, R.F, L.A. Walker, E.D. Potter and G. Pereira. 2016. Second generation anticoagulant rodenticide residues in barn owls 2015. CEH contract report to the Campaign for Responsible Rodenticide Use (CRRU) UK, 17 pp. http://pbms.ceh.ac.uk/sites/pbms.ceh.ac.uk/files/ stewardship-2015-owls.pdf. UBA. 2014. Authorisation of Anticoagulant Rodenticides in Germany Risk Mitigation Measures, Best Practice Code and FAQs. German Federal Environment Agency (Umweltbundesamt), Postfach 14 06 06813, Dessau-Roßlau, Germany. March 2014. 42 pp. http://www.umweltbundesamt.de/ en/publikationen/authorisation-of-anticoagulant-rodenticides-in. Feb. 15, 2017. USEPA. 2008. Risk Mitigation Decision for Ten Rodenticides, United States Environmental Protection Agency, Washington D.C, USA. May 28, 2008. 60 pp. https://www.regulations.gov/ document?D=EPA-HQ-OPP-2006-0955-0764. Feb. 15, 2017. USEPA. 2017. Canceling (sic.) Some d-CON Mouse and Rat Control Products. United States Environmental Protection Agency, Washington D.C, USA. https://www.epa.gov/rodenticides/ canceling-some-d-con-mouse-and-rat-control-products. Feb. 13, 2017. 171

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

CONTROLLING URBAN PIGEON POPULATIONS HUMANELY

1MARCO PELLIZZARI AND 2DAVID LOUGHLIN 1ACME Srl, via Portella della Ginestra, 9, Zona Industriale Corte Tegge, 42025 Cavriago (Re), Italia 2Sentomol Ltd., Glen House, St. Maughans Green, Monmouth, NP25 5QG, United Kingdom

Abstract Pigeons (Columba livia) are considered a major pest problem around the world. Management tools such as netting, spikes, gels and other approaches such as flying predatory birds can help, but these often move the problem elsewhere. Ovistop® containing nicarbazin can reduce pigeon numbers through contraception. Nica- rbazin treated corn can reduce pigeon numbers by 30% year on year for up to five years and maintain low pigeon numbers thereafter. Combined with other pigeon management products, it represents a modern, integrated pest management solution to this pest problem.

Key words Feral, bird, contraception, nicarbazin. INTRODUCTION The Feral Pigeon (Columba livia var. domestica) is a descendent of the Rock Dove which lives on cliffs in coastal regions but has adapted well to living in urban environments. The move to areas of human habitation and their close association with man (synanthropy) has been greatly influenced by their use as a food source, both for meat and eggs, illustrated by a wide variety of man-made dovecote type structures that exist around the world. Today we are used to seeing pigeons in our urban environment. To some they are part of the landscape and provide a natural link to nature that may otherwise be lacking in cities. Others get pleasure in feeding them. Pigeons love cities as they provide ideal roosting spots (Sacchi et al., 2002). The public habit of feeding pigeons does not help; this not only provide ideal roosts but the free availability of human waste food helps pigeons to succeed in urban situations. When pigeons are present in high numbers, they can present a hazard. Health and safety concerns come from a build-up of faecal matter which apart from being unsightly, when wet can cause slippage. The acidity can cause damage to stone and paintwork (Bassi and Chiatante, 1976) with an associated increase in cost to pay for the removal (Nomisma, 2013). Our heritage and outdoor works of art are most vulnerable (Pochon and Jaton, 1968). There is an associated potential risk to health, as pigeons have been found to carry several transmissible diseases (WHO, 2008). The primary means of transmission is through the droppings, which when dry, the infection vector (virus or bacteria) becomes powdered and floats up into the air as dust, which can be inhaled. Those with weakened immune systems are most vulnerable. Organisms include Cryptococcal meningitis, Salmonella (Haesendonck et al., 2016) and Listeria, Viral Encephalitis, E. Coli, Histoplasmosis, Campylobacteriosis (Gargiulo et al., 2014). Feral pigeons are commonly infected with the zoonotic bacterium Chlamydophila psittaci, the agent of psittacosis (also known as ornithosis) in humans (Magninoet al., 2008). Several surveys across Europe have detected high percentages of infection in feral pigeon populations (Vázquez et al., 2010). Those who work in the pest and facilities management sector are often most at risk as they often provide the cleaning services to remove unwanted guano. 172 M. Pellizzari and D. Loughlin Controlling Urban Pigeon Populations Humanely

There are two main categories pf products to manage pigeons. Bird deterrent or displacement tools, although sold as bird control products, do not affect pigeon numbers but seek to make environments unattractive for feeding, nesting and roosting. These include nets, spikes, wires, electrocution strips, gels, lasers, flying birds of prey and use of mimic predators. There are a wide range of such products that, if well deployed, can be very effective. However, if not well maintained birds can quickly exploit any weaknesses. True control approaches that affect pigeon population numbers, include shooting, trapping, use of nest boxes and egg replacement. The most popular of these, the culling of birds through trapping and shooting, can be effective at reducing pigeon numbers in the short term but require strict adherence to the appropriate laws, regarding the use of firearms and to animal welfare. Unless the programme is implemented regularly, pigeon populations have a strong ability to recover quickly, often to a higher level than before (Sol and Senar, 1992, 1995). Why are pigeons so troublesome? As always, it is important to understand the biology of the pest (Murton et al., 1972). Adult pigeons typically live 3-5 years depending on food resources, natural predation and human interference. All columbiformes are monogamous (pairing with one mate for life) and their pest status is heavily linked to their ability to breed all year round, climate allowing. They create a flimsy nest on accessible ledges, on a building or in the roof void of buildings (Murton et al., 1972). Two eggs are usually laid on each occasion, which hatch in 17-19 days. The squab lasts 30 days, growing through the fledgling stage to a juvenile at 6 months. Often breeding pairs will lay a new batch of eggs as soon as the previous ones have hatched. Juveniles are also capable of breeding from 6 months. These factors combined create a scenario where 2 pigeons can increase in number in a short period (theoretically 8-16 additional pigeons per year). This is why culling strategies have a short-term effect, as the recovery potential is so strong. A hierarchy exists within a colony of pigeons. Typically, 15% are dominant, experiencing low mortality as they have good access to resources and freely reproduce; 55% are subdominants that occasionally reproduce and 30% are juveniles. Although young pigeons can breed, this is rare, as they are poorer competitors than adults and are more vulnerable to starvation and disease with higher mortality rates than adults (Sol, D. et al., 1998). However, juvenile dispersal within a given city is significant with 30% of fledglings capable of dispersal each year as they move to new colonies where conditions may be better (Hetmanski, T. 2007). To influence pigeon numbers long term, a different approach is required.

MATERIALS AND METHODS Various products have been used in the past to interfered with breeding but these had an imperfect use profile (Dolbeer, 1980). Nicarbazin is a complex of two compounds (4,4’-dinitrocarbanilide (DNC) and 4,6-dimethyl-2-pyrimidinol (HDP)) that has been used as a coccidiostat in broiler chicken feeds since the 1950s (Jones et al., 1990), as a feed additive for the prevention rather than the treatment of disease, even in chicken destined for human consumption (Ott et al., 1956). At recommended doses however, treatment can affect egg laying hens, reducing hatchability and interrupting egg laying (Jones et al., 1990). Nicarbazin is not a hormone. It compromises the integrity of the egg’s vitelline membrane, allowing yolk and albumen to mix (Sherwood et al., 1956). The effect is temporary and birds recover fully 4–6 days after being taken off treated food (Yoder et al., 2005; Barbato and MacDonald, 2006). It was this side effect of nicarbazin which Italian veterinarians and researchers decided to exploit to reduce problem pigeon populations. The fertility effect on pigeons was first verified in studies on racing pigeons and proposals for urban pigeons quickly followed (Martelli et al., 1993), and trials by Ferri et al. (2009) led to the first effective presentation of nicarbazin for pigeon population management. Developed in collaboration with Acme Drugs, Italy (Ovistop®), this uses natural whole maize grains containing 800 ppm nicarbazin, applied at 8-10 g of maize grains, per pigeon per day, for a minimum of 5 days a week, from March to October. Controlling Urban Pigeon Populations Humanely 173

RESULTS AND DISCUSSION Ferri (2009) applied treated maize to 552 colonies (85,562 pigeons) and the resulting infertility led to a significant reduction (from 28% to 71%) of the number of pigeons in different Italian urban colonies. (Figure 1 shows results for Udine). Similar field effects were demonstrated in studies in Carpi, Parma and Forlì (Bursi et al., 2001) which showed a reduction of in the pigeon population of approximately of 48%, 8 months following daily administration (Table 1), while Albonetti et al., (2015) considered the efficacy of nicarbazin in the containment and reduction of a population of feral pigeons in the city of Genoa, Italy over an 8 year period (2005-2012). A reduction was observed over the first 4 years (35% to 45%) and a further decrease (65% to 70%) over the subsequent 4 years (Table 2). In Modena, the population has similarly been treated and pigeon numbers monitored since 2008 (Figure 2) (Ferri, 2016). In all studies, to be effective, it was important to first estimate the population and colonies within a given area, to determine the number of feeding points, to decide whether to use manual or automatic application and the daily dose to be delivered. Pigeons can quickly become habituated to being fed but before any treatment, plain maize kernels are used for a minimum of two weeks, to confirm that the correct locations have been chosen and that the pigeons will eat. Regular corn is then replaced with a nicarbazin treatment. As populations decrease, less product is required, but the remaining population needs to be continuously fed for the treatment to be effective.

Figure 1. Pigeon population reduction effect in Udine, Italy over 7 years 2000-2007 (Ferri, 2009). Arrows indicate start of application of treatment.

174 M. Pellizzari and D. Loughlin Controlling Urban Pigeon Populations Humanely

Figure 2. The population reduction effect of 8 years of pigeon treatment with nicarbazin treated maize in Modena 2008 – 2016. (Ferri, 2016)

The major benefit of nicarbazin, when compared to other fertility treatments, is its safety and environmental profile. There are no risks to other birds. In addition to the low toxicity, the risk to non- target birds is principally controlled by the large size of kernels and careful distribution, to feed those birds present only at the time of application.

Table 1. Changes in pigeon numbers at 4 Italian cities after short (4 months) and long treatments (7 to 8 months) with nicarbazin treated maize (Bursi et al., 2001).

Dura- Year Location Start End % Reduction tion 1996 Carpi Long 512 418 18% 1997 Forli Short 200 63 68% 1997 Parma Long 3219 1618 49% 1997 Carpi Long 745 365 51% S Felice sul 1997 Long 280 100 64% Panaro Total 4956 2564 48% Controlling Urban Pigeon Populations Humanely 175

Table 2. Efficacy of nicarbazin over 8 years to reduce pigeons in Genoa, Italy. (Albonetti, et al., 2015).

Mean pigeon numbers at each location each year

(presented using a relative index number, base 100, to best describe trend) Station 2. Station 1. Station 3. Control station Year Tommaseo 4. Scio Square Casaregis Street Square Cecchi Street 2005 107.8 199.4 148.9 155.0 2006 59.0 143.7 120.0 196.6 2007 65.5 146.5 123.2 258.8 2008 58.2 103.4 93.1 239.7 2009 23.9 53.6 64.0 216.6 2010 28.5 56.0 56.7 220.2 2011 25.9 62.0 40.9 259.6 2012 26.9 59.5 45.3 173.8 Reduction 75% 70% 70%

There is no risk posed to raptors that eat pigeons that have consumed nicarbazin. When pigeons ingest nicarbazin, they metabolize it rapidly and it breaks down into the two components. When a raptor eats a pigeon treated with nicarbazin, the nicarbazin exists in a dissociated form and is consequently inactive because it cannot be absorbed or the remaining inactive nicarbazin, that could be consumed, is irrelevant due to the scarce amount that remains (WHO, 1999; UN et al., 2000). Regarding granivorous species, the size of the maize kernels stops them being ingested by birds of smaller sizes than a pigeon. There is similarly no harm to the health of the pigeons (Yoder, Miller, and Bynum 2005). Clinical tests on pigeons treated with nicarbazin have not shown any adverse side effects nor anatomical or functional modifications with regards to their tissue or organs (Ubaldi and Fusari, 2000). The effect on egg laying is reversible, with egg laying returning 4-6 days after cessation of feeding. It is key to the success of any bird management programme that the public are advised to stop feeding the pigeons.

CONCLUSION Nicarbazin is an effective tool to reduce pigeon numbers. At a recommended application of 8 grammes of product per pigeon per day, in the first year of treatment, there is a reduction of approximately 20- 30% and after 4-5 years, a reduction of approximately 80% of the initial population. This reduction has been seen in all control programs that have been correctly implemented (Avery, 2006). The Italian experience is now leading to a much wider international adoption. Nicarbazin treated maize is being used in Singapore to manage pigeons (Hassan, 2015) and is now being applied to control 85,000 pigeons in the city of Barcleona (El Mundo, 2016). It is expected other towns, cities and facilities will also benefit as the approach becomes more widely understood.

REFERENCES CITED Albonetti, P., A. Marletta, I. Repetto, and E. Sasso. 2015. Efficacy of nicarbazin (Ovistop®) in the containment and reduction of the populations of feral pigeons (Columba livia var. domestica) in the city of Genoa, Italy: a retrospective evaluation. Veterinaria Italiana. 51 (1): 63-72. doi: 10.12834/VetIt.337.1448.3. 176 M. Pellizzari and D. Loughlin Controlling Urban Pigeon Populations Humanely

Avery, M. 2006. Effects of nicarbazin bait on pigeon reproduction. USDA/APHIS National Wildlife Research Center, Gainesville, Florida Experiment Station. Barbato, G. and A. MacDonald. 2006. Pekin Duck model for action of nicarbazin on fertility. Pennsylvania State University. Bassi, M., and D. Chiatante. 1976. The role of pigeon excrement in stone biodeterioration. Ini. Bìodein. Bull. 12 (3): 73-79. Bursi, E., A. Gelati, M. Ferraresi, G. Zannetti. 2001. Impiego della nicarbazina nel controllo della riproduzione del colombo randagio di città. Annali della Facoltà di Medicina Veterinaria, Università di Parma http://hdl.handle.net/11381/1463941. Dolbeer, R.A. 1980. The challenge of cost-benefit determinations in bird-damage control programs. Great Plains Wildlife Damage Control Workshop Proceedings. http://digitalcommons.unl. edu/gpwdcwp/242/. El Mundo. 2016. Barcelona, primera gran ciudad en controlar las palomas con anticonceptivos. http://www.elmundo.es/cataluna/2016/11/25/583878bfe5fdeadd098b45d4.html (Jan, 2017). Ferri, M., M. Ferraresi, A. Gelati, G. Zannetti, A. Ubaldi, B. Contiero, E. Bursi. 2009. Use of Nicarbazin in the control of urban pigeon colonies in Italy in 1990-2007. Ann. Fac. Medic. Vet. di Parma. (29): 91 -102. Ferri, M. 2016. pers comms. The effect of 8 years application of Ovistop in Modena 2008 -2016. Gargiulo, A., T. Russo, R. Schettini, K. Mallardo, M. Calabria, L.F. Menna, P. Raia, U. Pagnini, V. Caputo, A. Fioretti, and L. Dipineto. 2014. Occurrence of enteropathogenic bacteria in urban pigeons (Columba livia) in Italy. Vector-Borne and Zoonotic Diseases, 14(4). Hassan, Nadia J. 2015. Trial underway to control pigeon problem. Channel News Asia. www. channelnewsasia.com/news/singapore/trial-underway-to-control/2240094.html (January, 2017). Haesendonck, R., G. Rasschaert, A. Martel, E. Verbrugghe, M. Heyndrickx, F. Haesebrouck, and F. Pasmans. 2016. Feral pigeons: A reservoir of zoonotic Salmonella enteritidis strains. Veterinary Microbiology. 195: 101-110. Hetmanski, T. 2007. Dispersion asymmetry within a feral pigeon population. Acta Ornithologica, 42 (1), 23-31. Jones, J.E., I. Solis, B.L. Hughes, D.J. Castadldo, and J.E. Toler. 1990. Reproduction responses of broiler-breeders to anticoccidial agents. Poultry Science. 69:27-36. Martelli, P., L. Bonati, A. Gelati, M. Ferraresi, L. Montella, E. Cabassi, and G. Zannetti. 1993. Effects of nicarbazin on pigeon reproduction. Preliminary notes. Acts of the Italian Society of Veterinary Science. 47: 1283. Murton, R.K., C.F.B. Coombs, and R.J.P. Thearle. 1972. Ecological studies of the Feral Pigeon Columba livia. Flock behaviour and social organization, J. Appl. Ecol., 9 (3), 875-889. Murton, R.K, R.J.P. Thearle, and J. Thomson. 1972. Ecological studies of the Feral Pigeon Columba livia. Population, breeding biology and methods of control, J. Appl. Ecol., 9 (3), 835-874. Nomisma, 2013. Valutazione dei costi economici e sociali dei colombi in ambiente urbano. Ott, W.H., S. Kuna, C.C. Porter, and C. Cuckler. 1956. Biological studies on nicarbazin, a new anticoccidial agent. Poultry Science 35:1355-1367.

Controlling Urban Pigeon Populations Humanely 177

Pochon, J. and C. Jaton. 1968. Facteurs biologiques de l’alteration de la pierre. In: Biodeterioration of materials. Microbiological and allied aspects. A. H. Walters and J. Elphick (Eds), Elsevier Pub. Co., London: 258-268. Sacchi, R., A. Gentilli, E. Mazzetti, and F. Barbieri. 2002. Effects of building features on density and flock distribution of feral pigeonColumba livia in an urban environment. Canadian Journal of Zoology 80: 48-54. Sol, D., Santos, D.M., and J. Garcia. 1998. Competition for food in urban pigeons: The cost of being juvenile. The Condor 100:298-304. Sol, D. and J.C. Senar. 1992. Comparison between two censuses of feral pigeon Columba livia from Barcelona: an evaluation of seven years of control by killing. Butll. GCA, 9: 29-32. Sol, D. and J.C. Senar. 1995. Urban pigeon populations: stability, home range and the effect of removing individuals. Can. J. Zool., 73: 1154-1160. Ubaldi, A. and A. Fusari. 2000. Il fattore sicurezza nell’impiego della nicarbazina a scopo terapeutico e anticoncezionale. United Nations, World Health Organization (WHO), Food & Agriculture Organization (FAO), Jt. Exp. Comm. on Food Additives (JECFA) 2000. Evaluation of certain veterinary drug residues in food (nicarbazin). 888: 66-72. Vázquez, B., F. Esperón, E. Neves, J. López, C. Ballesteros, M.J. Muñoz. 2010. Screening for several potential pathogens in feral pigeons (Columba livia) in Madrid. Acta Veterinaria Scandinavica (52) 45. World Health Organization (WHO) 1999. FAO Food and Nutrition Paper 41 (11). Residues of Some Veterinary Drugs in Animals and Foods. World Health Organization. 2008. Public health significance of urban pests - ISBN 978-92-890- 7188-8: 239 - 288. Yoder, C. A., L.A. Miller, and K.S. Bynum. 2005. Comparison of nicarbazin absorption in chickens, mallards and Canada geese. National Wildlife Research Center, Fort Collins, CO. Poultry Science. 84: 1491-1494. 179

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

TOWARDS PRACTICAL APPLICATION OF EMERGING FERTILITY CONTROL TECHNOLOGIES FOR MANAGEMENT OF ROSE-RINGED PARAKEETS

MARK LAMBERT, GIOVANNA MASSEI, JULIE DENDY, AND DAVE COWAN National Wildlife Management Centre, Animal and Plant Health Agency, Sand Hutton, York, YO41 1LZ

Abstract Rose-ringed parakeets have recently become established in cities across Europe including London, where they are now commonly seen in parks and gardens. Concerns regarding impacts on native birds as well as noise and damage to horticultural interests, have prompted increasing interest in management of populations to reduce numbers. However, parakeets are also regarded by many people as a charismatic and colourful addition to our native fauna, and hence use of lethal methods is increasingly likely to meet with public opposition. We previously found that a cholesterol inhibitor, which has been used for control of feral pigeons, significantly reduced fertility rates in captive rose-ringed parakeets with no obvious negative effects on welfare. The effects are temporary but not species-specific, which means that targeted delivery systems are required before the method is likely to gain approval for use in the field in the UK. We developed and tested two types of weight-operated feeder using untreated test baits in captivity and then in the field. Feral parakeets successfully fed from the feeders, but non-target corvids and grey squirrels were also able to access the baits. Further development of species-specific delivery systems is required before non-lethal control of rose-ringed parakeets by using oral contraceptives is feasible.

Key words Ring-necked parakeet, Psittacula krameri, non-native species, human-wildlife conflicts.

INTRODUCTION Rose-ringed parakeets (Psittacula krameri) are native to central Africa and Asia but through accidental and deliberate release, populations are now established in Europe, Japan, and the United States (Lever, 2005). As an invasive non-native species, the rose-ringed parakeet has raised conservation concerns, because the early breeding season and preference for established nest cavities places it in potential conflict with native cavity-nesting birds (Lever, 2005; Strubbe and Matthysen 2007, 2009a). In their native range, rose-ringed parakeets are considered serious agricultural pests (Ali and Ripley, 1969) and hence their population expansion is also of economic interest (Fera, 2010). In Europe however, rose-ringed parakeet populations are still largely concentrated in urban areas (Strubbe and Matthysen, 2009b) where they are common visitors to bird feeders in parks and gardens (Glue, 2002; Clergeau and Vergnes, 2011). Given the current and predicted impacts of rose-ringed parakeets, there has been considerable interest in their removal or control. Licenced shooting is permitted in England but primarily intended for crop protection and thus controversial in urban areas where justification may be more difficult to demonstrate. Non- lethal techniques, such as fertility control, potentially offer an alternative to culling, provided that they are effective, humane, safe and sustainable. We previously demonstrated that an orally administered cholesterol inhibitor 20, 25-diazacholesterol dihydrochloride (diazacon) was effective in reducing the productivity of rose-ringed parakeets in captivity (Lambert et al., 2010). Diazacon has also been found to be an effective contraceptive for the monk parakeet (Myiopsitta monachus) introduced to the United 180 M. Lambert, G. Massei, J. Dendy, and D. Cowan Towards Practical Application Of Emerging Fertility Control Technologies

States (Avery et al., 2006; Yoder et al., 2007; Avery et al., 2008). These promising results suggest that diazacon could potentially be used to help manage populations of invasive parrot species, including the rose-ringed parakeet. However, to avoid exposure to non-target species that could potentially be affected a reliable means of targeted application is required. We designed and tested two types of species-specific feeders in captive and free-living parakeets to determine (i) the ability of parakeets to feed from each design, (ii) the degree of species-specificity, to evaluate the feasibility of using this method to deliver contraceptive baits to the target species.

MATERIALS AND METHODS Two novel types of custom-made feeders were designed (Figure 1). The first (lever-operated; LO) was based on the concept of the ‘weighted door’ design employed in food hoppers for grey squirrel control (Pepper and Currie, 1998). Instead of pushing against a weighted door to gain entry to a food hopper, the lever type feeder was operated by the weight of the target animal acting against a hinged and weighted lid via a perch and lever system. The weight on the lid was adjusted so that a downward force on the perch exerted by an adult parakeet of 125 g – 160 g average body weight (source: British Trust for Ornithology (2005) Ringing Scheme data) would be sufficient to raise the lid. The second design (springtype; SO) was based on a commercial cylindrical (tubular) birdseed feeder for perching birds but with a spring loaded outer tube restricting access for smaller perching birds by weight. Our designs were based on the types of garden bird feeders commonly used by small passerines and rose-ringed parakeets; we predicted that birds lighter than parakeets would be unable to operate the feeders, and we expected that larger garden birds would favour tray feeders and hence would not attempt to use our experimental feeders. Using untreated feed throughout, we trialled the feeders in four phases: Trial of prototype feeders in captivity: First we tested the response of rose-ringed parakeets in captivity by placing two feeders of one design in each of six outdoor aviaries each containing seven parakeets; hence three aviaries had two lever-operated feeders and three aviaries had two spring-operated feeders. Aviaries were 7-10 m long x 3 m wide x 2.5 m high, constructed of rectangular wire mesh (12.5 x 25 mm) over a wooden frame with an earth or gravel floor; tree branches and wooden perches were added to simulate a natural environment. During the first week of the trial the feeders were locked open such that parakeets could feed freely; food takes from the feeders and spillage (collected in open trays beneath) were measured and observations of feeding behaviour by individual birds were made during one hour before dusk each day when parakeets were most active (Lambert et al., 2010). Data collected consisted of the length of time spent at each feeder, whether the parakeet was investigating or feeding during that visit, and interactions between individuals (wins/losses when birds tried to displace others from feeders or preferred perches) to determine social rank according to David’s Score (Gammell et al., 2003). The feeders were then activated; observations of food takes and feeding behaviour continued for a further two weeks. Water, fresh fruit and normal maintenance diet (in open trays) containing sunflower, millet and hemp seeds were provided ad-libitum throughout the trial apart from in week 3 when the maintenance diet was removed during observation periods. Outdoor pilot trial: Next we deployed four of the prototype feeders (two of each type) in an area where parakeets were not present to test the response of non-target species. The feeders were deployed in place of regular bird feeders filled with a weighed quantity of commercial bird seed mix and were locked open (pre-trial) for 8 days. The feeders were checked regularly (every 1-4 days), and the contents weighed and replenished if necessary. All test feeders were then closed (trial) for a further 7 days, they were then checked every 2-3 days, and the contents weighed if necessary. Bird visits to 2 of the feeders (one of each design) during the last 24 hours of the pre-trial phase, and the first 24 hours of the trial phase were recorded using a colour video camera linked to a time-lapse VCR to record number of species feeding and number of visits per species. Towards Practical Application Of Emerging Fertility Control Technologies 181

Main trial: We made larger feeders to increase capacity (but to the same designs and weight sensitivity as previously), and deployed them at 12 sites (0.35 km – 28 km apart) where rose-ringed parakeets occurred in Surrey (n = 6; 4 LO, 2 SO), Berkshire (n = 4; 1 LO, 3 SO) and Buckinghamshire (n = 2; 1 LO, 1 SO). One trial site was on farmland at the Animal and Plant Health Agency in the county of Surrey where rose-ringed parakeets were known to regularly visit bird feeders, the others were private gardens in sub-urban areas likely to be visited by rose-ringed parakeets (parakeets were known to have visited several of these gardens the previous winter). LO feeders were fixed to the top of a 2m fence post; SO feeders were suspended from a commercial bird feeder hanger at a similar height. Feeders were locked open from mid-November 2009 until 9th February 2010; this time was chosen as the likely time for delivery of contraceptives in advance of the early (late winter) egg-laying period (Lambert et al. 2009). Feed take was measured 1-2 times per week, camera traps ((DGS-I60, MFH-I-40 (Moultrie, Calera, Alabama) or RC60 (Reconyx, Wisconsin, USA)) were used to monitor bird activity (species visiting, whether they successfully fed) for the final 20 days of this pre-bait period and for the remainder of the trial. Half of the feeders (3 of each type) were activated for 21 days; the treatments were then reversed and observations continued for up to 27 days. Feeders were placed away from fences and mature shrubs and trees to deter grey squirrels (Sciurus carolinensis) from feeding; a baffle was also added to each feeder support to deter access by squirrels. A tray was placed below each feeder to measure spillage. Half of the feeders (3 lever-operated and 3 spring-operated) had open trays so that non-target birds were allowed to feed, and hence their feeding behaviour could be monitored. The remaining feeders had mesh covers so that non-target birds could not remove the spillage, hence we could record the weight of spilled food Follow-up trial: As anecdotal evidence from the previous trial suggested that proximity of the feeders to trees or shrubs might affect likelihood of parakeets using the feeders, we investigated the effect of feeder placement with a further short trial. Feeders were deployed at 6 sites (3 Berkshire, 3 in Buckinghamshire); 3 were new sites, 3 were sites used in the main trial. The feeders (all SO type) were placed near to (within 5m) mature trees, shrubs or other structures that might enable parakeets to land in groups (rather than previously where feeders were placed in open ground to deter grey squirrels. The trial lasted a total of 49 days; all feeders were first locked open and then (after 2 weeks) activated, otherwise the trial followed the same protocol as the main trial.

Figure 1. Two types of custom-made bird feeders designed for species- specific presentation of feed to rose- ringed parakeets (drawings by Phil Aldwinckle). 182 M. Lambert, G. Massei, J. Dendy, and D. Cowan Towards Practical Application Of Emerging Fertility Control Technologies

RESULTS Trial of prototype feeders in captivity: Captive birds quickly learned to use the feeders. The mean daily feed take (shelled peanuts) was greater for the lever-operated (Figure 2). Total bait uptake from the six spring-operated feeders was 386.8 g, spillage was 70.5 g (18.2%), hence 316.3 g were consumed; this was equivalent to an average of 1.4 g per bird per day. Total bait uptake from the six lever-operated feeders was 1752.4 g, spillage was 525.7 g (30%), hence 1226.7 g were consumed and equivalent to an average of 5.7 g per bird per day. Observations of feeding behaviour indicated no significant correlation between David’s Score and number of feeding visits to either the lever-operated feeder (Spearman’s rank correlation coefficientrho = -0.353, P = 0.123) or spring-operated feeder (rho = 0.107, P = 0.948) indicating that feeders were not monopolised by individual birds. Outdoor pilot trial: During the pre-trial phase, the feeders were visited by 5 species. Three species visited both feeders; blue tit (Cyanistes caeruleus), great tit (Parus major), tree sparrow (Passer montanus). A further two species visited the lever-operated feeder; greenfinch (Carduelis chloris) and robin (Erithacus rubecula). None of the species visiting the feeders were able to access the contents during the trial phase (Table 1). Main trial:A total of 45,349 g of feed was taken between feeder deployment in mid-November and the end of the trial 136 days later; 22,190 g from spring-operated feeders and 23,159 g from lever-operated. Food take for the 29 days to 30th December was 10,435 g, the bait uptake for the following 29 days was 9,992 g; this suggested that bait takes had stabilised over the first two weeks of the pre-trial period in late November. The total amount of spilled bait recorded during the entire trial from all feeders was 772.8g; the majority of this (742.8 g) was found in the mesh-covered trays representing 2.48% of the food takes from those six feeders. When switched to weight-activated mode, average daily food takes were reduced by 28.4% (from 218.4 g to 156.4 g) for spring-operated feeders and by 73.4% (from 243.9 g to 65.0 g) for lever-operated feeders. Between 20th January (when camera observations started) and the end of the trial 2,783 visits to the feeders by rose-ringed parakeets and 13 non-target species were recorded; 2,649 (95.2%) visits by non-targets and 134 (4.8%) by rose-ringed parakeets (Table 2). A total of 622 feeding visits were recorded when feeders were in weight-activated mode; five by Eurasian jay (Garrulus glandarius), 85 by Eurasian jackdaw (Corvus monedula), 511 by grey squirrel and 21 by rose-ringed parakeets (jays and squirrels fed from the lever-operated feeders, jackdaws and rose-ringed parakeets fed from the spring-operated feeders).

Figure 2. Mean peanut takes from two types of feeders presented to 42 rose-ringed parakeets in captivity (six aviaries, three with two lever- operated feeders and three with two spring-operated feeders). Alternative food was provided throughout except in week 3 when it was removed for one hour each day. Towards Practical Application Of Emerging Fertility Control Technologies 183

Table 1. Data from the outdoor pilot trial of two novel feeder designs to determine the response of non- target passerines (rose-ringed parakeets were not present in the study area). Four feeders (two spring- operated and two lever-operated) were deployed for 8 days locked open (the pre-trial phase) and 7 days closed (the trial phase). Visits to two of the feeders were analysed using time lapse video during the last 24 hours of the pre-bait phase, and the first 24 hours of the trial phase.

Pre-trial period (8 days) Trial period (7 days) Spring Lever Spring Lever Number of species visiting 3 5 3 5 Number of visits 109† 134‡ 57 42 Total visit time (s) 1:30:44 1:38:22 0:08:07 0:07:08 Median visit time (s) 9 12 5 7 Percent successful visits 85% 97% 0% 0% Daily bait takes per feeder (g ± S.E.) 27.3 (± 3.2) 49.7 (± 3.6) 0.1 (± 0.1) 0.0 (± 0.0) †Includes 7 visits by small passerines that could not clearly identified from the video footage ‡ Includes 5 visits by small passerines that were not clearly identified from the video footage.

Table 2. Visits to weight sensitive feeders (six lever-operated, six spring-operated) deployed at study sites in south eastern England during November 2009 – March 2010 (parenthesis indicates the number of visits where food take from the feeder was observed).

Open (pre-trial) Activated (trial) Spring- Lever- Spring- Lever-operated operated operated operated Total Blackbird Turdus merula 1 1 Blue tit Cyanistes caeruleus 16 (2) 13 (5) 1 30 Collared dove Streptopelia decaocto 3 3 Feral pigeon Columba livia 1 1 Great spotted woodpecker Dendrocopos major 1 (1) 6 (1) 2 9 Great tit Parus major 28 (8) 20 (4) 4 4 56 Jay Garrulus glandarius 373 (257) 13 (2) 14 (5) 3 403 Jackdaw Corvus monedula 303 (130) 326 (85) 628 Magpie Pica pica 64 (27) 2 66 Pheasant Phasianus colchicus ƚ 2 1 3 Robin Erithacus rubecula 1 1 2 Rose-ringed parakeet Psittacula krameri 2 87 (23) 1 44 (21) 134 Grey squirrel Sciurus carolinensis 806 (683) 571 (511) 1377 Wood pigeon Columba palumbus 58 (2) 11 69 Total 1287 509 601 386 2783 ƚ On top of feeder

184 M. Lambert, G. Massei, J. Dendy, and D. Cowan Towards Practical Application Of Emerging Fertility Control Technologies

Follow-up trial: Non-target birds did not feed from the spring-operated feeders (lever-operated feeders were not used for this trial as the main trial demonstrated that rose-ringed parakeets did not feed from this type in the field). Rose-ringed parakeets visited 5/6 feeders (38 visits in total) during the pre-trial phase and fed 19 times (a further 4 visits were putative feeding visits) (Table 3). During the trial phase, rose-ringed parakeets visited 2/6 feeders made 6 visits and fed 3-4 times. The following 8 non-target species visited the feeders during the pre-trial phase (number of visits in brackets): blue tit (229), great tit (197), greenfinch (12), jay (4), robin (4), coal tit (Periparus ater) (2), great spotted woodpecker (2), and nuthatch (Sitta europaea) (1). There were 9 visits by birds that could not be identified from the photographic records. No non-target birds accessed the feed during the trial phase. Squirrels visited all six feeders during either the pre-trial or trial phase; they successfully fed from two feeders during the trial phase.

Table 3. Visits to 6 spring-operated weight sensitive feeders in Surrey & Berkshire between 27 January and 16 March 2011. Figures in parenthesis are additional possible feeding visits where it was not clear from the photograph whether the animal had fed or not.

Open (pre-trial) Activated (trial) Rose-ringed parakeets Visits 38 6 Feeding visits 19 (+4) 3 Feeding at spillage tray 0 0 Other birds Visits 462 8 Feeding visits 266 (+5) 0 Feeding at spillage tray 4 0 Total visits 500 14 Grey squirrels Visits 31 80 Feeding visits 18 52 Feeding at spillage tray 0 0

DISCUSSION Orally administered cholesterol inhibitor 20, 25-diazacholesterol dihydrochloride (diazacon) is effective in reducing the productivity of rose-ringed parakeets in captivity (Lambert et al., 2010). As an alternative to culling, fertility control has the potential to offer a long-term, effective and more socially acceptable means of reducing the size and growth of overabundant wildlife populations (Barlow, 2000; Smith and Cheeseman, 2002; Massei and Cowan, 2014). Diazacon affects the fertility of other species of mammals and birds, albeit temporarily (Fagerstone et al., 2010) hence targeted delivery is needed to achieve species-specificity. Our trials with captive birds demonstrated that rose-ringed parakeets successfully used both novel feeder types during the pre-trial (locked open) and trial (activated) phase. Indeed, the amount of bait consumed from each feeder did not differ between the three weeks of the trial, suggesting that bait take was not reduced during the trial phase when the birds had to use the weight-operated mechanisms, and did not increase when alternative food was temporarily removed. Individual parakeets made up to 76 visits to feeders during the 3 weeks of the trial phase, suggesting a high level of interest in the feeders, although in free-feeding trials monk parakeets (Myiopsitta monachus) appeared to self-regulate intake of diazacon baits (Yoder et al., 2007). Uptake from the lever-operated design was significantly higher than from spring-operated feeders, indicating that this design might be more effective in delivering baits to a higher number of birds. Towards Practical Application Of Emerging Fertility Control Technologies 185

Rose-ringed parakeets did not feed from lever-operated feeders in the field, but they successfully fed from one of the spring-operated feeders during the main trial, however the number of visits (both during the pre-baiting and trial phases) was lower than expected. Rose-ringed parakeets were recorded at only five of the 12 sites during the trial phase, and at three of those sites they were recorded on just one occasion. During the pre-bait phase, two feeders were removed from trial sites which had not received parakeet visits and moved to gardens where parakeets regularly visited bird feeders, but this still did not greatly increase the number of visits. It is possible that the problem may have been feeder placement. Feeders were placed away from mature shrubs, trees and fences in an attempt to limit access to grey squirrels. However, this may have also discouraged the target birds; preliminary observations in the urban gardens used for the trials suggested that rose-ringed parakeets may have avoided the exposed position of the feeders, perhaps due to potential risk of attack from predators. A previous study of garden bird feeder positioning found that food consumption at feeders adjacent to cover was approximately double that of feeders 7.5 m from cover (Cowie and Simons, 1991). The follow-up trial, where the feeders were placed within 5m of mature shrubs, trees and other structures did appear to increase the number of visits by rose-ringed parakeets, but grey squirrels, which had not successfully fed from the spring-operated feeders during the main trial, did feed during the trial phase of 2011 experiment. Exposure of grey squirrels could potentially be reduced or prevented by further baffles or other devices to prevent access to feeders, although ongoing interest in use of diazacon to control non-native grey squirrels may negate these concerns (Mayle et al., 2013). There was also some evidence from this study that parakeets found it difficult to land on the feeders. In captivity, the lever-operated feeders were attached to the sides of the aviaries (most parakeets tended to land on the mesh cage sides and climb across to the feeder, rather than land directly on the perch) and the spring-operated feeders were suspended next to branches; the birds usually landed on the branch and then climbed onto the feeder. However, the low number of rose-ringed parakeets recorded at the study sites during both field trials suggests that residential suburban gardens are probably not suitable sites for placement of bait delivery systems during autumn and winter. Future work should evaluate the factors that affect bait uptake from bird feeders by parakeets to optimise the targeting a larger number of rose-ringed parakeets, particularly in areas where they may be attracted to preferred food sources (for example rural areas where vulnerable soft fruit is extensively grown) or near to roost sites. In the outdoor pilot trial, both feeder designs were effective in excluding non-target species. However in the main trial outdoors, jackdaws, which had not visited the feeders during the outdoor pilot trial successfully fed from one spring-operated feeder. This feeder was placed in a rural environment, which is not representative of the urban and sub-urban sites where the other five spring-operated feeders were placed. This site also differed in bird assemblages compared to other sites, receiving the second highest number of pre-trial visits (only one lever-operated feeder received more) and the highest overall number of species during the pre-trial phase. Of the nine species recorded at the feeder during the pre- trial phase, all but jackdaws were excluded during the trial phase. Great spotted woodpeckers, one of the species present at this site but not commonly present in urban or sub-urban gardens, had damaged the feeder baffle during the pre-trial phase; although the baffle was repaired, this may have made it easier for jackdaws to access the feeder. Despite jackdaw numbers increasing at the national level, the use of gardens by this species has declined in recent years and is also seasonal (Cannon et al., 2005); this would potentially allow deployment of parakeet feeders at times when jackdaws are least likely to occur in gardens. Nonetheless, expansion of rose-ringed parakeets from urban into rural areas would doubtless prompt interest in controlling populations in agricultural contexts where exclusion of non-target species is likely to be particularly challenging; further development of feeders for targeted delivery of fertility control baits is therefore likely to be required. 186 M. Lambert, G. Massei, J. Dendy, and D. Cowan Towards Practical Application Of Emerging Fertility Control Technologies

ACKNOWLEDGEMENTS The work was funded under Defra project WM0408. We thank Phil Aldwinckle, George Watola, Sue Fox, Fiona Bellamy and Sean Carlisle for assistance with design and construction of feeders, data collection and image decoding.

REFERENCES CITED Ali, S., and S. Ripley. 1969. Birds of and . Vol. 3. Oxford University Press, Oxford. Avery, M., J. Lindsay, J. Newman, S. Pruett-Jones, and E. Tillman. 2006. Reducing monk parakeet impacts to electric utility facilities in south Florida. Advances in Vertebrate Pest Management 4: 125-136. Avery, M. L., C. A. Yoder, and E. A. Tillman. 2008. Diazacon inhibits reproduction in invasive monk parakeet populations. Journal of Wildlife Management 72: 1449-1452. Barlow, N. 2000. The ecological challenge of immunocontraception: editor’s introduction. Journal of Applied Ecology 37: 897-902. Cannon, A. R., D. E. Chamberlain, M. P. Toms, B. J. Hatchwell, and K. J. Gaston. 2005. Trends in the use of private gardens by wild birds in Great Britain 1995–2002. Journal of Applied Ecology 42: 659-671. Clergeau, P., and A. Vergnes. 2011. Bird feeders may sustain feral Rose-ringed parakeets Psittacula krameri in temperate Europe. Wildlife Biology 17: 248-252. Cowie, R., and J. Simons. 1991. Factors affecting the use of feeders by garden birds: I. The positioning of feeders with respect to cover and housing. Bird Study 38: 145-150. Fagerstone, K. A., L. A. Miller, G. Killian, and C. A. Yoder. 2010. Review of issues concerning the use of reproductive inhibitors, with particular emphasis on resolving human wildlife conflicts in North America. Integrative Zoology 5: 15-30. Fera. 2010. Rose-ringed parakeets in England: A scoping study of potential damage to agricultural interests and management measures. Report to the Department of Environment, Food and Rural Affairs. Gammell, M. P., H. d. Vries, D. J. Jennings, C. M. Carlin, and T. J. Hayden. 2003. David’s score: a more appropriate dominance ranking method than Clutton-Brock et al.’s index. Animal Behaviour 66: 601-605. Glue, D. 2002. Kites and parakeets add colour to midwinter birdtables. Bird Populations 7: 166-169. Lambert, M., G. Massei, J. Bell, L. Berry, C. Haigh, and D. Cowan. 2009. Reproductive success of rose-ringed parakeets Psittacula krameri in a captive UK population. Pest Management Science 65: 1215-1218. Lambert, M. S., G. Massei, C. A. Yoder, and D. P. Cowan. 2010. An evaluation of Diazacon as a potential contraceptive in non-native rose-ringed parakeets. Journal of Wildlife Management 74: 573-581. Lever, C. 2005. Naturalised birds of the world, A&C Black. Massei, G., and D. Cowan. 2014. Fertility control to mitigate human–wildlife conflicts: a review. Wildlife Research 41: 1-21. Mayle, B. A., M. Ferryman, A. Peace, C. A. Yoder, L. Miller, and D. Cowan. 2013. The use of DiazaCon™ to limit fertility by reducing serum cholesterol in female grey squirrels, Sciurus carolinensis. Pest Management Science 69: 414-424. Towards Practical Application Of Emerging Fertility Control Technologies 187

Pepper, H., and F. Currie. 1998. Controlling grey squirrel damage to woodlands, Great Britain, Forestry Commission Practice Note 4. Smith, G., and C. Cheeseman. 2002. A mathematical model for the control of diseases in wildlife populations: culling, vaccination and fertility control. Ecological Modelling 150: 45-53. Strubbe, D., and E. Matthysen. 2007. Invasive ring-necked parakeets Psittacula krameri in Belgium: habitat selection and impact on native birds. Ecography 30: 578-588. Strubbe, D., and E. Matthysen. 2009a. Experimental evidence for nest-site competition between invasive ring-necked parakeets (Psittacula krameri) and native nuthatches (Sitta europaea). Biological Conservation 142: 1588-1594. Strubbe, D., and E. Matthysen. 2009b. Establishment success of invasive ring-necked and monk parakeets in Europe. Journal of Biogeography 36: 2264-2278. Yoder, C. A., M. L. Avery, K. L. Keacher, and E. A. Tillman. 2007. Use of DiazaCon™ as a reproductive inhibitor for monk parakeets (Myiopsitta monachus). Wildlife Research 34: 8-13. 189

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

ANTIBIOTIC RESISTANT BACTERIA IN RODENTS, BIRDS, AND INSECTS

JESSICA C. SMITH, ANA M. FERREIRA, JOERI H. BAAK, AND SARA A. BURT Institute for Risk Assessment Sciences, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 2, 3584 CM Utrecht, The Netherlands.

Abstract The aim of this study was to find out whether pests on the Utrecht University campus and environs were vectors for ESBL/AmpC-producing bacteria and/or methicillin resistant Staphylococcus aureus (MRSA). Sam- ples were collected on and around campus in educational buildings, an aviary, the university pig farm, botanical gardens, the university hospital, and community buildings. Samples were analysed for the presence of ESBL/ AmpC-producing Enterobacteriaceae and MRSA and for susceptibility to five antibiotics. Of the samples 5/78 (6.4%) were positive for ESBL E. coli and/or MRSA. All fly samples and bird samples originated on the farm. Antibiotic susceptibility testing revealed that one of the isolates from flies was confirmed ESBL-producingE. coli according to CLSM guidelines. In conclusion, it is possible that pests on the university farm could be a vector for ESBL- producing E. coli and MRSA.

Key words ESBL, AmpC, E. coli, MRSA, flies.

INTRODUCTION Antibiotic resistant bacteria represent an increasing problem for public health and animal health because infections caused by them are more difficult to treat (Adegoke et al., 2016). Extended-spectrum beta-lactamase (ESBL) and AmpC beta-lactamases are enzymes produced by resistant bacteria to counteract the effect of antibiotics (Pitout & Laupland, 2008). Resistance to methicillin has been found in Staphylococcus aureus (Tiemersma et al., 2004). Strict hygiene measures and limiting the use of antibiotics are important strategies for limiting the spread of resistant bacteria. However, rodents, flies and birds travel between locations and may act as vectors for transmission of bacteria, including resistant strains (Burt et al., 2012; Davies et al., 2016; Guenther et al., 2010; Meerburg et al., 2007; Veldman et al., 2013). The aim of this study was to find out whether pests collected on a university campus could be vectors for the ESBL/AmpC-producing Enterobacteriaceae and methicillin resistant Staphylococcus aureus (MRSA). MATERIALS AND METHODS Samples were collected on and around the Utrecht University campus during May – November 2014. Locations included campus educational buildings, the university pig farm, botanical gardens, an aviary, the university hospital, and various houses and community buildings in Utrecht. Snap-traps and flypapers placed on the walls or under furniture were used to trap rodents, flies and cockroaches. Fly samples were pooled samples of all flies attached to a fly paper on a particular day. Other small animals found dead such as a wood mouse, a shrew and birds were also collected and examined. 190 J. C. Smith, A. M. Ferreira, J. H. Baak, and S. A. Burt Antibiotic Resistant Bacteria In Rodents, Birds, and Insects

Detection of ESBL/AmpC-producing Enterobacteriaceae was carried out using the method of Dierikx et al. (2013) using selective enrichment and plating out onto MacConkey agar (Oxoid) and TBX agar (Oxoid), both containing 1mg/L cefotaxime. For MAC-CTX: sharply defined pink colonies were scored as E. coli; slimy pink colonies were scored as Klebsiella; other pink colonies were scored as Enterobacter. For TBX-CTX green colonies were scored as E. coli. All isolates were tested for the indole reaction and oxidase reaction. MRSA was determined according to the method of Graveland et al. (2009) by selective enrichments and plating out onto Brilliance 2 MRSA agar (Oxoid). Dark purple colonies on agar typical for MRSA were subjected to coagulase and catalase tests.

For suspected ESBL/AmpC-producers susceptibility to five antibiotics was determined with the BD Sensi Disk® method (Figure 1). A fresh culture was adjusted to turbidity of 0.5 McFarland in physiological saline and spread onto a Müller-Hinton agar plate (Oxoid). Five discs containing antibiotics were dispensed by the Sensi Disk® apparatus and incubation was 18 hours at 37°C. Inhibition zones were measured with a digital calliper and the phenotype (ESBL- or AmpC-producing) was determined by reference to breakpoints according to the CLSI standards (CLSI, 2010). Strains E. coli ATCC 25922 and Klebsiella pneumonia SHV-18 were used as controls. All isolates were stored at -80°C for later confirmation by PCR analysis.

Figure 1. The assessment of antibiotic resistance phenotype using BD Sensi Disk®. Left, A bacterial strain sensitive to all five antibiotics; Right: A less sensitive strain.

RESULTS AND DISCUSSION Preliminary identification, pending PCR confirmation, indicates that 5/78 (6.4%) of the samples were positive for ESBL E. coli and/or MRSA, as presented in Table 1.

Table 1. Preliminary identification of antibiotic resistant bacteria in samples collected on and around the university campus May – July 2014.

Sample n ESBL/AmpC ESBL/AmpC ESBL/AmpC MRSA E. coli Klebsiella Enterobacter House mice 34 - - - - Birds 21 1 - - 1 Flies (pool) 20 2 - - 2 American 1 - - - - cockroach Common shrew 1 - - - - Wood mouse 1 - - - - Antibiotic Resistant Bacteria In Rodents, Birds, and Insects 191

Birds collected were mostly tree sparrows but also 1 jackdaw, 2 starlings, 2 blackbirds and a greenfinch. The pooled fly samples included mostly the housefly, lesser housefly and drain flies. All of the samples found positive (three fly samples and two bird samples) originated on the university pig farm. Antibiotic susceptibility testing on the isolated Enterobacteriaceae confirmed that one of the isolates from a pooled fly sample had an ESBL-phenotype according to CLSM guidelines, as shown inTable 2.

Table 2. Bacterial isolate from flies classified as ESBL-producing phenotype according to CLSI guidelines (CLSI, 2010).

Sample Bacterial Inhibition zone (diameter in mm) per antibiotic species cefotaxime cefotaxime ceftazidime ceftazidime cefoxitin + clavulan- + clavulan- ic acid ic acid Flies (pool) E. coli 7 13 13 30 26

DISCUSSION Our findings suggest that flies and birds on the university farm may be vectors for MRSA and ESBL- producing E. coli. These results confirm those of previous studies in which flies on pig and poultry farms were found positive for ESBL-producing E. coli (Blaak et al., 2014; Von Salviati et al., 2015). Samples of houseflies caught in a hospital were shown to be carriers ofEnterobacteriaceae 15/67 (22.4%), although the presence of ESBL/AmpC phenotypes were not determined (Davies et al., 2014). Our findings for birds are comparable with the low prevalence of MRSA in wild birds found in central Europe (0.3%) (Konicek et al., 2016). An earlier Dutch study of faecal swab samples from dead wild birds positive for ESBL/AmpC phenotype E. coli found a prevalence of 65/414 (15.7%) (Veldman et al., 2013), which is higher than found in the present study. This difference could be due to the fact that our bird samples concerned chiefly starlings and sparrows whereas the study by Veldman et al. took samples from waders and seabirds, which come into contact with contaminated surface waters. In conclusion, flies and birds on the university farm may be a vector for ESBL-producing E. coli and MRSA. Whether the bacteria originate outside the campus or are picked up from animals on the university farm has yet to be determined.

ACKNOWLEDGEMENTS JCS received a grant from the Merial Veterinary Scholars Program. Staff at Anticimex (Houten, The Netherlands), Rentokil (Nieuwegein, The Netherlands) and at the university farm are thanked for their assistance in collecting samples.

REFERENCES CITED Adegoke, A.A., A.C. Faleye, G. Singh, and T.A. Stenström. 2016. Antibiotic resistant superbugs: Assessment of the interrelationship of occurrence in clinical settings and environmental niches. Molecules 22, 29; doi:10.3390/molecules22010029. Blaak, H., R.A. Hamidjaja, A. van Hoek, L. de Heer, A.M. de Roda Husman, and F.M. Schets. 2014. Detection of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli on flies at poultry farms. Appl. Environm. Microbiol. 80: 329-246. Burt, S.A., L. Siemeling, E.J. Kuijper, and L.J.A. Lipman. 2012. Vermin on pig farms are vectors for Clostridium difficile PCR ribotypes 078 and 045. Vet. Microbiol. 160: 256-258. CLSI, 2010. Performance standards for antimicrobial susceptibility testing: twentieth information supplement. CLSI document M100-S20: Wayne, P.A.: Clinical and Laboratory Standards Institute. 192 J. C. Smith, A. M. Ferreira, J. H. Baak, and S. A. Burt

Davies, M.P., M. Anderson, and A.C. Hilton. 2016. The housefly Musca domestica as a mechanical vector of Clostridium difficile. J. Hospital Infection 94: 263-267. doi.org/10.1016/j. jhin.2016.08.023 Davies, M.P., A.C. Hilton, and M. Anderson. 2014. Proceedings of the Eighth International Conference on Urban Pests, Zurich, Switzerland. Dierikx, C., J. van der Goot, T. Fabri, A. van Essen-Zandbergen, H. Smith, and D. Mevius. 2013. Extended-spectrum-beta-lactamase- and AmpC-beta-lactamase-producing Escherichia coli in Dutch broilers and broiler farmers. J. Antimicrob. Chemother. 68: 60 – 67. Graveland, H., E. van Duijkeren,, A. van Nes, A. Schoormans, M. Broekhuizen-Stins, I. Oosting- van Schothorst, D. Heederik, and J.A. Wagenaar. 2009. Evaluation of isolation procedures and chromogenic agar media for the detection of MRSA in nasal swabs from pigs and veal calves. Vet. Microbiol. 139:121-125. Guenther, S., A. Bethe, A. Fruth, T. Semmler, R.G. Ulrich, L.H. Wieler, and C. Ewers. 2012. Frequent combination of antimicrobial multiresistance and extraintestinal pathogenicity in Escherichia coli isolates from urban rats (Rattus norvegicus) in Berlin, Germany. PLoS ONE 7(11): e50331. doi:10.1371/journal.pone.0050331 Konicek, C., P. Vodrážka, P. Barták, Z. Knotek, C. Hess, K. Račka, M. Hess, and S. Troxler. 2016. Detection of zoonotic pathogens in wild birds in the cross-border region Austria-Czech Republic. J. Wildlife Dis. 52: 850–861. Meerburg, B.G. and A. Kijlstra. 2007. Role of rodents in transmission of Salmonella and Campylobacter. J. Food Sci. Agric. 87:2774-2781. Pitout, J.D. and K.B. Laupland. 2008. Extended-spectrum beta-lactamase-producing Enterobacteriaceae: an emerging public health concern. Lancet Infect. Dis. 8: 159-166. Tiemersma, E.W., S.L. Bronzwaer, O. Lyytikainen, J.E. Degener, P. Schrijnemakers, N. Bruinsma, J. Monen, W. Witte, and H. Grundman. 2004. Methicillin-resistant Staphylococcus aaureus in Europe, 1999 – 2002. Emerg. Infect. Dis. 10:1627-1634. Veldman, K., P. van Tulden, A. Kant, J. Testerink, and D. Mevius. 2013. Characteristics of cefotaxime-resistant Escherichia coli from wild birds in The Netherlands. Appl. Environm. Microbiol. 79: 7556–7561. Von Salviati, C., H. Laube, B. Guerra, U. Roesler, and A. Friese. 2015. Emission of ESBL/AmpC- producing Escherichia coli from pig fattening farms to surrounding areas.Vet. Microbiol. 175:77-84. 193

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

MICROBIOLOGICAL ANALYSIS OF NON-BITING FLIES COLLECTED FROM HOSPITALS: NOVEL PATHOGENS AND NEW VECTORS IN THE CLINICAL ENVIRONMENT

1MATTHEW PAUL DAVIES, 1MORAY ANDERSON, AND 2ANTHONY C. HILTON 1Killgerm Chemicals Ltd, Wakefield Road, Ossett, WF5 9AJ. 2School of Life & Health Sciences, Aston University, Birmingham, B4 7ET, UK

Abstract The potential for houseflies Musca domestica to contribute to transfer of the ‘hospital superbug’ Clostridium difficile in hospitals has been demonstrated, highlighting flies as realistic vectors of this microorganism in clinical areas. Subsequent field studies where houseflies were sampled from hospitals have shown carriage of a variety of pathogenic bacteria. This study continues the previous work and reports on the pathogenic bacteria isolated from other non-biting flies in hospitals. Non-biting flies were collected from pre-existing ultra-violet light flytraps located throughout the hospitals. External washings and macerates of fly samples were prepared and inoculated onto a variety of agars and following incubation bacterial colonies identified by biochemical tests. A clinical serotype of Escherichia coli (E1525) was isolated from Calliphora vicina. A non-clinical serotype of E. coli (O71) was isolated from Lucilia sericata. The clinical isolate of E. coli from C. vicina was likely acquired from the hospital environment, so flies should be considered as a route of spread of clinical isolates of bacteria in hospitals. L. sericata likely acquired E. coli O71 from calf faeces then by ingress introduced this non-clinical isolate, novel to the hospital environment. Representing a number of novel findings, various bacterial isolates were recovered for the first time ever from a variety of non-biting flies, including Musca autumnalis, Fannia canicularis, , Phoridae, Sphaeroceridae and Drosophila sp. ‘Drain flies’ / ‘small flies’ are highlighted as an emerging problem or even new vectors in the hospital environment, due to their described carriage of pathogenic microorganisms in the clinical setting.

Key words Blowflies, drain flies, disease, pest control, infection control, healthcare.

INTRODUCTION Houseflies Musca domestica have been shown to carry and disseminate a variety of bacterial species, including the hospital-associated pathogen Clostridium difficile (Davies et al., 2016), while also harbouring Enterobacteriaceae, Bacilli, Clostridia, Staphylococci and Streptococci in hospitals (Davies et al., 2014). Most studies in the literature focus on the bacteria carried by M. domestica. Apart from work on houseflies, little research has been done on the bacteria associated with other fly species that are found in hospitals. Drosophila sp sampled from a hospital in Nigeria were found to harbour Proteus sp, Streptococcus sp and Salmonella sp (Nmorsi et al., 2007). Cluster flies, Pollenia rudis sampled from a hospital in Germany were found to harbour Pseudomonas aeruginosa and Erwinia spp which are also known as Pantoea spp (Faulde et al., 2001) and C. albipunctata was positive for species of Enterobacteriaceae (Faulde and Spiesberger, 2013). A relative lack of international knowledge is highlighted, regarding the carriage of bacteria by flies other than M. domestica in hospitals. This study is of benefit internationally, due to it encompassing the examination of bacterial carriage by non-biting flies aside from M. domestica, bridging a gap in current knowledge. 194 M. P. Davies, M. Anderson, and A. C. Hilton. Microbiological Analysis Of Non-Biting Flies Collected From Hospitals

MATERIALS AND METHODS Flies were collected from pre-existing ultra-violet light flytraps in the form of Electronic Fly Killers (EFK’s) and professional sticky traps located throughout 6 health care facility sites from March 2010 to August 2011. The contents of the EFK’s were tipped into sterile bags. The glue boards from the sticky traps were removed and covered with a sterile plastic bag. The samples were stored at 4°C in a domestic refrigerator, pending identification and microbiological analysis.

Isolation Of Bacteria Identified flying insects were washed in phosphate buffered saline (PBS) (Sigma Aldrich, Poole, UK) in a sterile 1.5ml universal micro test tube (Eppendorf, Stevenage, UK) by vortexing for 30 seconds. These external washings were then serially diluted down to 10-6 and 0.1ml of each dilution inoculated onto the surfaces of Cycloserine Cefoxitin Fructose Agar + sodium taurocholate (CCFA + Tc), Nutrient agar, Mannitol Salt agar and Violet Red Bile Glucose (VRBG) agar (Oxoid Ltd, Basingstoke, UK). The samples were then washed four further times, (fresh PBS with each wash), in order to remove external bacteria to avoid contamination when examining macerates for bacteria. The flying insects were then macerated with the end of a sterile plate spreader and the described inoculation process repeated for the macerates. Nutrient agar, Mannitol Salt agar and VRBG agar plates were incubated at 37°C for 24 hours in aerobic conditions. CCFA + Tc agar and a set of Nutrient agar plates were incubated in anaerobic conditions at 37°C for 48 and 24 hours respectively.

Identification Of Bacteria Bacterial colonies were identified by macroscopic morphology, Gram staining, microscopic examination of morphology, oxidase (HPA 2011a) and catalase tests (HPA 2011b) API (analytical profile index) 20E test kits, API Staph test kits, rapid ID (identification) 32A API test kits (bioMérieux, Marcy l’Etoile, France) and Bacillus-ID test kits (Microgen Bioproducts Ltd, Camberley, UK). Isolates of Staphylococcus aureus were cultured on Mannitol Salt agar with Oxacillin (Oxoid Ltd, Basingstoke, UK) for presumptive identification of Methicillin Resistant Staphylococcus aureus (MRSA). Isolates of Bacillus cereus Group were examined under phase contrast microscopy to determine the presence or absence of parasporal crystals in order to confirm or deny identification ofBacillus thuringiensis versus B. cereus (HPA 2011c). Escherichia coli isolates were cultured on Sorbitol MacConkey agar (Oxoid Ltd, Basingstoke, UK) for presumptive identification of E. coli O157 (HPA 2011d) and were also sent for serotyping to the Laboratory of Gastrointestinal Pathogens, Centre for Infections, Health Protection Agency, 61 Colindale Avenue, London, NW9 5EQ.

RESULTS To our knowledge, this study provides the first example of Escherichia coli serotype E1525, Klebsiella oxytoca, Klebsiella pneumoniae ssp ozaenae, Leclercia adecarboxylata, Pantoea species 1, Raoultella terrigena and Staphylococcus hominis isolation from C. vicina (Table 1). Furthermore, this study provides the first example ofBacillus subtilis Group, Pantoea spp 2 and Micrococcus sp isolation from F. canicularis (Table 1). The first example ofBacillus brevis, Escherichia coli serogroup O71 and Klebsiella pneumoniae ssp pneumoniae isolation from L. sericata is reported (Table 1). Enterobacter cloacae, Escherichia vulneris, Klebsiella pneumoniae ssp pneumoniae, Raoultella terrigena, Staphylococcus aureus and Staphylococcus saprophyticus isolation from M. autumnalis occurred for the first time (Table 1). Finally, this study shows the first example of isolation ofBacillus cereus Group and Staphylococcus aureus from Psychodidae, Bacillus cereus Group and Bacillus sphaericus from Phoridae, Bacillus cereus Group and Clostridium clostridioforme from Sphaeroceridae, Bacillus licheniformis and Staphylococcus aureus from Trichiaspis sp (family Sphaeroceridae) and Bacillus pumilus from Drosophila sp (Table 1). Microbiological Analysis Of Non-Biting Flies Collected From Hospitals 195

DISCUSSION E. coli serotype E1525 was isolated from bluebottle flies C. vicina sampled from a hospital restaurant. E1525 cultures are generally extraintestinal isolates i.e. from blood cultures and urine (often from surgical cases in hospital) rather than from faeces (personal communication, Dr Tom Cheasty, Health Protection Agency, 2011). E1525 is a clinical serotype, yet it has been isolated from C. vicina, which means it is more likely to have been acquired by C. vicina from the hospital environment rather than being brought in from an external source. This finding corresponds with the suggestion of Fotedar et al. (1992), that ‘microbial studies of randomly collected flies from a hospital environment may provide an epidemiological tool for monitoring existing sanitary conditions’. Enteropathogenic Escherichia coli (EPEC) of the serogroup O71 was isolated from L. sericata collected from a hospital kitchen. EPEC O71 has been detected in samples from healthy calves (Orden et al. 2002) and is not known as a clinical isolate. It is likely therefore that L. sericata had acquired EPEC O71 from calf faeces and then entered the hospital, illustrating perfectly the dangers of fly ingress and capacity for introduction of non-clinical isolates into the hospital environment where they may prove pathogenic in humans. The significance of EPEC O71 is that it can cause potentially fatal infant diarrhoea (Kaper et al. 2004).

Table 1. Bacteria isolated from flies sampled in UK hospitals

Fly species / Bacteria isolated Hospital Medical significance of isolated family location bacteria Calliphora Enterobacteriaceae vicina Citrobacter freundii Live MI Haemolytic uraemic syndrome Enterobacter asburiae Live MI Wound infection Enterobacter sp (aerogenes or cloacae) HS Neonatal septicaemia *Escherichia coli E1525 HC Haemolytic uraemic syndrome *Klebsiella oxytoca HC Haemorrhagic colitis *Klebsiella pneumoniae ssp ozaenae HS Chronic rhinitis *Leclercia adecarboxylata W Throat tissue abscess *Pantoea species 1 Live MI Fatal neonatal septicaemia *Raoultella terrigena M Resistant neonatal sepsis Staphylococci Staphylococcus aureus HC Resistant infection of blood, skin, Staphylococcus aureus HC urine, respiratory tract *Staphylococcus hominis HC Oxacillin-resistant sepsis Streptococci b-hemolytic Streptococcus sp WN Endocarditis Non-hemolytic streptococci WN 196 M. P. Davies, M. Anderson, and A. C. Hilton. Microbiological Analysis Of Non-Biting Flies Collected From Hospitals

Musca Enterobacteriaceae autumnalis *Enterobacter cloacae HC Resistant neonatal bacteraemia *Escherichia vulneris HC Soccer wound infection *K. pneumoniae ssp pneumoniae HC Pneumonia *Raoultella terrigena HC Resistant neonatal sepsis Staphylococci *Staphylococcus aureus HC Resistant infection of skin *Staphylococcus saprophyticus HC Oxacillin-resistant sepsis Fannia Bacillus spp canicularis *Bacillus subtilis Group HC Fatal brain and lung infection Enterobacteriaceae *Pantoea spp 2 HC Fatal neonatal septicaemia Staphylococci Staphylococcus aureus HC Resistant infection of blood, skin, Staphylococcus aureus WK urine, respiratory tract Other Enterococcus sp HC Infection of CNS *Micrococcus sp HC Peritonitis Lucilia sericata Bacillus spp *Bacillus brevis HC Peritonitis Enterobacteriaceae Enterobacter cloacae HC Resistant neonatal bacteraemia *Escherichia coli O71 HC Haemolytic uraemic syndrome *K. pneumoniae ssp pneumoniae HC Pneumonia Staphylococci Staphylococcus aureus HC Resistant infection of skin Psychodidae Bacillus spp *Bacillus cereus Group HC Neonatal lung and CNS infection Staphylococci *Staphylococcus aureus HC Resistant infection of blood, skin, Other urine, respiratory tract Micrococcus sp WN Peritonitis Phoridae Bacillus spp *Bacillus cereus Group HC Neonatal lung+CNS infection *Bacillus cereus Group HC *Bacillus sphaericus HC Bacteraemia

Clostridia Clostridium sp HC Microbiological Analysis Of Non-Biting Flies Collected From Hospitals 197

Sphaeroceridae Bacillus spp *Bacillus cereus Group WN Neonatal lung+CNS infection Bacillus sphaericus WN Bacteraemia Clostridia *Clostridium clostridioforme WN Intra-abdominal abscess Staphylococci Staphylococcus aureus WN Resistant infection of blood, skin, urine, respiratory tract Trichiaspis sp Bacillus spp *Bacillus licheniformis HS Septicaemia (Family Sphaeroceridae) Staphylococci *Staphylococcus aureus HS Drosophila sp Bacillus spp *Bacillus pumilus HS Food poisoning

Key: The location in the hospital that the insect carrying that particular isolate was sampled from: Hospital catering areas (HC), ward kitchens (WK), wards (W), Hospital food stores (HS), mortuary (M), neonatal & maternity (WN), Live from Medical illustration department toilet (Live MI). *Isolated from this insect for the first time, to the knowledge of the authors.

CONCLUSION The isolation of the clinical strain of E. coli (E1525) from C. vicina, likely acquired from the hospital environment, means that flies should be considered as a route of spread of clinical isolates of bacteria in hospitals and not merely a nuisance. The isolation of EPEC O71 (non-clinical E. coli typically associated with calf faeces) from L. sericata leads to the recommendation that fly-proofing measures should be an essential feature in hospitals, to prevent fly ingress and therefore limit the introduction of non-clinical bacterial isolates into the clinical environment. Psychodidae, Phoridae, Sphaeroceridae and Drosophila i.e. ‘drain flies’ / ‘small flies’ are highlighted as an emerging problem or even new vectors in the hospital environment, due to their described carriage of pathogenic microorganisms in the clinical setting. The collected findings continue to emphasise the importance of pest control as a component of infection control in hospitals.

ACKNOWLEDGEMENTS The authors thank Killgerm Chemicals Ltd for the funding of laboratory consumables.

REFERENCES CITED Davies, M.P., M. Anderson, and A.C. Hilton. 2016. The housefly Musca domestica as a mechanical vector of Clostridium difficile. Journal of Hospital Infection 94: 263-267. Davies, M.P., A.C. Hilton, and M. Anderson. 2014. Isolation and characterisation of bacteria associated with Musca domestica (Diptera: Muscidae) in hospitals. In: Müller, G., Pospischil, R., and Robinson, W.H., (ed.) Proceedings of the Eighth International Conference on Urban Pests. 8th. Zurich. 20–23 July 2014. OOK-Press, Veszprem, , 173-177. Faulde, M., and M. Spiesberger. 2013. Role of the moth fly albipunctata (Diptera: ) as a mechanical vector of bacterial pathogens in German hospitals. J Hosp Infect 83: 51-60. 198 M. P. Davies, M. Anderson, and A. C. Hilton.

Faulde, M., D. Sobe, H. Burghardt, and R. Wermter. 2001. Hospital infestation by the cluster fly, Pollenia rudis sensu stricto Fabricius 1794 (Diptera: Calliphoridae), and its possible role in transmission of bacterial pathogens in Germany. Int J Hyg Environ Health 203: 201-204. Fotedar, R., U. Banerjee, S. Singh, Shriniwas, and A. K. Verma. 1992. The housefly (Musca domestica) as a carrier of pathogenic microorganisms in a hospital environment. J Hosp Infect 20: 209-215. HPA, H. P. A. 2011a. UK Standards for Microbiology Investigations. Oxidase test. http://www.hpa. org.uk/webc/hpawebfile/hpaweb_c/1309970640399 HPA, H. P. A. 2011b. UK Standards for Microbiology Investigations. Catalase test. http://www.hpa. org.uk/webc/hpawebfile/hpaweb_c/1309970019332 HPA, H. P. A. 2011c. UK Standards for Microbiology Investigations. Identification of Bacillus species. http://www.hpa.org.uk/webc/hpawebfile/hpaweb_c/1313155002990 HPA, H. P. A. 2011d. UK Standards for Microbiology Investigations. Identification of Escherichia coli O157. http://www.hpa.org.uk/webc/hpawebfile/hpaweb_c/1313155007380 Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichia coli. Nature reviews. Microbiology 2: 123-140. Nmorsi, O. P., G. Agbozele, and N. C. Ukwandu. 2007. Some aspects of epidemiology of filth flies: Musca domestica, Musca domestica vicina, Drosophilia melanogaster and associated bacteria pathogens in Ekpoma, Nigeria. Vector Borne Zoonotic Dis 7: 107-117. Orden, J. A., D. Cid, J. A. Ruiz-Santa-Quiteria, S. Garcia, S. Martinez, and R. de la Fuente. 2002. Verotoxin-producing Escherichia coli (VTEC), enteropathogenic E. coli (EPEC) and necrotoxigenic E. coli (NTEC) isolated from healthy cattle in Spain. J Appl Microbiol 93: 29- 35. 199

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

FACTORS DRIVING PAEDERUS OUTBREAKS IN HUMAN SETTINGS: CLIMATIC FACTOR OR HUMAN INTERVENTION?

1KOK-BOON NEOH AND 2LEE-JIN BONG 1Department of Entomology, National Chung Hsing University, 250 Guoguang Rd., Taichung 40227 Taiwan 2National Health Research Institutes, 35 Keyan Road, Zhunan, Miaoli County 35053 Taiwan

Abstract linearis is skin irritation resulting from contact with the hemolymph of rove beetles from the genus Paederus. Paederus neither bite nor sting, but accidental crushing on human skin causing the release of the toxin paederin. Massive outbreaks are frequently reported in tropical regions of Asia and sporadic cases are documented elsewhere in temperate countries. It was hypothesized that climate factors have been the major determinant causing the massive dispersal to human settings as most outbreaks coincided with warmer summer months. In the present study, a year-long weekly sampling was conducted at infestation-prone human settings in Malaysia. The correlation between the numbers of rove beetle capture and climatic factors as well as the crop cycle activity was tested using Principal Component Analysis. The dispersal activity of P. fuscipes showed two peaks, which was from February to March and August to October. However, the result rejected the null hypothesis. Habitat disturbance and site unsuitability due to human intervention have been the main factors. In particular, massive dispersal of rove beetle was frequently observed during rice harvesting, including straw burning, and cultivation. The activity may disrupt the habitat, normal activities and reduce its prey. This activity could have rendered the rice fields unfavorable refuges and driven the rove beetles away to human settings. In addition, the management challenges such as the development of insecticide resistance owing to widespread use of insecticide in agricultural field is also discussed in this paper.

Key words Dermatitis linearis, rove beetle, insecticide resistance, habitat disturbance.

INTRODUCTION Of 50,000 staphylinids species distributed worldwide, only the genus Paederus of the Paederine Staphylinid subtribe Paederina (Coleoptera: Staphylinidae) is notoriously known to cause dermatitis linearis on human skin. Paederus is well adapted to habitats associated with moist environments like freshwater lakes, marshes, riverine floodplains, riverbanks, and crop fields (Frank and Kanamitsu, 1987). Similar to other staphylinids, this genus is beneficial to agricultural systems as they are polyphagous predator to agricultural pests (Frank and Kanamitsu, 1987). However, contact with these species causes serious health impact in humans, resulting in dermatitis linearis (Frank and Kanamitsu, 1987). Beetle infestations in human settlements are of increasing concern among the public. Adult Paederus are attracted to incandescent and fluorescent lights. Thus, adult flights are restricted to night and congregated around the fluorescent lights in human dominated areas. Inadvertently, human comes into contact with this beetle. This beetle neither bite nor sting. However, accidental brushing against or crushing the beetle provokes the release of its toxic haemolymph called paederin, the potent vesicant that causes dermatitis linearis on human skin (Frank and Kanamitsu, 1987). Clinically, dermatitis linearis is a necrotic blister that is characterized by linear vesiculobullous lesions on erythematous bases and pruritus (Frank and Kanamitsu, 1987; Nicholls et al., 1990; Zargari et al., 2003). This clinical appearance is sometimes confused with liquid burns, herpes simplex, herpes 200 Kok-Boon Neoh and Lee-Jin Bong Factors Driving Paederus Outbreaks In Human Settings

INTRODUCTION Of 50, 000 staphylinids species distributed worldwide, only the genus Paederus of the Paederine Staphylinid subtribe Paederina (Coleoptera: Staphylinidae) is notoriously known to cause dermatitis linearis on human skin. Paederus is well adapted to habitats associated with moist environments like freshwater lakes, marshes, riverine floodplains, riverbanks, and crop fields (Frank and Kanamitsu, 1987). Similar to other staphylinids, this genus is beneficial to agricultural systems as they are polyphagous predator to agricultural pests (Frank and Kanamitsu, 1987). However, contact with these species causes serious health impact in humans, resulting in dermatitis linearis (Frank and Kanamitsu, 1987). Beetle infestations in human settlements are of increasing concern among the public. Adult Paederus are attracted to incandescent and fluorescent lights. Thus, adult flights are restricted to night and congregated around the fluorescent lights in human dominated areas. Inadvertently, human comes into contact with this beetle. This beetle neither bite nor sting. However, accidental brushing against or crushing the beetle provokes the release of its toxic haemolymph called paederin, the potent vesicant that causes dermatitis linearis on human skin (Frank and Kanamitsu, 1987). Clinically, dermatitis linearis is a necrotic blister that is characterized by linear vesiculobullous lesions on erythematous bases and pruritus (Frank and Kanamitsu, 1987; Nicholls et al., 1990; Zargari et al., 2003). This clinical appearance is sometimes confused with liquid burns, herpes simplex, herpes zoster, periorbital cellulitis, and acute allergic contact dermatitis (Kamaladasa et al. 1997). The medical importance of Paederus had been an annual feature throughout the world. However, the insect in human setting system have received little attention from biologists. Considering that future climate changes and landscape disturbance may place further outbreak pressure to human setting landscape, adequate attention to the predicted outbreak crisis is required. To date, publications on Paederus have focused mainly its medical important. In contrast, knowledge about ecology and biology of Paederus is very limited. In the present study, a year-long weekly sampling was conducted at infestation-prone human settings in Malaysia. In the study, we hypothesize that climate factors may be the major determinant causing the massive dispersal to human settings as most outbreaks coincided with warmer summer months that reported elsewhere.

MATERIALS AND METHODS Study site Figure. 1. Principal Component Analysis (PCA) ordination diagram showing the abundance of Paederus species sampled (close arrows) in Site 1 and Site 2 and environmental variables (open arrows) throughout a year. The result indicates that outbreaks are peak in the months of February and March, and August to October. First axis is horizontal, second axis is vertical. The eigenvalues for the first two axes of the ordinations were 0.90 and 0.10, respectively. Factors Driving Paederus Outbreaks In Human Settings 201

The study was carried out on Mainland Penang that experience a uniformly warm and humid climate throughout the year and receives mean annual rainfall of 2,670 mm. The temperature falls between 29 and 35°C during the day and 26 and 29°C at night. The sampling sites were selected in two high-rise residential buildings where cases of P. fuscipes infestation were numerous (hence, site 1 and site 2) that set approximately 10km apart. Site 1 is located 1.89 km away from 1,016 ha of rice fields, whereas Site 2 is located 500 m away from 1,036 ha of rice fields

Data collection and statistical analysis At the two locations, samples were collected using six sticky traps that measuring 28 by 19 cm. The sticky traps were deployed below a 36-W fluorescent lamp. Insects were collected at weekly intervals and the traps were replaced with new traps. Sampling was carried out for a 1-yr period. The number of trapped insect were correlated with meteorological data, such as hourly air temperature and relative humidity and daily precipitation readings obtained from meteorological stations as well as annual crop activity nearby the rice field. Principal Component analysis (PCA) was employed to examine the association between the Paederus outbreak and environmental variables as well as crop cycle activity close to the sampling sites (human intervention).

RESULTS AND DISCUSSION A total of 628,513 P. fuscipes were caught throughout the sampling period. In general, the outbreak period was peak from February and March and from August to October (Figure 1). The association of Paederus outbreak with environmental variables was not significant but marginal association was detected between the outbreak and precipitation. The insignificant association between the outbreak and environment variables reflected that minor climatic variation in the tropical region contributed subtle impact on flight activity. Similarly, a study conducted in northeastern Brazil reported that only annual moisture and drought cycles are responsible for Paederus flight activity (Silva et al., 2015). In addition, PCA revealed that the Paederus outbreak were most closely associated to human intervention in the rice fields. This is particularly true as most flights occurred in the months during harvesting, cultivation, and transplanting of seedlings (Figure 1). The activity may disrupt the habitat, normal activities and reduce its prey. This activity could have rendered the rice fields unfavorable refuges and driven the rove beetles away to human settings. MANAGEMENT CHALLENGE Direct management effort by reducing Paederus population in rice fields is impossible becausePaederus is beneficial arthropod predator, which needs to be conserved in this agricultural setting. Insecticide applications using thermal fogging and direct chemical spraying are usually the only resort to control Paederus infestation in human settings using (Bong et al. 2013); yet the success is not guaranteed due to insecticide resistance. Bong et al. (2013) documented that the LT50 and LT95 values were significantly different between strains collected from different localities. Combined with their short mean generation time (Bong et al. 2012), the discrepancy of lethal time likely hinted at Paederus might have developed certain level of tolerances towards several conventional insecticides, which are widely used for crop pest management such as pyrethroids, organophosphates (chlorpyrifos and phenthoate), carbamates (e.g., isoprocarb, fenobucarb, and propoxur), and neonicotinoids (imidacloprid and thiamethoxam). Meta-analysis by combining the bioassay data from different biogeographical regions are required to ascertain the possibility of insecticide tolerance development in Paederus. This information is of crucial to formulate sustainable pest management in human dominating areas.

REFERENCES CITED Bong, L.-J., K.-B. Neoh, Z. Jaal, and C.-Y. Lee. 2013. Contact toxicity and residual effects of selected insecticides against the adult Paederus fuscipes (Coleoptera: Staphylinidae). Journal of Economic Entomology 106: 2530-2540. 202 Kok-Boon Neoh and Lee-Jin Bong

Bong, L. J., K. B. Neoh, Z. Jaal, and C. Y. Lee. 2012. Life table of Paederus fuscipes (Coleoptera: Staphylinidae). Journal of Medical Entomology 49: 451-460. Frank, J. H., and K. Kanamitsu. 1987. Paederus, sensu lato (Coleoptera: Staphylinidae): natural history and medical importance. Journal of Medical Entomology 24: 155-191. Kamaladasa, S. D., W. D. H. Perera, and L. Weeratunge. 1997. An outbreak of Paederus dermatitis in a suburban hospital in Sri Lanka. International Journal of Dermatology 36: 34-36. Nicholls, D. S. H., T. I. Christmas, and D. E. Greig. 1990. Oedemerid blister beetle dermatosis: A review. Journal of the American Academy of Dermatology 22: 815-819. Silva, F. S., S. E. P. D. Lobo, D. C. B. Lima, J. M. Brito, and B. M. Costa-Neta. 2015. The influence of weather and lunar phases on the flight activity of Paederus rove beetles (Coleoptera: Staphylinidae). Environmental Entomology 44: 874-879. Zargari, O., A. Kimyai-Asadi, F. Fathalikhani, and M. Panahi. 2003. Paederus dermatitis in northern Iran: A report of 156 cases. International Journal of Dermatology 42: 608-612. Kok-Boon Neoh and Lee-Jin Bong 203

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

EMERGENCE OF AS AN ARTHROPOD PEST IN URBAN CONTEXT AND THE “ONE HEALTH” APPROACH

1OLIVIER SPARAGANO, 2ROBERT FINN, 3MONIQUE MUL, 4ANNUNZIATA GIANGASPERO, 5MARIA ASSUNTA CAFIERO, 6NATALIE WILLINGHAM, 7KIRSTIE LYONS, 8AIMEE LOVERS, AND 9DAVID GEORGE 1Vice-Chancellor Office, Coventry University, CV1 5FB, Coventry, UK 2Department of Applied Sciences, Health and Life Sciences, Northumbria University, Newcastle upon Tyne, NE1 8ST, UK 3Researcher Animal Health, Wageningen Livestock Research, PO Box 338, 6700 AH Wageningen, Netherlands 4Department of Science of Agriculture, Food and Environment, Via Napoli 25, University of Foggia, Foggia, Italy 5Istituto Zooprofilattico Sperimentale della Puglia e della Basilicata,Via Manfredonia,20 71121, Foggia, Italy 6306 Ray Street East Bernard, Texas 77435, US / Administrator of Skin Support Group 7Facebook Skin Mites Support Group, Fort Lauderdale, FL, U.S.A. 8Department of Medical Microbiology and Infection Control, VU University Medical Centre, Amsterdam, Netherlands 9Stockbridge Technology Centre, Cawood, Selby, North Yorkshire, YO8 3TZ, UK

Abstract The poultry red , Dermanyssus gallinae is not well known in occupational health circles, yet it is well documented in poultry farming communities and pigeon racing households. The blood feeding mite is difficult to locate and eradicate due to its nocturnal behaviour and its ability to leave the host after relatively short feeding bouts to hide in cracks and crevices; in urban context, even more challenging is to identify the origin of the infestation. Medical practitioners do not receive the appropriate training to recognise such arthropod infestations, which are typically confused with and other similarly-presenting disorders, and are unfamiliar with mite behaviour or pathologies that would assist in diagnosis. An international patient group has now been created and supports that physical and chemical control methods for this pest seem ineffective in human habitation. Many patients have turned to self-treatment to contain the problem. Victims of mite infestations suffer tremendous physical and psychological damage, not seen on par with many other pest infestations, with symptoms including itching, dermatitis, skin lesions, biting, pinpricks, secondary infections, scarring/hyperpigmentation, Ineffective and often prolonged attempts to eradicate infestations commonly result in psychological and economic issues, manifested as an increase in depression and financial outlay when patients relocate and/or attempt to control these infestations. The serious lack of knowledge and misinformation regarding human infestation with D. gallinae across healthcare, science and pest control fields is disconcerting and, based on increasing reports of infestations, has potentially already led to the dangerous proliferation of the disease. An EU-funded project involving 28 countries (FA1404-COREMI) is pulling together expertise and scientific knowledge to identify new holistic approaches, immunologic, biological and chemical control methods, HAPCC) to combat D. gallinae, though these are primarily targeted to use in poultry facilities, not human habitation. Nevertheless, One Health approach allows veterinarians and medical practitioners to exchange information and treatment practices to alleviate the direct and indirect effects of this pest in both veterinary and medical sectors.

Key words poultry red mite, dermatitis, delusional psychosis, arthropod pest 204 O. Sparagano, R. Finn, M. Mul, A. Giangaspero, M. A. Cafiero, N. Willingham, K. Lyons, A. Lovers, and D. George Emergence Of Dermanyssus Gallinae As An Arthropod Pest In Urban Context

INTRODUCTION All animals are susceptible to attack by ectoparasites, where in most cases ectoparasites are (relatively) host-specific. In birds, mites are a particular issue with several species being significant pests of poultry, in particular the poultry red mite Dermanyssus gallinae and northern fowl mite . Despite being historically considered as avian-specific, the number of reports documenting bird-mite attacks on humans and mammalian companion animals is increasing (George, et al, 2015), with peer- reviewed literature repeatedly suggesting that avian ectoparasitosis (gamasoidosis) may be of medical and veterinary concern (e.g. Mignon, and Losson. 2008; Cafiero, et al., 2008; Schwarz and Litschauer. 2009; Akdemir, et al., 2009). While the potential significance of gamasoidosis has been acknowledged by the scientific community, little research has been conducted on the threat of gamasoidosis to human health, with the bulk of work being formed of case studies documenting occurrence only, in contrast to work undertaken with other ectoparasites of medical concern (e.g. biting flies and ticks). Given the potential for avian mite species to spread a range of diseases, including potential zoonosis (Sparagano, et al, 2014), this paucity of research is surprising. Diagnosis and treatment of gamasoidosis can be difficult. Bird mites have developed resistance to multiple pesticides and the different species concerned display varied ecologies that necessitate divergent treatment approaches; D. gallinae living primarily ‘off-host’ in contract to O. sylviarum. In cases of human infestation, positive identification of species is therefore critical for recommendation of suitable treatment, this requiring an understanding of mite and ecology that is typically lacking within healthcare and pest control organisations. Diagnosing infestations based on presenting symptoms alone is inadequate and likely to result in misdiagnosis for similarly-presenting parasitoses including scabies and pediculosis, general dermatitis or physiological conditions such as delusional parasitosis (Lucky, et al., 2001; Bellanger, et al., 2008; Akdemir, et al., 2009, Cafiero et al, 2013). More research and greater recognition of gamasoidosis is urgently required to effectively treat this condition and prepare for what may represent an emerging global problem. Work to confirm prevalence, determine the mite species involved and establish possible links to human disease is especially needed. Also important are investigation of effective treatment inventions and more reliable means of diagnosis. This paper will highlight the different perspectives from the patient, medical professionals and scientists’ perspectives to highlight the gaps in knowledge and effective treatments for human gamasoidosis.

PERSPECTIVES AND POTENTIAL ISSUES Patient Perspective As a host of these ectoparasitic mites, the grave lack of knowledge and misinformation across healthcare, science, and pest control fields is disconcerting and has led to the dangerous proliferation of the disease. There are no demonstrable protocols for the people suffering from this unrecognized affliction; in fact, there are more treatments and resources available for livestock and domestic pets. After contacting 18 different pest control companies, 13 entomologists, 5 medical doctors, and 11 veterinarians, I have come to the conclusion that there is little to no valid information to assist people with Gamasoidosis. Being a year into this infestation, I have had many moments in my sleep deprived, eaten alive state when I wanted to take my life because I just wanted peace. Nothing prepares you for the level of devastation mentally, emotionally, physically, and financially. There is no such thing as “normal” anymore, it is a constant daily battle for myself and my whole family. Having your reality be invalidated is almost as bad as having these mites. After living in isolation for so long, I believe that there is a dire need for scientists, pest control operators, veterinarians, and medical professionals to work together to research, share information, and develop treatment protocols for those who are suffering like me. Emergence Of Dermanyssus Gallinae As An Arthropod Pest In Urban Context 205

Medical Practitioner Perspective Increasing reports of human D. gallinae infestations, particularly in residential settings, suggests that gamasoidosis may warrant urgent attention for the medical sector (George, et al., 2015). However, physicians have difficulties in diagnosing gamasoidosis, especially in new or atypical settings such as urban areas (Cafiero, et al., 2008; Dogramaci, et al., 2010). Most physicians are not familiar with the diagnosis of ectoparasites and are not aware of dermatitis caused by zoonotic ectoparasites (Cafiero, et al., 2009; Haag-Wackernagel, 2005; Collgros, et al., 2013). Moreover, they often omit the environmental anamnesis and do not advise patients to inspect their residence for ectoparasites (Cafiero, et al., 2013). Diagnosing D. gallinae infestations solely on presenting symptom is inadequate (George, et al., 2015) as the cutaneous reactions in humans caused by D. gallinae are uncharacteristic and, therefore, D. gallinae infestations are often misdiagnosed as bed bugs, scabies, pediculosis, urticarial or attributed to various causes (atopy, and various dermatitides) (Bellanger, et al., 2008, Cafiero et al, 2013). Moreover, the diagnosis of D. gallinae is even more difficult as the literature on this subject is scarce and the mite mostly feeds during the night and leaves its host afterwards, as usually reported in urban cases (Bellanger, et al., 2008; Cafiero, et al., 2013). As a result of misdiagnosis, the quality of life of patients might be negatively affected (Dogramaci, et al., 2010). This misdiagnosis is worrisome, because D. gallinae poses a significant threat to public health as the mite may be vector/reservoir of zoonotic pathogens, such as Chlamydia psittaci, Erysipelothrix rhusiopathiae, Salmonella spp., Mycobacterium spp., Venezuelan equine encephalitis virus, Eastern equine encephalitis virus, and fowl pox virus (Circella, et al., 2011; Boseret, 2013; De Luna, et al., 2008). Therefore, the differential diagnosis of non-specific pruritic dermatitis of obscure origin should always include gamasoidosis caused by D. gallinae. Furthermore, the environmental anamnesis could facilitate in diagnosing patients with pruritic dermatitis of unclear etiology (Cafiero, et al., 2008; Haag-Wackernagel, 2005). The importance of the environmental anamnesis is supported by physicians of the EU-funded project FA1404-COREMI (Personal communication). Moreover, one physician advocated a more effective collaboration of physicians and medical environmental specialists and another physician recommended using a magnifier and flash light when an infestation with D. gallinae is suspected. Furthermore, these doctors also stated that physicians should especially ask patients for the presence of pet birds and/or abandoned bird nests, mostly pigeons close to their habitation, which is also supported by literature (Haag-Wackernagel, 2005; Akdemir, et al., 2009; Cafiero, et al., 2013). Finally, physicians should bear in mind that immunocompromised patients, patients that take corticosteroids, and patients with dementia may have a more severe infestation than healthy patients.

Scientific Approach In the last decade, we investigated the occurrence of PRM-skin disorders among farmers working on battery hen-laying farms in Southern Italy (Apulia region) and urban cases. As to the first research, we investigated most of the small-scale laying-hen farms (1,000-5,000 birds) with high level of parasite infestation and, from 2007 to 2009, 58 caged poultry farms were visited. One worker from each farm was interviewed by questionnaire to gather information about their knowledge/awareness of PRM and its zoonotic role and on possibly episodes of red-mite bites occurring/occurred during their working activities (egg collection, poultry managing, etc); they were also asked about the body areas involved in bites. As to the urban cases, from 2001 – 2016 the Medical Entomology Laboratory of the Istituto Zooprofilattico Sperimentale della Puglia e della Basilicata, Italy has been contacted from privates/ Public Health Services/physicians to collect and/or identify samples of arthropods suspected to be related to cases of intense pruritus and skin lesions in city-dwellers.

Poultry industry cases. Workers (58/58) (100%) from all farms in the survey confirmed that they knew of the RM and its tendency to bite man. Out of 58 poultry workers, eleven (11/58) (18.96%) reported having experienced pruritic skin eruptions at work following episodes of red mites crawling 206 O. Sparagano, R. Finn, M. Mul, A. Giangaspero, M. A. Cafiero, N. Willingham, K. Lyons, A. Lovers, and D. George Emergence Of Dermanyssus Gallinae As An Arthropod Pest In Urban Context on their skin. 18% (11/58) of poultry farm staff experienced irritating itchy skin eruptions at work after red mites had crawled on their skin. Of the 11 infected workers, 2 (18.18%) reported dermatitis on just their arms and hands, with 7 (63.63%) reporting symptoms on their chests and 2 (18.18%) on their legs (Cafiero et al. 2011, 2011a). Urban cases. All of the patients had no contact with pets/animals, with only three exceptions. Parasites were collected in public edifices (hospital/offices/Academic Institution) (7/21), private apartments (14/21) located in 9 different cities of the Southern Italy, and on patient and his clothes after occupational exposure. All of the patients, a total of 59 (54 adults and 5 children), suffered from itching and punctiform, erythematous papules. Cutaneous reactions were diffuse or almost exclusively on hands, arms, chest and legs and they lasted from a minimum of 2 days to a maximum of 36 weeks. In 14 cases (14/21), physicians (General Practitioners/Pediatricians/Dermatologists) were consulted by patients because of the pruritus and they attributed the symptoms to different arthropods species and/or other causes (atopy/ allergy/ psychogenic pruritus). Antihistamines and steroids were prescribed after the medical examination (14/14 cases), also in combination with parasitic shampoos (2/14), antibiotics (2/14) and tranquilizers (1/14). Symptoms returned after treatment was stopped. In the remaining outbreaks (7/21) no medical advice was sought. The collected arthropods were identified by IZSPB staff as the red poultry mite, Dermanyssus gallinae (19/21 outbreaks) and as the tropical rat mite (2/21 outbreaks) according to Baker’s morphological keys (Baker, 1999) and key characters (Di Palma et al., 2012). A careful inspection at all reported sites revealed that the sources of the infestation by Dermanyssus gallinae (19/21 outbreaks) were abandoned/removed pigeon (17/21)/sparrow (1/21) nests close to the infested rooms; in only one case it was traced to caged canarians previously buyed from an infested store and kept as pets (1/21); the source of the Ornithonyssus bacoti (2/21 outbreaks) were a previously eliminated rats’ nest in the living room and a colony of laboratory rats, respectively. Removal of the source (empty nests) coupled with intensive vacuum cleaning and disinfestation using pyrethroids in 1-2 cycles of fumigation at the infested sites, led to the complete regression of the symptoms; in the case where canarians were involved, they were moved to a new cage. There was no evidence of mites or dermatitis in the follow-up period. In all of the cases where physicians attributed the symptoms to different arthropods species, the patients referred that any instructions were done by physicians to find the ectoparasite in the environment (Cafiero et al., 2009; 2011abc; 2013; 2015; Giangaspero et al., 2016). Recent surveys and sample collection have confirmed the endemicity ofDermanyssus gallinae in poultry farming worldwide (about 85%), including Italy where its prevalence were found be 74% in Apulia region (Sparagano et al., 2009). RM-bites can be considered a serious health hazard and a source of discomfort and stress for personnel working in Italian affected poultry farms. Furthermore, workers tend not to wear any personal protective equipment. In such conditions and due to ability of the mite to bite in less than 1 second (Auger et al., 1979), handling infested birds and/or cages but also only visiting infested farms can result in a major risk to human contamination. Since the mite is also known to be a possible vector of a number of zoonotic agents, the inclusion of the red mite as a zoonotic agent in all regulations regarding occupational safety and RMD as an occupational hazard for poultry workers should be strongly considered (Cafiero, et al., 2011).

CONCLUSION Identifying poultry red mites or other human mites can be tricky following human infestations as patients struggle to collect appropriate samples, which can be identified by entomologists or pest experts. Very often samples show debris, skin fragment or crushed arthropods beyond recognition. Therefore, such lack of identification can lead to frustration from both sides and misdiagnosis. The majority ofco- authors of this paper are involved in the Cost Action called COREMI (for Control of the Red Mite) financed by the European COST scheme, with one working group focusing on the One Health concept to make sure that veterinarians and medical practitioners can exchange valuable information to lead Emergence Of Dermanyssus Gallinae As An Arthropod Pest In Urban Context 207 to a faster diagnostic and patient recovery. Considering that many arthropod specie can infest humans and their houses it is paramount that the diagnostic is made promptly and accurately to avoid using the wrong treatment products, producing side effects and damaging patient’s health.

ACKNOWLEDGEMENTS This paper is based upon work from COST Action (FA1404-COREMI), supported by COST (European Cooperation in Science and Technology).

REFERENCES CITED Akdemir, C., E. Gulcan, and P. Tanritanir. 2009. Case report: Dermanyssus gallinae in a patient with pruritus and skin lesions. Turkiye Parazitol Derg,. 33(3): 242-4. Auger A, Nantel J, Meunier N, Harrison JR. 1979. Skin acariasis caused by Dermanyssus gallina (De Geer): an in-hospital outbreak. Can Med Assoc J.;17:700–703. Baker, A. S. 1999. Mites and ticks of domestic animals. An identification guide and information source. London: HM Stationery Office. Bellanger, A.P., C. Bories, F. Foulet, S. Bretagne, and F. Botterel. 2008. Nosocomical dermatitis caused by Dermanyssus gallinae. Infect. Control Hosp. Epidemiol. 29: 282-283. Boseret, G., B. Losson, J. G. Mainil, E. Thiry and C. Saegerman. 2013. Zoonoses in pet birds: review and perspectives. Veterinary Research. 44(36): 1-17. Cafiero, M.A., A. Camarda, E. Circella, G. Santagada, G. Schino, and M. Lomuto. 2008 Pseudoscabies caused by Dermanyssus gallinae in Italian city dwellers: a new setting for an old dermatitis. J. Eur. Acad. Dermatol. Venereol. 22(11): 1382-3. Cafiero, M.A., A. Camarda, E. Circella, D. Galante, and M. Lomuto. 2009. An urban outbreak of red mite dermatitis in Italy. International Journal of Dermatology. 48: 1119-1121. Cafiero M.A., D. Galante, A. Camarda, A. Giangaspero, O.A.E. Sparagano, and D. Chiocco. 2011a. Skin disorders from occupational exposure to red mite, Dermanyssus gallinae (Acari: Mesostigmata) in poultry workers XXX Jubilee Congresso of Occupational Medicine Prague, National Public Health Institute, Prague, October 13-14,(O.C.) Cafiero M.A., D. Galante, A. Camarda, A. Giangaspero, and O.A.E. Sparagano, 2011b.Why Dermanyssosis should be listed as an occupational hazard. Occup Environ Med. 2011 Aug;68(8):628. Epub 2011 Apr 12. Cafiero M.A., D. Galante, N. Cavaliere, C. Nardella La Porta, M. Caiazzo, and M. Lomuto. 2011c. Occupational outbreak of tropical rat mite (Ornithonyssus bacoti) dermatitis in laboratory personnel in Southern Italy (Apulia Region). Clinical Microbiology and Infections –Issue Supplement Vol 17. 21st ECCMID-27th ICC Congress. Milan, 7-10 May 2011, Pag 111 Cafiero, M.A., A. Camarda, D. Galante, G. Mancini, E. Circella, N. Cavaliere, G. Santagada, M. Caiazzo and M. Lomuto. 2013. Outbreaks of Red Mite (Dermanyssus gallinae) Dermatitis in City-dwellers: An Emerging Urban Epizoonosis. In: Hypotheses in Clinical Medicine, Nova Science Publishers, Inc. pp. 413-424. Cafiero M.A. D. Raele, G. Mancini, D. Galante. 2015. Dermatitis by Tropical Rat Mite, Ornithonyssus bacoti (Mesostigmata, Macronyssidae) in city-dwellers: a diagnostic challenge. J Eur Acad Dermatol Venereol. 2015 Apr 24. doi: 10.1111/jdv.13162. [Epub ahead of print] No abstract available.

208 O. Sparagano, R. Finn, M. Mul, A. Giangaspero, M. A. Cafiero, N. Willingham, K. Lyons, A. Lovers, and D. George

Circella, E., Pugliese, N., Todisco, G., Cafiero., MA., Sparagano, O.A., Camarda A. 2011. Chlamydia psittaci infection in canaries heavily infested by Dermanyssus gallinae.Exp Appl Acarol. 55: 329-338. Collgros, H., M. Iglesias-Sancho, M. J. Aldunce, V. Expósito-Serrano, C. Fischer, N. Lamas and P. Umbert-Millet. 2013. Dermanyssus gallinae (chicken mite): an underdiagnosed environmental infestation. Clinical and Experimental Dermatology. 38: 373-377. De Luna, C., S. Arkle, D. Harrington, D. George, J. Guy and O. Sparagano. 2008. The Poultry Red Mite Dermanyssus gallinae as a Potential Carrier of Vector-borne Diseases. Animal Biodiversity and Emerging Diseases. 1149: 255-258. Di Palma A, A. Giangaspero, M.A. Cafiero, G.S. Germinara. 2012. A gallery of the key characters to ease identification of Dermanyssus gallinae (Acari: Gamasida: Dermanissidae) and allow differentiation from Ornithonyssus sylviarum (Acari: Gamasida: Macronyssidae) Parasit Vectors. 2012 May 30;5:104. Dogramaci, A.C., G. Culha, and S. Özćelik. 2010. Dermanyssus gallinae infestation: An unusual cause of scalp pruritus treated with permethrin shampoo. Journal of Dermatological Treatment. 21: 319-321. Galante D., M. Lomuto, G. Totaro, G. Mancini, C. Nardella La Porta, M.A. Cafiero. 2011. A nosocomial outbreak of red mite (Dermanyssus gallinae) dermatitis in Italy. Clinical Microbiology and Infections –Issue Supplement Vol 17. 21st ECCMID-27th ICC Congress. Milan, 7-10 May 2011, page 286 George, D.R., R.D. Finn, K.M. Graham, M.M. Mul, V. Maurer, C.V. Moro and O.A.E. Sparagano, 2015 Should the poultry red mite Dermanyssus gallinae be of wider concern for veterinary and medical science? Parasites & Vectors. 8(178): 1-10. Giangaspero A. A. Camarda, M.A. Cafiero, M. Marangi, O. Sparagano. 2016. Dermanyssus gallinae: A Never-Ending Story for the Poultry Industry and Public Health Nova Acta Leopoldina NF, Nr. 411, in press. Haag-Wackernagel, D. 2005. Parasites from feral pigeons as a health hazard for humans. Annals of Applied Biologists. 147: 203-2010. Lucky, A.W., C. Sayers, J.D. Argus, and A. Lucky. 2001. Avian mite bites acquired from a new source - pet gerbils: Report of 2 cases and review of the literature. Arch. Dermatol. 137(2): 167-70. Mignon, B. and B. Losson. 2008. Dermatitis in a horse associated with the poultry mite (Dermanyssus gallinae). Vet. Dermatol. 19(1): 38-43. Schwarz, B. and B. Litschauer. 2009. Dermanyssus gallinae-associated pruritic dermatitis in a horse. Wiener Tierarztliche Monatsschrift 96 (9-10): 222-226. Sparagano, OAE, D.R. George, D. Harrington, and A. Giangaspero 2014. Biology, epidemiology, management and risk related to the poultry red mite, Dermanyssus gallinae (de Geer, 1778). Annual Review of Entomology, 59: 447-466. 209

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

SURVEILLANCE AND CONTROL OF AEDES ALBOPICTUS IN EPIDEMIOLOGICAL RISK AREAS OF VALENCIA (SPAIN)

1RUBEN BUENO, 2A. MÍGUEZ, 1M. GARCÍA, 2A. SALAZAR, AND 3F. QUERO 1Departamento de Investigación y Desarrollo, Laboratorios Lokimica, Valencia, Spain 2Sección de Epidemiología, Centro de Salud Pública de Valencia, Conselleria de Sanitat de la Generalitat Valenciana, Valencia, Spain 3Servicio de Sanidad y Consumo, Ayuntamiento de Valencia, Valencia, Spain

Abstract In Spain Dengue (DENV), Zika (ZIKV) and Chikungunya (CHIKV) are frequently imported by tourists and immigrants infected in endemic countries. The Spanish Ministry of Health has declared DENV, ZIKV and CHIKV as priority notifiable diseases in the country. Research presented here is focused on entomological interventions, surrounding imported cases of DENV, ZIKV and CHIKV, carried out in Valencia, Spain. The objective was to evaluate and control the risk of disease amplification at local scale. Valencia has a population of about 800,000 and has a Mediterranean climate of mild winters and long, hot and dry summers. Aedes albopictus was first recorded in the city in July 2015. Since then, the spread of the species has been constant through the municipality although local authorities have implemented a comprehensive control program based on preventive measures, insecticide treatments, vector monitoring, and social awareness. We present the methodology and results of all entomological interventions associated to imported cases of DENV, ZIKV and CHIKV in 2016. The use of Geographic Information Systems techniques, the procedures of inspections in domestic and public risk environments, the treatment of vector breeding and resting sites, the epidemiological information about imported cases, and the results of vector activity inside the influence range of each imported case will be presented.

Key words Aedes albopictus, arbovirus, surveillance, mosquito control, vector-borne diseases.

INTRODUCTION The Asian tiger mosquito, Aedes albopcitus, is a potential vector of several arboviruses like Dengue (DEN), Zika (ZIK) or Chikungunya (CHIK) in urban and periurban environments. These viruses are currently emerging worldwide, especially in tropical and temperate regions where vectors are capable of proliferating and reach high population densities. In Spain DEN, ZIK and CHIK are diseases frequently imported by tourists and immigrants infected in endemic countries. This context of increasing incidence and spread of potential local vectors, high infection rates of these arboviruses in tropical countries and globalization, that facilitates quick and continuous human movements all over the world, has motivated to Spanish Ministry of Health to declare DEN, ZIK and CHIK as priority notifiable diseases in our country. This invasive mosquito was recorded for the first time in Valencia (Eastern Spain) in July 2015 (Bueno and Quero, 2015), during routine samplings associated to a surveillance system against exotic culicids implemented in the city since 2014 and based on different trapping strategies of mosquitoes (eggs, larvae and adults) in some of the most suitable urban points (gardens, cemeteries and bus and train stations). Valencia is the third most populated city of Spain (800,000 inhabitants) and has excellent environmental conditions for Ae. albopictus establishment, with a typical Mediterranean climate (hot summers and mild winters) and high density of ideal breeding sites in public areas; there are 67,708 catch basins which are the most important biotopes for larval development in urban areas. Once the 210 R. Bueno, A. Míguez, M. García, A. Salazar, and F. Quero Surveillance And Control Of Aedes albopictus In Epidemiological Risk Areas species was detected in the city, during the second half of 2015, many efforts were carried out to know the mosquito range expansion. Press articles and other printed/online material informing about the Asian tiger mosquito findings were published in order to promote new citizen communications of species activity in different urban areas, high number of awareness talks with variable contents were exposed to several targeted groups of population like municipal workers (gardeners, technicians of sewer maintenance), school students (educative projects), sanitary professionals (medicals, pharmaceuticals, veterinaries and biologists) as well as the rest of citizens. Other passive surveillance strategy were related with the implementation of the citizen science platform named Mosquito Alert as an additional system of information input about vector activity. Regarding the “active” measures conducted for the analysis of Ae. albopictus spread, a reinforcement of intensive samplings with ovitraps, adult collection devices (BG-Sentinel Trap ®) and larval search in catch basins was carried out in all districts of the city. As a result of this monitoring strategy, 47 isolated hot spots of Ae. albopictus distribution were identified in Valencia at the end of 2015. It is important to note that all positive detections of Asian tiger mosquitoes were followed by the subsequent execution of control tasks, either mechanical breeding sites elimination or larvicides/adulticides applications. With all this information properly analysed and georeferenced, the urban mosquito control campaign was designed in 2016 (first year afterAe. albopictus establishment) with 3 main axes: Periodic surveillance and control of Asian Tiger Mosquito Risk Points (ATMRP). These points correspond to the 47 areas where the species was firstly recorded the previous year plus 2 areas referred to the surroundings of sanitary centres which are the reference hospitals for arbovirus diagnostic and consequently are places where there is a potential racking of patients who can carry the mosquito- borne disease. Consequently, this combination of historical activity data and epidemiological issues, is the basis to conform the 49 ATMRP of 2016. The main identifiable breeding sites of this 49 ATMRP (a total of 4.026 catch basins) are monitored every 4-6 weeks and also treated if mosquito presence is detected between the most suitable activity period (April-November). Quick citizen complaints attention. This is also a notable source of information about cryptic problems linked to Ae. albopictus activity. In this kind of activities control actions are done in public areas, but not in private ones, and citizen awareness is also promoted through the distribution of informative brochures about mosquito prevention in domestic environments. Several traditional communication ways of these citizen complaints have been employed, like phone calls, e-mails or written instances. Moreover, with the aim to promote new computer technology tools to improve communication between citizens and public administration, the citizen science platform called “Mosquito Alert” (Oltra et al., 2016) was also used as an additional entry point of information about vector status in the city. Vector monitoring and control in areas of high epidemiological risk. Through the implementation of an all-inclusive and agile protocol coordinated between Epidemiology and Mosquito Control Services, entomological surveillance is quickly conducted around imported cases in viremic period of DEN, ZIKA and CHIK diagnosed in the city. The aim of this axis of the mosquito control campaign is to evaluate the possibilities of virus circulation in local vector populations while lessening the probabilities of autochthonous infections. The results and analysis of this last branch of the mosquito control programme will be the main objective of this paper.

MATERIALS AND METHODS Epidemiological Issues According to DENV, ZIKV and CHIKV Surveillance Protocols approved by General Direction for Public Health of the Valencian Community (GVA, 2016) we can distinguish 3 types of arbovirus cases depending on the diagnostic phase: Suspected case. Person who complies with the clinical criteria (difficult due to non-specific symptoms in most cases) and at least one of the next epidemiological criteria: a) travel history to epidemic/endemic areas inside the range of 15 days before the symptoms appearance, b) spatial-temporal Surveillance And Control Of Aedes albopictus In Epidemiological Risk Areas 211 coincidence in a territory where probable/confirmed cases have been diagnosed or c) non-protected sexual relations with people returned from epidemic/endemic countries inside the range of 28 days upon the arrival if there is a lack of symptoms or up to 6 months if there is a confirmed laboratory diagnostic. This criterion is only assumed in the case of ZIKA. For DEN and CHIK suspected cases can be admitted directly with only clinical criteria. Probable case. In the case of ZIKA and DEN, person who complies with clinical criteria, with or without epidemiological criteria, but with a laboratory criteria of probable case: a) presence of antibodies IgM and b) seroconversion of antibodies IgG specific for the virus or increase of 4 times the title of the samples taken in acute and convalescent phases. For CHIK is enough with clinical criteria and at least one epidemiological criteria (except sexual transmission). Confirmed case. Person who complies with clinical criteria, with or without epidemiological criteria, and at least one laboratory criteria of confirmed case: a) viral isolation in a clinical sample, b) detection viral nucleic acid in a clinical sample or c) detection of neutralizing antibodies in serum with positive Ig-M samples. Once there is an evidence of a confirmed case in the city of Valencia, the Epidemiology department of Public Health Center of Valencia (PHCV) informs the Pest Control section of the Health Service of Valencia (HSV) municipality about the major issues related with the case (patient residence, mobility degree during the viremic period, anamnesis about mosquito bites, etc.) in order to configure an integrated plan for vector surveillance and control in epidemiological risk areas. Entomological Proceedings After the communication of the confirmed case, a sequence of tasks is immediately accomplished by HSV: Delimiting the risk areas to study. Entomological prospections are always done at least at domiciliary and peri-domiciliary level. This is because these areas correspond to the zones where theoretically the contact between patients and vectors is more likely. Of course, this assumption is also affected by numerous factors that should be analysed individually for each case (confinement degree of patient at home, type of edification, vector status in surrounding areas, suitable/unsuitable period of the year for mosquito proliferation, etc.). However, the standardization of entomological monitoring in all patients domiciles is a good basis to homogenize the surveillance proceedings. This delimitation of the study area in the domiciles is articulated in two phases: a) on the one hand, through GIS software a map is quickly created with all the relevant information about mosquito breeding and resting sites surrounding the patient residence. This map includes all public areas in a buffer of 150 meters diameter (based on known and common flight range ofAe. albopictus) from the patient’s home and it’s an essential tool for entomologists and mosquito control technicians to increase the precision and speed in their tasks. When other areas, different from peri-domiciliary, are additionally suspected to be at risk due to patient mobility behaviour during the short viremic phase, like working environment, medical centres for symptoms treatment or disease diagnostic or gardens frequented for recreation, etc., the procedure was the same. b) On the other hand, interviews and entomological surveys with patients are arranged in their homes thus to evaluate the activity of vectors at intra-domiciliary scale. Health municipal inspectors take this opportunity of close contact among citizens to promote citizen awareness actions in the neighbourhoods through the distribution of informative brochures about mosquito prevention in domestic environments. Entomological survey. In all identifiable breeding, mainly catch basins but also occasionally ornamental fountains or other small containers, and resting (catch basins and adequate vegetation masses) sites mosquito samplings are fulfilled. Immature stages are collected by dipping method, while two kinds of entomological aspirators are used for adult captures (the superior heavy duty hand-held aspirators BioQuip® for sampling small and well identifiable resting units, as well as the backpack aspirators BioQuip® for quick collections in big areas like hedges and other vegetation masses of high dimensions). Only if high densities of vectors have been detected or a factor that can mask the real activity 212 R. Bueno, A. Míguez, M. García, A. Salazar, and F. Quero Surveillance And Control Of Aedes albopictus In Epidemiological Risk Areas of mosquitoes during the sampling is supposed, then traps are installed in the risk areas to monitor the situation for 48-72 hour period. Those specific traps for urban aedine mosquitoes are the BG-Sentinel® for adult collection and ovitrap (small plastic container with 350 ml of distilled water and a wood tablet partially submerged) for egg catching. This kind of passive monitoring tool is particularly interesting at intra-domiciliary level, where usually the information about vector activity is scanty because of the limits related to identifying breeding and resting sites. Mosquito control strategies. In order to minimize the potential development of competent vectors surrounding the domiciles of imported DEN, ZIKA and CHIK cases, all small water bodies (mainly catch basins) are treated with mosquito specific larvicides. Although entomological survey will give us the precise information about real transmission risks, we apply a preventive premise to block the mosquito development in all the vulnerable areas for mosquito breeding. After this initial inspection/ treatment, weekly entomological reviews are implemented in the risk areas. The case is considered as closed and no more environmental interventions are done once two consecutive negative revisions are accomplished. Consequently surveillance of the risk areas is always maintained at least during 3 weeks (initial prospection plus two further weekly revisions). Two different types of biocides have been employed following doses and other use specifications provided by the manufacturers: Vectomax FG® (bacterial larvicide most commonly employed) and Device TB2® (Insect Growth Regulator based on diflubenzuron specifically indicated for high organic charge of water and/or prevalence of late and non- feeding immature stages like fourth instar larvae and pupae). In exceptional cases, where high densities of Ae. albopictus have been detected, localized adulticides treatments are done with Deflow Plus® (combination of deltamethrin and diflubenzuron). Laboratory tasks. All entomologic material collected was processed in laboratory conditions for mosquito species and sexes identification. The final goal was to separate and preserve the blood-fed females of Ae. albopictus collected in the risk areas in order to identify hypothetical arbovirus presence in further analyse with molecular techniques. RESULTS AND DISCUSSION A total of 7 confirmed cases of arboviruses (4 ZIKA, 2 DEN and 1 CHIK) have been diagnosed in Valencia during 2016 (Table 1). Asian tiger mosquito activity was only identified in one case, detecting two females of the species resting in the outside structure of the building where the ZIKA viremic patient lived and other three males in surrounding catch basins. Globally, 1,042 catch basins have been prospected during the first environmental interventions related with arbovirus cases, being the activity of mosquitoes evidenced in a 7% of these potential breeding sites. Main species collected were precisely the two most common urban mosquitoes in Mediterranean environments: Culex pipiens (vector of other potential urban mosquito-borne diseases like West Nile Virus or Dirofilariosis) andCuliseta longiareolata (ornitophylic species). Regarding to Ae. albopictus, the species was only detected in the 0.003% of the prospected breeding sites. After first treatment, all subsequent weekly entomological revisions were always negative and consequently the “arbovirus cases” have been closed in the shortest period according to protocol (two weeks). It is important to note that at intra-domiciliary level, fortunately, no evidence of mosquito activity was detected and the vulnerability to mosquito proliferation of those homes was considered very low (flats in raised floors without small stagnant water bodies in terraces or inner courtyards). Other relevant data regarding the municipal Mosquito Control Programme conducted in 2016 is that 98 of 375 (26%) citizen complaints about mosquito presence were related with Ae. albopictus activity after the entomological surveys. None of these complaints were spatio-temporal overlapped with areas of epidemiological risk (arbovirus attendance). On another hand, only 14% of the complaints linked to Asian tiger mosquito activity overlapped with ATMRP, where monthly preventive control measures were accomplished in catch basins (Figure 1). This statistic is even more enhanced by the fact that all overlaps were not associated with Ae. albopictus development in catch basins and other regularly monitored structures, since all these complaints coinciding with ATMRP were linked to mosquito proliferation in temporary containers, mainly abandoned ones, as well as water filled vegetable cavities or private breeding sites. Surveillance And Control Of Aedes albopictus In Epidemiological Risk Areas 213

Figure 1. Map with confirmed Ae. albopictus activity points (positive citizen complaints), ATMRPs and 7 confirmed arbovirus cases diagnosed in Valencia during 2016. Reference hospitals for arbovirus diagnostic are typified with “H”.

Figure 1. Map with confirmed Ae. albopictus activity points (positive citizen complaints), ATMRPs15 and 7 confirmed arbovirus cases diagnosed in Valencia during 2016. Reference hospitals for arbovirus diagnostic are typified with “H”.

One major concern, that should be emphasized, is that case interventions should not wait until arbovirus verification, because this provokes a notable delay in the entomological risk evaluation. Aswecan observe in the data of 2016, only two of seven confirmed cases were communicated to HSV inside the viremic phase of patients. Being able to carry out entomological prospections during the viremic period is essential to estimate the risk of disease transmission. According to this, in 2017 the Protocol has been modified and entomological prospection of cases has been introduced even for low level disease confirmation, which is the suspected case. Although this will suppose an increased effort in surveillance and control tasks, we strongly believe that this preventive measure is highly recommendable in order to maximize the possibilities to act inside viremic periods. Following with the review of 2016 data, besides the 7 confirmed cases another 23 cases were notified as probable cases (no case remained as suspected case, so all patients with symptoms and travel history to endemic countries had at least one serologic confirmation regarding to the laboratory criteria of probable case). Finally, at global geo- epidemiological level we can highlight that 6 of 7 imported cases of arboviruses were imported from Latin American countries, where these diseases showed a marked epidemic tendency in 2016. Our country has a major commercial, touristic and cultural entailment with this territory of the American Continent, and subsequently this is one of the most important explanations for the tendencies observed and to some extent a preceding of what can be expect in Spain, as well as other Mediterranean regions, in the framework of vector-borne disease globalization during the next years. 214 R. Bueno, A. Míguez, M. García, A. Salazar, and F. Quero Surveillance And Control Of Aedes albopictus In Epidemiological Risk Areas

Cases Virus / origin Date Entomological findings Control Observations country measures Case 1* DEN / Ecua- Feb Cx. pipiens (L, A) Catch basins Larvicides Notification outside dor analysed: 132 (2% positive). the theoretically favourable period for vector activity (March- November) Case 2 ZIKA / Bo- Apr Cx. pipiens (L, A) and Cs. Larvicides Additional risk area: livia longiareolata (L, A). Catch and removing school (patient was a basins analysed: 206 (5% breeding sites student who went to positive). school during viremic period). Case 3 ZIKA / Bo- May Cx. pipiens (L, A) and Cs. Larvicides None particular livia longiareolata (L, A). Catch situation to remark basins analysed: 71 (7% posi- tive). Case 4 DEN / Tahi- Jul Catch basins analysed: 157 Larvicides No particular situation land (26% positive). to remark Case 5 ZIKA / Co- Aug Cx. pipiens (L, A) and Cs. Larvicides No particular situation lombia longiareolata (L, A). Catch to remark basins analysed: 101 (18% positive). Case 6 CHIK / Bo- Sep Cx. pipiens (L, A) and Cs. Larvicides Additional risk areas: livia longiareolata (L, A). Catch 2 hospitals (patient basins analysed: 264 (3% was in the urgencies positive). units of both hospitals during viremic period). Case 7* ZIKA / Mex- Oct Cx. pipiens (A) and Ae. al- Larvides and Additional risk area: ico bopictus (A**). Catch basins adulticides hospital (patient was a analysed: 111 (3% positive). (local spraying sanitary professional in catch basins) who was working in the hospital during viremic period).

Table 1. Confirmed cases of DEN, ZIKA and CHIK diagnosed in Valencia during 2016.* Cases environmentally attended inside the viremic period. ** Two females of Ae. albopictus were collected resting outside patient building coinciding with the viremic period.

CONCLUSIONS Main conclusions can be summarized as follows: 1) A strong coordination between epidemiologists from PHCV and entomologist from HSV is essential to improve the quality of vector-borne risk assessment. Quick communication (interventions inside the viremic period) and meticulous anamnesis (identification of other risk areas different from domiciles) are basic. 2) An exhaustive entomological monitoring in the risk areas provides crucial information, not only for assessment regarding disease transmission but also for establishment of an effective and rational Mosquito Control Programme. Surveillance And Control Of Aedes albopictus In Epidemiological Risk Areas 215

3) Beyond the entomological actions quickly carried out after the notification of arbovirus cases, a global strategy of vector surveillance and control based on the identification of the most vulnerable areas for Ae. albopictus proliferation should be implemented. These ATMRP are also essential to minimize the potential impact of these diseases, because we strongly believe that these arboviruses are clearly infra-diagnosed due the frequent clinical asymptomatism. Recent researches indicate that people who are infected with arbovirus like DENV without developing detectable clinical symptoms are also infectious to mosquitoes (Duong et al., 2015). Even at a given level of viremia, symptom-free people were more infectious to mosquitoes than clinically symptomatic patients. This conjuncture could change the current paradigm for arbovirus epidemiology and control in non-endemic countries, based on quickly detection of imported cases with apparent illness and entomological actions surrounding the risk affected areas. 4) According to the experience in 2016, several modifications and new ideas will be applied in the surveillance and control programme: a) As has been commented before, the disease verification level to start with the communication circuit should be at the stage of probable case; b) Thus, to complete a real risk assessment, a proceeding of quick viral identification in vectors collected in the risk areas must be accomplished; c) After two years of Ae. albopictus establishment and acknowledging that the species is now homogeneously distributed in the whole territory of the municipality (activity evidenced in all urban districts in 2016), the implementation of GIS based spatial analysis will be increased to improve the detection of potential Ae. albopictus proliferation hot spots. The combination of high precision normalized difference vegetation index (NDVI), shade models and humidity-temperature interpolation will help us to identify suitable Ae. albopictus resting areas in the city and the analysis of catch basin information layers (typology, degree of water storage, density by square kilometre, etc.) will be useful to determinate the most suitable territories for breeding in public environments. The overlap level of both data sources will be decisive to select the ATMRP in 2017. REFERENCES CITED Bueno, R. and R. Jiménez. 2012. Re-Emergence of Malaria and Dengue in Europe. In: Rodriguez- Morales, A. Current Topics in Tropical Medicine, Rijeka, InTech. Bueno, R. and F. Quero. 2015. Vigilancia entomológica frente a mosquitos invasores en la ciudad de Valencia: primer registro del mosquito tigre, Aedes albopictus (Skuse, 1894), en el municipio. Zool. Baetica. 26: 145-151. Duong, V., L. Lambrechts, R. Paul, S. Ly, R. Lay, K. Long, R. Huy, A. Tarantola, T. Scott, A. Sakuntabhai, and P. Buchy. 2015. Asymptomatic humans transmit dengue virus to mosquitoes. Proc Natl Acad Sci USA, 112: 14688–14693. GVA-Generalitat Valenciana. 2016. Protocolos para la vigilancia de Dengue, Zika y Chikungunya en la Comunitat Valenciana. http://www.san.gva.es/ MSSSI-Ministerio de Sanidad, Servicios Sociales e Igualdad. 2016. Plan Nacional de preparación y respuesta frente a enfermedades transmitidas por vectores. Parte I: Dengue, Chikungunya y Zika. https://www.msssi.gob.es/profesionales/saludPublica/ccayes/alertasActual/Docs Zika/Plan_Nac_enf_vectores_20160720.pdf Oltra A., J.R.B. Palmer, and F. Bartumeus. 2016. AtrapaelTigre.com: enlisting citizens- scientists in the war on tiger mosquitoes. In: Capineri, C., Haklay, M., Huang, H., Antoniou, V., Kettunen, J., Ostermann F. and Purves R., eds., European Handbook of Crowdsourced Geographic Information, London: Ubiquity Press. 217

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

MOSQUITOES (DIPTERA: CULICIDAE) AS DIROFILARIA VECTORS IN TULA REGION, RUSSIA

1ANNA BOGACHEVA, 1YULIYA LOPATINA, AND 2LUDMILA GANUSHKINA 1Lomonosov Moscow State University, Leninskie Gory street, 1, Moscow, Russia 2Sechenov First MGMU, Trubetskaya Street, 8, Moscow, Russia

Abstract This study was carried out to investigate the potential vectors and mosquito infection rates of Dirofilaria immitis and D. repens in Tula region which is located in central part of Russia. Mosquitoes were captured throughout three mosquito seasons (2013–2015). A total of 719 genomic DNA pools, extracted and grouped according to the species and collection site (1–5 specimens/pool) from 2877 mosquito specimens, were examined by PCR using species-specific primers for D. immitis and D. repens. DNA extraction was performed separately to thorax- heads and abdomens in order to determine infective and infected mosquito specimens, respectively. Mosquito fauna is represented by 18 species belonging to 6 genera. The most abundant species was determined as Och. cantans (41.8%), Cx. pipiens (9.5%), Och. cataphylla (8.9%), Ae. geniculatus (6.9%). The minimum infection rates (MIRs) for Dirofilaria infection were calculated as 2.6% (1.5% and 1.1% for D. immitis and D. repens, respectively). Filarial DNAs were found in 12 species but most frequently in Ae. geniculatus, Och. punctor, Och. sticticus, Ae. cinereus, Och. cantans. MIRs for these specimens were established as 4.0%, 3.9%, 3.7%, 3.5%, 3.2%, respectively. The PCR results indicated that filarial DNAs were detected mainly in mosquito abdomens: 39/719 (5.4%) and 30/719 (4.2%) pools were positive for D. immitis and D. repens infection, respectively. In thorax-heads DNAs were detected less frequently: 9/719 (1.3%) and 6/719 (0.8%) pools were positive for D. repens and D. immitis DNAs, respectively. Four species of mosquitoes (Ae. vexans, Ae. geniculatus, Cx. pipiens, Och. cantans) carried infective stages of dirofilarial nematodes and could be the main potential vector of D. immitis and D. repens in Russia.

Key words Dirofilaria immitis, Dirofilaria repens, potential vectors, PCR, DNA, MIR.

INTRODUCTION Dirofilariasis is a vector-borne disease that affects canine and feline population. Dirofilaria immitis (Leidy) and D. repens (Railliet, Henry) are causative agents of dirofilariasis and parasitize insubcutaneous tissues and hearts, respectively (Simon et al., 2012). Humans are at risk of developing pulmonary and subcutaneous lesions (Cancrini et al., 2007). D. immitis and D. repens are transmitted by culicid mosquito species belonging to Culex, Aedes, Ochlerotatus, Anopheles, Coquillettidia, Armigeres and Psorophora genera (Yildirim et al., 2011; Mckay et al., 2013). Vectors ingest the first stage of parasite (microfilariae) during a blood meal on an infected host. In mosquito Malpighian tubules microfilariae develop to second (L2) and third stage larvae (L3). Infective L3 reach the salivary glands and proboscis where they are transferred while feeding to another host (Kartman, 1953; Montarsi et al., 2015). In Russia, the ratio of mosquitoes with Dirofilaria is investigated for southern region and constitutes 1.0-14.0% (Arakeljan et al., 2008; Ermakova et al., 2014). Although dirofilariasis is a problem for Russia, many areas are not sufficiently studied. Also there are no data about mosquito species as 218 A. Bogacheva, Y. Lopatina, and L. Ganushkina Mosquitoes as Dirofilaria Vectors in Tula Region Russia potential vectors of dirofalarial worms. Identification of mosquitoes in all cases was conducted only to genera. D. immitis and D. repens have been detected in Culex, Aedes and Anopheles genera and established as 4.0-7.0, 5.0-6.7, 0.6-3.4%, respectively (Arakeljan et al., 2008; Ermakova et al., 2014). The purposes of the current study were detecting mosquito fauna and identifying mosquito species that can transmit filarial worms in the Tula region (central part) using species specific PCR primers to estimate infection rate. MATERIALS AND METHODS The research was conducted in three districts in Tula (54°12′N and 37°37′E) and in five sites in Tula region (53°55′N and 37°35′E). They are typical dog accumulation areas: gardens of private houses with one or two dogs and parks where owners walk their dogs. Also there are sufficient numbers of stray dogs in parks. Mosquitoes were collected throughout three mosquito seasons (2013–2015) from May to August using exhauster. Trapping was held in the evening from 6-9 p. m. for 6-8 times a month. After trapping mosquitoes were frozen in a −19°C for 20–30 min and afterwards were identified using taxonomic keys (Gutsevich et al., 1970). The collected mosquitoes were grouped according to the species and collection site (1–5 specimens/pool). DNA extraction was performed separately to thorax-heads and abdomens in order to determine infective and infected mosquito specimens, respectively. For the PCR analysis, we used 2877 female mosquitoes which were divided into 719 pools. Each pool was tested separately for identifying of D. immitis and D. repens. PCR amplification was performed with two sets of primers: DIR-3: F-5’ – CCGGTAGACCATGGCATTAT - 3’ и DIR-4: R – 5’ - CGGTCTTGGACGTTTGGTTA - 3’ for detection of D. repens (Vakalis et al., 1999); COI intF — 5’ -TGATTGGTGGTTTTGGTAA - 3’ and COI intR — 5’ - ATAAGTACGAGTATCAATATC -3’ for detection of D. immitis (Murata et al., 2003). The presence of filarial DNA was examined by agarose gel electrophoresis. Minimum infection rates (MIRs) were calculated by the standard formula: (number of positive mosquito pools)/(total number of mosquitoes tested)×100 (Cancrini et al., 2003).

RESULTS Totally, 2877 mosquito specimens belonging to Aedes, Ochlerotatus, Culex, Culiseta, Coquillettidia and Anopheles genera were caught during three mosquito seasons (2013–2015) in the studied area. The most abundant species was Och. cantans with the ratio of 41.8% and this rate was followed by Cx. pipiens (9.5%), Och. cataphylla (8.9%), Ae. geniculatus (6.9%) (Table 1). Mosquitoes as Dirofilaria Vectors in Tula Region Russia 219

Table 1. Numbers of wild-caught mosquitoes in Tula region, 2013-2015

Species May June July August Total 1. Anopheles maculipennis 0 0 4 19 23 2. Culiseta alaskaensis 3 5 28 15 51 3. Сs. аnnulata 0 0 7 3 10 4. Coquillettidia richiardii 3 5 41 8 57 5. Aedes cinereus 4 14 86 40 144 6. Ae. vexans 8 13 78 32 131 7. Ae. geniculatus 0 7 151 42 200 8. Осhlerotatus cantans 409 248 446 100 1203 9. Och. excrucians 5 22 10 4 41 10. Осh. communis 32 34 12 5 83 11. Осh. punctor 20 14 12 5 51 12. Осh. sticticus 23 23 4 4 54 13. Och. diantaeus 24 35 0 1 60 14. Осh. intrudens 54 55 41 6 156 15. Осh. cataphylla 87 111 47 13 258 16. Осh. leucomelas 26 20 8 3 57 17. Culex modestus 0 0 12 13 25 18. Cx. pipiens 3 32 112 126 273

The minimum infection rates (MIRs) for Dirofilaria infection were calculated as 2.6% (1.5% and 1.1% for D. immitis and D. repens, respectively). Filarial DNAs were found in 12 species but most frequently in Ae. geniculatus, Och. punctor, Och. sticticus, Ae. cinereus, Och. cantans. MIRs for these specimens were established as 4.0%, 3.9%, 3.7%, 3.5%, 3.2%, respectively (Table 2). Six species, which included Осh. cantans, Ae. qcinereus, Ae. geniculatus, Ae. vexans, Осh. cataphylla and four species (Осh. cantans, Ae. geniculatus, Осh. cataphylla, Och. punctor) had more than one positive pool for D. immitis and D. repens infection, respectively (Table 2). No specimen of mosquito showed a mixed infection.

D. immitis was found in 5.4% and 0.8% abdomen and thorax-head pools, respectively. D. repens DNAs were detected in 4.2% and 1.3% abdomen and thorax-head pools. Only four species of mosquitoes (Ae. vexans, Ae. geniculatus, Cx. pipiens, Och. cantans) carried the infective stage of dirofilarial nematodes. The number of D. repens infective pools established for Och. cantans, Ae. geniculatus and Cx. pipiens as seven, one, one, respectively. Concerning D. immitis (L3) pools Och. cantans, Ae. geniculatus and Ae. vexans had three, two and one positive pools, respectively. Regarding Och. cantans, three pools with D.immitis and seven pools with D. repens contained filarial DNA both in abdomen and thorax-head.

220 A. Bogacheva, Y. Lopatina, and L. Ganushkina Mosquitoes as Dirofilaria Vectors in Tula Region Russia

Table 2. Mosquito pools examined by PCR for filarial DNA

PCR (D. immitis) + PCR (D. repens) + MIRs

Head-tho- Abdo- Head-tho- Abdo- Tested Pools % rax mens rax mens

Cs.alaskaensis 51 12 0 1 0 0 1.9 Ae. cinereus 144 36 0 4 0 1 3.5 Ae. vexans 131 32 1 2 0 0 2.3 Ae. geniculatus 200 50 2 2 1 3 4.0 Осh. cantans 1203 300 3 21 7 17 3.2 Осh. communis 83 20 0 1 0 1 2.4 Осh. punctor 51 12 0 0 0 2 3.9 Осh. sticticus 54 13 0 1 0 1 3.7 Осh. intrudens 156 39 0 2 0 1 1.9 Осh. cataphylla 258 64 0 3 0 4 2.7 Осh. leucomelas 57 14 0 1 0 0 1.8 Cx. pipiens 273 68 0 1 1 0 0.7

DISCUSSION In the current study mosquito fauna is represented by 18 species belonging to 6 genera (Table 1). After comparing the fauna of mosquitoes in Tula with the studies of the neighboring regions of European Russia, similar data were noted (Gornostaeva and Danilov, 2000). There are no data concerning the species composition of mosquitoes in Tula region. Och. cantans and Och. cataphylla were the dominant mosquito species in this study in May and June. These species are associated with intermittent floodwaters which are numerous in spring. Other species, Ae. geniculatus and Cx. pipiens, became abundant from July to August. They reach the maximum number in the second part of summer. At the same time Och. cantans was dominant from July to August too due to their ability to give several generations per year (Gutcevich et al., 1970). Russia is endemic for Dirofilaria infection. Two species of Dirofilaria (D. immitis and D. repens) have been identified in mosquitoes, dogs and humans in other reseaches (Arakeljan etal., 2008; Ermakova et al., 2014). Both types of worms were found in Tula mosquitoes in the present study. Several cases of D. repens infection in humans were detected in Tula region previously (Derzhavina et al., 2010). However, D. immitis have not been identified in humans in Tula (Ermakova et al., 2014). The first case of D. immitis was detected in 2015 in Moscow region. Immature female was removed from 14-month-old child (Tumolskaya et al., 2016). The rates of MIRs are studied in other countries. Thus MIRs for Cx. pipiens varies from 0.05 to 0.54% for European countries (Cancrini et al., 2007; Yildirim et al., 2011; Latrofa et al., 2012; Capelli et al., 2013), for Ae. vexans it conducted 0.03-1.6% for European countries (Yildirim et al., 2011; Latrofa et al., 2012; Bockova et al., 2013; Sulesco et al., 2016) and 9.6% for USA (McKay et al., 2013). In Moldova MIRs for Ae. geniculatus, Ae. cantans and Och. sticticus established as 7.7; 13.3 and 4.2%, respectively (Sulesco et al., 2016). Our data are partially agreed with results of other studies. Differences of infection rates in the same mosquito species from different regions could be linked with ecological factors such as season, climate and geographical features which are specific for each region (Genchi et al., 2009). Mosquitoes as Dirofilaria Vectors in Tula Region Russia 221

Positive pools with D. immitis and D. repens were detected for the worm observing season. Moreover, according to other surveys infective stage (L3) of Dirofilaria were also determined in Ae. vexans, Ae. geniculatus and Cx. pipiens (Petruschke et al., 2001; Cancrini et al., 2007; Yildirim et al., 2011, McKay et al., 2013, Bockova et al., 2013). This is the first study in Russia to examine the mosquito species as potential vectors of D. immitis and D. repens. In this study filarial DNA was revealed in 12 species of mosquitoes, only four of them contained infective stage (L3) in the head or thorax. A location exclusively reached by the L3 demonstrating that these two mosquitoes are able of supporting the development of Dirofilaria species up to the infective stage. Thus Ae. vexans, Ae. geniculatus, Cx. pipiens, Och. cantans can be considered as important vectors in Russia. However, more studies are needed to establish the vector competence of Och. punctor, Och. sticticus and Ae. cinereus as high level of positive pools (16.7, 7.7, 13.9%, respectively) were identified only in the abdomen.

ACKNOWLEDGEMENTS The study was supported by Russian Science Foundation, grant No. 14-50-00029 (data handling, preparation of manuscript).

REFERENCES CITED Arakeljan, R., A. Kovtunov, V. Bikov, V. Shatalin, and E. Arakeljan. 2008. Epidemiologic- episootologic features of three-member system of dirofilariasis (dog-mosquito-people) on the territory of Astrakhan region. Siber. Med. J. 7: 13-18 (in Russian). Bocková, E., I. Rudolf, A. Kočišová, L. Betášová, K. Venclíková, J. Mendel, and Z. Hubálek. 2013. Dirofilaria repens microfilariae in Aedes vexans mosquitoes in . Parasit. Res. 112(10): 3465-3470. Cancrini, G., A. Frangipane di Regalbono, I. Ricci, C. Tessarin, S. Gabrielli, and M. Pietrobelli. 2003. Aedes albopictus is a natural vector of Dirofilaria immitis in Italy. Vet. Parasitol. 118: 195–202. Cancrini, G., P. Scaramozzini, S. Gabrielli, M. Paolo, L. Toma, and R. Romi. 2007. Aedes albopictus and Culex pipiens implicated as natural vectors of Dirofilaria repens in central Italy. J. Med. Entomol. 44(6): 1064-1066. Capelli, G., A.F. Regalbono, G. Simonato, R. Cassini, S. Cazzin, G. Cancrini, D. Otranto, and M. Pietrobelli. 2013. Risk of canine and human exposure to Dirofilaria immitis infected mosquitoes in endemic areas of Italy. Parasit. Vectors. 6:60. DOI: 10.1186/1756-3305-6-60. Derzhavina, T., M. Mertesheva, A. Chernysheva, and E. Chernikova. 2010. Human dirofilariasis in the Tula region. Med. Parasitol. 1: 46-47. Ermakova, L., S. Nagorny, E. Krivorotova, N. Pshenichnaya, and O. Matina. 2014. Dirofilaria repens in the Russian Federation: current epidemiology, diagnosis, and treatment from a federal reference center perspective. Int. J. Infect. Dis. 23: 47-52. Genchi, C., L. Rinaldi, M. Mortarino, M. Genchi, and G. Cringoli. 2009. Climate and Dirofilaria infection in Europe. Vet. Parasitol. 163, 286–292. Gornostaeva, R. and A. Danilov. 1999. Mosquitoes Moscow city and Moscow region. Moscow. Scientific Press (in Russian). Gutsevich, A., A. Monchadskii, and A. Shtakelberg. 1970. Fauna of the USSR. Diptera. Mosquitoes. Family Culicidae. 3(4). Leningrad: Nauka (in Russian). Mosquitoes as Dirofilaria Vectors in Tula Region Russia Kartman, L. 1953. Factors influencing infection of the mosquito with Dirofilaria immitis (Leidy, 1856). Experiment. Parasitol. 2: 27-78. 222 A. Bogacheva, Y. Lopatina, and L. Ganushkina

Latrofa, M., F. Montarsi, S. Ciocchetta, G. Annoscia, F. Dantas-Torres, S. Ravagnan, G. Capell, and D. Otranto. 2012. Molecular xenomonitoring of Dirofilaria immitis and Dirofilaria repens in mosquitoes from north-eastern Italy by real-time PCR coupled with melting curve analysis. Parasit. Vectors. 5: 76. DOI : 10.1186/1756-3305-5-76 Mckay, T., T. Bianco, L. Rhodes, and S. Barnett. 2013. Prevalence of Dirofilaria immitis (Nematoda: Filarioidea) in Mosquitoes From Northeast Arkansas, the United States. J. Med. Entomol. 50(4): 871-878. Montarsi, F., S. Ciocchetta, G. Devine, S. Ravagnan, F. Mutinelli, A.F. Regalbono, D. Otranto, and G. Capelli. 2015. Development of Dirofilaria immitis within the mosquito Aedes (Finlaya) koreicus, a new invasive species for Europe. Parasit. Vectors. 8: 177. DOI: 10.1186/ s13071-015-0800-y. Murata K., T. Yanai T, T. Agatsuma, and S. Uni. 2003. Dirofilaria immittis Infection of a snow leopard (Unica unica) in a Japanese zoo with mitohondrial DNA analysis. J. Vet. Med. Sci. 65(8): 945-947. Petruschke, G., I. Rossi, C. Genchi, and F. Pollono. 2001. Canine dirofilariasisin the canton of Ticino and in the neighboring areas of Northern Italy. Schweiz Arch. Tierheilkd. 143: 141– 147. Simón, F., M. Siles-Lucas, R. Morchón, J. González-Miguel, I. Mellado, E. Carretón, and J.A. Montoya-Alonso. 2012. Human and animal dirofilariasis: the emergence of a zoonotic mosaic. Clin. Microbiol. Rev. 25(3): 507-544. Șuleșco, T., H. Thien, L. Toderaș, I. Toderaș, R. Lühken, and E. Tannich. 2016. Circulation of Dirofilaria repens and Dirofilaria immitis in Moldova. Parasit. Vectors. 9: 627. DOI: 10.1186/s13071-016-1916-4. Tumolskaya, N., E. Pozio, V. Rakova, V. Supriaga, V.Sergiev, E. Morozov, L. Morozova, G. Rezza, and S. Litvinov. 2016. Dirofilaria immitis in a child from the Russian Federation. Parasite. 23: 37. DOI: 10.1051/parasite/2016037. Vakalis, N., G. Spanakos, E. Patsoula, and N. Vamvakopoulo. 1999. Improved detection of Dirofilaria repens DNA by direct polymerase chain reaction. Parasitol. Int. 48(2): 145–150. Yildirim, A., A. Inci, O. Duzlu, Z. Biskin, A. Ica, and I. Sahin. 2011. Aedes vexans and Culex pipiens as the potential vectors of Dirofilaria immitis in Central Turkey. Vet. Parasitol. 178: 143-147. 223

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

EFFECT OF CHLORPYRIFOS ON THE OVIPOSITION AND SURVIVAL OF AEDES AEGYPTI (DIPTERA: CULICIDAE)

1LEE-JIN BONG AND 2WU-CHUN TU 1National Mosquito-borne Diseases Control Research Center, National Health Research Institute, Taiwan, ROC 2Department of Entomology, National Chung Hsing University, Taichung, Taiwan ROC

Abstract Phenomenal of high egg reproduction when mortality risk rose is very common in mosquito. Yet, the presence of this reproduction advantage in insecticide resistance mosquito remains unclear. In this study, we evaluated the effect of chlorpyrifos (CP) exposure on the oviposition and survival of Aedes aegypti using two strains. We found that CP exhibited no oviposition deterrent against female mosquitoes of both Lab and KH strains, given that the females did not show any decrease in their reproduction activity on CP-treated sites. High mortality was recorded in Lab strain after contacting the CP-treated oviposition sites on day 4. Before death, the mosquitoes oviposited large number of eggs indicating the adaptive strategy of the mosquito aimed at maintaining the progeny in the population. However, this reproductive effort was not seen in KH strain although ~60% of the mosquitoes were killed at 1.0 ppm CP. Mosquitoes of this strain are exposed to a variety of insecticide. Coping with the toxicity of insecticides can be costly, and thus energy and resource are redirected to survival instead of reproduction.

Key words Fitness cost, fecundity, selection, trade-off, dengue

INTRODUCTION Aedes aegypti is the vector for dengue outbreak in the urban area of Southern of Taiwan. Pyrethroids and organophasphate are widely used in Taiwan to suppress the population of this mosquito. As a result, the mosquitoes are found resistance to these compounds. These mosquitoes often exhibited a series of trade- offs, most apparently on reproduction (Martins et al., 2012; Brito et al. 2013). High egg reproduction when mortality risk rose is common in mosquitoes. However, no study till date has investigated this reproductive effort in resistance strain of A. aegypti. In this study, we examined the oviposition trend of susceptible and resistance strain of A. aegypti on organophosphate insecticide.

MATERIALS AND METHODS Two strains of A. aegypti were used in the study: 1) Kaohsiung laboratory strain (Lab). This standard susceptible strain to chemical insecticides was collected from Kaohsiung, Taiwan, and has been maintained until 243 generation in the insectarium of National Chung Hsing University at 25.0 ± 1.0°C, 65.0 ± 2.0% relative humidity (RH), and a photoperiod of 12:12 (L:D); and 2) Kaohsiung wild strain (KH). The population was collected from Kaohsiung Lingya district, and maintained in the insectarium as mentioned above. First filial generation (F1) of KH strain was used in the study. Briefly, a total of 20 blood-fed female mosquitoes aged between 6-7 days old were introduced into mosquito cage (60.0 cm length x 60.0 cm width x 60.0 cm height) with provision of 10% sucrose. Two days after the introduction of the mosquitoes, a plastic cup (6.0 cm diameter x 7.0 cm height) lined with towel paper (22.5 cm length x 7.0 cm width) was filled with 30 ml chlorpyrifos (CP), and placed in 224 Lee-Jin Bong and Wu-Chun Tu Effect Of Chlorpyrifos On The Oviposition And Survival Of Aedes aegypti the cage as oviposition site. The number of eggs laid and the mortality of the adults were recorded daily for three consecutive days. Oviposition site was replaced with new oviposition site daily. Three concentrations of CP 95.3% (SINON Corporation, Taiwan R. O. C) were tested: 0.25 ppm, 0.5 ppm, and 1.0 ppm. For the control, the oviposition site was filled with distilled water. The test was replicated three times per each treatment. All the data were examined using the one-way analysis of variance (ANOVA), and means were separated by Tukey’s honestly significant difference (HSD) test.

RESULTS Adult female mosquitoes laid eggs on non-treated (control) and CP-treated oviposition sites. Regardless of concentrations, the total number of eggs laid per KH strain female on CP-treated sites (32.65 ± 7.06 to 37.32 ± 3.32 eggs per female) were similar to the control (33.92 ± 1.65 eggs per female) (Table 1). Each day, a female mosquito would oviposit ~ 2 to 20 eggs (Table 2). Conversely, large number of eggs were found laid by the Lab strain on day 4 on the CP-treated sites (Table 2), recorded ~ 40 eggs per female which was significantly higher than the control (F = 9.747; df = 6, 14; P < 0.001).This indirectly resulted in higher total number of eggs being produced by the Lab strain on the CP-treated sites throughout the study, e.g., total number of eggs laid on 0.25 ppm CP-treated site (83.69 ± 6.06) were significantly higher than the control (F = 6.381; df = 6, 14; P = 0.002) (Table 1). Although large numbers of eggs were also laid on 0.5 ppm and 1.0 ppm CP-treated sites, they were not significantly different from the control.

Table 1. Number of eggs laid by A. aegypti (mean ± se) on concentrations of CP-treated oviposition sites.

Control CP (ppm) 0.25 0.5 1.0

Lab 37.78 ± 1.52a(a) 83.69 ± 6.06b(a) 51.15 ± 10.31a(a) 48.68 ± 7.18a(a) KH 33.92 ± 1.65ab(a) 37.32 ± 3.32b(b) 36.81 ± 0.70b(a) 32.65 ± 7.06a(a)

Mean values followed by the same letter within a row are not significantly different (Tukey’s HSD; P > 0.05). Mean values followed by the same letter in parentheses within a column are not significantly different (Student’s t-test; P > 0.05) High mortality was recorded in Lab strain after contacting the CP-treated oviposition sites, registered the mortality of. ~ 70-80% on day 4 (Figure 1). This would also be the possible explanation on the sudden high egg reproduction on day 4 on the CP-treated sites. Both 0.25 ppm and 0.5 ppm CP resulted in ~ 20% mortality in KH strain, and ~ 50-60% of females were killed after contacting with 1.0 ppm CP-treated oviposition sites. The phenomenal of sudden egg reproduction was not seen in KH strain. Effect Of Chlorpyrifos On The Oviposition And Survival Of Aedes aegypti 225

Table 2. Number of eggs laid by A. aegypti (mean ± se) daily on concentrations of CP-treated oviposition sites.

Strain Larvicide (ppm) Day 3 Day 4 Day 5 Lab Control 10.37 ± 1.84a(ab) 17.95 ± 1.48b(a) 9.47 ± 1.00a(a) CP (0.25) 10.32 ± 2.22a(ab) 45.81 ±5.75b(c) 35.33 ± 3.18b(b) (0.50) 5.73 ± 0.85a(a) 34.60 ± 5.33b(bcd) 12.33 ± 9.67ab(a) (1.0) 4.22 ± 1.43a(a) 39.48 ± 6.88b(cd) 0.50 ± 0.50a(a) KH control 2.22 ± 0.48a(a) 18.27 ± 0.55b(a) 13.43 ± 2.23b(a) CP (0.25) 10.67 ± 2.04a(ab) 15.53 ± 3.03a(a) 11.40 ± 1.88a(a) (0.50) 9.25 ± 2.99a(ab) 18.25 ± 0.89a(a) 8.66 ± 3.25a(a) (1.0) 13.53 ± 3.25a(b) 12.40 ± 2.50a(a) 3.69 ± 0.93a(a)

Mean values followed by the same letter in the same row are not significantly different (Tukey’s HSD; P > 0.05).Mean values followed by the same letter in parentheses in the same column within a strain are not significantly different (Tukey’s HSD; P > 0.05).

Figure 1. Number of eggs laid (solid line) by Lab strain and KH strain A. aegypti on CP-treated oviposition sites and the survival of A. aegypti (dotted line) after contacting on the oviposition sites.

DISCUSSION We found that CP exhibited no oviposition deterrent against female mosquitoes of both Lab and KH strains, given that the females did not show any decrease in their reproduction activity on CP-treated sites. In fact, large number of eggs was found oviposited by the Lab strain on the CP-treated sites. The adults were found to pick up lethal dose when ovipositing on CP-treated sites. However, KH strain reflected more tolerance towards CP than the Lab strain as the females reacted to 1.0 ppm CP, registered the mortality of ~50% at day 4, while the Lab strain registered the mortality of ~70-80% at all concentrations. Similarly, only 1.0 ppm CP showed ovicidal and larvicidal effects on the KH strain (data not shown). Interestingly, the Lab strain female was shown to increase its reproduction effort by laying substantial number of eggs just before died. This phenomenal was commonly seen in insects during life 226 Lee-Jin Bong and Wu-Chun Tu threatening situations. For example, in the rove beetle, Paederus fuscipes Curtis, high reproduction was registered in the strain with short life span (Bong et al., 2012). Also, the parasitized male Drosophila nigrospiracula Patterson and Wheeler was found mated repeatedly before death (Polak and Starmer 1998). These strategies were believed to be adopted to sustain their progenies in the population when mortality risk rose. However, such trend was not exhibited in the KH strain. It was believed that the wild strain possibly has developed resistance to certain insecticides (unpublished data) as insecticide applications, e.g. thermal fogging were frequently used especially during summer to suppress the mosquito population in Lingya district. Such actions are costly and requires energy which redirected towards survival instead of reproduction (Kliot and Ghanim 2012). There were numerous studies on the effect of insecticides on insects reproduction, yet it remains highly controversial. On the one hand, some reported the increased of reproduction rate (Sutherland et al. 1967, Chelliah et al. 1980, Liu et al. 1986), while many reported otherwise (Hunter et al., 1958; Duncan 1963; Georghiou, 1965; Kumar and Chapman, 1984). These authors have overlooked the fact that resource might redirect for longevity instead of fecundity in insects which are under insecticide stress. So, the present study provided an important information that reacted to this controversial that was unanswered in decades.

REFERENCES CITED Bong, L. J., K. B. Neoh, Z. Jaal, and C. Y. Lee. 2012. Life table of Paederus fuscipes (Coleoptera: Staphylinidae). J. Med. Entomol. 49: 451-460. Brito, L. P., J. G. B. Linss, T. N. Lima-Camara, T. A. Belinato, A. A. Peixoto, J. B. P. Lima, D. Valle, and A. J. Martins. 2013. Assessing the effects of Aedes aegypti kdr mutations on pyrethroid resistance and its fitness cost. PLos ONE. 8. Chelliah, S. L. T. Fabellar, and E. A. Heinrichs. 1980. Effect of sublethal doses of three insecticides on the reproductive rate of the brown planthopper, Nilaparvata lugens on rice. Environ. Entomol. 9: 778-780. Duncan, J. 1963. Post-treatment effects of sublethal doses of dieldrin on the mosquito Aedes aegypti L. Ann. Appl. Biol. 52: 1-6. Georghiou, G. P. 1965. Effects of carbamates on house fly fecundity, longevity and food intake. J. Econ. Entomol. 58: 58-62. Hunter, P. E. L. K. Cutkomp, and A. M. Kolkaila. 1958. Reproduction in DDT- and diazinon- treated house flies. J. Econ. Entomol. 51: 579-582. Kliot, A. and M. Ghanim. 2012. Fitness costs associated with insecticide resistance. Pest Manag. Sci. 68: 1431-1437. Kumar, K. and R. B. Chapman. 1984. Sublethal effects of insecticides on the diamondback moth Pluttellla xylostella (L.). Pestic. Sci. 15: 344-352. Liu, W. R. G. Todd, and E. J. Gerberg. 1986. Effect of three pyrethroids on blood feeding and fecundity of Aedes aegypti. J. Am. Mosq. Control Assoc. 2: 310-313. Martins, A. J. C. D. M. Ribeiro, D. F. Bellinato, A. A. Peixoto, D. Valle, and J. B. P. Lima. 2012. Effect of insecticide resistance on development, longevity and reproduction of field or laboratory selected Aedes aegypti populations. PLos ONE. 7. Polak, M. and W. T. Starmer. 1998. Parasite-induced risk of mortality elevates reproductive effort in male Drosophila. Proc. R. Soc. Lond. B. Biol. Sci. 265: 2197-2201. Sutherland, D. J. F. D. Beam, and A. P. Gupta. 1967. The effects of mosquitoes of sublethal exposure to insecticides. 1. DDT, dieldrin, malathion and the basal follicles of Aedes aegypti (L.). Mosq. News. 27: 316-323. 227

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

EVALUATION OF MOSQUITO BARRIER APPLICATIONS USING LAMBDA-CYHALOTHRIN AND PYRIPROXYFEN IN THE UNITED STATES

NICOLA T. GALLAGHER, ELRAY ROPER, CHRIS T. KEEFER, MARK COFFELT, AND CLAY W. SCHERER Syngenta Crop Protection, LLC.

Abstract Aedes albopictus is an invasive mosquito in the United States and also a competent vector for many viruses. As an aggressive human biter, this mosquitoes is often the primary pest species eliciting complaints from the public in areas where they occur. This mosquito will readily utilize artificial containers for breeding and thus has adapted well to suburban and urban habitats. Barrier treatments for suppression of anthropophagic mosquitoes in the spatial scale of a typical suburban backyard show promise to provide meaningful reduction of nuisance mosquitoes. In this paper, we report the results of both a laboratory and field trial evaluating the performance and residual toxicity of Demand® CS insecticide (lambda-cyhalothrin) and Archer® insect growth regulator (pyriproxyfen) when barrier treatments are created by targeting treatments with mist blowers to low-lying foliage.

Key words Aedes, management, insect growth regulator, lambda-cyhalothrin, pyriproxyfen, foliage.

INTRODUCTION Aedes albopictus is the most invasive vector mosquito in the world (Bonizzoni et al. 2013) and a competent vector for many viruses (Benedict et al., 2007). As an aggressive human biter, this mosquito is often the primary pest species eliciting complaints from the public in areas where it occurs (Farajollahi, 2009). Because it readily utilizes artificial containers for breeding, it has adapted well to suburban and urban habitats (Barker et al. 2004). Residual pesticides applied to mosquito resting sites in vegetation have been shown to reduce pest mosquito populations (Trout et al., 2007; Amoo et al., 2008; Doyle et al., 2009). Syngenta and outside cooperator trials have evaluated the efficacy of Demand CS (lambda- cyhalothrin, Syngenta Crop Protection, Inc., Greensboro, NC) and Archer IGR (pyriproxyfen, Syngenta Crop Protection, Inc., Greensboro, NC) for the control of mosquitoes. The focus of such studies evaluated: 1) the residual toxicity under field conditions of lambda-cyhalothrin toAe. albopictus, and 2) barrier pesticide applications in mosquito infested backyards using lambda-cyhalothrin, pyriproxyfen, and a combination of both products on Ae. albopictus populations.

MATERIALS AND METHODS Residual Performance on Landscape Vegetation Five plant species common to landscaped areas in southwestern Virginia were selected: Miscanthus sinensis, Buxus spp., Rhododendron X ‘Chionoides’, Thuja occidentalis and Lonicera japonica. Plants were evenly spaced in a 6.1 meter2 plot and were exposed to natural environmental conditions. Treatments were 0.06% lambda-cyhalothrin, 0.03% lambda-cyhalothrin or water as a control. Treatments were 228 N. T. Gallagher, E. Roper, C. T. Keefer, M. Coffelt, and C. W. Scherer Evaluation Of Mosquito Barrier Applications Using Lambda-Cyhalothrin And Pyriproxyfen

INTRODUCTION Aedes albopictus is the most invasive vector mosquito in the world (Bonizzoni et al. 2013) and a competent vector for many viruses (Benedict et al., 2007). As an aggressive human biter, this mosquito is often the primary pest species eliciting complaints from the public in areas where it occurs (Farajollahi, 2009). Because it readily utilizes artificial containers for breeding, it has adapted well to suburban and urban habitats (Barker et al. 2004). Residual pesticides applied to mosquito resting sites in vegetation have been shown to reduce pest mosquito populations (Trout et al., 2007; Amoo et al., 2008; Doyle et al., 2009). Syngenta and outside cooperator trials have evaluated the efficacy of Demand CS (lambda- cyhalothrin, Syngenta Crop Protection, Inc., Greensboro, NC) and Archer IGR (pyriproxyfen, Syngenta Crop Protection, Inc., Greensboro, NC) for the control of mosquitoes. The focus of such studies evaluated: 1) the residual toxicity under field conditions of lambda-cyhalothrin toAe. albopictus, and 2) barrier pesticide applications in mosquito infested backyards using lambda-cyhalothrin, pyriproxyfen, and a combination of both products on Ae. albopictus populations.

MATERIALS AND METHODS Residual Performance on Landscape Vegetation Five plant species common to landscaped areas in southwestern Virginia were selected: Miscanthus sinensis, Buxus spp., Rhododendron X ‘Chionoides’, Thuja occidentalis and Lonicera japonica. Plants were evenly spaced in a 6.1 meter2 plot and were exposed to natural environmental conditions. Treatments were 0.06% lambda-cyhalothrin, 0.03% lambda-cyhalothrin or water as a control. Treatments were applied using a Stihl sr200 mist blower just to the point of runoff, taking care to ensure that both the top and undersides of the leaves were treated. Leaves were sampled from the plants the day after spraying and at the same time each week thereafter for 8 weeks, omitting weeks 5 and 7, to conduct bioassays. A leaf was placed in each bioassay vial and 10 female mosquitoes (between 2-3 days of age) were added. Knockdown was evaluated after a 1-hour exposure, and mortality was evaluated at 24 hours. The effect of plant species on knockdown and mortality were analyzed using 1-way ANOVA followed by Tukey’s HSD. T-tests were used to analyze the effect of concentration on total mean knockdown and total mean mortality. All statistical analyses were carried out using JMP Pro 11.0.0 (SAS, 2013) at a significance level of α = 0.05.

Barrier Applications in a Residential Setting In a residential setting in Lexington, KY, a randomized complete block design was used to compare lambda-cyhalothrin alone and lambda-cyhalothrin combined with pyriproxyfen as a tank mix. One suburban residence in each of five neighborhoods (the blocking factor) were randomly assigned one of the two treatments or a water-only control. Insecticides were applied at 0.06% lambda-cyhalothrin and 0.1% pyriproxyfen. Treatments were applied with a Stihl sr450 mist blower, directed to perimeter vegetation shorter than 2 meters. Mosquito populations were sampled using CO2 traps, gravid traps, human landing rates, and ovitraps. Sampling was conducted weekly for 3 weeks pre-treatment and 8 weeks post-treatment when treatment effects had dissipated. Data were analyzed with Proc Mixed by ANOVA repeated measures and means were separated by Tukey’s Least Square Means test (SAS Institute 2001). RESULTS AND DISCUSSION Residual Performance on Landscape Vegetation The total mean knockdown of mosquitoes after a 1-hour exposure was significantly higher for the 0.06% lambda-cyhalothrin application rate than for the 0.03% lambda-cyhalothrin rate (76.3% vs. 43.3%) (t-test, P<0.01). Regardless of application rate, plant species did not have a significant effect on knockdown (Table 1). Evaluation Of Mosquito Barrier Applications Using Lambda-Cyhalothrin And Pyriproxyfen 229

Table 1. Mean percent knockdown (SE) of Aedes albopictus 1 h after exposure to leaves treated with different concentrations of lambda-cyhalothrin.

Concentration (%)

Plant 0.03 0.06 Miscanthus sinensis 49.5 (0.08) 90.0 (2.7) Rhododendron X ‘Chionoides’ 45.7 (8.2) 83.8 (4.4) Thuja occidentalis 40.4 (9.8) 69.0 (8.6) Buxus spp. 44.8 (9.7) 69.0 (7.7) Lonicera japonica 36.7 (8.4) 69.5 (8.9) Mean 43.4 (0.04) 76.3 (0.03)

Mean percent mortality after a 24-hour exposure was affected by both application rate and plant species (Table 2). Mortality was higher for the 0.06% application rate than for the 0.03% rate (93.4% vs. 79.5%) (t-test, P<0.01). Mortality was highest on M. sinensis, Rhododendron, and T. occidentalis and lowest on L. japonica regardless of application rate (Table 2).

Table 2. Mean percent mortality (SE) of Aedes albopictus after 24-hour exposure to leaves treated with different concentrations of lambda-cyhalothrin.

Concentration (%)

Plant 0.03 0.06 Miscanthus sinensis 94.3 (1.8) a 99.5 (0.5) a Rhododendron X ‘Chionoides’ 86.7 (3.5) a,b 95.2 (2.3) a,b Thuja occidentalis 84.8 (3.4) a,b 94.8 (1.8) a,b Buxus spp. 72.9 (5.4) b,c 92.9 (2.9) a,b Lonicera japonica 59.0 (9.0) c 84.8 (5.6) b Mean 79.5 (0.03) 93.4 (0.01)

Means within each column followed by the same letter are not significantly different. Tukeys HSD test (P > 0.05).

230 N. T. Gallagher, E. Roper, C. T. Keefer, M. Coffelt, and C. W. Scherer Evaluation Of Mosquito Barrier Applications Using Lambda-Cyhalothrin And Pyriproxyfen

Table 3. Total mosquitoes captured by treatment throughout the entire season post-treatment (7/8/2014 – 9/10/2014).

Treatment and Concentration (%) Post-Treatment Trap Totals lambda-cyhalothrin lambda-cyhalothrin Water (0.06) (0.06) and pyriproxyfen (0.1)

CO2 Trap 102 68 763

Gravid Trap 133 96 489

Human Landing Rate 59 84 224 Ovitrap 89 35 1,788 NOTE: Both insecticide treatments significantly P( < 0.05) reduced mosquitoes relative to control, but there were no statistical differences between the two treatments except for ovit- rap counts

Barrier Applications in a Residential Setting Both lambda-cyhalothrin and lambda-cyhalothrin combined with pyriproxyfen effectively reduced overall mosquito numbers during the 8 week post-treatment evaluation (Table 3). With respect to effect on individual species, Aedes/Ochlerotatus spp. were reduced the most and were effectively reduced by both treatments (Table 4). Except for the reduction in larvae collected from ovitraps (P<0.05), there were no significant differences between lambda-cyhalothrin and lambda-cyhalothrin combined with pyriproxyfen (Table 3). However, there was a consistent pattern of lambda-cyhalothrin combined with pyriproxyfen producing a lower mosquito population than did lambda-cyhalothrin alone (Table 3).

Table 4. Percentage reduction of mosquito species relative to control throughout the entire season post-treatment (7/8/2014 – 9/10/2014).

Treatment and Concentration (%) Species lambda-cyhalothrin (0.06) lambda-cyhalothrin (0.06) and pyriproxyfen (0.1)

Aedes albopictus 87 78 Culex pipiens 34 61 Aedes vexans 72 79 Anopheles spp. 16 44 NOTE: Both insecticide treatments significantly P( < 0.05) reduced mosquitoes relative to control, but there were no statistical differences between the two treatments

Evaluation Of Mosquito Barrier Applications Using Lambda-Cyhalothrin And Pyriproxyfen 231

CONCLUSIONS In conclusion, these studies show that lambda-cyhalothrin is an effective insecticide for use as barrier sprays against nuisance mosquitoes such as Ae. albopictus. Plant species does not seem to have a major effect on efficacy, although care should be taken to ensure that the product is evenly applied to all surfaces of the leaves. Pyriproxyfen does not cause immediate mortality or impair adult activity (Kawada et al. 1993), but it is effective on immature mosquitoes at extraordinarily low concentrations

(LC50 in Ae. albopictus 0.012 ppb and Ae. aegypti is 0.023 ppb) (Gaugler et al. 2012). Results from this trial are encouraging in that pyriproxyfen, when used in combination with lambda-cyhalothrin, may further reduce mosquito populations and be used as an effective component of barrier applications. Ae. albopictus control is challenging, but residual insecticide applications to vegetation can provide long lasting suppression against nuisance mosquitoes and can be incorporated as part of an integrated mosquito management program. ACKNOWLEDGEMENTS The authors acknowledge the following institutions for their assistance and work in the mosquito control research lab and field trials during 2014-2015: Department of Entomology, Virginia Polytechnic Institute and State University and Department of Entomology, The University of Kentucky.

REFERENCES CITED Amoo, A., R.-D. Xue, W. Qualls, B. Quinn, and U. Bernier. 2008. Residual efficacy of field-applied permethrin, d-phenothrin, and resmethrin on plant foliage against adult mosquitoes. J Am Mosq Control Assoc 24: 543-549. Barker, C.M., C.C. Brewster and S.L. Paulson. 2004. Spatiotemporal oviposition and habitat preferences of Ochlerotatus triseriatus and Aedes albopictus in an emerging focus of La Crosse virus. J Am Mosq Control Assoc. 19: 382-391. Benedict, M. Q., R. S. Levine, W. A. Hawley, and L. P. Lounibos. 2007. Spread of the tiger: global risk of invasion by the mosquito Aedes albopictus. Vector-Borne and Zoonotic Diseases 7: 76- 85. Bonizzoni, M., G. Gasperi, X. Chen, and A. A. James. 2013. The invasive mosquito species Aedes albopictus: current knowledge and future perspectives. Trends Parasitol 29: 460- 468. Doyle, M. A., D. L. Kline, S. A. Allan, and P. E. Kaufman. 2009. Efficacy of residual bifenthrin applied to landscape vegetation against Aedes albopictus. . J Am Mosq Control Assoc 25: 179- 183. Farajollahi, A., and M. P. Nelder. 2009. Changes in Aedes albopictus (Diptera: Culicidae) populations in New Jersey and implications for arbovirus transmission. J Med Entomol 46: 1220-1224. Gaugler, R., D. Suman, and Y. Wang. 2012. An autodissemination station for the transfer of an insect growth regulator to mosquito oviposition sites. Med. Vet. Entomol. 26: 37-45. Kawada, H., Y. Shono, T. Ito, and Y. Abe. 1993. Laboratory evaluation of insect growth regulators against several species of anopheline mosquitoes. Jap. J. Sanit. Zool. 44: 349- 349. SAS (2013) JMP version 11.0.0. SAS Institute, Cary, NC. Trout, R., G. Brown, M. Potter, and J. Hubbard. 2007. Efficacy of two pyrethroid insecticides  applied as barrier treatments for managing mosquito (Diptera: Culicidae) populations in suburban residential properties. J Med Entomol 44: 470-477.

233

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

LABORATORY STUDY OF PERSISTENCE AND RESIDUAL ACTIVITY OF PYRETHROID AGAINST ANOPHELES STEPHENSI AND AEDES AEGYPTI (DIPTERA: CULICIDAE) IN PAKISTAN

FARKHANDA MANZOOR, UROOJ SHAHID, AND MADIHA SANA Department of Zoology, Lahore College For Women University, Lahore, Pakistan

Abstract Present study was carried out to test the residual activity of deltamethrin EC 1.5%, K-Othrine EC 1.5% and deltamethrin WP 5% under laboratory conditions on five different surfaces i.e. cement (concrete), mud, plaster, wood and filter paper. Four blocks were prepared for each surface, from which one block was not treated with insecticide to serve as control. The surfaces were attached to the wall and deltamethrin EC 1.5% , K-Othrine EC 1.5% and deltamethrin WP 5% were sprayed using standard Hudson pump. The bioassay test was carried out for evaluation of residual effect of insecticides using WHO standard cones. Result of bioassay test on aedes aegypti showed that deltamethrin 1.5% EC had best residual capacity on filter paper indicating 60.90% mortality and for Anopheles stephensi plaster surface had best residual effect showing 77.75% mortality after 2 months of Indoor Residual Spraying (IRS) application. For K-Othrine, filter paper had best residual capacity for both mosquito species. Deltamethrin WP 5% depicted different residual effects on different surfaces showing 58.33% mortality on filter paper against An. stephensi and Ae.aegypti showed 65.72% mortality on mud after 2 months of IRS application. The study also highlights proper knowledge of IRS and its management according to building material that may lead to best strategy, which might reduce vector population up to the desired level.

Key words Deltamethrin, K-Othrine, WP Deltamethrin, concrete, mud, plaster, Ae aegypti, An stephensi,

INTRODUCTION Malarial vector mosquito Anopheles transmits malarial pathogen from one host to another by its bite. Globally, there are almost 380 known species of Anopheles. In Pakistan, among 24 reported species An. culicifacies and An. stephensi are two major malaria vectors (Druilhe et al., 2008). Dengue is primarily an urban disease of the tropics, and the viruses that cause it are maintained in a cycle that involves humans. Ae. aegypti, a domestic, day-biting mosquito prefers to feed on human blood. Indoor Residual Spraying (IRS) is one of very good and efficient method for the control of different species of vector mosquitoes. The effectiveness and efficiency of this process depends on the application method, resistance of vector, killing ability of insecticide, properly maintained equipment, sufficient training of persons and good financial resources (Rasheed et al., 2012). Pyrethroids are the most common insecticides being used for adult mosquito control. This is due to their short persistence in the environment (Antonious et al., 1997). Present study was conducted to determine the residual effect of different insecticides against Anopheles and Aedes mosquitoes. The information generated will ensure the pattern of insecticide use for vector control. Data will also be helpful in future insecticide resistance management strategies targeted against malaria vectors in these regions (Tikkar et al., 2011). 234 F. Manzoor, U. Shahid, and M. Sana Laboratory Study Of Persistence And Residual Activity Of Pyrethroid

MATERIALS AND METHODS Immature Ae. aegypti larvae were collected from breeding sites such as water storage tanks, fountains, pipe leakages, whereas An. stephensi larvae were collected mainly from muddy water, from ponds, stagnant water channel and rainwater collections also from artificial containers such as discarded jars, tyres, plastic tubs found in Misri Shah (slum area) in North of Lahore. All the collections were conducted between 17:00-18:30 pm from November 2015- January 2016. Deltamethrin EC 1.5% , K-Othrine EC1.5%, Deltamethrin WP 5% were sprayed by Hudson® X-Pert compression sprayer recommended by WHO for IRS at the rate of 755– 780 ml/min. The duration for spray was set for 30 minutes. The dried blocks were fixed on to the vertical surfaces of the wall. After spraying, all the blocks were collected and stored in the box for further bioassay tests. Five surfaces i.e. cement (concrete), mud, plaster, wood and filter paper were prepared in pans. The blocks were allowed to dry under laboratory conditions. All prepared samples were stored in wooden blocks in laboratory. Four blocks were prepared for each surface containing one cone on each tray, from which one block was untreated to serve as control. Three replicates of each treated surface were carried out. The filter paper (Whatman No.1) was attached to the sprayed surfaces normally and then removed and packed inside the kit for bioassay tests. At least 12–15 sugar fed active female mosquitoes were aspirated from a mosquito cage into each cone through the hole at the vertical position. Once the mosquitoes have been transferred, the slide unit was closed and the cones were set in an upright position for one hour. At the end of this time, any damaged insects were removed. Mosquitoes were kept in the exposure cone, which were set in a vertical position, for a period of 30 minutes. At the end of the 30 minutes exposure period, the mosquitoes were transferred to the clean cup. Mosquitoes were maintained in the cones for 24 hours (the recovery period). During this time, it was important to keep the cones in a shady, sheltered place free from extremes of temperature (an insectary is ideal). Temperature and humidity were also recorded during the recovery period. At the end of recovery period (i.e. 24 hours post-exposure), the number of dead mosquitoes was counted and recorded. An adult mosquito was considered to be alive if it is able to fly, regardless of the number of legs remaining. Any knocked-down mosquitoes, whether or not they have lost legs or wings, were considered moribund and are counted as dead. Contact bioassay tests were carried out on day 1, 5, 15, 30, 45, and 60 after applications. Relative humidity and temperature of the laboratory were recorded during the bioassay experiments that were 75% and 270 C, respectively (WHO, 2010). Three replicates of the experiment were calculated for % mortality in treated and control cones. Percentage mortality was recorded after 24-hours recovery period on the standard form. Data were analyzed statistically for Mean, Standard deviations.

RESULTS Table 1 shows the results of bioassay tests on Ae. aegypti and An. stephensi. For deltamethrin EC 1.5%, the best residual capacity is for filter paper after 60 days exposure showing 59.90% mortality followed by cement (concrete), mud and plaster with % mortality 52%, 49% and 45% against Ae. aegypti. Results of present study indicate that different insecticides have different results on different surfaces. K-Othrine is more effective on filter paper surface ofAn. stephensi and Ae. aegypti as compared to other surfaces and insecticides. The results of laboratory trials also revealed that deltamethrin WP 5% was more effective against Ae. aegypti as compared to An. stephensi on filter paper, plaster and mud surface. There was no significant difference between mortalities after first and second week after application (p >0.05). There was also a significant difference between mortality after two months. Laboratory Study Of Persistence And Residual Activity Of Pyrethroid 235

DISCUSSION Pyrethroid resistance is very common in Anopheles and Aedes mosquitoes throughout the world. Rozilawati et al. (2005) studied residual effect of deltamethrin against the Aedes and found it effective up to almost 6 weeks. The study also showed that both An. stephensi and Ae. aegypti were more susceptible on cement (concrete) than wood. Etang et al. (2011) evaluated the efficacy of three different insecticides formulations on different surfaces. According to their study, it is very important to study the residual effects of insecticides. Results of present study indicate that there is variation in residual effects on different surfaces. K-Othrines is more effective on filter paper surface of An. stephensi and Ae. aegypti as compared to other surfaces and insecticides. The results of laboratory trials also indicate that deltamethrin was more effective against Ae. aegypti mosquitoes as compared to An. stephensi on filter paper surface instead of other surfaces like plaster, wood, cement (concrete) and mud surface. Deltamethrin (WP) was more effective on filter paper against Ae. aegypti and on plaster surface of An. stephensi. Among all these surfaces cement and wood have least performance. It was concluded that surfaces of filter paper and plaster are best in effectiveness against K-Othrin materials the residual effect according to building material should be kept in mind to effectively control disease vector population. The results of our study are also in accordance with previous investigations by different scientists. Rozilawati et al. (2005) studied residual effect of deltamethrin against the Aedes and found it effective up to almost 6 weeks.

Table1. Results of % mortality on different surfaces with deltamethrin EC 1.5%, K-Othrine EC 1.5% and deltamethrin WP 5% under laboratory conditions against Ae. aegypti and An. stephensi

Aedes aegypti Anopheles

Plaster Mud Cement Wood Filter Plaster Mud Cement Wood Filter Days paper paper 1 94.41 77.75 88.51 74.29 91.18 83.33 73.54 59.72 68.55 74.29

±3.10 ±6.30 ± 6.24 ±5.80 ±3.8 ±5.47 ±5.50 ±7.22 ±6.90 ±7.55 5 91.67 70.54 79.95 77.12 79.95 80.5 72.16 62.81 68.83 73.54

±3.94 ±6.75 ± 5.93 ±6.00 ±5.99 ±6.1 ±4.98 ±6.66 ±6.65 ±5.54 15 85.69 65.72 63.83 71.37 86.08 71.37 62.81 69.41 51.41 80.5 Deltamethrin ±6.64 ±7.50 ± 7.01 ±6.8 ±6.2 ±6.8 ±6.66 ±7.4 ±7.15 ±5.40 30 63.83 58.81 64.72 58.33 70.54 66.66 52.75 58.81 48.45 70.54

±6.86 ±7.10 ±7.68 ±6.22 ±5.8 ±9.00 ±7.41 ±7.10 ±6.65 ±6.00 45 54.54 65.72 55.45 55.5 69.42 60.54 61.72 58.33 47.17 61.08

±6.22 ±7.50 ±6.10 ±6.80 ±6.75 ±7.20 ±7.22 ±7.00 ±6.52 ±7.22 60 45.5 49.58 52.5 47.17 59.98 77.75 42.84 42.36 47.17 51.41

±6.00 ±6.60 ±5.65 ±4.90 ±7.22 ±6.31 ±5.55 ±5.59 ±5.85 ±6.13 236 F. Manzoor, U. Shahid, and M. Sana Laboratory Study Of Persistence And Residual Activity Of Pyrethroid

Aedes aegypti Anopheles

Plaster Mud Cement Wood Filter Plaster Mud Cement Wood Filter Days paper paper 1 97.17 77.75 85.68 77.12 91.18 86.08 67.63 74.29 79.94 97.08

±1.80 ±6.31 ±50.64 ±6.31 ±4.46 ±5.7 ±8.88 ±5.91 ±6.65 ±2.38 5 88.83 70.54 79.94 68.55 79.94 88.83 66.66 65.72 66,66 91.18

±4.89 ±6.75 ±6.1 ±7.5 ±4.33 ±1.32 ±7.68 ±7.68 ±9.00 ±4.46 15 82.86 62.81 75 71.37 83.33 91.43 71.37 61.08 48.58 86.08

±5.76 ±6.66 ±7.89 ±6.8 ±5.47 ±4.46 ±6.8 ±6.66 ±6.41 ±4.1 30 75 47.08 64.72 47.17 82.36 77.75 63.83 67.63 51.45 76.45 K-Othrine ±5.89 ±5.12 ±7.68 ±6.87 ±5.76 ±4.10 ±6.20 ±8.75 ±7.41 ±5.89 45 66.63 57.15 51.45 63.83 61.08 63.63 55.90 52.75 47.16 69.41

±9 ±7.10 ±6.60 ±6.88 ±7.22 ±6.46 ±6.21 ±7.52 ±6.62 ±7.4 60 58.33 48.58 47.17 50 59.98 58.33 55.5 52.75 47.16 63.83

±5.88 ±6.48 ±6.59 ±6.62 ±5.22 ±7.00 ±6.21 ±5.65 ±6.65 ±6.64 1 91 80.5 82.86 79.94 91.18 88.83 79.36 88.51 74.29 91.43

±2.90 ±5.93 ±5.50 ±6.88 ±3.88 ±6.24 ±5.93 ±6.24 ±5.91 ±3.26 5 83 76.45 77.12 74.29 94.25 94.41 75 74.29 77.75 88.18

±5.64 ±4.00 ±4.10 ±5.91 ±3.13 ±3.13 ±5.85 ±5.90 ±4.00 ±4.5 15 77.12 65.72 72.16 62.81 83.33 82.86 68.55 58.33 59.98 66.66

±6.31 ±7.68 ±6.10 ±6.66 ±5.51 ±5.76 ±7.50 ±7.89 ±7.45 ±6.99 30 72.16 52.91 61.75 69.41 73.54 72.16 52.75 61.72 63.63 82.36

±5.89 ±7.52 ±6.46 ±7.40 ±5.10 ±6.52 ±6.89 ±6.40 ±6.80 ±5.76 45 57.54 52.91 54.54 61.08 66.66 63.63 58.81 69.41 55.5 63.83 5% WP Deltamethrin 5% WP ±6.52 ±7.52 ±7.89 ±6.30 ±7.80 ±6.70 ±6.69 ±7.5 ±6.21 ±7.68 60 55.5 65.72 50 41.66 54.24 58.33 50 57.54 50± 54.24

±6.89 ±6.50 ±7.88 ±8.02 ±6.85 ±5.85 ±7.45 ±6.52 7.41 ±6.86 60 55.5 65.72 50 41.66 54.24 58.33 50 57.54 50± 54.24

±6.89 ±6.50 ±7.88 ±8.02 ±6.85 ±5.85 ±7.45 ±6.52 7.41 ±6.86

The study also showed that both An. stephensi and Ae. aegypti were more susceptible on cement (concrete) than wood. Etang et al. (2011) evaluated the efficacy of three different insecticides formulations on different surfaces. According to their study the insecticides was more effective on mud surface. Mohammad et al. (2011) also studied the effectiveness of deltamethrin and evaluated the relationship between residual activity and persistence of it on different surfaces to control the malarial vectors. Deltamethrin showed its knockdown up to 120 days after its application on the walls used in the experiment against Ae. aegypti. Among all other tested surfaces, mud surface showed least performance. The whole study gave us fruitful findings that if we use insecticide for IRS on different building. Laboratory Study Of Persistence And Residual Activity Of Pyrethroid 237

REFERENCES CITED Antonious, G. F., M. E. Byers, and W. C. Kerst. 1997. Residue levels of pyrethrins and piperonyl butoxide in soil and runoff water. Journal of Environmental Sciences and Health 32: 621–644. Druilhe, P., P. Daubersies, J. Patarapotikul, C. Gentil, L. Chene, and T. Chongsuphajaisiddhi. 1998. A primary malarial infection is composed of a very wide range of genetically diverse but related parasites. Journal of Clinical Investigation 101(9): 2008-2016. Etang, J., P. Nwane, J, A. Mbida, M. Piameu, B. Manga, and D. Souop. 2011 .Variations of insecticide residual bio-efficacy on different types of walls: results from a community-based trial in south Cameroon. Malarial Journal 10(333):10.1186/1475-2875-10-333. Mohammad, A., S. Mansoreh, K. Mehdi, V. Hasan, and A. M. Reza. 2011. Persistence and residue activity of deltamethrin on indoor residual spraying surfaces against malaria vectors in southeastern Iran. Asian Pacific Journal of Tropical Biomedicine 1(2): S271-S275. Rasheed, S., R. Butlin, and M. Boots. 2012. A review of dengue as an emerging disease in Pakistan. Public Health 127(1); 11-17. Rozilawati, H., H. Lee, S. M. Masri, M. Noor, and S. Rosman. 2005. Field bioefficacy of deltamethrin residual spraying against dengue vectors. Tropical Biomedicine 22(2):143-148. Tikar, S. N., M. J. Mendkib, A. K. Sharmac, D. Sukumarand, V. Veere, S. Prakashf, and B. D. Parashar. 2011. Resistance status of the malaria vector mosquitoes, Anopheles stephensi and Anopheles subpictus towards adulticides and larvicides in arid and semi-arid areas of India. Journal of Insect Science 11(1): 85-90. Vatandoost, H., and A. A. Hanafi-Bojd. 2012. Indication of pyrethroid resistance in the main malaria vector Anopheles stephensi from Iran. Asian Pacific Journal of Tropical Medicine 5(9):722- 726. WHO 2010. World Malaria Report. World Health Organization, Geneva, Switzerland. http://www. who.int/malaria/world_malaria_report_2010/en/ 239

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

EFFICACY OF A POLYDIMETHYLSILOXANE FORMULATION AGAINST URBAN MOSQUITO PESTS IN THE UK

JOHN SIMMONS Acheta Consulting Ltd, Front Street, Churchill, Winscombe, North Somerset, UK, BS25 5NB

Abstract The silicon-based, monomolecular film, mosquito control product Aquatain was introduced into an on-going programme to control Culex pipiens molestus, in a partially flooded undercroft, in September 2015. The impact on the control programme is reviewed in this study. Application of Aquatain was far simpler than was the case for the larvicidal insecticide used previously, and it is considered that the introduction of this product had a significant positive impact on the effectiveness of the control programme. It is believed that this is the first occasion when such a benefit has been observed in the subterranean habitat typically inhabited byC. p. molestus.

Key words Aquatain AMF, mono-molecular film,Culex pipiens molestus, subterranean, Bti

INTRODUCTION In August 2013, the pest management consultancy Acheta Consulting Ltd was approached by a food manufacturing site in East London. The site had a long-standing problem with mosquitoes, with large numbers of staff reporting significant mosquito nuisance, with large numbers of people being bitten, often very severely. The problem was causing significant industrial relations concerns. The building is built on stilts, above reclaimed land, and the mosquito population was said to be emanating from a large undercroft, which extends, largely at surface level, throughout the footprint of the building. Drainage leaks from the production areas above, and a varying water table, were creating numerous pools of water, of widely varying size and depth. The undercroft is classed as a confined space, and specialist training is required before access is permitted. Access is extremely challenging, and involves a team of at least three people, equipped with gas detection and escape breathing apparatus. A pest control contractor had been engaged for several years, to carry out mosquito control works. Access for this work was provided in conjunction with a drainage maintenance company who enter the undercroft on a frequent basis. Our initial investigation highlighted that there were large numbers of mosquitoes present in areas above the undercroft, and our initial survey (done without entering the undercroft) suggested that these were emanating from the undercroft, as mosquitoes could be seen clustering in large numbers where there was a direct access point between the undercroft and areas above (Figure 1). The control programme had involved the use of the larvicide Vectobac (Bacillus thuringiensis israelensis) and, for surface treatment, a synthetic pyrethroid insecticide. The contractor’s control programme did not extend throughout the undercroft, focusing only on one area where access was relatively easy. Additionally, there was no monitoring programme, of any description, in place. Culex pipiens molestus (C. p. molestus) has been found in subterranean locations around the world. It has been suggested that it has only relatively recently adapted to man-made underground systems from local above-ground populations of C. pipiens, but more recent evidence suggests it is a southern mosquito variety related to C. pipiens that has adapted to the warm underground spaces of 240 J. Simmons Efficacy Of A Polydimethylsiloxane Formulation Against Urban Mosquito Pests northern cities (Fonseca et al., 2004). C. p. molestus breeds all-year round, is cold intolerant, and bites rats, mice, and humans, in contrast to the above-ground species, which is cold tolerant, hibernates in the winter, and is considered to feed primarily on bird hosts. The two species are commonly referred to as Culex pipiens pipiens, and Culex pipiens molestus.

Figure 1. A drain connection between the undercroft and a production area. Drain was dry and contained large numbers of adult mosquitoes.

Although no formal identification was done of the species encountered in this study, beyondC. pipiens status, the behavioural and environmental preference characteristics would strongly suggest that it was the molestus form that was the dominant species present in the undercroft.

Mono-Molecular Films For Mosquito Control Most mosquito control products target either the waterborne or aerial stages of the lifecycle; larvicides and adulticides respectively. Monomolecular layers differ from such agents as they target multiple stages in the mosquito life cycle, with all stages that contact the water surface (eggs, larvae, pupae, emerging adults, and ovipositing females) being affected by the lowered surface tension caused by such layers. The product Aquatain™ is a polydimethylsiloxane (PDMS, 80%) based liquid that was developed as an anti-evaporation product, to prevent water loss from large water storage basins. It can cover large areas containing vegetation, and is resilient to wind and rain. It is also reported to have no adverse effect on water quality and has been certified for use on drinking water in the USA. It’s positive impact in mosquito control programmes has been the subject of several studies in a variety of situations; in a laboratory setting (Bukhari and Knols, 2009) in rice paddies (Bukhari et al., 2011), in laboratory and field-test situations (Mbare et al., 2014), and in backyard container-type habitats (Webb and Russell, 2012). It is not known whether any trials concerning the efficacy of any monomolecular film product have taken place in the flooded subterranean habitats that are favoured byC. p. molestus.

MATERIALS AND METHODS Monitoring Programme A formal monitoring programme commenced in April 2014. The undercroft was divided into monitoring zones, bordered by the supporting walls for the building above (Figure 2). Double-sided yellow drystick glueboards (20 x 40 cm) were installed at permanent locations. With some exceptions (due to staff availability) these were serviced on a weekly basis between April and October/ November (inclusive), and fortnightly for the remainder of the year. Service involved removal and replacement of the board by the drainage company employees, with insect count and analysis provided by Acheta personnel. Monitoring Zones 6 and 7 were a later addition (April 2015) to the monitoring programme. Although these zones were known to the drainage company, they had not been highlighted to Acheta personnel. They are the most challenging locations to access. In addition to analysing catches of mosquitoes on the glue-boards, qualitative (high, medium or low) data was collected concerning the presence of larvae, pupae and egg-rafts in and around Efficacy Of A Polydimethylsiloxane Formulation Against Urban Mosquito Pests 241 water bodies near each of the monitoring locations. Air temperature at each monitoring location, and approximate water depth, was also measured.

Figure 2. Site plan of the undercroft showing the 7 monitoring zones and locations of the glue-boards.

Control Programme Prior to the availability of the PDMS film the control programme consisted of: 1) Aquapy; natural pyrethrins, used for surface treatment of fly alighting surfaces using a 5 litre compression sprayer, or space treatment using an electrically operated fogger. The latter technique could only be done from outside due to the potentially explosive atmosphere within the undercroft.; 2) Ficam W; bendiocarb containing wettable-powder insecticide, applied using a 5-litre compression sprayer. Used for treatment of the building structure within the undercroft.; 3) Dobol Fumigators; water-activated smoke generators, containing cyphenothrin, for treatment of the undercroft airspace, and exposed surfaces; 4) Vectobac; a mosquito larvicide containing Bacillus thuringiensis var israelensis (Bti), for treatment of standing water within the undercroft, applied using either a 5-litre compression sprayer, or 10-litre knapsack sprayer. The PDMS product was gradually phased into the control programme between 7 September and 26 October 2015. There was no use of Vectobac after October 2015, and adulticide treatment since that time has been limited to sporadic use of Dobol Fumigators. The PDMS film is applied by simply adding the required amount to the water body, as determined by an estimate of the size of the area to be treated.

RESULTS AND DISCUSSION The percentage breakdown of adult mosquitoes caught on glue-boards in zones 1 to 7, during 2015 and 2016, is shown in Figure 3. Zones 3 and 6 returned a large proportion of the catch in both years, with zone 2 decreasing in importance, and zone 4 increasing in importance during the monitoring period. The importance of Zone 6 should be noted, due to its late introduction to the monitoring programme. The mean air temperature within the undercroft during 2015 and 2016 is shown in Figure 4. The temperature followed the expected seasonal trend, though temperatures during 2016 were, for much of the year, slightly cooler than those recorded during 2015. Importantly, temperatures remained within the zone where C. p. molestus will continue to breed, for the duration of both years. Figures 5a and 5b display the relationship between the total mosquito catches in 2015 and 2016, and the mean water depth in the undercroft during those years. There is no clear relationship, suggesting that water depth was not the primary factor regulating the mosquito population. However, it must be pointed out that pumping works were instigated during 2016, for the express purpose of aiding 242 J. Simmons Efficacy Of A Polydimethylsiloxane Formulation Against Urban Mosquito Pests the mosquito control programme. As a direct result of this, water levels during 2016 were consistently lower than during 2015. This certainly had the potential to reduce the availability of breeding areas for mosquitoes throughout the undercroft.

Figure 3. Percentage breakdown of mosquito catch by zone during 2015 (April to December) and

Figure 3. Percentage2016 (full breakdown year) of mosquito catch by zone during 2015 (April to December) and 2016 (full year) Figure 3. Percentage breakdown of mosquito catch by zone during 2015 (April to December) and

2016 (full year)

Figure 4. Mean air temperature (oC) within the undercroft 2015 - 2016.

Efficacy Of A Polydimethylsiloxane Formulation Against Urban Mosquito Pests 243

The total adult mosquito counts, aggregated for all monitoring zones, for the three years of the trial, are shown in Figure 6. It should be remembered that Zones 6 and 7 (Zone 6 being an important breeding ground for mosquitoes) were added to the monitoring programme during April 2015. This in part accounts for the height of the peak noted in May of that year. The switch from Bti to the PDMS film for treatment of standing water occurred during September and October 2015. This introduction was followed by a rapid decline in mosquito numbers, albeit at a time of year when the population would be expected to decline naturally anyway. However, the increase in the mosquito population that might have been expected to appear in the spring of 2016 did not appear, with adult mosquito numbers remaining low throughout the whole of that year. Figure 4. Mean air temperature within the undercroft during 2015 and 2016

Figures 5a and 5b. Relationship between total mosquito catch and mean water depth (cm) within the undercroft during 2015 and 2016.

244 J. Simmons Figures 5 and 6. Relationship between total mosquito catch and mean water depth within the

undercroft during 2015 and 2016.

Figure 7. Total mosquito counts recorded in all monitoring zones. Figure 6. Total mosquito counts recorded in all monitoring zones.

CONCLUSION Introduction of a PDMS monomolecular film product resulted in a significant, and sustained, fall in the mosquito population. It is believed that this is the first time this product has been demonstrated to have such an effect in the control of C. p. molestus in a flooded subterranean environment. The environment involved in this study is extremely challenging from both an access and health and safety viewpoint, and the simplicity of application of the PDMS film is considered to have considerably enhanced the safety and efficacy of the treatment programme.

REFERENCES CITED Bukhari, T. and B.G.J. Knols. 2009 Efficacy of Aquatain™, a Monomolecular Surface Film, against the Malaria Vectors Anopheles stephensi and An. gambiae s.s. in the Laboratory. Am. J. Trop. Med. Hyg. 80(5): 758-763. Bukhari, T., W. Takken, A.K. Githeko, and C.J.M. Koenraadt. 2011. Efficacy of Aquatain, a Monomolecular Film, for the Control of Malaria Vectors in Rice Paddies. PLoS One. 6(6): e21713. Fonseca, D.M., N. Keyghobadi, C.A. Malcolm, C. Mehmet, F. Schaffner, M. Mogi, R.C. Fleischer, and R.C. Wilkerson. 2004. Emerging vectors in the Culex pipiens complex. Science. 303 (5663): 1535–1538. Mbare, O., S.W. Lindsay, and U. Fillinger. 2014. Aquatain® Mosquito Formulation (AMF) for the control of immature Anopheles gambiae sensu stricto and Anopheles arabiensis: dose- responses, persistence and sub-lethal effects. Parasites and Vectors 7: 438. Webb, C.E. and R.C. Russell. 2012. Does the monomolecular film aquatain mosquito formula provide effective control of container-breeding mosquitoes in Australia? J. Am. Mosq. Control Assoc. 28(1): 53-58. 245

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

FLAVESONE: A NOVEL INSECTICIDE FOR THE CONTROL OF URBAN PESTS

PETER MILLER AND BRYCE PETERS Faculty of Science, University of Technology, Sydney. 123 Broadway, NSW, Australia

Abstract Flavocide® is based on a beta-triketone molecule, flavesone, that is produced by synthetic chemical means. Flavesone exists in nature in a number of plant species but at low abundance. Initial testing suggests a unique mode of action with potential in addressing the increasing problem of resistance to existing classes of insecticides. Flavesone has been initially formulated as an emulsion-in-water (EW) for use in a range of agricultural and public health applications. It is this formulation that was used in urban pest studies. Flavesone was effective as a direct spray in small chamber studies against Aedes aegypti, Culex quinquefasciatus and Musca domestica. Flavesone also demonstrated residual contact activity against these insects and Ctenocephalides felis. Other groups have also shown that flavesone demonstrated residual contact activity againstAnopheles sp.. Flavesone is a novel insecticide, which has the potential to be useful in the management of insecticide resistant urban pest populations.

Key words Aedes aegypti, Culex quinquefasciatus, Musca domestica, flavesone.

INTRODUCTION Bio-Gene Technology Ltd is an Australian company engaged in the development of naturally derived and synthetically produced insecticides. Bio-Gene holds patents covering the use of β-triketones for control of a range of pest groups including insects, arachnids, helminths, molluscs, protozoa and viruses. Flavesone is one of a number of β-triketone compounds that have shown insecticidal activity and expressed what appears to be a novel mode of action. Flavocide® is a commercial formulation of flavesone developed by Bio-Gene Technology Ltd and it is this formulation which is used inthese studies. Flavesone has been initially formulated as an emulsion-in-water (EW) for use in a range of agricultural and public health applications. This formulation is compared to a pyrethroid, permethrin. Pyrethroids are used widely for the control of mosquitoes, flies and other urban pests. Resistance to pyrethroids has become an increasing problem in mosquitoes (Liu et al., 2014) and House fly (Liu and Xue, 2014) as well as a wide range of other pests. This resistance can have wider implications than simply resistance to pyrethroids because of the development of cross resistance to other insecticide groups (Zaim and Guillet, 2002). There is now an urgent need for alternative insecticides to manage resistant strains of insects, particularly those that are disease vectors. Zhu et al. (2016) concluded that biopesticides have varied mechanisms of activity that could contribute additional defences against the development of insecticide resistance. The aim of these studies is to investigate the efficacy of flavesone against two species of mosquito, House fly and Cat in the laboratory. In addition a preliminary field study against mosquitoes is reported. 246 P. Miller and B. Peters Flavesone: A Novel Insecticide For The Control Of Urban Pests

MATERIALS AND METHODS Insecticides. The insecticide used in these studies was Flavocide 500EW (Active Constituent: flavesone 500 g/l). This was compared to Permethrin 100EC (Active Constituent: 100 g/l permethrin 25:75). Both insecticides were diluted with water. Flavesone 50 mg/ml and 25 mg/ml, and permethrin 2.5 mg/ml for mosquitoes. Flavesone 200 mg/ml and 100 mg/ml, and permethrin 2.5 mg/ml for flies. Insects. All insects used were laboratory bred susceptible strains. House fly, Musca domestica, mixed sex adults 2-5 day old; Culex quinquefasciatus, female adults 2-5 day old; Aedes aegypti, female adults 2-5 day old. All were supplied by Department of Medical Entomology, ICPMR, Westmead Hospital, Sydney. Ctenocephalides felis, mixed sex adults 1-5 days old and first and second instar larvae supplied by VetX Research, Wongaburra, NSW Small Chamber Studies on Flying Insects. The test chamber consisted of an aluminium frame with glass sides and top. The base of the chamber was constructed from laboratory grade stainless steel. The front of the chamber was hinged to form a door to facilitate cleaning. A small sliding glass door was provided in the front door of the chamber to allow for the introduction of the insects and the spray application. The dimensions of the chamber were 70 cm x 70 cm x 70 cm. Prior to testing, the chamber was cleaned using detergent and water. The chamber was then dried completely. Twenty laboratory cultured insects were introduced into the chamber. A 0.5 litre pump spray was used to spray the insecticide. The nozzle of the pump spray was pointed slightly upwards to aim at the middle of the upper half of the back wall of the chamber. The spray was pumped once to deliver one gram of diluted insecticide. The weight of the spray discharge was recorded. Knockdown was noted at 30 second intervals to 300 seconds, 60 second intervals to 600 seconds, 120 second intervals to 1200 seconds and 300 second intervals up to a maximum period of 2,400 seconds. Insects were considered knocked down when they were incapable of coordinated movement. After 2,400 seconds or after all insects were knocked down the insects were collected and placed in a clean plastic holding container with a 10% sucrose pad, to check for recovery. Mortality was observed at 24 hours post treatment. The above was repeated to give a total of 5 replicates per rate. The control consisted of 20 insects (as above) handled in the same manner as for the active treatment; only water was sprayed into the chamber. Knockdown was noted as above for the active treatments. There were 5 replicates for the control. The study took place in a room with a temperature of 22±2° C. and 50% RH. Residual Contact Studies on Flying Insects. Ae. aegypti - flavesone 12.5 mg/ml and 6.25 mg/ ml and permethrin 0.625 mg/ml; C. quinquefasciatus - flavesone 50 mg/ml and 25 mg/ml and permethrin 2.5 mg/ml; M. domestica - flavesone 200 mg/ml and 100 mg/ml and permethrin 2.5 mg/ml. Insecticide treatments were applied to the glazed tiles from a distance of 20 cm. The substrate was placed on a 0.5 m2 grid and the entire 0.5 m2 area, including the plate, was sprayed using a handheld pump sprayer. The spray rate was 50 ml/m2. The pump spray was weighed to check that the correct spray weight was applied. The plates were left for 2 hours post-treatment to allow the plates to dry prior to the start of the exposure period. A plastic petri dish, perforated with small holes for ventilation, and one larger hole for introduction of insects was place on a treated glazed tile. Ten insects were placed into the plastic petri dish using a powered aspirator. A cotton wool plug soaked in sugar solution was used to plug the hole and provide moisture. The 10 insects were constantly exposed to the treated surface for thirty minutes. The exposure took place in a room with a temperature of 22±2° C. and approximately 50% RH. After 30 minutes exposure a piece of printing paper was introduced between the petri dish and the treated tile surface to prevent further mosquito contact. The insects continued to be held at 22±0.5° C and approximately 50% RH for 24 hours. Knockdown was noted after 15 minutes and 1 hour post initial exposure. Mortality was noted at 24 hours post initial exposure. This was repeated with a further four batches of insects to give five replicates per active treatment. The control consisted of 5 replicates of 10 insects placed on untreated glazed tiles.

Flavesone: A Novel Insecticide For The Control Of Urban Pests 247

Residual Contact Studies on C. felis. Insecticide treatments were applied to 32 mm diameter nylon carpet discs or 32 mm cotton fabric discs. Carpet and fabric discs were alternatively placed in a 0.25 m2 grid and the entire area, including the discs, was sprayed using a hand held pump sprayer at the rate of 100 ml/m2. The pump spray was weighed to check the correct spray weight was applied. The discs were then left to dry for 30 mins. At 30 minutes post treatment, three 32 mm carpet discs were placed in separate plastic vials. The vials were 32 mm diameter and 9 cm high and had a perforated screw cap. Ten adult fleas were placed in each vial by a power aspirator and the screw cap closed. Vials were stored in an incubator at 27° C and 75% relative humidity for 24 hours. This was repeated with a further two batches of insects to give three replicates per active treatment. The control consisted of three replicates of 10 insects placed on untreated carpet discs. Mortality was noted after 24 hours exposure. Mortality included all fleas that were showing no movement and not maintaining normal posture. All the above was repeated for flea larvae. Flea larvae were picked up using a small soft paint brush and placed on the treated cotton fabric in the plastic vials. Larvae were examined at 24 hours post exposure and considered dead when they displayed no movement when touched with a fine paint brush. Controls consisted of carpet discs or cotton fabric discs treated with water alone and handled as above. Preliminary Field Study on C. quinquefasciatus. Flavesone 50 mg/ml, 25 mg/ml and 12.5 mg/ml. Ten C. quinquefasciatus adults were placed in a plastic container. The container was 10 cm high and 11cm diameter and had mesh over one end to allow penetration of the insecticide fog. The container was placed out in an urban garden at a height of one metre. The area was sprayed using a Dynafog Trijet Fogger at a rate of 500 ml/hectare. This was repeated to provide three replicates of each of the three rates of flavesone. There were three untreated controls. Knockdown was noted at 0.5 and 2 hours, and mortality at 24 hours after fogging. The mosquitoes were transported to the laboratory after the 0.5 hour assessment and held at 22±2° C. and 50% RH.

RESULTS AND DISCUSSION Small Chamber Studies on Flying Insects Results are presented in Tables 1 to 3. An analysis of variance was performed to determine the differences between treatments at KD50 and KD90 points, and 24 hours after exposure. Treatments were tested against each other using Ryan’s Q test if the assumption of equality of variance was met or Dunnett T-test if the assumption was not met. Ae. aegypti. Flavesone 50 mg/ml and 25 mg/ml gave 100% mortality at 24 hours and this was equivalent to the mortality achieved by permethrin 2.5 mg/ml. The KD50 and KD90 of both rates of flavesone were both slightly slower than those for permethrin. Flavesone 50 mg/ml KD90 was 633 seconds and permethrin was 510 seconds. C. quinquefasciatus. Flavesone 50 mg/ml and 25 mg/ml gave 100% mortality at 24 hours and this was equivalent to the mortality achieved by permethrin 2.5 mg/ml. The KD50 and KD90 of both flavesone 50 mg/ml were both slightly faster than those for permethrin. Flavesone 50 mg/ml KD90 was 1431 seconds and permethrin was 1745 seconds. Flavesone KD50 and KD90 25 mg/ml were slightly slower than permethrin. M. domestica. Flavesone 200 mg/ml and 100 mg/ml gave 100% mortality at 24 hours and this was equivalent to the mortality achieved by permethrin 2.5 mg/ml. The KD50 and KD90 of both rates of flavesone were both slightly slower than those for permethrin. Flavesone 200 mg/ml KD90 was 637 seconds and permethrin was 386 seconds. Residual Contact Studies on Flying Insects The results are presented in Tables 4 to 6. No statistical analysis was conducted on mosquito data as most results were 100%. An analysis of variance was performed to determine the differences between treatments for M. domestica. Treatments were tested against each other using a Dunnett T-test as the assumption was not met. 248 P. Miller and B. Peters Flavesone: A Novel Insecticide For The Control Of Urban Pests

Ae. aegypti. Flavesone 12.5 mg/ml and 6.25 mg/ml gave 100% knockdown at 15 minutes and 2 hours and 100% mortality at 24 hours and this was equivalent to knockdown and mortality for permethrin 0.625 mg/ml. C. quinquefasciatus. Flavesone 50 mg/ml and 25 mg/ml gave 100% knockdown at 15 minutes and 2 hours and 100% mortality at 24 hours and this was equivalent to knockdown and mortality for permethrin 2.5 mg/ml. Other collaborators have also shown that flavesone demonstrated residual contact activity against Anopheles sp. M. domestica. Flavesone 200 mg/ml and 100 mg/ml gave 100% knockdown at 15 minutes and 2 hours and 100% mortality at 24 hours. Both rates of flavesone appeared superior to permethrin 2.5 mg/ ml which gave 70% and 92% knockdown at 15 minutes and 2 hours, respectively, and 72% mortality at 24 hours, however these differences were not statistically significant. There was some recovery at 24 hours with permethrin but this did not occur with flavesone. The comparative finding in contact studies in M. domestica that flavesone was able to induce 100% mortality versus 72% for permethrin highlights the ongoing issue of increasing reduced efficacy of the synthetic pyrethroids. Residual Contact Studies on C. felis The results are presented in Table 7. No statistical analysis was conducted on C. felis data as most results were 100%. Against adult C. felis on a nylon carpet the 3 higher rates of flavesone (150 mg/ml, 62.5 mg/ml and 23.8 mg/ml) resulted in 100% mortality after 24 hours exposure. Flavesone at 2.38 mg/ml achieved 10% mortality after 24 hours exposure. Permethrin 2.5 mg/ml gave 100% mortality. Control adult flea mortality was nil. Against C. felis larvae on cotton fabric the 3 higher rates of flavesone (150 mg/ml, 62.5 mg/ml and 23.8 mg/ml) resulted in 100% mortality after 24 hours exposure. Flavesone at 2.38 mg/ml achieved 3.3% mortality after 24 hours exposure. Permethrin 2.5 mg/ml gave 100% mortality. Control larval flea mortality was nil. Preliminary Field Study on Mosquitoes The results are presented in Table 8. No statistical analysis was conducted for this pilot study. Flavesone at 50 mg/ml gave 80% knockdown after 15 minutes and mortality was 76.7% at 24 hours, thus there was very little recovery. Based on these early promising results two further field studies are planned in Cairns, Queensland. The first study will investigate further the efficacy of flavesone for knockdown and kill of mosquitoes. The second study will look at the ability of flavesone to protect humans from mosquito bites (bite inhibition).

Table 1. Knockdown and mortality of Aedes aegypti.

24 hours KD50 KD90 Treatment and Rate mortality (seconds) (seconds) (%) 100a Permethrin 2.5 mg/ml 352.8a 510.0a

100a Flavesone 50 mg/ml 488.0b 633.0b

100a Flavesone 25 mg/ml 570.2c 788.0c

Treatments with same letter do not differ significantly from each other. Flavesone: A Novel Insecticide For The Control Of Urban Pests 249

Table 2. Knockdown and mortality Culex quinquefasciatus. 24 hours KD50 KD90 Treatment and Rate mortality# (seconds) (seconds) (%) 100a Flavesone 50 mg/ml 1025.1a 1431.4a

100a Permethrin 2.5 mg/ml 1284.1b 1745.0b

100a Flavesone 25 mg/ml 1606.4c 1932.9c

Treatments with same letter do not differ significantly from each other.

Table 3. Knockdown and mortality of Musca domestica.

KD50 KD90 24 hours Treatment and Rate KM KM mortality#

(sec) (sec) (%) 100a Permethrin 2.5 mg/ml 253.3a 386.0a

100a Flavesone 200 mg/ml 467.5b 637.2b

100a Flavesone 100 mg/ml 1051.7c 1376.0c

Table 4. Percentage knockdown and Mortality of Aedes aegypti Percentage Knockdown and Mortality at Three Exposure Times Treatment and Rate 15 minutes 4 hours 24 hour

mortality Flavesone 12.5 mg/ml 100 100 100

Flavesone 6.25 mg/ml 100 100 100

Permethrin 0.625 mg/ml 94 100 100

Control 0 0 12

*Treatments with same letter do not differ significantly from each other. 250 P. Miller and B. Peters Flavesone: A Novel Insecticide For The Control Of Urban Pests

Table 5. Percentage knockdown and mortality of Culex quinquefasciatus Table 8. Percentage knockdown and mortality of Culex quinquefasciatus at Three exposure times (Pilot Field Trial) Percentage Knockdown and Mortality at Three Exposure Times Treatment and Rate 15 minutes 2 hours 24 hour

mortality Flavesone 50 mg/ml 100 100 100

Flavesone 25 mg/ml 100 100 100

Permethrin 2.5 mg/ml 100 100 100

Control 0 0 4

Table 6. Percentage Knockdown and Mortality of Musca domestica

Percentage Knockdown and Mortality at Three Exposure Times Treatment and Rate 15 minutes 2 hours 24 hour

mortality Flavesone 200 mg/ml 100a 100a 100a Flavesone 100 mg/ml 100a 100a 100a Permethrin 2.5 mg/ml 70a 92a 72a Control 0 0 4 Treatments with same letter do not differ significantly from each other.

Table 7. Ctenocephalides felis mortality after 24 hour exposure.

Flea Mortality After 24 Hours Exposure (n=10) Treatment and Rate Adults Larvae Flavesone 2.38 mg/ml 10 3.3 Flavesone 23.8 mg/ml 100 100 Flavesone 62.5 mg/ml 100 100 Flavesone 150 mg/ml 100 100 Permethrin 2.5 mg/ml 100 100 Control 0 0 Flavesone: A Novel Insecticide For The Control Of Urban Pests 251

Table 5. Percentage knockdown and mortality of Culex quinquefasciatus Table 8. Percentage knockdown and mortality of Culex quinquefasciatus at Three exposure times (Pilot Field Trial) Percentage Knockdown and Mortality at Three Exposure Times Percentage Knockdown and Mortality at Three Exposure Times Treatment and Rate 15 minutes 2 hours 24 hour 15 minutes 2 hours 24 hours mortality Concentration mg/ml KD KD mortality Flavesone 50 mg/ml 100 100 100 Flavesone 50 mg/ml 80.0 76.7 76.7 Flavesone 25 mg/ml 100 100 100 Flavesone 25 mg/ml 43.3 40.0 20.0 Permethrin 12.5 mg/ml 53.3 10.0 6.6 Permethrin 2.5 mg/ml 100 100 100 Permethrin 2.5 mg/ml 20.0 13.3 10.0 Control 0 0 4 Control 0 0 6.7 CONCLUSION In our studies flavesone demonstrated its ability to knockdown and killAe. aegypti, C. quinquefasciatus Table 6. Percentage Knockdown and Mortality of Musca domestica and M. domestica in both small chamber studies and direct contact residual studies. It was also very effective against C. felis. Initial studies on the mode of action of flavesone suggest that flavesone has a Percentage Knockdown and Mortality at different mode of action to pyrethroids. The widespread issue of insecticide resistance therefore presents Three Exposure Times significant opportunities for flavesone to act as a “resistance breaker” in integrated pest management programs including against urban pests. Treatment and Rate 15 minutes 2 hours 24 hour ACKNOWLEDGEMENTS mortality The authors thank Bio-Gene Technology for provision of a research grant which supported this work. Flavesone 200 mg/ml 100a 100a 100a FLAVOCIDE® is a registered trademark of Bio-Gene Technology Ltd. Flavesone 100 mg/ml 100a 100a 100a REFERENCES Permethrin 2.5 mg/ml 70a 92a 72a Liu, N. Xu Q., F. Zhu, and Z. Lee. 2014. Pyrethroid resistance in mosquitoes. Insect Sci. 13:159-166 Control 0 0 4 Liu, N. and X. Yue. 2014. Insecticide resistance and cross-resistance in the House fly Treatments with same letter do not differ significantly from each other. (Diptera: Muscidae). J. Econ. Entomol. 93: 1269-1275. Zaim, M. and P. Guillet. 2002. Alternative insecticides: an urgent need. Med. Vet. Entomol. 14:1-5. Table 7. Ctenocephalides felis mortality after 24 hour exposure. Zhu, F., L. Lavine, S. O’Neal, M. Lavine, M. Foss, and D. Walsh. 2016. Insecticide Resistance and Management Strategies in Urban Ecosystems. Insects. 7:2 Flea Mortality After 24 Hours Exposure (n=10) Treatment and Rate Adults Larvae Flavesone 2.38 mg/ml 10 3.3 Flavesone 23.8 mg/ml 100 100 Flavesone 62.5 mg/ml 100 100 Flavesone 150 mg/ml 100 100 Permethrin 2.5 mg/ml 100 100 Control 0 0 253

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

IGRs FOR CAT FLEA (SIPHONAPTERA: PULICIDAE) CONTROL REVISITED

1MICHAEL K. RUST AND 2W. LANCE H. HEMSARTH 1Department of Entomology, University of California Riverside, Riverside, CA 2Hartz Mountain Corp., Secaucus, NJ

Abstract The intrinsic activity of combinations of methoprene and chlorfluazuron and methoprene and fipronil was determined against larval cat fleas,Ctenochephalides felis (Bouché). Methoprene synergized the activity of the

IGR chlorfluazuron and the adulticide fipronil. The 50LC s of chlorfluazuron, fipronil, and methoprene were 0.187 (0.136-0.236), 0.983 (0.236-1.520), and 0.39 (0.212-0.574) ppm, respectively. Combinations of chlorfluazuron

1: methoprene 1 and chlorfluazuron 5: methoprene 1 were synergistic providing LC50s of 0.028 (0.017-0.042) and 0.23 (0.112-0.337) ppm, respectively. All other combinations of these two IGRs were antagonistic. The

combinations of fipronil 1: methoprene 1 and fipronil 5: methoprene 1 were synergistic providing 50LC s of 0.292 (0.221-0.360) and 0.927 (0.824-1.011) ppm, respectfully. The addition of methoprene to chlorfluazuron or fipronil allows for the reduction of amounts of both compounds needed to kill fleas and in the future may also retard the development of insecticide resistance.

Key words Methoprene, chlorfluazuron, fipronil, synergism.

INTRODUCTION Insect growth regulators (IGRs) have been used to control cat fleas,Ctenocephalides felis (Bouché), on the host and in the environment for nearly three decades (Beugnet and Franc, 2012; Blagburn and Dryden, 2009; Rust, 2005). Most of the research has focused on three IGRs, lufenuron, methoprene and pyriproxyfen. Initially, the focus was on the use of IGRs to control fleas in the environment with applications of organophosphates and pyrethoids and methoprene or pyriproxyfen, combination treatments being routinely conducted by pest management professional (PMPs) (Rust and Dryden, 1997, Hinkle et al., 1997). In 1995 the emphasis switched to applications directly to the pet, and less attention has been given to IGRs and their application in the urban environment to control fleas. Methoprene and pyriproxyfen have been combined with adulticides such as dinotefuran, fipronil, imidacloprid and permethrin and directly applied to the pelage of the pet.The development of these combination products has become very popular and their efficacy has been widely reported (Varloud and Hodgkins, 2015; Baker et al., 2014; Boushira et al., 2012; Ross et al., 2012; Beugnet et al., 2011; Beugnet et al., 2012; Dryden et al., 2008; Dryden et al., 2011 a, b, c). The objectives of this paper are to re-examine the potential role that IGRs may play in C. felis control both on-animal therapies and in the environment. The intrinsic activity of combinations of IGRs and methoprene and the adulticide fipronil is presented. Potential areas for further research are highlighted. 254 M. K. Rust and W. L. H. Hemsarth IGRs For Cat Flea Control Revisited

MATERIALS AND METHODS Cat Flea Maintenance A laboratory strain of cat flea (UCR) has been maintained without any exposure to insecticides for nearly 40 years (Rust and Hemsarth, 2016a). Cat flea eggs were collected from a tray underneath the cats and the debris and eggs were passed through metal sieves. The eggs were retained on the 60-mesh screen. The eggs were placed on larval rearing media consisting of 2950 g 30-mesh play sand, 375 g finely ground dog chow, 75 g hemoglobin freeze-dried (MP Biomedicals. LLC, Solon, OH), and 50 grams Brewer’s yeast. The larvae were held in a desiccator chamber maintained at 75% RH (saturated NaCl solution, Winston and Bates, 1960) and 26.7º ± 1º C. On day 12 -13 after egg collection, the larval medium was passed through a 16-mesh sieve to remove the cocoons. Adults emerged 16-18 d after the egg collection. Insecticides and IGRs The IGRs chlorfluazuron (tech. 98.4 %, Chem Services, West Chester, PA), fipronil (tech. 97.8%, Pestanal ® Sigma-Aldrich, St. Louis, Mo) and methoprene (99.2%, Chem Service, West Chester, PA). Acetone was selected as the solvent. Eleven serial dilutions of chlorfluazuron (chlor) and methoprene (meth) were tested ranging from 0.039 to 1.25 ppm and 0.0625 to 2.5 ppm, respectively. Serial dilutions of the fipronil (fip) and methprene combinations were tested ranging from 0.125 to 2.0 ppm. Dilutions of the chlorfluazuron and methoprene were tested ranging from 0.004 to1.0 ppm. Larval Media Studies Aliquots of 0.2 ml of each test solution were applied to 2 grams of larval rearing media in plastic vials (76 by 20 mm diameter Sarstedt, Newton, NC) and allowed to dry for at least 2 hours under a fume hood. The relative humidity of the work bench was increased by two humidifiers (TaoTronics TT- AH002, Fremont, CA) providing 75-80% RH, preventing the desiccation of larvae, and reducing the static electricity. Larvae were selected from the rearing media on day 4 or 5 after the egg collection for testing with a fine paint brush lightly moistened with water. Ten larvae were placed in glass petri dishes (5 cm diameter by 1.7 cm). The treated larval medium was transferred from the plastic vial to the glass petri dishes with the larvae. A piece of parafilm (ca. 1 cm by 3 cm) was stretched around about 2/3 of the bottom of the petri dish to help secure the lid and prevent adult fleas from escaping. The dishes were then placed into a desiccator maintained with 75% RH and held at 26.7º ± 1º C. After 21 days, the dishes were placed in the freezer for 2 hours and the number of adult fleas was counted. The number of dead larvae and adults that failed to emerge from cocoons was counted. Adult fleas were counted as emerged or fully developed adults in cocoons if the legs were free from the body.

DATA ANALYSIS The adult development data were analyzed by probit analysis with POLO program (Robertson et al., 2007). The program performs a likelihood ratio test of the equality of the slopes and intercepts of the probit lines for each IGR. To determine the effects of the combination treatments the data were analyzed with the Chou- Talalay Method (Chou and Talalay, 1984; Chou, 2006, 2010). The median-effect plots allow the potency value or median dose and dose effect curve of each pesticide and their combination to be determined. These are used to calculate the Combination Index (CI) which provides a quantitative value and a basis for determining if combinations are synergistic, additive or antagonistic for each dose. Chou (2006) categorized CI values as follows: <0.1- very strong synergism, 0.1-0.3 – strong synergism, 0.3-0.7 – synergism, 0.7-0.85 – moderate synergism, 0.85-0.90 – slight synergism, 0.9-1.10 – nearly additive, 1.10-1.12 – slight antagonism, 1.20 -1.45 – moderate antagonism, 1.45 - 3.3 antagonism, 3.3 -10 – strong antagonism, >10 very strong antagonism. The Dose Response Index (DRI) measures the potential reduction of the dose of each IGR in the combination compared with the IGR alone. IGRs For Cat Flea Control Revisited 255

RESULTS

The intrinsic activity of the two IGRs and fipronil (LC50’s) were chlorfluazuron (chlor) > methoprene

(meth) > fipronil (fip) (Table 1). The LC50 and LC95 of chlorfluazuron and methoprene were 0.19 and 0.78 ppm and 0.39 and 5.07 ppm, respectively. Fipronil was the least active compound against larvae, the LC50 and LC95 being 0.98 and 22.28 ppm, respectively.

The combination of chlor 1: meth 1 and chlor 5: meth 1 provided LC50s of 0.03 and 0.23 ppm, respectively. The combination of chlor 1: meth 1 was highly synergistic with Combination Indices (CI) ranging from 0.11 to 0.31 (Table 2), whereas the combination of chlor 5: meth 1 was slightly synergistic with CI values ranging from 0.72 to 0.98. The DRI’s for chlor 1: meth 1 ranged from 6.04 to 68.24 suggesting that the concentrations of each IGR could be dramatically reduced and still provide the same activity of each IGR alone. The DRI’s for chlor 5: meth1 were less, but the DRI’s for methoprene ranged from 11.41 to 41.56 indicating that concentrations of methoprene could be significantly reduced.

Table 1. The intrinsic biological activity of IGRs against larval cat fleas,C. felis. Data in ppm.

Slope ± (SEM) Treatment n LC50 (95% C.I.) LC95 (95% C.I.) Chlorfluazuron 720 2.65 ± 0.24 0.19 (0.137-0.236) 0.78 (0.600-1.146) (Chlor) Methoprene (Meth) 610 1.48 ± 0.21 0.39 (0.212-0.574) 5.07 (2.531-16.526) Chlor 5: Meth 1 520 4.10 ± 0.55 0.23 (0.112-0.337) 0.58 (0.403-0.974) Chlor 1: Meth 1 450 1.59 ± 0.18 0.03 (0.017-0.042) 0.30 (0.172-0.824) Fipronil (Fip) 940 1.21 ± 0.22 0.98 (0.236-1.520) 22.28 (7.782- 3464.980) Fip 5: Meth 1 600 5.72 ± 0.63 0.93 (0.824-1.011) 1.80 (1.592-2.183) Fip 1: Meth1 690 2.32 ± 0.20 0.29 (0.221-0.360) 1.50 (1.173-2.126)

Table 2. Combination Index at each Effective Dose (ED) for the combinations of chlorfluazuron (Chlor) and methoprene (Meth).

Combination ED50 ED75 ED90 ED95 Chlor 5: Meth 1 0.72 0.79 0.89 0.98 Chlor 1 : Meth 1 0.31 0.19 0.13 0.11

The combination of fip 1: meth 1 and fip 5: meth 1 provided LC50s of 0.29 and 0.93 ppm, respectively. The CI’s of the fip 1: meth 1 ranged from 0.26 to 2.62 and were slightly synergistic. Similarly, the CI’s of fip 5: meth 1 ranged from 0.13 to 2.47. The DRI’s for fipronil and methoprene combinations ranged from 0.55 to 21.89 and indicated that some reductions in the amounts of methoprene may be possible and still achieve the activity of fipronil alone. 256 M. K. Rust and W. L. H. Hemsarth IGRs For Cat Flea Control Revisited

Table 3. Dose-reduction Index at each Effective Dose (ED) for the combinations of chlorfluazuron (Chlor) and methoprene (Meth) against C. felis larvae.

Combination ED50 ED75 ED90 ED95 Chlor Meth Chlor Meth Chlor Meth Chlor Meth Chlor 1: Meth 1 6.04 7.15 7.52 16.59 9.35 38.5 10.83 68.24 Chlor 5: Meth 1 1.56 11.41 1.34 19.74 1.16 34.14 1.05 41.56

Table 4. Combination Index at each Effective Dose (ED) for the combinations of fipronil (Fip) and methoprene (Meth).

Combination ED50 ED75 ED90 ED95 Fip 5: Meth 1 2.47 0.81 0.27 0.13 Fip 1 : Meth 1 2.62 1.09 0.46 0.26

Table 5. Dose-reduction Index at each Effective Dose (ED) for the combinations of fipronil (Fip) and methoprene (Meth) against C. felis larvae.

Combination ED50 ED75 ED90 ED95 Fip Meth Fip Meth Fip Meth Fip Meth Fip 1: Meth 1 1.22 0.55 3.99 1.23 10.53 2.72 21.89 4.67 Fip 5: Meth 1 0.58 1.32 1.96 3.35 6.59 8.51 15.04 16.04

DISCUSSION IGRs have played an important role in IPM programs for cat flea control for nearly 3 decades. Initially they were important as environmental treatments to control immature stages of fleas (Osbrink et al., 1986; Rust and Dryden, 1997). With the advent of the spot-on therapies with fipronil and imidacloprid in the mid- 1990’s, the IGRs also became an effective treatment on animal and the treatment of the environment applications became a secondary recommendation. Chlorfluazuron is as active as methoprene and pyriproxyfen against larval cat fleas (Rust and Hemsarth, 2016b). Chlorfluazuron has been registered to control Dipteran and Lepidopteran pests in agricultural settings (Rust and Hemsarth, 2016a). Physiological resistance to methoprene and pyriproxyfen have been reported in Diptera and Lepidoptera (Rust and Hemsarth, 2016a). Chlorfluazuron might serve as a potential IGR if resistance were to develop to either methoprene or pyriproxyfen in fleas. Methoprene is capable of synergizing the activity of the IGR chlorfluazuron. Recent research has shown that methoprene is synergized by pyriproxyfen and even at 20:1 ratios the combination is about 3-fold more active than methoprene alone (Rust and Hemsarth, 2016b). This is the first published data that methoprene is also capable of synergizing another IGR. The DRI clearly indicate that concentrations of chlorfluazuron and methoprene could be reduced for each IGR as a result of the synergy. Young et al. (2004) suggested that methoprene may even synergize the activity of fipronil against immature stages of fleas when applied to the pelage of dogs. Our data provides evidence to support that observation. The addition of methoprene clearly increased the activity of the combination. Additional research with the combination against adult fleas is warranted to determine if any other effects might occur. Our understanding of the mode of actions of the IGRs has changed since the first on-animal IGR/adulticide combination therapies registered some 20 years ago. In addition to altering insect development, studies have demonstrated IGR effects on behavior and synergistic activity towards other IGRs For Cat Flea Control Revisited 257 active ingredients. Additional studies dealing with the interactions of IGRs and other active ingredients used to control cat fleas are warranted. CONCLUSIONS Methoprene synergized both chlorfluazuron and fipronil against larvalC. felis. The DRI of the chlorfluazuron and methoprene suggest that the concentrations of both IGRs could be reduced at least 3-fiold and still provide the activity of either IGR alone. The DRIs of the fipronil and methoprene suggest that only modest reductions are probably possible.

REFERENCES CITED Baker, C., E. Tielemans, J.B. Prullage, S.T. Chester, M. Knaus, S. Rehbein, J.J. Fourie, D.R. Young, W.R.. Everett, and J.R. Rosentel. 2014. Efficacy of a novel topical combination of fipronil, (S)-methoprene, eprinomectin and praziquantel against adult and immature stages of the cat flea Ctenocephalides( felis) on cats. Veterinary Parasitology 202: 54-58. Beugnet, F. and M. Franc. 2012. Insecticidal and acaricidal molecules and/or combinations to prevent pet infestation by ectoparasities. Trends in Parasitology 28: 267-279. Beugnet, F., V. Doyle, M. Murray, and K. Chalvet-Monfray. 2011. Comparative efficacy on dogs of a single topical treatment with the pioneer fipronil/(S)-methoprene and an oral; treatment with spinosad against Ctenocephalides felis. Parasite 18: 325-331. Beugnet, F., J. Fourie, and K. Chalvet-Monfray. 2012. Comparative efficacy on dogs of a single topical treatment with fipronil/(S)-methoprene or weekly physiological hygiene shampoos against Ctenocephalides felis in a simulated flea-infested environment. Parasite 19: 153-158. Blagburn, B.L. and M.W. Dryden. 2009. Biology, treatment and control of flea and tick infestations. Veterinary Clinical Small Animal 39: 1173-1200. Bouhsira, E., E. Lienard, P. Jacquiet, S. Warin, V. Kaltsatos, L. Baduel, and M. Franc. 2012. Efficacy of permethrin, dinotefuran and pyriproxyfen on adult fleas, flea eggs collection, and flea egg development following transplantation on mature female fleasCtenocephalides ( felis felis) from cats to dogs. Veterinary Parasitology 190: 541-546. Chou, T.-C. 2006. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacological Review 58: 621-681. Chou, T.-C. 2010. Drug combination studies and their synergy quantification using the Chou-Talalay Method. Cancer Research 70: 440-446. Chou, T.-C., and P. Talalay. 1984. Quantitative analysis of does-effect relationships: the combined effects of multiple drugs or enzymes inhibitors. Advances in Enzyme Regulation 22: 27-55. Dryden M.W., P. A. Payne, A. Lowe, S. Mailen, V. Smith, and D. Rugg. 2008. Efficacy of a topically applied spot-on formulation of a novel insecticide, metaflumizone, applied to cats against a flea strain (KS1) with documented reduced susceptibility to various insecticides. Veterinary Parasitology. 151: 74-79. Dryden M., D. Carithers, A. McBride, L. Smith, J. Davenport, V. Smith. P. Payne, and S.J. Gross. 2011a. A comparison of flea control measurement methods for tracking flea populations in highly infested private residences in Tampa FL, following topical treatments of pets with Frontline Plus (fipronil/(S)-methoprene). Intern. J. Appl. Res. Vet. Med. 9: 356-367. 258 M. K. Rust and W. L. H. Hemsarth

Dryden M.W., P. A. Payne, S. Vicki, B. Riggs, J. Davenport, and D. Kobuszewski. 2011b. Efficacy of dinotefuran-pyriproxyfen, dinotefuran-pyrproxyfen-permethrin and fipronil-(S)-methoprene topical spot-on formulations to control flea populations in naturally infested pets and private residences in Tampa, FL. Veterinary Parasitology 182-281-286. Dryden M.W., P. A. Payne, S. Vicki, and D. Kobuszewski. 2011c. Efficacy of topically applied dinotefuran formulations and orally administered spinosad tablets against the KS1 flea strain infesting dogs. International Journal of Applied Research in Veterinary Medicine 9: 124-129. Hinkle, N.C., M.K. Rust, and D.A. Reierson. 1997. Biorational approaches to flea (Siphonaptera: Pulicidae) suppression: present and future. Journal of Agricultural. Entomology 14: 309-321. Osbrink, W.L.A., M.K. Rust, and D.A. Reierson. 1986. Distribution and control of cat fleas in homes in southern California (Siphonaptera: Pulicidae). Journal of Economic Entomology 79: 135-140. Robertson, J.L., R.M. Russell, H.K. Preisler, and N.E. Savin. 2007. Bioassays with Arthropods. 2nd edition. CRC, Boca Raton, FL. Ross, D.H., R.G. Arther, C. Simon, V. Doyle, and M.W. Dryden. 2012. Evaluation of the efficacy of topically administered imidcloprid + pyriproxyfen and orally administered spinosad against cat fleas (Ctenocephalides felis): impact of treated dogs on flea life stages in a simulated home environment. Parasites & Vectors 5: 192. Rust, M.K. 2005. Advances in the control of Ctenocephalides felis (cat flea) on cats and dogs. Trends in Parasitology 21: 232-236. Rust, M.K. and M.W. Dryden. 1997. The biology, ecology, and management of the cat flea. Annual Review of Entomology 42: 451-473. Rust, M.K., and W.L.H. Hemsarth. 2016a. Intrinsic activity of IGRs against larval cat fleas. Journal of Medical Entomology. DOI: https/doi.org/10.1093/jme/tjw201. Rust, M.K., and W.L.H. Hemsarth. 2016b. Synergism of the IGRs methoprene and pyriproxyfen against larval cat fleas. Journal of Medical Entomology 53: 638-643. Varloud, M., and E. Hodgkins 2015. Five-month comparative efficacy evaluation of three ectoparasiticides against adult cat fleas Ctenocephalides( felis), flea egg hatch and emergence, and adult brown dog ticks (Rhipicephalus sanguineus sensu lato) on dogs housed outdoors. Parasitol. Res. 114: 965-923. Winston, P.W. and D.H. Bates. 1960. Saturated solutions for the control of humidity in biological research. Ecology 41: 232-237. Young, D.R., P.C. Jeannin, and A. Boeckh. 2004. Efficacy of fipronil/(S)-methoprene combination spot-on for dogs against shed eggs, emerging and existing adult cat fleas Ctenocephalides( felis, Bouché). Veterinary Parsitology 125: 397-407. 259

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

EVALUATING A NEW CONCEPT IN COCKROACH BAITING

STEVEN BROADBENT Ensystex Australasia Pty. Ltd., 4-6 Junction Street, Auburn, NSW 2144, Australia

Abstract Gel bait treatments are widely used for cockroach control, in part because they are considered to be safer and more effective than other methods. However, commercially available baits are considered to have a limited range over which they can attract and, as a result, fail to lure cockroaches out of deep refuges. In addition, some strains have shown resistance to this treatment through developed bait aversion behaviour. German cockroaches are gregarious, often spending up to 75% of their lifetime at rest deep in harbourages, limiting the effect of gel treatments. The hard exoskeletons of cockroaches contain chitin and chitosan which can display paramagnetic properties, attracting ferromagnetic objects. This means that a magnetically charged powder carrying an insecticide active ingredient can be attracted to the exoskeleton and will adhere to it, overcoming disadvantages of gel baits. The active constituent can then also enter the cockroach body through the soft membranes in the exoskeleton, as well as by ingestion. A series of detailed laboratory trials were performed to confirm efficacy and produce a new concept in cockroach baits. This product is a dry flowable powder which also includes food attractants and the active constituent, fipronil. Averaged across gender and days after treatment, this new concept provided improved levels of control, and speed of control, when compared to three reference cockroach gel baits, including use of the same active.

Key words Dry flowable cockroach bait, magnetic,Periplaneta, Blattella, fipronil

INTRODUCTION Ensystex Inc. (Fayetteville, North Carolina, USA) in association with Energy Investment Group Holding Co. Ltd. (Calebasses, Mauritius) have developed a Magnetic Flowable Bait, MAGNATHOR® Magnetic Cockroach Bait with Magthanite®, which is a ready-to-use, dry, flowable, granular cockroach bait that utilises a toxicant incorporated with a ferromagnetic granular compound and a food attractant for the control of cockroaches (and ants). The toxicant is 0.5 g/kg fipronil and the ferromagnetic granular carrier used is a proprietary compound, Magthanite. This is a non-hazardous proprietary oxide powder blend of strontium ferrite, iron oxide, silicon dioxide, aluminium oxide, zinc oxide, and calcium oxide; originally developed for the modern electronics industry. Several species of social insects have been shown to use the earth’s magnetic field to help them to orientate and navigate whilst foraging, migrating and building their nests. This appears to be linked to the presence of particles of magnetite in their bodies (Ferreira et al., 2005). Magnetite is a ferromagnetic substance, generating its own magnetic field, just like a compass needle. The magnetic remanence is reported as being low, of the order of 10-6 emu per individual. 260 S. Broadbent Evaluating A New Concept In Cockroach Baiting

Numerous experiments have shown that there is a clear attraction between ferromagnetic particles and several insect pests, and most importantly, that this effect can be utilised for their control (Entwistle, 2011). Insect exoskeletons consist of an epidermis underlying a soft endocuticle of chitin (an acetylglucosamine polysaccharide) and an exocuticle of chitin which has flexible regions containing the elastic protein resilin together with rigid plates that are strengthened through quinone cross linkages and a mixture of proteins called sclerotin. The chemical composition of the exoskeleton does not explain why it should exhibit paramagnetism, and there appears to be a gap in research in this area, though the chitin that forms the exoskeleton, and its chemically de-acetylated version, chitosan, can be processed in the laboratory into their paramagnetic forms. Enhanced pick-up by the insect cuticle has been demonstrated through use of this electrostatic powder (O’Halloran and Fryatt, 2011). Tests by Smith and Moores at the Rothamsted Experimental Station, UK were reported as showing that cockroaches passing over a residual deposit of the ferromagnetic carrier picked up an average of 56% more particulate material than those passing over a deposit of inert talc. In a further test comparing inert talc and this ferromagnetic carrier, they found that 250% more ferromagnetic carrier was transferred between cockroaches. Cockroaches are an important group of insect pests in the urban environment. Their adaptability has made them a universal pest associated with humans. The use of insecticides remains the most common method of control, among which use of insecticide baits is the most popular method. Baits are precise, use less toxicant and carry lower risks when applied (Tee, 2014). In modern cockroach management programs, emphasis is placed on using the least amount of insecticide possible (Miller and Meek, 2004). Cockroach baits are available in various formulation types. Gel baits are most commonly used and can be applied directly in cockroach-infested harbourages such as cracks, crevices and voids using a syringe or bait gun (Reierson, 1995). A dry flowable granular bait offers the option of reaching deep into cracks and crevices to reach deep spaces where application of gel baits is restricted (Dhang, 2011). The amount of bait consumed is considered an important criterion for bait efficacy since it determines whether a lethal dose is being ingested and it influences the amount of toxicant available for horizontal transfer. Consumption of more bait means that poisoned individuals will defecate or regurgitate more materials containing toxicant and contain more toxicant within the cadaver (Silverman and Bieman, 1996). The attractiveness and consumption of the bait is therefore considered a paramount factor in performance. However, a substance that is attractive to cockroaches may not necessarily stimulate feeding (Tsuji, 1965). An attractant functions by attracting cockroaches towards the bait, whereas a feeding stimulant induces and promotes increased consumption of the bait (Durier and Rivault, 2000). Commercially available baits are thought to have a limited range over which they can attract and, as a result, fail to lure cockroaches out of deep refuges, (Nalyana and Schnall, 2001). In addition, some strains have shown resistance to gel bait treatments through developed bait aversion behaviour (Wang et al., 2004). In addition, German cockroaches are gregarious, often spending up to 75% of their lifetime at rest deep in harbourages, (Strong et al., 2000), thus limiting the effect of traditional gel placements. By developing a bait matrix in which consumption is not a primary factor for uptake, it was expected that improved control of cockroaches could be achieved, with the paramagnetic effects of the proposed carrier allowing more toxicant to be picked up.

MATERIALS AND METHODS This trial was established to determine if the proposed formulation would attract the cockroaches so they actively picked up the particles, resulting in cockroach mortality; and to compare it with three industry standard products. The Magnetic Flowable Bait, was produced by Ensystex Inc., North Carolina, USA. This consisted of 0.5 g/kg fipronil as the active constituent, 5 g/kg of a plant-based food as the attractant, and 994.5 g/kg of the flowable magnetic carrier. Positive controls consisted of three leading, commercially available gel cockroach baits as developed by the original registrants of the products with their respective active constituents. The active Evaluating A New Concept In Cockroach Baiting 261 constituents of these were 0.5 g/kg fipronil, 0.5 g/kg abamectin, and 21.5 g/kg imidacloprid. These were purchased from a distribution company in NSW, Australia. The trials were performed at the laboratories of the South African Bureau of Standards, Pretoria, Republic of . Test conditions were maintained with the temperature set at 23-28° Celsius, relative humidity of 45-65% and a normal day/night cycle. The test insect species were the German cockroach (Blattella germanica) and the American cockroach (Periplaneta americana). Plastic trays measuring 350 mm x 350 mm x 220 mm were used to house the cockroaches. These were fitted out with two cockroach shelters using commercially available cardboard egg cartons. These were positioned at one side of the test arena. A food source (dried dog food) and water were placed on the opposite side of the container, in the corner. The shelter closest to the food and water sources was maintained as an untreated shelter in all tests. Cockroaches were released into this untreated shelter. For the Magnetic Flowable Bait, the internal surfaces of the second shelter were lightly dusted with 1 g of the Magnetic Flowable Bait. This was the shelter that was furthest away from the provided water and food sources. For the Positive Controls, 2 g of each gel bait, was applied to a plastic lid and placed in the centre of the container, closest to the shelter in which the cockroaches were released. The cockroaches would need to pass the gel baits in order to access the provided food or water source. One series of trials was established using American cockroaches and a second series using German cockroaches for each Material. Three (3) replicates for each cockroach species were conducted using fourteen (14) females, fourteen (14) males, and fourteen (14) nymphs (approx. two weeks old). The cockroaches were released in each separate test container and left for one hour to settle before the Materials were introduced. Mortality counts were made daily for fourteen days. The dead cockroaches were removed after each count. A standard control was also used for each species with no Material present.

RESULTS AND DISCUSSION The Magnetic Flowable Bait was the only material that produced 100% cockroach mortality in the trials. This was achieved within 6 days against the American cockroach, though all adults were dead within 48 hours. Against the German cockroach, total mortality of all life-stages was achieved within 48 hours. The Fipronil Gel Bait was the next best performing material, providing 98% mortality of American cockroaches after 12 days; and 99% mortality of German cockroaches after 9 days. Detailed statistical analysis confirmed that the Magnetic Flowable Bait demonstrated significantly faster control and more effective control than any of the gel baits tested against both species.

Figure 1. Graphical representation of Figure 2. Graphical representation of German cockroach results. American cockroach results. 262 S. Broadbent Evaluating A New Concept In Cockroach Baiting

CONCLUSIONS The above results support the contention that a Magnetic Flowable Bait could offer improved levels of control compared to a traditional gel bait. The Magnetic Flowable Bait does not need to be consumed by the cockroaches. This means the food component is only required to lure the cockroach to the target zone. It is suggested that, once the cockroach approaches the target zone, the magnetic attraction between the cockroach exoskeleton and the Magnetic Flowable Bait draws the particles containing the active constituent to the cockroach exoskeleton. The power of paramagnetism, also causes the particles to adhere to the exoskeleton and to be transferred more readily during grooming to provide improved secondary transfer. The particles likely enter the cockroaches’ bodies through the soft membranes in the exoskeleton. Ingestion of the Magnetic Flowable Bait is not necessary for toxicity. When compared with conventional gel baits it is considered that the Magnetic Flowable Bait delivered superior results due to the improved adhesion and transferability of the particles. Since it is a dry flowable bait, it will travel deep into cracks, crevices and other cockroach harbourages, allowing treatment of places that cannot be reached with other baits. ACKNOWLEDGEMENTS Special thanks are expressed to Dr Heinz Loots from the South African Bureau of Standards who worked on the laboratory trials. REFERENCES CITED Dhang, P. 2011. Insect Baits and Baiting: Novel Technology for Managing Urban Pests with Less Insecticide. In: Dhang, P., ed., Urban Pest Management: An Environmental Perspective. Wallingford: CAB International. Durier, V. and C. Rivault. 2000. Comparisons of toxic baits for controlling the cockroach, Blattella germanica: attractiveness and feeding stimulation. Medical and Veterinary Entomology 14, 410-418. Entwistle, J. 2011. Magnetic insect control – a novel application for specialist magnetic powders. International Pest Control, 53:1. Ferreira, J., G. Cernicchiaroa, M. Winklhoferb, H. Dutrac, P.S. de Oliveirac, D.M.S. Esquivela, and E. Wajnberga. 2005. Comparative magnetic measurements on social insects. Journal of Magnetism and Magnetic Materials 289, 442-444. Miller, D.M. and F. Meek. 2004. Cost and efficacy comparison of integrated pest management strategies with monthly spray insecticide applications for German cockroach (: Blattellidae) control in public housing. Journal of Economic Entomology, 97, 559-569. Nalyana, G. and C. Schnall. 2001. Evaluation of Attractants for Monitoring Populations of the German cockroach. J. Econ. Entomol. 94(1): 208-214. O’Halloran, C. and R. Fryatt. 2011. Use of Magnetic Carrier to Improve Delivery of Active Ingredients for Urban Pest Control. In: Robinson W.H. and A. Eugênia de Carvalho Campos, eds., Proceedings of the Seventh International Conference on Urban Pests. Reierson, D.A. 1995. Baits for German cockroach control. In: Rust, M.K., Owens, J.M. and Reierson, D.A. eds., Understanding and Controlling the German Cockroach. New York: Oxford University Press. Silverman, J. and D.N. Bieman. 1996. Issues affecting the performance of cockroach baits. In: Wildey, K.B. ed., Proceedings of the Second International Conference on Insect Pests in the Urban Environment. Edinburgh: Heriot-Watt University.

Evaluating A New Concept In Cockroach Baiting 263

Strong, C., S. Valles, P. Koehler, and R. Brenner. 2000. Residual Efficacy of Blatticides Applied to Surfaces Contaminated with German Cockroach Faeces. Florida Entomologist 83(4): 438-445. Tee, Hui-Siang and Chow-Yang Lee. 2014. Sustainable Cockroach Management Using Insecticidal Baits: Formulations, Behavioural Responses and Issues. In: Dhang, P. ed., Urban Insect Pests: Sustainable Management Strategies. London: CAB International. Tsuji, H. 1965. Studies on the behavior pattern of feeding of three species of cockroaches, Blattella germanica L., Periplaneta americana L., and P. fuliginosa S., with special reference to their responses to some constituents of rice bran and some carbohydrates. Japanese Journal of SanitaryZoology 16, 255-262. Wang, C., M. Scharf and G. Bennett. 2004. Behavioural and physiological resistance of the German cockroach Blattella germanica (L). Pest Management Science 57:11 1055- 1059. 265

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

USE OF AN ALGINATE HYDROGEL TO DELIVER AQUEOUS BAIT TO MANAGE AN INVASIVE ANT PEST IN RESIDENTIAL SETTINGS

1JIA-WEI TAY, 1MARK S HODDLE, 2ASHOK MULCHANDANI, AND 1DONG-HWAN CHOE 1Department of Entomology, University of California, Riverside, CA 92521, USA 2Department of Chemical Engineering, University of California, Riverside, CA 92521, USA

Abstract Insecticide sprays used for ant control generally cause environmental contamination. Liquid bait is ef- fective, but requires bait stations to dispense the toxicant. In this study, we develop a natural alginate hydrogel to deliver liquid bait, without the use of bait stations. Hydrogel beads conditioned in a sucrose solution with 0.0001% thiamethoxam provided complete control of all castes of Argentine ant Linepithema humile (Mayr) colonies, by 5 days post-treatment in the laboratory trial, and provided a 79% reduction in ant activity after 8 weeks in the field trial. This work demonstrates the potential of alginate hydrogel as an effective tool to deliver liquid bait in controlling Argentine ants.

Key words Argentine ant, ant control, biodegradable hydrogel, Linepithema humile, liquid bait, thiamethoxam

INTRODUCTION The Argentine ant, Linepithema humile (Mayr), is among the most successful pest ant species in urban (Knight and Rust, 1990), agricultural (Daane et al., 2008), and natural environments (Boser et al., 2014). Sucrose liquid bait has been demonstrated to effectively control Argentine ants (Rust et al., 2004). However, they require that bait stations be implemented, which are costly and require frequent maintenance (Nelson and Daane, 2007; Rust et al., 2015). The sucrose liquid baits in the bait station also tends to ferment under warm environmental conditions, consequently compromising its attractiveness (Cooper et al., 2008; Buczkowski et al., 2014a). To date, a synthetic hydrogel made of polyacrylamide was tested to deliver sucrose liquid baits to Argentine ants, without the use of bait stations (Boser et al., 2014; Buczkowski et al., 2014a; Buczkowski et al., 2014b; Rust et al., 2015). The use of hydrogels makes it possible to apply liquid bait directly on the ground, near areas where ants are foraging and nesting. Polyacrylamide hydrogel, however, degrades into acrylamide, a chemical listed by the World Health Organization as being toxic (World Health Organization, 1985). We report the effectiveness of alginate, a natural polymer derived from seaweed, to deliver sucrose liquid bait to Argentine ants.

MATERIALS AND METHODS Ants Linepithema humile colonies were collected from a citrus grove located at the University of California, Riverside, CA, USA, and were maintained in the laboratory.

266 J.-W. Tay, M. S Hoddle, A. Mulchandani, and D.-H. Choe Use Of An Alginate Hydrogel To Deliver Aqueous Bait To Manage An Invasive Ant

Preparation of Alginate Hydrogels A 1% sodium alginate (Na-Alg) solution was prepared by dissolving 1 g of Na-Alg (Sigma Aldrich, St. Louis, MO, USA) in 100 ml of deionized water. The Na-Alg solution was dispensed dropwise into the crosslinker, 0.5% calcium chloride (CaCl2) using a 5 ml syringe. The resulting hydrogel beads were filtered out after 5 minutes, and then rinsed with deionized water. Each bead was conditioned in 100ml of the 25% sucrose solution containing 0.0001% (wt:vol) analytical grade thiamethoxam (Thiamethoxam PESTANAL®, Sigma Aldrich, St. Louis, MO, USA), which resulted in the complete hydration of the hydrogel beads. The concentrations of Na-Alg (1%) and CaCl2 solutions (0.5%), and crosslinking time (5 minutes) was optimized to produce hydrogel beads with preferred rigidity and maximum hydration in a 25% sucrose solution (Tay et al., unpublished data). Laboratory Small Colony Test A total of 300 workers, 2 queens, and 0.1g of brood were separated from the main colony. Each colony was then reared in a polyethylene container (33 x 19 x 10 cm), the sides and inner surface of which were coated with a thin film of teflon (polytetrafluoroethylene suspension; BioQuip, Rancho Dominguez, CA, USA). A petri dish (10 cm in diameter and 1.5 cm in height) with 4 small entry holes containing folded corrugated paper (14 x 6 cm), served as harborage. On a weekly basis, the ants were provided with water, a 25% sucrose solution, freshly-killed cockroaches, and canned tuna fish. The colonies were acclimatized for a 7-day period, and were then starved for 3 days, prior to baiting. At the completion of the starvation period, 3 newly prepared hydrogel beads were introduced in each colony box. The treated colonies were provided with hydrogels conditioned in a 25% sucrose solution with 0.0001% analytical grade thiamethoxam for 24 hours. Control colonies were provided with hydrogel conditioned in a 25% sucrose solution without any toxicants. At 24 hours post-treatment, the colonies were re-assigned to their original diet. The number of live queens and workers were counted from photographs, and the weight of the brood was measured at 1, 3, and 5 days post-treatment. The experiment was replicated 5 times. The percent reductions in the number of workers, queens, and brood between the treated and untreated colonies were arcsine square-root transformed and analyzed using paired t-test (SPSS Inc, 2002). Field Efficacy Test Droplets of 1% Na-Alg solution were produced using a 100-nozzle shower head (AKDY AZ-6021 8-inch bathroom chrome shower head, CA, USA), and were collected in a plastic container (381 x 292 x

152 mm) with a 0.5% CaCl2 cross linker solution. The resulting alginate hydrogel beads prepared from a 5 L of Na-Alg solution were filtered out and conditioned in a 5 L of 50% sucrose solution with 0.0002% of thiamethoxam for a 24-hour period. It was assumed that concentrations of thiamethoxam and sucrose solution inside and outside of the hydrogel beads reached equilibrium after the 24-hour conditioning period, which produced alginate hydrogel baits containing about 25% sucrose solution with ~ 0.0001% of thiamethoxam. The hydrogel baits were then filtered out from the liquid bait. Their efficacy was tested at 5 residential houses in Riverside, CA, USA. Each experimental site was treated with ~ 1 kg of hydrogel bait in an application rate of 10 grams m-2, applied in ~ 20 piles (~ 50 grams per pile), within 5 m from the structure. Estimations of foraging activity levels of Argentine ants, before and after treatment, were based on the total amount of sucrose solution consumed by ants over a 24-hour period. On each monitoring date, 20 monitoring vials (15 ml Falcon plastic vial, BD bioscience, San Jose, CA, USA), each containing 12 ml of 25% sucrose solution, were placed at 10 different spots around each structure. At each spot, a set of 2 vials was placed on the ground in the notch of 2 Lincoln LogsTM, and was covered with a flower pot (15.5 cm in diameter and 11.5 cm in height). The amount of sucrose solution consumed by the ants was determined by measuring the difference between the initial and finial weights of the vials over 24 hours, and then correcting for evaporation (weight loss from another set of monitoring vials which ants could not access). The number of ant visits to each vial was estimated by dividing the amount of sucrose solution an Argentine ant can consume (0.3 mg) per visit (Reierson et al., 1998). Field sites were monitored on day 1 pre-treatment, and weeks 1, 2, and 4 post-treatment. The second treatment with hydrogel bait was made in the same manner, after the monitoring at week 4, Use Of An Alginate Hydrogel To Deliver Aqueous Bait To Manage An Invasive Ant 267 and sites were further monitored at weeks 5, 6, and 8 post-treatment (calculated from the dates of the first treatment deployment). The average number of ant visits recorded at each site for all monitoring dates was square-root transformed. The number of ant visits at each post-treatment monitoring date was compared with the pre-treatment level with paired t-tests at the 0.05 level of significance (SPSS Inc, 2002).

Table 1. Percentage reduction of worker, queen, and brood ants (mean ± SEM) in laboratory study after baiting with alginate hydrogel baits containing 0.0001% thiamethoxam.

Time (Day) a Treatment Caste 1 3 5 Worker 9.87 ± 3.07a 12.13 ± 4.23a 13.93 ± 2.12a Control Queen 0.00 ± 0.00a 0.00 ± 0.00a 0.00 ± 0.00a Brood 10.00 ± 6.32a -2.00 ± 12.41a 16.00 ± 8.72a Worker 22.93 ± 5.55a 89.07 ± 1.24b 100.00 ± 0.00b 0.0001% thiame- Queen 0.00 ± 0.00a 40.00 ± 10.00b 100.00 ± 0.00b thoxam Brood 22.00 ± 5.83b 78.00 ± 7.35b 100.00 ± 0.00b a Means with the same letter for each caste within a column are not significantly different at α = 0.05 (data were arcsine square-root transformed; paired t-test).

Table 2. Pre- and post-treatment average ant visits at 5 sites treated with hydrogel baits containing 0.0001% thiamethoxam.

Pre-treatment Post-treatment average ant visits a average ant Site visits 1 week 2 weeks 4 weeks 5 weeks 6 weeks 8 weeks 1 54,199 26,166 32,707 18,474 15,058 22,236 13,261 2 70,197 24,508 30,217 8,284 13,871 9,048 6,229 3 30,517 26,925 28,133 23,460 18,316 26,294 11,033 4 46,826 32,490 29,689 8,029 5,887 15,180 5,672 5 68,741 35,272 30,304 15,077 14,253 17,474 15,314 Mean 54,096 29,072* 30,210* 14,665* 13,477* 18,046* 10,302*

a A second bait treatment was made at all sites between week 4 and 5

* Significant at α = 0.05 compared with corresponding pre-treatment average ant visits (data were

square-root transformed; paired t-test)

RESULTS In the laboratory study, significant differences in the percent brood reduction were recorded in the treated colonies, when compared to the control at day 1 post-treatment. The hydrogel baits containing 0.0001% thiamethoxam provided 100% control for workers, queens, and brood by day 5 post-treatment (Table 1). In the field study, an average of 42, 40, 68, 72, 61, and 79% reduction in ant visits were recorded for week 1, 2, 4, 5, 6, and 8, respectively, when compared to the corresponding pre-treatment data. Average ant visits to monitoring vials in all post-treatment monitoring dates were significantly lower than their 268 J.-W. Tay, M. S Hoddle, A. Mulchandani, and D.-H. Choe Use Of An Alginate Hydrogel To Deliver Aqueous Bait To Manage An Invasive Ant respective pre-treatment estimates, across the entire experimental period (week 1, t = 3.6, df = 4, P = 0.023; week 2, t = 3.6, df = 4, P = 0.022; week 4, t = 4.4, df = 4, P = 0.012; week 5, t = 5.7, df = 4, P = 0.005; week 6, t = 3.7, df = 4, P = 0.020; week 8, t = 6.9, df = 4, P = 0.002) (Table 2).

DISCUSSION Alginates are polysaccharides that are widely distributed in nature. They consist of (1-4)-linked β-D- mannuronic acid (M) and α-L-guluronic acid (G) (Murata et al., 2004). The calcium alginate hydrogel utilized in this study was created by the ionical interaction between Na-Alg and calcium ions (Saarai et al., 2011). Alginate hydrogel containing low concentration of thiamethoxam (0.0001%) shows high efficacy in the laboratory and field trials. The alginate hydrogel bait immediately provided a 42% ant reduction, on average, by week 1 post-treatment in the field trial. After a second treatment between weeks 4 and 5, the alginate hydrogel baiting maintained 61 – 79% ant reductions, on average, until the completion of the experiment. A recent similar laboratory small colony test demonstrates that alginate hydrogel conditioned in a 25% sucrose solution with 0.5% boric acid, a lower risk insecticide, achieved complete mortality in all castes of Argentine ant by day 14 post-treatment (Tay, unpublished data). An in-depth field study is currently in progress to evaluate its efficacy in the field. The use of alginate hydrogel baits allows effective ant management possible with minimal amounts of insecticide. It is also environmentally friendly as it does not leave any toxic on degradation.

REFERENCES CITED Boser, C.L., C. Hanna, K.R. Faulkner, C. Cory, J.M. Randall, and S.A. Morrison. 2014. Argentine ant management in conservation areas: Results of a pilot study. Monogr. West. N. Am. Nat. 7: 518-530. Buczkowski, G., E. Roper, and D. Chin. 2014a. Polyacrylamide hydrogels: An effective tool for delivering liquid baits to pest ants (Hymenoptera: Formicidae). J. Econ. Entomol. 107: 748- 757. Buczkowski, G., E. Roper, D. Chin, N. Mothapo, and T. Wossler. 2014b. Hydrogel baits with low-dose thiamethoxam for sustainable Argentine ant management in commercial orchards. Entomol. Exp. Appl. 153: 183-190. Cooper, M.L., K.M. Daane, E.H. Nelson, L.G. Varela, M.C. Battany, N.D. Tsutsui, and M.K. Rust. 2008. Liquid baits control Argentine ants sustainably in coastal vineyards. Calif. Agr. 62: 177-183. Daane, K.M., M.L. Cooper, K.R. Sime, E.H. Nelson, M.C. Battany, and M.K. Rust. 2008. Testing baits to control Argentine ants (Hymenoptera: Formicidae) in vineyards. J. Econ. Entomol. 101: 699-709. Knight, R.L. and M.K. Rust. 1990. Repellency and efficacy of insecticides against foraging workers in laboratory colonies of Argentine ants (Hymenoptera: Formicidae). J. Econ. Entomol. 83: 1402-1408. Murata, Y., D. Jinno, K. Kofuji, and S, Kawashima. 2004. Properties of calcium-induced gel beads prepared with alginate and hydrolysates. Chem. Pharm. Bull. 52: 605-607. Nelson, E.H. and K.M. Daane. 2007. Improving liquid bait programs for Argentine ant control: bait station density. Environ. Entomol. 36: 1475-1484. Reierson, D.A., M.K. Rust, and J. Hampton-Beesley. 1998. Monitoring with sugar water to determine the efficacy of treatments to control Argentine ants,Linepithema humile (Mayr). In: Proceedings of the National Conference on Urban Entomology. 26-28 April 1998. San Diego, CA. 78-82. Use Of An Alginate Hydrogel To Deliver Aqueous Bait To Manage An Invasive Ant 269

Rust, M.K., D.A. Reierson, and J.H. Klotz. 2004. Delayed toxicity as a critical factor in the efficacy of aqueous baits for controlling Argentine ants (Hymenoptera: Formicidae). J. Econ. Entomol. 97: 1017-1024. Rust, M.K., A. Soeprono, S. Wright, L. Greenberg, D.H. Choe, C.L. Boser, C. Cory, and C. Hanna. 2015. Laboratory and field evaluations of polyacrylamide hydrogel baits against Argentine ants (Hymenoptera: Formicidae). J. Econ. Entomol. 108: 1228-1236. Saarai, A., V. Kasparkova, T. Sedlacek, and P. Saha. 2011. A comparative study of crosslinked sodium alginate/gelatin hydrogels for wound dressing. In: Mastorakis, N. (ed.), Proceeding of the 4th WSEAS International Conference on Engineering Mechanics, Structures, Engineering Geology. WSEAS Press, Greece. 384-389. SPSS Inc. 2002. SPSS user’s guide, version 11.5 for Windows. SPSS Inc., Chicago, IL. World Health Organization. 1985. International Programme on Chemical Safety - Environmental Health Criteria 49: Acrylamide. WHO, Gen 271

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

ROLE OF ANT LARVAE IN THE DIGESTION OF GEL AND GRANULAR BAITS IN MANAGEMENT OF CAMPONOTUS MODOC AND TAPINOMA SESSILE (HYMENOPTERA: FORMICIDAE)

LAUREL D. HANSEN Biology Department Ms 3280, Spokane Falls Community College, 3410 W. Fort Wright Drive, Spokane, Wa Usa 99224

Abstract Solid food carried into nests of ants by foraging workers is reported to be fed to larvae for digestion before nutrients are transmitted back to workers. The role of the digestion of solid food by larvae for worker consumption was investigated in the use of gel and granular baits in the management of two species of ants: carpenter ants, Camponotus modoc, and odorous house ants, Tapinoma sessile. Nests were established in feeding trials with granular and gel baits with and without larvae. Ants in nests without larvae had a higher or equilivant mortality compared to ants in nests without larvae indicating that toxicants in baits were ingested without the aid of larval digestion. As only liquid materials can pass the infrabuccal filter in workers, digestion must occur in the infrabuccal pocket of the foraging ants.

Key words Carpenter ants, odorous house ants, trophallaxis,

INTRODUCTION Tapinoma sessile, odorous house ants, and Camponotus spp., carpenter ants, are widely distributed throughout the United States and have become two of the most serious pests in structures, either as nuisance pests or structurally damaging organisms. Odorous house ants belong to the Subfamily and carpenter ants belong to Subfamily . The industry considers these ants as the number one and two ‘call-back’ pests in the United States (NPMA 2012 Ant Industry Research Survey). The complex food cycle within an ant colony varies with the species of ant. Foraging ants bring food or water back to the colony and distribute it to other workers and larvae by trophallaxis. A filtering mechanism (infrabuccal plate) in adult ants prevents solid food particles from entering the digestive tract (Eisner and Happ, 1962) (Hansen and Klotz, 2005). The feeding of larvae occurs most commonly when workers apply mouth parts to that of larvae and liquid food is regurgitated from the adult’s crop (Wheeler 1928). Stomodeal trophallaxis by larvae has been observed in nearly all major ant families (Wheeler, 1928) except the Dolichodorinae (Holldobler and Wilson, 1990). Wheeler (1994) states that larvae digest prey items externally, producing soluble proteins and are solicited from larvae by adults. The larvae then regurgitate the digested food back to the workers in a liquid form. The possibility that larvae serve as specialized digestive castes has been supported chiefly for some of the Myrmicinae that feed on seeds (Holldobler and Wilson, 1990). The larval body shape of carpenter ants is pogonomyrmecoid and allows for a short ventrally curved neck that can feed from a praesaepium, a shallow ventral depression on the thoracic wall. This serves as an adaptation to feeding on insect fragments (Wheeler and Wheeler, 1976). Their simple mandible forms a round-pointed tooth with no medial teeth. Odorous house ant larval shape is designated 272 L. D. Hansen Role Of Ant Larvae In The Digestion Of Gel And Granular Baits In Management Of Camponotus as dolichoderoid without a neck and with nearly vestigial mouth parts. These ants consume liquid food only (Wheeler and Wheeler, 1976). Pest management professionals (PMPs) and homeowners employ a wide variety of management strategies with varying degrees of success. The recognition of the role that liquid foods play in the nutrition and colony cohesion has led to bait development, particularly liquids (Oi and Vail, 2011). Many bait formulations (granular, gels, liquids, and prepared stations) are available for both of these species. The purpose of this study was to determine whether digestion by larvae is a factor in the consumption and distribution of the toxicants from the baits to worker ants. Understanding the mechanism that allows toxicants to enter the colony is fundamental for control. Application of baits is acceptable by homeowners as less toxicant is applied to their surroundings and to the environment compared to other application strategies. MATERIALS AND METHODS Two species were used in these trials: Camponotus modoc W.M.Wheeler and Tapinoma sessile (Say). The procedure was similar for both species. colonies were collected in May near Moscow, Idaho and odorous house ant colonies were collected near Leavenworth, Washington in June. Colonies were transferred to the laboratory and maintained until trials were initiated. From the collected colonies, nest boxes of ants for trials were established with 45 worker ants per box or 45 worker ants plus larvae per box. Each nest box was supplied with a food source (honey) and water. Estimates were made of the number of larvae: 10-12 larvae (all sizes) for carpenter ants and 20-25 larvae (all sizes) for odorous house ants. Attempts to determine what larval instars were present were not made. Nest boxes were maintained for 24 hours before feeding trials were initiated. After 24 hours exposure to bait, honey was added to provide an alternate food choice. Controls were offered honey as a food source and no bait. Five reps were made for each treatment. Mortality of workers (and larvae) was monitored and recorded every two days for four weeks. Percent mortality for each nest box at each time interval was computed and the five reps were averaged for each bait. Granular Baits with five different active ingredients were selected: Advion Insect Granules (0.22% Indoxacarb), Maxforce Granular Insect Bait (1.0% Hydramethylnon), InVict Xpress (granules) (0.5% Imidacloprid), Niban FG (5% Orthoboric acid), and Advance Select Granular Ant Bait (0.011% Abamectin). For comparison three gel baits were selected: Advion Ant Gel (0.05% Indoxacarb), Optigard Ant Gel Bait (0.010% Thiamethoxam), and InTice Sweet Ant Bait (5.0% Orthoboric Acid).

RESULTS Carpenter ants: At the end of four weeks, mortality of ants in nest boxes without larvae was similar or higher than ants in nest boxes with larvae for all the baits (Table 1). A higher rate of mortality was shown in nest boxes without larvae for three granular baits and for two gel baits. None of the nest boxes contained larvae after four weeks. The larvae did not increase in size or pupate. The larvae darkened in color and shriveled in size before dying. In the control boxes 50% of the larvae remained but did not increase in size or develop to pupae. Odorous house ants: At the end of four weeks, mortality of ants in nest boxes without larvae was similar or higher than ants in nest boxes with larvae for all the baits (Table 2). A higher rate of mortality was shown without larvae for three granular baits and for two gel baits. None of the odorous house ant nest boxes contained larvae after 4 weeks. The larvae did not increase in size or pupate but larvae darkened in color and shriveled in size. In the control boxe,s approximately 30% of the larvae remained but did not increase in size or develop to pupae. Role Of Ant Larvae In The Digestion Of Gel And Granular Baits In Management Of Camponotus 273

DISCUSSION Management training materials (Hedges, 2010) (Bennett et al., 2010) state that solid pieces of food are carried back to the colony and are fed to larvae that eat and digest them. The larvae then regurgitate the digested food back to the workers in a liquid form. Carpenter ants in the Subfamily Formicinae have this capability; however, the odorous house ants (Subfamily Dolichodorinae) lack this ability.

Table l. Average percent mortality of Camponotus modoc workers in nest boxes with and without larvae supplied with granular and gel baits through four weeks.

Bait Days 2 4 8 16 22 28 ADVION G No larvae 21.1 46.2 85.5 100.0 With larvae 2.4 16.2 53.9 86.1 97.9 100.0 MAXFORCE G No larvae 2.5 4.6 5.4 22.5 49.2 57.1 With larvae 1.1 3.8 7.8 40.8 47.6 55.4 INVICT EXPRESS No larvae 21.4 30.3 67.3 98.7 100.0 With larvae 2.7 22.1 57.7 97.2 99.2 100.0 NIBAN G No larvae 1.7 3.3 7.1 35.9 65.8 85.4 with larvae 1.3 1.3 3.8 35.9 55.8 70.8 ADVANCE No larvae 1.2 2.4 15.2 65.9 81.3 89.2 With larvae 4.4 6.3 12.6 46.5 86.4 99.2 ADVION GEL No larvae 1.2 7.3 21.6 82.8 96.0 100.0 With larvae 1.3 5.0 11.7 37.5 51.7 67.1 OPTIGARD GEL No larvae 9.9 63.7 93.4 100.0 With larvae 8.6 48.0 73.2 89.8 98.8 100.0 INTICE BAIT No larvae 2.9 11.2 33.2 73.8 90.8 93.3 With larvae 1.1 7.6 45.1 77.5 92.1 98.7 CONTROL No larvae 1.3 2.2 3.8 5.8 6.9 6.9 With larvae 0.4 2.1 2.9 2.9 2.9 4.2 274 L. D. Hansen Role Of Ant Larvae In The Digestion Of Gel And Granular Baits In Management Of Camponotus

Table 2. Average percent mortality of Tapinoma sessile workers in nest boxes with and without larvae supplied with granular and gel baits.

Bait Days 2 4 8 16 22 28 ADVION G No larvae 23.2 52.7 79.3 96.9 100.0 With larvae 13.4 32.6 57.4 83.6 90.1 90.1 MAXFORCE G No larvae 12.8 27.5 42.5 83.5 95.1 98.7 With larvae 5.3 7.5 16.0 36.7 44.1 65.2 INVICT EXPRESS No larvae 20.6 28.0 35.3 48.6 62.6 77.6 With larvae 4.0 8.2 15.1 19.4 21.4 31.4 NIBAN G No larvae 17.1 21.7 23.7 27.3 39.4 59.4 With larvae 6.5 13.7 19.5 32.7 39.8 54.2 ADVANCE No larvae 13.5 38.3 55.8 74.3 76.5 77.6 With larvae 14.2 34.3 55.5 68.6 79.3 80.2 ADVION GEL No larvae 3.0 9.1 15.4 45.4 58.4 81.5 With larvae 14.5 16.6 20.5 26.2 29.7 39.4 OPTIGARD GEL No larvae 25.5 55.9 94.1 98.1 100.0 With larvae 14.4 28.9 66.9 79.6 83.5 87.8 INTICE BAIT No larvae 2.2 4.8 7.0 17.7 52.8 44.8 With larvae 11.1 17.0 19.6 28.7 32.9 39.0 CONTROL No larvae 2.7 4.6 8.4 9.1 11.0 12.6 With larvae 1.5 2.6 2.6 5.3 6.2 9.9

In the feeding trials with larvae, granular baits were not dependent on larval digestion to affect mortality of worker carpenter ants or odorous house ants. Both granular and gel formulations produced similar results in trials with both species. Differences in the mortality of carpenter ants compared to odorous house ants with different baits demonstrate that these two ants do not respond equally to the same baits. The toxic effect of baits to worker ants may occur through the exoskeleton or through the mouth parts where food enters the cibarium. This chamber opens into a second chamber, the infrabuccal pocket that is a collection site for particles of food and debris. Ducts from the propharyngeal, postpharyngeal, maxillary, labial, and mandibular glands empty into the cibarium and infrabuccal pocket (Hansen and Klotz, 2005). Materials including baits stored in the infrabuccal pocket would come into contact with glandular secretions that would release the toxicants. Through trophallaxis among workers, the toxicants spread rapidly through nestmates without the aid of digestion by larvae.

Role Of Ant Larvae In The Digestion Of Gel And Granular Baits In Management Of Camponotus 275

REFERENCES CITED Bennett, G.W., J.M. Owens, and R.M. Corrigan. 2010. Truman’s scientific guide to pest management operations. 7th ed. Questex Media Group, Cleveland, OH Eisner, T. and G.J. Happ. 1962. The infrabuccal pocket of a formicine ant: a social filtration device. Psyche 69: 107-116. Hansen, L.D. and J.H. Klotz. 2005. Carpenter ants of North America and Canada. Ithaca, NY: Cornell University Press. Holldobler, B. and E.O. Wilson. 1990. The ants. Cambridge, MA: Harvard University Press. Hedges, S.A. 2010. Field guide for the management of structure-infesting ants. Richfield, OH: G.I.E. Media. NPMA. 2012. Ant Industry Research Survey. Pest Management Foundation. Oi, D. and K. Vail. 2011. Ants, Chapter 11. In Handbook of pest control. 10th ed. Mallis Handbook LLC Wheeler, D.E., 1994. Nourishment in ants: patterns in individual and societies. In J.H. Hunt and C.A. Nalepa (eds.). Nourishment and evolution in insect societies. Boulder: Westview Press. Wheeler, W.M. 1928. The social insects: their origin and evolution. London: Kegan Paul, Treanch, Trubner and Co. Wheeler, G.C., and J. Wheele. 1976. Ant larvae: review and synthesis. Memoirs Entomol. Soc. Washington, No. 7. Washington, D.C.: Entomological Society. 277

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

DEVELOPMENT AND EVALUATION OF TESTING METHODS FOR ANT REPELLENTS

ANNE KRÜGER, SARA KNOBELSPIESS AND ERIK SCHMOLZ German Environment Agency, Sect. IV 1.4, Health Pests and their Control, Boetticherstr. 2, Building 23, 14195 Berlin

Abstract Repellents are biocides and a proof of efficacy is required for active substance inclusion as well as for product authorization. Here, we describe two test systems for efficacy evaluation of ant repellents with the substances DEET 50 %, Margosa extracts 100 %, baking powder: sodium hydrogen carbonate and sea sand. Monomorium pharaonis was tested in both systems. They are designed as choice tests and allow testing of solid and liquid substances. In the first test system, a forced-choice test, groups of 50 - 70 ant workers were set into an escape situation with a choice to escape either over a treated or an untreated surface. The second test system was a simulated use-test: Whole colonies, including workers, brood and queens were set into a test arena and allowed to forage. Between the nest and the food/water source, a barrier was placed which could only be passed over two small bridges, of which one was treated with the test substance and one untreated. In both test systems, ants crossing the surfaces were counted. The results of the study show that DEET repelled in both systems 100 % of the ants. Margosa repelled in the forced-choice test 96 % and 100% of the foragers were repelled in the simulated use-test. Baking powder had no repellent effect. 42 % of all workers in the forced-choice test and in the simulated use-test 51 % of the foragers crossed the substance. A comparison of the data revealed that the repellent effect of each substance was similar in both test systems.

Key words Monomorium pharaonis, pest control, testing method

INTRODUCTION Most ant species in buildings in Europe are nuisances, but some have also the potential to destruct building materials or, like Pharaoh ants (Monomorium pharaonis), are potential mechanical vectors for pathogen bacteria (Klebsiella sp., Staphylococcus sp. or Enterobacter sp.; Zarzuela et. al, 2005; Moreira et. al, 2005). M. pharaonis is spread worldwide (Wetterer 2010). Their potential for distribution is facilitated by their small size, as they can nest in numerous small transportable objects. Pharaoh ants are polygynous and new colonies can be founded easily (Peacock et al., 1955; Petersen and Buschinger, 1971) through fission or budding (Vail and Williams, 1994). In temperate regions they occur almost entirely indoors. Control of pharaoh ants and other tropical ant species as potential vectors is required especially in hospitals or food facilities. Ants can be controlled with baits which act slowly and are transported by foraging workers to the nest and fed to queens and brood. For ants nesting outside of buildings an alternative control method cis the use of repellents to hold back the workers from food sources. Ants living indoors may be repelled from sensitive areas in addition to control with insecticide baits. Repellents and insecticide baits are biocides according to the EU Biocides Directive (528/2012). A requirement for authorization is proof of their efficacy. However, the relevant EU biocide guidance documents (ECHA 2016) provide no tests descriptions for repellents against ants. 278 A. Krüger, S. Knobelspiess and E. Schmolz Development And Evaluation Of Testing Methods For Ant Repellents

In this study, we compared two test designs: a short-time forced choice-test, where the ants are set in an escape situation, and a simulated use-test, conducted with whole colonies with workers, queens and brood. Repellents were tested in both systems to compare their efficacy onMonomorium pharaonis.

MATERIALS AND METHODS Study Animals. Ants were taken from laboratory colonies of the German Environment Agency. The ants were provided with dead Periplaneta americana, sugar and a drinking trough consisting of a small petri dish with a cotton ball soaked with water. Climate conditions were 25 ± 1.5°C and 60 ± 10 % humidity. Repellents and Substances. Substances were tested: DEET 50 % (NobiteÒ Hautspray, Tropical Concept

Sarl), Margosa extract 100 % (vectrade UG), baking powder: sodium hydrogen carbonate NaHCO3 (Kaiser-Natron®, Arnold Holste Wwe. GmbH & Co. KG) and sea sand (Merck KGaA). Test Designs. The first test system (Figure 1, A) is aforced choice-test (modified after Dani et al., 1996). A petri dish with its walls coated with FluonÒ (Whiteford GmbH) was placed upon an inverted beaker. At two sites the walls were left blank on the position where two microscope slides served as bridges for the ants to two different beakers. One of the slides was treated with the test substance, the other slide was non-treated and served as alternative escape route for the ants. About 50 to 70 ants were put into the petri dish and had 30 minutes to escape over one of the slides, from which they subsequently fell into the beakers adjacent to them. If the ants did not move in the petri dish, they were gently disturbed with a brush. Every 10 minutes the slides and the adjacent beakers were swapped with each other to avoid possible side preferences by the ants. After 30 minutes the ants in the beakers were counted. The second test system is a simulated use-test (Figure 1, B and C). Whole colonies, including workers, brood and queens were set into the test arena and allowed to forage for a week. Between the nest and the food/water source, a barrier of insect glue was applied. An untreated microscope slide served as bridge over this barrier to water and food. After a period of 7 days for acclimatisation, the untreated slide was replaced with a slide treated with the repellent substance and a second untreated slide was provided at the opposite side as alternative route to food and water. Ants passing the slides were counted over a period of 5 minutes directly after the repellent substance exposition, as well as 3 to 5 hours, 24 hours and 48 hours after exposition.

Figure 1. A – Forced choice-test. Petri dish and two beakers with 1 3 b microscope slides as bridges to a d 20 cm escape. 1 - microscope slide/ c ø 90 mm 2 bridge with repellent substance (3), 2 - untreated slide/bridge. 3

1 2 B B – Simulated use-test every 10 min 30 cm 26 mm acclimatization period for 7 days. a – nest, b – food, c – water, d – 1 insect glue as barrier, 1 – slide as b A ø 50 mm a bridge, 2 – slide with barrier. d 20 cm c C – Simulated use-test after 2 change of microscope slides. C a – nest, b – food, c – water, d – 30 cm insect glue as barrier, 1 – slide with repellent substance (3), 2 Figure 1. A – Forced choice-test. Petri dish and two beakers with microscope slides as - slide as alternative route to food bridges to escape. 1 - microscope slide/bridge with repellent substance (3), 2 - untreated and water. slide/bridge. B – Simulated use-test acclimatization period for 7 days. a – nest, b – food, c – water, d – insect glue as barrier, 1 – slide as bridge, 2 – slide with barrier. C – Simulated use- test after change of microscope slides. a – nest, b – food, c – water, d – insect glue as barrier,

1 – slide with repellent substance (3), 2 - slide as alternative route to food and water.

Development And Evaluation Of Testing Methods For Ant Repellents 279

Figure 2. Repellent effect of the test substances in forced choice-test and in simulated use-test 48 h after application of the substances against Monomorium pharaonis. Boxplots show the percentage of workers which crossed the untreated slide. In this study only the data of the 48 h counting periods in the simulated use-test were taken into account to compare the two test designs. In both systems, each substance was tested in 7 replicates. The efficacy of the substances as repellents was determined by counting the amount of workers that crossed the untreated bridge in comparison to the treated bridge. Data analysis. Data analysis and evaluation was done with graph pad prism 7.0. A Kruskal- Wallis-test and Dunn´s post hoc test showed if the data of the substances were significantly different to the data from the control. Results for the different substances in both test systems were compared with multiple t-tests for significant differences.

RESULTS AND DISCUSSION In both test systems, repellent effects of the test substances against pharaoh ants were observed. Substances with high repellent potential against pharaoh ants were DEET and margosa extract. Other substances like baking powder or sea sand were less efficient or showed no effect. In both tests systems, 100 % of the M. pharaonis foragers were repelled by DEET. Undiluted margosa extract caused strong repellent effects. In the forced choice-test, only 4 % M. pharaonis workers crossed the margosa extract and 100% of the foragers were repelled in the simulated use-test. Baking powder had no repellent effect to pharaoh ants. In the forced choice-test 42 % of all foragers, and in the simulated use-test 51 % of all foragers crossed the test substance. With sea sand as test substance, in the forced choice-test more ants 63 %) crossed the untreated slide compared to the simulated use-test with only 49 %. The results for efficacy of repellents were not significantly different between both test systems for all substances tested so far. Efficacy testing of different substances, which are potentially repellent against ants, is possible in both systems. As the motivation of the ants to pass the treated or control surfaces is relatively high (escape reaction) in the forced choice-test, a large number of individual ants can be checked for their reaction in a relatively short period of time. Moreover, the test design is quite simple and can be realized using standard laboratory materials (microscope slides, petri dish, beakers). In the simulated use-test, the motivation of ants to cross the test surfaces is closer to the practical situation in which repellents against ants are being applied. However, a disadvantage of the test system is that the number of tests is limited by their long duration, and that for each test, a complete ant colony 280 A. Krüger, S. Knobelspiess and E. Schmolz is needed. As substances with a medium or low repellent potential show a relatively high variance in test results, the possibility to conduct more test replicates with the forced choice-tests in a shorter time may overweigh the less artificial test situation in thesimulated use-tests, since both test systems deliver consistent data so far. REFERENCES CITED Dani, F.R., S. Cannoni, S. Turillazzi, and D.E. Morgan. 1996. Ant repellent effect of the sternal gland secretion of Polistes dominulus (Christ) and P. sulcifer (Zimmermann). (Hymenoptera: Vespidae). Journal of Chemical Ecology 22:37–48. ECHA (European Chemicals Agency). 2016. Transitional Guidance on Efficacy Assessment for Product Types 18+19 https://echa.europa.eu/documents/10162/13643/transitional_ guidance_efficacy_pt18_pt19_en.pdf/da8f2a4f-a0d4-49d8-a006-19acd9d937e5 (Jan. 27, 2017) Moreira, D.D.O., V. de Morais, O. Vieira-da-Motta, A.E. de C. Campos-Farinha, and Jr A. Tonhasca. 2005. Ants as carriers of antibiotic-resistant bacteria in hospitals. Neotropical Entomology 34 (6): 999-1006. Peacock, A.D., Sudd, J.H., and A.T. Baxter. 1955. Studies in Pharaoh ́s ant, Monomorium pharaonis (L.). 11. Colony foundation. Entomologist‘s Monthly Magazine 91: 125-129. Petersen, M., and A. Buschinger. 1971. Untersuchungen zur Koloniegründung der Pharaoameise Monomorium pharaonis (L.). [Article in German; Investigations on colony founding of the pharaoh ant Monomorium pharaonis (L.)]. Anzeiger für Schädlingskunde und Pflanzenschutz 44: 121-127. Vail, K.M., and D.F. Williams. 1994. Foraging of the Pharaoh ant, Monomorium pharaonis: An exotic in the urban environment. In: Williams D.F. (eds.) Exotic ants: biology, impact andcontrol of introduced species. California: Westview Press: 228-239. Wetterer, J.K. 2009. Worldwide spread of the ghost ant, Tapinoma melanocephalum (Hymenoptera: Formicidae). Myrmecological News: 23-33. Wetterer, J.K. 2010. Worldwide spread of the pharaoh ant, Monomorium pharaonis (Hymenoptera: Formicidae). Myrmecological News: 115-129. Zarzuela, M.F.M. de, A.E de C. Campos-Farinha, and M.P. Peçanha. 2005. Evaluation of urban ants (Hymenoptera: Formicidae) as carriers of pathogens in residential and industrial environments: I. Bacteria. Sociobiology 45 (1): 9-14. 281

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

STUDIES ON INSECTICIDE RESISTANCE IN AUSTRALIAN BED BUGS, CIMEX SPP. (HEMIPTERA: CIMICIDAE)

1DAVID G. LILLY, 1,2KAI DANG, 1STEPHEN L. DOGGETT, AND 1CAMERON E. WEBB 1Department of Medical Entomology, Westmead Hospital, University of Sydney and Pathology West – ICPMR Westmead Hospital, Westmead, NSW 2415, Australia 2Urban Entomology Laboratory, Vector Control Research Unit, School of Biological Sciences, Universiti Sains Malaysia, 11800 Penang, Malaysia

Abstract To investigate insecticide resistance in modern field populations of bed bugs in Australia, a program to collect and screen field specimens was initiated. Thirty-five bed bug strains (a mixture that included both C. lectularius and C. hemipterus) were collected from across Australian and subsequently colonized for laboratory- based insecticide resistance testing. To screen for resistance, bed bugs were exposed topically to a discriminating dose of 2.5 g/L deltamethrin and, separately, 0.1 g/L of imidacloprid, applied at a rate of 1 μL/bug. Results indicated a broad spread in the frequency of resistance against deltamethrin in C. lectularius. Mortality was predominantly high with C. lectularius against imidacloprid at ≥95%, except for several recently collected strains that returned between 70%-85%, indicating that a degree of tolerance may be developing in select strains. Three of four C. hemipterus strains returned mortality values at or below 10%, with the remainder recording 75% mortality, thereby indicating pyrethroid resistance is similarly advanced in this species. Normal susceptibility (≥95% mortality) was otherwise evident in all four C. hemipterus strains to imidacloprid. These findings complement concurrent research, which indicates variable patterns of resistance mechanisms are present across the Australia and around the world. The results have profound implications for product manufacturers and registration authorities in ensuring that a product is as effective at controlling bed bugs in the field as the laboratory.

Key words Cimex lectularius, Cimex hemipterus, insecticide resistance

INTRODUCTION Insecticide resistance is now considered as one of the key drivers of the global bed bug resurgence (Doggett et al., 2012; Romero et al., 2007) with resistance, particularly to the pyrethroid insecticides, well established in populations of both C. lectularius and C. hemipterus around the world (Adelman et al., 2011; Boase et al., 2006; Dang et al., 2015b; Dang et al., 2015c; Karunaratne et al., 2007; Kilpinen et al., 2011; Koganemaru et al., 2013; Moore and Miller, 2006; Myamba et al., 2002; Romero et al., 2007; Tawatsin et al., 2011; Yoon et al., 2008). In Australia, resistance was suspected by the mid-2000s following anecdotal reports from professional pest managers of poor insecticide performance (Doggett et al., 2012; Doggett and Russell, 2008) and, principally, mediocre efficacy with both pyrethroid and carbamate-based products when assessed by both topical and residual application under laboratory conditions (Lilly et al., 2009a, 2009b). Subsequently, full examination of dose-responses and resistance ratios between a susceptible and suspected-resistant strain via topical application confirmed extremely high resistance to deltamethrin and permethrin, along with intermediate resistance to bendiocarb (Lilly et al., 2015). No resistance to imidacloprid was detected at the time, although preliminary testing with a formulated product showed poor performance via residual application (Lilly and Doggett, unpublished data). Successive elucidation of kdr-type mutations determined that the majority of ‘modern’ strains possessed the haplotype B (L925I) target-site mutation, but that a smaller subset collected at or pre- 2002, possessed either no mutation or a novel putative kdr mutation, haplotype I936F (Dang et al., 282 D. G. Lilly, K. Dang, S. L. Doggett, and C. E. Webb Studies On Insecticide Resistance In Australian Bed Bugs, Cimex spp.

2015b). This suggested that C. lectularius populations across Australia were either rapidly evolving or new founders were introduced. Similarly, in C. hemipterus, four novel mutations on the voltage-gated sodium channel gene were discovered from colony and preserved specimens, of which two (M918I and L1014F) were deemed to be probable kdr-type mutations (Dang et al., 2015c). A contingent link of the above kdr-type mutations to expressed resistance was determined in seven strains (three Australian, four international) by exposure to a simplified ‘mat-assay’ designed for rapid and economical field use by professional pest managers (Dang et al., 2015a). There still remains a gap in our present understanding as to how widespread resistance to pyrethroids is in recently collected field strains and whether there is evidence for any change in the frequency of resistance to pyrethroids and susceptibility to neonicotinoids. It was the aim of this study to screen field strain bed bugs collected from across Australia using a laboratory topical bioassay employing discriminating doses of the pyrethroid deltamethrin and the neonicotinoid imidacloprid. A secondary aim was to assess if resistance or susceptibility was changing over time by plotting mortality values against the collection date of each strain and analyzing the data for trends using linear regression.

MATERIALS AND METHODS Thirty-one field strains of C. lectularius and four field strains C. hemipterus were derived from active bed bug infestations around Australia. After collection or receipt of field samples, all specimens were identified to species (Usinger, 1966), and select strains tested forkdr -type mutations (Dang et al., 2015a; Dang et al., 2015b; Dang et al., 2015c). Colonies were maintained at 25°C (±1°C) and 75% (±10%) RH with a photoperiod of 12:12 h (L:D). No insecticide selection was undertaken and all strains collected during or post-2012 were tested for their susceptibility within twelve months of their collection in order to eliminate any bias as a result of potential resistance reversion.

LD99 values from an insecticide-susceptible strain were based on data obtained with the ‘Monheim’ C. lectularius strain (Lilly et al., 2015), obtained from Bayer CropScience (Monheim, Germany) and which has been maintained under laboratory conditions since the 1960s. No equivalent insecticide-susceptible C. hemipterus strain exists, and data from the Monheim strain was regarded as indicative for C. hemipterus is selecting the same discriminating doses.

Discriminating Dose Bioassays To determine topical resistance, a dose of 2.5 g/L deltamethrin in acetone applied at a rate of 1 μL/bug was set as the discriminating value and, for the neonicotinoids, a dose of 0.1 g/L of imidacloprid was chosen, also applied topically at 1 μL/bug. The deltamethrin dose was equivalent to approximately 10 times the dose of many formulated insecticides registered for the treatment of bed bugs, and was otherwise

>500 times the LD99 of a C. lectularius susceptible strain. As no topical resistance to imidacloprid has ever been detected locally, the discriminating dose was selected based on it being approximately 4 times the LD99 of a C. lectularius susceptible strain. Controls received acetone only. Two replicates of 10 randomly selected adult bed bugs (mixed sex and age) per treatment plus controls were then affixed dorsally on double-sided tape to the lids of 500 mL plastic containers, and then 1 μL of solution was applied topically to the ventral side using a micro-applicator (Lilly et al., 2015). After exposure, the solution was allowed to dry for several minutes before the bugs were carefully removed with a fine pair of tweezers and placed in the base of the 500 mL container lined with ø90 mm Whatman number 1 qualitative filter papers. Mortality was recorded at 24 h and defined as the bugs exhibiting no response to gentle pressure from a probe or, in the case of moribund vestigial nerve twitching, the inability to right themselves upon being inverted onto their dorsal side.

RESULTS AND DISCUSSION Discriminating topical dose assays with deltamethrin against 31 field strains ofC. lectularius resulted in a wide variety of mortality, ranging from 15% to 100% (Figure 1) indicating resistance is widespread. A similar result was obtained against the four C. hemipterus strains (Figure 2), with three strains returning Studies On Insecticide Resistance In Australian Bed Bugs, Cimex spp. 283

≤10% mortality, while the other yielded 75% mortality. Repeat topical discriminating dose assays with imidacloprid against 30 field strains of C. lectularius (one strain had insufficient numbers for testing compared to deltamethrin assays) resulted in predominantly high (≥90%) mortality (Figure 3).

Figure 1. Mean cumulative mortality (± S.E.) of C. lectularius field strains treated with 2.5 g/L deltamethrin via topical application.

Figure 2. Mean cumulative mortality (± S.E.) of C. hemipterus field strains treated with either 2.5 g/L deltamethrin or 0.1 g/L imidacloprid via topical application. 284 D. G. Lilly, K. Dang, S. L. Doggett, and C. E. Webb Studies On Insecticide Resistance In Australian Bed Bugs, Cimex spp.

Figure 3. Mean cumulative mortality (± S.E.) of C. lectularius field strains treated with 0.1 g/L imidacloprid via topical application.

Figure 4. Linear regression (± 95% C.I.) of mean cumulative survival (± S.E.) vs. time (year collected) of C. lectularius field strains treated with 0.1 g/L imidacloprid via topical application. Studies On Insecticide Resistance In Australian Bed Bugs, Cimex spp. 285

Mortality was uniform (≥95%) with the four C. hemipterus strains (Figure 2) indicating imidacloprid remains a highly efficacious insecticide against current field strains of this species when applied topically. Mean control mortality across all strains was 1.25% (S.E. ± 0.45%). Linear regression analysis of mean survival values for each strain plotted against date of collection indicated no correlation for deltamethrin with C. lectularius (R2 = 0.013, p = 0.536). However, a positive correlation against collection date was returned for imidacloprid with C. lectularius (R2 = 0.352, p < 0.001) (Figure 4) with the newest colonized strains being less susceptible, suggesting a degree of reduced susceptibility to the insecticide is developing in field populations. No significant trend was determined for C. hemipterus either for deltamethrin (R2 = 0.047, p = 0.784) or imidacloprid (R2 = 0.160, p = 0.600). This study represents the most comprehensive survey to date on the topical susceptibility of modern bed bug populations in Australia to commonly used pyrethroid and neonicotinoid insecticides. The results from topical discriminating dose assays confirm that pyrethroid resistance in both C. lectularius and C. hemipterus is ubiquitous and present at a high frequency. Susceptibility to neonicotinoids predominantly remains via topical application, although there may be evidence of reduced susceptibility developing in C. lectularius based on a slight, but significant, trend being evident when mean mortality values were compared against the year each strain was collected. The lack of a significant regression trend for bothC. lectularius and C. hemipterus against deltamethrin suggests that, despite being inherently variable from strain to strain, there is no obvious positive or negative change evident in the frequency of resistance in Australian bed bugs for the last 8 years. Variability in the mortality achieved in both C. lectularius and C. hemipterus against deltamethrin could be due to a number of reasons and does not indicate for the absence of resistance in some strains. Notably, given kdr-type mutations have been found to be consistently present in field strains of both species collected post-2002 both in Australia (Dang et al., 2015b; Dang et al., 2015c) and overseas (Durand et al., 2012; Palenchar et al., 2015; Seong et al., 2010; Yoon et al., 2008; Zhu et al., 2010), variability in the mortality achieved against deltamethrin points to either the presence of some fitness- derived differences from strain to strain or, more likely, the activity of multiple resistance mechanisms. Evidence for multiple resistance mechanisms being present and widespread is supported by the fact that several C. lectularius strains, all with known haplotype B kdr-type resistance, returned cumulative mortality values between 20% and 100%, with no apparent association to other facts (such as collection date). Subsequent research on a subset of these C. lectularius field strains has elucidated that metabolic detoxification and cuticle thickening contribute to the observed resistance (Lilly et al., 2016a; Lilly et al., 2016b). CONCLUSION The development of insecticide resistance in both the C. lectularius and C. hemipterus is well established in Australia. This study confirms that field populations of C. lectularius are ubiquitously resistant to deltamethrin, and may be exhibiting the first signs of reduced susceptibility to neonicotinoids. Cimex hemipterus is even more resistant to deltamethrin, but not the neonicotinoids, although further collection and study of field specimens would be warranted beyond the four strains included in this study. Continued culturing and development of the collected field strain colonies, and subsequent elucidation of the resistance mechanisms, may provide further insights into the differences between strains. Ultimately, this will improve our understanding of how to effectively eradicate or prevent future infestations.

REFERENCES CITED Adelman, Z. N., K. A. Kilcullen, R. Koganemaru, M. A. E. Anderson, T. D. Anderson, and D. M. Miller. 2011. Deep sequencing of pyrethroid-resistant bed bugs reveals multiple mechanisms of resistance within a single population. PLOS ONE, 6(10), e26228. Boase, C., G. Small, and R. Naylor. 2006. Interim report on insecticide susceptibility status of UK bedbugs. Professional Pest Controller, Summer, 6-7. 286 D. G. Lilly, K. Dang, S. L. Doggett, and C. E. Webb Studies On Insecticide Resistance In Australian Bed Bugs, Cimex spp.

Dang, K., D. G. Lilly, W. Bu, and S. L. Doggett. 2015a. Simple, rapid and cost-effective technique for the detection of pyrethroid resistance in bed bugs, Cimex spp. (Hemiptera: Cimicidae). Austral Entomology, 54(2), 191-196. Dang, K., C. S. Toi, D. G. Lilly, W. Bu, and S. L. Doggett. 2015b. Detection of knockdown resistance (kdr) mutations in the common bed bug, Cimex lectularius (Hemiptera: Cimicidae) in Australia. Pest Management Science, 71(7), 914-922. Dang, K., C. S. Toi, D. G. Lilly, C. Y. Lee, R. Naylor, A. Tawatsin, U. Thavara, W. Bu, and S. L. Doggett. 2015c. Identification of putativekdr mutations in the tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae). Pest Management Science, 71(7), 1015-1020. Doggett, S. L., D. E. Dwyer, P. F. Peñas, and R. C. Russell. 2012. Bed bugs: clinical relevance and control options. Clinical Microbiology Reviews, 25(1), 164-192. Doggett, S. L. and R. C. Russell. 2008. The resurgence of bed bugs, Cimex spp. (Hemiptera: Cimicidae) in Australia. In: Robinson, W. H. and D. Bajomi (Eds.), Proceedings of the Sixth International Conference on Urban Pests, Budapest, Hungary, 13-16 July 2008 (pp. 407-425). OOK-Press: Veszprém, Budapest, Hungary. Durand, R., A. Cannet, Z. Berdjane, C. Bruel, D. Haouchine, P. Delaunay and A. Izri. 2012. Infestation by pyrethroid resistance bed bugs in the suburb of Paris, France. Parasite, 19(4), 381-387. Karunaratne, S. H. P. P., B. T. Damayanthi, M. H. J. Fareena, V. Imbuldeniya and J. Hemingway. 2007. Insecticide resistance in the tropical bedbug Cimex hemipterus. Pesticide Biochemistry and Physiology, 88(1), 102-107. Kilpinen, O., M. Kristensen and K. M. Vagn Jensen. 2011. Resistance differences between chlorpyrifos and synthetic pyrethroids in Cimex lectularius population from Denmark. Parasitology Research, 109(5), 1461-1464. Koganemaru, R., D. M. Miller and Z. N. Adelman. 2013. Robust cuticular penetration resistance in the common bed bug (Cimex lectularius L.) correlates with increased steady-state transcript levels of CPR-type cuticle protein genes. Pesticide Biochemistry and Physiology, 106(3), 190- 197. Lilly, D. G., K. Dang, C. E. Webb and S. L. Doggett. 2016a. Evidence for metabolic pyrethroid resistance in the common bed bug (Hemiptera: Cimicidae). Journal of Economic Entomology, 109(3), 1364-1368. Lilly, D. G., S. L. Doggett, C. J. Orton and R. C. Russell. 2009a. Bed bug product efficacy under the spotlight - part 1. Professional Pest Manager, February/March, 14-16. Lilly, D. G., S. L. Doggett, C. J. Orton and R. C. Russell. 2009b. Bed bug product efficacy under the spotlight - part 2. Professional Pest Manager, April/May, 14-15, 18. Lilly, D. G., S. L. Latham, C. E. Webb and S. L. Doggett. 2016b. Cuticle thickening in a pyrethroid- resistant strain of the common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae). PLOS ONE, 11(4), e0153302. Lilly, D. G., M. P. Zalucki, C. J. Orton, R. C. Russell, C. E. Webb and S. L. Doggett. 2015. Confirmation of insecticide resistance inCimex lectularius (Hemiptera: Cimicidae) in Australia. Austral Entomology, 54(1), 96-99. Moore, D. J., and D. M. Miller. 2006. Laboratory evaluations of insecticide product efficacy for control of Cimex lectularius. Journal of Economic Entomology, 99(6), 2080-2086. Studies On Insecticide Resistance In Australian Bed Bugs, Cimex spp. 287

Myamba, J., C. A. Maxwell, A. Asidi and C. F. Curtis. 2002. Pyrethroid resistance in tropical bedbugs, Cimex hemipterus, associated with use of treated bednets. Medical and Veterinary Entomology, 16(4), 448-451. Palenchar, D. J., K. J. Gellatly, K. S. Yoon, K. Y. Mumcuoglu, U. Shalom and J. M. Clark. 2015. Quantitative sequencing for the determination of kdr-type resistance allele (V419L, L925I, I936F) frequencies in common bed bug (Hemiptera: Cimicidae) populations collected from . Journal of Medical Entomology, 52(5), 1018-1027. Romero, A., M. F. Potter, D. A. Potter, and K. F. Haynes. 2007. Insecticide resistance in the bed bug: a factor in the pest’s sudden resurgence? Journal of Medical Entomology, 44(2), 175-178. Seong, K. M., D. Y. Lee, K. S. Yoon, D. H. Kwon, H. C. Kim, T. A. Klein, J. M. Clark and S. H. Lee. 2010. Establishment of quantitative sequencing and filter contact vial bioassay for monitoring pyrethroid resistance in the common bed bug, Cimex lectularius. Journal of Medical Entomology, 47(4), 592-599. Tawatsin, A., U. Thavara, J. Chompoosri, Y. Phusup, N. Jonjang, C. Khumsawads, P. Bhakdeenuan, P. Sawanpanyalert, P. Asavadachanukorn, M. S. Mulla, P. Siriyasatien and M. Debboun. 2011. Insecticide resistance in bedbugs in Thailand and laboratory evaluation of insecticides for the control of Cimex hemipterus and Cimex lectularius (Hemiptera: Cimicidae). Journal of Medical Entomology, 48(5), 1023-1030. Usinger, R. L. 1966. Monograph of Cimicidae (Hemiptera - Heteroptera). Entomological Society of America: College Park, Maryland. Yoon, K. S., D. H. Kwon, J. P. Strycharz, C. S. Hollingsworth, S. H. Lee and J. M. Clark. 2008. Biochemical and molecular analysis of deltamethrin resistance in the common bed bug (Hemiptera: Cimicidae). Journal of Medical Entomology, 45(6), 1092-1101. Zhu, F., J. Wigginton, A. Romero, A. Moore, K. Ferguson, R. Palli, M. F. Potter, K. F. Haynes and S. R. Palli. 2010. Widespread distribution of knockdown resistance mutations in the bed bug, Cimex lectularius (Hemiptera: Cimicidae), populations in the United States. Archives of Insect Biochemistry and Physiology, 73(4), 245-257. 289

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

PYRETHROID RESISTANCE IN CIMEX LECTULARIUS (HEMIPTERA: CIMICIDAE) IN GERMANY

1ARLETTE VANDER PAN, 2JÜRGEN KRÜCKEN, 1ERIK SCHMOLZ, 2GEORG VON SAMSON-HIMMELSTJERNA, AND 1CAROLA KUHN 1German Environment Agency, Boetticher Str. 2, Haus 23, 14195 Berlin, Germany 2Institute for Parasitology and Tropical Veterinary Medicine, Freie Universität Berlin, Robert-von-Ostertag-Str. 7-13, 14163 Berlin, Germany

Abstract The development of resistance against insecticides, which are primarily used for bed bug (Cimex lectularius) control, is considered to one of the main reasons for the worldwide expansion of this pest. This study provides evidence of the occurrence of resistance and the mechanisms associated with a decreased pyrethroid susceptibility of bed bugs collected in Berlin, Germany. In five of 20 bed bug field strains collected from infested apartments in Berlin, susceptibility to deltamethrin was determined in a filter contact bioassay. Maximum detected resistance ratio (Rr) was Rr>20 and considerably lower than reported from other countries. However, pyrethroid resistance was confirmed for the AS strain with Rr>20 in a simulated use-test. Pyrethroid resistance has been shown to be associated with the presence of the amino acid sequence exchanges V419L or L925I in voltage-gated sodium channel alpha-subunit gene as the target site of pyrethroids and an increased metabolic detoxification by cytochrome P450 enzymes. Pyrosequencing of genomic DNA fragments was performed in order to analyze the frequency of these polymorphisms in strains and field populations. The L925I exchange was present in 15 of 18 tested strains and populations with allele frequencies of up to 100%. Additionally, in one strain both males and females had the exchange V419L with allele frequencies up to 96%. Furthermore, each strain showed non-mutated, heterozygous and homozygous mutated bed bugs for the substitution L925I. Relative mRNA-expression levels of the four CYP-genes cyp397a1, cyp398a1, cyp4cm1 and cyp6dn1 were determined with reverse-transcription quantitative PCR (RT-qPCR) for seven bed bug strains. In four of seven strains a higher relative mRNA-expression level of cyp397a1 was detected. One strain showed higher mRNA-expression levels of cyp397a1 and cyp398a1. Key words kdr-mutation, metabolic resistance, contact bioassay, simulated use-test

INTRODUCTION Increased opportunities for dissemination and development of pyrethroid resistance are considered to be responsible for the ongoing worldwide expansion of the bed bug Cimex lectularius (Davies et al., 2012; Doggett et al., 2012). In recent years, German pest control companies have increasingly observed difficulties in controlling bed bugs using only pyrethroids (personal communications). For Germany, preliminary data about the occurrence of pyrethroid resistant bed bugs were presented at the ICUP 2014 (Vander Pan et al., 2014). Decreased susceptibility in bed bugs has been shown to be associated with the mutations V419L or L925I in the voltage-gated sodium channel α-subunit gene (Yoon et al., 2008; Zhu et al., 2010). An increased metabolic detoxification by cytochrome P450s (CYP) has been described as an additional mechanism causing pyrethroid resistance in bed bugs (Mamidala et al., 2011; Mamidala et al., 2012; Adelman et al., 2011; Bai et al., 2011; Zhu et al., 2013). The objective of the present study was to determine the presence, degree and mechanisms of pyrethroid resistance in bed bug field strains in Berlin. 290 A. Vander Pan, J. Krücken, E. Schmolz, G. Von Samson-Himmelstjerna, and C. Kuhn Pyrethroid Resistance In Cimex lectularius In Germany

MATERIALS AND METHODS Bed Bug Strains In the period 2009-2013, bed bugs were collected from 20 infested locations in Berlin. Of these 20, rearing of five bed bug field strains (SK, AS, OB, HO and LB) in the laboratory was successful. Sufficient numbers of bed bugs were obtained about one year after initial introduction into the laboratory. As a reference for the laboratory studies, the insecticide-susceptible bed bug strain of the German Environment Agency (UBA) was used, which has been kept since 1947, with several refreshments of the genetic pool. Rearing of all strains was performed as described in Vander Pan et al. (2014). Five field strains failed to breed under laboratory conditions and the remaining bed bug samples consisted of less than 20 individuals, which was insufficient for laboratory rearing in a reasonable time period. Thus, samples were frozen for further molecular analysis.

Filter Contact Bioassay The 24-well filter contact bioassay was conducted as described by Vander Pan et al. (2014)and susceptibility to deltamethrin in five field strains (SK, AS, OB, HO and LB) was determined. 50EC values were calculated by using logit analysis and resistance ratios (Rr) were determined. Statistical differences between the EC50 values of the field strains and the susceptible UBA strain were calculated with a sum of square F-Test in Graphpad Prism 6.0 and p-values were adjusted using the Bonferroni-Holm correction.

Simulated Use-Test Actual presence of pyrethroid resistance in the AS strain, which showed the highest Rr in the filter contact bioassay, was tested under conditions of practice (choice trial system), using a pyrethroid insecticide primarily used for bed bug control. The susceptible UBA strain was used as reference strain.

In the simulated use-test, a total of 100 bed bugs (equal sex ratio) in a harborage were attracted by CO2 and heat in order to mimic a host. Between the CO2 and heat source, an insecticide treated wallpaper was placed (freshly sprayed, aged for one and two weeks) over which the bed bugs were lured. The time period bed bugs spent on the treated surfaces in the test system did thus vary and corresponded to their natural seeking behavior. As control, 100 bed bugs of the AS and UBA strain in an equal sex ratio were placed in petri dishes in direct proximity to the trial system. Only the bed bugs which crossed the treated surface were included in effectiveness evaluation, animals that stayed in the harborage were neglected. Numbers of lethally affected bed bugs were determined after 24 h and afterwards daily inspected by forceps stimulation of the bed bugs for a period of seven days. Statistical differences in lethal effect between the susceptible UBA strain and the AS field strain were calculated using mid P exact tests (α=0.05) with the free online statistic software OpenEpi (version 3.03). The resulting mid P values were adjusted using Bonferroni-Holm correction.

Pyrosequencing Of Genomic DNA Pyrosequencing of genomic DNA fragments of individual (10 field strains and the UBA strain; 10 male and female bed bugs each) and pooled (18 field strains and the UBA strain; 100 male and female bed bugs each) bed bug samples was performed in order to analyze the presence of the two polymorphisms (V419L, L925I) and to evaluate the genotypes. Pyrosequencing, corresponding assays and statistics were conducted as described by Vander Pan et al. (2014).

Reverse-Transcription Quantitative PCR Relative mRNA-expression levels of the CYP genes cyp397a1, cyp398a1, cyp4cm1 and cyp6dn1 were determined using RTqPCR for seven bed bug field strains and the susceptible UBA strain (10 individual male bed bugs each, two technical repeats) using rps16, rpl8 und rpl11 as reference genes (Zhu et al., 2012). Sequence specific primer pairs used for RT-qPCR were designed as described by Zhu etal. (2012) for the three reference genes and by Adelman et al. (2011) for the four CYP genes. At the end of every extension phase, the amount of double-stranded PCR product was measured by the increase Pyrethroid Resistance In Cimex lectularius In Germany 291 in fluorescence and the quantification cycle (Cq) was determined. Relative quantitative analysis of amplification data was done using CFX Manager Software. Statistical differences (α=0.05) between the resulting mRNA expression levels of the four CYP genes from the seven strains and those from the susceptible UBA strain were calculated with a Kruskal-Wallis test and Dunn´s post hoc test.

RESULTS AND DISCUSSION

Differences in EC50 values between the UBA strain and the five field strains in the filter contact bioassay were found to be statistically highly significant p<0.0005 ( for all strains). Highest Rr was Rr>20. Furthermore, pyrethroid resistance in the AS strain (Rr>20) was confirmed in the simulated use-test, as up to 50% of the bed bugs crossing the sprayed surface survived the pyrethroid insecticide treatment. Differences in the number of lethally affected UBA and AS strain bed bugs were found to be highly statistically significant (p=0.0000021), regardless of the ageing stage of the insecticide. Pyrosequencing of pooled bed bugs showed the presence of mutation L925I in 15 of 18 examined field strains with allele frequencies up to 100%. In one of these strains, the mutation V419L was additionally detected in both males and females with allele frequencies up to 96%. Pyrosequencing of single bed bugs showed non-mutated, heterozygous as well as homozygous genotypes for the polymorphism L925I (V419L was not detected in these tests). In comparison to the UBA strain, an up to 56fold higher relative mRNA-expression level of cyp397a1 was detected in five field strains. Four of these five strains additionally showed the mutation L925I and the fifth a 4.9fold higher transcript level ofcyp398a1 . The results of the simulated use-test demonstrate that pyrethroid resistance in bed bugs is present in Germany. Moreover, different potential resistance mechanisms like mutations in the voltage-gated sodium channel and an increased metabolic detoxification by cytochrome P450s (Adelman et al., 2011, Zhu et al., 2013) have been proven in bed bugs occurring in Germany. Other xenobiotic metabolising enzymes (Zhu et al., 2013; Fountain et al., 2016) or mechanisms such as cuticle thickening (Lilly et al., 2016) have not been examined in the present study but may also have an influence on the susceptibility of bed bug strains in Germany and should be investigated in the future.

CONCLUSIONS Although the frequency of resistance-associated alleles is high and can occur in combination with an increased metabolic detoxification, Rr´s in all tested bed bug field strains were considerably lower than reported from other countries (e.g. USA Rr=5,200 (Adelman et al., 2011) and Australia Rr=432,000 (Lilly et al., 2009)). This might be due to the fact that bed bugs were reared without selection pressure in the laboratory. However, the results of the simulated use-test indicated that even bed bug populations with comparatively low Rr´s can survive a treatment with pyrethroids. This is an obvious explanation for recent reports of German pest control companies about increasing problems or failures in bed bug control using pyrethroids. Development and spread of resistant bed bugs can only be prevented with integrated control approaches including insecticide-free methods (e.g. heat treatment).

ACKNOWLEDGEMENTS We thank Sabrina Ramünke for the technical support in pyrosequencing.

REFERENCES CITED Adelman, Z.N., K.A. Kilcullen, R. Koganemaru, M.A.E. Anderson, T.D. Anderson, and D.M. Miller. 2011. Deep Sequencing of Pyrethroid-Resistant Bed Bugs Reveals Multiple Mechanisms of Resistance within a Single Population. PLoS One 6(10): e26228. doi:10.1371/ journal.pone.0026228. Bai, X., P. Mamidala, S.P. Rajarapu, S.C. Jones, and O. Mittapalli. 2011. Transcriptomics of the Bed Bug (Cimex lectularius). PLoS One 6(1): e16336. doi: 10.1371/ journal.pone.0016336. 292 A. Vander Pan, J. Krücken, E. Schmolz, G. Von Samson-Himmelstjerna, and C. Kuhn

Davies, T.G.E., L.M. Field, and M.S. Williamson. 2012. The re-emergence of the bed bug as a nuisance pest: implications of resistance to the pyrethroid insecticides. Med. Vet. Entomol. 26(3): 241-254. Doggett, S.L., D.E. Dwyer, P.F. Peñas, and R.C. Russel. 2012. Bed bugs: clinical relevance and control options. Clin. Microbiol. Rev. 25(1): 164-192. Fountain, T., M. Ravinet, R. Naylor, K. Reinhardt, and R.K. Butlin. 2016. A Linkage Map and QTL Analysis for Pyrethroid Resistance in the Bed Bug Cimex lectularius. G3: Genes|Genomes|Genetics 6(12):4059-4066. doi:10.1534/g3.116.033092. Lilly, D., S.L. Doggett, M.P. Zalucki, C.J. Orton, and R.C. Russell. 2009. Bed bugs that bite back, confirmation of insecticide resistance in the Common bed bug,Cimex lectularius. Professional Pest Manager 13: 22–24. Lilly, D.G., S.L. Latham, C.E. Webb, and S.L. Doggett. 2016. Cuticle Thickening in a Pyrethroid- Resistant Strain of the Common Bed Bug, Cimex lectularius L. (Hemiptera: Cimicidae). Vontas J, ed. PLoS ONE. 11(4):e0153302. doi:10.1371/journal.pone.0153302. Mamidala, P., S.P. Rajarapu, S.C. Jones, and O. Mittapalli. 2011. Identification and validation of reference genes for quantitative real-time polymerase chain reaction in Cimex lectularius. J. Med. Entomol. 48(4): 947-951. Mamidala, P., A.J. Wijeratne, S. Wijeratne, K. Kornacker, B. Sudhamalla, L.J. Rivera-Vega, A. Hoelmer, T. Meulia, S.C. Jones, and O. Mittapalli. 2012. RNA-Seq and molecular docking reveal multi-level pesticide resistance in the bed bug. BMC Genomics 13(6): 1-16. Vander Pan, A., C. Kuhn, E. Schmolz, J. Klasen, J. Krücken, and G. von Samson- Himmelstjerna. 2014. Studies on Pyrethroid Resistance in Cimex lectularius in Berlin, Germany. Paper presented at the Sixth International Conference on Urban Pests, H-8200 Veszprém, Pápai út 37/a, Hungary. Yoon, K.S., D.H. Kwon, J.P. Strycharz, C.S. Hollingsworth, S.H. Lee, and J.M. Clark. 2008. Biochemical and molecular analysis of deltamethrin resistance in the common bed bug (Hempitera: Cimicidae). J. Med. Entomol. 45(6): 1092-1101. Zhu, F., J. Wigginton, A. Romero, A. Moore, K. Ferguson, R. Palli, M.F. Potter, K.F. Haynes, and S.R. Palli. 2010. Widespread distribution of knockdown resistance mutations in the bed bug, Cimex lectularius (Hemiptera: Cimicidae), populations in the United States. Arch. Insect Biochem. Physiol. 73(4): 245-257. Zhu, F., S. Sams, T. Moural, K.F. Haynes, M.F. Potter, and S.R. Palli. 2012. RNA Interference of NADPH-Cytochrome P450 Reductase Results in Reduced Insecticide Resistance in the Bed Bug, Cimex lectularius. Smagghe G, ed. PLoS ONE. 7(2):e31037. doi:10.1371/journal. pone.0031037. Zhu, F., H. Gujar, J.R. Gordon, K.F. Haynes, M.F. Potter, and S.R. Palli. 2013. Bed bugs evolved unique adaptive strategy to resist pyrethroid insecticides. Sci. Rep., 3, 1456. doi:10.1038/ srep01456. 293

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

TROPICAL BED BUG INFESTATION DYNAMICS IN MALAYSIA: EVALUATION OF INSECTICIDE RESISTANCE LEVEL AND SUSCEPTIBILITY ON PYRETHROID AND CARBAMATE INSECTICIDES (HEMIPTERA: CIMICIDAE)

ABDUL HAFIZ AB MAJID AND ZULAIKHA ZAHRAN Household and Structural Urban Entomology Laboratory, Vector Control Research Unit, School of Biological Sciences, Universiti Sains Malaysia, 11800 Minden, Penang, Malaysia

Abstract Currently pest control industries are having difficulties in controlling bed bugs, specifically in workers’ dormitories and residential houses. Survey of bed bug infestations across Peninsular Malaysia by collecting sam- ples from residential houses, dormitories, hotels and motels and flats and apartments. The survey was carried out in Pulau Pinang, Perlis, Perak, Kedah, Terengganu, Kelantan, Pahang, Selangor, Negeri Sembilan, Melaka, Johor and federal territory of Kuala Lumpur. Highest number of collected species, Cimex hemipterus, resulted in Perak (24.8%) in workers’ dormitories. No bed bugs were found in Kelantan. They are known to infest mattresses, cracks and crevices of walls and floors as well as cushion seats. Collected bed bugs were then colonized in the laboratory for resistance study and mortality testing on bed bugs using natural enemies of insect, fungi as an introduction to non-chemical method in managing the insect pest. In insecticide resistance bioassay, deltamethrin and pyrethroid were used against live following protocol of World Health Organization (WHO) insecticide-impregnated papers. Triplicates of ten adult bed bugs, each replicate contained impregnated papers and the insect were left exposed for

14 days. Resistance in bed bugs were detected in AR strain (LT50 = 466.119h) after exposed to deltamethrin insec-

ticides. Propoxur was highly effective against IP strain due to the low lethal value, LT50 = 260.793h. There was a significant difference between the insecticide groups and bed bugs strains. Interaction among the strains exposed to deltamethrin also showed significant difference but not in propoxur.

Key words tropical bed bug, Malaysia, infestation dynamics, pyrethroid, carbamate, insecticide resistance.

INTRODUCTION Recent issues regarding bed bugs control in major infested houses or buildings like dorms, schools, offices including public areas were yet to be solved due to their resurgence due to rapidly develop against pesticides applied (Adelman et al., 2011; Bai et al., 2011). After DDT was banned for its extensive usage, other classes of insecticides showed reduced susceptibility in carbamate, phenylpyrazole, neonicotinoid, organothiophosphate and pyrrole which were also tested for their toxicity in controlling C. lectularius colonies in poultry facilities (Steelman et al., 2008). In Australia, bed bugs populations showed lower mortality rate in most insecticide groups except imidacloprid and pirimiphos-methyl (Lilly et al., 2015). However, resistance issue against the pyrethroid group evolved in the insects, including bed bug populations caused difficulties and possessed more challenges to suppress the infestation level. A report by Zhu et al., (2010), proved that common bed bugs in USA involved with kdr-type resistance showed no response towards deltamethrin. Field-collected strain in infested homes in Denmark also reported low efficacy in permethrin and deltamethrin while alternative insecticide, chlorpyrifos resulted in high mortality percentage (Kilpinen et al. 2011). Meanwhile, a survey conducted among pest control companies in Malaysia reported that 25% of them found that the insect became resistant against 294 Abdul Hafiz Ab Majid and Zulaikha Zahran Tropical Bed Bug Infestation Dynamics In Malaysia: Evaluation of Insecticide Resistance pyrethroid class, such as alpha-cypermethrin, deltamethrin, cyphenothrin and lambda-cyhalothrin (Abdul Hafiz and Zulaikha, 2015). Lower efficacy of chlorpyrifos also causes reinfestation to likely occur in residential houses and hotels in Kuala Lumpur. Collected tropical bed bugs in Bangkok, Phuket and Krabi of Thailand were resistant against several insecticide classes like organochlorines, carbamates and pyrethroids compared to imidacloprid and chlorfenapyr which scored higher mortality percentage of the pest (Tawatsin et al. 2011). This study is to investigate infestation levels of bed bugs across Peninsular Malaysia within the target premises, and to evaluate the resistance level in tropical bed bugs by using impregnated papers of two major classes of insecticide group; pyrethroid and carbamate while determining the status of insecticide resistance among ten populations of bed bugs in Malaysia.

MATERIALS AND METHODS Bed Bug Survey A total of 185 surveyed sites in 11 out of 13 states in Malaysia were visually inspected. The sites were categorized based on their state divisions and federal territories on the map. The 11 states were as follows: Pulau Pinang, Perlis, Kedah, Perak, Kelantan, Terengganu, Pahang, Selangor, Negeri Sembilan, Melaka, Johor including a federal territory of Kuala Lumpur. The surveys were targeted mainly in the urban areas. Each visit had a limited period of 30-45 minutes per site to collect all bed bugs found in the premises. Infestation level was determined based on number of bed bugs collected in each surveyed sites. For instance, level 1 indicates 1-10 bed bugs found, followed by 2 (11-20 bed bugs); 3 (21-30 bed bugs); 4 (31-40 bed bugs); and 5 (>41 bed bugs). The collected bugs were then marked based on different population obtained at the respective sites.

Table 1. Populations of bed bugs in the resistance bioassay. Location and population Cluster* Date Total bed bugs in Resistance status** collected both treatments Arau, Perlis (AR) 1 24 Sept 80 Unknown 2014 Ipoh, Perak (IP) 1 17 Oct 80 Highly resistant 2014 Teluk Intan, Perak (TI) 1 18 Oct 80 Resistant 2014 Hutan Melintang, Perak (HM) 1 18 Oct 80 Resistant 2014 Sg. Petani, Kedah (PY) 1 26 Sept 80 Resistant 2014 Langkawi, Kedah (PC) 1 27 Oct 80 Resistant 2014 Kuala Terengganu, Terengganu 2 20 Aug 80 Unknown (KT) 2014 Klang, Selangor (KG) 3 25 Nov 80 Resistant 2014 Port Dickson, Negeri Sembilan 4 29 Nov 80 Unknown (PD) 2014 Senawang, Negeri Sembilan (SW) 4 29 Nov 80 Unknown 2014 *Cluster: 1 (Northern region); 2 (East Coast region); 3 (Central region); 4 (Southern region) **Status on field population were in accordance with answered questionnaires by professionals and local residents. Tropical Bed Bug Infestation Dynamics In Malaysia: Evaluation of Insecticide Resistance 295

Strain Selection, Insecticide Preparation and Resistance Bioassay Ten populations were selected to evaluate resistance in them against deltamethrin and propoxur insecticides. Strains were chosen based on the resistance status from recent bed bugs control reports and questionnaires answered by the professionals in Malaysia aside from do-it-yourself treatment of the locals (Abdul Hafiz and Zulaikha 2015). They were represented by each cluster obtained from the previous sampling. The list of selected population (strains) were tabulated in Table 1. Each treatment required 40 individuals that were chosen from each population group. Insects were separated and maintained according to field population (strains). Selected bed bug populations were tested and observed for their resistance using the insecticide impregnated papers from World Health Organization (WHO) test kit. In this study, deltamethrin and propoxur were evaluated for resistance against tropical bed bugs. The papers (12 cm x 15 cm) were impregnated with 0.1% propoxur and 0.05% deltamethrin. Impregnated papers then were cut into smaller pieces (3 x 5 cm), rolled and inserted into glass test tubes of 12.5 cm x 1.5 cm. Once the bugs were exposed to the treated papers for the first 24 hours, the tubes were covered with fine net cloth to prevent them from escaping. Only adult bed bugs of laboratory strain were used in this study. All tubes were placed in a container at room condition (temperature, 25±2ºC, relative humidity, 50-60%). The resistance test was conducted following methods by Tawatsin et al. (2011). Ten adults from each population were tested by introducing them first into the test tube containing impregnated papers, deltamethrin (0.05%) or propoxur (0.1%). Each treatment was triplicated with one control. Control bugs were exposed on papers impregnated in silicone oil for deltamethrin treatment. While in propoxur treatment, control papers were treated with risella oil. Prior to the experiment, bed bugs were fed one day on expired human blood. The bed bugs were exposed for 24 hours according to the exposure period for preliminary testing and their mortality were continued and recorded for fourteen days. They were starved during the continuous bioassay. Mortality was scored based on their posture and movement in the tubes. Dead bugs were in an upside-down position with no signs of movement at all after 10 seconds of observation. Dead bed bugs were kept for further studies of resistance presence in the bugs in 70% alcohol preservation. Control groups that exceeded 10% of mortality were corrected using Abbott’s formula. Percentage of collected bugs based on locations (strains) were used for statistical analysis. Fisher’s exact test was used to calculate bed bugs infestation status according to the number of surveyed premises in each state. Chi-square test for association relating two factors, harborage sites and types of premises were analyzed statistically using SPSS Version 22.0 (IBM Corp., Armonk, NY, USA). Mortality percentage of bed bugs in each treatment was calculated and analyzed daily at 24 hours’ interval. Probit analysis was used in determining lethal time (hours) of the bugs at LT50, LT 90 and LT99 with confidence limit of 90-95%. Evaluation on lethal time were made by using software SPSS Version 22.0 (IBM Corp., Armonk, NY, USA).

RESULTS Results of Fisher’s exact test indicated that there was no significant difference between status of bed bugs infestation and number of premises in each state since, p > 0.05 (Figure 1). Tropical bed bugs were less susceptible against deltamethrin compared to propoxur. From the first until the third day of application, all populations showed low mortality within the range of 3-20% in deltamethrin treatment. After a week, both KT and HM populations reached another 20% higher than the third day of exposure. The PC population recorded the highest mortality percentage with more than 70% of the bugs died on day 10 compared to the remaining populations. On day 14, the lowest mortality percentage was observed in AR population with 40% than the others which were ranged between 60- 80%. Populations of PC and SW had high susceptibility towards deltamethrin since 90% of them were 296 Abdul Hafiz Ab Majid and Zulaikha Zahran Tropical Bed Bug Infestation Dynamics In Malaysia: Evaluation of Insecticide Resistance completely dead. However, they were still considered to be resistant against this insecticide. Survived bed bugs might be due to the factor of resistance which had developed in them from earlier chemical treatment made by the pest control operators. Meanwhile, propoxur showed high efficacy in killing bed bugs as it caused overall mortality of 90% throughout the treatment period. Only one population, TI had many dead bugs on the first day of exposure with 20% of mortality and day 3 increased to 37%. Nine other populations displayed slow mortality rate until third day of exposure, but increasingly to nearly 50% after day 7. On the 10th day, all populations had reached 80-90 mortality percentages except for the two populations, KT and HM populations. Each of them had 60% and 67% of mortality in bed bugs, respectively. There were three populations including IP, PY and PC, which had all bed bugs die on 14th day of treatment resulting in 100% of mortality. The lowest mortality percentage was found in KT population with 87% while about 90% were recorded for the other seven populations. Lethal time in hours were performed in values of LT50, LT 90 and LT99 within confidence intervals of 95% to determine the efficacy of insecticides against bed bugs (Table 2).

40 35 30 25

premises 20

of 15 10 5 Number 0

State Not infested Infested

Figure 1. Number of active infestation in all surveyed premises in Peninsular Malaysia.

The results showed that the efficacy of each insecticide class were different in each population of bed bugs. A few populations had high LT50 values which were linked to resistance factor. In deltamethrin treatment, the highest LT50 values was detected in AR population with 466.119h since there were 60% of survivors on day 14. Increasing LT50 values were also exhibited in the following populations; TI, PD, IP, KT and SW. Their lethal time values were ranged between 216.162-328.166h, to kill 50% of bed bug populations using deltamethrin. However, three populations such as KG, HM and PY had decreased LT50 values with 207.201h, 203.391h and 200.593h, respectively. The lowest lethal value was found in PC population where LT50 = 164.068h, resulting in the most susceptible population to deltamethrin. Exposure on impregnated papers of propoxur demonstrated that half of the population were most susceptible after eight days of treatment for all tested populations. About 153.032h was required to kill 50% of IP population which indicated lowest LT50 value compared to the others. Another population exhibited low resistance among bed bugs was TI population with 158.754h. The remaining eight populations had increasing lethal time values but were still considered to have low resistance since up to 30-53% of bed bugs were killed within 7-8 days of exposure period. Populations of PY, PD, HM,

PC, AR, KG and SW had LT50 values of 168.238h, 177.739h, 178.756h, 190.135h, 191.67h, 195.85h and 199.483h. KT population however, had the lowest percentage of mortality and thus, had highest LT50 value in the population with 203.334 h (Table 2). Tropical Bed Bug Infestation Dynamics In Malaysia: Evaluation of Insecticide Resistance 297

Table 2. Comparison of lethal hours of 2 insecticides on 10 populations of bed bugs.

Insecticide Popula- Slope ± SE LT 50 (hours) LT 90 (hours) LT 99 (hours) group tion Deltamethrin TI 3.530 ± 1.431 284.804 463.274 688.802 (Pyrethroid) (240.644- (379.422- (492.113- 328.166) 947.871) 2515.216) IP 2.320 ± 0.954 260.793 468.215 754.473 (232.406- (393.439- (563.208- 289.819) 664.890) 1403.948) SW 3.354 ± 1.383 237.864 343.034 462.348 (216.162- (314.216- (397.345- 254.595) 399.939) 620.013) AR 5.924 ± 2.377 466.119* 933.355* 1643.948* (no time interval) (no time interval) (no time interval) PD 4.114 ± 1.671 264.429 376.335 501.796 (239.107- (342.284- (425.178- 283.148) 455.285) 723.230) PY 3.248 ± 1.293 200.593 400.629 704.157 (95.664-249.387) (342.782- (514.451- 589.981) 2245.255) KG 2.136 ± 0.882 207.201 393.510 663.832 (170.238- (339.133- (505.724- 233.596) 522.291) 1183.800) KT 2.108 ± 0.860 247.848 549.310 1050.986 (173.481- (404.198- (619.948- 307.909) 1650.044) 8425.492) HM 1.862 ± 0.777 203.391 385.057 647.902 (173.900- (332.895- (501.074- 227.031) 496.535) 1060.090) PC 1.901 ± 0.798 164.068 301.371 494.759 (120.478- (259.628- (388.286- 193.927) 382.042) 830.287) 298 Abdul Hafiz Ab Majid and Zulaikha Zahran Tropical Bed Bug Infestation Dynamics In Malaysia: Evaluation of Insecticide Resistance

Propoxur TI 2.492 ± 1.048 158.754 280.187 445.237 (Carbamate) (116.636- (245.834- (360.467- 186.392) 340.010) 695.171) IP 1.644 ± 0.735 153.032 224.445 306.698 (143.223- (209.445- (275.686- 162.228) 245.345) 356.010) SW 2.684 ± 1.119 199.483 307.926 438.687 (172.598- (280.695- (375.006- 219.028) 354.980) 585.523) AR 2.557 ± 1.075 191.670 290.600 407.987

(159.364- (261.759- (342.834- 213.146) 347.293) 591.645) PD 3.697 ± 1.485 177.739 334.460 559.993 (69.581-226.661) (284.997- (431.029- 438.197) 1565.418) PY 3.266 ± 1.408 168.238 231.404 300.083 (142.984- (212.569- (265.020- 184.959) 260.921) 382.786) KG 3.597 ± 1.505 195.850 269.887 350.520 (171.461- (251.511- (314.812- 212.711) 296.361) 424.036) KT 1.677 ± 0.681 203.334 591.646 1413.259 (133.444- (441.068- (817.121- 251.892) 1236.819) 6474.890) HM 1.672 ± 0.672 178.756 376.324 690.455 (139.948- (324.764- (525.655- 207.008) 481.492) 1175.958) PC 4.465 ± 1.895 190.135 250.897 314.544 (168.293- (234.988- (284.094- 204.621) 275.576) 381.439)

DISCUSSION Pyrethroid-based insecticide currently was widely used in Malaysia for treating bed bug infestation (Abdul Hafiz and Zulaikha, 2015). Therefore, via resistance bioassay on strains of bed bugs accumulated across Peninsular Malaysia, we observed that deltamethrin was less effective in controlling the pest. Populations of tropical bed bugs in Sri Lanka also had similar results after exposing them on papers impregnated with permethrin and deltamethrin for 24 hours, each KT50 recorded ranges within 0.5-24 hours and 2.5-47 hours respectively (Karunaratne et al., 2007). Effective doses (ED50) values in treated bugs in Thailand although higher compared to other urban pest, triggered their defensive mechanism against pyrethroid-based insectide which were bifenthrin and alpha-cypermethrin (Suwannayod et al. 2010). While C. hemipterus showed resistance towards pyrethroid insecticide, C. lectularius have already established theirs in many European countries (Lilly et al., 2015; Goddard, 2013; Romero et al., 2007). Rarely reports on tropical bed bugs were published especially on their susceptibility towards chemical pesticides. Sydney strain, Australia showed common bed bugs were highly resistant against permethrin (1 235 000 times), deltamethrin (370 000 times) and bendiocarb (250 times) due to their high LD50 values compared to other insecticide groups based on the study conducted by Lilly et al. Tropical Bed Bug Infestation Dynamics In Malaysia: Evaluation of Insecticide Resistance 299

(2015). Upon their act of resistance on pyrethroid insecticides, bed bugs seemed to thicken their cuticle as a defensive mechanism which was positively correlated to knockdown time as well as in 24 hours’ survivor bugs (Lilly et al., 2016). In contrast, observation on mortality rate among strains in Malaysia was much higher when exposed to propoxur, carbamate-based insecticide. Significant interaction between percentages of mortality to the lethal time of the insect was detected regardless of strains, showing the insecticide was also susceptible to resistant strains. Minimum number of days required for 50% of the population to be lethal was 6.4 days, whereas 58.8 days indicated as maximum estimation of time needed for lethal values of 99% (LT50 = 153.302h, LT99 = 1413.259h). Reports from Thailand and Sri Lanka claimed that there was resistance issue in the field strains tested with propoxur (Tawatsin et al., 2011; Karunaratne et al., 2007). Observation on 24 hours’ exposure at a concentration of 0.8% displayed 45.5% of the insect were survived in a population regardless of their growth stages. It can be concluded via this study that tropical bed bugs, C. hemipterus were highly susceptible against propoxur insecticide. Low lethal values indicated the insecticide was effective in killing these bugs. Pyrethroid- based active ingredient, deltamethrin however, was expected for their low efficacy towards resistant bugs. Malaysian Pest Control Professional can refer the results as their general guideline in controlling the pest population, while considering main active ingredients in their new products.

REFERENCES CITED Abdul Hafiz, A. M., and Z. Zulaikha. 2015. Resurgence of Tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae) Infestation in Malaysia: Control strategies and challenges faced by Urban Pest Control Operator (PCO). J Entomol Zool Stud. 3(3): 419-422. Adelman, Z. N., K. A. Kilcullen, R. Koganemaru, M. A. Anderson, T. D. Anderson, and D. M. Miller. 2011. Deep sequencing of pyrethroid-resistant bed bugs reveals multiple mechanisms of resistance within a single population. PLoS One 6 (10): e26228. Bai, X., P. Mamidala, S. P. Rajarapu, S. C. Jones, and O. Mittapalli. 2011. Transcriptomics of the bed bug (Cimex lectularius). PLoS One 6(1): e16336. Goddard, J. 2013. Laboratory assays of various insecticides against bed bugs (Hemiptera: Cimicidae) and their eggs. J. Entomol. Sci. 48(1):65-69. Karunaratne, S. H. P. P., B T. Damayanthi, M. H. J. Fareena, V. Imbuldeniya, and J. Hemingway. 2007. Insecticide resistance in the tropical bedbug Cimex hemipterus. Pestic. Biochem. Physiol. 88(1): 102-107. Kilpinen O., M. Kristensen, and K. V. Jensen. 2011. Resistance differences between chlorpyrifos and synthetic pyrethroids in Cimex lectularius population from Denmark. Parasitol. Res. 109(5):1461–1464. Lilly, D. G., M. P. Zalucki, C. J. Orton, R. C. Russell, C. E. Webb, and S. L. Doggett. 2015. Confirmation ofinsecticide resistance inCimex lectularius Linnaeus (Hemiptera: Cimicidae). Australia. Austral Entomology. 54(1): 96–99. Lilly, D. G., S. L. Latham, C. E. Webb, and S. L. Doggett. 2016. Cuticle thickening in a pyrethroid- resistant strain of the common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae). PLoS One. 11(4): e0153302. Romero, A., M. F. Potter, D. A. Potter, and K. F. Haynes. 2007. Insecticide resistance in the bed bug: a factor in the pest’s sudden resurgence? J. Med. Entomol. 44(2): 175-178. 300 Abdul Hafiz Ab Majid and Zulaikha Zahran

Steelman, C. D., A. L. Szalanski, R. Trout, J. A. McKern, C. Solorzano, and J. W. Austin. 2008. Susceptibility of the bed bug Cimex lectularius L. (Heteroptera: Cimicidae) collected in poultry production facilities to selected insecticides. J. Agric. Urban Entomol. 25(1): 41–51. Suwannayod, S., Y. Chanbang, and S. Buranapanichpan. 2010. The life cycle and effectiveness of insecticides against the bed bugs of Thailand. Southeast Asian J. Trop. Med. Public Health. 41(3): 548-554. Tawatsin, A., U. Thavara, J. Chompoosri, Y. Phusup, N. Jonjang, C. Khumsawads, P. Bhakdeenuan, P. Sawanpanyalert, P. Asavadachanukorn, M. S. Mulla, and P. Siriyasatien. 2011. Insecticide resistance in bedbugs in Thailand and laboratory evaluation of insecticides for the control of Cimex hemipterus and Cimex lectularius (Hemiptera: Cimicidae). J. Med. Entomol. 48(5): 1023-1030. Zhu, F., J. Wigginton, A. Romero, A. Moore, K. Ferguson, R. Palli, M. F. Potter, K. F. Haynes, and S. R. Palli. 2010. Widespread distribution of knockdown resistance mutations in the bed bug, Cimex lectularius (Hemiptera: Cimicidae), populations in the United States. Arch. Insect Biochem. Physiol. 73(4): 245–257.] 301

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

THEORY AND PRACTICE OF INSECTICIDE RESISTANCE MANAGEMENT: INSIGHTS FOR PUBLIC HEALTH VECTOR CONTROL

MARK HOPPÉ Chair IRAC Public Health Team, Syngenta Crop Protection, 4332 Stein, Switzerland

Abstract Insecticide resistance can be defined as, a heritable change in the sensitivity of a pest population that is reflected in the repeated failure of a product to achieve the expected level of control when used according to the label recommendation for that pest species. There have been large gains in the fight against malaria, with a 40% reduction in the incidence of clinical cases since 2000. A significant proportion of this reduction has been attributed to the use of insecticidal vector control interventions. However, there is a growing concern that these gains are threatened by insecticide resistance in the anopheline vectors of malaria. Whilst there are currently only four insecticide classes recommended by WHOPES for adult mosquito control, initiatives are underway to facilitate and expedite the development and introduction of novel mosquito adulticides. It is argued that insecticide resistance management, or “insecticide susceptibility maintenance” programmes, need to be implemented to maintain the utility of the novel and effective vector control interventions being developed. It is further argued that such programmes can only be effectively implemented in the context of a wider Integrated Vector Management programme.

Key words Mosquito, Malaria.

INTRODUCTION Insecticide resistance can be defined as, a heritable change in the sensitivity of a pest population that is reflected in the repeated failure of a product to achieve the expected level of control whenused according to the label recommendation for that pest species (IRAC 2011). It has been around almost as long as the use of insecticides. For insects, it is a continuation of their evolutionary struggle to overcome the insecticidal and inhibitory compounds in their environment, and produced by the organisms they interact with and feed on. Almost 60 years ago Brown (1958) wrote, “In July 1956 a WHO Expert Committee on Insecticides noted that the problem of insecticide resistance was growing more rapidly than the necessary measures to deal with it”. In the same year, Hammerstrom (1958) reported that “insect resistance is internationally recognized by leading health authorities as the most important problem facing organized vectorborne disease control programs today”. Unfortunately, both Brown and Hammerstrom’s statements remain equally relevant today. Whilst the first observations of insecticide resistance were made in agricultural pests in 1914 (Melander, 1914), over the next forty years the majority of reports describe insecticide resistance in public health pests. However, as Spiller (1958) pointed out, agriculture had not escaped the “infliction” of insecticide resistance, but that public health pests were often easier to maintain in the laboratory and 302 M. Hoppé Theory And Practice Of Insecticide Resistance Management had shorter life cycles, which facilitated their study. Whilst agricultural pests were more challenging to maintain, requiring the “tedious diversion” of rearing plants for them to feed upon, and hence their study had been neglected. THESIS Insecticide susceptibility is lost in an insect population when individuals with a heritable trait that allows them to survive an insecticide based intervention, or which suffer less of a fitness cost when exposed to the intervention, pass on the genes for that trait to the next generation. At first there may be a very small proportion of the population that express the trait, however, if the population is further exposed to the selection by the insecticide based intervention, then the less susceptible proportion will increase and eventually the intervention may fail to deliver the desired level of control. An insecticide resistance management (IRM) programme therefore has the aim of maintaining the proportion of the population that survive, below that which would cause the intervention to fail to deliver the desired level of control. To minimise selection pressure, the target pest population should not be continually exposed to a given insecticide, or insecticides with the same mode of action. This forms the basis for all IRM programmes, which recommend rotating, or using mosaics, of insecticides with different modes of action, or using mixtures of insecticides (WHO 2012; Onstad, 2014). To facilitate the identification of which insecticides have the same mode of action, the Insecticide Resistance Action Committee (IRAC) has developed a numerical classification system (Sparks and Nauen, 2015). IRM should therefore be a simple exercise in the use of insecticides with different modes of action in a structured programme. However, the practicalities and logistics of insect pest control add multiple layers of complication. Since 2000 there has been a 40% reduction in the incidence of clinical malaria, with an estimated 663 million clinical cases averted. 87% of this gain has been attributed to large scale mosquito adulticide based vector control interventions. (Bhatt et al, 2015). Insecticide based vector control therefore plays a key role in the prevention of malaria. However, this great achievement is considered by many to be under threat by ever increasing levels of insecticide resistance in the anopheline vectors of malaria. IRAC identifies 27 insecticidal modes of action. However, currently only four subclasses of insecticide have sufficiently desirable characteristics for use in vector control, and meet the criteria for recommendation by the WHO Pesticide Evaluation Scheme (WHOPES). Only one of which, the pyrethroids, are currently recommended for use in Long-Lasting Insecticide treated Nets (LLINs). With the admirable aim of universal access to LLINs, for those at risk of malaria, mosquito populations in malaria endemic regions face almost constant selection pressure for pyrethroid resistance. It is therefore not surprising that susceptibility to pyrethroids in many Anopheles species is falling. There are reports of pyrethroid resistant mosquitoes entering damaged LLINs and successfully taking blood meals (Ochomo et al., 2013). It has also been reported that when a malaria control programme in Ghana switched from pyrethroid to organophosphate based residual wall spraying (IRS), the incidence of parasitemia fell (Ricks, 2015). Whilst not demonstrating a causal link between pyrethroid resistance and a reduction in malaria control, there is strong evidence that it could be a problem. Although, in late 2016 the WHO stated that there was no evidence that pyrethroid resistance was impacting malaria indices in areas where LLINs were widely used (WHO, 2016). There are numerous reports of insecticide resistance in agricultural pests, with the Arthropod Pesticide Resistance Database containing 4276 reports of insecticide resistance in the Lepidoptera alone (2017). However, a steady stream of novel insecticides have been developed, enabling, in most cases, effective pest control to be re-established. The relative ease with which insecticides from different mode of action classes can be used in crop husbandry facilitates the implementation of IRM programmes. Multiple generations of a given pest species need not be exposed to selection from the same class of insecticides. In contrast, an LLIN is designed to remain effective for three years, exposing multiple generations of mosquito to the same insecticide. Theory And Practice Of Insecticide Resistance Management 303

The paucity of insecticidal modes of action available for adult mosquito control has a number of root causes, including an unattractive return on investment. Historically, insecticides were developed that had both agricultural and public health utility. However, in recent decades, regulatory pressure and environmental concerns have focused development on those with a limited spectrum and characteristics that are less suitable for use as mosquito adulticides. To address this, a number of initiatives have been initiated with the aim of developing novel solutions for the control of malaria vectors. These include public private partnerships that aim to facilitate the research and development required to deliver novel insecticide solutions and expedite the transition of novel vector control concepts to effective interventions (Hemingway et al., 2006). It is anticipated that the next decade will see a number of adulticides brought to market, to which mosquitoes resistant to the current recommended insecticide classes are susceptible. To enable the greatest utility to be derived from novel mosquito adulticides, a programme of resistance management should be developed and implemented to coincide with their initial deployment. However, IRM should not be considered alone, but only in the context of Integrated Vector Management (IVM). IVM has been defined by the WHO as “a rational decision-making process for the optimal use of resources for vector control. The approach seeks to improve the efficacy, cost-effectiveness, ecological soundness and sustainability of disease-vector control. The ultimate goal is to prevent the transmission of vector-borne diseases” (WHO, 2014). Vector control is not sustainable if the limited number of effective interventions are lost to resistance development. IRM is therefore implicit in the requirement for sustainability of vector control. IVM should not be considered an activity to overlay an existing insecticide based vector control programme, but insecticide based vector control should only be used as a component of an IVM programme. Mosquito adulticides should be part of a holistic approach that embraces all activities, including larvicides, which reduce mosquito populations, and minimise their interaction with humans. This will not only increase the effectiveness of the vector control programme, but will also help to minimise the selection of resistance. An effect IRM programme requires an understanding of the susceptibility status of the target population to the available insecticidal modes of action, to identify the most appropriate insecticide to use. Currently, there is a limited choice of insecticidal modes of action available, and evidence of insecticide resistance, it is therefore appropriate to identify which insecticides still provide a satisfactory level of control, i.e. which are not resisted at the target application rate. However, when novel insecticidal modes of action become available, measuring smaller changes in the susceptibility of the population becomes a vital tool in the “susceptibility maintenance” programmes that should be implemented to gain the greatest utility from a given class of insecticide. This shift from resistance to susceptibility monitoring may require novel tools and strategies to be developed and deployed. It may also require the training of the practitioners who undertake the susceptibility monitoring, and of those who use the information to design and implement IRM programmes. The insecticide susceptibility status of a mosquito species may change significantly between geographically dispersed populations. It is therefore important to regularly characterise it over the entire range of the insecticide intervention. Changes in susceptibility to the available insecticidal tools can then be identified, and remedial steps taken before reduced susceptibility becomes widely spread, or intensifies further. During the development of a novel insecticide, it is imperative to identify whether there is any cross resistance with existing insecticides. Cross resistance occurs when the mechanisms that reduces the susceptibility of an insect to one insecticide, confer reduced susceptibility to a second insecticide. To undertake cross resistance studies in the field with experimental insecticides can be problematic. However, maintaining resistant mosquito populations for use in laboratory studies, whilst not having the “tedious diversion” of the need to rear plants, is highly challenging in its own right. Therefore, to facilitate the timely evaluation of cross resistance, and to identify whether novel insecticides effectively control 304 M. Hoppé Theory And Practice Of Insecticide Resistance Management all relevant field populations, a collaborative effort between the insecticide research and development, and the wider vector control communities needs to take place. A good understanding of the susceptibility status of all important mosquito species and populations is therefore not only vital for implementing effective IRM, but also in the expeditious development of novel insecticides, on which vector control and IRM rely.

CONCLUSION Through the implementation of IRM, or “insecticide susceptibility maintenance”, in the context of IVM, vector control programmes can be made more resilient to insecticide resistance development. The ongoing initiatives facilitating the development of novel vector control insecticides, and expediting their transition to effective vector control interventions, may be a once in a generation opportunity. It is therefore vital that the utility of new public health tools is maintained for as long as possible through their use in such “resistance resilient” vector control programmes.

REFERENCES CITED Arthropod Pesticide Resistance Database. 2017. http://www.pesticideresistance.org (Jan. 31, 2017) Bhatt S., D. Weiss, E. Cameron, D. Bisanzio, B. Mappin, U. Dalrymple, K. Battle, C. Moyes, A. Henry, P. Eckhoff, E. Wenger, O. Briët, M. Penny, T. Smith, A. Bennett, J. Yukich, Eisele T., J. Griffin, C. Fergus, M. Lynch, F. Lindgren, J. Cohen, C. Murray, and D Smith. 2015. The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015. NATURE. 526: 207-211. Brown A. 1958. The insecticide-resistance problem: a review of developments in 1956 and 1957. Bulletin of the World Health Organization. 18: 309-321. Hammerstrom R.J. 1958. Insect resistance to insecticides. Public Health Reports. 73(12):1126-1132. Hemingway J., B.J. Beaty, M. Rowland, T.W. Scott, and B.L. Sharp. 2006. The Innovative Vector Control Consortium: improved control of mosquito-borne diseases. TRENDS in Parasitology. 22.7: 308-312. IRAC. 2011. Prevention and Management of Insecticide Resistance in Vectors of Public Health Importance. http://www.irac-online.org/documents/irm-vector-manual (Jan. 28, 2017). Melander, A.L. 1914. Can insects become resistant to sprays? J. Econ. Entomol. 7:167-173. Spiller D. 1958. Resistance of Insects to Insecticides. New Zealand Entomologist. 2: 34–51. Ochomo E., N. Bayoh, E. Walker, B. Abongo, M. Ombok, C. Ouma, A. Githeko, J. Vulule, G. Yan, and J. Gimnig. 2013. The efficacy of long-lasting nets with declining physical integrity may be compromised in areas with high levels of pyrethroid resistance. Malaria Journal. 12: 368-378 Onstad D.W. (Editor) 2014. Insect Resistance Management (Second Edition). Academic Press, London, U.K. Ricks P. 2015. The Importance of Insecticide Resistance Monitoring to Maintain IRS Program Effectiveness, PMI Experiences in Northern Ghana. http://slideplayer.com/slide/8980543/ (Jan. 31, 2017) Sparks T. and R. Nauen. 2015. IRAC: Mode of action classification and insecticide resistance management. Pesticide Biochemistry and Physiology. 121: 122-128. WHO. 2012. Global Plan for Insecticide Resistance Management in Malaria Vectors. Geneva, Switzerland: World Health Organization. Geneva, Switzerland.

Theory And Practice Of Insecticide Resistance Management 305

WHO. 2014. Integrated Vector Management (IVM). http://www.who.int/neglected_diseases/ vector_ecology/ivm_concept/en/ (Jan. 24, 2017) WHO. 2016. Implications of insecticide resistance for malaria vector control. WHO/HTM/ GMP/2016.8.rev. World Health Organization. Geneva, Switzerland. 307

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

RESISTANCE RISK ASSESSMENT IN FIELD-COLLECTED STRAINS OF THE GERMAN COCKROACH (DICTYOPTERA: BLATTELLIDAE) TO FIPRONIL AND INDOXACARB BAITS

1,2LING-HUI ANG AND 1CHOW-YANG LEE 1Urban Entomology Laboratory, Vector Control Research Unit, School of Biological Sciences, Universiti Sains Malaysia, 11800 Penang, Malaysia. 2Present address: Imaspro Resources Sdn Bhd, 37 Jalan 5, Kawasan 16, Taman Intan, 41300 Klang, Selangor, Malaysia.

Abstract The German cockroach, Blattella germanica (L.) is an important urban insect pest world-wide. Heavy reliance and frequent usage of residual insecticides have led to the development of insecticide resistance in the German cockroach. Bait formulations containing fipronil and indoxacarb are excellent resistance management tools against insecticide-resistant cockroaches. Despite that they have been used for nearly a decade, there are limited studies on the quantitative assessment of the development of fipronil and indoxacarb resistance in B. germanica. This study was carried out to assess the risk of resistance development towards fipronil and indoxacarb baits in three field-collected German cockroach populations (Boat Quay, Cavenagh and Ghimmoh strains) from Singapore, based on laboratory bait selection. These strains were each divided into two groups, one group selected with fipronil bait, while the other one selected with indoxacarb baits. After continuous selection for 7 generations,

there were 9–11.2 fold increase in the LD50 of fipronil, and 24.1–68.7 fold increase in LD50 of indoxacarb, when compared to their parental generations. The realized heritability (h2) of fipronil resistance ranged from 0.336 – 0.600, whereas indoxacarb resistance was in range of 0.197–0.475. The estimated slopes and h2 were not correlated and all the possible combinations of these estimates provided prediction that it will take between 3.2 and 21.3 generations, and between 1.5 and 16.9 generations to achieve 10-fold increase in resistance to fipronil and indoxacarb, respectively, under a selection pressure of 50–90% mortality. This is the first study on resistance risk assessment in the German cockroach to fipronil and indoxacarb baits using multiple field strains. The outcome of this study provides useful information to the pest management industry towards preventing or delaying insecticide resistance development to baits in B. germanica.

Key words Realized heritability, resistance development, selection, insecticide resistance.

INTRODUCTION The German cockroach, Blattella germanica (L.), is one of the most important cosmopolitan urban insect pest (Rust et al., 1995; Lee, 2007). Frequent usage and heavy reliance on insecticides have led to the development of insecticide resistance in this species (Cochran, 1995; Hemingway et al., 1995; Lee et al., 1996; Wei et al., 2001; Chai and Lee, 2010). Fipronil and indoxacarb are commonly used toxicants in cockroach baits. Earlier reports have recorded the occurrence of physiological-based resistance of fipronil (Holbrook et al., 2003; Kristensen et al., 2005; Gondhalekar and Scharf, 2012; Ang et al., 2013) and indoxcarb (Gondhalekar et al., 2011; Ang et al., 2014) in the German cockroach. Assessing resistance risk is an important component of integrated pest management (IPM) and resistance management program. Resistance risk can be assessed via artificial selection in the laboratory (NRC, 1986) and subsequent quantitative genetic analyses of the data. By considering that resistant/ susceptive to an insecticide is a threshold trait, the realized heritability is estimated based on actual inter-generational responses to selection to predict the speed and potential amount genetic 308 Ling-Hui Ang and Chow-Yang Lee Resistance Risk Assessment In Field-Collected Strains Of The German Cockroach changes in future generations (Firko and Hayes, 1990; Hartl, 1988). Tabashinik (1992) suggested that brief selection experiments (4–6 generations) may effectively detect the potential for resistance development. Too short selection experiment might produce an unreliable estimated heritability because of the short-term random changes in insect population and experimental errors (Firko and Hayes, 1990). In this study, we assessed the resistance risk development of fipronil and indoxacarb using laboratory bait selection method against three strains of field-collected populations of B. germanica from Singapore, and subsequently predicted the risk of resistance development of these two toxicants with the estimated realized heritability.

MATERIALS AND METHODS Cockroach strains. The cockroaches used were the Boat Quay, Cavenagh Road and Ghimmoh Road strains from Singapore. The resistance profiles of these strains were previously described in Chai and Lee (2010) and Ang et al. (2013). A laboratory susceptible strain (EHI) was used as comparison. All cockroaches were reared under laboratory conditions of 26 ± 1ºC, 60 ± 5 % RH and photoperiod (12:12, L:D) with food and water provided ad libitum. Chemicals. Technical grade insecticides fipronil (PestAnal, Sigma-Aldrich Laborachemikalien GmBh, Munich, Germany) and indoxacarb (Sigma-Aldrich Sdn. Bhd., Kuala Lumpur, Malaysia) were used in topical assay. The Goliath® gel bait (Bayer Environmental Sciences, Singapore) containing 0.05% fipronil and Advion® gel (Syngenta Crop Protection, Malaysia) containing 0.6% indoxacarb were used for bait selection and evaluation. Selection for resistance. The method used for the selection experiment was identical to that described in Ang et al. (2013). Groups of nymphs (approximately ten thousand individuals each) from the three cockroach strains was selected with fipronil bait, while the other group was treated with indoxacarb bait. The EHI susceptible strain was reared without any exposure to the baits as control (unselected). Approximately 3 g of gel bait was provided for 24 – 48 hour, without the presence of alternative food. After the treatment, the bait was removed, and dried dog food and water were introduced to the survivors. Offspring of the survivors were tested for susceptibility to the insecticides using topical assays. Cockroaches were selected based on the described procedure for up to the 7th generation. Topical bioassays. One to 3 weeks old adult males were topically treated with a series of concentrations of fipronil diluted in acetone using a microapplicator (Burkard Scientific Ltd., Middlesex, United Kingdom). The control set was treated with one µl of acetone. All treated cockroaches were transferred into a clean petri dish (90 mm diam. x 15 mm height) provided with dog food and a wet cotton ball. Mortality was scored at 48 hours post-treatment. Data analysis. Data were pooled and subjected to probit analysis using POLO-PC (LeOra, 1997).

Resistance ratio (RR50) was determined by comparing the LD50 of selected population with those of the susceptible one. Estimation of realized heritability. The heritabilities of resistance to indoxacarb and fipronil in B. germanica were estimated as realized heritability (h2) based on a threshold trait analysis method up to 7th selected generation using the equation:

where R is the response to selection and S represents the selection differential (Tabashnik, 1992; Falconer, 1989). The h2 values were calculated separately for three selected populations. Resistance Risk Assessment In Field-Collected Strains Of The German Cockroach 309

The R value, the difference in mean phenotype (insecticide tolerance level) between progeny of selected parents and the whole parental generation prior to selection, was calculated based on a formula:

where the final LD50 is the lethal dose of progeny of the selected cockroach population at 50% mortality after n generations of selection, the initial LD50 is the lethal dose of parental generation at 50% mortality and R is the average selection response of single generation.

The S value, the difference in mean phenotype (insecticide tolerance level) between the selected parents and the whole parental generation, was estimated as

where i is the intensity of selection and is the phenotypic standard deviation. The i value was estimated from p, the percentage of surviving individual after selection by using Falconer and Mackay

(1996), based on the properties of the normal distribution. The phenotypic standard deviation (σp) was estimated as the reciprocal of the mean of the estimated slopes of the probit regression lines from the parental generation (initial slope) and the progeny after n generations of selection (final slope):

Projected rates of resistance development. The future response of selection (R) can be estimated as the multiplication of heritability (h2) and selection differential (S),

Using the response of selection of the three laboratory-selected cockroach populations, the number of generations that required for a 10-fold increasing in LD50, G, is the reciprocal of R, can be predicted with 2 different selection pressure (S), phenotypic standard deviation (σp) and heritability (h ).

RESULTS

After 7 generations of selection, there were increase of 9–11.2 folds in LD50 of fipronil (Figure 1) and

24.1–68.7 folds in LD50 indoxacarb (Figure 2), compared with the parental generation. The selection response R and selection differential S of fipronil resistance in the three selected populations were estimated to be 0.136–0.150 and 0.25–0.42, respectively. The estimated realized heritability (h2) of fipronil resistance ranged from 0.336 to 0.600 (Table 1). On the other hand, withR of 0.197–0.262, and S of 0.53–1.12, indoxacarb resistance was found to develop in the three selected populations with h2 of 0.197–0.475 (Table 1). There was no apparent correlation between the mean slopes and h2 among the strains for both fipronil and indoxacarb (Table 1). 310 Ling-Hui Ang and Chow-Yang Lee Resistance Risk Assessment In Field-Collected Strains Of The German Cockroach

Table 1. Estimation of response to selection (R) and selection differential (S) of fipronil- and indoxacarb-selected population of the German cockroach.

Estimation of selection Estimation of response to selection differential Strain h2 Initial LD Final LD Mean 50 50 R σ S (95% FL) (95% FL) slope p Fipronil-selected Boat Quay 0.07 (0.05–0.09) 0.75 (0.62–0.86) 0.147 5.71 0.18 0.25 0.600 Cavenagh Road 0.15 (0.09–0.27) 1.69 (1.28–2.00) 0.150 3.35 0.30 0.42 0.360 Ghimmoh Road 0.11 (0.09–0.13) 0.99 (0.69–1.22) 0.136 3.45 0.29 0.41 0.336 Indoxacarb-selected 21.85 760.86 Boat Quay 0.220 1.26 0.80 1.12 0.197 (15.24–30.34) (534.80–1031.96) 41.24 993.20 Cavenagh Road 0.197 2.67 0.38 0.53 0.376 (35.17–50.03) (809.31–1251.67) 10.47 719.03 Ghimmoh Road 0.262 2.54 0.39 0.55 0.475 (7.97–14.91) (586.04–859.48)

The projected rates of resistance development for fipronil and indoxacarb were estimated based on realized heritability (h2) and selection differential (S). Figure 3 shows the effect of three different realized heritabilities (based on current study) on the number of generations required for a 10-fold increase in

LD50 of fipronil at different selection intensities (i). Figure 4 shows effect of three different realized heritabilities (based on current study) on the number of generations required for a 10-fold increase in

LD50 of indoxacarb at different selection intensities (i). It would take 1.5–16.9 generations for a 10-fold 2 increase in LD50 of indoxacarb at different combination of slopes and estimated h (Figure 4).

Resistance Risk Assessment In Field-Collected Strains Of The German Cockroach 311

Figure 1. Development of fipronil toxicity in fipronil-selectedB. germanica from parental to F7 generations (Results for parental to F5 generations had been reported in Ang et al. 2014). The error

bars represent the range of the observed LD50.

Figure 2. Development of indoxacarb toxicity in indoxacarb-selected B. germanica from parental to F7 generations (Results for parental to F5 generations had been reported in Ang et al. 2014). The error bars represent the range of the observed LD50. 312 Ling-Hui Ang and Chow-Yang Lee Resistance Risk Assessment In Field-Collected Strains Of The German Cockroach

Figure 3. Effect of three different realized heritability [(a) h2 = 0.600, (b) h2 = 0.360, and (c) h2

= 0.336] on the number of generations required for a 10-fold increase in LD50 of fipronil at three different slopes and different selection mortality (i). The three values of h2 and slopes used were those obtained from the three populations. The lines with enlarged symbols are predictions based on the combination of estimated slopes and h2 of each population. Resistance Risk Assessment In Field-Collected Strains Of The German Cockroach 313

Figure 4. Effect of three different realized heritability [(a) h2 = 0.475, (b) h2 = 0.376, and (c) h2 =

0.197] on the number of generations required for a 10-folds increase in LD50 of indoxacarb at three different slopes and different selection mortality (i). The three values of h2 and slopes used were those obtained from the three populations. The lines with enlarged symbols are predictions based on the combination of estimated slopes and h2 of each population. 314 Ling-Hui Ang and Chow-Yang Lee Resistance Risk Assessment In Field-Collected Strains Of The German Cockroach

DISCUSSION We predicted that fipronil and indoxacarb resistance would increase at the rate of 34 – 60 % and 20 – 48 % of the selection differential, respectively. In this study, the range of estimated h2 of fipronil resistance in the three fipronil-selected cockroach strains was 0.336 to 0.600, which was higher than that of rice stem borer, Chilo suppressalis (Walker) to fipronil (h2 = 0.213) (Huang et al., 2010). In the case of indoxacarb resistance, the estimated h2 in the selected cockroach populations was 0.197 to 0.475, which was higher than that of tobacco budworm, Heliothis virescens (Fabrius) (h2 = 0.03) (Sayyed et al., 2008), but was comparable with that of cotton bollworm, Helicoverpa armigera (Hubner) (h2 = 0.45) (Ghodki et al., 2009). We used three strains to diversify the responses from different cockroach populations with varying resistance allele frequency. These strains were previously reported to carry 302Ser resistance allele (Rdl mutation), responsible for fipronil resistance at the varying frequencies (Boat Quay = 17.5%, Cavenagh Road = 35.0% and Ghimmoh Road = 12.5%) (Ang et al. 2013). No relationship between the initial frequency of resistance allele and the realized heritability was detected. However, Tabashnik (1992) reported that the initial resistance allele frequency did play significant role in estimatingh 2 in first few generations of selection. This could likely due to the existence of some addition variations such as modifier loci (Firko and Hayes, 1990). The effects of this variation are normally diverse among different cockroach strains. Hence, it is important to use multiple strains to determine selection responses with different genetic backgrounds. In this study, we used realized heritability (h2 = 0.336–0.600 for fipronil resistance, h2 = 0.197–0.475 for indoxcarb resistance) to predict the rate of resistance development with all possible combinations of different probit slopes based on different selection intensities (Figure 3 and 4). We found that the 10-folds increase in LD50 of fipronil can happen within only three generations, while it can take up to 21 generations if the selection pressure is low. Similar situation was observed in the selection using indoxacarb bait. There are some limitations and biases when accounting artificial selection experiment for insecticide resistance traits. Rosenheim (1991) described three processes that can result in over- and underestimating of heritability; the difference in receiving doses by different individuals, sublethal effects of insecticide after exposure (reduced fitness components) and unequal selection of males and females. If there is negative pleiotropic effect between resistance and fitness components, insecticide selection shall result in reduced fitness and this may lead to underestimation in resistance response. Our earlier study demonstrated that these strains showed absence of fitness penalty (Ang et al., 2011). In this study, we reduced the bias by only using the immature stages to prevent premating selection of reproductive individuals. If artificial selection was done on the adults of both sexes which mating may occur before the selection, this may result in the S value become smaller for males compared to females due to the possible difference of tolerance distribution of both sexes (Rosenheim, 1991). This study demonstrated for the resistance risk assessment of fipronil and indoxacarb gel baits on German cockroaches for the first time. The information obtained from this study will assist in developing an effective IPM program against this species, and to prevent the development of physiological-based resistance towards these two toxicants.

REFERENCES CITED Ang, L.H. and C.Y. Lee. 2011. Absence of fitness penalty in insecticide-resistant German cockroaches, Blattella germanica (L.) (Dictyoptera: Blattellidae). Int. J. Pest Manag. 57: 195-204. Resistance Risk Assessment In Field-Collected Strains Of The German Cockroach 315

Ang, L.H., W.A. Nazni, M.K. Kuah, A.C. Shu-Chien, and C.Y. Lee. 2013. Detection of the A302S Rdl mutation in fipronil bait-selected strains of the German cockroach (Dictyoptera: Blattellidae). J. Econ. Entomol. 106: 2167 – 2176. Ang, L.H., W.A. Nazni, and C.Y. Lee. 2014. Indoxacarb resistance in the German cockroach, Blattella germanica (L.) (Dictyoptera: Blattellidae) after subjected to bait selection. In: Mueller, G., R. Pospischil, and W.H. Robinson (eds). Proceedings of the 8th International Conference on Urban Pests. Zurich, Switzerland. Hungary: OOK-Press Kft, 399 – 403. Chai, R.Y. and C.Y. Lee. 2010. Insecticide resistance profiles and synergism in field populations of the German cockroach (Dictyoptera: Blattellidae) from Singapore. J. Econ. Entomol. 103: 460 – 471. Cochran, D.G. 1995. Insecticide resistance. In: Rust, M.K., Owens, J.M. and Reierson, D.A. (eds.) Understanding and Controlling the German cockroach. New York: Oxford University Press, 171-192. Gondhalekar, A.D. and M.E. Scharf. 2012. Mechanisms underlying fipronil resistance in a multiresistant field strain of the German cockroach (Blattodea: Blattellidae). J. Med. Entomol. 49: 122 – 131. Gondhalekar, A.D., C. Song, and M.E. Scharf. 2011. Development of strategies for monitoring indoxacarb and gel bait susceptibility in the German cockroach (Blattodea: Blattellidae). Pest Manag. Sci. 67: 262 – 270. Falconer, D.S. 1989. Introduction to quantitative genetics. New York: Wiley. Falconer, D.S. and T.F.C. Mackay. 1996. Introduction to Quantitative Genetics. New York: Longman. Firko, M.J. and J.L. Hayes. 1990. Quantitative genetic tools for insecticide resistance risk assessment: Estimating the heritability of resistance. J. Econ. Entomol. 83: 647 – 654. Ghodki, B.S., S.M. Thakare, M.P. Moharil, and N.G.V. Rao. 2009. Genetics of indoxacarb resistance in Helicoverpa armigera (Hubner). Entomol. Res. 39: 50e54. Hartl, D.L. 1988. A primer of population genetics. Massachusetts, Sunderland: Sinauer. Hemingway, J., S.J. Dunbar, A.G. Monro, and G.J. Small. 1993. Pyrethroid resistance in German cockroaches (Dictyoptera: Blattellidae): resistance levels and underlying mechanisms. J. Econ. Entomol. 86: 1631 – 1638. Holbrook, G.L., J. Roebuck, C.B. Moore, M.G. Waldvogel, and C. Schal. 2003. Origin and extent of resistance to fipronil in the German cockroach,Blattella germanica (L.) (Dictyoptera: Blattellidae). J. Econ. Entomol. 96: 1548 – 1558. Huang, Q., Y. Deng, T. Zhan, and Y. He. 2010. Synergistic and antagonistic effects of piperonyl butoxide in fipronil-susceptible and resistant rice stem borers, Chilo suppressalis. J. Insect Sci. 10: 182. Kristensen, M., K.K. Hansen, and K.-M.V. Jensen. 2005. Cross-resistance between dieldrin and fipronil in German cockroach,Blattella germanica (Dictyoptera: Blattellidae). J. Econ. Entomol. 1305 – 1310. Lee, C.Y. 2007. Perspective in urban insect pest management in Malaysia. Vector Control Research Unit, Universiti Sains Malaysia, Penang. 316 Ling-Hui Ang and Chow-Yang Lee

Lee, C.Y., H.H. Yap, N.L. Chong, and R.S.T. Lee. 1996. Insecticide resistance and synergism in field-collected German cockroaches (Dictyoptera: Blattellidae) from Peninsular Malaysia. Bull. Entomol. Res. 86: 675-682. LeOra. 1997. Probit and logit analysis, California: LeOra Software. NRC (National Research Council). 1986. Pesticide resistance: strategies and tactics for management. Washington DC: National Academies Press. Rosenheim, J.A. 1991. Realized heritability estimation for pesticide resistance traits. Entomol. Exp. Appl. 58: 93 – 97. Rust, M.K., J.M. Owens, and D.A. Reierson (eds.) 1995. Understanding and Controlling the German cockroach. New York: Oxford University Press. Sayyed, A.H., M. Ahmad, and N. Crickmore. 2008. Fitness costs limit the development of resistance to indoxacarb and deltamethrin in Heliothis virescens (Lepidoptera: ). J. Econ. Entomol. 101, 1927-1933. Tabashnik, B.E. 1992. Resistance risk assessment: realized heritability of resistance to Bacillus thuringiensis in diamondback moth (Lepidoptera: Noctuidae), and Colorado potato beetle (Coleoptera: Chrysomelidae). J. Econ. Entomol. 85: 1551 – 1559. Wei, Y., A.G. Appel, W.J. Moar, and N. Liu. 2001. Pyrethroid resistance and cross-resistance in the German cockroach, Blattella germanica (L.). Pest Manag. Sci. 57: 1055 – 1059. 317

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

DETERMINING THE SOURCE OF HOUSE FLIES (MUSCA DOMESTICA) USING STABLE ISOTOPE ANALYSIS

KATHARINA HEINRICH, HOWARD BELL, AND ROBERT WEAVER Fera Science Ltd (Fera), National Agri-Food Innovation Campus, Sand Hutton, York, YO41 1LZ, UK

Abstract Intensive livestock units frequently produce flies in large numbers that, on migration, cause nuisance to the occupants of neighbouring dwellings.The resolution of such problems is often reliant on the unequivocal identification of the origin of the flies, particularly when several potential sources exist. This study evaluated stable isotope analysis as a method for differentiating adult house flies (Musca domestica (L.)) on the basis of their dietary history so as to determine their likely source. Flies were reared in the laboratory on several substrates, including chicken and cattle manure, laboratory diet and household vegetable waste. Different fly parts (wings, heads, and legs) and whole flies were analysed immediately after eclosion and after 10 days. The 13δ C and δ15N values for adults that had developed on each diet type were highly distinct. Stable isotope analysis, therefore, shows potential to be employed to determine the likely source of various nuisance insects, and to contribute to the abatement of such problems.

Key words Nuisance insects, stable isotopes, EA-IRMS, intensive livestock, dietary history

INTRODUCTION House flies (Musca. domestica), and other muscids, are a perennial problem associated with intensive livestock rearing facilities throughout the world. Flies also emerge from a range of other sources, notably domestic waste, carcasses and landfill sites. When conditions are optimal, large livestock units are a significant source of flies, which can often migrate to nearby premises. These flies can constitute a nuisance to affected householders and also pose a significant health risk due to the carriage of pathogenic organisms such as Campylobacter, Escherichia coli, Salmonella, and others. Persuading the management of suspected source facilities to abate the problem can often prove difficult for enforcement bodies as it is challenging to unequivocally prove that the suspected source is actually the premises generating the insects causing the nuisance problem, especially when several potential sources are found in close proximity. The analysis of tissues using Elemental Analyser - Isotope Ratio Mass Spectrometer (EA-IRMS) techniques has proven to be extremely effective as an ecological tool for the identification of animal migration patterns and feeding habits (Hood-Nowotny and Knols, 2007). Stable isotope analysis has also demonstrated to be an effective technique elucidating the dietary histories of several insect species (Patt et al., 2003). The current project was designed to provide baseline data to examine the potential for the exploitation of IRMS as a method for determining the origin of nuisance insects such as house flies. This initial work is based entirely on laboratory-reared flies, but builds a platform for a full assessment of this method using flies derived from the field. The potential applications for this technique in the context of resolving nuisance insect issues in the UK and elsewhere, are discussed. 318 K. Heinrich, H. Bell, and R. Weaver Determining The Source Of House Flies Using Stable Isotope Analysis

MATERIALS AND METHODS Adult flies were derived from a laboratory strain (Cooper) held at 25°C, 16:8 hours light:dark photoperiod and 70% relative humidity. Larvae were reared on a medium of bran, grassmeal, yeast, malt and milk powder (40:20:10:3:3) made up to a paste with water. On emergence, adults were held in 30 x 30 x 30 cm screen cages and provided with powdered milk, sugar and water ad libitum. Eggs were collected though placement of milk-saturated cotton wool swabs into adult cages which were subsequently collected ca. 12-14 hours after the start of oviposition. New larval cultures were initiated through seeding approximately 1000 eggs into 250 g of diet, using the conditions described for adult flies. A series of diets were used to raise flies of potentially different stable isotope ratios. These were (i) standard laboratory diet (as described above), (ii) standard laboratory diet to which corn oil had been added (25% w/w), (iii) chicken manure (from an intensive egg production unit), (iv) cattle manure (from cattle kept on deep litter straw and fed maize silage) and (v) meat-free household waste consisting of liquidised potato peelings, carrot peelings and onion skins (4:1:1 by weight). Approximately 50% of the insects were culled within 24 hours of emergence (D0) and immediately frozen at -20°C whilst the remaining adults were held in screen cages and provided with sugar water only (10% w/v cane sugar) for a further 10 days (D10). Prior to stable isotope ratio determination, insects were dissected to provide samples of wings, heads and legs. The various body parts and whole insect samples were dried overnight in a Savant Speed-Vac. Cohorts of whole insects (n = 10-15) were milled to a fine powder using a ball mill (Retsch MM400), whilst the other body parts were analysed without further preparation. Each sample was weighed into tin-foil capsules with a minimum of three replicates prepared for each diet and fly type. In the case of wings and legs, appendages from ca. 10-20 flies were required to provide sufficient tissue whilst 2-3 heads were used for each determination. Isotope ratio mass spectrometry was used to determine the 15N/14N and 13C/12C ratio of fly body parts, by calibration against reference materials of known isotope ratios. The IRMS system comprised of a GV Instruments IRMS (Isoprime Ltd, Manchester, UK), fitted with an elemental analyser combustion interface (Fisons1108) and operated with MassLynx Inorganic 4.0i software. Stable isotope ratios are expressed in per mil [‰] units, according to the following formula:

where X and Y represent the heavier and the lighter isotope, respectively. The international standards V-PDB (Vienna-Pee Dee Belemnite) for δ13C and AIR for δ15N are referred to; which are defined as 0 ‰ on the respective δ-scale. The uncertainty of measurements using IRMS is typically ± 0.2 ‰. The trophic shift of δyX diet to insect body is calculated by using the following formulae: δyX trophic shift: Δinsect−diet = δyX insect − δyX diet where y is an isotope and X is an element.

Data was analysed using one way analysis of variance (ANOVA) to examine the 15N/14N and 13C/12C ratios of the diets and the flies produced by the different feeding regimes for a given time point (D0 or D10). Means were subsequently separated by Tukey-Kramer post hoc tests. Analysis was conducted using GraphPad Prism 5.0. Determining The Source Of House Flies Using Stable Isotope Analysis 319

RESULTS AND DISCUSSION Significant differences in the δ13C and δ15N values for the different diets, and the D0 flies (whole, milled) that had developed on them were obtained (Table 1). The δ-values for whole milled adult M. domestica immediately after emergence (D0) indicated that 13C and 15N were, with one exception, more abundant in the adult flies than in the diets that they had developed upon. Enrichment with the heavier isotope is commonly observed between trophic levels and an increase of 0.4 ‰ (+/- 1.3 ‰ SD) in δ13C and 3.4 ‰ (+/- 1 ‰ SD) in δ15N is estimated (Post, 2002), values that were reflected in the “producer” (manure) - consumer (fly larvae) relationship, observed in the present study.

Table 1. δ13C and δ15N values [‰] for diets and Musca domestica reared on these respective diets, and the enrichment of δ13 C and δ15 N from diet to insect. The determinations were made for each diet type from a pooled sample of 10-15 whole flies. The uncertainty of measurements is typically ±0.2‰. For each isotope, values followed by different letters within each column are significantly different (one- way ANOVA, P<0.05).

Isotope Diet Diet M. domestica (D0) Trophic isotope isotope values [‰] shift (relative to values standards) [‰] Δinsect-diet [‰] δ13C (vs SLD* -26.9 ± -23.0 ± 0.1a 3.7 V-PDB) 0.1a Chicken -26.5 ± -27.3 ± 0.1b -0.8 manure 0.1a Corn-oil / -21.2 ± -19.9 ± 0.1c 1.7 SLD 0.2b Cattle -22.5 ± -21.4 ±0.1d 1.5 Manure 0.1c House- -27.3 ± -25.7 ± 0.1e 1.6 hold 0.1a waste Cane -11.7 ± sugar 0.1 δ15N (vs SLD* 3.8 ± 9.1 ± 0.1a 5.3 AIR) 0.1a Chicken 18.4 ± 21.8 ± 0.1b 3.3 manure 0.2b Corn-oil / 3.6 ± 6.6 ± 0.1c 3.0 SLD 0.2ac Cattle 8.2 ± 10.9 ± 0.1d 2.7 Manure 0.2d House- 3.5 ± 8.7 ± 0.2e 5.1 hold 0.2c waste *SLD = Standard Laboratory Diet 320 K. Heinrich, H. Bell, and R. Weaver Determining The Source Of House Flies Using Stable Isotope Analysis

A positive isotopic shift of 2.9 to 5.1‰ for δ13C, indicative of increasing 13C abundance, was recorded in all flies that had been kept on a cane sugar diet for 10 days post emergence, regardless of larval diet upon which they had been reared. The diet switch affected the δ15N values of whole flies differently compared to fly body parts and no general trend was observed. Scatterplots correlating the δ15N and δ13C values for whole flies, wings, legs and heads illustrate how the values change as flies age (Figures 1A-D). By correlating15 δ N and δ13C values, for whole milled flies (n = 10 to 15), full differentiation of their origin was achieved (Figure 1A). Whilst, in many cases, the source of insects may be very obvious and readily identifiable through visual inspections, in some situations several alternative locations could be serving as breeding sites for flies. Given that different livestock facilities vary widely in their standards of hygiene, animal husbandry and production methods, knowledge of where flies are actually coming from provides useful information for any enforcement agency tasked with resolving such issues.

Figure 1. The correlation between the δ13C values and δ15N values for (A) whole flies, (B) wings, (C) legs and (D) heads. Error bars indicate two standard deviations of the mean values for a minimum of three determinations. Key to diets: SLD = standard laboratory diet, CO-SLD = Corn oil / standard laboratory diet, Ch M = chicken manure, CM = cattle manure, HH = household waste. Determining The Source Of House Flies Using Stable Isotope Analysis 321

The observed changes in isotopic signatures as flies age would indicate that13 δ C and δ15N signatures will be variable within a given M. domestica population, even when they have identical larval dietary histories, due to the variable ages of the insects present. However, the degree that flies will vary needs to be substantiated in scenarios that reflect the situations where M. domestica naturally develops. In these situations the adult fly will feed on a range of substrates, including the one that it had developed upon as a . The differences in the stable isotope ratios of insects that derive from certain substrates, such as chicken manure, were so different that, even after a prolonged period of feeding on a completely different adult diet, with no access to the larval substrate, the isotopic ratios still remained distinct. Whilst the data presented here clearly indicates that the source of nuisance flies could be determined through correlating stable isotope ratios with potential developmental substrates, further experiments are required to cater for the broad range of diets that are exploited by house flies. It will be also necessary to monitor the isotope ratios of these substrates over time to identify possible fractionation, caused by decomposition or fermentation. In particular, a factor that must be considered is that animal manures tend to become isotopically heavier as, for example, volatilisation of 14N ammonia is kinetically favoured over that of 15N ammonia (Bateman and Kelly, 2007).

CONCLUSIONS The results of this study are promising and demonstrate that flies can be readily differentiated on the basis of their larval diet. As such, stable isotope analysis could be employed to resolve the more intractable cases of insect nuisance, where the source of insects and, therefore, the responsible premises, are subject to a degree of doubt. Whilst M. domestica was used here as a model, the strength of this technique would allow to ascertain the dietary history of a range of other nuisance and peridomestic pests, such as mosquitoes, other dipteran species and cockroaches, and consequently determine where they have issued from. ACKNOWLEDGEMENTS The authors are grateful to Mr Martin Liversidge and Mr P. Kershaw for allowing us to collect manure samples from their farms and make them available for other studies. Financial support for this project was provided by Defra / Temple Group.

REFERENCES CITED Bateman A.S. and S.D. Kelly. 1988. Fertilizer nitrogen isotope signatures. Isotopes in Environmental and Health Studies. 43: 237-247. Hood-Nowotny R. and B.G.J. Knols. 2007. Stable isotope methods in biological and ecological studies of arthropods. Entomologia Experimentalis et Applicata. 124: 3-16. Post D.M. 2002. Using stable isotopes to estimate trophic position: Models, methods, and assumptions. Ecology. 83: 703-718. Tooker J.F. and L.M. Hanks. 2004. Trophic position of the endophytic beetle, aethiops Smith (Coleoptera : ). Environmental Entomology. 33: 291-296. 323

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

COMPARISON OF NUMBER OF LIMNOPHYES NATALENSIS (DIPTERA: CHIRONOMIDAE) COLLECTED WITH STICKY AND SUCTION LIGHT TRAPS IN FOOD FACTORY

1GORO KIMURA, 2KIMIO HIRABAYASHI, AND 1TSUTOMU TANIKAWA 1Technical Research Laboratory, Ikari Shodoku Co., Ltd., 579 Chibadera, Chuo-ku, Chiba, 260-0844 Japan 2Institute of Textile and Science, School of Science and Technology, Academic Assembly, Shinshu University, 3-15-1 Tokida, Ueda, Nagano 386-8567 Japan

Abstract Adult Limnophyes natalensis were collected using sticky and suction light traps during the course of a year in a Japanese food factory. Such physical control methods have been demonstrated effective for collecting adult midges. The numbers of adult L. natalensis collected with the two methods were compared by season. A total of 121 were collected over eight nights with the sticky light trap, and 194 were collected with the suction light trap, a significantly higher number. The numbers were not significantly different for winter. These results demonstrate that suction light traps are more effective for collecting adult midges in food factories.

Key words Chironomid midges, nuisance, physical control, sticky light trap, suction light trap

INTRODUCTION Although Chironomidae are not listed as a household pest as are Diptera (Ito, 1982), adult chironomids can contaminate materials and final products in pharmaceutical and food processing factories (Tabaru et al., 1987). While they typically originate outdoors (e.g., Matsuzaki and Buei, 1993; Hattori and Moriya, 1996). Colonization and massive numbers of Limnophyes natalensis (Kieffer) in Japanese food factories have been reported (Kimura et al., 2010, 2014). Genus Limnophyes is terrestrial and semi- terrestrial (Pinder, 1995), and L. natalensis have been reported to breed in rivers and streams (Sæther, 1990). An investigation at a certain food factory discovered L. natalensis larva in the organic residue from the drains and machines (Kimura, unpublished). Kimura et al. (2014) used a special light trap to investigate the abundance and flight activity of adult L. natalensis in a food factory and found that the thermal conditions affected both on a daily basis (Kimura et al., 2014). While chemical insecticides are frequently used to control midge population, biological and physical control methods have also been used (Failla et al., 2015). Methods for controlling L. natalensis have not yet been established, because chemical control has been avoided in Japanese pharmaceutical and food factories, and biological control is not realistic in such environments. A more promising approach to controlling the adult L. natalensis population is to use light traps because this species exhibits phototactic behavior (Kimura et al., 2014). In the study reported here, we compared the effectiveness of using sticky and suction light traps in a food factory as an ecological approach to the effective physical control of L. natalensis. 324 G. Kimura, K. Hirabayashi, and T. Tanikawa Comparison of Number of Limnophyes natalensis Collected

MATERIALS AND METHODS Study Site The food factory is in Chiba City, Chiba Prefecture, Japan and usually operates from 08:00 to 18:00. The lights are normally off from 18:00 to 08:00. Data on the seasonal abundance and flight behavior of L. natalensis in this factory were given by Kimura et al. (2014).

Collection of L. natalensis The sticky light trap (Optclean VI, Ikari Shodoku Co., Ltd.) was equipped with a 20-W black fluorescent lamp (Figure 1), the suction light trap (Clean Eco Line GXmini, Ikari Shodoku Co., Ltd.) equipped with two 10-W black fluorescent lamps (Figure 2). Both were installed 1.0 m above the floor, with a distance of 5.0 m between them. They were operated from 17:00 to 8:00 over the course of a year (2013), and their locations were switched at the start of each sampling period: spring (March 19–20 and 21–22; vernal equinox on March 20), summer (June 20–21 and 21–22; summer solstice on June 21), autumn (September 21–22 and 22–23; autumnal equinox on September 23), and winter (December 21–22 and 22–23; winter solstice on December 22). The sticky sheet and insect net were replaced after each sampling period.

20-W black fluorescent lamp 188 mm188

Sticky sheet

719 mm Figure 1. Structure of sticky light trap.

Intake duct 10-W black fluorescent lamps 477 mm477 Insect net (inside)

Outlet with filter 430 mm

Figure 2. Structure of suction light trap. Comparison of Number of Limnophyes natalensis Collected 325

Room air temperature was continuously measured with a temperature and humidity sensor (TH-001, Ikari Shodoku Co., Ltd.) each sampling period. The mean room air temperature ranged from 13.1±6.8°C (December 21–23) to 19.5°±0.7C (June 20–22), averaging 17.2 ± 4.6°C. The mean air temperature during the early morning hours (4:00–8:00) did not fall below 7.4°C at any time (Figure 3). The L. natalensis were counted using a binocular dissecting microscope.

Data analysis

All statistical tests were performed using SPSS version 11.5.1.J for Windows (SPSS Japan Inc.).

35 ) 30 ( ℃ 25 20 15 spring 10 summer 5 autumn Air temperature winter 0 0:00 1:00 2:00 3:00 4:00 5:00 6:00 7:00 8:00 9:00 0:00 1:00 2:00 3:00 4:00 5:00 6:00 7:00 8:00 11:00 17:00 18:00 19:00 20:00 21:00 22:00 23:00 10:00 12:00 13:00 14:00 15:00 16:00 17:00 18:00 19:00 20:00 21:00 22:00 23:00 Time

Figure 3. Air temperature in food factory by season. Shaded areas indicate times light traps were in operation.

RESULTS AND DISCUSSION A total of 121 (male:female=78:43) adult L. natalensis were collected during the sampling periods with the sticky light trap, 194 (123:71) were collected with the suction light trap (Table 1). The sex ratio was biased towards male for each trap. The number collected with by suction light trap was significantly higher than the number collected with the sticky light trap (Binomial test, p < 0.01). The number was the highest for summer (sticky light trap: 68/collected over two nights; suction light trap: 95/collected over two nights), followed by autumn (34 and 54), spring (13 and 32), and winter (6 and 13). The number collected with the suction light trap was significantly higher for each season (Binomial test, spring: p < 0.01; summer and autumn: p < 0.05), except for winter (Table 1). As mentioned above, the thermal conditions affect the abundance and flight activity of adult L. natalensis on a daily basis. Adult L. natalensis were collected in the morning, when the mean air temperature was higher than 7.4°C (Kimura et al., 2014). Therefore, the daily flight activity of L. natalensis showed two peaks (morning and evening) from spring to autumn, with only an evening peak in winter (Kimura et al., 2014), which agrees with the low number collect in winter. These results demonstrate that suction light traps are more effective than sticky light traps for collecting adult midges in food factories. However, sticky light traps have been traditionally used in Japanese food factories because the sticky sheets prevent dispersal of insect debris and reduce insect contamination. The suction light trap used in this study has become widely used in Japanese food factories as a means of physical control because it is equipped with a filter to control the dispersal of insect debris (Figure 2). 326 G. Kimura, K. Hirabayashi, and T. Tanikawa Comparison of Number of Limnophyes natalensis Collected

Table 1. Number of adult L. natalensis collected using suction and sticky light traps.

Sampling period Suction light trap Sticky light trap (17:00–8:00) M F Total M F Total

March 19–20 8 1 A 8 1 a 32 13 March 20–21 20 3 3 1

June 20–21 29 32 B 23 12 b 95 68 June 21–22 17 17 16 17

September 21–22 8 1 B 16 7 b 54 34 September 22–23 29 16 8 3 December 21–22 8 0 4 2 13 6 December 22–23 4 1 0 0 A a Total 123 71 194 78 43 121 Aa，Bb: Values with different superscript in same row are significantly different in binomial test (Aa: p < 0.01; Bb: p < 0.05)

It has been shown that the attraction of chironomid species to a light source is directly proportional to light intensity (Ali et al., 1984, 1986; Hirabayashi et al., 1993). The suction light trap (Clean Eco Line GX, Ikari Shodoku Co., Ltd.) we used has a powerful light souse two 20-W black fluorescent lamps. This trap has been widely used in Japanese food factories as a means of physical control. The chironomid species responded more to the quantity of light than to the quality of light (Ali et al., 1984, 1986; Hirabayashi et al., 1993). There is little information about their attraction to the visible light of a LED. Kimura et al. (2014) demonstrated that chironomid midges are equality attracted to a white fluorescent lamp (emitting UV light) and a white LED lamp (not emitting UV light). Hirabayashi et al. (2016) reported that chironomid midges are attracted to several colors of LEDs, with a green LED being the most attractive, followed by a white fluorescent lamp, white LED, UV LED, red LED, and blue LED. Further research on the manipulation of wavelength should be undertaken to obtain a better understanding of how chironomid midges can be effectively controlled in food factories.

ACKNOWLEDGEMENTS We express sincere thanks to Mr. Nobuyuki Miyazawa and Mr. Satoshi Motosugi at Ikari Shodoku Co. Ltd., for their generous support and assistance during the investigation period.

REFERENCES CITED Ali, A., S.R. Stafford, R.C. Fowler, and B.H. Stanley. 1984. Attraction of adult Chironomidae (Diptera) to incandescent light under laboratory conditions. Environ. Entomol. 13: 1004-1009. Ali, A., B.H. Stanley and P.K. Chaudhuri. 1986. Attraction of some adult midges (Diptera: Chironomidae) of Florida to artificial light in the field. Fla. Entomol. 69: 644-650. Failla, A.J., A.A. Vasquez, M. Fujimoto, and J.L. Ram. 2015. The ecological, economic and public health impacts of nuisance chironomids. Aquat. Invas. 10: 1-15 Hattori, K. and K. Moriya. 1996. Fukaigaichu to sono kujyo revised edition. Kanagawa: Japan Environmental Sanitation Center (In Japanese) Hirabayashi, K., R. Nakazato, A. Ohara, and T. Okino. 1993. A study on phototaxis for adult Chironomidae (Diptera) by artificial light in Lake Suwa. Response of adult chironomid midges to near ultraviolet and visible light. Jpn. J. Sanit. Zool. 44: 33-39. Comparison of Number of Limnophyes natalensis Collected 327

Hirabayashi, K., M. Higashino, Y. Taniguchi, and M. Yamamoto. 2016. Field research on phototaxis of aquatic insects from a small canal by light emitting diode and fluorescent lamps –focus on response of adult chironomid midges. Jpn. J. Environ. Entomol. Zool. 27: 43-52. (in Japanese and English abstract) Ito, S. 1982. Diptera- found in the house. House and Household Insect Pest, 13, 14: 64-68. Kimura, G., K. Hirabayashi, and T. Tanikawa. 2014. Flight behavior of Limnophyes natalensis (Diptera: Chironomidae) within a food factory. In: Müller, G., Pospischil, R., and Robinson, W.H. (eds.) Proceedings of the Eighth International Conference on Urban Pests, Hungary: OOK- Press. Kimura, G., T. Harunari, E. Inoue, K. Hirabayashi, and T. Tanikawa. 2010. Emergence time and period of chironomid midges occurring from an indoor drainage. Rep. Res. Edu. Ctr. Inlandwat. Environ. 6: 109-113. Kimura, G., T. Harunari, Y. Houkita, K. Kamezawa, and T. Tanikawa. 2014. Insects attracted to light emitting diodes (LED) lamps and cold cathode fluorescent lamps. Urban Pest Mgt., 4, 15- 21. (in Japanese and English abstract) Matsuzaki, S. and K. Buei. 1993. Toshi gaityu hyakka. Tokyo: Asakura shoten (In Japanese) Pinder, L.C.V. 1995. The habitats of chironomid larvae. In: Armitage, P.D., Cranston, P.S., and Pinder, L.C.V., eds., The Chironomidae: the Biology and Ecology of Non-biting Midges, London: Chapman & Hall Sæther, O.A. 1990. A review of the genus Limnophyes Eaton from the Holarctic and Afrotropical regions (Diptera: Chironomidae, ). Entomol. Scand. Suppl. 35: 1-139. Tabaru, Y., K. Moriya, and A. Ali. 1987. Nuisance midges (Diptera: Chironomidae) and their control in Japan. J. Am. Mosq. Contol Assoc. 3: 45-49. 329

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

ROLE OF LED LIGHTS IN THE DESIGN OF ULTRA-VIOLET LIGHT TRAPS FOR HOUSE FLY MONITORING AND CONTROL

MATTHEW GREEN Rentokil-Initial PLC Foundry Court, Foundry Lane, Horsham, West Sussex. RH13 5PY

Abstract The light emitting diode (LED) lamp market is predicted to experience massive growth over the next decade. Outside the domestic lighting sector there are a number of specialist uses for LED technology that have warranted research into specific frequencies of light emission. Ultra-violet (UV-A waveband) LEDs are becoming powerful enough to offer a credible alternative light source to the fluorescent lamps currently used in ultra-violet light traps for the monitoring or control of flying insects in urban environments. Whilst there are significant energy savings to be made in employing this technology, other differences between LEDs and fluorescent lamps can be exploited to maximise their characteristics of light emission to catch flying insects. The hypothesis that an insect light trap using a UV-A LED luminaire can be as efficient at removing a known number flies from an environment as a light trap using fluorescent lamps is tested using common chasses with spectroscopy and replicated bioassays.

Key words House fly, Musca domestica, spectral sensitivity, visual response

INTRODUCTION In 2015, the global price of LED bulbs was estimated to have fallen by 30-40% and by 2016 the global LED lighting market exceeded $30.5 billion US dollars (Anon, 2016). With the rise in domestic use of LED lighting manufacturers have sought to expand market share by leveraging technology into related niche markets including ultra violet (UV) and infrared (IR) applications. The largest market for UV LEDs is in ink curing, a rapid polymerisation process that fixes inks to surfaces that requires neither water nor solvents. The ink curing market is curiously fortuitous for the future of insect light traps in that the frequencies of UV light commonly used to fix ink (365nm wavelength) is close to a peak in spectral sensitivity in the visual apparatus of the house fly, Musca domestica (Goldsmith and Hernandez, 1968) UV-A mercury phosphor lamps have been used in commercial insect light traps for over 40 years (Roberts, 1990) and such units are commonplace in commercial and industrial setting, particularly those handling foodstuffs. Mercury phosphor lamps have a non-negligible environmental impact, even in relatively niches uses as insect light traps and are subject to increasing regulation such as the European Union’s recent Restriction on Hazardous Substances II (RoHS II) regulation, the implementation of which saw a shift from lamps emitting peak UV-A wavelength at 350 nm to those emitting at a peak of 365 nm due to the quantities of lead used to attenuate the output. There are important waste considerations for Pest Management Companies too; each lamp has a functional life of approximately one year, after which it degrades to a point where the peak wavelength has shifted and the intensity declined to a level that no longer draws flies to the trap having been saturated by ambient light. 330 M. Green Role Of LED Lights In The Design Of Ultra-Violet Light Traps

House flies are an important urban disease vector (Davies, 2016) that are controlled or monitored with insect light traps by pest management companies that will respond to changes in change number or species by proofing to restrict the insects’ access to the area in question or remove them from the environment where ingress is inevitable. Quantifiable measurements from these traps that purport to effect catch rate are often quoted as de facto figures for their efficacy, including total lamp power, UV-A output and lethal surface area. Whilst there is certainly some evidence to support the maximisation of these measurements (Pickens and Thimijan, 1986) previous studies and suggest that various design factors that may negate any advantages gained through such efforts (Hanley et al., 2009; Green, 2011; Jones et al., 2017). Light emission spectrographic variation between the LED and fluorescent luminaires from previous (unpublished) studies shows that under known ambient light levels (400LUX) the shape of UV-A light cone produced by an LED luminaire differs from that of that of three 15 W UV-A fluorescent lamps mounted in an identical chassis. The ‘forward facing’ directional nature of LEDs throws light further away from the trap. The aim of this work was to derive a relative efficacy rank from a consistent series of tests that enables direct comparison between LED and fluorescent luminaires operating on the same trap chasses. Removing flies from the environment as fast as possible is seen as the most important factor for the end user (Sargent, 2010) to reduce the risk to human health. This is the role of light traps when used to monitor areas where risk is low and hazard is high (usually traps with adhesive surfaces to aid identification for origin and cause/point of ingress); and when they are used as a control device in areas where risk is high and hazard is low (areas with direct access to the external environment where high voltage grids are employed in light traps). Catch rate in this study was quantified by estimating the best possible time to catch 50% of flies within a room. A significant amount of prior investigation into catch rates forMucsa domestica has centred on UV light wavelength attraction (Smallegange, 2003; Roberts et al., 1992; Syms, 1988). Black light bulbs sold for the fly killer market radiate light in the 330-385 nm ultra-violet range, within which there does not seem to be a consensus for the wavelength that is most attractive M. domestica in practice, despite electrophysiological studies (Smallegange, 2003).

MATERIALS AND METHODS Two light trap chasses (Figures 1-4) were tested with two luminaires in identical controlled environment rooms (4 m2 with a volume of 9 m3), maintained at 25° C + 2° C and 50% + 10% RH, illuminated daily on a 12- hour cycle. The rooms were subject to 10 air changes per hour and sealed to prevent flies escaping.

Figure 1. Chassis A with fluorescent lamp (left) and LED (right) luminaires. Role Of LED Lights In The Design Of Ultra-Violet Light Traps 331

Figure 2. Chassis B with fluorescent lamp (left) and LED (right) luminaires. Role Of LED Lights In The Design Of Ultra-Violet Light Traps

UV lamps used in the traps were on for a minimum of 100 hours prior to testing. LED luminaires were on for 2 hours to ensure the light output was stable (assessed with a handheld UV spectrometer). Traps tested were mounted 1.8 m from the floor. Bioassay protocol followed Green (2001): 100 unsexed adult Musca domestica were released at floor level from the centre of the room. The number of flies captured in the unit was counted at intervals of: 15, 30, 60, 90, 120, 240 minutes, 5 hours, 7 hours and 24 hours. After 24 hours all live flies in the room, dead flies on the floor or within the unit (not on the glue) and observed escapees were accounted for. Six replicates of each test were conducted with fresh glue surfaces for each test and luminaires emitting the same level of UV-A light. RESULTS

An average time for half the number of available flies to be caught (C50) was calculated by averaging the counts from six days of testing. The C50 score is the minimum possible time that it would take each unit to catch 50% of the available flies (given maximal performance of the unit based on the average recorded catch for each of the eight time intervals), using the following equation: t

C50 = log2 (N0/Nt) where C50 is the fastest average catch time, t is the time elapsed, N0 is the initial percentage of flies (100) and Nt is the percentage remaining after t.

Figure 3. Catch rate variation with luminaire and power. 332 M. Green Role Of LED Lights In The Design Of Ultra-Violet Light Traps

The results show chassis B to be more efficient than chassis A (although there is some notable cover colour and therefore contrast variation). At a high power setting the units with LED luminaires consume approximately 60% of the power of the units with fluorescent lamps, falling to below 50% at the low power setting over the test period. No significant difference (p=0.05) was found between luminaires for either chassis or power level. DISCUSSION Directional LED luminaires offer a number of interesting design choices for UV-A insect light traps. The use pattern and power dimming capabilities of LEDs make them a particularly good fit for use in insect light traps, the limiting factor currently being power output that will gradually be overcome as technological hurdles of cooling and reliability are addressed. Variable power supply to LEDs would initially seem to be of nominal use for light traps given some test methods currently used for assessing light trap effect, this work has shown that under single choice bioassay conditions UV-A LEDs offer comparable risk protection against fly-borne disease in low light settings to fluorescent lamps with a fraction of the power consumption required to maintain an arc in a mercury phosphor lamps emitting light at the same peak frequency. The use of a single light trap chassis allowed us to investigate the effect of changing the luminaire without affecting any other variable that would influence the catch rate of a trap in a room with a known number of house flies. Single choice bioassays should be the norm for insect light trap testing as LED luminaires become more common in the market. The alternative two choice testing will inevitably result in a bias towards high power units (regardless of luminaire type) being deployed in situations where a comparable level of disease risk reduction from house flies could be achieved using potentially lower UV-A light output more attuned to ambient light levels (Jones et al., 2017). Further work will seek to define and optimise the relationship between an LED luminaire and the trap chassis to accentuate the directionality adaptive power modes unique to this technology. The results are also is in line with observations by Syms (1988) that sub-sets of flies within the released population are for unclear reasons do not display the same level of flight and attraction to UV-A than others. The behaviour of released sets house flies and identification and quantification of any sub-set therein that is more or less attracted to light traps shall be documented to improve the operational understanding and limitations of these units.

REFERENCES CITED Anon. 2016. Lighting Market Report - UK 2016-2020 Analysis www.amaresearch.co.uk/lighting.html (24 January 2017) Davies, M.P., M. Anderson, and A.C. Hilton. 2016. The housefly Musca domestica as a mechanical vector of Clostridium difficile. Journal of Hospital Infection, 94 (3), pp. 263-267. Green, M. 2011. Catch rate of Musca domestica in laboratory tests: contrasting ultraviolet light traps with their surroundings. In: W.H. Robinson and A.E. de Carvalho Campos (eds.), Proceedings of the Seventh Conference on Urban Pests. Instituto Biológico, São Paulo, Brazil. Goldsmith, T.H. and H.R. Fernandez. 1968. The sensitivity of housefly photoreceptors in the mid- ultraviolet and the limits of the visible spectrum. J. Exp. Biol. 49(3):669-77. Hogsette, J.A. 2008. Ultraviolet light traps: design affects attraction and capture. In: Proceedings of the Sixth International Conference on Urban Pest. Eds: W. H. Robinson and D. Bajomi. Budapest, Hungary. Role Of LED Lights In The Design Of Ultra-Violet Light Traps 333

Jones, R.T., M.V. Holl, H.M.P. Smith, M. Green, and J.G. Logan. 2017. A standardized method for the assessment of house fly killers under controlled environmental conditions. In press. Pickens, L.G. and R.W. Thimijan,. 1986. Design parameters that affect the performance of UV- emitting traps in attracting house flies (Diptera: Muscidae). J. Econ. Entomol. 79: 1003-1009. Roberts, A.E. 1990. The response of Musca domestica to ultra-violet electrocutor traps under field and laboratory conditions. Ph.D. Thesis. University of London. Roberts, A.E., P.R. Syms, and L.J. Goodman,. 1992. Intensity and spectral emission as factors affecting the efficacy of an insect electrocutor trap towards the house-fly. Entomologia Experimentalis et Applicata 64: 259-268. Sargant, J. 2010. Which ILT is Best? Prescription Treatment® Quarterly, BASF Pest Control Solutions. In: Pest Control Technology Magazine (June 2010 issue), GIE Media, Richfield, Ohio. USA Smallgange, R.C. 2003. Attractiveness of different light wavelengths, flicker frequencies and odours to the housefly (Musca domestica L.) Ph.D. Thesis. University of Groningen, The Netherlands. Syms, P.R. 1988. A laboratory study of factors influencing the effectiveness of an electrocutor fly trap against the house-fly, Musca domestica. Ph.D thesis, Queen Mary College, University of London, United Kingdom. 335

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

PARASITOIDS FOR CLASSICAL BIOLOGICAL CONTROL OF TINEOLA BISSELLIELLA (LEPIDOPTERA: )

1RUDY PLARRE, 2HENRIK HERING, AND 1MARTINA MATZKE 1BAM-Federal Institute for Materials Research and Testing, Unter den Eichen 87, 12205 Berlin, Germany 2BfR-Federal Institute for Risk Assessment, Max-Dohrn-Straße 8–10, 10589 Berlin, Germa

Abstract Two species of parasitoid wasps, Apanteles carpatus (Hymenoptera: Braconidae) and Baryscapus tineivorus (Hymenoptera: ), are known to successfully parasitize larvae of tineid moths. We have evaluated each species potential impact on suppressing the pest Tineola bisselliella (Lepidoptera: Tineidae). Both parasitoids have shown high potential for biological control of webbing clothes moth larvae when tested on different host instars in the laboratory and field. Preferences for parasitizing older and larger host larval instars for egg largely overlap in both species. Apanteles carpatus is a solitary koinobiont and parthenogen, while B. tineivorus is a gregarious koinobiont, with a sex ratio of approximately 1:5 (male:female). Solitary reproduction in A. carpatus

markedly suppressed the pest population early on but lagged large numbers of progeny in the F1-generation.

Gregarious reproduction resulted in a faster build-up of the F1-generation but lagged the immediate control effect. Combining the release of both parasitoid species for pest control seemed to be the logical conclusion. We tested the reproductive success of both species when experimentally forced into intensive intraguild competition. For this, parasitoids had either to compete simultaneously or slightly time shifted on the same preferred host resource. Reproductive success of A. carpatus was not significantly influenced by the presence of B. tineivorus. B. tineivorus reproductive output was significantly reduced in the presence of A. carpatus. Overall suppression of host development was not significantly enhanced with both parasitoid species co-occurring when compared to their exclusive access to hosts. B. tineivorus does not significantly improve the control of webbing clothes moth hosts when occurring together with and having to compete against A. carpatus, at least in restricted laboratory conditions. Results show that B. tineivorus should be released with a temporal advantage of at least several days. For inundative release, reproduction strategies and even competition between parasitoids is negligible, and a deferred release strategy would not be required.

Key words Apanteles carpatus, Baryscapus tineivorus, biological control, inoculative release, intraguild predation.

INTRODUCTION Biological control of pest insects is one cornerstone in modern concepts of IPM, not only in agricultural systems but also in museums, private households and the textile industry (Pinniger, 2001; Pinniger et al., 2016). Tineola bisselliella (Hummel) (Lepidoptera: Tineidae), webbing clothes moth, and Tinea pellionella (L.) (Lepidoptera Tineidae), case-making clothes moth, are important insect pests in these synanthropic environments (Cox and Pinniger, 2007), and parasitic wasps have been shown to be suitable for their biological control. One is Apanteles carpatus (Say) (Hymenoprera: Braconidae), a solitary koinobiont and parthenogen braconid wasp of approx. 4 mm in size (Fallis, 1942). This wasp is capable of parasitizing and completing development in all larval stages of T. bisselliella and T. pellionella (Plarre et al., 1999; Plarre and Balnuweit, 2003; Tibaut, 2005). The other is Baryscapus tineivourus (Ferriére) (Hymenoptera: Eulophidae), a gregarious koinobiont eulophid wasp of max. 2 mm and with a sex ratio 336 R. Plarre, H. Hering, and M. Matzke Parasitoids For Classical Biological Control Of Tineola bisselliella of approximately 1 male to 5 females (Jotzies, 2011). For successful development, B. tineivorus requires older host larvae. Younger hosts can be parasitized in principle but these lack the resources to allow completion of larval development or pupation (Matzke, 2016). Table 1 summarizes for both species the present state of scientific knowledge relevant for controlling clothes moths. For any applied pest control strategy, a mixed approach is considered advantageous, particularly if it results in a synergistic suppression of the pest. This also applies to biological means of control, where different species of pathogens, parasitoids or predators are released to reduce or eradicate pest populations (O’Neil and Obrycki, 2008). However, inter-specific competition between putative parasitoids or predators may be problematic (Brodeur and Rosenheim, 2000), especially when important biological niche parameters of the introduced beneficial species, like reproduction, are similar (De Moraes and Mescher, 2005). Although the reproductive strategies of A. carpatus and B. tineivorus differ, with each being solitary and gregarious respectively (Pennacchio and Strand, 2006), their host range and host larval instar preferences for egg laying largely overlap (Plarre et al., 1999; Matzke, 2016). Additionally, both species are koinobionts and endoparasitoids (Pennacchio and Strand, 2006). Indeed, A. carpatus and B. tineivorus can be regarded as members of the same guild (Hawkins and MacMahon, 1989), meaning that intraguild competition between these two beneficials is highly likely when the two species occur regionally and timely in sympatry (Ehler, 1992; Godfray, 1994; Pennacchio and Strand, 2006). Intraguild competition could lower the reproductive success of a lesser competitor, hinder its sustainable build up of a residual population and reduce its efficacy in controlling the pest (Rosenheim et al., 1995; Brodeur and Rosenheim, 2000; Müller and Brodeur, 2002; Briggs and Borer, 2005). Competition in parasitoids during resource acquisition can be manifold (Godfray, 1994). For example, it may occur prior to oviposition during host searching and finding or by antagonistic behavior for individual hosts (Batchelor et al., 2005). Physical post-ovipostion competition may result in intraguild predation by larvae of the superior species inside the host (Polis and Holt, 1992; Rosenheim et al., 1995; Hunter et al., 2002; Müller and Brodeur, 2002; Arim and Marquet, 2004). Host or territory-marking allomones, produced by primary parasitoids or predators which repel secondary ones are non-physical forms of competition, resulting in the marker becoming the superior parasitoid or predator (Polis et al., 1989; Gnanvossou et al., 2003). The superior species is likely to out-compete the inferior one, ending in competitive displacement (Amarasekare, 2002; Reitz and Trumble, 2002). In the extreme, this could lead to pest control failure, when the competitors are of equal strength and restrain each other’s reproduction. Here, we experimentally compete A. carpatus and B. tineivorus in a restricted environment. This is achieved by simultaneously release of both species onto a limited number of accessible hosts, by narrowing the developmental stage of the host to be optimal for both parasitoid species, and by constraining the available space. Competition avoidance strategies, as described by Polis et al. (1989) and Hatcher et al. (2008), is thus ruled out by the overall experimental design. This scenario may well be realistic, when parasitoids are released initially after the first detection of the pest, e. g. through monitoring pheromone traps (Trematerra and Fontana, 1996). At such an early stage, the pest population presumably still has an age-uniform structure. In this study, we evaluated the reproductive success of either parasitoid species in the F1-generation and their control effect on their common host T. bisselliella. METHODS AND MATERIALS Tineola bisselliella. Larvae of webbing clothes moth were derived from stock cultures of the BAM (Federal Institute for Materials Research and Testing) Berlin, Germany. Stock insects have been reared for more than 10 years on goose feathers, soaked in 10% brewer’s yeast/water solution, oven- tried at 60°C and cooled down to room temperature. Rearing conditions are 27°C±2°C and 70%±5%r h. Parasitoids For Classical Biological Control Of Tineola bisselliella 337

Under these conditions developmental time from egg to adult moth lasts approx. 7 to 8 weeks (Griswold, 1944; Plarre et al., 1999). Larvae for experiments were 5 weeks old, prepared out of their feeding tubes and transferred onto patches of 100% worsted wool which had been placed into glass-jars of 780 cm3 volume (ø10.5 cm x 9 cm height) and covered by a ventilated screw cap. During the next 24 hours, the larvae had spun new feeding tubes. Apanteles carpatus. Wasps were reared continuously for more than 5 years on cultures of T. bisselliella as described above. Newly over night emerged adult wasps were used in experiments. Apanteles carpatus is thelytokous, and therefore all wasps were female. Baryscapus tineivorus. Wasps were reared continuously for more than 3 years on cultures of T. bisselliella as described above. Newly over night emerged adult wasps (males and females) were used in subsequent experiments. Isochronic release of parasitoids. In each of six replicate experiments, 50 larvae of T. bisselliella were caged in glass-jars as described above, simulating realistic constricted host resource patches. After 24 hours, ten newly emerged A. carpatus females and 15 newly emerged B. tineivorus of mixed sex were simultaneously added to each replicate jar. Sexing live B. tineivorus is impossible without harming the insects. However, with a sex ratio of 1:5 (male/female) in B. tineivorus, it was assumed to have approximately even numbers of females from each parasitoid species. Both species had to compete with con-specifics and inter- specifics for host resources during the next 4 days, after which all parasitoids were removed. The patches with hosts were then incubated at rearing conditions to allow hatching of non-parasitized T. bisselliella larvae to adult moths, or in the case of parasitized individuals; development of each parasitoid species’ F1-generation. For comparison and to evaluate the effect of interspecies competition, an equal number of set ups was prepared in the same way but with only one parasitoid species being released, respectively. For overall comparison an equal number of set ups was prepared in the same way without the release of any parasitoid species. Metachronic release of parasitoids. In each of three replicate jars, 25 larvae of T. bisselliella were caged as described above. After 24 hours ten newly emerged A. carpatus females were added to each jar. Three days later, all A. carpatus were removed and 15 newly emerged B. tineivorus of mixed sex were added for the next 3 days. The same procedure was independently repeated but with introduction of parasitoids in reverse order. Direct pre-oviposition competition between the two parasitoid species was thus avoided. After removal of all parasitoids, the patches with hosts were incubated at rearing conditions to allow hatching of non-parasitized T. bisselliella larvae to adult moths or in the case of parasitized individuals; development of each parasitoid species’ F1-generation. For comparison, equal numbers of replicates were prepared in the same way with either simultaneous release or no release of the parasitoid species. Data Analysis Data were analyzed statistically using two-sample t-Test for pairwise comparison of mean values. Differences at p≤ 0.05 were regarded as significant.

RESULTS Isochronic Release Of Parasitoids Development of clothes moth larvae to adults was reduced in all cases where parasitoids were introduced (Figure 1). This suppression, however, was statistically significant only when A. carpatus was present, either alone or in combination with B. tineivorus (Figure 1/II and 1/III). A significant reduction of the pest was not achieved when B. tineivorus acted alone under the above mentioned experimental condition (Figure 1/IV). Its contribution to moth mortality when both parasitoids species acted together was thus insignificant as well. 338 R. Plarre, H. Hering, and M. Matzke Parasitoids For Classical Biological Control Of Tineola bisselliella

Reproductive success of A. carpatus in the F1-generation was not influenced by the simultaneous presence of B. tineivorus (Figure 2/I and 2/II). Approximately 20 F1 A. carpatus individuals completed development in each experimental set up. With 10 females of A. carpatus depositing eggs over 4 days, this corresponds to a reproduction rate of 0.5 per parental female per day.

On the contrary, reproductive success of B. tineivorus in the F1-generation was significantly influenced by the simultaneous presence of A. carpatus (Fig. 2/III). Approximately 35 F1 B. tineivorus completed development in the absence of A. carpatus (Figure 2/IV) but almost none when A. carpatus was present (Figure 2/III). Assuming a rate of 10 B. tineivorus females depositing eggs over 4 days, this corresponds to a reproduction rate of 0.9 and almost 0.0 per parental female per day, respectively. Metachronic release of parasitoids The development of clothes moth larvae to adults was significantly reduced in all cases where both parasitoids were present as compared to when parasitoids were absent (Figure 3). The order in which the parasitoids were released had no impact on pest population suppression (Figure 3/II, 3/III and 3/IV).

Reproductive success of A. carpatus in the F1-generation was not influenced by the order of its release in relation to B. tineivorus (Figure 4/I, 4/II and 4/III). No difference in development was observed regardless of whether both parasitoids acted simultaneously or in succession. Approximately 12 new A. carpatus completed development in each experimental set up. With 10 females of A. carpatus depositing eggs over 3 days, this corresponds to a mean reproduction rate of 0.4 per parental female per day. The reproductive success of B. tineivorus was strongly suppressed by the presence of A. carpatus (Figure 4/IV, 4V and 4/VI). However, with a 3-day time advantage B. tineivorus was able to slightly but significantly increase its reproduction rate (Figure 4/VI) when compared to 3-day time disadvantage or simultaneous release with A. carpatus (Figure 4/V and 4/IV).

Figure 1. Mean absolute and mean percentile development of clothes moth larvae (T. bisselliella) to adult moths in respect to the presences of : I. no parasitoids, II. both parasitoids simultaneously, III. the koinobiont solitary larval parasitoid only, and IV. the koinobiont gregarious larval parasitoid only. Differences at the p≤ 0.05 level are indicated by different letters. Parasitoids For Classical Biological Control Of Tineola bisselliella 339

Figure 2. Mean absolute development

of F1-generation of A. carpatus from its host T. bisselliella in respect to: I. simul- taneous presence of parental A. carpatus with B. tineivorus and II. single presence of parental A. carpatus as well as mean

absolute development of F1-generation of B. tineivorus from its host T. bissel- liella in respect to: III. simultaneous presence of parental B. tineivorus with A. carpatus and IV: single presence of parental B. tineivorus. Differences at the p≤ 0.05 level are indicated by different letters.

Figure 3. Mean absolute and mean percentile development of clothes moth larvae to adult moths in respect to: I. no parasitoids, II. simultaneous presence of parental A. carpatus and B. tineivorus, III. the metachronic presences of the larval parasitoid A. carpatus after 3 days by the larval parasitoid B. tineivorus, and IV. B. tineivorus followed after 3 days by A. carpatus. Differences at the p≤ 0.05 level are indicated by different letters.

Figure 4. Mean absolute development

of F1-generation of A. carpatus from its host T. bisselliella in respect to: I. simultaneous presence of both parasitoids, II. metachronic presences of the larval parasitoid A. carpatus followed after 3 days by the parasitoid B. tineivorus, and III. metachronic presences of B. tineivorus followed after 3 days by A. carpatus, and mean

absolute development of F1-generation of B. tineivorus from its host T. bisselliella in respect to: IV. simultaneous presence of both parasitoids, V. metachronic presences of the parasitoid A. carpatus after 3 days by the larval parasitoid Baryscapus tineivorus, and VI. metachronic presences of B. tineivorus after 3 days by A. carpatus. Differences at the p≤ 0.05 level are indicated by different letters. 340 R. Plarre, H. Hering, and M. Matzke Parasitoids For Classical Biological Control Of Tineola bisselliella

DISCUSSION When parasitoids are released for biological control, two main objectives are pursued: a fast reduction of the pest below an economic threshold, and a rapid population build-up of the beneficial specie(s). A. carpatus and B. tineivorus differed considerably at our two main experimental restrictions on host use, which were limited time-window for and limited number of spatially confined hosts. In the absence of interspecific competitors, reproduction in the gregarious species, B. tineivorus, resulted in a higher number of F1-progeny per parental female per day (0.9) than in the solitary A. carpatus (0.5). This would have led to a faster population build up of B. tineivorus over subsequent generations. Initial suppression of pest development by F1-progeny was greater in A. carpatus. As a solitary parasitoid, a single egg is delivered to a different host individual, which resulted in 70% mortality of clothes moth larvae (Figure 1/III). Host mortality caused by B. tineivorus alone, by contrast, was only 40 % (Figure 1/IV), and did not significantly differ from the natural mortality of host larvae in our experiments (30 - 40%; Figure 1/I and 3/I) which is within the expected range for T. bisselliella (Griswold, 1944). We hypothesized that the combined release of both parasitoids with their different reproduction strategies could have resulted in an additive effect on host mortality and a fast build-up of a residual population of at least one beneficial species. The highest host mortality in our experiments was recorded when both parasitoids acted together (Figure 1/II). However, host mortality caused by both parasitoid species did not significantly differ from that caused by A. carpatus alone (Figure 1/III). The simultaneous presence of A. carpatus significantly reduced the reproductive success of B. tineivorus in the F1-generation to almost zero (Figure 2/III) and therefore prevented its population establishment. This demonstrates that B. tineivorus suffers significantly from intraguild competition withA. carpatus under restricted laboratory conditions, whereas A. carpatus´ developmental success is not influenced by the presence of B. tineivorus (Figures 2 and 4). Although pre-oviposition competition between the two parasitoids cannot completely be ruled out, the deferred and successive release strategies adopted by each parasitoid respectively, indicates that interspecific competition is strongest during post-oviposition, among larvae inside the host. The most likely mode of action is predation (Rosenheim et al., 1995; Brodeur and Boivin, 2004), with A. carpatus larvae not only feeding on host tissue but also on B. tineivorus larvae. Larvae of solitary endoparasitoids do not tolerate other internal feeders. If they encounter competitors, their feeding habits are likely to require significant aggression towards that intra or inter specific competitor in order to survive (Brodeur and Boivin, 2004). Solitaries such as A. carpatus also do not have to constrain their tissue consumption habits to smaller portions inside the host, unlike in gregarious endoparasitoids, where a large degree of immobility inside the host would have been selected for to avoid the encountering of conspecific competitors (Boivin and van Baaren, 2000; Pexton and Mayhew, 2001). This may explain why A. carpatus larvae are superior competitors. Under our metachronic experimental conditions, their reproductive success did not differ, regardless of whether they had to compete simultaneously with B. tineivorus, or following delayed introduction (Figure 4). Solitary parasitoids may only slow down aggressive feeding activities or enter developmental dormancy when the host provides insufficient resources, such as in small hosts for example (Lawrence, 1990). For gregarious larvae this kind of behavior would be fatal. The life histories of A. carpatus and B. tineivorus fulfill these assumptions: Susceptible host instars forA. carpatus range from old (large) to very young (small), with prolonged developmental times resulting from infestation of the latter (Plarre et al., 1999; Harvey et al., 2000). In B. tineivorus, only older hosts facilitate successful development. Matzke (2016) has previously shown that younger hosts do not provide sufficient resources for the brood to complete the life cycle. Collective dormancy in gregarious endoparsitoids is unlikely to have evolved because of the difficulty associated with synchronizing behavior or physiology amongst competing members of the same brood. Complete extraction of host tissue has been reported for A. carpatus Parasitoids For Classical Biological Control Of Tineola bisselliella 341

(Harvey et al., 2000), whereas in B. tineivorus, depending on the actual number of progeny, parasitoid larvae may not completely hollow out a given host (Jotzies, 2011). As the inferior competitor over a restricted range of host conditions, B. tineivorus was only able to successfully compete with A. carpatus when given a temporal advantage. We have demonstrated here that a 3-day advantage leads to significantly increased reproduction rate of B. tineivorus (Figure 4/VI)). It remains unclear whether B. tineivorus larvae successfully avoided secondary parasitism through direct physical defense against A. carpatus eggs or egg-larvae, or via the release of a repellent allomone. Evidence for the latter comes from studies in hymenopteran parasitoids where unparasitized and parasitized hosts could be discriminated prior to oviposition (Tillman and Powell, 1992; Godfray, 1994), but whether B. tineivorus mark their hosts during or after egg-laying remains to be shown.

CONCLUSION Under restricted experimental conditions, A. carpatus clearly outcompetes B. tineivorus. Simultaneous release of both species for biological pest control is therefore not recommended in situations where both parasitoid species are under severe competition for a restricted range of host conditions. Although such conditions are quite realistic in specific environments (e. g. new pest infestations), they do not represent the full range of host conditions found in nature. Nonetheless, in such conditions, we have shown that it may be effective to combine the benefits of a solitary reproductive strategy (A. carpatus) which has the advantage of higher initial host suppression, with a gregarious reproductive strategy (B. tineivorus) which has the advantage of a faster eventual build up of a residual population of beneficials. Deferred release of the two species, by which the inferior competitor is given a time advantage, represents a potential means of implementing such a mixed strategy (De Moraes and Mescher, 2005; Everard et al., 2009; Cusumano et al., 2011). Because B. tineivorus is gregarious, the consequent initial numeric superiority of this species’ reproductive success in the F1 generation is a significant factor that also should be considered when trying to give long term predictions (Table 1). B. tineivorus requires only 18 days to complete development in 5-week old, well fed T. bisselliella larvae (Matzke, 2012). This is in contrast to A. carpatus, which requires 34 days to complete development (Plarre et al., 1999).

Table 1. Reproduction life history of Apanteles carpatus and Baryscapus tineivorus.

Life History Data Apanteles carpatus Baryscapus tineivorus Reproduction strategy endoparasitoid, koinobiont

Solitary Gregarious

parthenogenic (thelytoky) males and females (1:5) Range of host species Tineola bisselliella, Tinea pellionella Range of host Larval stages All larval stages developmental stage 5 - 7 weeks old 35, rang of 60 - 25 de- Mean development time (days) 18 pending on host stage Parasitism rate (hosts/♀wasp) Maximum 60 Mean 5

Mean Re- F1/host 1 4, maximum 20 production F /♀wasp 30, maximum 65 38, maximum 75 capacity 1 342 R. Plarre, H. Hering, and M. Matzke Parasitoids For Classical Biological Control Of Tineola bisselliella

With food* 27, maximum 40 9, maximum 27 With host** Not determined 4, maximum 13 Mean With food* ♀ Longevity Not determined 11, maximum 16 (days) With host** Without food* Not determined 3, maximum 11 Without host** * Honey water; ** Larvae of T. bisselliella

Therefore, given a few days time advantage, in combination with a faster life cycle, B. tineivorus could in principle stably coexist alongside A. carpatus, and establish respectable population size (Amarasekare, 2002; Price and Morin, 2004; Briggs and Borer, 2005; Hatcher et al., 2008). We emphasize, however, that our conclusion applies mainly to inoculative release strategies where the principal goal is to establish a sustainable population of the beneficial species in a uniform host environment. In many cases, a more heterogeneous and widespread pest (host) population in more diverse environments would create opportunities for coexistence through competition avoidance strategies (Godfray, 1994; Křivan, 2000; Borer, 2002; Revilla, 2002; Nakazawa and Yamamura, 2006; Amarasekare, 2007; Bampfylde and Lewis, 2007; Holdt and Huxel, 2007; Janssen et al., 2007; Cusumano et al., 2011). For inundative release, in which a pest-infested environment is flooded with beneficials for immediate pest control, reproductive strategies and even competition itself between parasitoids, will have a negligible impact on the host (Rosenheim et al., 1995; Bográn et al., 2002), unless both species negatively influence each other in their host-finding abilities. But for A. carpatus and B. tineivorus this is not the case. Here, a deferred release strategy would not be required.

ACKNOWLEDGEMENT The authors thank Prof. Dr. D.P. McMahon for reviewing the manuscript.

REFERENCES CITED Amarasekare, P. 2002. Interference competition and species coexistence. Proc. R. Soc. Lond. B 269: 2541–2550. Amarasekare, P. 2007. Trade-offs, temporal variation, and species coexistence in communities with intraguild predation. Ecology 88: 2720–2728. Arim, M. and P.A. Marquet. 2004. Intraguild predation: a widespread interaction related to species biology. Ecol. Lett. 7: 557–564. Bampfylde, C.J. and M.A. Lewis. 2007. Biological control through intraguild predation: case studies in pest control, invasive species and range expansion. Bull. Math. Biol. 69: 1031–1066. Batchelor, T.P., I. C.W. Hardy, J.F. Barrera, and G. Pérez-Lachaud. 2005. Insect gladiators II: Competitive interactions within and between bethylid parasitoid species of the coffee berry borer, Hypothenemus hampei (Coleoptera: Scolytidae). Biol. Control 33: 194–202. Bográn, C.E., M. Heinz, and M.A. Ciomperlik. 2002. Interspecific competition among insect parasitoids: field experiments with whiteflies as hosts in cotton. Ecology 83: 653–668. Boivin, G. and J. van Baaren. 2000. The role of larval aggression and mobility in the transition between solitary and gregarious development in parasitoid wasps. Ecol. Lett. 3: 469–74. Parasitoids For Classical Biological Control Of Tineola bisselliella 343

Borer, E.T. 2002. Intraguild predation in larval parasitoids: implications for coexistence. J. Anim. Ecol. 71: 957–965. Briggs, C.J. and E.T. Borer. 2005. Why short-term experiments may not allow long-term predictions about intraguild predation. Ecol. Appl. 15: 1111–1117. Brodeur, J. and G. Boivin. 2004. Functional ecology of immature parasitoids. Ann. Rev. Entomol. 49: 27–49. Brodeur, J. and J.A. Rosenheim. 2000. Intraguild interactions in aphid parasitoids. Entomol. Experi. et Appl. 97: 93–108. Cusumano, A., E. Peri, S.B. Vinson, and S. Colazza, S. 2011. Intraguild interactions between two egg parasitoids exploring host patches. BioControl 56: 173–184. Cox, P.D. and D.B. Pinniger. 2007. Biology, behaviour and environmentally sustainable control of Tineola bisselliella (Hummel) (Lepidoptera: Tineidae). J. Stored Prod. Res. 43: 2–32. De Moraes, C.M. and M.C. Mescher. 2005. Intrinsic competition between larval parasitoids with different degrees of host specificity. Ecol. Entomol. 30: 564–570. Ehler, L.E. 1992. Guild analyses in biological control. Environ. Entomol. 21: 26-40. Everard, A., C.T. Griffin, and A.B. Dillon. 2009. Competition and intraguild predation between the braconid parasitoid Bracon hylobii and the entomopathogenic nematode Heterorhabditis downesi, natural enemies of the large weevil, Hylobius abietis. Bull. Entomol. Res. 99: 151–161. Fallis, A.M. 1942. The life cycle of Apanteles carpatus (Say) (Hymenoptera: Braconidae), a parasite of the webbing clothes moth, Tineola bisselliella Hum. Cana. J. Res. 20: 13-19. Gnanvossou. D., R. Hanna, and M. Dicke. 2003. Infochemical-mediated intraguild interactions among three predatory mites on cassava plants. Oecol. 135: 84–90. Godfray, H.C.J. 1994. Parasitiods – Behavioral and Evolutionary Ecology. Monographs in Behavior and Ecology. Princeton University Press Griswold, G.H. 1944. Studies on the biology of the webbing clothes moth (Tineola bisselliella Hum.). Cornell University Agricultural Experiment Station Memoir 262: 1-59. Harvey, J.A., K. Kadash, and M.R. Strand. 2000. Differences in larval feeding behavior correlate with altered developmental strategies in two parasitic wasps: implications for the size-fitness hypothesis. Oikos 88: 621–629. Hatcher, M.J., J.T.A. Dick, and A.M. Dunn. 2008. A keystone effect for parasites in intraguild predation? Biol. Lett. 4: 534–537. Hawkins, C.P. and J.A. MacMahon. 1989. Guilds: the multiple meanings of a concept. Ann. Rev. Entomol. 34: 423-451. Holt, R.D. and G.R. Huxel. 2007. Alternative prey and the dynamics of intraguild predation: theoretical perspectives. Ecol. 88: 2706–2712. Hunter, M.S., T.R. Collier, and S.E. Kelly. 2002. Does an autoparasitoid disrupt host suppression provided by a primary parasitoid? Ecol. 83: 1459–1469. Janssen, A., M.W. Sabelis, S. Magalhães, M. Montserrat, and T. van der Hammen. 2007. Habitat structure affects intraguild predation. Ecol. 88: 2713–2719. Jotzies, A. 2011. Biology of Apanteles carpatus (Say) (Hymenoptera: Braconidae) and Baryscapus tineivorus (Ferrièrre) (Hymenoptera: Eulophidae) when parasitizing webbing cloth moth larvae Tineola bisselliella (Hummel) (Lepidoptera: Tineidae). Diploma Thesis Free University of Berlin, Germany and Federal Institute for Materials Research and Testing Berlin, Germany. Křiva, V. 2000. Optimal intraguild foraging and population stability. Theor. Pop. Biol. 58: 79-94. 344 R. Plarre, H. Hering, and M. Matzke Parasitoids For Classical Biological Control Of Tineola bisselliella

Lawrence, P.O. 1990. The biochemical and physiological effects of insect hosts on the development and ecology of their insect parasites: an overview. Arch. Insect Biochem. Physiol. 13: 217–228. Matzke, M. 2012. Biology of Baryscapus tineivorus (Hymenoptera: Eulophidae) when parasitizing larvae of Tineola bisselliella and Tinea pellionella (Lepitoptera Tineidae). Master Thesis University of Bayreuth, Germany and Federal Institute for Materials Research and Testing Berlin, Germany. Matzke, M. 2016. Observation on the biology of the wasp Baryscapus tineivorus (Hymenoptera: Eulophidae), a parasitoid of tineid moths. Sitzungsberichte Gesellschaft Naturforschender Freunde N.F. 52: 105-116. Müller, C.B. and J. Brodeur. 2002. Intraguild predation in biological control and conservation biology. Biol. Contr. 25: 216–223. Nakazawa, T. and N. Yamamura. 2006. Community structure and stability analysis for intraguild interactions among host, parasitoid, and predator. Popul. Ecol. 48: 139–149. O’Neil, R.J. and J.J. Obrycki. 2008. Introduction and augmentation of biological control agents. In: Radcliffe, E.B., Hutchinson, W.D., and Cancelado, R.E. Michael E. Gray, Susan T. Ratcliffe, Marlin E. Rice, Scott M. Swinton, George W. Norton, Leon G. Higley , Robert K. D. Peterson, Paul D. Mitchell, William D. Hutchison, David J. Horn, William E. Snyder, Anthony R. Ives; Roger D. Moon, L. T. Wilson, Scott A. Isard, David A. Mortensen, Shelby J. Fleischer, Erick D. De Wolf, Robert J. O’Neil, John J. Obrycki, Miguel A. Altieri, Clara I. Nicholls, Luigi Ponti, Stephen P. Wraight, Ann E. Hajek, Mary Gardiner, Anna Fiedler, Alejandro C. Costamagna and Douglas A. Landis, Pamela G. Marrone, Richard A. Weinzierl, Casey W. Hoy, Paul C. Jepson, Brian Hughes, Larry G. Olsen, Fred Whitford, C. Michael Smith, Anthony M. Shelton, J. Z. Zhao, Jarrad R. Prasifka, Richard L. Hellmich, Michael J. Weiss, Thomas C. Baker, Daniel Doucet, Michel Cusson, Arthur Retnakaran, Michelle L. Walters, Ron Sequeira, Robert Staten, Osama El-Lissy, Nathan Moses-Gonzales, Charles Vincent, Phyllis G. Weintraub, Guy J. Hallman, Francis Fleurat-Lessard, Steven E. Naranjo, Randall G. Luttrell, Richard F. Lee, Joop C. van Lenteren, Jeffrey A. Davis, Edward B. Radcliffe, David W. Ragsdale, Willem Schrage, Stephen A. Kells, David H. Oi, Bastiaan M. Drees, Chris F. Curtis, Michael L. McManus, Andrew M. Liebhold, Robert C. Venette, Robert L. Koch, John K. VanDyk,Thomas A. Green, Stephen Morse, Harold D. Coble, Eldon E. Ortman, Carol L. Pilcher, Edwin G. Rajotte John Aselage, Donn T. Johnson, E. A. Heinrichs, Karim M. Maredia Subbarayalu Mohankumar eds., Integrated Pest Management. Concepts, Tactics, Strategies and Case Studies. Cambridge University Press: 107-115. Pennacchio. F. and M.R. Strand. 2006. Evolution of developmental strategies in parasitic hymenoptera. Ann. Rev. Entomol. 51: 233–258. Pexton, J.J. and P.J. Mayhew. 2001. Immobility: the key to family harmony? Trends Ecol. Evol. 16: 7–9. Pinniger, D.B. 2001. Pest Management in Museums Archives and Historic Houses. Archetype Press, London Pinniger, D., B. Landsberger, A. Meyer, and P. Querner. 2016. Integriertes Schädlingsmanagement in Museen, Archiven und historischen Gebäuden. Gebr. Mann, Berlin. Plarre, R. and O. Balnuweit. 2003. Biology of Apanteles carpatus (Hymenoptera: Braconidae), a parasitoid of tineid moths (Lepidoptera: Tineidae). In: Credland, P.F., Armitage, D.M., Bell, C.H., Cogan, P.M., and Highley, E. eds., Proceedings of the International Working Conference on Stored Product Protection, York (United Kingdom) 2002: 169-172. Parasitoids For Classical Biological Control Of Tineola bisselliella 345

Plarre, R., K. Lieber, W.E. Burkholder, and J.K. Phillips. 1999. Host and host instar preference of Apanteles carpatus (Say) (Hymenoptera: Braconidae) a possible parasitoid for biological control of clothes moths (Lepidoptera: Tineidae). J. Stored Prod. Res. 35: 197-213. Polis, G.A. and R.D. Holt. 1992. Intraguild predation: the dynamics of complex trophic interactions. Tree 7: 151-154. Polis, G.A., C.A. Myers, and R.D. Holt. 1989. The ecology and evolution of intraguild predation: Potential competitors that eat each other. Ann. Rev. Ecol. Syst. 20: 297-330. Price, J.E. and P.J. Morin. 2004. Colonization history determines alternate community states in a food web of intraguild predators. Ecol. 85: 1017–1028. Reitz, S.R. and J.T. Trumble. 2002. Competitive displacement among insects and arachnids. Ann. Rev. Entomol. 47: 435–465. Revilla, T. 2002. Effects of intraguild predation on resource competition. J. theor. Biol. 214: 49-62. Rosenheim, J.A., H.K. Kaya, L.E. Ehler, J.J. Marois, and B.A. Jaffee. 1995. Intraguild predation among biological-control agents: theory and evidence. Biol. Contr. 5: 303–335. Thibaut, J. 2005. Behavior of Apanteles carpatus(Say) (Hymenoptera: Braconidae) when parasitizing Tinea pellionella (L.) (Lepidoptera: Tineidae). Diploma Thesis Free University of Berlin, Germany and Federal Institute for Materials Research and Testing Berlin, Germany. Tillman, P.G. and J.E. Powell. 1992. Intraspecific host discrimination and larval competition in Microplitis croceipes, Microplitis demolitor, Cotesia kazak (Hym.: Braconidae) and Hyposoter didymator (Hy.: Ichnoimonidae), parasitoids of Heliothis virescens (Lep.: Noctuidae). Entomophaga 37: 229-237. Trematerra, P. and F. Fontana. 1996. Monitoring of webbing clothes moth, Tineola bisselliella (Hummel), by sex pheromone. Anz. Schädlingskde., Pflanzenschutz, Umweltschutz 69: 119- 347

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

PHYSICAL METHODS TO COMBAT MASS OCCURRENCES OF CYLINDROIULUS CAERULEOCINCTUS (DIPLOPODA: JULIDAE)

KLAUS ZIMMERMANN inatura GmbH, Jahngasse 9, 6850 Dornbirn, Austria

Abstract In the small village of Röns (Austria) three families were confronted with a long lasting major mass occurrence of the snake millipede Cylindroiulus caeruleocinctus (Wood). Chemical, biological and physical methods were tested to force back those invaders and to protect the affected people. A three-stage defence-system containing different physical barriers was established to provide long-term protection. The inner circle was built up to prevent the millipedes from entering indoor areas. The middle circle was installed to keep them from climbing up the outer house walls. The outer circle was attached to protect the whole plot against new invaders.

Key words Snake millipedes, swarming behaviour, mechanical methods in pest management, silicate powder.

INTRODUCTION Millipedes are a group of primeval arthropods characterized by two pairs of legs on most body segments. The biological knowledge about millipedes is rather sparse. On the other hand, their mass occurrences are rather common, and nobody can explain their biological reasons (Passig and Scholz, 2007). In 2004, the biological advisory service (BAS) of the “inatura – Erlebnis Naturschau Dornbirn” was informed about the mass occurrence of C. caeruleocinctus in the village of Röns (Zimmermann, 2014b). Thousands of specimens were climbing up the outer house walls of three detached houses each night during a period of several weeks. Frequently singular millipedes managed to get into the houses, disgusting the tenants massively in their private sphere. This had already been remarked three years before, but in the beginning nobody had an idea of its dimension: the snake millipedes became part of the lives of the affected residents for more than ten years. As there was no chance of getting rid of them rapidly, it was the author´s goal to support the affected families in minimizing the disruptions caused by the invaders and to build up physical barriers to keep them away from more sensitive areas (Zimmermann, 2013). The author has been asked for advice more than 100 times by people confronted with mass occurrences of C. caeruleocinctus and other millipedes in Austria and other European countries during the past ten years. None of these infestations reached the dimension of the one in Röns.

MATERIALS AND METHODS Annoying Intruders C. caeruleocinctus is a Julidae-species that is common in many parts of Europe (Bogyó and Korsós, 2010). It was also imported to the U.S.A. and Canada. Being a synanthropic ground dweller in open landscapes it can be found near the boundary of acres, in cemeteries and gardens – mainly under stones 348 K. Zimmermann Physical Methods To Combat Mass Occurrences Of Cylindroiulus caeruleocinctus or wooden structures. The diet of this snake millipede contains leaves of several deciduous trees as well as litter of grass plants and moss. Being strictly hygroscopic the specimens show their main activity periods in spring and autumn (Voigtländer, 2005). During the hot summer as well as in winter they hide in deeper zones in the soil. They show a typical diurnal vertical movement pattern, their main activity period being during the night (Haacker, 1967). A few authors describe C. caeruleocinctus as a pest feeding on roots of carrots, sweet potatoes and other culture plants (Brunke et al., 2012). Much more relevant is its role as an annoying species, whenever thousands of individuals enter gardens and houses (Scott, 1958). Evaluation Of The Pest This mass occurrence of C. caeruleocinctus occupied an area of about two hectares of ground. It was completely impossible to count or assess the whole number of individuals. To get a proper reference to the dimension of the infestation, the numbers of individuals climbing up the house walls were counted frequently. This led to the experimental definition, that an amount of 500 or more individuals entering the walls of a house during one hour (at night) three times or more frequently during an activity period marks a major mass occurrence. This definition might also be useful to distinguish between an annoying occurrence and a real pest. Due to the author´s experience, an amount of 500 millipedes and more on the house walls leads to a significantly higher number of individuals trying to get into the houses. On the affected sites in Röns many singular counting (over a period of 7 years) with 2.000 individuals and more, climbing up the walls of each of the affected houses, were documented. Methodical Attempts To Combat The Pest At first a local pest controller tried to combat the millipedes using insecticides containing Pyrethrum or Chlorpyrifos, but none of these pesticides could stop these invaders. As a second step, different beneficial organisms like predatory mites (Hypoaspis miles) and nematodes (Steinernema carpocapsae) were tested to reduce the amount of millipedes (Schulte, 1989). Applied in situ, the mites showed a weak effect for a few days, whereas in laboratory experiments they showed no influence on the millipedes. Nematodes were tested in cooperation with the enema company (Germany), but also showed no effect on C. caeruleocinctus. As these chemical and biological methods did not help to reduce the swarming millipedes properly, various physical barriers and traps were tested to keep away these intruders. This led to the plan of an experimental three-stage defence system to force back the invading millipedes (Zimmermann, 2014a).

THREE STAGE PHYSICAL DEFENCE SYSTEM The inner circle of the barrier-system was built up to prevent the diplopods from entering the indoor areas of the houses. To fulfill this purpose, insect screens were installed on windows and doors, several door and window seals were renewed, and other entrance facilities for the millipedes (ventilation slits etc.) were closed with tapes. The middle circle was established directly on or near the plinths of the house walls to keep the millipedes from climbing up the outer house walls. It also enabled the protection of balconies, verandas, terraces, pergolas and other defined places near the houses. In a small distance from the ground a slippery plastic tape (7 cm high) was fixed with a double-sides adhesive tape to the house wall. Entering millipedes had no chance to pass this slippery barrier. The areas around doors and pathways were additionally protected with trails of silicate powder. To complete the protection masking tapes were applied as adhesive traps on the ground. The outer circle was installed near the plot boundaries to protect the whole property against migrating millipedes. It was put into practice with a slug fence made of galvanized iron-plate. The vertical parts of this fence were coated with a liquid formulation of silicate powder to build a self-eroding surface. Whenever millipedes tried to climb up this chalky surface, small eroding silicate-crumbs stuck Physical Methods To Combat Mass Occurrences Of Cylindroiulus caeruleocinctus 349 to their tarsi and made them lose their grip and slip down again (Mucha-Pelzer, 2010). This special surface coating had been developed by the Humboldt-University of Berlin and was tested in situ for the first time in Röns (Mucha-Pelzer et al., 2009). On both sides of this fence sets of barber-traps were posed to control the effect of this barrier. EXPERIENCES AND DISCUSSION It proved to be rather helpful to define three different protection areas. Each defence-circle had its specific functions and demands. But all these measures had to fulfill one goal, they had to ameliorate the welfare of the affected tenants. Normally the interior areas indicate the most delicate space that has to be protected solidly. To achieve this, each single window and door seal had to be proved and – if necessary – renovated. Ventilation slits had to be taped carefully. All windows (and also balcony doors etc.) that might remain open during the nights had to be secured with insect screens. Wherever these inner defence-measures were realized properly, not even single millipedes were able to enter the rooms. Keeping the house wall more or less free from millipedes is a further important step to keep the tenants calm. The applied plastic tape fulfilled this purpose sufficiently and free from service costs. Its only disadvantage was that it could damage the surface (painting) of the wall, when being peeled off again. Also barriers made of silicate powder showed a rather good performance against the millipedes. Part of the specimens was aware of the silicate trail and turned back. Others, that tried to crawl through the powder, were contaminated massively (Zimmermann and Duelli, 2007). Being animals with many joints and intersegments, the millipedes are predestinated to be controlled with silicate powder: The grains of the powder stuck everywhere on their bodies, destroying the waxy layer of their cuticule and making them unable to move or curl up. Most of the individuals died at least a few hours after being contaminated. But this lethal barrier needed to be maintained permanently: after strong rains or winds the trails had to be cleaned (especially if there were lots of millipede bodies covering the silicate) and new powder had to be applied. The installation of the adhesive traps made from masking tapes was rather tricky, and they had to be renewed very often. As soon as a few millipedes were already sticking to the tapes, the following individuals could cross them in climbing over their bodies. The outer circle was established to keep migrating millipedes away from the whole plot. The slug fence and its special coating fulfilled this purpose perfectly. But the attempts to quantify this effect with barber-traps had to be cancelled because too many bycatches had been killed. The big disadvantage of this barrier was its permanent need for maintenance. After each grass-mowing, the fence had to be cleaned coated. During winter the fence had to be removed completely and then to be rebuilt in spring.

CONCLUSIONS The tested set of physical barriers proved to be a proper long-term method to combat swarming and migrating masses of millipedes. The success of these measures is strongly depending on the attitude of the affected tenants, therefore a close contact between them and the pest advisors has to be established. According to the needs of the individual situation, this method can be adapted or only a part of the barriers can be installed. As this system does not help to reduce the stocks of the swarming millipedes (only the silicate powder partly does!), it could be combined with biological methods (nematodes and other beneficial animals) to get a quicker reduction of the problem for the tenants. 350 K. Zimmermann

REFERENCES CITED

Bogyó, D. and Z. Korsós. 2010. Cylindroiulus caeruleocinctus (Wood, 1864), new to the fauna of Hungary, and its current European distribution (Diplopoda: Julida). Schubertiana 4/2010, 9-14. Brunke, A.J., L. O’Keefe, C.A. Bahlai, M.K. Sears, and R.H. Hallett. 2012. Guilty by association: an evaluation of millipedes as pests of carrot and sweet potato. J. Appl. Entomol. 136/10. Dec. 2012, 772–780. Haacker, U. 1967. Tagesrhythmische Vertikalbewegung bei Tausendfüßlern (Myriapoda, Diplopoda). Die Naturwissenschaften 54 (13): 346-347. Mucha-Pelzer, T. 2010. Amorphe Silikate – Möglichkeiten des Einsatzes im Gartenbau zur physikalischen Schädlingsbekämpfung. Dissertation an der Humboldt-Universität zu Berlin. In: Berliner ökophysiologische und phytomedizinische Schriften, Band 17, Der Andere Verlag, Tönning, Lübeck und Marburg. Mucha-Pelzer, T., Ch. Ulrichs, K. Zimmermann, and N. Gorbach. 2009. Wenn Lästlinge zur Last werden – Tausendfüßler in Röns. Der praktische Schädlingsbekämpfer 4: 16-17, Beckmann Verlag, Lehrte. Passig, K. and A. Scholz. 2007. Tausendfüßler. In: Lexikon des Unwissens – Worauf es bisher keine Antwort gibt. Berlin: Rowohlt Verlag. Schulte, F. 1989. Biologische Kontrolle eingeschleppter Tausendfüßer in Südaustralien. Biologie in unserer Zeit 6: 203-204. Scott, H. 1958. Migrant millipedes and centipedes entering houses 1953-1957. Entomol. Mon. Mag. 94: 73-77. Voigtländer, K. 2005. Mass occurrences and swarming behaviour of millipedes (Diplopoda: Julidae) in Eastern Germany. Peckiana, Volume 4 (2005) 181-187. Zimmermann, K. 2013. Röns: St. Magnus und die Tausendfüßler. In: Naturmonographie Jagdberggemeinden. 371-386. Dornbirn: inatura – Erlebnis Naturschau. Zimmermann, K. 2014a. Die Invasion der Schnurfüsser. – Pest Control News, 56 (April 14) 29-31. Zimmermann, K. 2014b. Scientific experiences from pest advisory in Vorarlberg (Austria). In: Müller, G.; Pospischil, R. and Robinson, W.H.; eds. Proceedings of the 8th International Conference on Urban Pests. 315-318. Veszprém (OOK-Press). Zimmermann, K. and H. Duelli. 2007. Mikrotechnik hilft Probleme mit tierischen Lästlingen zu beseitigen. Posterpräsentation bei: Erstes Forschungsforum der Österreichischen Fachhochschulen, 11.-12. April 2007, Puch. K. Zimmermann 351

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

WHAT IS EATING YOUR COLLECTION? DEVELOPMENT OF A WEB-BASED INSECT PEST RECORDING DATABASE

1JANE THOMPSON WEBB AND 2DAVID PINNIGER 1Conservation Team Leader. Conservation Department, BM&AG, Chamberlain Square, Birmingham B3 3DH 2DBP Entomology, Cookham, UK,

Abstract There is very little information on the distribution of indoor insect pests, and particularly those that infest museum collections. In 2009, the authors developed a website using Renaissance in the Regions funding. The site www.whatseatingyourcollection.com was devised to be a source of information about IPM and insect pests with a photographic reference guide. The website grew out of requests for a reference tool from participants who attended our IPM workshops for people working in the Heritage sector. The participants also asked questions about the spread of insect pests in the UK and whether this was changing. Whilst a pest identification tool could be generated, it was not possible to answer the question regarding the distribution of insect pests other than via anecdotal evidence and personal experience. A second part of the website was therefore developed as an insect pest recording tool. IPM co-ordinators in UK heritage institutions were invited to record the insect finds from their trapping programme on a quarterly basis. There are also records from some domestic and commercial premises where the accuracy of identification can be assured. We have examined the results of all the recordings so far obtained and analysed the current distribution of many species of insect pests across the UK, based on geography and building type. We have also tracked changes in distribution and frequency of established pests and recorded the introduction and spread of new pests, such as Australian carpet beetle Anthrenocerus australis. With coordination, this recording system could be adapted for use in any country or geographical area and it is hoped that it will become a valuable tool to be used by all IPM practitioners.

Key words Museum pests, insect pest distribution, insect pest identification, database

INTRODUCTION In 2003, Birmingham Museums Trust (BMT) was one of the recipients of Renaissance in the Regions funding from central Government. At the time, there was a strong emphasis on improving collections and BMT decided to use some of the funding to provide training in collection care for museums in the six counties of the West Midlands. A survey undertaken in 2002 by Porter identified that a gap had developed in the delivery of training in the heritage sector and that it was very difficult for smaller museums to access affordable, practical training. Where training was provided, the courses were often based in London, adding high travel costs to an already expensive course. These factors excluded many museums, especially those run by volunteers. BMT planned a series of free collection care training for the West Midlands and courses began in 2004. After 12 years, the courses are still being run, although they are no longer offered free. IPM courses were a major part of the programme offered and they proved to be some of the most popular courses. They engendered many questions, some about specific issues and some about IPM more generally. One of the early questions was - what pest insects are found in collections in my county? 352 J. Thompson Webb and D. Pinniger What Is Eating Your Collection? Development Of A Web-Based Insect Pest Recording Database

This was closely followed by – how many are there? There was no way to answer these questions as the data did not exist. Information about the distribution of insect pests is very thorough for insects that affect crops – the outdoor insect pests, but there is less information regarding urban insect pests and even less about those that attack collections. MATERIALS AND METHODS There is some information available for indoor insect pests, but it is either highly specific or quite general. An internet search on varied carpet beetle, Anthrenus verbasci receives over 49,000 results. It is possible to find a map to show the distribution of this species, but that it favours the temperate regions. Superficially this is helpful, but it doesn’t show if Anthrenus verbasci is more common in Wales than Sicily or if it is more common in museums than historic houses. For those people monitoring insect species and infestations in the heritage sector, this is the information we really need. With this kind of information we could be on the alert for new species and perhaps change IPM practices to avoid a potential infestation. We decided that the heritage sector in the West Midlands needed a comprehensive resource to enable people to find out about IPM and to help them to identify what they were finding. We also wanted to create a database where we could start to gather information about what insects were being found and where they were. In addition we could record how many insects were being found and if the numbers or distribution were changing.

Website Renaissance in the Regions funding was used to create a CD ROM that gave information on IPM and insect pest identification. This was found to be very useful, but the format was inflexible and could not be updated. We developed the concept into a website which contained expanded insect pest images and information to help identification and also enabled us to include a pest recording database. CD and website were called What’s Eating Your Collection? (www.whatseatingyourcollection.com) Confidentiality was an important part of the development of the website. To avoid embarrassment and to encourage heritage organisations to submit their data, each data enterer can only see their own data and on the public access side, the map is controlled so that it is not possible to zoom in to a large scale. This means that individual properties and institutions cannot be identified. The data enterer is required to enter information about their institution, date of check, trap type, insect found etc. This enables us to build up a picture about the kind of institution favoured by insect species, time of year when most are found and geographical spread. We only gather quarterly totals – the database is not meant to replace an institution’s own pest recording, but be a supplement to it.

Managing The Website Insect species are recorded using a drop down list. This was a later addition to the website. The field was originally free text and this gave us some spurious insect name combinations, such as Stegobium smirnovi, or useless information like “beetle”. The drop down avoids this and thus provides consistent information. The scientific and common name drop downs are linked so that entering in one box auto fills the other – useful for those who can only remember one version of a name. The list contains all the insects illustrated in the identification section of the website and this gives a list of 49 insect species, although so far only 30 from the list have been recorded. There are 32 data enterers registered representing a wide range of institutions. Birmingham Museums Trust, National Trust for Scotland, the National Trust and English Heritage enter data from across their portfolio of all types of property. There is also information from a commercial company, giving us data for commercial and domestic properties. It is essential that the data recorders are competent to identify the insects accurately as a wrong ID. would make any analysis worthless. All have been trained by the authors and receive refresher ID. information. In cases where the recorders are not sure of a species, they send specimens or images to one of the authors for confirmation. This has worked What Is Eating Your Collection? Development Of A Web-Based Insect Pest Recording Database 353 well and resulted in a number of unusual infestations being discovered. Examples include the first record of the museum nuisance beetle Reesa vespulae in a Birmingham Museum and the first record on the Australian carpet beetle Anthrenocerus australis in a National Trust property.

Analysing Data From The Website The front end, accessible to anyone, allows one to search on a variety of terms. Drop down boxes allow entry of search terms. These are by county, building type, quarter/year, genus, species and stage of life cycle. A selection of filters allow the data to be ranked in different ways – it can be grouped by county, building type, quarter/year, genera, species, stages and shown on a map which allows for multiple permutations of data presentation.

RESULTS AND DISCUSSION Examples of Pest Occurrence and Distribution. Death watch beetle, Xestobium rufovillosum. Death watch beetles have been causing problems in buildings for hundreds of years. As they are particularly associated with oak timbers, it is not surprising that there are few historic buildings in England which have not had some damage. In recent years, improvements in design and good maintenance to prevent timbers getting damp, has reduced the fungal attack which the beetle larvae need to thrive. Xestobium rufovillosum (Figure 1) is widespread across most of England. However, there are very few records from Scotland and none from North of the Border area. The explanation is that there is very little oak in Scotland and therefore most wooden building structures are not prone to attack by death watch beetles. Furniture beetle (woodworm), Anobium punctatum. Furniture beetle has also been associated with damage to wooden buildings and wooden objects, probably since Roman times. Anobium punctatum needs wood above 14% moisture content to thrive, it is not restricted to oak or wood with previous fungal attack. Furniture beetle (Figure 2) is widespread in the UK, even the far North of Scotland. A. punctatum it is associated with buildings with high humidity and is absent from most museums and other buildings with good heating systems which make the wood too dry (Ridout, 2012).

Figure 1. Figure 2. Distribution of Distribution Death watch of Furniture beetle, Xestobium beetle, Anobium rufovillosum punctatum

354 J. Thompson Webb and D. Pinniger What Is Eating Your Collection? Development Of A Web-Based Insect Pest Recording Database

Webbing clothes moth, Tineola bisselliella. Tineola bisselliella is the major pest of wool, fur and feather textiles in buildings in the UK. The data from the National Trust for Scotland shows that it has spread to all corners of the UK (Figure 3). It is increasing in numbers. Two spot carpet beetle, Attagenus pellio. Also known as the fur beetle, Attagenus pellio is associated with damage to fur, wool and feathers in houses where infestations are often linked to blocked chimney flues. The data from historic houses (Figure 4) supports this and Figure 5 shows that it is very rarely found in museums which do not provide the right environment for A. pellio to thrive.

Figure 4. Figure 3. Distribution of Two Distribution of spot carpet beetle, Webbing clothes Attagenus pellio in moth, Tineola historic houses. bisselliella

Vodka beetle or Brown carpet beetle, Attagenus smirnovi. This pest was probably introduced into the UK in the 1970’s (Pinniger, 2011) and has become established in buildings the London area, firstly in museums and more recently in houses. Only a few specimens have been found elsewhere in the UK (Figure 6), but given its spread across mainland Europe, (Pinniger, 2013) the occurrence of A. smirnovi may be under-recorded in the UK. Varied carpet beetle, Anthrenus verbasci and Guernsey carpet beetle, Anthrenus sarnicus. Varied carpet beetle Anthrenus verbasci is a pest of wool, fur and feathers in museum collections and domestic housing. It is widely distributed across the UK, apart from the North of Scotland (Figure 7). In the 1970’s a new species, Anthrenus sarnicus, was found in London, having only previously been recorded from Guernsey. The spread of this species in London and elsewhere has been documented and it has continued to spread (Figure 8). We suspect that this species is also under recorded as it is difficult to distinguish A. sarnicus from A. verbasci. A. sarnicus thrives in warm environments so there may be more than one generation a year.

What Is Eating Your Collection? Development Of A Web-Based Insect Pest Recording Database 355

Figure 5. Distribution of Two Figure 6. Distribution Figure 7. Distribution spot carpet beetle, Attagenus of Brown carpet beetle, of Varied carpet beetle, pellio in museums. Attagenus smirnovi Anthrenus verbasci

Figure 8. Figure 9. Distribution Distribution of Guernsey of Australian carpet beetle, carpet beetle, Anthrenus Anthrenocerus sarnicus. australis

Australian carpet beetle, Anthrenocerus australis. This was first recorded in the UK in 1938, few specimens were found until an infestation was discovered in a carpet in the Victoria and Albert Museum in 2012. Since then these carpet beetles have been collected in traps (Pinniger, 2014). The distribution map (Figure 9) will need to be updated regularly for new records of this species. Although the distribution data covers a wide area of the UK, there are some obvious gaps where we do not have people recording or entering data. We hope to rectify this by recruiting more recorders to the scheme from the heritage sector and also from the pest control industry as the domestic and commercial data provided by Killgerm has been invaluable in providing a bigger picture of pests in all buildings across the UK. To do this we need accurate identification and greater awareness of new species. This has recently been highlighted by the first occurrence in the UK of grey silverfish Ctenolepisma longicaudata. Abby Moore at the Museum of London was the first to notice some unusually large silverfish on traps in her museum. The identification was confirmed as C. longicaudata and in 2016 a further infestation was discovered in a London art gallery (Moore et al 2016). We will now have to add Ctenolepisma longicaudata to our species list. 356 J. Thompson Webb and D. Pinniger What Is Eating Your Collection? Development Of A Web-Based Insect Pest Recording Database

A number of people in other countries have expressed interest in our scheme and Austria and Scandinavia are currently discussing a similar recording system. It is hoped that maybe we will eventually have a European pest recording database, as insects certainly do not recognise national boundaries.

INSECTS IN DATABASE

Insect species listed on database

1. Australian carpet beetle Anthrenocerus 23. Guernsey carpet beetle Anthrenus sarnicus australis 24. Hide beetle Dermestes maculatus 2. Australian spider beetle Ptinus tectus 25. Hide beetle larva Dermestes sp 3. Berlin beetle Trogoderma angustum 26. House Hylotrupes bajulus 4. Biscuit or drug store beetle Stegobium 27. Indian meal moth Plodia interpunctella paniceum 28. Larder beetle Dermestes lardarius 5. Black carpet beetle Attagenus unicolour 29. Mealworm beetle Tenebrio molitor (megatoma) 30. Museum nuisance Reesa vespulae 6. Booklouse or psocid Liposcelis bostrychophila 31. Obvious moth Monopis obviella 7. Brown carpet beetle/Vodka beetle Attagenus 32. Odd beetle Thylodrias contractus smirnovi 33. Peruvian hide beetle Dermestes peruvianus 8. Brown house moth Hofmannophila 34. Plaster beetle Adistemia watsoni pseudospretella 35. Plaster beetle Dienerella sp 9. Brown-dotted clothes moth Niditinea 36. Plaster beetle Lathridiidae sp fuscella 37. Powder post beetle Lyctus brunneus 10. Carpet beetle larva Anthrenus sp 38. Silverfish Lepisma saccharina 11. Carpet beetle larva Attagenus sp 39. Six spot spider beetle Ptinus sexpunctatus 12. Case-bearing clothes moth Tinea pellionella 40. Spider beetle Ptinus clavipes 13. Cigarette beetle Lasioderma serricorne 41. Tapestry moth Trichophaga tapetzella 14. Anobium 42. Two-spot carpet beetle Attagenus pellio punctatum 43. Varied carpet beetle Anthrenus verbasci 15. Dark carpet beetle Anthrenus fuscus 44. Warehouse moth Ephestia elutella 16. Death watch beetle Xestobium rufovillosum 45. Webbing clothes moth Tineola bisselliella 17. Firebrat Thermobia domestica 46. Wharf borer Nacerdes melanura 18. Fungus beetle Cryptophagus sp 47. White-marked spider beetle Ptinus fur 19. Fungus beetle Mycetophagus sp 48. White-shouldered house moth Endrosis 20. Furniture carpet beetle Anthrenus flavipes sarcitrella 21. Globular spider beetle Trigonogenius 49. Wood weevil Euophryum/Pentarthrum sp globulus 22. Golden spider beetle Niptus hololeucus What Is Eating Your Collection? Development Of A Web-Based Insect Pest Recording Database 357

REFERENCES CITED Moore A, D.B. Pinniger and D. Mann. 2016. A new silverfish threat in the UK and Europe Ctenolepisma longicaudata. 3rd International IPM conference in Museums, Archives and Historic Buildings. Paris Porter, G. 2002. Overview of Collections Information and Advice in the Museums Domain. London: Re:source; The Council for Museums, Archives and Libraries Pinniger, D.B. 2011. Ten Years on – from Vodka beetles to Risk Zones. Integrated Pest Management for Collections. In: Proceedings of 2011: A Pest Odyssey, Ten Years later. English Heritage, London. Pinniger, D.B 2013. Past, Present and Future. 2013. Changes in status and distribution of museum insect pests. In: International conference on IPM in museums, archives and historic houses. Vienna 2013 Pinniger, D.B. 2014. Invaders from Oz? Pest Magazine. November/December 2014 Pinniger, D.B, 2015. Integrated Pest Management in Cultural Heritage, Archetype Publications, London, UK 142p Ridout, B. 2012. Timber, English Heritage, Ashgate Publishing, Farnham Surrey UK. 359

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

BIOLOGICAL CONTROL WITH LARVAL PARASITOID LARIOPHAGUS DISTINGUENDUS IN MUSEUMS AND HISTORIC BUILDINGS

PASCAL QUERNER University of Natural Resources and Applied Life Sciences, Department of Integrated Biology and Biodiversity Research, Institute of Zoology, Gregor-Mendel-Straße 33, A-1180 Vienna - Austria Universitity of Applied Arts Vienna, Institute of Archäometrie, Expositur Salzgries, A-1010 Vienna, Austria

Abstract In this paper the biological control of biscuit beetle (Stegobium paniceum) and spider beetle (Gibbium psylloides) found in different museums, historic buildings and a monastery library in Austria is described. Six case studies are presented where the insect pest monitoring with sticky blunder traps showed the activity of biscuit beetles and spider beetles. It was not clear if objects were actively infested or the pests were coming from the building. Success of the release of wasps varies and no clear trend was found. In two cases the monitoring in the years after the release clearly showed the success of this control method. In the other cases the number of the beetles remained about the same. In those cases the beetles were probably not living in infested objects but were coming from the building. In the infested library other measures needed to be taken as the trapped number of beetles increased significantly. Biological pest control with mass release of parasitoid wasps might have a future in preventive conservation of museum objects, but success depends very much on the local circumstances and the type of the infested objects.

Key words Museum pests; Integrated Pest Management; IPM; treatment; costs.

INTRODUCTION Integrated Pest Management (IPM) is an important part of preventive conservation in museums and aims to stop both damage to valuable museum objects and the spread of pests between collections. In IPM, different measures like sealing the building, regulating the climate, quarantine for all incoming objects, good cleaning and housekeeping, training museum staff and monitoring all help to prevent an infestation (see for example Brokerhof, 2007; Flieder and Capderou; 1999, Florian, 1997; Pinniger, 2015; Querner, 2015; www.museumpests.net). Most museums try to reduce the application of pesticides in their collections and use freezing, controlled heating, nitrogen or CO2 fumigation or anoxic treatment to kill all stages of pests in wood, textile, natural history, ethnographic, modern art objects, historic libraries, archives or historic buildings (see Querner and Kjerulff, 2013 for an overview of treatment methods used in museums). For some years, parasitoid wasps have been applied in biological pest control to reduce infestations in food storage and processing facilities (Schöller et al., 1997; 2006). Various parasitoid species are now commercially available and can be applied against different kinds of moths and beetles (Schöller and Flinn, 2000). Good results have been obtained from different experiments using various selected foods, breeding and releasing parasitoids against different stored product pests (Schöller et al., 1997; 2006). 360 P. Querner Biological Control With Larval Parasitoid Lariophagus distinguendus

The same pests as in the food industry like the drugstore beetle (Stegobium paniceum), the tobacco beetle (Lasioderma serricorne) and the webbing clothes moth (Tineola bisselliella) are also important pests in museum, therefore parasitiods could also be used to control them (see Schöller, 2010; Schöller and Prozell, 2011; 2016). Over the last years biological control of insects was tested in several museum collections (Querner and Biebl, 2011; Anheuser and Garcia Gomez, 2013; Anheuser, 2016; Querner et al., 2013; Biebl, 2013; Auer and Kassel, 2014; Querner et al., 2015) but most of these applications were carried out alongside other treatments such as freezing or nitrogen fumigation (Biebl and Reichmuth, 2013; Querner et al., 2015). Until now it is not clear whether a biological control using parasitoid wasps can be 100% successful in a museum environment. Compared with stored product protection, food storage and processing facilities, where biological control is used mainly to reduce infestations under a commercial threshold, in a museum context the infestation needs to be eradicated completely, as the objects are stored for long periods and cannot be replaced. In this paper we report on the release of the larval parasitoid Lariophagus distinguendus against an active biscuit beetle infestation in a museum. See Table 1 for an overview of the most important pests and their natural predators (or predators accepting them as host), that are of relevance for biological control of museum pests.

Table 1. Different insect pest species found in museums or historic buildings (see Pinniger, 2015; Querner, 2015) and their biological control agents). Species marked with “ * ” are commercially available (Table modified from Biebl personal communication, Zimmermann, 2005; Al Kirshi, 1998).

Moth Species Egg and Larval Parasitoid Reference

Tineola bisselliella Trichogramma spp. * Zimmermann, 2005 Apanteles carpatus * Plarre et al., 1999

Tinea pellionella Baryscapus tineivorus (Eulophidae) Zimmermann, 2005

Beetles Species Predator or Larval Parasitoid

Stegobium paniceum Lariophagus distinguendus * Kaschef, 1961 Lasioderma serricorne Anisopteromalus calandrae * Kaschef, 1955 Niptus hololeucus Cephalonomia gallicula Biebl and Reichmuth, Gibbium psylloides 2013 Schöller, 2010 Trogoderma angustum Laelius pedatus * Al Kirishi, 1998 Anthrenus verbasci Attagenus unicolor Xylocoris flavipes * (bug) Al Kirishi, 1998 Attagenus smirnovi Anthrenocerus australis Anobium punctatum Spathius exarator * Auer and Kassel, 2014 Cephalonomia gallicula Biological Control With Larval Parasitoid Lariophagus distinguendus 361

Larval parasitoid Lariophagus distinguendus (Hymenoptera, Pteromalidae). A naturally occurring parasitoid of the biscuit beetle S. paniceum is the pteromalid parasitoid Lariophagus distinguendus. The larval parsitoid wasp has a cosmopolitan distribution and is reported to attack about 15 different beetle species from several families (Noyes, 2014), but not all equally successfully (Goodrich, 1921; König et al., 2015). Several of these pests are regularly active in museum collections or historic buildings and naturally become parasitized by L. distinguendus. Examples are: The larvae of the drugstore beetle S. paniceum, of the tobacco beetle L. serricorne, both occurring in museums and historic libraries and the hump beetle Gibbium psylloides and the golden spider beetle Niptus hololeucus, both frequently occurring in historic buildings. The wasps find their hosts mainly by olfactory stimuli (Benelli et al., 2013; Steidle, 2000; Steidle and Ruther, 2000). L. distinguendus occurs naturally in central Europe and can also be found in high infested museum locations. The wasps lay up to 60 eggs on the larvae and pupae of the beetles, which are found within the infested materials. Parasitoid wasps should be released either monthly, or 2-4 times per year to treat an infestation.

MATERIAL AND METHODS Monitoring insect activity in the storage or museums In all locations monitoring with sticky blunder traps (type Catchmaster) was performed to collect regularly active insect pests and non-pest arthropods. Traps were replaced twice per year and checked six times per year between March and October. Traps were left in place also for the winter months but not checked regularly. The results and details from the monitoring data are not presented here. Table 2 presents the abundance of the pests S. paniceum and G. psylloides in the last years.

Parasitoid release after beetles were found If an activity of pests like S. paniceum and G. psylloides was found, the release of the parasitoid wasps L. distinguendus was discussed with the conservator and the number of wasps and release dates decided on a case by case situation (see Table 2). There were released in the rooms where the beetles were found, usually close to the objects on the floor. 362 P. Querner Biological Control With Larval Parasitoid Lariophagus distinguendus

Table 2. Location (exhibition space in a museum = M, museum storage = S, historic library = L), pest species found and treated, years where the monitoring was performed, parasitorid release dates, number of parsitoid wasps L. distinguendus released each date.

Location Year Numb. Parasitoid Release Number of Success or Failure and Pest of Parasitoids Species Pests Dates Released Hofburg 2012 46 No effect on the Wien (M) biscuit beetles! G. p. 2013 47 -> can not reach the 2014 44 2., 3., 4., 5. 2014 4 x 150 ind. beetles underneath the floor boards 2015 44 2., 3., 4., 5. 2015 4 x 150 ind.

2016 55 Monastery 2014 207 11., 12. 2014 2 x 900 ind. No effect on the bis- library (L) cuit beetles -> high S. p. 2015 273 4., 5., 7., 10., 10. 5 x 900 ind. infestation of books 2015 -> other treatment 2016 681 4 x 900 ind. needed 3., 4., 5., 6. 2016 Academy 2013 5 No effect on the picture biscuit beetles ! gallery (M) 2014 8 4., 5. 2014 2 x 120 ind. S. p. -> they come from 2015 4 2., 3., 4., 5. 2015 4 x 180 ind. the building 2016 8 KHM pic- 2012 18 4., 5. 2012 2 x 100 ind. No effect on the ture gallery biscuit beetles ! (M) S. p. 2013 2 4., 5., 6. 2013 3 x 300 ind. -> they come from 2014 8 3., 4., 5. 2014 3 x 300 ind. the building 2015 8 2., 3., 4., 5. 2015 4 x 300 ind.

2016 9 KHM old 2010 51 4., 5., 6. 2010 3 x 360 ind. reduction of bee- storage (S) tles, but all objects S. p. 2011 5 (paintings lined with starch paste linings)

were treated with Anoxia before trans- port to new storage KHM new 2013 51 ind. monthly 7. 2013 6 x 1800 ind. no more biscuit storage (S) beetles were found-> S. p. 2014 0 until 9. 2014 9 x 1800 ind. 100% success! 2015 0

2016 0 Biological Control With Larval Parasitoid Lariophagus distinguendus 363

RESULTS AND DISCUSSION In the two storages where old master paintings were infested by S. paniceum (see also Fohrer et al., 2006; Liu, 2013), the release of the wasp had a clear effect on the beetles resulting in much lower number of beetles found on the traps, or none at all. This result shows that biological control of museum pest is possible and can even result in 100% success. No effect on the contrary was found in the infested library where the historic books already had quite a high infestation. The infestation was discovered in 2013 only by chance and the monitoring and release of parasitoids started soon after. We monitored the effect of the wasp released for two years, but after the beetle population increased significantly in 2016, the release of wasps was stopped and a alternative treatment method had to be found. Similar results were found by Anheuser and Garcia Gomez (2013) for biological control of the webbing clothes moths in an infested store. Also here the release of the wasps could not reduce the moth population. Anheuser (2016) describe pesticide residues in the objects as a potential reason for the failure of this method. This might also be the case in the historic library in Austria, where dead L. distinguendus were found close to the release tubes. Parasitoid wasps are known to be very sensitive towards historic pesticides (Mathias Schöller, oral communication) which might be a limitation of this method as many museum collections, especially natural history and ethnography, are still heavily contaminated. A second reason for the failure in the case study of the historic library is the already advanced and high infestation. Not a few beetles were found every year but hundreds (Table 2 presents only the number of beetles found on traps and by the windows, this probably reflects only a portion of the beetles hatching each year). As shown in other examples, parasitiod wasps are only effective when the infestation is still low (Schöller, 2010; Schöller and Prozell, 2011). Therefore a good monitoring and IPM program needs to be in place to monitor pest activity and be able to react when the population is still low. No effect was also found in three locations where only a low number of S. paniceum and G. psylloides were found each year. Few beetles of both species were collected on the traps in each location, mostly in the same room year after year. Objects were checked for an infestation and none was found in all three locations. We therefore assume that the beetles were not coming from infested objects (this would have resulted in a clear increase of trapped beetles over the years), but from within the building. S. paniceum is known to be a generalist feeding on all kind of food. In museum and historic buildings it prefers food like starchy and dry plant material (see pest fact sheet on www.museumpests.net, www. whatseatingyourcollection.uk and www1.montpellier.inra.fr), but they can feed also on dust, debris, dead animals, bird nests or dead insects. In the historic location G. psylloides is probably coming from below the floorboards where it (and other spider beetles) is known to feed on plant material like straw that was historically used for insulation. The location is a palace in the centre of Vienna with a historic floor. When the beetles are coming from within the building, the parasitoid wasps don’t seem to find their host larvae, which might be difficult to access underneath the wood parquet floor or in other areas like shafts, a hanging sealing or other dead spaces. If the source of the infestation is assumed to be here, other measurement like cleaning, sealing of gaps or acceptance of a low but stable pest level have to be considered. We show that the release of parasitoid wasps as part of an Integrated Pest Management concept could have a future in museum environments. The method is cheaper than other methods like nitrogen fumigation, depending on the number of objects or room size. It is also easy to use by non-trained staff and some of the main museum pests can be controlled. The fact that objects do not require transportation to a nitrogen chamber or other facility is a big advantage, since the handling of museum objects bears risks and is also costly. Advantages of the biological control in museums: 1. No chemicals are applied which could harm objects, staff or the environment; 2. Easy to use; 3. Cheaper than other treatment methods; 4. Objects do not need to be moved to another location for treatment.. 364 P. Querner Biological Control With Larval Parasitoid Lariophagus distinguendus

Disadvantages: 1. Natural enemies are only commercially available for specific pests; 2.They have to be regularly applied over a long period; 3. They are only effective in the early stages of an infestation; 4. Wasps need to be able to access all pest larvae in the objects; 5. The dead wasps need to be cleaned / removed after the treatment.

ACKNOWLEDGEMENTS We thank the all Museums in Vienna and the monastery in Klosterneuburg for supporting and funding an IPM program and also for their open approach to testing and funding the use of parasitoid wasps in the collection. We also thank Mathias Schöller, Stefan Biebl and Bill Landsberger for discussion on the use of parasitoid wasps in museums.

REFERENCES CITED Anheuser, K. and I. Garcia Gomez. 2013. Trichogramma evanescens contre Tineola bisselliella: expérience de lutte biologique contre la mite des vêtements dans une réserve d’objets ethnographiques. Studies in Conservation 58: 269-273. Anheuser, K. 2016. Parasitoids against insect pests - a future for IPM? 233-239. In: Querner, P., D. Pinniger, and A. Hammer. (eds.) Proceedings of the International Conference on IPM in museums, archives and historic houses. held in Vienna, Austria, 5.-7. June 2013. Online http://museumpests.net/conferences/international-conference-in-vienna-austria-2013/ Accessed 17.1.2017 Auer, J. and A. Kassel. 2014. Braconid Wasps: A biological control method. In: Proceedings of the 8th International Conference on Urban Pests: 335-340. Benelli, G., N. Pacini, B. Conti, and A. Canale. 2013. Following a scented beetle: Larval feaces as a key olfactory cue in host location of Stegobium paniceum (Coleoptera: Anobiidae) by Lariophagus distinguendus (Hymenoptera: Pteromalidae). Chemoecology 23(2): 129-136. Biebl, S. 2013. Nützlinge gegen Kleidermotten. Praktische Erfahrungen im Deutschen Museum München, Restauro 1: 39-41. In German Biebl, S. and C. Reichmuth. 2013. Stickstoff-Behandlung gegen Materialschädlinge. Journal für Kulturpflanzen 65(3): 99-109. In German Brokerhof, A.W., B. van Zanen, K. van de Watering, and H. Porck. 2007. Buggy Biz: Integrated Pest Management in Collections. In: Netherlands Institute for Cultural Heritage (ICN), Amsterdam. Dummer, J. and S. Prozell. 2013. Zwergwespen auf Schlittenfahrt. Materialschutz mit Nützlingen. Restauro 1: 46-49. In German Flieder, F. and C. Capderou. 1999. Sauvegarde des collections du patrimoine - La lutte contre les détériorations biologiques. CNRS éditions. Florian, M.L. 1997. Heritage Eaters: Insects and Fungi in Heritage Collections, Earthscan Publications Ltd. Fohrer, F., K. Basle, and F. Daniel. 2006. Problématique de l’infestation des colles de rentoilage des peintures de chevalet par le Stegobium paniceum (L.). In: Support tracé n° 6: 78-85. Goodrich, E.S. 1921. Note on the Hymenoptera parasite in beetle infested grains. Report of the Grain Pest (War) Committee of the Royal Society of London 9. Cambridge Scholars Publishing. Kaschef, A.H. 1955. Étude biologique du Stegobium paniceum L. (Col. Anobiidae) et de son parasite Lariophagus distinguendus Först. (Hym. Pteromalidae). Annales de la Societé Entomologique de France 124: 1-88. Biological Control With Larval Parasitoid Lariophagus distinguendus 365

Kaschef, A.H. 1961. Gibbium psylloides Czemp. (Col., ) new host of Lariophagus distinguendus Först. (Hym., Pteromalidae). Zeitschrift für Parasitenkunde 21: 65-70. Al-Kirshi, A.G.S. 1998. Untersuchungen zur biologischen Bekämpfung von Trogoderma granarium Everts, Trogoderma angustum (Solier) und Anthrenus verbasci L. (Coleoptera, Dermestidae) mit dem Larvalparasitoiden Laelius pedatus (Say) (Hymenoptera, Bethylidae). PhD Landwirtschaftlich-Gärtnerische Fakultät der Humboldt-Universität zu Berlin, Berlin. König, K., E. Krimmer, S. Brose, C. Gantert, I. Buschlüter, C. König, S. Klopfstein, I. Wendt, H. Baur, L. Krogmann, and J.L.M. Steidle. 2015. Does early learning drive ecological divergence during speciation processes in parasitoid wasps? Proceedings of the Royal Society B: Biological Sciences 282: 1799. Liu, L.Y. 2013. First Case of Stegobium paniceum (L., 1758) (Coleoptera: Anobiidae) Infesting Paintings in a Taiwanese Museum. The Coleopterists Bulletin 67(1): 52-53. http:// www1.montpellier.inra.fr/CBGP/insectes-du-patrimoine/?q=en Accessed 17.1.2017www. museumpests.net Accessed 17.1.2017 Noyes, J.S. 2014. Universal chalcidoidea database. See http:www.nhm.ac.uk/chalcidoids. Accessed 17.1.2017 Pinniger, D.B. 2015. Integrated pest management in cultural heritage. Archetype Publications, London. Plarre, R., K. Lieber, W. Burkholder, and J. Phillips. 1999. Host and host instar preference of Apanteles carpatus (Say) (Hymenoptera: Braconidae) a possible parasitoid for biological control of clothes moths (Lepidoptera: Tineidae). Journal of Stored Products Research 35: 197-213. Querner, P. and A.K. Kjerulff. 2013. Non-Chemical Methods to Control Pests in Museums: An Overview. In: Rogerio-Candelera, M.A. Lazzari, M., and Cano, E. (eds.) Science and Technology for the Conservation of Cultural Heritage. Taylor & Francis: 273-276. Querner, P. and S. Biebl. 2011. Using parasitoid wasps in Integrated Pest Management in museums against biscuit beetle (Stegobium paniceum) and webbing clothes moths (Tineola bisselliella). Journal of Entomological and Acarological Research 43(2): 169-175. Querner, P., E. Götz, T. Kimmel, and M. Morelli. 2013. Einsatz von Lagererzwespen im Rahmen eines Integrierten Schädlingsmanagements (IPM) im Museum. Restauro 1: 42–45. Querner, P. 2015. Insect pests and Integrated Pest Management in museums, libraries and historic buildings. Insects 6(2), special issue on Integrated Pest Management: 595-607. Querner, P., T. Kimmel, S. Fleck, E. Götz, M. Morelli, and K. Sterflinger. 2015. Integrated Pest Management (IPM) as part of the move to the new storage in Himberg. Technologische Studien 9/10, Kunsthistorisches Museum Wien: 63-80. Schöller, M. 2010. Biological control of stored-product insects in commodities, food processing facilities and museums. 10th International Working Conference on Stored Product Protection Julius-Kühn-Archiv 425: 596-606. Schöller, M. and P.W. Flinn. 2000. Parasitoids and predators. In: Subramanyam, B. and Hagstrum, D.W. (eds.) Alternatives to Pesticides in Stored Product IPM. Kluwer Academic Publishers, Boston, USA: 229-271. Schöller, M., S. Prozell, A.G. Al-Kirshi, and C. Reichmuth. 1997. Towards biological control as a major component of integrated pest management in stored product protection. Journal of Stored Products Research 33: 81-97.

366 P. Querner

Schöller, M., P.W. Flinn, M.J. Grieshop, and E. Zdarkova. 2006. Biological control of stored product pests. In: Heaps, J.W. (ed.) Insect Management for Food storage and Processing. American Association of Cereal Chemists International, St. Paul, Minnesota, USA: 67-87. Schöller, M. and S. Prozell. 2011. Biological control of cultural heritage pest Coleoptera and Lepidoptera with the help of parasitoid Hymenoptera. Journal of Entomological and Acarological Research 43(2): 157–168. Schöller, M. and S. Prozell. 2016. Biological control of cultural heritage pests – a review. 157-232. In: Querner, P., Pinniger, D., and Hammer, A. (eds.) Proceedings of the International Conference on IPM in museums, archives and historic houses. held in Vienna, Austria, 5.-7. June 2013. Online http://museumpests.net/conferences/international-conference-in-vienna- austria-2013/ Accessed 17.1.2017 Steidle, J.L.M. 2000. Host recognition cues of the granary weevil parasitoid Lariophagus distenguendus. Entomologia Experimentalis et Applicata 95(2): 185-192. Steidle, J.L.M. and J. Ruther. 2000. Chemical used for host recognition by the grain weevil parasitoid Lariophagus distenguendus. Journal of Chemical Ecology 26(12): 2665- 2675.www.whatseatingyourcollection.uk Accessed 17.1.2017 Zimmermann, O. 2005. Untersuchungen zur biologischen Bekämpfung der Kleidermotte Tineola bisselliella (Hummel 1823) und anderer tineider Textilschädlinge (Lepidoptera: Tineidae) mit parasitoiden Hymenopteren. PhD thesis, Johannes-Gutenberg-Universität Mainz. 367

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

PRACTICAL USE OF BRACONID WASPS FOR CONTROL OF THE COMMON FURNITURE BEETLE (COLEOPTERA: ANOBIIDAE)

1STEPHAN BIEBL AND 2JUDITH AUER 1Ingenieurbüro für Holzschutz, Mariabrunnweg 15, 83671 Benediktbeuern, Germany 2Ostendstrasse 132, 90482 Nürnberg, Germany

Abstract This paper will show the practical use of a braconid wasp species (Spathius exarator) as a biological control method for Anobium. punctatum. The parasitic wasp parasitizes its host by piercing its ovipositor directly through the wood surface followed by oviposition onto the furniture beetle larva. Adult wasps emerge through a 0.5 mm wide hole, which can be distinguished from the 2 mm wide hole of A. punctatum. With the consultancy of an official expert for wood protection, the infestation of A. punctatum and the use of the braconid wasp S. exarator were controlled from 2014 till 2016 in a castle church (Schloßkirche Ellingen). Success was based on the count of new exit holes of wasps and furniture beetles on defined areas. The results of the three-year treatment period with the braconid wasp species showed improvement with a decrease of up to 80% emerging furniture beetles on monitored areas. The results of another representative chapel N., treated with S. exarator for two years, demonstrated a decrease of up to 100% emerging beetles with a slight rerise of A. punctatum activity after five years. These results show the promising state of affairs of biological control with the host-specific braconid wasp for A. punctatum infested objects. However, more practical experience will be required to optimise the treatment and rate of success. Furthermore, supportively integrated wood protection treatments, like the use of Anoxia, may be used to reduce partial tight infestations on removable objects.

Key words Anobium punctatum, Spathius exarator, castle, museum pests, integrated wood protection

INTRODUCTION Many chemical products for wood preservation are currently in a review process and will be restricted from the European Biocidal Product Regulation (BPR). This will lead to a lower supply of chemical products for pest control and necessitates the use of alternative methods, like physical treatments or biological control. While physical methods for controlling wood boring insects, like heat treatment or anoxia, have a long tradition in knowledge and practical experience, the biological control using natural enemies to control wood pests had not been applied so far. Despite the knowledge of a wide spectrum of antagonists against different common wood boring species (Haustein, 2010; Schmidt 1952) only few statements of laboratory research as well as practical experience had been reported from scientists (Lygnes, 1955; Haustein, 2010). Described predators of the common furniture beetle Anobium punctatum are amongst others the checkered beetles (Cleridae) Opilo domesticus and Corynetes coeruleus, the soft-winged flower beetle (Malachiidae) Anthocomus bipunctatus and the parasitoids Spathius exarator, (Schmidt, 1952), Cephalonomia gallicola (Paul et.al., 2008) and Cerocephala cornigera (Becker, 1942). Laboratory breeding experiments with predators from the family of Cleridae showed, that they do not seem to be optimal candidates for biological control, since mass development required for the 368 S. Biebl and J. Auer Practical Use of Braconid Wasps for Control of Common Furniture Beetle release in pest-infested buildings was not achieved (Haustein, 2010). Because of the lack of a bulk of natural enemies of A. punctatum, the commonly used parasitoid wasp Lariophagus distinguendus (Pteromalidae) to control storage pests was released at an infested historic altar in Erfurt (Paul et al., 2008). However, scientific investigations showed, that L. distinguendus has no potential for controlling the furniture beetle. Moreover, it was recommended to focus on the natural enemies of A. punctatum for biological control (Steidle et al., 2007). Further practical monitoring (Ott, 2005; Paul et al., 2008; Schöller et al., 2008) revealed, that the clerid beetle Corynetes coeruleus, the bethylid wasp Cephalonomia gallicola and the braconid wasp Spathius exarator are the most common natural enemies of the furniture beetle in historic buildings in Germany. With the scientific knowledge of Becker (1942) and Lyngnes (1956) the innovative pest control company APC AG from Nuremberg bred the braconid wasp Spathius exarator as a commercial biological control method against A. punctatum (Auer and Kassel, 2014). After successful mass rearing, first results of laboratory as well as several praxis tests were published (Kassel andAuer, 2015). This paper will show the practical use of the parasitoid S. exarator in two representative churches, selected from currently more than 50 S. exarator treated objects. Additionally, as the infested wood in churches often is heavily painted, the difference in the parasitation rate of painted versus unpainted wood is presented in laboratory experiments.

MATERIALS AND METHODS Life cycle of S. exarator The parasitic wasp S. exarator parasitizes its host by piercing its ovipositor directly through the wood surface followed by oviposition onto the furniture beetle larva. After hatching, the larva of S. exarator feeds on the anobiid larva and kills the pest insect. S. exarator larvae pupate and, after eclosion, adult wasps emerge through a 0.5 mm wide exit hole, which can be clearly distinguished from the 2 mm wide hole of A. punctatum (Figure 1).

Figure 1. Life cycle of S. exarator. The female wasp drills its ovipositor through the wood surface (A), paralyses the A. punc- tatum larva and deposits one single egg on it (B). After development (C), S. exarator ecloses through a self gnawed exit hole with an average diameter of 0.5 mm (D).

Release protocol and monitoring Between five and eight treatments at intervals of four weeks from Mai to October within a period of up to three years were performed by the company APC AG. About 100 breeded wasps of the species Spathius exarator were applied for each defined infested area inside the building. In general, a total of 500 wasps was released per object and treatment. Success was monitored by the intensity of the infestation by A. punctatum compared to the effectiveness of the parasitic wasps. On exactly defined areas, the new exit holes of wasps and furniture beetles were counted and documented after each treatment. From these data, the reduction of newly hatched A. punctatum beetles per year was calculated. Additionally, the Practical Use of Braconid Wasps for Control of Common Furniture Beetle 369 ratio of parasitism was determined as quotient of number of new S. exarator and A. punctatum exit holes per year. As the lifespan of the wasps without nutrition ended after three weeks (unpublished data), all living wasps, detected before releasing new wasps, had emerged in the church and were termed as second generation. These second-generation wasps were counted and documented.

Sample 1: Schloßkirche Ellingen With an official expert for wood protection, the infestation of A. punctatum and the use of the braconid wasp S. exarator were controlled from 2014 till 2016. Treatments were performed by the pest control company APC AG with eight applications in 2014, seven applications in 2015 and five applications in 2016. Monitoring the count of exit holes was done on one infested part of the pipe organ (1 x 0.4 m). At each treatment 400-600 braconid wasps were released at five infested positions in the castle church.

Sample 2: Chapel N. The pest control company APC AG performed six applications in 2012 and eight applications in 2013 in the Chapel N. From 2014-2015 a yearly monitoring, without treatments was performed. In 2016 one single treatment with monitoring was done. Monitoring with the count of exit holes was made on two benches of the pewage (total 4 x 0.4 m). At each treatment, about 250 - 400 braconid wasps were released at three infested places in the chapel.

Laboratory tests To studying the effect of paintworks on the ability of S. exarator to pierce wooden surfaces and parasitize A. punctatum, a laboratory experiment was conducted. Small test lumbers (5 x 1.5 x 1.5 cm), each equipped with two larvae of A. punctatum, were prepared by the Bundesanstalt für Materialforschung und -prüfung (Berlin, Germany). Ten of the test lumbers were painted twice with a commercial wood lacquer (Obi 2in1 Buntlack). Five painted or unpainted lumbers each were stored in a plastic box (23 x 15.3 x 16.5 cm) with air permeable but tightly closing plastic covers. Ten female and five male parasitoids were added to each plastic container. A second charge of wasps were added after a period of about 4 month. Ten unpainted lumbers without any addition of wasps served for controlling the optimal conditions for surviving and developing of A. punctatum. The plastic containers were kept in the laboratory with 18 hours daylight, 6 hours darkness, 21° C room temperature and 70% relative humidity. The number of new exit holes of S. exarator per lumber, representing the number of parasitized A. punctatum larvae, was counted monthly. After a period of six month, the test lumbers were splitted using a pry bar to determine the exact number of surviving anobiid larvae.

Data Analysis For each date of the laboratory experiment, cumulative parasitation rates were evaluated per test lumber. Differences in the parasitation rates between painted and unpainted lumbers were analysed by Mann- Whitney U tests using the software PAST (version 2.17c; Hammer et al., 2001).

RESULTS In both investigated churches, the number of new exit holes of A. punctatum clearly decreased after the release of the parasitoid S. exarator.

Sample 1: Schloßkirche Ellingen Monitoring the defined area of the pipe organ revealed three hatching phases of A. punctatum during the three-year treatment period (Figure 2). The first hatching phase was long-lasting between June and October 2014, the second and the third hatching phase happened in July 2015 and 2016 and were well- defined. The number of emerged A. punctatum beetles decreased from eleven beetles in 2014 to four beetles in 2015 and to two beetles in 2016, implying an overall reduction of 64% after the first and of 370 S. Biebl and J. Auer Practical Use of Braconid Wasps for Control of Common Furniture Beetle

82% after the second year of treatment. The reduction was caused by the parasitism of S. exarator, which killed 16 A. punctatum larvae in the monitored area during the entire treatment period, as identified by the exit holes of the wasps (Figure 3). The yearly ratio of parasitism was 1:2.75 after the first year of treatment, implying 2.75 emerged A. punctatum per emerged S. exarator on the monitored areas. This ratio was strongly reduced after the second year of treatment to 1:0.8 and even to 1:0.28 after the third year of treatment.

Figure 2. Number of new A. punctatum exit holes found at a defined Anobium infested area of the pipe organ between 2014 and 2016 in Schloßkirche Ellingen at the respective dates. Numbers before brackets indicate the number of treatment.

Figure 3. Cumulative number of S. exarator exit holes found at a defined Anobium infested area of the pipe organ between 2014 and 2016 in Schloßkirche Ellingen at the respective dates. Numbers before brackets indicate the number of treatment. Practical Use of Braconid Wasps for Control of Common Furniture Beetle 371

On selected infested places of the church, the second generation of S. exarator was searched and counted. The results show a continuous reproduction with a total of 148 autonomous developed parasitic wasps within the three years (data not shown).

Sample 2: Chapel N. Between 2012 and 2013 the chapel N. was treated with S. exarator. After the two-year treatment period, yearly monitoring obtained long-term data of the infestation. Figure 4 illustrates the number of new exit holes of infested benches of the pewage. The results show a decrease from 25 exit holes of A. punctatum after the first year of treatment to 10 exit holes after the second year of treatment. In the third and fourth year without any additional treatment no new exit holes appeared, meaning a reduction of 100%. However, after two years without any application ten new exit holes of A. punctatum had to be recorded. Thus, a single treatment with the release of S. exarator was performed directly. As illustrated in figure 5 there was a strong parasitism of A. punctatum in the first two years, with a total of 128 parasitized A. puncatum larvae. In 2014, an overall number of 22 new exit holes (16 in spring, 6 in autumn) of Spathius exarator were found in the defined monitored area, even though no new wasps were released in this year. In 2015 no parasitism was detected in the monitored area, because of the weak infestation of A. punctatum. After the release of new parasitoids in 2016, the parasitation increased up to 167 new S. exarator exit holes within the monitored area.

Figure 4. Number of new exit holes of A.punctatum over a period of 5 years for a defined area in chapel N. Treatments took place in 2012 and 2013. In the years 2014 and 2015 no treatments were performed. One further application occurred in 2016.

The yearly rate of parasitism in the church N. was 1:0.35 after the first year of treatment, implying 0.35 emerged A. punctatum per emerged S. exarator on the monitored areas. This rate was strongly reduced to 1:0.18 after the second year of treatment. In the third and fourth year, no beetles emerged. In the fifth year, an increased rate of 1:0.63 was documented. The numbers of the second generation of S. exarator showed a continuous reproduction with a total of 39 S. exarator in the first and second year of treatment (data not shown). In the following years, no S. exarator were detected, because monitoring was done in late autumn. 372 S. Biebl and J. Auer Practical Use of Braconid Wasps for Control of Common Furniture Beetle

Laboratory tests After a period of six month, all A. punctatum larvae were parasitized and killed by S. exarator (Figure 6). In none of the pried tests lumbers living anobiid larvae were found. However, there are significant differences in the parasitation rates of painted and unpainted lumbers at three dates: while the parasitation rates in unpainted lumbers reached 100% after two months, the parasitation rates of painted samples is significantly lower in month 2, 3 and 4 of the experimental period (65%; Mann-Whitney U test, p < 0,01). In the pried control samples without the addition of wasps 100% viable A. punctatum larvae were detected (data not shown).

Figure 5. Cumulative number of S. exarator exit holes at a definedA. punctatum infested area in Chapel N. from 2012 till 2016 in chapel N. at the respective dates. Numbers before brackets indicate the number of treatment. In the years 2014 and 2015, no treatments were applied.

Figure 6. Cumulative parasitation rates of A. punctatum larvae in painted and unpainted test lumbers. (*: p < 0,01; n.s.:no significant difference; Mann-Whitney U test). Practical Use of Braconid Wasps for Control of Common Furniture Beetle 373

DISCUSSION In both Spathius exarator treated churches, the number of new A. punctatum exit holes decreased over the treatment period. On the defined monitored area of the pipe organ in the Schloßkirche in Ellingen, a decrease of 82% of emerging A. punctatum was found over a period of three years. In Chapel N., a decrease of 100% was observed over a treatment period of three years. However, after two years without any treatment, ten new exit holes of A. punctatum appeared. In both churches under investigation, the reduction of A. punctatum can be attributed to the parasitation of the released parasitoid wasp S. exarator, as indicated by the increased number of new S. exarator exit holes and the resulting higher parasitation rates. Monitoring of success in Ellingen revealed a short and well-defined hatching phase of the furniture beetle after the first treatment year. The phenomenon of a shortened anobiid hatching phases also occurred in other Spathius treated objects (Auer, personal communication). The number of second-generation wasps prior to the release of new wasps proves the ability of the parasitoids to survive and to develop autonomously within the treated objects. Moreover, the fact that new exit holes were found in chapel N. after an annual phase without any treatments demonstrates the settling of the wasps, thus proving the efficiency of the biological control method. However, the recurrence of new A. punctatum exit holes after a two-year period without any releases also shows the necessity of a well-defined application program. Monitoring was initially performed by the count of wood dust heaps. However, the number of heaps does not correlate with the intensity of infestation, as wood dust heaps are caused by furniture beetles, as well as by antagonists (e.g. Cleridae), secondary guest insects, vibrations or even swelling/shrinking after change of wood moisture (Biebl 2015). It is well known that, due to the natural predator-prey relationships, biological pest control does not result in a 100% containment of pest organisms after a few treatment applications (Graf, 1992; Querner, 2017). Instead, a continuous monitoring program with periodic single treatments is strongly recommended. This is even more important in the light of the relatively long development period of A. punctatum which can take up to 5 years (Pinniger, 1996). The results of the laboratory experiment show that S. exarator parasitizes furniture beetle larvae in unpainted as well as in painted wood. However, parasitation of painted lumbers seems to be delayed in comparison to unpainted wood. The hundred percent survival rate of A. punctatum larvae in the control lumbers without addition of wasps proves optimal laboratory conditions for the surviving and development of the furniture beetle. Further experiments with different materials (e.g. varnish, shellac, leaf gilding) will reveal more insights in the parasitation abilities of S. exarator and thus allow more sophisticated programs of application. Nowadays some individual objects (buildings, artworks, etc.) with historic pesticide contaminated wood are known to have an active infestation with furniture beetles. However, parasitoid wasps are known to react very sensitive to historic pesticides (Querner, 2017). Therefore, in case of suspicion about pesticide contamination, infested wood should be checked using chemical analyses prior to biological control with parasitoids. In case of contamination, the application of braconid wasps could fail and other treatment methods should be applied after careful evaluation. Fundamentally, the biological pest control results in a reduced infestation and keeps it below a certain minimum level, like longtime experiences from plant protection had shown (Haustein, 2010). After a period of intensive treatment, one or more further annual single-treatments will be recommended, to control the low infestation and hold it under a defined damage threshold. Although research and application of biological control against the furniture beetle lasted only several years it showed already considerable success. Nevertheless, more practical experience will be required to develop a sophisticated, continuous application program to control the furniture beetle using its natural enemy. 374 S. Biebl and J. Auer Practical Use of Braconid Wasps for Control of Common Furniture Beetle

CONCLUSIONS The results show the promising state of affairs of biological control with the host-specific braconid wasp for Anobium punctatum infested objects. In comparison with chemical treatment methods and their negative effects, the success rate of this biological method up to 100% indicates the ability for effective wood preservation in historic buildings, for artworks, etc. Integrated wood preservation always includes the combination of different methods (Graf, 1992). Elements of the integrated wood preservation are structural-, physical-, chemical- and biological methods. Supporting methods should also be applied in addition to the biological pest control to treat heavily infested removable objects as term of integrated wood protection. However, more practical experience will be required to optimise treatment and rate of success with Spathius exarator, to fulfill the requirements of conservation without further damage of the historic objects by Anobium punctatum larvae.

ACKNOWLEDGEMENTS We thank the Bayerische Schlösserverwaltung, the staff of the Residenz Ellingen, the Staatliche Bauamt Ansbach and APC AG for technical assistance and support. We also thank Deborah Schweinfest for reviewing the manuscript.

REFERENCES CITED Auer, J. and A. Kassel. 2014. Braconid Wasps: A biological control method for the common furniture beetle. In: Müller, G., Pospischil, R., and Robinson W.H. (ed.) Proceedings of the 8th International Conference on Urban Pests: 335-340 Becker, G. 1954. Räuber und Parasiten holzzerstörender Insekten in Gebäuden. In: Verhandlungen auf der 12. Mitgliederversammlung der deutschen Gesellschaft für Angewandte Entomologie e.V., Berlin. Parey Verlag: 75-86. Biebl, S. 2015. Diagnose von aktivem Holzwurmbefall. Hintergründe und praktische Methoden im Rahmen vom Schädlingsmonitoring, Restauro 5/2015: 30-35 Graf, E. 1992. Biologischer Holzschutz – Möglichkeiten und Grenzen. In: Deutsche Gesellschaft für Holzforschung (Hrsg.) DGfH 19. Holzschutz-Tagung Rosenheim Hammer, O., D.A.T. Harper, and P.D. Ryan. 2001. PAST: Paleontological software package for education and data analysis. Palaeontologia Electronica 4(1):9 pp. Haustein, T. 2010. Zur Diagnose und integrierten Bekämpfung Holz zerstörender Insekten unter besonderer Berücksichtigung der Buntkäfer. Fraunhofer IRB Verlag Stuttgart. Kassel, A. and J. Auer. 2015. A new biological control method for the common furniture beetle, Anobium punctatum. In: Integrated Protection of Stored Products. IOBC-WPRS Bulletin Vol. 111, 2015 pp. 455-461 Lyngnes, R. 1956. Zur Kenntnis der Biologie von Spathius exarator L. (Hym., Bracon.). Z. angewandte Entomologie 38: 73-81 Ott, R., 2005. Untersuchungen über die Entstehung von Bohrmehlhäufchen an Schlupf-löchern des Gemeinen Nagekäfers (Anobium punctatum) De Geer. http://www.holzfragen.de/seiten/ biol_holzschutz.html (Download: January 27, 2017) Paul, F., S. Prozell and M. Schöller. 2008. Monitoring natürlicher Feinde des Gemeinen Nagekäfers Anobium punctatum. Mitt. Dtsch. Ges. Allg. Angew. Ent.16 Pinniger, D.B. and R.E. Child. 1996. Woodworm-A necessary case for treatment? New techniques for the detection and control of furniture beetle. In: Wildey, K.B. (ed.) Proceedings of the 2nd International Conference on Urban Pests. Practical Use of Braconid Wasps for Control of Common Furniture Beetle 375

Querner, P. 2017. Success and failure in biological pest control with the larval parasitoid Lariophagus distinguendus in museums and historic buildings Proceedings of the 9th International Conference on Urban Pests. 2017 Schmidt, H. 1952. Holzschädlingstafeln: Anobium punctatum De Geer, Zeitschrift HOLZ als Roh- und Werkstoff, 10.Jg., Heft 3: 119-120 Schöller, M., S. Prozell, and P. Florian. 2008. Versuche zur biologischen Bekämpfung des Gemeinen Nagekäfers Anobium punctatum. 2.N.i.Ke.-Workshop 2008. Berlin Steidle, J.L.M., C. Gantert, U. Noldt, S. Prozell, and M. Schöller. 2007. Bekämpfung von holzzerstörenden Käfern durch Massenfreilassungen der Lagererzwespe: Fiktion und Fakten. S. 163-172. In: Noldt, U. & Michels, H. (Hrsg.) Holzschädlinge im Fokus. Alternative Maßnahmen zur Erhaltung historischer Gebäude. Schriften des LWL-Freilichtmuseums Detmold, Westfälisches Landesmuseum für Volkskunde, Band 27, Detmold: 163-172 Wiessner, J. Integrierte Insektenbekämpfung. http://www.jochenwiessner.de/downloads/integrierte- insektenbekaempfung (Download: January 27, 2017) 377

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

LYCTUS (COLEOPTERA: BOSTRYCHIDAE): A NEVER ENDING STORY

REINER POSPISCHIL PMP-Biosolutions, Im Tiergarten 9, 50129 Bergheim-Erft, Germany

Abstract Alien true powder post beetle (Lyctinae) species started to be a concern with the growing worldwide trade after the Second World War. Lyctus brunneus arrived in Central Europe 70 years ago and replaced the native species Lyctus linearis as lyctine beetle of economic importance. But this situation changed at the end of last century. The author received numerous samples from different places of Germany between 2010 and 2017. Until 20 years ago this species was rare in Central Europe. However, in the meantime it established indoors and outdoors and reached a similar economic importance as Lyctus brunneus. Infestation by lyctine beetles was a typical indoor problem in the past and the source of introduction were infested woods. Nowadays outdoor populations of Lyctus cavicollis (and in the south west of Central Europe also Lyctus brunneus!) may invade homes (for example with firewood).

Key words Lyctus brunneus, Lyctus cavicollis, Minthea rugicollis true powder post beetles

INTRODUCTION True powder post beetles of the subfamily Lyctinae (Family Bostrychidae) develop in the sapwood of seasoned timbers with high content of starch and are serious pests in furniture industry, in wooden doors, door frames and hardwood floors (Gay, 1953; Gerberg, 1957; Cymorek, 1969b). The economic importance of Lyctus brunneus (Stephens, 1830) in Central Europe started with the beginning of the 20th century. Until 1891 L. brunneus was very rare in Europe in contrast to the common Lyctus linearis (Fabricius, 1792). Up to 1923 this ratio reversed in UK (Hickin, 1960). On the European continent regular imports and fast propagation started after the Second World War with the increase of wood imports and world trade and L. brunneus replaced the native species Lyctus linearis as lyctine beetle of economic importance (Cymorek, 1969b, 1979). Until the end of the 20th century true powder post beetles which were sent for identification mainly belonged to L. brunneus. We had only one case with L. linearis from an outdoor wood storage place, an infestation with Lyctus africanus (Lesne, 1907) in souvenirs from the Ivory Coast, and one specimen of the genus Trogoxylon. But this situation changed dramatically during the past years. Lyctine beetles are now sent frequently for identification and the most prominent species are L. brunneus and Lyctus cavicollis (J.L. LeConte, 1805). A survey of these two species on their occurrence in Central Europe and habits until the year 2002 is given by Geiss (2002).

MATERIAL AND METHODS Most samples came from pest management professionals, museums, scientific institutes and zoological gardens. Infestations were examined in detail and expertises were written in four cases. The specimens 378 R. Pospischil Lyctus: A Never Ending Story were included in the reference collection to save them for further studies. Wood samples with larvae were cultured at 25° C / 75% relative humidity. Identification was done according to Cymorek (1969a) and Gerberg (1957).

RESULTS AND DISCUSSION Twenty three samples of true powder post beetles belonging to the genera Lyctus, and Minthea were submitted for identification since 2010 from different places in Germany, 13 cases with L. brunneus, 8 cases with L. cavicollis, 1 case with L. africanus and 1 case with Minthea rugicollis (Walker, 1858), respectively. Most samples of L. brunneus were collected from parquet flooring and some from museums and galleries. A strong infestation of L. brunneus was found 2012 in at least 12 years old doorframes. Reason for this infestation were small North Indian Rosewood tables (Dalbergia sissoo Roxb.) from India, which after production were shipped directly to Germany and delivered to the customer, who found wood dust 5 months and exit holes 8 month later in several door frames and doors close to these new tables. Development of the larvae took place in a tropical hardwood inside the door frames. Doors and door frames were removed in autumn 2011 and stored in an unheated garage. The inspection of the infested furniture (door frames, doors and Indian tables) was carried out in February 2012 after a cold period of at least four weeks with temperatures between -10° C and -20° C during the nights. No exit holes were present on the surface of the tables, but beetles, exit holes and living larvae were found in the sapwood in hollow spaces inside the tables. Some areas of the doorframes were heavily infested and gnawing marks of the adult females were found on the surface. More than 100 adults hatched from the doorframes three months later in Mai and another generation followed 5 to 6 months later in October/ November. The common literature specifies that the development stages ofL. brunneus can tolerate at least -7° C over night except for the eggs and the first larval stage (Cymorek, 1966). However, their high reproduction rate in 2012 after storage under temperatures below -10°C implicates a cold resistance to lower temperatures and longer periods than known from literature. Since the nutrient content in the wood decreases with the age, the risk of infestation by the lyctine beetles declines and more than 10 years old wood is less infested (Cymorek, 1979). The strong infestation of the door frames, the relatively short development time of the larvae and the body length of the beetles (4.5 - 6 mm) indicate that the wood is still susceptible to L. brunneus after a period of at least 12 years. An unusual infestation with L. brunneus in railway sleepers during construction of a new underground railway line was inspected in October 2015. The responsibles had already removed 75 heavily infested railway sleepers. Many exit holes were found at the edges of the woods and below the thin surface layer the whole sapwood part was found to be totally destroyed by Lyctus over the entire length of the railway sleepers. The leftover few larvae and beetles of L. brunneus were used for identification. According to the Federal Railways standards only beech and oak can be used as wooden railway sleepers in Germany (DBS 918 144, 2007). The standard allows the presence of a low sapwood portion. However, some inspected railway sleepers consisted of up to 20% sapwood. Outside of the tunnel and on the first 100 meters inside the tunnel, the sleepers were treated with carbolineum against infestation by fungi and wood-destroying insects. Within the tunnel, no treatment with carbolineum was carried out in order to avoid an odor emission in the subway stations. The whole railway line was therefore thoroughly inspected and active infestation was noticed in some sleepers. Another 400 infested railway sleepers were replaced to avoid any risk for the rail traffic and the remaining woods were treated with a water based and odorless preservative. The infestation with L. brunneus began during the manufacture in summer 2013 and the storage of the railway sleepers in the sawmill and later on at an outdoor storage place of the train. The likelihood of a future active infestation of L. brunneus in the tunnel was discussed. The temperature on the surface of the railway sleepers was about 14° C in December and January and 18° C during summer time. A Lyctus: A Never Ending Story 379 development of L. brunneus is possible in less than 12 months under these temperature conditions depending on the nutrient content of the wood (Kuehne, 1981). According to Gay (1953) even a continuous temperature of 15° C is still sufficient for the development ofL. brunneus with an extension of the development time to one year or even more. Vibrations and strong air flows by the rail traffic may also have a negative impact on the larval development and distribution of the adults in the underground tunnel. An eight years old infestation of railway sleepers by L. brunneus was observed several months later in another town in North Rhine Westfalia. Both examples indicate that oak railway sleepers should have less than 10% sapwood and must be thoroughly examined for Lyctus infestation before their use in the railway line. These results indicate that the possibility of an infestation by L. brunneus in oak infrastructure of railway sleepers should be considered when planning new underground railway lines. Eight infestations with L. cavicollis were discovered since 2013 in several Federal States of Germany. Beetles were twice isolated outdoors from dry Grape vine stems together with Bostrychus capucinus (Linnaeus, 1758) (Bostrychinae) and Tarsostenus univittatus (Rossi, 1792) (Cleridae). Another outdoor infestation was found in an outdoor children’s playground in a zoological garden in North Rhine Westfalia (Gloyna, pers. com.). Indoor infestations of L. cavicollis derived from parquet flooring, door frames, a mahogany door and furniture. Only one sample of L. africanus arrived from a museum in Bavaria. M. rugicollis was discovered together with Heterobostrychus brunneus (Murray, 1867) (Bostrychinae) between picture frames which were sent from the Ivory Coast to a museum of modern art in Hessen. The exit holes of this species are only 0.8 mm in diameter and can easily be missed. CONCLUSION The examples demonstrate well that true powder post beetles are a concern for the pest management professionals and for insurance companies as well. Since the year 2000 L. brunneus is gradually being replaced by L. cavicollis. Other species of the subfamily Lyctinae are rarely found. In the past L. brunneus was a typical indoor pest in Central Europe which was brought into new buildings with infested wooden materials or furniture. Now first outdoor populations were detected in the southwest of Central Europe (Geiss, 2015). L. cavicollis is found indoors and outdoors and may enter buildings with infested fire wood from the forest. Outdoor populations were found in the south west of Germany, but also in Rhineland-Palatinate and North Rhine Westphalia. The intensified use of untreated wood which is susceptible to Lyctus also favours infestations by these species even in places where they were not recognized before (e.g. in underground railway lines or in outdoor children’s playground). We already know a lot about L. brunneus (Cymorek, 1966, 1969b, 1979; Hickin, 1960; Kühne, 1980, 1981; Pospischil 2012), but information on the requirements of L. cavicollis is quite rare despite Geiss (2002, 2015). We need more efforts to understand the requirements of L. cavicollis as a drywood pest.

REFERENCES CITED Cymorek, S. 1966. Experimente mit Lyctus. Material und Organismen Beih. 1, Symp. Holz und Organismen: 391-413. Cymorek, S. 1969a. Teredilia, 1. Überfamilie Bostrychoidea. In: Freude, H., Harde, K. W. and Lohse, A., eds., Die Käfer Mitteleuropas Bd.8, Krefeld: Goecke & Evers Cymorek, S. 1969b. Eingeschleppte und einheimische Bohr- und Splintholzkäfer als Holzschädlinge (Col.; Bostrychidae, Lyctidae): Übersicht zur Lebensweise, über Vorkommen, Einschleppungen, Wirtschaftliche Bedeutung, Bekämpfung. Z. angew. Entomol. 66 (2): 206- 224. Cymorek, S. 1979. Der Fall Lyctus – Skizzen über Auftreten, Bedeutung und Bekämpfung eines Holzwurms. Der praktische Schädlingsbekämpfer. 31 (5): 66-69. DBS 918 144 2007. Technische Lieferbedingungen – Holzschwellen. DB Standard: 18pp. 380 R. Pospischil

Gay, F.J. 1953. Observations on the biology of Lyctus brunneus (Steph.). Austral. J. Zool. 1 (1): 102- 110. Geiss, K.-U. 2002. Gebietsfremde Splintholz- und Bohrkäfer, nach Mitteleuropa mit Importholz und anderen Gütern eingeschleppt. Frankfurt: Mitteilungen Int. Entomol. Verein, Suppl. X Geiss K.-U. 2015. Invasive Splintholzkäfer: Anpassungssprünge. Der praktische Schädlingsbekämpfer, 67 (6): 8-9. Gerberg, E.J. 1957. A Revision of the New World Species of Powderpost Beetles Belonging to the Family Lyctidae. Washington: U.S.Dep.Agric., Tech. Bull. 1157: 1-55 Hickin, N. E. 1960. An Introduction to the Study of the British Lyctidae. B.W.P.A. Annual Convention: 1-13. Kühne, H. 1980. Entwicklung einiger Lyctidae- and Bostrychidae-Arten in Abhängigkeit von Nahrung, Temperatur und Luftfeuchte. In: Oxley, T.A., Allsopp, D. and Becker, F., eds., Proc. 4th Internat. Biodetn. Symp., Berlin: 71-78. Kühne, H. 1981. Methods of Culturing Lyctidae (Coleoptera). Material und Organismen 16 (2): 141- 156. Pospischil, R. 2012. Der Braune Splintholzkäfer Lyctus brunneus – Ein Update. Der praktische Schädlingsbekämpfer, 64, 7/8: 14-15. 381

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

CRYPTOTERMES BREVIS (ISOPTERA: KALOTERMITIDAE) CONTROL METHODOLOGY ON A HISTORIC BAROQUE CHURCH

EDER FLÁVIO REDE Rua Júlio Prestes de Albuquerque, 405, Mairinque/SP, 18120 000, Brazil/Tamanduá Bandeira Controle de Vetores e Pragas Urbanas Ltda.

Abstract The aim of this study is to present a methodology for Cryptotermes brevis control in such a fragile, old building environment. The described treatment was undertaken at Igreja Matriz Nossa Senhora da Candelária, a church built in 1780 at Itu city, São Paulo. Its presbytery is made of cedar and was being attacked by Cryptotermes brevis. It was decided to treat the structure by using a wettable granules formulation (Optigard LT® - thiamethoxam 25%) sprayed by an aerosol generator, with a needle injector. The application was made by using the holes made by the termites themselves. The product used dosage was 7g/1L of water and the insecticide solution reached about 1 meter distance into termites´ galleries. Twenty litres of insecticide solution were used to treat the infested area, showing that this is also an economic methodology. The used technic provided 100% C. brevis control after 2 years. This methodology, using thiamethoxam WG in an aerosol machine, showed effectiveness against drywood termites.

Key words Historic buildings, thiamethoxam.

INTRODUCTION The West Indian drywood termite, Cryptotermes brevis (Isoptera: Kalotermitidae), infestation in historic buildings, mainly the ones from the baroque period, has been long known by the researches, as it is pointed by some authors: “Among the several threats to the historic built heritage, termite is one of the most harmful ones, as it was pointed by Paulo Duarte (1938) and Germain Bazil (1956/58). These insects reach the wood structures, wattle and daub and rammed earth walls, retables, altars, stairs and other wood pieces and many times is only noticed when the damages caused are greatly extended, often there are damages of large extension, frequently compromising the structural stability of the building itself.” (Fontes and Filho, 1998). Most of the infestation occurs due to negligence or lack of knowledge of owners and managers about the Isoptera. (Fontes and Filho, 1998). In Brazil, there is not enough reliable statistics regarding the degradation of cultural property caused by termite. However, a board presented on ICUP 2011, in Ouro Preto, showing a survey performed in baroque churches within the Serro area, in Minas Gerais, pointed that 83% of these buildings were attacked by termites (Silva et al., 2011). Igreja Matriz de Nossa Senhora da Candelária, completed in 1780 in the city of Itu – the place where this work was developed – represents the social-economic and cultural development of prosperous cities in the colonial period in Brazil.

382 E. F. Rede Cryptotermes brevis Control Methodology On A Historic Baroque Church

Since treatments that use toxic gases such as methyl bromide and aluminum phosphide are prohibited under the law, West Indian drywood termite control is done exclusively by means of application of insecticides solutions in Brazil. There are also the aerosol insecticides, marketed in the retail market, which can be also applied for termite control. However, all these techniques are limited as they present low productivity. In baroque churches, the most difficult part in treating wood for controlling termite attacks has always been choosing the methodology and chemicals properly. Besides the difficulties for reaching 100% of structures, due to barriers and inaccessible confined spaces that limits the application and fast volatilization of insecticide solutions - and extremely high fire hazards due to the use of flammable products in pieces extremely dry and scarified by termites, which significantly increase the combustibility of wood pieces - there is also the enormous risks of damaging paintings, art elements made with natural pigment-based paints, and water and gliding made with the application of thin gold layers. Those factors impaired the use of treatment solutions formulated with oil solvents because they can stain or even remove the finishing. Even in little quantities, as in insecticide formulations of emulsifiable concentrates, which contain oil derivatives in their compositions, solvents can seriously damage paintings and ornaments, which also restricts the use of this type of compound. This way, the challenge for performing these works that are highly specialized – where error margins are almost null – consist of the exact choice of insecticides, solvents, techniques of preparation for the woodwork, dosing and equipment that are able to ensure the efficacy of treatments without causing (minor) damages to wood components. For that, the insecticide shall be solvent-free, extremely efficient on termite elimination, high residual power and preferentially odorless. The solvent shall be completely inert to not damage ornaments, do not cause discomfort due to strong and long lasting odors in treated environments and to avoid the maximization of fire risks. Using water as a vehicle is the most recommended practice, although it has deleterious effects to wood in high doses. This way, treatments shall be suitable to be fully effective against West Indian drywood termite colonies elimination without damaging art or constituent elements. The aim of this study is to present a methodology for Cryptotermes brevis control in such a fragile environment. The described treatment was undertaken at Igreja Matriz Nossa Senhora da Candelária, an ancient baroque church built in 1780 at Itu city, São Paulo. Its presbytery is made of cedar and was being attacked by Cryptotermes brevis. There are several old paintings on its walls, so the usage of formulations containing oil solvents is not appropriate. MATERIALS AND METHODS Chancel’s woodwork comprises cedar wood, contemporary in this Church’s construction. The treatments described as follows were performed considering all the aforementioned restrictions, and it was performed on the wood walls of the chancel, main altar, side altars, art and decorative elements and furniture of Igreja de Matriz de Nossa Senhora da Candelária, Itu, São Paulo, Brazil. These described treatments occurred from June to September, 2014. By the end of the treatment, 10 visits with insecticides applications were done, totalizing 180 hours of work. Being a building listed by the National Heritage Department, mechanical interventions, like perforation to allow insecticide application were considered aggressive due to the fact the attack was very disseminated through the architectural complex. Taking all considerations presented for this issue, the woodwork treatment by “extra-low volume” application of an insecticide solution of aqueous base and high concentration of active ingredient was selected. The application was made by using the holes made by the termites themselves, to avoid more damage to the wood. To perform this treatment, the pieces were checked, and the holes were previously identified and marked. Before applying the insecticide, the internal part of the galleries was cleaned by compressed air jet. This procedure aimed to remove fecal granules inside the pieces, cleaning inside the attacked pieces, removing fecal granules, unclogging galleries and allowing the free flow of insecticide solution. Cryptotermes brevis Control Methodology On A Historic Baroque Church 383

The structure was treated by using a wettable granules formulation (Optigard LT® - Thiamethoxam 25%), at 7g c.p./L dosage (higher than indicated by the manufacturer for subterranean termite control) sprayed by an aerosol generator (Micronizer®), with a needle injector, that allowed extremely low volumes application. The average flow measured for the injection nozzle was 80 ml/ minute. This equipment also works with a low airflow that helps insecticide penetration into the wood.

RESULTS AND DISCUSSION After treating such woodwork, there was a monitoring period of 24 months to assess the results. During this period, there was no occurrence of attacks by West Indian drywood termites regarding treated pieces. The technique used allowed the full Chancel treatment at Igreja Nossa Senhora da Candelária, and two years after applications, no West Indian drywood termite activity was found in the pieces. Monitoring visits were established every 60 days in the first year and every 90 days in the second year. The low volume of insecticide solution used for the treatment, about 30 liters, was considered enough for this work, confirming one of the purposes of this test, which was to seek a higher efficacy in treatments and reducing the quantity of chemical agents used. This success is due to the set of methodologies: 1) Using a concentrated aqueous and low volume solution in order to not damage the pieces; 2) Using holes opened by termites as insecticide introduction points to reach the entire internal part of the pieces; 3) Previous clearance of galleries by using compressed air jet; 4) Using the galleries as conduction paths for the insecticide to go inside wood pieces; 5) Simultaneously inoculate both insecticide and compressed air, which enabled the expansion and propagation, and full distribution of insecticides through galleries; 6) Using insecticide with good residual and non-repellent effects. In December, 2016, a West Indian drywood termite occurrence was diagnosed in one of the chambers of the Chancel. This attack is still under surveillance due to the fact traces are still arising from internal structural timbers of the walls not treated yet.

REFERENCES CITED Fontes, L.R. and E.B. Filho. 1998. Cupins – O desafio do conhecimento. Editora Loyola: 135. Silva, C.R., N.A. Silva, and R.D. Silveira. 2011. Survey of xylophagous insects in churches and chapels in Serro and neighboring city belonging to the diamond path of the royal road, Brazil-MG. Proceedings of the Seventh International Conference on Urban Pests: 402

385

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

A MULTI-STATE STUDY TO ASSESS THE EFFICACY OF CHLORANTRANILIPROLE IN CONTROLLING RETICULITERMES FLAVIPES (ISOPTERA: RHINOTERMITIDAE) IN INFESTED STRUCTURES

1,2T. CHRIS KEEFER, 3SUSAN C. JONES, 2,4EDWARD L. VARGO, 4PAUL LABADIE, 2ROGER E. GOLD, 1CLAY W. SCHERER, AND 1,3NICOLA T. GALLAGHER 1Syngenta Crop Protection, LLC. 2Department of Entomology, Texas A&M University, College Station, TX, United States 3Department of Entomology, The Ohio State University, Columbus, OH, United States 4Department of Entomology, North Carolina State University, Raleigh, NC, United States

Abstract The efficacy of Altriset® 20SC (AI, chlorantraniliprole) in controlling structural infestations of the eastern subterranean termite, Reticulitermes flavipes, was assessed in Ohio, North Carolina, and Texas. Prior to chlorantraniliprole treatment, termites were collected from the structure as well as from a grid of in-ground monitoring stations encircling each structure. Microsatellite markers were used to genetically fingerprint each of the termite colonies. The structures and stations continued to be monitored for 2 years after the termiticide treatment. Chlorantraniliprole provided effective structural protection as termite activity in and on the majority of structures ceased within ~1 month or less and they continued to be free of termites for the 2-year study duration; a follow-up spot treatment was done only at one house in Texas at 5-months post-treatment and at one house in North Carolina at 8 months post-treatment. A single infesting colony appeared to be associated with each structure prior to treatment. Key words Termiticide, subterranean termite, colony, microsatellite.

INTRODUCTION Chlorantraniliprole is an anthranilic diamide insecticide that has low mammalian toxicity and is considered a least risk pesticide (US EPA, 2008). Chlorantriliprole has a unique mode of action wherein it acts on the ryanodine receptor, where it stimulates the release and depletion of intracellular calcium, which causes paralysis of the target insect (Qi et al., 2011). Altriset® with the active ingredient chlorantraniliprole is a liquid termiticide used as a sub-soil barrier to control subterranean termites. Chlorantraniliprole is a slow-acting non-repellent termiticide and studies have concluded that this type of termiticide allows for a high rate of transfer of active ingredient among nestmates (Bagneres et al., 2009). The objective of this trial was to evaluate the efficacy of chlorantraniliprole applied at 0.05% in controlling termites (Reticulitermes flavipes Kollar) in infested structures in multiple regions and to determine the fate of termite colonies in and around each structure post-treatment. MATERIALS AND METHODS All structures were infested with Eastern subterranean termites. At pre-treatment live termites were collected from each infestation point at each structure. At each structure, in-ground subterranean termite 386 T. C. Keefer, S. C. Jones, E. L. Vargo, P. Labadie, R. E. Gold, C. W. Scherer, and N. T. Gallagher A Multi-State Study To Assess The Efficacy Of Chlorantraniliprole stations were installed in two concentric rings around the structure. All stations were monitored on a monthly basis for 3-6 months pre-treatment. All subterranean termites collected pre-treatment were preserved and held for subsequent analyses. All termiticide applications followed the manufacturer’s label instructions. Post-treatment inspections included the exterior of structure and in-ground termite stations. All structures were inspected on or about 1, 2, 3 months, and then quarterly for 24-months post-treatment. From each station and shelter tube sampled, 10 workers (or all if fewer were present) were genotyped to determine colony affiliation. The DNA of individual workers was extracted and the genotypes for two microsatellite loci, Rf 24-2 and Rf 21-1, were determined following established methods (Parman and Vargo, 2008; Vargo and Parman, 2012). Colony affiliation of groups of collected workers was determined by means of an exact test for genotypic differentiation as implemented in the program GenePop on the Web (Raymond and Rousset, 1995). Groups of workers from the same property that were not significantly differentiated were considered to belong to the same colony. This method has been used to determine colony affiliation in R. flavipes after insecticide treatments (Vargo, 2003; Vargo and Parman, 2012).

RESULTS AND DISCUSSION Ohio Structures At three of the structures, termite activity ceased within 1 month post-treatment. At the fourth structure, at 1 month post-treatment, several live termites were found among dead termites in a basement above ground station. After that inspection, there was no evidence of live termites found at any inspection. Ohio Landscape At each of the four structures, some the same colonies were present pre- and post-treatment. At one structure, the infesting termite colony was eliminated from the landscape during the second year. At three of the structures, termite activity, including the infesting colony, in the landscape persisted for 2 years North Carolina Structures Termite activity ceased within 1 month post-treatment at two structures. At the third structure, a spot treatment of chlorantraniliprole was required at 8-months post-treatment due to continued termite activity in damp floor joists. After this treatment, there was no evidence of live termites for the duration of the study. One structure was removed from the study due to a persistent water leak. North Carolina Landscape At each of the three remaining structures, some of the same colonies were present pre- and post- treatment in the landscape. At one structure, the infesting colony was eliminated from the landscape with the initial treatment of chlorantraniliprole. At the remaining two structures, the colony initially infesting the structures were last found at 6 months and 18-months post-treatment. Texas Structures Termite activity ceased within 1 month post-treatment at three structures. At the fourth structure a spot treatment was necessary in a window at 5-months post-treatment because several live worker and swarmer termites were present. After the spot treatment at 5-months post-treatment, no evidence of live termites was found at this structure. Texas Landscape At three of the structures, some of the same colonies were present pre- and post-treatment (Table 1). At three structures the infesting colony was eliminated from the landscape. Colony members were last found in in-ground stations at pre-treatment at two structures and 1-month post-treatment at the third structure. The fourth structure was removed from the study at 19-months post-treatment because the contracted PMP inadvertently performed a spot-treatment with a different termiticide. A Multi-State Study To Assess The Efficacy Of Chlorantraniliprole 387

Table 1. Results from structures treated with 0.05% chlorantraniliprole to control subterranean termites.

Status at initial inspection Status at 2 year inspection Termites in Termites in Termites in Termites in Site structure landscape structure landscape Ohio yes yes No yes North Carolina yes yes No yes Texas yes yes No yes

Table 2. Summary of structures treated with 0.05% chlorantraniliprole to control subterranean termites.

Post-treatment Status Ohio North Carolina Texas (4 structures) (3 structures) (4 structures) Time to eliminate infesting <1-2 months at 4 <1 month at 2 <1 month at 3 colony from structure structures structures, 9 structures, 5 months months at 1 structure at 1 structure Spot treatment 0 1 1 Infesting colony eliminat- ed from landscape 1 structure/4 1 structure/3 3 structures/4

Chlorantraniliprole effectively controlled R. flavipes infesting houses in OH, NC, and TX and resulted in apparent elimination of the infesting colony from the landscapes at 1 of 4 houses in OH, 1 house in NC, and 3 of 4 houses in TX (Table 2). The reduction of termite activity in the landscape of the treated structures indicates that chlorantraniliprole is transferred among nestmates. This transfer of chlorantraniliprole has also been confirmed in laboratory trials (Puckett et al., 2012). Chlorantraniliprole has delayed mortality on subterranean termites. This allows donor termites to return to the nests and potentially transfer the active ingredient to recipient termites. Although mortality is delayed, paralysis of the mouthparts is immediate. Therefore, worker termites are unable to continue to feed and cause damage to a structure. Termites that come in contact with chlorantraniliprole have been noted to aggregate (Buczkowski et al., 2012). This increases social interaction, which increases exposure from donor to recipient termites.

CONCLUSIONS Based on the elimination of termites from the structures, the objective of controlling termites in infested structures was achieved. The reduction of the frequency of termites in the landscape in the current study was noted. Therefore, it can be suggested that to some degree these three behaviors (feeding cessation, aggregation, donor to recipient transfer) are taking place in the field. Based on these facts and the data from the current study, it can be concluded that chlorantraniliprole when applied around a structure for post-construction control of subterranean termites does have some colony level effects in suppression of termites in the surrounding landscape.

388 T. C. Keefer, S. C. Jones, E. L. Vargo, P. Labadie, R. E. Gold, C. W. Scherer, and N. T. Gallagher

REFERENCES CITED Bagneres, A.G., A. Pichon, J. Hope, R.W. Davis, and J.L. Clement. 2009. Contact versus feeding intoxication by fipronil inReticulitermes termites (Isoptera: Rhinotermitidae): Laboratory evaluation of toxicity, uptake, clearance, and transfer among individuals. Journal of Economic Entomology 102: 347-356. Buczkowski, G., C.W. Scherer, and G.W. Bennett. 2012. Toxicity and horizontal transfer of chlorantraniliprole in Eastern subterranean termite. Journal of Economic Entomology 105: 1736-1745. Raymond, M., and F. Rousset. 1995. GENEPOP, version 1.2: population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248-249. Parman, V. and E.L. Vargo. 2008. Population density, species abundance and breeding structure of subterranean termite colonies in and around infested houses in central North Carolina. Journal of Economic Entomology 101: 1349-1359. Puckett, R.T., T.C. Keefer, and R.E. Gold. 2012. Performance of Altriset™ (chlorantraniliprole) termiticide against Formosan subterranean termites, Coptotermes formosanus Shiraki, in laboratory feeding cessation and collateral transfer trials, and field applications. Sociobiology 59: 531-548. Qi, F., W. Ming-zhong, X.Lia-xia, L. Zhi-li, and L. Zheng-ming. 2011. Synthesis and insecticidal activities of novel analogues of chlorantraniliprole containing nitro group. Chemical Research Chinese Universities 274: 610-613. United States Environmental Protection Agency. Pesticide Fact Sheet (7505P). April 2008. Vargo, E.L. 2003. Genetic structure of Reticulitermes flavipes and R. virginicus (Isoptera: Rhinotermitidae) colonies in an urban habitat and tracking of colonies following treatment with hexaflumuron bait. Environmental Entomology 32: 1271-1282. Vargo, E.L. and V. Parman. 2012. Effect of fipronil on subterranean termite (Isoptera: Rhinotermitidae) colonies in the field. Journal of Economic Entomology 105: 523-532.

389

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

INTER- AND INTRASPECIFIC COLONY INTERACTIONS IN RETICULITERMES (ISOPTERA: RHINOTERMITIDAE)

MARK A. JANOWIECKI AND EDWARD L. VARGO Department of Entomology, Texas A&M University, College Station, Texas, USA

Abstract Subterranean termites are the most economically damaging termites in the U.S. costing $11 billion annually for prevention, treatment, and repair of damage. However, termite colony spatial dynamics are an un- derstudied topic. In previous laboratory studies, termite colonies of different species are aggressive while termite colonies of the same species are passive to each other. Conversely, in field studies, colonies of the same species have not been observed overlapping whereas congeneric colonies foraging ranges were observed overlapping. These seemingly conflicting findings require further research to clarify the inter- and intraspecific interactions of Reticulitermes. This project investigates these colony interaction dynamics in east Texas with three native species of Reticulitermes: R. flavipes, R. virginicus, and R. hageni. Two 14x14 grids of pine stakes spaced 2m apart were established in the Sam Houston State University Center for Biological Field Studies for a total of 392 stakes. These stakes were monitored monthly for active termite foraging and had a hit rate more than 10% in the first month alone. Collected termites will be genetically fingerprinted using microsatellites and colonies will be tracked for the duration of the study. Laboratory colonies will be established from termites at the field site and will be used for be- havioral assays using both the petri plate and planar assay methods. Unique species and colonies will be paired in these assays to compare aggressive behavior. Finally, further sampling and investigation will occur at the areas of overlap to compare the behavior of different colonies of termites in the field to the results of the laboratory assays.

Key words Subterranean termites, genetic fingerprinting, behavior, planar assay.

INTRODUCTION Subterranean termites, including Reticulitermes, primarily live in the soil and are the most structurally destructive family of termites in the United States (Suiter et al., 2002). While subterranean termites are urban pests, economically and environmentally, they are important because of their ability to consume cellulose materiel. Annually, Americans spend approximately $11 billion on prevention, treatment, and repair of subterranean termite damage (Su, 2002). Despite their pest status, termites recycle nutrients by decomposing wood and other nutrients back to the soil, thus providing a vital ecosystem service (Thorne and Forschler, 2001). Although different termite species and colonies of the same species have often been observed in close proximity (Houseman et al., 2001; Deheer and Vargo, 2004), inter- and intraspecific termite colony dynamics and interactions have not been thoroughly studied in Reticulitermes. Houseman et al. (2001) investigated distributions of R. flavipes and R. hageni, but were unable to distinguish unique colonies. They attributed spatial distribution of these two species to temperature and soil moisture content with R. hageni preferring to forage in hot, dry periods and R. flavipes in cool, damp periods (Houseman et al., 2001). This confirmed an earlier laboratory study by Forschler and Henderson (1995) which found that R. flavipes is able to withstand water submersion the longest (LT50 of 19.6 h) of the several subterranean termites sampled. Laboratory aggression assays found a behavioral reaction between species of Reticulitermes (Thorne and Haverty, 1991), but no aggression between unique colonies of 390 M. A. Janowiecki and E. L. Vargo Inter- And Intraspecific Colony Interactions InReticulitermes

R. flavipes (Bulmer and Traniello, 2002). In a field study, Deheer and Vargo (2004) found the opposite scenario, with overlapping colonies of different species, but no overlap in foraging ranges of colonies of the same species. This study tracked Reticulitermes colonies in Raleigh, North Carolina, U.S., for two years and determined colony identity using microsatellite DNA markers. Generally, they observed that low numbers of smaller colonies of R. flavipes never overlapped and fewer, larger colonies of R. virginicus overlap with colonies of R. flavipes ranges. In two cases, R. virginicus foragers were found in the same piece of wood that previously was inhabited by R. flavipes (Deheer and Vargo, 2004). Reticulitermes species and colony interactions are understudied and contain many discrepancies between laboratory and field trials investigating the same biological aspect. This study will examine these inter- and intraspecific colony interactions to determine what variables influence these boundaries and interactions. To investigate these colony interactions, I intend: 1) to characterize the species and colony boundaries of Reticulitermes in a given location, 2) to determine aggression between colonies of the same and different species in laboratory trials, and 3) to observe areas of actual or potential overlap of termite colonies in the field. MATERIALS AND METHODS Objective 1. A field site at the Sam Houston State University Center for Biological Field Studies was established in August 2016. Two 2-meter grids of pine stakes were created to provide similar clarity to previous studies that used a 2 meter and 2.5 meter grid, respectively (Houseman et al., 2001, Deheer and Vargo, 2004). Samples were collected monthly from any stake with active termite feeding, as done in DeHeer and Vargo (2004). Species will be determined genetically (Szalanski et al., 2003) for each sample. Colonies will then be characterized with previously established microsatellite DNA markers (Vargo, 2000; Dronnet et al., 2004) in a multiplex to differentiate and track colonies over time. The data obtained will be compared to previous studies (Houseman et al., 2001; Deheer and Vargo, 2004) and live termites collected will be kept in the laboratory for the next objective. Objective 2. Although R. flavipes was previously shown to not be aggressive to other R. flavipes colonies (Bulmer and Traniello, 2002), this study assumed colonies were unique based on distance since it was before genetic markers were commonly used in termites. Now, with updated methods and in a different part of the species range (Texas rather than Massachusetts), I will examine interactions between termite colonies of the same and different species using the agonism assay outlined in Bulmer and Traniello (2002) as well as the planar areas from Chouvenc et al. (2011). Briefly, the Bulmer and Traniello (2002) method introduces 20 worker termites of each colony in an arena lined with moist filter paper and assesses mortality and injury at 24 hours after introduction. Termites are differentiated by feeding them dyed filter paper in advance of the experiment. This temporarily dyes the termite gut and is visible through its exoskeleton. Controls will consist of both 40 workers collected from the same wooden stake and combinations of workers collected from different stakes that were genetically determined to be the same colony. The second method in Chouvenc et al. (2011) has a modified arena consisting of soil sandwiched between two sheets of Plexiglas. This method has shown to have generally higher survival rates and provides a more realistic setup and allows the termites to tunnel (Chouvenc et al., 2011). These methods will be replicated with as many samples as possible obtained from the first objective. Objective 3. After the termite colonies have been mapped out for each field site, the areas of overlap or near overlap will be investigated in greater detail. Additional wooden stakes will be added in these areas to make a 0.5 m grid that will provide more clarity of the overlap and ranges of each colony. Any additional wood debris present in these areas will be examined for potential foragers of either colony. Observations will be made at these overlapping areas as to how termites avoid or conflict with other colonies of the same or different species.

Inter- And Intraspecific Colony Interactions InReticulitermes 391

RESULTS In the first five months at the field site (September 2016 to January 2017) there was an average of 48.4 active termite monitors per month, greater than 10% of the total stations. Currently, the genetic analysis is ongoing, but it appears that the abundance in the field station is directly correlated with the moisture in each site. The total number of active stations is approximately stable over the first five months, but the abundance in the two plots vary over time (Figure 1).

Figure 1. Number of active stations over the first five months for Plot 1 and Plot 2.

DISCUSSION While much is known regarding termite biology, there are still many knowledge gaps that require further investigation. Although studies have scratched the surface of Reticulitermes colony interactions in the lab and field (Thorne and Haverty, 1991; Houseman et al., 2001; Thorne and Forschler, 2001; Bulmer and Traniello, 2002; Deheer and Vargo, 2004; Chouvenc et al., 2011), a consensus and understanding of the interactions is lacking. This project seeks to investigate these basic interactions between colonies of Reticulitermes of the same and different species to produce the foundation required to further study the mechanisms that mediate these interactions. Termites are very significant economic pests, costing billions of dollars annually in the U.S. (Su, 2002). Colony interactions, as investigated in this project, have the potential to be applied to future pest management strategies. It has been suggested by Thorne and Haverty (1991) that the ability to understand and breakdown cues that termites use to distinguish colony members from outsiders could be manipulated to cause a “civil war” in the colony, and thus destroy the colony. Interfering with the cues that determine whether a colony fights or avoids another colony could also be used as a tool to control pest species.

ACKNOWLEDGEMENTS We are grateful for the help and support of the members of the Texas A&M Urban and Structural Entomology Laboratory, particularly Carlos Aguero. Additional funding support came from the William L. and Ruth D. Nutting Research Grant through the North American Section of the International Union for the Study of Social Insects (IUSSI-NAS) as well as the Texas A&M Urban Entomology Endowment. 392 M. A. Janowiecki and E. L. Vargo

REFERENCES CITED Bulmer, M.S. and J.F.A. Traniello. 2002. Lack of aggression and spatial association of colony members in Reticulitermes flavipes. J. Insect Behav. 15: 121-126. Chouvenc, T., P. Bardunias, H.-F. Li, M.L. Elliott, and N.-Y. Su. 2011. Planar arenas for use in laboratory bioassay studies of subterranean termites (Rhinotermitidae). Fla. Entomol. 94: 817- 826. Deheer, C.J. and E.L. Vargo. 2004. Colony genetic organization and colony fusion in the termite Reticulitermes flavipesas revealed by foraging patterns over time and space. Mol. Ecol. 13: 431-441. Dronnet, S., A.G. Bagnères, T.R. Juba, and E.L. Vargo. 2004. Polymorphic microsatellite loci in the European subterranean termite, Reticulitermes santonensis Feytaud. Mol. Ecol. Notes 4: 127-129. Forschler, B.T. and G. Henderson. 1995. Subterranean termite behavioral reaction to water and survival of inundation: implications for field populations. Environ. Entomol. 24: 1592-1597. Houseman, R.M., R.E. Gold, and B.M. Pawson. 2001. Resource partitioning in two sympatric species of subterranean termites, Reticulitermes flavipesand Reticulitermes hageni (Isoptera: Rhinotermitidae). Environ. Entomol. 30: 673-685. Su, N.-Y. 2002. Novel technologies for subterranean termite control. Sociobiology 40: 95-101. Suiter, D.R., S.C. Jones, and B.T. Forschler. 2002. Biology of subterranean termites in the eastern United States. University of Georgia Cooperative Extension Service Bulletin 1225. 16pp. Szalanski, A.L., J.W. Austin, and C.B. Owens. 2003. Identification ofReticulitermes spp. (Isoptera: Reticulitermatidae [sic] Rhinotermatidae) from south central United States by PCR-RFLP. J. Econ. Entomol. 96: 1514-1519. Thorne, B.L. and M.I. Haverty. 1991. A review of intracolony, intraspecific, and interspecific agonism in termites. Sociobiology 19: 115-145. Thorne, B.L. and B.T. Forschler. 2001. Biology of subterranean termites of the genus Reticulitermes; Subterranean termite biology in relation to prevention and removal of structural infestation, National Pest Control Association, Fairfax, VA. Vargo, E.L. 2000. Polymorphism at trinucleotide microsatellite loci in the subterranean termite Reticulitermes flavipes. Mol. Ecol. 9: 817-829. 393

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

BUILDING CONSUMER TRUST WITH INTERNATIONAL PEST MANAGEMENT CREDENTIALING

CHRISTOPHER J. STELZIG Entomological Society of America, Annapolis MD, 21401 USA

Abstract In 2004 the highly-successful Associate Certified Entomologist (ACE) program was developed by the Entomological Society of America (ESA) Certification Corporation (ESACC) as a means of providing a professional credentialing pathway for pest management professionals (PMP) who may not have the formal academic training of an entomologist. The ACE program and its partner program, the Board Certified Entomologist (BCE) are the two most dominant personal credentialing options for PMPs in the United States and around the world. However, they are not the only way that individuals and businesses in the pest control industry can differentiate themselves from the competition. From business credentials like QualityPro–a program offered by the National Pest Management Association (NPMA)–or the Confederation of European Pest Management Association’s (CEPA) CEPA-certified directory, to third-party credentials such as Angie’s List, today’s pest management customer is faced with a dizzying array of credentials to sort through. This paper serves as an exploration of the various pest management- based credentials that exist, the reasons for personal and business credentials, and offers a deeper exploration of the ACE and BCE programs.

Key words Professionalism, certification, ACE, license.

INTRODUCTION Professional credentialing is one proven way for PMPs to differentiate themselves from their competition. Research has shown that PMPs who hold a personal pest management credential feel high levels of personal satisfaction, feel more respected in the industry, enjoy a feeling of enhanced technical performance, have increased employment opportunities, and can assist their employers in securing more business contracts (McKinley, 2012). Studies have also shown that in general, certification can enhance salary potential, with one study indicating that overall individuals with at least one credential earned 18% more in salary (ICE, 2015). Professional credentialing has long been an important component of many diverse industries, including automotive mechanics, computer technicians, lawyers, and medical doctors. Historically, entomology has been largely devoid of professional credentialing programs, though not for want of discussion and debate. The desire to create professional standards has often been a heated topic of conversation among entomologists. The controversy arises at least in part due to the inherent push-pull relationship between scientifically-rooted entomology and technologically-based entomology. (Smith, 1989). As evidenced by steadily growing ranks of certified individuals, operationally, today’s ACE and BCE programs are far more recognized as a legitimate professional credential by ESA members and others. Both programs are directed by the ESACC Certification Board (CB), managed by the ESA staff, and overseen by the ESACC Governing Board.

394 C. J. Stelzig Building Consumer Trust With International Pest Management Credentialing

Voluntary credentialing began to emerge as a business practice in the pest management industry in 1936 when the Purdue Pest Management conference–recognized as one of the first such programs in the United States–held its first conference. At that time, ESA leadership was considering what responsibility it had to develop a credentialing program. After decades of debate and discussion, ESA appointed a Standing Committee on Professional Training, Standards, and Status for Entomologists (Reed, 1964). The program’s development took the next 13 years, and in 1968 the first certification program in the industry was launched with the adoption of the American Registry of Professional Entomologists (ARPE) program. At its height, approximately 25% of all ESA members were ARPE-certified (Smith, 1989) (Hines, 1975) (Sabrosky, 1969). In 1992, ARPE morphed into the BCE certification, which remains an active program today. Then, as now, the primary purposes of the program were to document professional training, promote ethical standards, and support the visibility of the profession (Cilek, 2010). From the genesis of the first American entomological societies, there has been a call to better define the profession and professionalism of entomology. The American Association of Economic Entomology (AAEE)–one of the three Societies that merged to become today’s ESA–stated in its founding documents “The membership shall be confined to workers in economic entomology. All economic entomologists employed by the general or State Governments or by the State Experiment Stations or by any agricultural or horticultural associations, and all teachers of economic entomology in education institutions may become active members of the association by transmitting proper credentials to the secretary.” In other words, membership in AAEE was based on employment differentials rather than interest in the subject or academic credentials. Members were permitted to join who did not meet the standards, but they were only admitted as associate members (Osmun, 1989).

MATERIALS AND METHODS The word “entomologist” has different definitions for different people. Popular culture would accurately describe an entomologist as a person who studies insects. Historically the ESA has felt that a minimum of a bachelor’s degree in the science would be required to attain the title (Palm, 1958). In 1971, in an attempt to quantify the training required to attain entomologist status, ESA and ARPE created these two definitions. Professional entomologist is a person who by academic training and/or practical experience has acquired a working knowledge in the science of entomology, who is recognized as an entomologist by entomologists, and who is engaged in entomological work as a substantial portion of his career. Certified entomologist is an entomologist whose record has been reviewed by the committee on Professional Training, Standards and Status of the ESA and who is considered by that Committee to meet its requirements for professional entomologist. Those definitions stood for the next 42 years. In 2013, the CB modified the ACE Code of Ethics in such a way as to clearly distinguish that, in the views of the Society, an entomologist is a person who has a minimum of a Bachelor’s degree in entomology, or a closely-related discipline. All other practitioners certified by the Society are “associate certified,” a continuation of the phrasing from the program’s founding.

Regardless of business sector or industry, there are four primary types of credentialing and each serves a unique market need. They are:

1. Certificate program is one in which a person, after meeting minimum qualifications, voluntarily submits themselves to an organization for a determination of skills, competency, and/ or knowledge. A certificate of accomplishment is generally awarded.

2. Certification programs are also voluntary programs that are similarly structured for individuals, but they differ from certificate programs in that they also require ongoing proof of

Building Consumer Trust With International Pest Management Credentialing 395

training and competency to continue to hold the credential. Often this is evaluated through the submission of continuing education units (CEUs).

3. Accreditation programs are best defined as certification programs for businesses or organizations.

4. Licensure can define either a certificate, certification, or accreditation program, but the key difference is that licensure is mandatory, as defined by some type of a government agency. (Rops, 2011). Most jurisdictions regulate applicators that operate within their borders with a few organizations, such as the Association of Structural Pest Control Regulatory Officials (ASPCRO) serving as quasi-consultative bodies.

From a business accreditation perspective, NPMA’s QualityPro was the first dominant business accreditation program to emerge. A 2004 NPMA pest management industry strategic sought to find a way to “raise the level of professionalism in pest management.” Out of this plan grew QualityPro as a way to define professional business practices for the industry. The program serves only the North American marketplace and as of this writing there are 518 QualityPro Certified companies with 98% of them (508) based in the U.S.A. NPMA also offers service credentials for QualityPro certified companies. GreenPro (started in 2009) is held by 190 companies, QualityPro Schools (started in 2007) is held by 99 companies, and QualityPro Food Safety (started in 2007) is held by 35 companies. NPMA reports erratic growth for the first decade of the program, but a relatively steady growth of approximately 8.5% since 2012. Other U.S.-based accreditation programs, such as the IPM Institute’s GreenShield are focused on specific aspects of pest control. In 2015, CEPA launched EN16636 ‘Recommendations for the Provision of Pest Management Services’ as well as implemented CEPA-Certified – a scheme to create awareness of and a desire for EN16636. They are both based on the development of a European standard for basic competencies for the operation of pest management companies in the European Union. The standard is an accreditation program and is only available in Europe. Numerous licensing programs exist for both businesses and individuals. Additionally, a wide array of third-party review sites offer customers additional assurances of contractor competency. However, many of the review sites are not moderated and are thus subject to the capricious whims of the marketplace. Social media websites such as Yelp, Facebook, Porch, Houzz, Angie’s List, TalkLocal, Judy’s Book, Thumbtack, and HomeAdvisor are all places where customers can review, “like,” attach comments or opinions to, or otherwise influence other people’s perceptions and knowledge of a business or service individual’s profile. These services serve a marketplace need, but are often are limited in their effectiveness to merely providing subject and anecdotal evidence, rather than certified and documented training and experience. However, at least partially due to low entry barriers to join as a member, social media platforms offer huge audiences and can serve as rapid change agents for businesses who receive either favorable or unfavorable reviews. Nearly 1.8 billion people use Facebook at least monthly and at least 1.18 billion people self-identify as daily users. 2013 data recorded 4.5 billion daily “likes” on the platform which is a 67% increase over the previous year (Zephoria, 2017). All of this indicates a vast, growing, and active marketplace with the potential to disrupt business models if not managed carefully.

DATA ANALYSIS While many pest management certificate programs exist throughout the world, ACE and BCE are the only global and widely-accepted personal certification programs in the industry. BCE has been international from the program’s earliest days. ACE began as a U.S.-only program; in 2014 ESA introduced the ACE International (ACE-I) program for non-US based PMPs. The U.S. version of the ACE-I program has grown an average >30% per year since introduction in 2004. (Figure 1). Today the BCE program requires an advanced academic degree in entomology or a closely- 396 C. J. Stelzig Building Consumer Trust With International Pest Management Credentialing related discipline to be considered as an applicant. Those without a degree in the science need to apply for ACE if they wish to become certified by ESA. In each case, however, the application process is similar and includes an application, letters of professional reference, documentation of work history, proof of professional competency, and approval by a program administrator. Once the application is approved, the applicant is permitted to take their examination(s) within one year. A key distinguisher of the ACE and BCE programs is that they are not in and of themselves a preparatory course. Instead, participants engage in self-study and take their examinations when they feel that they are sufficiently prepared. All examinations are administered by a proctor (generally an ACE or a BCE). Once an examinee attains a passing score, they do not need to retake that test again to maintain their certification. Continuing competency is documented via submitted CEUs at three-year intervals.

Figure 1. Growth of ACE and BCE since 1992.

CONCLUSIONS Based on market adoption as a metric for market demand, the growth rate for ACE and ACE-I indicate that this is a credential with long-term potential for widespread adoption. The pest management marketplace is large and growing. In the U.S. alone, the industry is estimated to be approximately $7.8 billion annually with an estimated 20,000 firms in place and an estimated workforce of over 74,000 (GIE, 2017). The largest 100 firms in North America (by sales volume) posted an additional $304 million in sales in 2015 over 2014 and currently employ more than 57,000 individuals (BLS, 2017). While not all companies or individuals are qualified candidates for voluntary credentialing programs such as those described herein, the market for credentialing is clearly growing.

REFERENCES CITED BLS, 2017. U.S. Department of Labor, Bureau of Labor Statistics Occupational Outlook Handbook. https://www.bls.gov/ooh/building-and-grounds-cleaning/pest-control-workers.htm (January 27, 2017) Cilek, J.E. 2010. ESA’s Board Certified Entomologist Program. American Entomologist. 56 (1) 32-33. GIE Media, 2017. Pest Control. http://www.giemedia.com/pest_control.html (January 27, 2017) Hines, M.E. 1975. The American Registry of Professional Entomologists. Bulletin of the ESA. 21 (1) 33-35. Building Consumer Trust With International Pest Management Credentialing 397

Institute for Credentialing Excellence (ICE). 2015. 6 Organizations Collaborate on Survey to Determine How Certification Enhances Salary Potential. http://www.credentialingexcellence. org/p/cm/ld/fid=420 (July 23, 2016) McKinley Advisors. 2012. ESA Certification Marketing Report. Osmun. J.V. 1989. American Registry of Professional Entomologists. Bulletin of the ESA. 15 (1) 1-2. Palm, C.E., E. Gerberg, R.E. Heal, C.F. Smith, L.M. Smith, K.L. Knight. 1958. Report of the Committee on Professional Training, Standards and Status. Bulletin of the ESA. 4 (2) 62-66. Reed, W.D. 1964. Professional Training, Standards, and Status for Entomologists. Bulletin of the ESA.10 (2) 62-66 Building Consumer Trust With International Pest Management Credentialing Rops, M.S. 2011. Certification Simplified: A Primer for Staff and Volunteer Leaders. Washington D.C.: Association Management Press Sabrosky C.W. 1969. Winds of Change: A Message from the President. Bulletin of the ESA. 15 (1) 1-2. Smith, E.H. 1989. The Entomological Society of America: The First Hundred Years, 1889–1989. Bulletin of the ESA 35 (3) 10-32 Zephoria. 2017. The Top 20 Valuable Facebook Statistics. https://zephoria.com/top-15-valuable- facebook-statistics/ (January 27, 2017) 401

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

CONTROL OF PERIPLANETA AMERICANA AND BLATTELLA GERMANICA OOTHECAE USING CHEMICAL AND BIOLOGICAL INSECTICIDES

1MARIAH V. BAGGIO-DEIBLER, 2ROBERTO M. PEREIRA, AND 3MARCELO DA COSTA FERREIRA 1Biologist, PhD in Agronomy (Agricultural Entomology), Department of Plant Protection, UNESP, Jaboticabal, SP, Brazil 2Agronomist, Associate Research Scientist, Entomology & Nematology Dept.,University of Florida, USA 3Agronomist, Professor, Department of Plant Protection, UNESP, Jaboticabal, SP, Brazil

Abstract Periplaneta americana and Blattella germanica are pests of great importance in urban areas, mainly due to their role as vectors of pathogens and capability of causing allergies. The interspecific differences between these cockroaches can lead to different results in their control. No chemical (liquid/ powder application) or biological products have been successful in controlling pre-embryonic stages of cockroaches and little is known about their residual effect on nymph eclosion. The objective of this study was to analyze the potential of different synthetic chemical insecticides and entomopathogenic fungi in controlling oothecae of P. americana and B. germanica. Two experiments were conducted with the objective of determining nymphal mortality. First, the oothecae of B. germanica and P. americana were submitted to the following treatments: T1 – control, T2 – indoxacarb (0.03g/10mL) T3 –fipronil (62µL/10mL), T4 – lambda cyhalotrin (63µL/10mL) T5 – imidacloprid (31.70µL/10mL) and T6 – imidacloprid + β-cyfluthrin (21µL/10mL); and then the percentage of dead oothecae, the total number of nymphs eclosed and dead nymphs were compared. In the second bioassay, the same variables were analyzed after submitting oothecae to the following treatments: T1 – control, T2 – deltamethrin 0.05% (0.037g/0.015m2), T3 – thyme oil 4.1% (0.046g/0.015m2), T4 –imidacloprid + β-cyfluthrin 0.075% (1.22mL/0,015m2), T5 – isolate 428 of Beauveria bassiana (2.6 x 108 conidia/0.015m2) and T6 – isolate 2575 of Metarhizium anisopliae (1.7 x 108 conidia/0.015m2). Each treatment consisted of 50 oothecae with 5 repetitions. Data were compiled and subjected to analysis of variance by the F test in a factorial (6 treatments X 2 cockroaches) and the means compared by the Tukey test (p≤0.05). M. anisopliae was the most effective strategy to control oothecae of both cockroach species. The chemical active ingredients fipronil, lambda cyhalothrin, deltamethrin and imidacloprid + β-cyfluthrin were most effective in controlling nymphs of these cockroach species.

403

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

CONTROL OF TWO POPULATIONS OF PERIPLANETA AMERICANA BY SPRAYING CHEMICAL AND BIOLOGICAL INSECTICIDES IN URBAN SEWAGE

1MARIAH VALENTE BAGGIO-DEIBLER AND 2MARCELO DA COSTA FERREIRA 1Biologist, PhD in Agronomy (Agricultural Entomology), Department of Plant Protection, UNESP, Jaboticabal, SP, Brazil 2Agronomist, Professor, Department of Plant Protection, UNESP, Jaboticabal, SP, Brazil

Abstract The applicability of entomopathogenic fungi for Periplaneta americana’s control in urban sewage is still not well studied, even though its importance as an urban pest capable of disease dis- semination being a constant. Females have an important role on dissemination of the species due to their oviposition capability and yet majority of researches focus on male control. The objective of this work was to verify the efficiency and viability ofMetarhizium anisopliae and Beauveria bassiana fungi isolates applied by cold spraying on the control of two populations of P. americana females in urban sewage in comparison to chemical control. Twenty sewage galleries in Jaboticabal, Brazil and in Piraci- caba, Brazil were used for the following treatments: T1- control (no application), T2 - Tween 80® 0.1% solution (suspension vehicle), T3- 3 x 108 conidia/mL suspension of JAB68 of M. anisopliae, T4- 3 x 108 conidia/mL suspension of IBCB35 of B. bassiana, T5- Insecticide with lambda cyhalothrin (2.5%) with recommended concentration (10mL/L). The applications were conducted by spraying a volume of 373.3 mL/m3 with cold-air nozzle sprayer AT1000 and it was evaluated: total mortality, mortality by fungus, extrusion, time of death by the fungus and fungi viability before and after application. It was found that the isolate JAB 68 of M. anisopliae is more effective in controlling P. americana females in urban sew- age when compared to IBCB35 of B. bassiana, and it doesn’t differ from chemical control after second application. Conidia of this fungus are still viable after fogging, with 97% viability.

405

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

GENETIC ANALYSIS OF TWO POPULATIONS OF PERIPLANETA AMERICANA

1MARIAH VALENTE BAGGIO-DEIBLER, 2MARCELO DA COSTA FERREIRA, 3ANDRESSA DE SOUZA-POLLO, AND 4MANOEL VICTOR FRANCO LEMOS 1Biologist, PhD in Agronomy (Agricultural Entomology), Department of Plant Protection, UNESP, Jaboticabal, SP, Brazil. 2Agronomist, Professor, Department of Plant Protection, UNESP, Jaboticabal, SP, Brazil 3Agronomist, Assistant of Academic Suport IV, Department of Preventive Veterinary Medicine and Animal Reproduction, UNESP, Jaboticabal, SP, Brazil 4Biologist, Professor, Department of Applied Biology, UNESP, Jaboticabal, SP, Brazil

Abstract The control in the field of insect large geographical distribution as Periplaneta americana species, that is a mechanical vector of several pathogens to man, may be affected by genetic variability among their populations. They can be segregating, resulting in differences in susceptibility to the control agent. One way to get answers on genetic diversity of populations of some species studied, such as American cockroach, with lower cost and faster results is through the use of Random Amplification of DNA Polymorfic (RAPD) technique. The objective of this study was to determine the genetic distance between two populations of P. americana species. Twenty females of each area were selected, corresponding to F1 generation of Jaboticabal (Brazil) and Fn generation of Piracicaba (Brazil). Each adult had their third right leg removed for DNA extraction, followed by RAPD-PCR amplification. Out of the 192 tested primers, 14 were considered the most informative and used on the RAPD analysis. The RAPD bands in each sample were coded in binary matrix by PAUP software. Molecular Analysis of Variance (AMOVA) was performed and it was calculated the fixation index (Fst). There were 128 bands generated, of which 113 (88%) were polymorphic. Populations were separated in two groups corresponding to their locations. It was observed more subdivisions in Jaboticabal than in Piracicaba. The existing variation corresponded to 17.69% between cities and 82.31% within populations. The Fst of Jaboticabal was equivalent to 0.108 and 0.074 of Piracicaba. The gene flow (Nm) was higher in Piracicaba (3.15), followed by Jaboticabal (2.05) and between cities (1.16). Data show low differentiation within Piracicaba’s population, moderate in organisms from Jaboticabal and high levels of interpopulation segregation, suggesting that the populations are different depending on their geographic location.

407

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

COCKROACH MANAGEMENT, A MUNICIPAL APPROACH. CITY OF MADRID (SPAIN)

1CÁMARA JOSÉ-MARÍA, 1TORRES PILAR, 1REY-CARAMÉS CLARA, 2BLÁZQUEZ ÁNGEL, 2ÁLVAREZ-RUIZ SUJEILI, AND 2CALDERÓN LUIS 1Carretera de La Fortuna, 33; 28054-Madrid (Spain) / Environmental Health Dpt., Health Madrid (City Council of Madrid). 2Calle Mar Mediterráneo 1, 28830, San Fernando de Henares, Madrid (Spain) / Rentokil Initial Spain.

Abstract Urban pest management in Spain, which involves prevention and control, corresponds to the municipalities. The data, key elements and conclusions of a continuous analysis of 10 years of the Madrid Municipality pest control program against sewer system cockroaches ( orientalis and Periplaneta americana) are presented. Although most resources are focused on inspection and treatment of the municipal sewage system, integrated cockroach management requires other additional areas of work: (1) Information, education and citizen’s responsibility; (2) Careful, continuous monitoring and treatment plan of the municipal sewer system; (3) Powerful data collection and integrated management of citizen complaints; (4) A comprehensive and well-designed action plan including environmental city monitoring to manage cockroach habitats; (5) Specific measures against Periplaneta americana, ‘foreign’ insect in Madrid but with increasing distribution in Spain and other Mediterranean countries in recent years; (6) Data management using the Geographic Information System tool of the city of Madrid; (7) Strengthen the research and collaborations with University and other research institutions; (8) Strong cooperation with pest control companies in the city. Overall, the continuous data analysis along the last 10 years has shown a decrease for the whole city (real citizen complaints). City districts revealed similar behaviour, only four of the twenty-one City Districts had experienced a very slight increase of the number of citizens’ complaints (year 2016) with respect to the previous year 2015, but still showed a very strong and continuous decrease trend for the 10-year-period (-25,44 % reduction average; -17,82 to -36,16). Focusing on Periplaneta americana, data showed an increase in the last four years, the number of interventions in 2016 were 136 % higher than in 2015. Data analysis conclusions: (A) The sewer cockroach prevention and control require a strong involvement of municipal departments and resources. (B) Citizen’s commitment and involvement in their private areas are critical. (C) It is necessary to implement new and effective application techniques and products in the sewer system compatible with chemical and environmental safety (i.e. effective and affordable baits). As a result, the application of these global approach procedures in Madrid Municipality, according to program indicators, has reduced notably cockroach infestation. Banning of conventional insecticide spraying practices in the Municipal sewer system has avoided the dispersion of cockroaches to alternative sewer system habitats (i.e. municipal or private subterranean infrastructures, etc.). (D) Periplaneta americana is the cockroach species with higher growth potential, therefore a strategic proactive plan to control and avoid the colonization of new areas must be designed and implemented as soon as they are detected or suspected. In this respect, the cooperation between municipal administrations and private property and pest control companies are entirely crucial.

409

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

MULTIRESISTANT GERMAN COCKROACHES IN RUSSIA

OLGA EREMINA, VERONIKA OLIFER, AND ILKHAMIA IBRAGIMKHALILOVA Scientific Research Disinfectology Institute, Nauchny proyezd, 18, Moscow, Russia.

Abstract From 2014 to 2016, in Moscow, Kaluga region, and Ural (Ekaterinburg) we have been monitored the susceptibility of male German cockroaches to topically applying 1μl insecticides of different structure. It was found that all cockroach populations are most resistant to pyrethroid insecticides, especially cypermethrin. Tolerance (3-13×) to pyrethroids in households and in the Moscow Zoo were registered, high resistance (140-300×) – in hospital, student dormitories or restaurant, and super-resistance we found in food market in Obninsk (>4000×). A number of the cockroach populations exhibited resistance to fipronil (10-54×). Tolerance or resistance to organophosphates (3-15×) are found in six Moscow, one Obninsk, and four Ekaterinburg cockroach populations. At the same time, these populations exhibit weak tolerance to carbamates (1-4×) and susceptibility or weak tolerance to neonicotinoids (0.7-3.5×) and avermectins (1-3×). A statistically significant delay in the expression of poisoning symptoms is found in all the studied populations upon contact male cockroach with the glass surface treated with 20 μg a.i./cm2 of cypermethrin, chlorpyrifos, propoxur, and fipronil. A delayed insecticidal effect on resistant cockroaches or complete insecticide ineffectiveness has been established. In this regard, it is necessary to determine the level of insect resistance and develop the individual insecticide rotation scheme for each location. Analysis of the data obtained makes it possible to assume that we are dealing with the multiresistance accompanied with different genetic mechanisms - the occurrence of Kdr- and Rdl-mutations, changes in the permeability of cuticle and in the activity of enzyme systems, etc. Moreover, delay in cockroach poisoning after feeding baits based on isoxazolines, substances of new chemical class, having never been used in Russia, apparently demonstrates an increase in the level of detoxifying enzymes, in particular monooxygenases. In our situation, we can recommend to introduce into IPM system a number of baits based on aminohydrazones (hydramethylnon), avermectins (aversectin C and abamectin), and IGR (hydroprene which controls cockroach reproduction). It is necessary to use boric acid-based baits and agents with mechanical type of action - sticky traps, diatomaceous earth, which causes desiccation of cockroaches and their sufficiently rapid death.

411

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

PERFORMANCE OF GEL BAIT INSECTICIDE IN THE SEWAGE SYSTEM OF BARCELONA FOR COCKROACH CONTROL

1FRANCO, S., 1SIMIC, T., 1VALSECCHI, A., 2BUENO, R., 2GARCÍA- HOWLETT, M., 2LACOMBA, A., AND 1PERACHO, V. 1Public Health Agency in Barcelona 2Lokímica, S.A.

Abstract The Public Health Agency of Barcelona (ASPB Catalan acronym) is in charge of the surveillance and control of pests, such as cockroaches, in public areas and sewage system of the City. As in other Mediterranean cities, Periplaneta americana has colonized the sewage system of Barcelona in last years, causing citizen complaints, economical costs and potential sanitary implications. Therefore, the control of this species in public environments is mandatory for multiple reasons. As 55% of Barcelona’s sewage system can be visited and inspected the City counts with singular conditions to fulfil an Integrated Pest Management (IPM) based program. In order to test the efficiency of a gel bait insecticide in different situations of the sewage system, a comprehensive study was carried out from June to November 2016. According to current biocides registration in Spain and the gathered experience of routine control plans in the city, the product Ecorex Gel One® (Cypermethrin 40/60 at 1%) was selected for the assays. Four different treatment types with five replicas each (20 points) and two control points were chosen. Of the total 22 points 16 corresponded to accessible underground sewage system and 6 points to non-accessible underground sewage system. Accessible underground points included a 50m section with 3 manholes, inspection was made at underground level when possible, the difference in treatment consisted on whether the gel bait was applied at manhole level, underground level or at both levels. Each point was monitored every two weeks and information of cockroach activity (visual counting and trapping), as well as environmental humidity and temperature, was recorded every visit. Biocide was applied whenever activity was found, and an influence perimeter area was established where no other control actions could be taken. The efficacy, variation in efficacy associated with the point of gel bait application, as well as some interesting information about the ethology of P. americana in this urban habitat will surely be of great interest for future IPM sewage system cockroach control plans.

413

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

INCIDENCE OF PATHOGENIC BACTERIA ON COCKROACHES COLLECTED IN DIFFERENT MUNICIPAL BUILDINGS OF BARCELONA

1MONTALVO T., 1BARAHONA L., 1PEPIÓ M., 3BUENO R., 3JARQUE J., 2RAMÍREZ B., 2SABATER S., 2PLANELL R., AND 1PERACHO V. 1Servei de Vigilància i Control de Plagues Urbanes, Agència de Salut Pública de Barcelona, Barcelona, Spain 2Servei de Microbiologia, Agència de Salut Pública de Barcelona, Barcelona, Spain 3Departamento de Investigación y Desarrollo, Laboratorios Lokimica, Barcelona, Spain.

Abstract Cockroaches (Blattodea) are important mechanical vectors for the transmission of many pathogens including bacteria, protozoa, fungi, and viruses, and can contaminate food, water, and affect animals and humans. These pathogens can be carried in different parts of the cockroach body (legs, mouthparts) as well as in their secretions (regurgitations and feces) so they suppose a major problem for public health. Transmission and storage of certain bacteria by cockroaches is an important risk factor for the spread of pathogens in hospitals, homes, restaurants and food establishments. Consequently, a suitable control of cockroach populations is needed to minimize the spread of several infectious diseases. To evaluate the pathogenic potential of cockroaches, a comprehensive study was carried out in municipal facilities of Barcelona analyzing the infestation level and prevalence of different pathogens. Exemplars of cockroaches were obtained from the pest surveillance and control programme conducted in 668 municipal buildings. Sampling was focused on two types of equipments with greater risk for public health in the context of likely alimentary contamination: municipal centers including a kitchen or a bar (alimentary manipulation) and municipal markets containing large quantities of food products (alimentary storage). Samples were taken every three months during one complete year (12 months). In each monitoring visit, cockroaches collected in sticky traps were carefully identified at species level and processed for pathogens screening in laboratory conditions. More than 80 samples were analyzed for those pathogens with major importance for public health: Salmonella spp, Campylobacter spp, Listeria monocytogenes, Staphylococcus coagulase positive and Escherichia coli beta-lactam resistant. The results show the presence of three synanthropic species of cockroaches in the equipments: Periplaneta americana, Blattella germanica and Blatta orientalis (in less amount). The analysis of the pathogens prevalence shows the ability of these insect species to transport and store bacteria of public health interest, certainly an important reason to increase efforts in pest monitoring and control programmes in these establishments and reduce the risks to public health.

415

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

RESIDUAL EFFECTIVENESS EVALUATION OF INSECTICIDES AGAINST COCKROACHES ON POROUS SURFACE

1MARCOS R. POTENZA, 1MARCIA DA F. VALBUZA, 2WASHINGTON L.B. FERREIRA, AND 2GUILHERME STAGNI 1Av. Cons. Rodrigues Alves, 1252, São Paulo/SP, 04014 002, Brazil/ Instituto Biológico/APTA 2Av. Nações Unidas, 18001 4ºandar São Paulo/SP 04795 900, Brazil/ Syngenta, Professional Pest Management LATAM

Abstract The residual effect of an insecticide is directly related to its formulation, active ingredient and application rates. The aim of this study was to evaluate the effectiveness of 2 distinct commercial insecticides products against Blattella germanica and Periplaneta americana during the following six months after their application on porous surface. The tested products were P1: 2.5% Lambda-cyhalothrin on a microencapsulated formulation (Demand 2.5 CS®) and P2: 3.5% Lambda-cyhalothrin combined with 11.6% Thiamethoxam on an EZ formulation – microencapsulated + suspension concentrate, respectively (Tandem®). The tested dosage followed manufacturers’ indications: P1: 10mL/1L of water and P2: 8mL/1L of water. Each insecticide solution was sprayed on a 20cm x 20cm cement surface, following 1L/20m² proportion. Two hours after the application, 10 Blattella germanica individuals (5 males and 5 females) were exposed on the treated surface for 15 minutes, and, after that, 10 individuals of Periplaneta americana (5 males and 5 females) were also exposed to the same surface, for the same time. Five repetitions were made for each treatment. Residual effectiveness was evaluated at 30, 60, 90, 120, 150 and 180 days after application. These evaluations followed the same proceedings: individuals exposed for 15 minutes, 5 repetitions for each treatment. All the surfaces were kept in a laboratory, under room temperature and humidity. After exposure, all the individuals were moved to an insecticide free arena, with food and water available. Mortality was evaluated until 96 hours after exposition. Results showed that P1 and P2 provided 100% of control even 6 months after applications. For both products, LT50 (time to reach 50% of mortality) for Blattella germanica and Periplaneta americana was inferior to 1 hour at 0, 30, 60, 90, 120, 150 and 180 days after application. LT90 (time to reach 90% of mortality) for both species was also inferior to 1 hour for both products, even after 180 days after application. Microencapsulated formulations provided long lasting residual effectiveness even on porous surface. The obtained information is valuable when designing an effective cockroach control program where residual effectiveness is required.

417

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

COMPARATIVE EVALUATION OF GEL BAITS PALATABILITY AGAINST BLATTELLA GERMANICA

1MARCOS R. POTENZA, 1FABRÍCIO C. REIS, 1THAIS L. LIMA, 2WASHINGTON L. B. FERREIRA, AND 2GUILHERME STAGNI 1Av. Cons. Rodrigues Alves, 1252, São Paulo/SP, 04014 002, Brazil/ Instituto Biológico/APTA/SAA 2Av. Nações Unidas, 18001 4ºandar São Paulo/SP 04795 900, Brazil/ Syngenta, Professional Pest Management LATAM

Abstract The control of Blattella germanica represents a major challenge for Brazilian PCOs (Pest Control Operators), due to their great capacity for reproduction and dispersal on tropical weather environments. Several gel bait insecticides have been developed and sold in Brazil, during the past few years, from a wide amount of multinational and local manufacturers. Although the active ingredient is a key component of baits, the food matrix is also a fundamental part of a product and it may vary from manufacturer to manufacturer due to the alimentary components used. The quality of the bait food matrix is directly related to its performance on the most challenging situations, such as kitchens and food processing areas, especially when competing with other food sources. The aim of this study was to compare the palatability of 9 distinct gel baits against a new product on Brazilian market – Advion Cockroach Gel Bait® (Indoxacarb 0.6%) – when offered to a population of Blattella germanica. The products tested against the Indoxacarb 0.6% bait, named here as P1, were: P2: a Hydramethylnon (2%) gel bait, P3: a Hydramethylnon (2%) gel bait, P4: a Fipronil (0.05%) gel bait, P5: a Fipronil (0.05%) gel bait, P6: a Imidacloprid (2.15%) gel bait, P7: a Imidacloprid (2.15%) gel bait, P8: a Imidacloprid (2.15%) gel bait, P9: a Imidacloprid (2.15%) gel bait and P10: a Indoxacarb (0.6%) gel bait, and all of them were present at Brazilian market by the time the trials were made. Ten repetitions were made for each P1 x Other Product trial. In an arena (33cm length, 22cm width, 10cm height) containing 30 individuals of Blattella germanica – 10 male, 10 female and 10 nymphs, fasted for 24 hours before the trials – 0.5g of P1 and 0.5g of other gel bait were offered simultaneously for 2 hours. After this period, both remaining baits were weighted on a high precision balance. P1 consumption was: 92.30% higher than P2, 233.33% higher than P3, 1000% higher than P4, 43.75% higher than P5, 62.5% higher than P6, 100% higher than P7, 300% higher than P8, 240% higher than P9 and 375% higher than P10. Results showed that P1 has superior palatability when compared to all its competitors. The obtained information is valuable when designing an effective cockroach control program where a palatable gel bait formulation is required.

419

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

COMPARATIVE RODENTICIDES PALATABILITY AGAINST RATTUS RATTUS AND MUS MUSCULUS ON POULTRY FARM FACILITIES

1MARCOS R. POTENZA, 2MARIA F. DOS SANTOS MENEGUETTI, 3WASHINGTON L. B. FERREIRA, AND 3GUILHERME STAGNI 1Av. Cons. Rodrigues Alves, 1252, São Paulo/SP, 04014 002, Brazil/ Instituto Biológico/APTA 2Al. Diamantina, 35, Fundos, Jd Esmeralda, Bastos, SP, CEP 17690-000, Brazil/ Meneguetti, Pest Control Operation 3Av. Nações Unidas, 18001 4ºandar São Paulo/SP 04795 900, Brazil/ Syngenta, Professional Pest Management LATAM

Abstract Rodents are frequent pests on a farm environment in Brazil. Among several species that may occur on this kind of facility, there are Rattus rattus and Mus musculus, also known as the roof rat and mouse, respectively. The aim of this study was to evaluate the comparative palatability of 6 distinct blocks against a recent released extruded block (Talon Blocos XT®), called here as P1, on both species mentioned above. The tested blocks were: P1: 0.005% Brodifacoum extruded block (20g), P2: 0.0025% Difethialone extruded block (15g), P3: 0.005% Difenacoum compressed block (20g), P4: 0.005% Bromadiolone extruded block (20g), P5: 0.005% Flocoumafen compressed block (20g), P6: 0.005% Brodifacoum wax block (20g) and P7: 0.005% Brodifacoum wax block (20g). Palatability tests against Rattus rattus were undertaken at Iacri city, São Paulo, in a quails creation facility. During sixty days, 20 bait stations were positioned on strategic points. Ten bait stations contained P1, P2, P3 and P4 simultaneously and the other ten bait stations contained P1, P5, P6 and P7 simultaneously. Consumption was evaluated by weighting the blocks every 15 days, with bait replacement at 15 and 30 days after the beginning of the trials. After that, bait replacement was made whenever there was block consumption noticed during the evaluations. P1 consumption was 122.05% higher than P2, 1950.52% higher than P3, 1950.52% higher than P4, 223.02% higher than P5, 2679.36% higher than P6 and 2114.06% higher than P7. Palatability tests against Mus musculus were undertaken at Bastos city, São Paulo, at a laying eggs chicken facility. During sixty days, 20 bait stations were positioned on strategic points. Ten bait stations contained P1, P2, P3 and P4 simultaneously and the other ten bait stations contained P1, P5, P6 and P7 simultaneously. Consumption was evaluated by weighting the blocks every 15 days, with bait replacement at 15 and 30 days after the beginning of the trials. After that, bait replacement was made whenever there was block consumption noticed during the evaluations. P1 consumption was 117.15% higher than P2, 324.43% higher than P3, 373.85% higher than P4, 144.76% higher than P5, 862.26% higher than P6 and 682.14% higher than P7. Results showed that P1 has superior palatability when compared to all competitors, for both species. The obtained information is valuable when designing an effective rodent program where an attractive bait product is required.

421

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

BURROW TREATMENT WITH BIOCIDE BAITING IN URBAN GREEN AREAS OF BARCELONA

1FRANCO, S., 1TONERA, J., 1RISPA, R., 2BUENO, R., 2GARCÍA-ANGLÉS, A., AND 1PERACHO, V. 1Public Health Agency in Barcelona 2Lokímica, S.A.

Abstract The Public Health Agency of Barcelona (ASPB Catalan acronym) is in charge of the surveillance and control of pests, such as some rodents, in public green areas and sewage system of the City. In the context of recent legal restrictions on the use of rodenticides, the control in green surfaces through the unique employment of rodent bait stations has been insufficient to solve several problems linked to murids (Rattus norvegicus and Mus musculus) proliferation in urban environments. A specific petition was made to the Spanish Ministry responsible of biocides registrations to enable the use of rodenticide directly in burrows in green spaces of the City (tree pits, borders, etc.). The selected product was Lok Difenacoum Bloque ®, a rodenticide bait in block form with Difenacoum (0,005%) as active matter. After the positive response, a specific protocol was designed and implemented to maximize the security of the application technique for citizens and pets that frequent the affected areas: rodenticide was introduced 25cm (minimum) into the burrows from the ground surface and covered with soil, each site was checked twice a week until activity finished. This method was held during three and a half months in 2015 and eight months during 2016 in all the public green spaces in Barcelona where burrows were found. More than three hundred plans were carried out to control rodent infestations in parks, green spaces and tree pits, sometimes including just one burrow, and others even exceeding fifty burrows. The method proved to be more efficient and reduced the necessary control period compared to the use of bait stations, being small infestations the quickest to resolve. The use of bait stations comprises issues such as rats’ rejection, vandalism or use viability (for example, it is not possible to use in tree pits) that hinder its success. Treating the burrows directly with rodenticide involves less time of exposure to biocides and less time of uncontrolled rat populations, thus it appears to be a more effective and safer method.

423

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

DEVELOPMENT OF THE FIRST TRANSDERMAL RODENTICIDE SYSTEM, AN ALTERNATIVE TO ANTICOAGULANT MULTI-FEEDING

STEVE L GOODE PiedPiper Consortium, Leominster, Herefordshire, HR6 9RW, United Kingdom

Abstract PiedPiper was born out of the desire to move rodenticide control away from the current multi-feed technology that leads to toxin resistant rats and mice. Our approach was to develop a single application methodology that would prevent the protracted times to death and also avoid the increase in tolerance to the anticoagulants. The primary step was to find a “suitable” toxin – i.e. a toxin which has had limited exposure in the field so as not to compromise its efficacy and could be developed into a transdermal application. Our compound of choice was cholecalciferol coupled with a solvent that readily traverses the dermis which could be formulated for aerosol use and dispensed as a single application treatment on to the back of a rodent that has been attracted into our custom designed Pest Control Device. The project has been funded by a number of grants such as EU FP7 R4SME and EU FP7DA – the first results were obtained in 2012 and these have been followed up with further independent trials in Romanville (France), Aston University (UK) and in the field at University of Nairobi (Kenya). All trials were successful and show that this is a highly innovative and effective system for rodenticide control in both urban and rural areas.

425

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

A REVIEW OF THE CHALLENGES AND LESSONS LEARNED IN DEVELOPING PROACTIVE MANAGEMENT STRATEGIES TO COMBAT INFESTATIONS OF CIMEX LECTULARIUS (HETEROPTERA: CIMICIDAE) IN COMMERCIAL ACCOMMODATION ENVIRONMENTS

DAVID CAIN Bed Bugs Limited, 3 Cobden Road, London, SE25 5NY

Abstract Having started working exclusively with bed bug infestations in 2005 and taking a unique science and fact lead approach to extermination we have always used the data produced in our work to refine the methods we use and to develop better processes. Initially focused on educational and raising understanding within our client’s organisations we quickly realised the flaws in this approach, which by 2009 this lead to the creation of Passive Monitors for bed bugs taking our services to the hospitality industry from a purely reactive offering to one that is proactive and capable to dealing with infestations before they are able to develop and spread. While this has given us a viable tool to base solutions upon there have been significant challenges in the implementation of programs within a diverse range of hospitality providers from high end hotels through to hostels and residential care facilities. Through constant review and feedback, we have identified a number of key obstacles that must be overcome in the implementation of any successful program from the overcoming of natural entomophobia, the culture of pests being someone else’s problem to deal with and the involvement of senior management. Having tackled 100% infested hotels (50+ rooms) through to entire student campuses (500+ rooms) we have established optimal detection parameters for different profiles of accommodation providers which can be adapted as the level of exposure risk changes while maintaining a foundation level of quality assurance. This review is best understood when presented as a timeline that illustrate when the challenges were first encountered, anticipated and overcome, from the changes in insecticide availability, emergence of widespread resistance through to the development of ProActive disciplines and green treatment solutions. The current conclusions to these projects have been that bed bugs continue to develop to treatment strategies and that without feedback and continual modification reactive solutions quickly fail.

427

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

CASE REPORT: DESCRIPTION OF BED BUGS (HEMIPTERA: CIMICIDAE) INFESTATION IN PRISON, ESTATE OF SAO PAULO, BRAZIL

MARCIO RODRIGUES LAGE AND JOSÉ MARIA SOARES BARATA(in memoriam) 715 Av. Dr. Arnaldo, São Paulo / University of São Paulo, Dept. of Epidemiology, Brazil

Abstract The Cimicidae or bed bugs are sucking blood insects and Cimex lectularius and Cimex hemipterus are the main species cited with distribution in Brazil. They are nocturnal insects, remain protected in their hideout in most of the day and biting people during sleep, virtually any fissure or protected location serve as hideout to bedbugs colonize. Their importance to public health is due to on contribution to deterioration of human life quality. In Brazil it has been notified the presence of these insects in hotels and residences of high economic levels. The case to be treated in this research is located in a prison in the city of Mirandópolis, where was collected 62 bed bugs. The local infrastructure was very precarious, just not because it is a prison environment, but the place has been built for other purposes initially. It is noted that local conditions are clearly suitable for the existence of large infestation of bed bugs. The treatment carried out by the specialized company, it is observed that this was following the instructions of the manufacturers of the chemicals, as well as information from specialists. It is concluded this case may reflect a public health problem is still poorly noticed in Brazil.

429

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

BED BUG MUNICIPAL MANAGEMENT. CITY OF MADRID (SPAIN)

CÁMARA, JOSÉ-MARÍA., TORRES, PILAR., ORTIZ, CARMEN., ARRIBAS, ALFONSO., PÉREZ, ANA., AND GARRASTAZU, CONSUELO. Carretera del Barrio de La Fortuna 33, 28054 - Madrid (Spain) Environmental Health Dpt., Health Madrid (City Council of Madrid)

Abstract Initially infestations of houses by Cimex lectularius were sporadically detected in the middle of the previous decade and increased over the past years. Data obtained by the Environmental Health Department have shown events increase by 1000% in the past five years for the whole city. Among the 21 City Districts, 01-Centro gathered the highest number of municipal interventions against bed bug infestations. In response to this situation, the environmental health services of Madrid City Council have quickly designed an action plan and specific procedures to carry out the best possible practices for preventing and controlling the numerous circumstances of bed bug infestation and spread. Some substantial actions are the following: (1) The promotion of information, education and reliability of citizens. (2) The information and promotion of the co-responsibility of the hotel industry. (3) Protection of municipal facilities susceptible to bed bug infestation, especially facilities and housing related to social care and temporary shelter of the homeless. (4) Special procedures and municipal intervention in social housing scenarios and other very complex cases such as bedbugs in multi-infested buildings, Diogenes Syndrome, etc. (5) Implementation of a special municipal service for collection of infested mattresses, furniture, etc. (6) Integrated monitoring and management through the vector/pest management geographic information system (GIS) of Health Madrid. (7) The cooperation and information sharing with private sector pest control companies. The implementation of these measurements and the analysis of the data obtained through the last five years allowed us to draw several conclusions, such as: (A) The lack of reliable indicators of infestation, then the important risk of underestimating real City situation and tendencies. (B) The importance that competent administrations, especially the health local authority, become aware of the relevance of this problem and of the necessity of a strong proactive and early response. (C) The transcendence and difficulty of implementing powerful strategies of citizen information and education regarding bedbug infestations, key aspect in an efficient prevention and control of the infestation spread. Media impact and information management. (D) The remarkable technical difficulties of the infestations treatments, especially in cases such as social housing, multiple-infested premises, squatted buildings, etc. Current problems for the use of new bedbug biocides and technologies in these complex situations. (E) The human and economic impact of bedbug infestations, especially in vulnerable social layers. (F) The importance of collaboration and coordination between Municipal Government (mainly Health, Environmental and Human Services) and pest control companies.

431

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

SYNANTHROPIZATION OF MOSQUITOES (DIPTERA: CULICIDAE) OF SIBERIA AND AMUR REGION

ELENA BOGDANOVA I.M.Sechenov First Moscow State Medical University, Moscow, Russia

Abstract Investigations were carried out in several climatic zones of Western and Eastern Siberia, and at the Amur region. Blood-sucking mosquitoes in these areas have a rich species composition and very high numbers. In addition to a significant irritating action in an attack on the people, they are vectors of many vector-borne diseases, and also cause allergic reactions and dermatitis. The research program included the study of the species composition and abundance of adults and larvae of mosquitoes. The surveys were carried out using standard methods in the neighborhood and in the territory of residential areas, had a long-existing and newly built. The species composition of mosquitoes of studied regions, according to our data, ranged from 22 to 31 species of the genera Aedes, Culiseta, Culex, Anopheles. Dominants in various accounting items were Ae.communis, Ae.pionips, Ae.cantans, Ae.punctor, Ae.excrucians, Ae.cinereus, Ae.vexans, Ae.riparius, An.hyrcanus. The number of mosquitoes in the new settlements was not significantly different from the number in their neighborhoods. With the development of localities in their neighborhoods and the outskirts it changed slightly. For example, in settlements at Western Siberia, in the years 1966-1968 the number of mosquitoes was 385 exemplars of a 5-minute account of entomological net, and in 1995-1998 - 265 exemplars of the records. However, the number of mosquitoes decreased from the village outskirts to its center to several tens of accounting. Of all the species in the settlements was met Ae.communis, Ae.punctor, Ae.excrucians, Ae.riparius, Ae.cantans, Ae.diantaeus, Ae.cinereus, Ae.vexans ssp, An.hyrcanus. In the localities with their development happens a reduction of the species composition of mosquitoes, but in different climatic zones and regions of different types, for example, Ae.communis, Ae.punctor, Ae, cinereus, Ae.vexans tended to the occupation of anthropogenic biotopes. This increases their epidemiological significance, since contacts of synanthropic species with the humans are increasing significantly.

433

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

KNOWLEDGE, ATTITUDES AND PRACTICES ABOUT AEDES AEGYPTI (DIPTERA: CULICIDAE), VECTOR OF DENGUE, CHIKUNGUNYA AND ZIKA IN VILLAVICENCIO (COLOMBIA)

1GLORIA ISABEL JARAMILLO AND 2LUZ STELLA BUITRAGO 1Carrera 35 N. 36-99 Barzal-Villavicencio / Universidad Cooperativa de Colombia, Medicine Faculty, Villavicencio-Colombia. 2Calle 37 N. 41 - 80 Barzal Alto-Villavicencio / Entomology laboratory, Health Secretary of Meta

Abstract Mosquito Aedes aegypti is the most efficient vector in the transmission of dengue, chikun- gunya and zika in Colombia. Villavicencio, located in the central part of the country, is one of the cities that report more cases of these pathologies. Despite the strategies of communitarian education to control the vector, the number of cases and larval index don’t decrease. Then, it is important to know if the community recognize and apply this knowledge. The main objective was to determine the knowledge, attitudes and practices about Ae. aegypti in two low income neighborhoods in Villavicencio-Colombia. A descriptive cross-sectional study was conducted in 2016. The houses were selected randomly and in the event that nobody attended, the next house was selected. Only individuals aged 18 years and above were interviewed using a structured, pre-tested questionnaire. Informed consent (verbal) was taken from all the respondents and confidentiality was ensured. Additionally, entomological data were recorded in order to calculate the larval indexes at homes: house, container and Breteau index were calculated. 76 houses (309 people inhabiting them) were evaluated. 79,45% (IC95% 68,38-88,02%) of the people surveyed known that a mosquito transmits these diseases but unknown the scientific name and 68% (IC95% 56,22-78,31%) unknown that only the female bites. 81,36% (IC95% 69,09-90,31%) didn´t know the life cycle of the mosquito but are aware that the elimination of breeding sites and de- struction of containers with water prevent transmission; 88,46% (IC95% 73,19-90,82%) recognize that the community should be responsible for these control actions at home. But the recommendations are not implemented due to lack of interest (39,51% IC95% 28,81-50,99%) or laziness (27,16% IC95% 17,87-38,19%). The house index was of 39,22% and 41,38% for each neighborhood, and Breteau index was 47,06 and 48,28. The highest percentage of positive breeding sites was for low tanks (62,5 % and 57,14 %) in both neighborhoods. It is necessary to review information campaigns, communication and education promoted in the municipality since they do not reflect the empowerment of its people. These programs need to translate population knowledge about vector borne diseases into positive preventive practices that lead to a reduction in the transmission of dengue, chikv, and zika in these communities. This will require more infrastructure and resources for long-term sustainability.

435

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

INTER- AND INTRA-SPECIFIC LARVAL COMPETITION OF TWO CONTAINER BREEDING MOSQUITOES IN SOUTH TEXAS

1SAKSHI PURI, 2FELICIA VAZQUEZ, AND 2CHRISTOPHER VITEK 1Hidalgo County Health Department 2University of Texas Rio Grande Valley

Abstract There has recently been an observed increase in vector-borne disease in the Americas, including those diseases which are primarily vectored by Aedes aegypti. South Texas is at risk of vector- borne diseases due to the mild temperatures, year-round presence of the disease vectors, and proximity to Mexico where disease like dengue, Zika, and Chikungunya have been circulating. Longitudinal and seasonal patterns in abundance in South Texas of the two vector species, Aedes aegypti and Aedes albopictus, were hypothesized to be due in part to larval competition. We examined inter-specific and intra-specific interactions with Aedes aegypti and Aedes albopictus at 30°C with a 13:11h light:dark cycle, and 15°C with a 11:13h light:dark cycle, representing average summer and winter temperatures (respectively) for South Texas. Using F2 generation colony mosquitoes, we reared mosquitoes at varying densities and food availability. In experiment one, we kept the overall density and food levels the same, and varied the level of interspecific competition. In experiment two, we varied the starting densities and the food levels, but only included intraspecific competition. Temperature significantly influenced survivorship of both species regardless of density (p < 0.05), with increased survivorship in hot temperatures. In experiment two, food levels also significantly influenced survivorship (p < 0.05), and significantly interacted with temperature (p < 0.05) for both species. Starting density wasnot significant by itself in either experiment or interacting with any other variables in the first experiment (p > 0.05), but in the second experiment starting density of Aedes aegypti interacted with temperature to significantly influence Aedes aegypti survival (p < 0.05). Our results indicate that Aedes albopictus has an overall higher survivorship rate in all conditions, although in typical summer conditions the difference is minimal. At the densities tested, starting density of hetero- or con-specific larvae was not a primary influence on survivorship. These results may partially explain the differences observed in Aedes albopictus and Aedes aegypti abundance that was observed longitudinally in residential areas, although competition alone may not sufficiently explain the pattern of moreAedes albopictus in cooler, coastal areas. Development time and size at emergence are planned for future analysis.

437

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

AEDES (STEGOMYIA) AEGYPTI AND AEDES (STEGOMYIA) ALBOPICTUS IN RUSSIA

1SVETLANA A. ROSLAVTSEVA AND 2MIKHAIL A. ALEKSEEV 1Scientific Research Disinfectology Institute of Federal Service for Surveillance on Consumer Rights Protection and Human Well-being, Nauchnyi proyezd 18, Moscow 117246, Russia 2Scientific Research Disinfectology Institute of Federal Service for Surveillance on Consumer Rights Protection and Human Well-being, Nauchnyi proyezd 18, Moscow 117246, Russia

Abstract Aedes aegypti was first discovered on the territory of the former Soviet Union in Batumi as an introduced species in 1911. High numbers of these mosquitoes have been recorded on the Black Sea coast from Sukhumi to Batumi. Since 1950s, these mosquitoes are not detected in this region (Cherkasskyi, 2000). In August-September of 2001-2005, in the Central district of Sochi a few A. aegypti females were found (Ryabova et al., 2005). In 2007, the presence of this mosquito in the Greater Sochi was confirmed. Moreover, this mosquito was registered in the cities of Abkhazia – Gudauta and Sukhumi (Yunicheva et al., 2007). In Russia, Aedes albopictus females were first caught in the Greater Sochi (Khosta) in July 2011. Species identification of caught females was confirmed by PCR (Ganushkina et al., 2012). In 2013, in the Central district of Sochi, 100-400 meters from the sea coast, females, larvae and pupae of this species were found. By 2015-2016, range of A. albopictus has expanded rapidly, reaching Novorossiysk in the north and border between the Russian Federation and Abkhazia in the south. Recently, much attention is paid to Zika virus transmitted by Aedes mosquitoes, in particular, A. aegypti and A. albopictus. On February 1, 2016 WHO announced Zika as a threat to international public health. Knowledge of insecticide susceptibility of Aedes mosquitoes is required for drawing-up a plan on rational use of insecticides in mosquito control programs and for carrying out measures on sanitary protection of the territories of Russia and CIS countries. At the end of XX and beginning of XXI century, A. aegypti and A. albopictus mosquitoes were introduced on the Black Sea coast, apparently from different countries, and their insecticide susceptibility is not known. In 2016, we carried out the preliminary work for the establishment of diagnostic concentrations of larvicides commonly used for mosquito control in Russia and other countries. After literature analysis of the distribution, insecticide susceptibility of these species and our own experiments on mosquito larvae A. aegypti of insecticide- susceptible SNIID strain, we obtained the diagnostic concentrations for some larvicides. Concentrations (mg/L) were: DDT – 0.1; temephos (abate) – 0.03; fenthion – 0.06; malathion – 0.155; chlorpyrifos – 0.016; cypermethrin – 0.119; alpha-cypermethrin – 0.086; deltamethrin – 0.048; lambda-cyhalothrin – 0.078; etofenprox – 0.05; larvicides based on Bacillus thuringiensis var. israelensis: «Larviol-pasta» – 0.013 and «Baktitsid» – 0.09. Diagnostic concentrations obtained for Ae. aegypti were used in July 2016 to determine the susceptibility of six sub-populations of Ae. albopictus from Loo, Khosta, Adler and Central districts of Sochi (most larvae were collected in cemeteries) by WHO method (1981). Larvae of all the populations studied were susceptible to cypermethrin, chlorpyrifos and larvicides based on Bacillus thuringiensis var. israelensis.

439

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

IDENTIFICATION OF MOSQUITOES USING MORPHOMETRIC WING CHARACTERS

1ANDRÉ BARRETTO BRUNO WILKE, 2RAFAEL DE OLIVEIRA CHRISTE, 2LAURA CRISTINA MULTINI, 3PALOMA OLIVEIRA VIDAL, ¹RAMON WILK-DA-SILVA, ¹GABRIELA CRISTINA DE CARVALHO, AND 1MAURO TOLEDO MARRELLI 1Departamento de Epidemiologia, Faculdade de Saúde Pública, Universidade de São Paulo, São Paulo, Brazil 2Instituto de Medicina Tropical de São Paulo, Universidade de São Paulo, São Paulo, Brazil 3Departamento de Parasitologia, Instituto Butantan, São Paulo, Brazil

Abstract Mosquitoes are responsible for the transmission of several infectious diseases endangering approximately 3 billion people around the world. The precise identification of mosquitoes’ species is decisive to understand epidemiological patterns of diseases transmission and to develop control strategies. The most commonly method used to the identification of mosquito relies on morphological taxonomic keys. Mosquito wing geometric morphometric is able to identify vector mosquitoes, even sibling and cryptic species. The objective of the present study is to accurately identify twelve mosquito species from the three main epidemiologically important mosquito genera using wing morphometric technique. Twelve mosquito species from three epidemiological important genera (Aedes, Anopheles and Culex) were collected and identified by taxonomic keys. The right wing of adult female mosquitoes was removed, photographed and the coordinates of eighteen landmarks at the vein intersections were digitized. The allometric influence was accessed followed by a canonical variation analysis, a thin-plate splines, a reclassification and cross-validated test were computed for each individual and a Neighbor Joining tree was constructed to illustrate species identification and segregation. The analyses and graphics were made with the following software: TpsUtil 1.29, TpsRelw 1.39, MorphoJ 1.02, Past 2.17c. The canonical variation analysis between Aedes, Anopheles and Culex genera showed a clear segregation of genera, subgenera and species in the morphospace correctly sorting out mosquitoes employed in this study. The pairwise cross-validated reclassification test regarding genera resulted in at least 99% identification accuracy scores, it also correctly identified subgenus resulting in a mean of 96%. Regarding species identification, 88 from 132 possible comparisons resulted in 100%, identification accuracy. Our results showed that Aedes, Culex and Anopheles were correctly distinguished by wing shape. When subjected to the analysis of lower hierarchical levels of subgenera (when present) and species, the wing geometric morphometric was also efficient resulting in high reclassification scores.

441

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

SPECIES IDENTIFICATION OF THE ANOPHELES FLUVIATILIS COMPLEX (DIPTERA: CULICIDAE) USING PHYLOGENETIC ANALYSIS PCR-SEQUENCING IN SOUTHWESTERN IRAN

1GHOLAMHOSSEIN SHAHRAKI AND 2ZEYNAB BARGHAMADI 1Faculty of Health, Yasuj University of Medical Sciences, Yasuj, Iran 2Tehran University of Medical Sciences, Tehran, Iran

Abstract Anopheles fluviatilis is one of the most important malaria vectors in Iran. The aim of this study was to identify Anopheles fluviatilis complex species using proliferation and sequence analysis of ITS2 and also 28.S- D3parts of rDNA gene in southwestern Iran. In this research Anopheles fluviatilis was caught from different areas of Kohgiluyeh and Boyer-Ahmad province at southwestern Iran in 2013. DNA was taken from 4 Anopheles fluviatilis selected samples and PCR tests of 28S- D3 part were done on these DNA samples. Then after the sequence results were obtained, these were identified and compared with similar samples of Anopheles fluviatilis based on data from a gene word bank. Phylogenetic tree and individual sequences of samples were calculated. PCR Phylogenetic analysis of r DNA 28S-D3 part of Anopheles fluviatilis confirmed that U genotype in Kohgiluyeh and Boyer- Ahmad province was identified. The gene length of r DNA 28S-D3 part between populations of this species was the same (333bp). This study showed that Anopheles fluviatilis has a species separate branch in southwestern Iran which is different to the branch of southeastern Iran (Hormozgan, Kerman and Sistaan & Baluchestaan provinces).

443

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

FAUNA AND FREQUENCY OF PHLEBOTOMINE SAND FLIES (DIPTERA: PSYCHODIDAE) IN SOUTHWESTERN IRAN

GHOLAMHOSSEIN SHAHRAKI Faculty of Health, Yasuj University of Medical Sciences, Yasuj, Iran

Abstract Determination of sand flies species is very important especially as vectors for Leishmaniasis in most provinces in Iran. This study was conducted to determine fauna and frequency of sand flies in Kohgiluyeh and Boyer-Ahmad province located in southwestern Iran. Sand flies samples were collected from five counts during May to November 2015 using sticky traps. Traps were installed in indoor and outdoor places of the rural selected areas after sunset and collected before the next day sunrise. Collected sand flies monitored for monthly activity and identified after mounting. Froma total of 8500 collected specimens, 12 species of sand fly were identified. They were from two genera (Phlebotomus and Sergentomyia). Phlebotomus species (with 50.8% frequency) including: Phlebotomus sergenti (58.3%), P. caucasicus (26%), P.papatasi (12.5%) and P. kandelaki (1%). Sergentomyia species including: Sergentomyia tiberiadis (49.5%), S. clydei (22.6%), S. dentana (6.5%), S. sintoni (10.7%), S. theodori (6.5%), S. baghdadis (2.1%), S. parratomyia (1.1%) and S. iranica (1.1%). The most trapped phlebotomus species were from indoor places (62.5%). P. sergenti observed the dominant species in the most study areas with relatively high frequency. Due to this species is the main vector for Anthroponotic Cutaneous Leishmaniasis (ACL) and the study province surrounded by three provinces which focuses of cutaneous leishmaniosis, it can be deduced that the potential of ACL in this province is considerable.

445

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

MOSQUITOES (DIPTERA: CULICIDAE) IN THE CAPITAL OF THE CZECH REPUBLIC

FRANTIŠEK RETTICH AND MARTIN KULMA National Institute of Public Health, Šrobárova 48, Prague 10, 142 00, Czech Republic

Abstract The occurrence of mosquitoes in Prague sub urban forests, gardens, parks, recreation areas, golf courses etc. was compared between flood and non-flood years. The monitoring was based on mos- quito larvae collection and mosquito female catch by CO2 traps. No massive larval populations of the an- thropophilic species of flood mosquitoes (Aedes vexans or Ae. sticticus) appeared even after catastrophic floods (in 2002, 2006, and 2013). On the contrary, in drying out flood lagoons with water polluted by decaying vegetation, larvae of the mostly ornitophilic species Culex pipiens/torrentium hatched. No larviciding (often required by local authorities) was performed. In non-flood years, scarce populations of snow melt mosquitoes appeared regularly in remnants of natural habitats, with Ae. cantans being the dominant species. But rapid urbanization (fast spreading of the urban environment) caused the disap- pearance of many natural breeding sites. Some rare species recorded in the last two decades of the last century have not been collected again (Ae. pulchritarsis, Ae. flavescens, Coquillettidia richiardii, Cu- liseta alaskaensis, etc.). Of the sibling species Cx. pipiens and Cx. torrentium, it has been the latter that prevailed in most of the natural breeding sites. The breeding sites of an autogenous, anthropophilic form of Cx. pipiens (molestus), which was frequently detected in flooded basements in Prague in the second half of the last century, have gradually disappeared owing to improved maintenance of buildings. Cx. modestus (a new species to Prague) larvae were caught on the edge of flooded meadows in the southern outskirts of Prague in 2013. Culex spp. females dominated in most of the CO2 trap catches. No invasive mosquito species have been recorded yet. Data from the first half of 2017 will be added to the poster.

447

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

REPORT OF PAEDERUS SPECIES IN IRAN, MAZANDARAN AND FARS PROVINCES, 2012- 2013

1SAHAR BAZRAFKAN, 2SEYED MOHAMMAD ABTAHI, 3ALI ASGHAR BAZDAR, AND 4ALI MEHDINIA 1International Campus, Tehran University of Medical Sciences (IC-TUMS), Tehran, Iran 2Isfahan University of Medical sciences 3Department of Industrial Engineering, Faculty of Engineering, Golpayegan University 4Department of marine Living Science

Abstract Rove beetles of the genus Paederus cause dermatitis when they come in contact with human skin. Their hemolymph contains a blistering, vesicant and toxic amide named pederin. Dermatitis caused by stimulation of beetle Paederus, is a common health problem in Iran especially in Mazandaran (North of Iran) and Fars (South of Iran) provinces. Paederus is a genus of small beetles of the family Staphylinidae (rove beetles) with 622 valid species (Frank and Kanamitsu, 1987). This survey was carried out in several different districts of the Mazandaran and Fars provinces over a period of two years, during spring and summer 2012 and 2013. Rove beetles from selected areas were collected during every visit with the help of aspirator, during day hours (10:00-15:30) with hand catch method using. The greatest number of specimens (334) was collected from north (Mazandaran province) and identified as Paederus fuscipes. Other 154 beetles were collected from south (Fars province) were classified in two groups; Paederus fuscipes (28.07%) and Paederus littoralis (71.93%).

449

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

QUANTITATIVE CHARACTERIZATION OF PEDERIN IN THE ROVE BEETLE, STAPHILINIDAE; PAEDERUS, IN MAZANDARAN AND FARS PROVINCES, IRAN.

1SAHAR BAZRAFKAN, 2MOHAMMAD ALI OSHAGHI, AND 2MANSOUREH SHAYEGHI 1International Campus, Tehran University of Medical Sciences (IC-TUMS), Tehran, Iran. 2Tehran University of medical Sciences, Tehran, Iran.

Abstract Rove beetles, genus Paederus have a vesicant toxin amid, in their hemolymph, named pederin, and caused lesions on human skin. It was first described by a procedure on 25 millionPaederus fuscipes collected from the field. A few studies were conducted about pederin content of each beetle. It is very various in each specimen. According to a Pavan study in 1963, at least 1µg pederin per one male adult beetle is expected and 10 times more in females. Kellner and Dettner (1995) assessed a new method for quantification of pederin in each beetle for the first time. Before that, severity of dermatitis caused by Paederus beetles was the only method for determination of pederin content. They also reported 0.1-1.5 µg of the toxins in males and 0.2-20.5 µg in females, 10 fold more than males in most cases. Results: In this study pederin is quantified in field specimens of two province of Iran, Fars (south of Iran) and Mazandaran (north of Iran). Males contain 0.76µg, 0.73µg and 0.36µg for P. Fuscipes Mazandaran, P. Fuscipes Fars and P. littoralis Fars and females 10.89 µg, 10.31 µg and 3.29 µg of the toxin respectively.

451

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

FLYING INSECT FAUNA OF HOSPITALS

1MATTHEW P. DAVIES, 1MORAY ANDERSON, AND 2ANTHONY C. HILTON 1Killgerm Chemicals Ltd, Wakefield Road, Ossett, WF5 9AJ 2School of Life & Health Sciences, Aston University, Birmingham, B4 7ET, UK

Abstract The collection and identification of flying insects associated with a number of UK hospitals was undertaken, in order to classify and enumerate the insects found and establish their seasonality and location in such premises, therefore informing pest control measures. A total of 19,937 individual insects (and other arthropods) were collected from seven UK hospitals over a 20 month period via ultra-violet light flytraps. Of these individuals, approximately 114 arthropod species were identified. Chironomidae were the most common flies, Calliphora vicina were the most common synanthropic fly and ‘drain flies’ were surprisingly numerous and represent an emerging problem in hospitals. Psychodidae were the most common of the ‘drain flies’ and were therefore the most important known insect vector of the ‘hospital superbug’ Clostridium difficile present in hospitals. Other known insect vectors of C. difficile present were Musca domestica, Fannia canicularis and Drosophila sp. Of the known insect vectors of C. difficile, M. domestica were surprisingly low in numbers. Another perhaps surprising finding was that ‘occasionally encountered insects’ (also known as occasional invaders / casual intruders) were actually the group most frequently found in hospitals. It was noted that presence of certain species, specifically some of the ‘occasionally encountered insects’ is diagnostic of proofing inadequacies in UK hospitals. Regarding seasonality, many species were present all year round and not all peaks in numbers were in summer, insect diversity was highest in spring and sheer numbers of insects were highest in summer. Location data showed that insects were found most often in food preparation areas. This study updates the knowledge base regarding flies in hospitals and contrasts with the general wisdom that houseflies M. domestica are the most numerous in such premises and that flies are mainly a summer problem. Furthermore, this work provides pest control and infection control staff with knowledge of the key flying insect species that are likely to be present in hospitals at certain times of year and in which hospital locations. This knowledge better informs the design of integrated flying insect management programs, in order to minimise the risk of disease transmission by flying insects, with pest control central to infection control.

453

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

CHARACTERIZATION OF ANTIBACTERIAL ACTIVITIES OF A SUBTERRANEAN TERMITE AGAINST HUMAN PATHOGENS

XING PING HU, SANG-JIN SUH, AND YUAN ZENG Auburn University, College of Agriculture, 107 Comer Hall, Auburn, Alabama

Abstract The emergence and dissemination of multidrug resistant bacterial pathogens necessitate research to find new antimicrobials against these organisms. We investigated antimicrobial production by eastern subterranean termites against a panel of bacteria including three multidrug resistant (MDR) and four non-MDR human pathogens. We determined that the crude extract of naïve termites had a broad-spectrum activity against the non-MDR bacteria but it was ineffective against the three MDR pathogens including MRSA. Heat or trypsin treatment resulted in a complete loss of activity suggesting that antibacterial activity was proteinaceous in nature. The antimicrobial activity changed dramatically when the termites were fed with either P. aeruginosa or MRSA. P. aeruginosa induced activity against P. aeruginosa and MRSA while maintaining or slightly increasing activity against non-MDR bacteria. MRSA induced activity specifically against MRSA, altered the activity against two other Gram-positive bacteria, and inhibited activity against three Gram-negative bacteria. Further investigation demonstrated that hemolymph, not the hindgut, was the primary source of antibiotic activity. This suggests that the termite produces these antibacterial activities and not the hindgut microbiota. Two-dimensional gel electrophoretic analyses of hemolymph protein spots indicated that a total of 38 and 65 proteins were differentially expressed at least 2.5-fold upon being fed with P. aeruginosa and MRSA, respectively. Our results provide the first evidence of constitutive and inducible activities produced by this termite against human bacterial pathogens.

455

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

FREQUENCY OF KNOCKDOWN RESISTANCE MUTATIONS IN BODY LICE (PHTHIRAPTERA: PEDICULIDAE) FROM RUSSIA

1,2YULIYA V. LOPATINA, 2OLGA YU. EREMINA, AND 3LIUDMILA S. KARAN

1Moscow State University, Russia 2Scientific Research Institute for Disinfectology, Moscow, Russia 3Central Research Institute of Epidemiology, Moscow, Russia

Abstract One of the global problems of today is the insecticide resistance of the human louse Pediculus humanus L. to pyrethroids. The continuous application of pyrethroids (mostly, permethrin) resulted in the formation of local lice populations resistant to this group of insecticides. In the 2013-2015 body lice P.h.humanus were collected in various regions of Russia (European Russia, Ural, Siberia), both in big cities (Moscow, St. Petersburg, Novosibirsk, Perm), and in small towns (Kursk, Tambov). Body lice were studied by real-time PCR to detect the kdr mutations (T917I and L920F) in the para-orthologous voltage-sensitive sodium channel gene, which are associated with permethrin resistance. The resistant haplotype was found in all of the body lice samples. The frequency of the resistant allele varied from 0.432 to 0.89 which indicates the different level of permethrin resistance. The resistance monitoring was carried out in Moscow in the 2008-2015. The frequency of the resistant allele was 0.488 in 2008; whilst a considerable part of the species was represented by susceptible homozygous (37. 5%) and heterozygous by kdr allele (27. 5%) individuals. The frequency of kdr allele which increased sharply in 2009 (0.763) has been gradually growing hereafter, and reached its maximum (0.879) in 2014. 80% of the insects were the homozygous resistant individuals at the time; the rate of susceptible homozygous individuals didn’t exceed 3%. From 2011 onwards no colonies of exclusively permethrin-susceptible (SS) lice have been found. Our research resulted in the substitution of permethrin by fenthion in 2014 for the treatment of homeless people’s clothes infected by lice, and for the liquidation of their head lice in the decontamination centers. This probably caused the decrease of the lice infestation rate among homeless people in 2014-2015, as compared to 2009-2013 (15% vs 30%). The other reasons of the improvement could also be the active efforts of charitable organizations in Moscow, and the increase of homeless people’s awareness which allowed them to change clothing, infested by lice in particular, for the new one more often.

457

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

UNDERSTANDING HOUSEHOLDERS’ INTENTIONS TO ENGAGE IN PEST CONTROL: THE USE OF THE HEALTH BELIEF MODEL

1STEFAN A. LIPMAN AND 2SARA A. BURT 1Department of Social Health & Organizational Psychology, Faculty of Social Sciences, Utrecht University, Utrecht, The Netherlands. #Current address: Institute of Health Policy & Management, Erasmus University Rotterdam, Rotterdam, The Netherlands. 2Institute for Risk Assessment Sciences, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands.

Abstract Pests in the home are a health risk because they can be reservoirs or mechanical vectors for several bacterial, parasitic, fungal and viral disease agents. Other associated health risks are allergies and damage to building structure by gnawing. The aims of this study were to use a social cognitive model that is widely used in psychology, the health belief model, to investigate which factors influence householders’ intention to control pests and to record which categories of pests are reported in homes in the Netherlands. An online questionnaire was developed to record the following variables: demographic variables, health motivation, perceived susceptibility/severity of contracting diseases through pests, and the costs/benefits of pest control. The survey was placed online between 11 September and 31 November 2015 and was completed by 413 respondents. Regression analysis revealed that perceiving the benefits of pest control and expecting severe consequences of zoonotic infections predicted higher intention to control pests. Intentions towards pest control were not influenced by perceiving oneself as susceptible to catching a disease from pests, health motivation (striving towards a healthy lifestyle), or by the expected costs of pest control. Interestingly, pet owners and farmers were less likely to control pests than others. A large majority of respondents reported pests in or around their home within the previous year. The prevalences were: rodents 62%, flying insects 98%, crawling insects 85%, birds 58%, and moles 20%. In conclusion, the findings of this study suggest that interventions aimed at improving the effectiveness of domestic pest control should focus on increasing the benefits that individuals associate with effective pest control and on underlining the severity of the diseases that pests may carry. That animal owners are less likely than other people to engage in pest control should be taken into account.

459

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

LASER TECHNOLOGY FOR BIRD DISPERSAL

STEINAR HENSKES, TIM SPRANG, AND HENK VAN DIJKE Bird Control Group, Molengraaffsingel 12, 2629 JD Delft, The Netherlands

Abstract Industrial sites are in conflicting with nature if it comes to birds. The roofs and ledges of factories and other buildings are an ideal habitat for birds to breed and forage. These places are often without human presence, making them an optimal place for birds to perch. The presence of birds and guano at industrial sites is a globally recognized problem that can seriously jeopardize safe working conditions and prove costly. Inspired by wildlife control programs at airports, we developed a new integrated approach that enables performance-based bird control. Results are significantly better than conventional methods. Many bird deterring products only focus on dealing with the symptoms of bird presence. They leave an important issue unaddressed: how can we integrate industrial activities into the natural environment in a sustainable way? Bird Control Group developed an integrated approach consisting of 3 main elements: 1. Continuous monitoring and analyzing of bird data using optical camera technology. 2. Avoiding birds entering the area by influencing the habitat and deploy automated lasers for bird repelling. 3. Direct intervention by wildlife officers. We furthermore developed the tools needed to put this approach into practice. The laser equipment is based on a scientific new technology: an automatic laser beam that makes use of the fear reflex of birds for green light. Built-in safety methods make sure that the laser can never dazzle aircraft, vehicles or the general public. The birds will stop seeing the industrial area as a safe haven since the system keeps firing its animal friendly laser ‘attacks’. Bird Control Group has introduced a laser system that repels birds automatically from so-called ‘bird hotspots’. The principle of repelling birds with a laser beam is inspired by nature. Birds perceive the approaching laser beam as a physical object. It appeals to the survival instinct, causing the birds to fly away. The continuous presence of the moving laser beam keeps areas free of birds, 24 hours a day. Numerous users in more than 70 countries make us of the technology. Some of these clients are leading international companies. Leading pest control companies around the world implement the approach at their clients. In a business case of a well-known tire warehouse, 40,000 square meter of roof is protected from birds with one laser system. The investment of about 10,000 Euro saves the company tens of thousands of Euro each year.

461

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

INTENSITY-DEPENDENT SUCCESS OF FERAL PIGEON POPULATION CONTROL BY CULLING IN BARCELONA CITY (CATALONIA, SPAIN)

1J. PASCUAL., 1T. MONTALVO., 1V. PERACHO., AND 2J.C. SENAR 1Servei de Vigilància i Control de Plagues Urbanes, Agència de Salut Pública de Barcelona, Barcelona, Spain 2Natural History Museum of Barcelona

Abstract Pigeon control actions in big cities are usually necessary to maintain the populations in such densities that do not generate conflicts with the human inhabitants. Pigeon control has traditionally been undertaken by culling. However, several papers have shown that this method might not be effective since it creates a gap in the capture locations that is rapidly filled by neighboring individuals. Nonetheless, many of these studies were based on culling actions over small or medium-sized cities, on culling over only some parcels of big cities or on culling over a small proportion of the whole population. In a former paper (Senar et al. 2009, Arxius de Miscel·lània Zoològica 7: 62-71) we showed that culling actions eliminating 227,479 pigeons from 1991 to 2006 (i.e.15,165 pigeons/year) were very few effective to the control of the whole pigeon population in Barcelona city, since the population increased from 183,667±14,914 to 256,663±26,210 individuals (CI 95%). Here we present the results of a study on the efficacy of culling actions from 2009 to 2014 over the same population, with an intensity of 42,363 pigeons caught per year, showing that the pigeon population dropped to 85,777± 10,028 individuals in 2015. These results clearly show that culling might be highly effective to the control of pigeon populations when its intensity is properly dimensioned. They also stress the importance of analyzing the effect of control actions over whole populations and not only to selected parcels in evaluation tests in order to overcome the influence of metapopulation dynamics.

463

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

PHYTOMASS OF URBAN ECOSYSTEMS AS THE BASIS FOR ATTRACTION OF DESIRABLE AND UNDESIRABLE ORGANISMS

VАLENTIN B. SAPUNOV Saint-Petersburg State Agrarian University, St-Petersburg, Russia

Abstract Under increase of pressure on nature, many organisms have adapted to a new environment and began an active attack on new ecosystems. Urbanized communities are part of the biosphere and live according to the fundamental laws of ecology. Urban green plantations having both alive and dead phytomass are attractive for urban pests. Under increase of natural hazard activity and anthropogenic pressure, biological indication as cheap monitoring methods becomes necessary. Urban plants are natural indicators of ecological pressure: float asymmetry is a measure of mutagenic pollution. Abnormal form of three is criteria of teratogen pollution. The more plants have abnormality, the more resources for pests. Importance of such an indication is increased by Chernobyl and Fukushima incidents etc. The ratio between number of species and their biomass has mathematical description available to the prediction of the number of weed plants and phytophagous, which will occupy urban plantations. Urban populations have a higher phenotypic variation than wild ancestors. According to data of ICUP (1993 – 2014), 3 important processes during the 22 years took place: 1. Development of fundamental knowledge about urban pests. 2. Development of practical methods of pest control. 3. Ecological and evolutionary processes in pests that allowed them to take extensive ecological niches. The latter occurred most rapidly and efficiently, and the pests have proved to be stronger than program of pest management. Some organisms in the urban environment were more populated than their ancestors in the wild. Dead plant phytomass is resource for the breeding of termites. These insects produce gases that significantly affect global climate. In some cases, increase in the number of pests occurs after natural disasters. So, tsunami 2011 in Japan washed up on the shore a huge biomass of marine animals. It has become a breeding ground for the development of many pests and sharply worsened sanitary conditions in coastal areas. The first ICUP conference was dominated by reports offering chemical methods of control and rotation of pesticides. These methods have been, and will continue to apply, despite their possible negative environmental consequences. However, an increasing number of works devoted to environmentally friendly methods of struggle, reproducing the processes occurring in nature without human influence. This is the use, along with pesticides, repellents, including those of natural origin. An important aspect of pest management under policy of “green economy” – the shift from synthetic pesticides to substances derived from natural materials and organisms, and synthetic analogs of such substances. Accordingly, the fight against plant pests and pathogens for humans can only be effective based on the latest achievements of scientific ecology and on control of their resources.

465

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

CONTROLLING INVASIVE TREE PESTS IN THE URBAN FOREST USING TREE MICRO INJECTION

ALEXANDER CORNISH AND PETER WYSS Syngenta Crop Protection AG, Schwarzwaldallee 215, CH-4058 Basel, Switzerland

Abstract It is well documented that several waves of invasive tree pests are advancing across the European continent and there are few practical solutions to halt their progress. Pests include Horse Chestnut Leaf Miner, Red Palm Weevil, Asian Longhorn Beetle, Pine Wood Nematodes and Pine and Oak Processionary Moth. Studies carried out over the last 10 years using specially formulated emamectin benzoate have shown that the invasive pests listed above can be controlled effectively via tree micro injection. Examples of be effective control will be shown, often for several years following a single application. The application method is particularly suited to treatment of urban trees.

467

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

LURING BISCUIT BEETLES (COLEOPTERA: ANOBIIDAE) AWAY FROM DRIED ORNAMENTAL PLANTS

1CHRIS SWINDELLS AND 2YVETTE HARVEY 1Acheta Consulting Ltd, Church View, Front Street, Churchill, North Somerset, BS25 5NB 2Royal Horticultural Society Garden Wisley, Woking, Surrey, GU23 6QB

Abstract Monitoring of insect pest activity with the use of sticky blunder traps (sometimes with an attractant) is routinely carried out in the food industry and other businesses. Biscuit beetles (Stegobium paniceum) can be a significant pest but, there have been few commercially available species specific traps. Monitoring for Stegobium paniceum has been limited to visual inspection, the use of generic sticky blunder traps, or captures in electric flying insect control units. In collaboration with Acheta Consulting Ltd, The Royal Horticultural Society’s (RHS) herbarium at RHS Garden Wisley has recently taken part in a very small trial of a pheromone lure, currently commercially unavailable in the UK, to attract male Stegobium paniceum. The herbarium contains over 83,000 ornamental plant specimens that have been pressed, dried and mounted on thick card. Most specimens have not been treated with any pesticide, and are contained within sealed metal cabinets in a small room that has open access to other rooms. The herbarium suite is not environmentally controlled. Although the specimens are annually frozen (a rolling programme), a population of Stegobium paniceum have been able to survive in the collection area. This made the herbarium ideal to trial the pheromone lure. The trial was undertaken during August and September 2016. As part of the trial, the pheromone lures were not stuck on glue traps provided by the manufacturer of the lure, or presented in the orientation suggested by the manufacturer. Lures were stuck on to alternative commercially available crawling insect monitor glue pads, held within a hanging frame and hung around the collection area. Identical traps lacking the lures were placed near the lured traps. Results indicate that Stegobium paniceum were attracted to the lured traps in preference to the traps that were free of the pheromone lures. Beetles were still being caught after the manufacturers recommended renewal time, indicating the potential effectiveness of the pheromone lure. Captures within the traps have indicated where the problem is likely to be and has shown the pheromone to be a promising tool in the fight againstStegobium paniceum in a herbarium collection.

469

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

AUSTERITY BITES: LOCAL AUTHORITY PEST CONTROL SERVICES

MATTHEW AUDLEY, SIMON FORRESTER, AND PARMINDER THINDAL British Pest Control Association, 4A Mallard Way, Pride Park, Derby DE24 8GX

Abstract The landscape of public health pest control is changing. Budgets are being cut across the country, with most local authorities (LAs) still being the main source of dealing with public health pest problems as they did before, but with significant reductions in resourcing. Through analysing the UK pest control call-out data of LAs and comparing them to commercial (private) pest control companies, it is apparent that under-resourcing public councils places significant pressure on the public to self-finance public health pest control. Data indicated that UK LAs have been gradually contracting out their pest control services within the last five years. For the financial year 2011-2012, 17.9% of LAs contracted out their pest control services. This has risen significantly, emphasising the notion that LAs are no longer financing public health pest control, and suggesting that pest control services at LAs are under-resourced due to the government austerity measures within their local districts. Many services are under threat from future cutbacks, and in most cases these cuts have already had an impact on pest control staffing levels and services. This highlights a worrying trend; that UK LAs can no longer provide pest control services to the public due to the current measures and changes to LA financial models, thus leading members of the public and private pest control companies to solve the public health pest control needs of the nation. The majority of the general public perceives that the first call for pest-related problems is their local council. However many will discover their calls being rejected from councils that no longer offer these services, and therefore will rely on DIY treatments and commercial pest control providers. It’s thought that analysis of BPCA referral data demonstrates that areas where cutbacks are prominent, there are resultant increases in demand for commercial pest control activity. This exposes the vulner- able to unscrupulous and potentially unqualified pest operators. The British Pest Control Association believes these data highlights the need for greater cooperation between LAs and the private sector to guarantee an affordable and safe pest control for the public.

471

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

ABILITY OF TRAINED SCENT DETECTION DOGS TO DETECT GRAIN WEEVIL IN WHEAT SAMPLES

A JUSON AND C JUSON Merlin Environmental Solutions Ltd. PO BOX 112, Carshalton, Surrey SM5 4XT. UK

Abstract Cereal grains are the major source of food for humans and most domesticated animals. In many developing countries, overall post harvest losses of cereals of between 10–15% are fairly common. The grain weevil, Sitophilus granaries is a pest of wheat, oats, rye, barley, rice and corn. Grain weevils cause significant damage to harvested stored grains and may drastically decrease yields. They are hard to detect and usually all of the grain in an infested storage facility must be destroyed. In common with other grain boring species, its larval stage is concealed within the grain, feeding on the germ, only becoming apparent after pupation. Currently on farms, manual samples, traps, and probes have been used to determine the presence of insects. These methods are not efficient and are time consuming. At the industrial level, acoustic detection, carbon dioxide measurement, uric acid measurement, near-infrared spectroscopy, can be used to detect insects in grain samples however these methods are cost prohibitive and not widely available in the developing world. The use of scent detection dogs for the monitoring of wood destroying insects and certain parasites of man is widespread and highly successful, however their role in stored product pest management has not been investigated. Dogs were trained as part of this study to detect grain weevil larvae and adults using a toy and verbal/physical interaction reward system. Their efficacy was tested with adult grain weevils and larvae placed in vented polycarbonate containers under controlled test conditions. Dogs were able to discriminate grain weevil samples from Blattella germanica, and Callosobruchus maculatus, with a 96% positive indication rate (correct indication behaviour from dog when target present) and 0% false positives (incorrect indication of when not present). Under controlled conditions using infested wheat samples from captive colonies, dogs were 92% accurate in locating live grain weevil larvae prior to pupation at infestation levels as low as 1 infested grain per 100ml of wheat. If trained properly, dogs can be used effectively to locate live grain weevil larvae in stored wheat crop prior to pupation. They could offer a fast and cost effective addition to integrated pest management programmes and subsequently reduce grain losses.

473

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

INSECTICIDE CANDLE

BOEY WAI LOON Plot 10.01, Jalan PKNK 1/3, Kawasan Perindustrian Sungai Petani, 08000 Sungai Petani, Kedah, Malaysia.

Abstract Insecticide candle is the optimum human lifesaving innovation that kills flying vectors, particularly mosquitoes - the most lethal of all insects in the world. Over one million people worldwide die from mosquito-borne diseases every year. The candle is a special vegetable wax-encased formulated candle which uses pyrethroids as the active repellent ingredient. An evaluation of the candles’ repellent effect was done by the National Institute of Malariology, Parasitory and Emotology, Vietnam, after a field efficacy trail of the candles’ formulation with transfluthrin was done using the human bait technique as the criteria in measuring the population of night biting mosquitoes, Anopheles epiroticus and Culex vishnui. The field trial was done in an indoor setting, conducted at the brackish residential area, An Thoi Dong, Can Gio District, Vietnam where the predominant population density species was the Anopheles epiroticus reported to be resistant to the pyrethroids class. The field trial results showed that in spite of mosquito resistance to pyrethroids the repellent candles provided a highly substantial protection effect from biting. The average protection effect of the candles in 6 hours biting of Anopheles epiroticus was 71.92% and Culex vishnui at 76.36%. In comparison, the results showed an increase of protection against a previous bioassay result done in July 2014 where the protection rate was only 60% with alphacypermethrin. This suggests that the candles had proved better to limit mosquito biting and has gathered a high degree of acceptance by the community (98%) for the candle. Further prevailing results were gathered from a laboratory evaluation research at the Vector Control Research Unit, Universiti Sains Malaysia using the Peet Grady chamber method indicating a response after 5 hours burning of a single candle. After-burned-time measured for 8 hours showed the efficacy for knock-down (KT50 and confidence limit) at 4.09 minutes and 100% mortality. This candle is a new revolutionary solution. It is a scientifically tested and proven tool in fighting mosquitoes and the diseases they transmit. Essentially applicable for both indoor and outdoor use, it is smokeless, odourless and adequately doubles up ideally as a light providing source especially useful in areas with no electricity. It stands decidedly as an effective, acceptable, affordable, accessible, and available source of household protection against many widespread vector diseases.

475

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

DEVELOPMENT OF A BIOLOGICAL TICK TRAP BASED ON ATTRACT-AND-KILL STRATEGY

1KERSTIN BÜCHEL, 1HANS DAUTEL, 1BJÖRN PÖTSCHKE, 1MARIELLA JONAS, 2MARION WASSERMANN, 2UTE MACKENSTEDT, 3ELISA BEITZEN-HEINEKE, 3WILHELM BEITZEN-HEINEKE, 3MICHAEL PRZYKLENK, 4SISSY-CHRISTIN LORENZ, 4PASCAL HUMBERT, AND 4ANANT PATEL

1IS Insect Services GmbH, Haderslebener Straße 9, 12163 Berlin, Germany 2University of Hohenheim, Dept. of Parasitology, Emil-Wolff-Straße 34, 70599 Stuttgart, Germany / cooperation partner 3BIOCARE company of biological plant protection mbH, Dorfstr. 4, 37574 Einbeck, Germany / cooperation partner 4Bielefeld University of Applied Sciences, Faculty of Engineering Sciences and Mathematics, Fermentation and Formulation of Biologicals and Chemicals, Wilhelm-Bertelsmann-Str. 10, 33602 Bielefeld, Germany / cooperation partner

Abstract The most frequently reported vector-borne diseases in the temperate zone of the Northern Hemisphere are related to ticks, e.g. borreliosis and tick-borne encephalitis. In Europe, Ixodes ricinus (Acari: Ixodidae) is the most abundant species infesting a wide range of hosts. Increased public awareness concerning infectious ticks has raised interest in an effective tick control. The aim of this project is the development of a tick trap based on an attract-and-kill strategy. Therefore, we screen long and short range attractants as well as aggregation pheromones. For the first time we demonstrate behavioural assays with I. ricinus nymphs using a novel y-olfactometer for screening compounds of, inter alia, the classes of aldehydes, lactones, and terpenoids. We demonstrate a significantly attractive effect of CO2 on I. ricinus. Further we screen aggregation pheromones using a refined static assay. Up to date we detected aggregation pheromones of the classes of purines and their derivatives. These substances combined (attractant component) will be released through a capsule-based biopolymer system, which is coupled with a kill component, a naturally occurring entomopathogenic fungus. The fungus Metarhizium spp. is able to infect the ticks as they come into contact with the capsules. The intention of the trap is to provide protection against I. ricinus in areas frequently used by humans. Future research should investigate whether similar results are obtained when adult Ixodes ticks or other tick species are tested.

477

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

PEST ODYSSEY UK – A GROUP TO PROMOTE IPM IN CULTURAL HERITAGE IN THE UK

1SUZANNE RYDER, 1ARMANDO MENDEZ, 2PHILIP BAXTER, AND 3DAVID PINNIGER 1Natural History Museum, Cromwell Road, London SW7 5BD, 2The British Museum, Great Russel Street, London WC1B 3DG, 3DBP Entomology, Cookham SL6 9DE

Abstract The Pest Odyssey group consists of professionals from the cultural heritage sector with a wide experience of IPM, a personal interest and demonstrated dedication to the program and its applica- tions. We effectively represent the cultural sector and members are from a wide group which includes; National Museums, Historic Houses and independent consultants. It has its origins in a programme set up by English Heritage in 2008 to encourage transmission and exchange of IPM skills. The group really came together in its present form to organise and run the very successful 2011 Pest Odyssey Conference at the British Museum. Our mission is to provide a trusted platform to communicate, advise and promote best practise in Integrated Pest Management for cultural heritage. This multi-disciplinary group pro- vides expertise in reducing pest risk, thus protecting valuable collections. We advocate the use of IPM as an essential cost-effective and sustainable tool to serve the cultural heritage industry, creating collabo- rative networks and sharing relevant information. There is a small steering group of members who must show active participation within the group. Some of the achievements over the last 10 years include: development of guidelines and strategies for IPM programmes, advice to legislative bodies directing control and treatment products and developing the Pest Odyssey website. The group aims to organise one open meeting each year for interested museum and pest professionals to encourage presentation of new information and discussion on best practice IPM strategies in the heritage sector.

479

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

THE FATE OF TICK POPULATIONS (ACARI: IXODIDAE) AFTER INTRUSION OF AN URBAN SETTLEMENT INTO WILD NATURE (A CASE STUDY)

IGOR USPENSKY The Hebrew University of Jerusalem, Israel

Abstract The construction of a hydroelectric power station on Zeya River near the town of Zeya (Amur Region, Russian Far East) in the early 1970s spurred the development of a new urban settlement in the town for construction workers. Natural conditions of this area supported the persistence of populations of 3 species of ixodid ticks: the taiga tick Ixodes persulcatus (I.p.), the main vector of a number of tick-borne pathogens, as well as Haemaphysalis concinna and Dermacentor silvarum. The preferred host species for adult ticks in the area were Siberian roe deer, wild boar and numerous mountain hares. The abundance of I.p. adults in the peak of their activity reached 12.0 specimens per 1 km of dragging at the initial stage of construction of the settlement. Numerous cases of tick attacks and bites (mainly by I.p. adults) were registered in this and adjacent areas at that time. The prevalence of the tick-borne encephalitis virus in I.p. females was found to be up to 1.0%. Aerial treatment of the area by DDT dust was performed in 1970, which resulted in the disappearance of adult ticks of all 3 species. The effect on the larval and nymphal stages was weaker, 40-60% reduction according to the data of tick collection from small mammals. In the following 4 years, no adult ticks were detected in the area, while the preadult occurrence decreased every year; tick attacks were rarely documented, and then only near the border of the treated territory. These results are in contrast to the data obtained in a number of studies, in which a gradual recovery of tick populations was observed in the years following a single acaricidal treatment. The unexpected results of our study may be explained by the strong anthropogenic pressure over the territory of the settlement and its surroundings. Each year following the acaricidal treatment, the size of the settlement and its human population increased significantly, which resulted in intensive trampling of the grass, uncontrolled fires, destruction of vegetation as well as displacement of wild animals from the territories contiguous to the settlement. As a consequence, the territory was transformed into a very unfriendly environment for tick development and feeding.

481

Proceedings of the Ninth International Conference on Urban Pests Matthew P. Davies, Carolin Pfeiffer, and William H Robinson (editors) 2017 Printed by Pureprint Group, Crowson House, Uckfield, East Sussex TN22 1PH UK

PRODUCTION, CHARACTERIZATION AND EFFICACY OF ETHYL CELLULOSE-BASED NANOCAPSULES CONTAINING IMIDACLOPRID FOR CONTROL OF MICROCEROTERMES DIVERSUS (SILVESTRI) (ISOPTERA: TERMITIDAE) UNDER LABORATORY CONDITIONS

1BEHZAD HABIBPOUR, 1REZA ABOLFARSI, AND 2ALI ASHRAFI 1Department of Plant Protection, College of Agriculture, Shahid Chamran University of Ahvaz, Iran. 2Department of Materials Engineering, College of Materials Engineering, Isfahan University of Technology, Iran.

Abstract Microcerotermes diversus (Silvestri) (Isoptera: Termitidae) is a major species of termites that attacks cellulosic materials and is an economically important pest, damaging buildings in Khuz- estan Province (Iran). Neonicotinoids, most notably imidacloprid, have recently been introduced for pest control programs. The main purpose of this study was to develop new techniques for termite con- trol by environmentally friendly formulations. Nanotechnology has become important in a number of fields during the past decade. The use of this new technology in the preparation of nanocapsules made of different materials in a slow and controlled release of drugs and toxins and increase stability within the nanocapsules has been recently reviewed. In the present study, we report for the first time the emul- sification synthesis of ethylcellulose-based nanocapsules containing imidacloprid. In this method, we prepared the polymer and the polymer solution (including: ethylcellulose, imidacloprid, benzene and ethanol) was added drop by drop to an aqueous solution (including: deionized water, nitric acid, sodium dodecyl sulphate and polyethylen glycol). Finally, produced ethylcellulose-based nanocapsules contain- ing imidacloprid and determined some of the quantitative and qualitative characteristics such as shape and size of the particles by Scanning Electron Microscope (SEM) using a secondary electron detector (SE) and Infrared spectroscopy (IR). The effects of ethylcellulose-based nanocapsules without imida- cloprid and those containing 50, 100, 500 or 1000 ppm imidacloprid were evaluated against M. diversus. The ethyl cellulose in this formulation did not induce lethal effects against the termite and showed feed- ing attractancy. Treated filter papers with this formulation caused a gradual increase in mortality during the 14-day trial. Our results suggest that ethyl cellulose-based nanocapsules containing imidacloprid could be an effective termiticide formulation.