Photobiont Associations in Co-Occurring Umbilicate Lichens with Contrasting Modes of Reproduction in Coastal Norway

The Lichenologist 48(5): 545–557 (2016) © British Lichen Society, 2016 doi:10.1017/S0024282916000232

Photobiont associations in co-occurring umbilicate lichens with contrasting modes of reproduction in coastal Norway

Geir HESTMARK, François LUTZONI and Jolanta MIADLIKOWSKA

Abstract: The identity and phylogenetic placement of photobionts associated with two lichen-forming fungi, Umbilicaria spodochroa and Lasallia pustulata were examined. These lichens commonly grow together in high abundance on coastal cliffs in Norway, Sweden and Finland. The mycobiont of U. spodochroa reproduces sexually through ascospores, and must find a suitable algal partner in the environment to re-establish the lichen symbiosis. Lasallia pustulata reproduces mainly vegetatively using symbiotic propagules (isidia) containing both symbiotic partners (photobiont and mycobiont). Based on DNA sequences of the internal transcribed spacer region (ITS) we detected seven haplotypes of the green-algal genus Trebouxia in 19 pairs of adjacent thalli of U. spodochroa and L. pustulata from five coastal localities in Norway. As expected, U. spodochroa associated with a higher diversity of photobionts (seven haplotypes) than the mostly asexually reproducing L. pustulata (four haplotypes). The latter was associated with the same haplotype in 15 of the 19 thalli sampled. Nine of the lichen pairs examined share the same algal haplotype, supporting the hypothesis that the mycobiont of U. spodochroa might associate with the photobiont ‘pirated’ from the abundant isidia produced by L. pustulata that are often scattered on the cliff surfaces. Up to six haplotypes of Trebouxia were found within a single sampling site, indicating a low level of specificity of both mycobionts for their algal partner. Most photobiont strains associated with species of Umbilicaria and Lasallia, including samples from this study, represent phylogenetically closely related taxa of Trebouxia grouped within a small number of main clades (Trebouxia sp., T. simplex/T. jamesii, and T. incrustata+T. gigantea). Three of the photobiont haplotypes were found only in U. spodochroa thalli. Key words: Lasallia pustulata, mutualism, photobiont guilds, phylogeny, symbiosis, Trebouxia, Umbilicaria spodochroa Accepted for publication 15 April 2016

Introduction the environment (Bowler & Rundel 1975; Hestmark 1990, 1991a, b, c, 1992a, b;Nash Many lichens can establish a new thallus from 2008). A potential source of such suitable algae small pieces (thallus fragmentation) or have is symbiotic propagules dispersed by other evolved special reproductive structures such as lichen species (Beck et al. 1998; Fedrowitz et al. sorediaorisidiathatallowthedispersalofboth 2011). Many lichen photobionts may not symbiotic partners simultaneously (Büdel & occur frequently in a free-living stage due to Scheidegger 2008). However, for numerous their long co-evolution with fungi in lichen lichens only the fungal partner seems to symbiosis (Ahmadjian 1988). The degree of disperse, either by sexually generated spores specificity in the symbiotic relationship or by asexual conidia, and in order to differs substantially between lichen taxa, from re-establish the symbiosis these species face the rare cases of reciprocal one-to-one specificity challenge of finding a suitable photobiont in (e.g. Otalora et al. 2010) or high specificity of mycobionts for a single or a small number of G. Hestmark: CEES, Center for Ecological and Evolu- photobionts (e.g., Paulsrud et al. 2000; Yahr tionary Synthesis, Department of Biosciences, et al. 2004; Lindgren et al. 2014; Muggia et al. University of Oslo, P.O. Box 1066 Blindern, 0316 2014; Nyati et al. 2014; O’Brien 2014; Leavitt Oslo, Norway. Email: [email protected] et al. 2015) to generalist mycobionts that are F. Lutzoni and J. Miadlikowska: Department of fl Biology, Duke University, Durham, NC 27708-90338, more exible and may associate with multiple USA. partners (Piercey-Normore & DePriest 2001;

Downloaded from http:/www.cambridge.org/core. Duke University Libraries, on 03 Oct 2016 at 15:15:00, subject to the Cambridge Core terms of use, available at http:/www.cambridge.org/core/terms. http://dx.doi.org/10.1017/S0024282916000232 546 THE LICHENOLOGIST Vol. 48

Piercey-Normore 2005; Guzow-Krzemińska the thallus (Fig. 2). Thalli typically start to 2006; Yahr et al. 2006; Hauk et al. 2007; produce isidia when they reach a minimum Nelsen & Gargas 2008; Muggia et al. 2013). size of 5 cm in diameter and the isidia In general, one would predict that a lichen- become more abundant as thalli grow forming fungus that needs to re-establish the older and larger (Hestmark 1992b). Very symbiotic state at every reproductive cycle large thalli may also develop apothecia and should be more flexible with regard to the reproduce sexually (Hestmark 1992b). photobionts it associates with than a lichen that Compared to ascospores, isidia are heavy and propagates the intact symbiosis. roll onto the rock surface adjacent to the The peltate lichen-forming fungus thallus of origin. Because of the common Umbilicaria spodochroa Hoffm. grows in high co-occurrence of these two lichens in the abundance on the rocky coasts of southern same habitats, L. pustulata could serve as a Norway. It reproduces sexually through potential ‘photobiont donor’ via its isidia ascospores from apothecia on the upper from which newly dispersed ascospores of surface, and the number of apothecia is U. spodochroa could obtain a compatible positively correlated with thallus size photobiont. The almost entirely sympatric (Ramstad & Hestmark 2001), a common ranges of the two species in Norway, with trait also observed in several other members that of U. spodochroa being slightly narrower of the genus Umbilicaria Hoffm. (Hestmark (Fig. 3), could indicate that prior establish- et al. 2004; Gregersen et al. 2006). To form a ment of L. pustulata in any given habitat lichen thallus, ascospores of U. spodochroa facilitates the successful colonization by must re-establish symbiosis de novo with U. spodochroa. The two co-occurring species suitable photobionts encountered in the seem to form an ecological guild, i.e. a group environment. Alternatively, new thalli could of species that exploit the same class of be formed through the growth of small environmental resources in the same way thallus fragments containing both symbionts, (Simberloff & Dayan 1991), in this case but neither fragmentation nor erosion of mediated by a photobiont as has been pre- thalli seems common in this particular species viously proposed for other groups of lichens (G. Hestmark, unpublished field observations). (Beck et al. 1998, 2002; Beck 1999; Rikkinen On the coastal cliffs of Scandinavia, et al. 2002; Rikkinen 2003; Werth 2012). U. spodochroa commonly grows in mixed Great progress in the identification of populations with another peltate lichen, lichen photobionts has been made over the Lasallia pustulata (L.) Mérat (Fig. 1), and past decade due to the application of competitive overgrowth interactions between molecular methods. Large scale phylogenetic the two species were demonstrated both analyses of ITS sequence data of the in situ and experimentally by Hestmark unicellular green algal genus Trebouxia (1997a). Although both species belong to the Puymaly, the most common lichen photo- same family, molecular phylogenetic studies biont, have revealed at least 25 main lineages indicate that they are not closely related (Muggia et al. 2014; O’Brien 2014). Recent within the Umbilicariaceae (Miadlikowska studies by Sadowska-Des et al. (2013, et al. 2006, 2014). The two species have 2014) demonstrated that the mycobiont of almost identical physiological niche respon- L. pustulata associates with several haplo- ses to light and temperature (Kappen et al. types of Trebouxia in Europe. Comparative 1996, 1997; Hestmark et al. 1997), and very data for U. spodochroa do not exist. Studies of similar population dynamics (Hestmark other Umbilicaria taxa indicate that, overall, 1997b, c, 2000; Sletvold & Hestmark 1999; members of this genus are generalists and Ramstad & Hestmark 2000). In contrast to exhibit substantial flexibility (i.e. low U. spodochroa, L. pustulata reproduces mainly specificity) with regard to their choice of through isidia, that is, packages of fungal Trebouxia photobionts (Romeike et al. 2002; hyphae and algae produced as coralloid or Jones et al. 2013). The aims of the present tree-like structures on the upper surface of study were to 1) evaluate whether U. spodochroa

FIG. 1. Mixed populations of Umbilicaria spodochroa (light grey) and Lasallia pustulata (olive-green) on coastal cliffs of southern Norway. Black dots on U. spodochroa are apothecia.

and L. pustulata share the same algal 3) Vestfold, Nøtterøy kommune, shore at Torød, symbionts (forming a photobiont-mediated 59°10'0"N, 10°26'26"E, leg. et det. G. Hestmark 2013; guild) through comparative study of ITS 4) Akershus, Frogn kommune, Drøbak, Torkildstranda, 59°38'46"N, 10°38'5"E, leg. et det. G. Hestmark 2013; sequences of the photobionts associated with and 5) Østfold, Hvaler, Kråkerøy, Ødegården, shore, these two species growing side by side in 59°9'9"N, 10°56'53"E, leg. et det. G. Hestmark 2011. several localities in Norway; 2) determine if With the exception of the ﬁrst locality, which is an old U. spodochroa, which mostly propagates only moraine located c. 60 m above sea level and 2 km from the sea, the remaining localities were all on sloping coastal the fungal partner, hosts a larger diversity of cliffs, 20–30 m above sea level. Altogether, photobionts of photobionts than L. pustulata, which propa- 19 pairs (38 specimens) of L. pustulata and U. spodochroa gates the intact symbiosis. were investigated (Table 1). The lichen material was deposited in the Oslo University Herbarium (O).

Materials and Methods DNA isolation, sequencing and sequence alignment Sample collection Approximately 0·5cm2 of each lichen thallus was Individual thalli (4–5cm in diam.) of Lasallia homogenized with 0·7 mm zirconium beads for 8 s in a pustulata and Umbilicaria spodochroa growing adjacent to mini-beadbeater. Genomic DNA was extracted using a each other (<1 cm between the thallus margins) were modified protocol from Zolan & Pukkila (1986) with 2% sampled in pairs from five different localities on the south sodium dodecyl sulphate (SDS) as extraction buffer. coast of Norway (Fig. 1 & Table 1): 1) Rogaland, Forsand Isolated DNA was resuspended in sterile water and kommune, Esmark-moraine, 58°54'14"N, 6°8'37"E, leg. stored at −20 °C. The ITS region of the photobionts et det. G. Hestmark 2007; 2) Vest-Agder, Flekkefjord was amplified from the lichen total genomic DNA using kommune, Hidre-heiene, W of old farm Håland, the following algal-specific and/or general primer 58°15'54"N, 6°34'48"E, leg. et det. G. Hestmark 2011; pairs (including newly developed primers shown in

TABLE 1. Photobiont diversity found in adjacent specimens (19 pairs) of Lasallia pustulata and Umbilicaria spodochroa in ﬁve localities in Norway. GenBank accession numbers are shown in parentheses. Asterisks indicate ITS sequences representing each haplotype in the phylogenetic analysis as shown in Fig. 4.

Pair Photobiont diversity of adjacent lichen species with Collection location number GenBank accession numbers† Lasallia pustulata Umbilicaria spodochroa Forsand 1 H1.1.1 (KU900251) H1.1.2 (KU900266) Drøbak 2 H1.2.3 (KU900252)* H1.2.4 (KU900267) 3 H1.3.5 (KU900253) H1.3.6 (KU900268) 4 H1.4.7 (KU900254) H2.4.8 (KU900275)* Hvaler 5 H3.5.9 (KU900276) H3.5.10 (KU900277) 6 H1.6.11 (KU900255) H1.6.12 (KU900269) 7 H1.7.13 (KU900256) H1.7.14 (KU900270) 8 H1.8.15 (KU900257) H4.8.16 (KU900279) 9 H1.9.17 (KU900258) H4.9.18 (KU900280) Flekkefjord 10 H5.10.19 (KU900281)* H5.10.20 (KU900282)* 11 H2.11.21 (KU900273) H6.11.22 (KU900283)* 12 H1.12.23 (KU900259) H3.12.24 (KU900278)* 13 H1.13.25 (KU900260) H6.13.26 (KU900284) 14 H2.14.27 (KU900274) H7.14.28 (KU900288)* Nøtterøy 15 H1.15.29 (KU900261) H6.15.30 (KU900285) 16 H1.16.31 (KU900262) H1.16.32 (KU900271) 17 H1.17.33 (KU900263) H6.17.34 (KU900286) 18 H1.18.35 (KU900264) H1.18.36 (KU900272) 19 H1.19.37 (KU900265) H6.19.38 (KU900287) †Key to information given for each photobiont. Three numbers are given for each haplotype; the ﬁrst = the unique haplotype number also indicated in different colours (H1 -7), the second = the pair number (1 -19), the third = the number of the individual thallus (1 -38). For instance H1.1.1 = Haplotype 1, pair number 1, thallus number 1.

parentheses): nrITSaJOFOR2 and nrITSaJOREV2 Foster City, CA) utilizing a 22 s injection time and a (Sadowska-Des et al. 2013); nrITSSaJOFOR2 and 50 cm capillary array, at the Sequencing and Genomic nrITS4T (Kroken & Taylor 2000); nrITSSaJOFOR2 Technologies Shared Resource core facility, part of the and nrITS4 (White et al. 1990); nrITSSaJOFOR2 Duke Center for Genomic and Computational Biology. and Treb_1R (5’ACCTCAGGTCGAAAGCCAAA3’); Sequences were assembled and edited using the nrITS1T (Kroken & Taylor 2000) and Treb_3R software package Sequencher™ 5.1 (Gene Codes (5’CTGACCTCAGGTCGAAAGCCAA3’). All PCR Corporation, Ann Arbor, MI, USA) and subjected to products were cleaned with ExoSAP (Affymetrix Inc., BLAST searches (Wheeler et al. 2007) to confirm the CA, USA) following the manufacturer’s protocol. algal origin of each sequence fragment. GenBank Sequencing was carried out in 10 µl reactions using: accession numbers for the 38 ITS sequences generated 1 µl primer (10 µM), 1 µl purified PCR product, 0·75 µl in this study are provided in Table 1. These ITS BigDye (BigDye Terminator Cycle sequencing sequences represent seven haplotypes defined by using a kit, ABIPRISM version 3.1; PerkinElmer, Applied 100% similarity criterion in Sequencher. Biosystems, Foster City, CA), 3·25 µl BigDye buffer, and Single representative sequences for each of the seven 4 µl double-distilled water. Clean up reactions were haplotypes were added to an ITS reference data set from performed over Sephadex G-50 DNA grade columns, GenBank, that we assembled based on the Trebouxia eluting in water. Samples were then injected directly in phylogeny from the study by Muggia et al. (2014). an ABI 3730xl DNA analyzer (PE Applied Biosystems, The exception was Haplotype 5 which was represented

consider bootstrap values ≥70% as strong support. The NEXUS ﬁle and the resulting RAxML phylogeny were deposited in TreeBASE (accession number http://purl.org/ phylo/treebase/phylows/study/TB2:S19031).

Results The photobionts associated with 19 pairs of Lasallia pustulata-Umbilicaria spodochroa from ﬁve localities in Norway are represented by seven ITS haplotypes (hereafter referred to as H1–7) of Trebouxia algae (Table 1 & Fig. 4). Most haplotypes differed from each other substantially (i.e. by 10–37 nucleotide substitutions), except for two sets of haplotypes (H6/H7 and H2/H3) which differed only by one and two nucleotide substitutions, respec- tively. The most common haplotype (H1) was foundin22of38thalliexamined(57%),of which 15 were L. pustulata and seven were U. spodochroa (Table 1). This haplotype was present at all ﬁve study localities. Three of

FIG. 2. SEM of isidium on the thallus of L. pustulata:an the remaining haplotypes (H2, H3, and H6) asexually generated coralloid propagule that includes were less common (three to ﬁve occurrences) the fungus and alga in bundles. Scale = 0·5 mm. and appeared in two sites only, whereas three others (H4, H5 and H7) were rare and restricted to a single locality (Table 1). by two sequences due to a few nucleotide uncertainties The highest diversity of photobionts was in one of them. The data matrix included multiple found in Flekkefjord, where six of the seven representatives of all major lineages and selected potential species (see also O’Brien 2014), as well as the haplotypes were present. In the remaining existing sequences of photobionts from Lasallia and sites (excluding Forsand because only one Umbilicaria (Romeike et al. 2002; Jones et al. 2013; pair of lichens was sampled) up to three Sadowska-Des et al. 2013, 2014) for a total of 221 OTUs haplotypes of Trebouxia were detected. (Fig. 4). Sequences were aligned manually using Mac- In about half of the lichen pairs examined Clade 4.08 (Maddison & Maddison 2005), and ambiguously aligned regions (sensu Lutzoni et al. 2000), (9 of 19), adjacent thalli of L. pustulata and were excluded from the ﬁrst set of phylogenetic analyses. U. spodochroa shared the same photobiont The maximum likelihood analyses on 429 characters haplotype, which was H1 in seven of these were performed using RAxML-HPC2 version 7.2.8 nine pairs (Table 1). As expected, the mostly (Stamatakis 2006; Stamatakis et al. 2008) as imple- mented on the CIPRES portal (Miller et al. 2010). sexually reproducing U. spodochroa Optimal tree and bootstrap searches were conducted was found associated with a higher diversity with the rapid hill-climbing algorithm for 1000 replicates of photobionts (seven haplotypes) than with the GTRGAMMA substitution model (Rodríguez the mostly asexually reproducing L. pustulata et al. 1990) estimated for two partitions (ITS1+ITS2, (four haplotypes), which was found to be and 5.8S). The second set of analyses was conducted on an extended data set with the re-inclusion of associated with the same haplotype (H1) in four ambiguous regions that were coded using 15 of the 19 thalli sampled. Three haplotypes PICS-Ord (Lücking et al. 2011), giving a total of of Trebouxia (H4, H6 and H7) were found 545 characters (426 nucleotides and 119 recoded char- only in U. spodochroa thalli. acters). Trebouxia galapagensis (Hildreth & Ahmadjian) Gärtner (AJ249567) and Trebouxia sp. from Ramalina The ITS phylogeny for Trebouxia (Fig. 4) peruviana Ach. (AY842266) were used to root the inferred for this study is largely in agreement phylogenies (Muggia et al. 2014; O’Brien 2014). We with previous published phylogenies (e.g.

FIG. 3. Distribution maps of U. spodochroa (A) and L. pustulata (B) in Norway. Stars and crosses indicate collections without exact coordinates, localized to county. Grey triangles indicate sample sites in this study, from left to right: Forsand, Flekkefjord, Torød, Drøbak, Hvaler. Maps generated from the lichen database Norsk Lavdatabase of the Natural History Museum, University of Oslo courtesy of E. Timdal.

Muggia et al. 2014; O’Brien 2014). The (2014). This might be due to the more con- addition of coded characters greatly servative approach in delimiting ambiguously improved the resolution and support in some aligned regions, which were excluded from parts of the tree, especially for relationships our phylogenetic analyses since only four among the most similar sequences. However, regions were reintegrated as coded char- as in previous phylogenies, the backbone acters. In contrast to Muggia et al. (2014), remained poorly supported (Muggia et al. sequences in the T. simplex/jamesii clade were 2014; O’Brien 2014). No conﬂicting rela- resolved in two groups, one of which also tionship was detected between the tree based included members of Trebouxia “URa2”. on 545 characters (i.e. 426 nucleotides and However, none of these clades received 119 PICS-Ord characters derived from the strong bootstrap support. We also found that recoded ambiguously aligned regions; Fig. 4) T. gigantea (Hildreth & Ahmadjian) Gärtner and the phylogeny based on 429 characters was nested within T. incrustata Ahmadjian (nucleotides only and ambiguously aligned ex Gärtner, and sequences of those two regions excluded; tree not shown). Thirty- taxa were recovered within multiple well- four internodes weakly supported in the supported monophyletic groups (Fig. 4). phylogeny based on nucleotide characters Most Trebouxia sequences from our only, received bootstrap support above 70% sampling sites are nested within two main with the addition of PICS-Ord characters, clades corresponding to the poorly supported but the opposite was true for ﬁve internodes; T. simplex/T. jamesii complex (H1, H2, and 41 branches were highly supported by both H3) and the T. incrustata + T. gigantea group phylogenetic analyses. Overall, bootstrap (H6 and H7) that received high bootstrap support was lower in our phylogeny com- support in our study (Fig. 4). Both clades pared to the results from Muggia et al. contain photobionts associated with members

of Umbilicaria or Lasallia such as U. antarctica the only available source of photobiont for Frey & I. M. Lamb in the T. incrustata clade U. spodochroa. The fact that in many cases and L. pustulata in the T. simplex/T. jamesii U. spodochroa utilizes photobionts other clade from previous studies (e.g., Sadowska- than those present in adjacent L. pustulata Des et al. 2013, 2014; Romeike et al. 2002). (especially H6; Table 1) suggests that the Haplotype 4, found associated only with former species does not entirely depend on U. spodochroa in our study, was recovered the latter for successful colonization and in a well-supported monophyletic clade of establishment. The overlap in geographical Trebouxia strains associated exclusively with range of the two species is thus less likely to L. pustulata in previous studies. This clade be explained solely by the mutual depen- might represent a new Trebouxia species dence on the same photobiont, and perhaps (Trebouxia sp.inFig.4).Haplotype5was involves other environmental and/or repro- recovered as a distinct, well-supported lineage ductive factors. Ecological and evolutionary which could also represent a new Trebouxia theory suggests that competitive exclusion species but its relationship to other Trebouxia should lead to the loss of one or other of these lineages is poorly supported (Fig. 4). A revised species due to the similarity of their require- classification of the diversity that has been ments (MacArthur & Levins 1967; Abrams documented within the genus Trebouxia 1983; Abrams & Rueffler 2009). It is is urgently needed and has been advocated (e.g. therefore possible that the co-occurring Leavitt et al. 2013, 2015) in order to identify L. pustulata and U. spodochroa select different lichen photobionts and better understand photobionts to achieve some degree of patterns of associations among symbionts. niche-separation, which is driven in part Overall, the phylogenetic placements of our by their contrasting mode of reproduction. isolates were in agreement with nucleotide To what degree some of the detected BLAST results based on the sequences Trebouxia haplotypes occur in a free-living deposited in GenBank. For example, H6 and state or in association with other lichen species H7 share an 84-nucleotide insertion (excluded in the same habitat has yet to be examined. from ML analyses) in ITS1 of T. incrustata, Overall, the most widespread, common the highest BLAST hit (100% query cover and shared Trebouxia was represented by and 99% identity) being in the sequence Haplotype 1 (H1), which also associates more of a photobiont found in other lichens frequently with L. pustulata (79%) than with (e.g., Protoparmeliopsis muralis (Schreb.) U. spodochroa (37%). The same Trebouxia M. Choisy and Xanthoparmelia tinctina haplotype was found in approximately one (Maheu & A. Gillet) Hale). third of the 44 specimens of L. pustulata collected across Europe by Sadowska-Des et al. (2013). Whether an association with a particular photobiont haplotype reflects some Discussion degree of physiological adaptation of the Our study demonstrates that the two fungus to particular local habitats or the co-occurring lichen species Lasallia pustulata availability/ frequency of compatible photo- and Umbilicaria spodochroa often share the bionts, remains unknown. In L. pustulata, same photobiont within a single site and Sadowska-Des et al. (2013) found hardly across different localities, and might there- any genetic variation in several loci of fore form a photobiont-mediated guild sensu the mycobiont sampled within a broad Rikkinen (2003). It is also very likely that geographical range in Europe, suggesting that U. spodochroa ‘pirates’ algal cells from isidia there is no correlation between mycobiont- of L. pustulata, as corroborated by the sharing photobiont haplotypes. Trebouxia Haplotype 1 of the rare Haplotypes 3 in Hvaler and 5 in has only rarely been recorded from other Flekkefjord. However, empirical evidence lichen species (e.g. Cetraria aculeata (Schreb.) would be needed from re-lichenization Fr.; Fernandez-Mendoza et al. 2011; where, for example, isidia of L. pustulata are Domaschke et al. 2013). This may, however,

T. galapagensis AJ249567 T. R6 (Ramalina peruviana) AY842266 T. higginsiae AJ249574 T. (Usnea filipendula) AJ249573 * T. (Parmotrema tinctorum) AB177833 T. (Parmotrema tinctorum) AB177835 T. corticola T. corticola (Parmotrema tinctorum) AB177819 * * T. clade I (L1764 Tephromela atra) KJ754201 * T. clade I (culture L1831 Tephromela atra)KJ754202 Trebouxia clade I T. clade I (L1204 Tephromela atra) KJ754198 0.05 length units T. sp.4b(014H12Lasallia pustulata)KJ623940 * T. sp.4c(017H37Lasallia pustulata) KJ623943 * T. sp. 4a (010 H41 Lasallia pustulata) KJ623936 T. sp. 4a (012 H33 Lasallia pustulata) KJ623938 T. sp.3(009H20Lasallia pustulata) KJ623935 * T. sp. 2 (008 H21 Lasallia pustulata) KJ623934 T. sp. 1 (001 H47 Lasallia pustulata) KJ623927 T. sp. (G0116 D14 Lasallia pustulata) JX474337 * T. sp. (W0105 D16 Lasallia pustulata) JX474359 T. sp. (G0910 D15 Lasallia pustulata) JX474358 T. sp. (P0206 D13 Lasallia pustulata) JX474346 T. sp. (P0101 D12 Lasallia pustulata) JX474327 Trebouxia sp. T. H4.8.16 (Umbilicaria spodochroa)N=2 T. sp. (N0201 D10 Lasallia pustulata)JX474328 T. sp. (W0131 D11 Lasallia pustulata) JX474360 T. simplex/jamesii (P0309 D3 Lasallia pustulata) JX474341 * T. H1.2.3 (Lasallia pustulata)N=22 * T. simplex/jamesii (Lasallia pustulata) JX474357 T. simplex/jamesii (H0502 D2 Lasallia pustulata) JX474357 T. simplex/jamesii (Lasallia pustulata) JX474334 T. simplex/jamesii (Lasallia pustulata) JX474349 * T. H3.12.24 (Umbilicaria spodochroa)N=2 * T. simplex/jamesii (Cetraria aculeata) GQ375338 T. simplex/jamesii FJ626736 T. simplex/jamesii (L1929 Tephromela atra) KJ754234 T. simplex/jamesii (G0507 D7 Lasallia pustulata) JX474348 * T. simplex/jamesii (L1134 Tephromela sp.) KJ754219 * T. simplex/jamesii (L1138 Tephromela atra) KJ754221 T. simplex/jamesii (L1136 Tephromela atra) KJ754220 T. sp. (S0401 D8 Lasallia pustulata) JX474335 T. simplex/jamesii (N0701 D6 Lasallia pustulata) JX474331 T. simplex/jamesii (Cetraria islandica) FM945345 T. simplex/jamesii (Lecidea cancriformis) JN204809 T. simplex/jamesii (Cetraria aculeata) GQ375363 T. simplex/jamesii T. simplex/jamesii (Cetraria aculeata)GQ375355 T. simplex/jamesii (Cetraria aculeata) GQ375323 T. simplex/jamesii (Lecidea cancriformis) JX036166 T. simplex/jamesii (Tephromela atra) EU551513 T. simplex/jamesii (Cetraria aculeata)GQ375320 T. simplex/jamesii (Lecanora swartzii) DQ166620 T. simplex/jamesii (A3 Umbilicaria antarctica) AJ431574 T. simplex/jamesii (Lecanora rupicola) DQ166600 T. simplex/jamesii (Tephromela atra)EU551541 T. H2.4.8 (Umbilicaria spodochroa)N=3 T. simplex/jamesii (Tephromela atra)EU551512 T. simplex/jamesii (Tephromela atra)EU551542 T. simplex/jamesii (Tephromela atra)EU551543 T. simplex/jamesii (Lecidea auriculata) JN204793 T. simplex/jamesii (Carbonea vorticosa) JN204767 Tr. simplex/jamesii (Lecidea obluridana) JN204768 T. simplex/jamesii (Cetraria aculeata) GQ375319 T. jamesii “letharii” (Letharia vulpina) AF242464 * * T. jamesii “letharii” (Letharia vulpina) AF242460 T. jamesii “letharii” T. jamesii “letharii” (Letharia vulpina)AF242463 T. “URa1" (Lecidea cancriformis) JN204749 T. “URa1" (Lecidea cancriformis) JN204811 T. “URa1" (Lecidea cancriformis) JN204771 Trebouxia “URa1" T. “URa1" (Lecidea cancriformis) JN204812 T. clade II (L1177 Tephromela atra) KJ754203 * T. uncult. (Physcia tenella) EU717913 T. uncult. (Physcia tenella)EU717912 uncult.Trebouxia T. gelatinosa (Xanthomendoza sp.) AM159213 * T. gelatinosa (Flavoparmelia subrudecta) AJ249575 * T. gelatinosa (Teloschistes chrysophthalmus)FJ792802 T. gelatinosa (Physcia semipinnata) AJ293787 T. gelatinosa * T. gelatinosa (Flavoparmelia caperata)AJ249568 T. gelatinosa (Flavoparmelia caperata)Z68698 T. gelatinosa (Flavoparmelia caperata)Z68697 T. clade III (L1199 Tephromela atra)KJ754205 T. impressa (Phaeophyscia orbicularis) AF389931 Trebouxia ITS T. impressa (Physcia adscendens) AJ293773 * T. impressa (Physconia distorta) AF389926 RAxML phylogeny T. impressa (Physconia distorta) AF389927 T. impressa (Physcia adscendens) AJ293771 221 OTUs; 545 char. T. impressa (Lecidea andersonii) JN204778 T. impressa (Lecidella carpatica) JN204761 T. impressa (426 nuc. and 119 rec.) T. impressa (Lecanora fuscobrunnea) JN204800 T. impressa (Lecidea atrobrunnea)JN204759 T. impressa (Physcia caesia)AF389918 T. impressa (Physcia aipolia) AJ293775 T. impressa (Phaeophyscia orbicularis) AF389930 T. impressa (Rinodina capensis)AJ293793 T. clade IV (L1141 Tephromela atra)KJ754245 T. clade IV (Boreoplaca ultrafrigida)HQ026171 * T. clade IV (L1389 Tephromela atra) KJ754242 T. clade IV (Boreoplaca ultrafrigida) HQ026180 Trebouxia clade IV T. clade IV (Boreoplaca ultrafrigida) HQ026178 T. clade IV (Boreoplaca ultrafrigida) HQ026182 T. clade IV (Boreoplaca ultrafrigida) HQ026167 T. ‘TR9” (Ramalina farinacea) GU252182 * T. “TR9" (Ramalina farinacea) GU252197 Trebouxia “TR9" T. “TR9" (Ramalina farinacea) GU252200 * T. “TR1" (Ramalina farinacea)GU252195 * T. “TR1" (Ramalina farinacea)GU252173 T. ‘TR1" (Ramalina farinacea) GU252178 * T. “TR1" (Tephromela atra) EU551536 T. “TR1" (Lecanora rupicola) DQ166608 T. “TR1" (Lecanora cenisia) EU551525 Trebouxia “TR1" * T. “TR1" (Tephromela atra) EU551527 T. “TR1" (Tephromela atra) EU551546 T. “TR1" (Tephromela atra) EU551547 T. “TR1" (Ramalina siliquosa)FJ792799 T. “TR1" (Ramalina farinacea) GU252202 T. “TR1" (culture L1660 Tephromela atra) KJ754297

(Fig. continued )

T. “URa2" (Rhizoplaca macleanii) JN204790 T. simplex/jamesii (Rhizoplaca macleanii) JX036231 T. simplex/jamesii (Buellia frigida) JX036213 T. simplex/jamesii (Austrolecia sp.) JX036208 T. simplex/jamesii (Lecidella greenii)JX036168 T. “URa2" (Lecidea andersonii) JN204772 T. simplex/jamesii (lichen sp.) JX036160 T. simplex/jamesii (Buellia frigida) JX036272 T. “URa2" (Lecidea andersonii) JN204777 T. simplex/jamesii (Austrolecia sp.) JX036210 Trebouxia “URa2” T. simplex/jamesii (Rhizoplaca macleanii) JX036259 T. simplex/jamesii (Rhizoplaca sp.) JX036240 + T. sp. (D11 Umbilicaria antarctica) AJ431580 T. simplex/jamesii T. simplex/jamesii(Austrolecia sp.) JX036194 T. simplex/jamesii (Sarcogyne privigna) JX036211 T. simplex/jamesii (Austrolecia sp.) JX036180 T. “URa2" (Lecidea andersonii) JN204779 T. simplex/jamesii (Lecanora sp.) JX036217 T. “URa2" (Lecanora physciella) JN204756 T. “URa2" (Lecidea greenii) JN204782 T. “URa2" (Lecidea greenii) JN204735 T. “URa2" (Lecidea spilei) JN204776 T. “sp. 1" (Lecanora lojkaeana) DQ166584 * T. “sp. 1" (Lecanora rupicola) DQ166610 T. “sp.1" (Ri1 Rimularia insularis) AF534386 T. “sp. 1" (Xanthoria karrooensis) AM159216 Trebouxia “sp.1" T. “sp. 1" (Lecanora rupicola) DQ166587 T. “sp. 1" (L1394 Tephromela nashii) KJ754311 T. “sp. 1" (Tephromela atra) EU551523 T. arboricola/decolorans (Chaenotheca phaeocephala) AF453259 T. arboricola/decolorans (Xanthomendoza hasseana) AM159210 * T. arboricola/decolorans (Xanthoria parietina) AJ969545 T. arboricola/decolorans (L1107 Tephromela atra) KJ754236 T. arboricola/decolorans (Xanthoria parietina) AJ969562 T. arboricola/decolorans (Seirophora villosa) FJ792797 T. arboricola/decolorans (Xanthoria parietina) AJ007387 T. arboricola/decolorans (Pleurosticta acetabulum) AJ249482 T. arboricola/decolorans (Xanthoria parietina) AJ970889 T. arboricola/decolorans T. arboricola/decolorans (Xanthoria parietina) AJ969556 T. arboricola/decolorans (L1308 Tephromela atra) KJ754238 T. arboricola/decolorans (Xanthoria parietina) AJ969597 T. arboricola/decolorans (Xanthoria parietina)AJ969598 T. arboricola/decolorans (Xanthoria parietina)AJ969594 T. arboricola/decolorans (Anaptychia ciliaris) AF389916 T. arboricola/decolorans (Xanthoria parietina)AJ969549 T. arboricola/decolorans (Anaptychia ciliaris) AF389917 T. “muralis I” (Lecidella stigmatea) JN204760 * T. “muralis I” (Protoparmeliopsis muralis) AJ293782 T. “muralis I” (Protoparmeliopsis muralis) DQ133481 Trebouxia “muralis T. “muralis I” (Protoparmeliopsis muralis) DQ133476 I" T. “muralis I” (Protoparmeliopsis muralis) DQ133500 T. assymetrica (Lecidella stigmatea) JN204764 T. asymmetrica (Diploschistes albescens) AF345889 * T. asymmetrica (Diploschistes diacapsis) AJ249565 T. asymmetrica (Buellia zoharyi) AJ293784 T. assymetrica T. asymmetrica (Toninia sedifolia) AF344177 T. asymmetrica (Fulgensia fulgida) AF344176 T. asymmetrica (Fulgensia fulgida) AF344175 T. sp. (C18 Umbilicaria decussata) AJ431583 * T. clade V (culture L1541) KJ754248 T. clade V (Lecanora rupicola) DQ166603 Trebouxia clade V * T. “BMP1" (Xanthoparmelia aff. cumberlandia) KF026242 * T. “BMP1" (Xanthoparmelia aff. norchlorochroa) KF026233 Trebouxia “BMP1" * T. “BMP1" (Xanthoparmelia aff. coloradoensis) KF026251 T. “URa3" (Lecanora rupicola) DQ166611 T. “URa3" (Lecanora rupicola)DQ166595 * T. “URa3" (Carbonea vorticosa) JN204747 T. “URa3" (Lecidea cancriformis) JN204841 Trebouxia “URa3" T. “URa3" (Lecidea fuscoatra) JN204765 T. “URa3" (Lecidea andersonii) JN204826 * T. H5.10.20 (Umbilicaria spodochroa) T. H5.10.19 (Lasallia pustulata) Trebouxia sp. * T. showmanii FJ626734 T. showmanii (Letharia vulpina) AF242470 T. showmanii * T. incrustata (BMP2 Xanthoparmelia aff. cumberlandia) KF026276 T. incrustata (BMP2 Xanthoparmelia aff. cumberlandia) KF026223 T. incrustata (BMP2) T. gigantea (Caloplaca cerina) AJ249577 * T. gigantea (Letharia vulpina) AF242468 T. gigantea T. gigantea (Rinodinella controversa)AJ293790 T. incrustata (Umbilicaria antarctica) AJ431577 * T. incrustata (Umbilicaria antarctica) AJ431578 T. incrustata * T. incrustata (Buellia georgei) AJ293783 T. incrustata (Rinodina tunicata) AJ293789 + T. incrustata (Umbilicaria antarctica) AJ431591 T. incrustata (Umbilicaria antarctica) AJ431579 T. gigantea T. incrustata (BMP5 Xanthoparmelia aff. coloradoensis) KF026226 T. incrustata (BMP5 Xanthoparmelia aff. chlorochroa) KF026245 T. incrustata (BMP5 Xanthoparmelia aff. coloradoensis) KF026241 T. incrustata (BMP5 Xanthoparmelia aff. chlorochroa) KF026231 T. incrustata (BMP5 Xanthoparmelia aff. cumberlandia) KF026274 T. incrustata (BMP5) T. incrustata (BMP5 Xanthoparmelia aff. coloradoensis) KF026237 T. incrustata (BMP5 Xanthoparmelia aff. cumberlandia) KF026255 T. incrustata (BMP5 Xanthoparmelia aff. coloradoensis) KF026252 T. incrustata (BMP3 Xanthoparmelia aff. chlorochroa) KF026248 * T. incrustata (BMP3 Xanthoparmelia aff. chlorochroa) KF026225 T. incrustata (BMP3) T. incrustata (BMP4 Xanthoparmelia aff. chlorochroa) KF026236 T. incrustata (BMP4 Xanthoparmelia aff. coloradoensis)KF026278 * T. incrustata (BMP4 Xanthoparmelia aff. coloradoensis) KF026238 T. incrustata (BMP4) T. incrustata (BMP4 Xanthoparmelia aff. chlorochroa) KF026249 * T. H7.14.28 (Umbilicaria spodochroa) * T. incrustata (culture L1828) KJ754253 T. incrustata (Rinodina atrocinerea) AJ293791 T. incrustata (Lecanora dispersa) AJ293795 T. incrustata (Xanthoparmelia conspersa) AM920667 T. H6.11.22 (Umbilicaria spodochroa)N=5 T. incrustata (Lecidea fuscoatra) AM92066 T. incrustata (Xanthoparmelia tinctina) FJ792801

(For legend see following page)

indicate the under-sampling of certain pattern we observed in the two umbilicate environments, including coastal cliff habitats lichen species sampled. In the genus in Norway, rather than its uniqueness. Umbilicaria this strategy is not restricted to The taxonomic identity of this strain sexually reproducing species but seems to remains unclear as two names, T. angustilobata occur also in about one third of its species that (del Campo et al. 2010) and T. jamesii reproduce mainly by specialized asexual fungal (e.g., Domaschke et al. 2013), are being used, propagules called thalloconidia seceded and the phylogenetic placement of Haplotype 1 from the lower cortex, which are strictly within a broadly defined T. simplex/T. jamesii fungal (Hestmark 1990, 1991a, b, c,1992a). complex is not conclusive as it has been placed Numerous photobionts (based on the ITS) where boundaries among species are not well and diverse sharing patterns were found defined and supported. in four thalloconidia-producing species Our study confirms the capacity of (U. antarctica, U. decussata (Vill.) Zahlbr., L. pustulata to utilize several different strains of U. kappenii Sancho et al.andU. umbilicarioides Trebouxia. This was earlier demonstrated by (Stein) Krog & Swinscow) in the Antarctic Sadowska-Des et al. (2013), but the genetic (Romeike et al.2002).Similarly,anumberof variation we detected among the photobionts Trebouxia strains associated with U. aprina was lower, perhaps due to the more limited Nyl. and U. decussata were reported from sampling area restricted to the southern coast several localities in Antarctica (Jones et al. of Norway. Umbilicaria spodochroa seems to 2013). Somewhat in contrast to these results, accept a wider range of algal partners (seven another study of U. aprina in Antarctica haplotypes) compared with L. pustulata (four revealed only a single algal strain in 19 thalli haplotypes). This pattern may be explained (Pérez-Ortega et al. 2012), but this may be due partly by the greater likelihood of algal to the restricted geographical sampling in that switches in U. spodochroa because a new thallus particular study. The fact that different is often re-established de novo through ascos- algae were detected in thalli of L. pustulata pores by the mycobiont encountering a sui- supports previous studies reporting that even table algal partner in the environment, in a mostly clonally reproducing species compared to L. pustulata which transmits its with propagules containing both partners, photobiont from one generation to the next diverse symbiotic associations occur at various using isidia. In these circumstances, it might spatial scales (e.g. Piercey-Normore 2009; Dal be advantageous for a sexually reproducing Grande et al. 2012; Sadowska-Des et al. 2013). species, which is required to re-associate with Our results show that U. spodochroa a new photobiont at each generation, to associates with three Trebouxia haplotypes be a generalist when selecting a ‘suitable (H4, H6 and H7) not found in the thalli of photobiont’ especially when competing with the neighbouring L. pustulata. The H4 strain a mainly clonally reproducing species that was, however, previously reported from propagates the symbiosis intact. This is the L. pustulata (Sadowska-Des et al. 2013)

FIG. 4. Phylogenetic placement of seven haplotypes (H1–H7) of photobionts sampled from adjacent thalli of Lasallia pustulata and Umbilicaria spodochroa in Norway, in a broad phylogenetic context of the Trebouxia phylogeny based on ITS sequences (545 characters including 426 nucleotide sites and 119 recoded PICS-Ord characters) for 221 OTUs. See Table 1 for the sampling design and abbreviations used. Reference sequences were selected from Muggia et al. (2014), Sadowska-Des et al. (2013, 2014) and Romeike et al. (2002). The phylogeny was rooted with T. galapagensis AJ249567 and Trebouxia AY842266 following Muggia et al. (2014) and O’Brien (2014). Arrows indicate sequences of photobionts from L. pustulata, U. spodochroa (published – white arrows pointing to the left; from this study – black arrows), U. antarctica (grey arrows) and U. decussata (white arrow pointing to the right). Clades containing Trebouxia sequences from this study are delimited by grey boxes. Clade annotations follow Muggia et al. (2014). Thick branches indicate bootstrap support ≥70%. Stars indicate internodes that received high bootstrap support (>70%) in the maximum likelihood analysis based on nucleotides only (i.e. without PICS- Ord characters). Haplotype 5 (H5) is represented by two sequences due to a few nucleotide uncertainties in one of the sequences.

and H7 is known from other saxicolous photobiont transmission within populations lichens such as Lecanora dispersa (Pers.) of a lichen symbiosis. Molecular Ecology 21: Sommerf. (UTEX 784), and Tephromela atra 3159–3172. del Campo, E. M., Hoyo, A., Casano, L. M., (DC.) Hafellner (Muggia et al. 2014). Martinez-Alberola, F. & Barrena, E. (2010) A rapid Overall, Trebouxia strains associated with and cost-efficient DMSO-based method isolating Umbilicaria/Lasallia are not spread evenly DNA from cultured lichen photobionts. Taxon 59: across the ITS phylogeny but cluster in a few 588–591. Domaschke, S., Vivas, M., Sancho, L. G. & Printzen, C. lineages (Trebouxia sp., T. simplex/T. jamesii, (2013) Ecophysiology and genetic structure of polar and T. incrustata+T. gigantea), and might versus temperate populations of the lichen Cetraria include new Trebouxia species. Having a aculeata. Oecologia 173: 699–709. more stable phylogeny for Trebouxia will Fedrowitz, K., Kaasalainen, U. & Rikkinen, J. (2011) not only help in establishing boundaries Genotype variability of Nostoc symbionts associated with three epiphytic Nephroma species in a boreal among potential species and reveal their forest landscape. Bryologist 114: 220–230. phylogenetic relationships, but will also Fernandez-Mendoza, F., Domaschke, S., Garcia, M. A., facilitate the taxonomic revision of the genus Jordan, P., Martin, M. P. & Printzen, C. (2011) and allow a more reliable identification Population structure of mycobionts and photobionts of the most common lichen photobiont. of the widespread lichen Cetraria aculeata. Molecular Ecology 20: 1208–1232. Gregersen, I. K., Hegseth, M. N., Hestmark, G., The authors are grateful to Brendan Hodkinson for Kongsbak, R. H. & Moe, T. F. (2006) The his assistance in the installation and implementation of relationship between thallus mass, surface area and PICS-Ord. Funding for this study came from a research apothecium production in Umbilicaria rigida. Nova sabbatical grant from the University of Oslo to GH. Hedwigia 82: 115–121. Guzow-Krzemińska, B. (2006) Photobiont flexibility in the lichen Protoparmeliopsis muralis as revealed by ITS rDNA analyses. Lichenologist 38: 469–476. Hauk, M., Helms, G. & Friedl, T. (2007) Photobiont R EFERENCES selectivity in the epiphytic lichens Hypogymnia physodes Abrams, P. (1983) The theory of limiting similarity. and Lecanora conizaeoides. Lichenologist 39: 195–204. Annual Review of Ecology, Evolution, and Systematics Hestmark, G. (1990) Thalloconidia in the genus 14: 359–376. Umbilicaria. Nordic Journal of Botany 9: 547–574. Abrams, P. & Rueffler, C. (2009) Coexistence and Hestmark,G.(1991a) Teleomorph-anamorph relationships limiting similarity of consumer species competing in Umbilicaria.I.Makingtheconnections.Lichenologist for a linear array of resources. Ecology 90: 23: 343–359. 812–822. Hestmark, G. (1991b) Teleomorph-anamorph relation- Ahmadjian, V. (1988) The lichen alga Trebouxia: does it ships in Umbilicaria. II. Patterns in propagative occur free-living? Plant Systematics and Evolution morph production. Lichenologist 23: 361–380. 158: 243–247. Hestmark, G. (1991c) To sex or not to sex...structures and Beck, A. (1999) Photobiont inventory of a lichen strategies of reproduction in the family Umbilicariaceae community growing on heavy-metal-rich rock. (Lecanorales, Ascomycetes). Sommerfeltia Supplement 3: Lichenologist 31: 501–510. 1–47. Beck, A., Friedl, T. & Rambold, G. (1998) Selectivity of Hestmark, G. (1992a) Conidiogenesis in five species of photobiont choice in a defined lichen community: Umbilicaria. Mycological Research 96: 1033–1043. inferences from cultural and molecular studies. New Hestmark, G. (1992b) Sex, size, competition and escape – Phytologist 139: 709–720. strategies of reproduction and dispersal in Lasallia Beck, A., Kasalicky, T. & Rambold, G. (2002) The myco- pustulata (Umbilicariaceae, Ascomycetes). Oecologia 92: photobiontal selection in a Mediterranean cryptogam 305–312. community with Fulgensia fulgida and considerations on Hestmark, G. (1997a) Competitive behaviour of research strategies focusing on the selectivity of umbilicate lichens - an experimental approach. lichen bionts. New Phytologist 153: 317–326. Oecologia 111: 523–528. Bowler, P. A. & Rundel, P. W. (1975) Reproductive Hestmark, G. (1997b) Gap-dynamics, recruitment strategies in lichens. Botanical Journal of the Linnean and individual growth in populations of Lasallia Society 70: 325–340. pustulata. Mycological Research 101: 1273–1280. Büdel, B. & Scheidegger, C. (2008) Thallus Hestmark, G. (1997c) Growth from the centre in an morphology and anatomy. In Lichen Biology, 2nd edn umbilicate lichen. Lichenologist 29: 379–383. (T. H. Nash III, ed.): 43–70.Cambridge:Cambridge Hestmark, G. (2000) The ecophysiology of lichen popula- University Press. tion biology. Bibliotheca Lichenologica 75: 397–403. Dal Grande, F., Widmer, I., Wagner, H. H. & Hestmark, G., Schroeter, B. & Kappen, L. (1997) Scheidegger, C. (2012) Vertical and horizontal Intrathalline and size-dependent patterns of activity

in Lasallia pustulata and their possible consequence Hofstetter, V., Gueidan, C. et al. (2014) A multigene for competitive interactions. Functional Ecology 11: phylogenetic synthesis for the class Lecanoromycetes 318–322. (Ascomycota): 1307 fungi representing 1139 Hestmark,G.,Skogesal,O.&Skullerud,Ø.(2004)Growth, infrageneric taxa, 317 genera and 66 families. Molecular reproduction, and population structure in four alpine Phylogenetics and Evolution 79: 132–168. lichens during 240 years of primary colonization. Miller, M. A., Pfeiffer, W. & Schwartz, T. (2010) Creating Canadian Journal of Botany 82: 1356–1362. the CIPRES Science Gateway for inference of large Jones,T.C.,Hogg,I.D.,Wilkins,R.J.&Green,T.G.A. phylogenetic trees. In Proceedings of the Gateway (2013) Photobiont selectivity for lichens and evidence Computing Environments Workshop (GCE), 14 November for a possible glacial refugium in the Ross Region, 2010, New Orleans, Louisiana, pp. 1–8. – Antarctica. Polar Biology 36: 767 774. Muggia, L., Vancurova, L., Skaloud, P., Peksa, O., Kappen, L., Schroeter, B., Hestmark, G. & Winkler, J. B. Wedin, M. & Grube, M. (2013) The symbiotic (1996) Field measurements of photosynthesis of playground of lichen thalli – a highly flexible umbilicarious lichens in winter. Botanica Acta 109: photobiont association in rock-inhabiting lichens. 292–298. FEMS Microbiology Ecology 85: 313–323. Kappen, L., Schroeter, B., Scheidegger, C., Muggia, L., Pérez-Ortega, S., Kopun, T., Zellnig, G. & Sommerkorn, M. & Hestmark, G. (1997) Cold resistance and metabolic activity of lichens below Grube, M. (2014) Photobiont selectivity leads to 0°C. Advances in Space Research 18: 119–128. ecological tolerance and evolutionary divergence in Kroken, S. & Taylor, J. W. (2000) Phylogenetic species, a polymorphic complex of lichenized fungi. Annals of – reproductive mode, and specificity of the green alga Botany 114: 463 475. Trebouxia forming lichens with the fungal genus Nash, T. H. III (2008) Lichen Biology, 2nd edn. Letharia. Bryologist 103: 645–660. Cambridge: Cambridge University Press. Leavitt, S. D., Nelsen, M. P., Lumbsch, H. T., Nelsen, M. P. & Gargas, A. (2008) Dissociation and Johnson, L. A. & St Clair, L. L. (2013) Symbiont horizontal transmission of codispersing lichen flexibility in subalpine rock shield lichen symbionts in the genus Lepraria (Lecanorales: communities in the Southwestern USA. Bryologist Stereocaulaceae). New Phytologist 177: 264–275. 116: 149–161. Nyati, S., Scherrer, S., Werth, S. & Honegger, R. (2014) Leavitt,S.D.,Kraichak,E.,Nelsen,M.P.,Altermann,S., Green-algal photobiont diversity (Trebouxia spp.) in Divakar,P.K.,Alors,D.,Esslinger,T.L.,Crespo,A.& representatives of Teloschistaceae (Lecanoromycetes, Lumbsch, T. (2015) Fungal specificity and selectivity lichen-forming ascomycetes). Lichenologist 46: for algae play a major role in determining lichen 189–212. partnerships across diverse ecogeographic regions in O’Brien, H. (2014) Trebouxia update 24 October 2014. the lichen-forming family Parmeliaceae (Ascomycota). http://www.photobiontdiversity.org/ Molecular Ecology 24: 3779–3797. Otálora, M. A. G., Martínez, I., O’Brien, H., Lindgren, H., Velmaala, S., Högnabba, P., Goward, T., Molina,M.C.,Aragón,G.&Lutzoni,F.(2010) Holien, H. & Myllys, L. (2014) High fungal Multiple origins of high reciprocal symbiotic selectivity for algal symbionts in the genus Bryoria. specificity at an intercontinental spatial scale among – Lichenologist 46: 681 695. gelatinous lichens (Collemataceae, Lecanoromycetes). Lücking,R.,Hodkinson,B.P.,Stamatakis,A.& Molecular Phylogenetics and Evolution 56: 1089–1095. Cartwright,R.A.(2011)PICS-Ord:unlimitedcoding Paulsrud, P., Rikkinen, J. & Lindblad, P. (2000) Spatial of ambiguous regions by pairwise identity and cost patterns of photobiont diversity in some Nostoc- scores ordination. BMC Bioinformatics 12: 10. containing lichens. New Phytologist 146: 291–299. Lutzoni, F., Wagner, F. P., Reeb, V. & Zoller, S. (2000) Pérez-Ortega, S., Ortiz-Alvarez, R., Green, T. G. A. & Integrating ambiguously aligned regions of DNA de los Rios, A. (2012) Lichen myco- and photobiont sequences in phylogenetic analyses without violating diversity and their relationships at the edge of positional homology. Systematic Biology 49: 628–651. life (McMurdo Dry Valleys, Antarctica). FEMS MacArthur, R. & Levins, R. (1967) The limiting similarity, – convergence, and divergence of coexisting species. Microbiology Ecology 82: 429 448. American Naturalist 101: 377–385. Piercey-Normore, M. (2005) The lichen-forming ascomy- Maddison, D. R. & Maddison, W. P. M. (2005) McClade: cete Evernia mesomorpha associates with multiple Analysis of Phylogeny and Character Evolution, 4.08. genotypes of Trebouxia jamesii. New Phytologist 169: Sunderland, Massachusetts: Sinauer Associates. 331–344. Miadlikowska,J.,Kauff,F.,Hofstetter,V.,Fraker,E., Piercey-Normore, M. (2009) Vegetatively reproducing Grube, M., Hafellner, J., Reeb, V., Hodkinson, B. P., fungi in three genera of the Parmeliaceae share Kukwa, M., Lücking, R. et al. (2006) New insights into divergent algal partners. Bryologist 112: 773–785. classification and evolution of the Lecanoromycetes Piercey-Normore, M. & DePriest, P. T. (2001) Algal (Pezizomycotina, Ascomycota) from phylogenetic switching among lichen symbioses. American Journal analyses of three ribosomal RNA- and two of Botany 88: 1490–1498. protein-coding genes. Mycologia 98: 1088–1103. Ramstad, S. & Hestmark, G. (2000) Effective Miadlikowska, J, Kauff, F., Högnabba, F., Oliver, J. C., neighbourhoods for a saxicolous lichen. Mycological Molnár, K., Fraker, E., Gaya, E., Hafellner, J., Research 104: 198–204.

Ramstad, S. & Hestmark, G. (2001) Population structure Stamatakis, A. (2006) RAxML-VI-HPC: maximum and size-dependent reproductive effort in Umbilicaria likelihood-based phylogenetic analyses with spodochroa. Mycologia 93: 453–459. thousands of taxa and mixed models. Bioinformatics Rikkinen, J. (2003) Ecological and evolutionary role of 22: 2688–2690. photobiont-mediated guilds in lichens. Symbiosis 34: Stamatakis, A., Hoover, P. & Rougemont, J. (2008) A 99–110. rapid bootstrap algorithm for the RAxML Web Rikkinen, J., Oksanen, I. & Lohtander, K. (2002) Lichen servers. Systematic Biology 57: 758–771. guilds share related cyanobacterial photobionts. Werth, S. (2012) Fungal-algal interactions in Ramalina Science 297: 357. menziesii and its associated epiphytic lichen community. Rodríguez,F.,Oliver,J.L.,Marin,A.&Medina,J.-R. Lichenologist 44: 543–560. (1990) The general stochastic model of nucleotide Wheeler, D. L., Barrett, T., Benson, D. A., Bryant, S. H., substitution. Journal of Theoretical Biology 142: 458–501. Canese,K.,Chetvernin,V.,Church,D.M., Romeike, J., Fridl, T., Helms, G. & Ott, S. (2002) DiCuccio, M., Edgar, R., Federhen, S. et al. (2007) Genetic diversity of algal and fungal partners in Database resources of the national center for four species of Umbilicaria (lichenized Ascomycetes) biotechnology information. Nucleic Acids Research 35: along a transect of the Antarctic Peninsula. D5–D12. Molecular Biology and Evolution 19: 1209–1217. White, T. J., Bruns, T., Lee, S. & Taylor, J. W. (1990) Sadowska-Des, A., Balint, M., Otte, J. & Schmitt, I. (2013) Amplification and direct sequencing of fungal riboso- Assessing intraspecific diversity in a lichen-forming mal RNA genes for phylogenetics. In PCR Protocols: fungus and its green algal symbiont: evaluation of eight A Guide to Methods and Applications (M.A.Innis,D.H. molecular markers. Fungal Ecology 6: 141–151. Gelfand, J. J. Sninsky & T. J. White, eds): 315–322. Sadowska-Des, A., Dal Grande, F., Lumbsch, T., New York: Academic Press. Beck, A., Otte, J., Hur, J.-S., Kim, J. A. & Yahr, R., Vilgalys, R. & DePriest, P. (2004) Strong Schmitt, I. (2014) Integrating coalescent and fungal specificity and selectivity for algal symbionts phylogenetic approaches to delimit species in the in Florida scrub Cladonia lichens. Molecular Ecology lichen photobiont Trebouxia. Molecular Phylogenetics 13: 3367–3378. and Evolution 76: 202–210. Yahr, R., Vilgalys, R. & DePriest, P. (2006) Geographic Simberloff, D. & Dayan, T (1991) The guild concept variation in algal partners in Cladonia subtenuis and the structure of ecological communities. Annual (Cladoniaceae) highlights the dynamic nature Review of Ecology and Systematics 22: 115–143. of a lichen symbiosis. New Phytologist 171: Sletvold, N. & Hestmark, G. (1999) A comparative test 847–860. of the predictive power of neighbourhood models in Zolan, M. E. & Pukkila, M. J. (1986) Inheritance of natural populations of Lasallia pustulata. Canadian DNA methylation in Coprinus cinereus. Molecular and Journal of Botany 77: 1655–1661. Cellular Biology 6: 195–200.